Hey2 Regulates the Size of the Cardiac Progenitor Pool During Vertebrate Heart Development Natalie Gibb1, Savo Lazic1,2, Xuefei Yuan1,3,2, Ashish R

RESEARCH ARTICLE Hey2 regulates the size of the cardiac progenitor pool during vertebrate heart development Natalie Gibb1, Savo Lazic1,2, Xuefei Yuan1,3,2, Ashish R. Deshwar1,2, Meaghan Leslie1,3,2, Michael D. Wilson3,2 and Ian C. Scott1,2,4,5,*

ABSTRACT and SHF represent truly distinct populations with unique molecular A key event in heart development is the timely addition of cardiac signatures, or whether they exist as one population with a gradient in progenitor cells, defects in which can lead to congenital heart defects. timing for deployment to the heart (Abu-Issa et al., 2004; Moorman However, how the balance and proportion of progenitor proliferation et al., 2007; Ivanovitch et al., 2017). versus addition to the heart is regulated remains poorly understood. As a key driver of cardiac morphogenesis, the balance of Here, we demonstrate that Hey2 functions to regulate the dynamics of proliferation, maintenance and cardiac differentiation events in the cardiac progenitor addition to the zebrafish heart. We found that CPC compartment must be tightly regulated. However, although the previously noted increase in myocardial cell number found in the cardiac cell fate diversification has been elegantly studied via clonal absence of Hey2 function was due to a pronounced expansion in the analysis (Meilhac et al., 2003; Lescroart et al., 2010; Devine et al., size of the cardiac progenitor pool. Expression analysis and lineage 2014), how the magnitude of contribution to the developing heart tracing of hey2-expressing cells showed that hey2 is active in cardiac from the CPC pool is regulated remains poorly understood. This progenitors. Hey2 acted to limit proliferation of cardiac progenitors, process has perhaps been most examined in SHF progenitors, where prior to heart tube formation. Use of a transplantation approach several signaling pathways have been implicated in regulating the demonstrated a likely cell-autonomous (in cardiac progenitors) balance of CPC maintenance/proliferation and differentiation (Prall function for Hey2. Taken together, our data suggest a previously et al., 2007; Ryckebusch et al., 2008; Sirbu et al., 2008; Tirosh- unappreciated role for Hey2 in controlling the proliferative capacity of Finkel et al., 2010; Zhao et al., 2014; Li et al., 2016; Mandal et al., cardiac progenitors, affecting the subsequent contribution of late- 2017). Notable among these are fibroblast growth factor (FGF) and differentiating cardiac progenitors to the developing vertebrate heart. retinoic acid (RA) signaling, the balance of which fine-tunes the specification and differentiation of cardiac progenitors (Ilagan et al., KEY WORDS: Cardiac progenitors, Hey2, Heart development, 2006; Park et al., 2008; Rochais et al., 2009; Sorrell and Waxman, Second heart field, Zebrafish 2011; Witzel et al., 2012). Transcription factors including Islet1 (Isl1), Nkx2.5 and Fosl2 are essential for maintaining the SHF INTRODUCTION progenitor pool (Cai et al., 2003; Prall et al., 2007; de Pater et al., Cardiac development is regulated by the activity of concerted 2009), yet the full make-up of the transcriptional network required signaling, transcriptional and morphogenetic events. Subtle to precisely regulate the behavior of the CPC population perturbations in these processes, either genetic or environmental, remains unclear. can lead to congenital heart defects (CHDs), the most common class Hey2 is a member of the Hairy/Enhancer of split basic helix-loop- of congenital anomalies. It is now evident that the vertebrate heart is helix (bHLH) subfamily, which act as transcriptional repressors built from two populations of cardiac progenitor cells (CPCs), during embryonic development (Davis and Turner, 2001). Zebrafish termed the first heart field (FHF) and second heart field (SHF), hey genes exhibit more restricted expression patterns compared with which contribute to the heart in two successive windows of mammals, with hey2 being the only family member detectably differentiation. Cells of the FHF differentiate in an initial wave expressed in the heart (Winkler et al., 2003). Based on computational of cardiogenesis, resulting in formation of the linear heart tube. approaches, Hey2 has recently been predicted to be a key regulator of Over a well-defined developmental window, multi-potent, late- human cardiac development (Gerrard et al., 2016). Studies in mice differentiating progenitors of the SHF migrate into the poles of the have shown that disruption of hey2 can lead to ventricular heart tube to extensively remodel and add structure to the heart septal defects (VSD), as well as other CHD and cardiomyopathy (Cai et al., 2003; van den Berg et al., 2009; Hutson et al., 2010; (Donovan et al., 2002; Sakata et al., 2002). Mutation in zebrafish Kelly, 2012). It remains under debate, however, whether the FHF hey2 leads to a localized defect of the aorta resembling human aortic coarctation (Weinstein et al., 1995; Zhong et al., 2000), with Hey2 having a key role in specifying arterial versus venous cell fates 1Program in Developmental and Stem Cell Biology, The Hospital for Sick Children, (Zhong et al., 2000, 2001; Hermkens et al., 2015). Of note, Hey2 has Toronto, Ontario M5G 0A4, Canada. 2Department of Molecular Genetics, University of Toronto, Ontario M5S 1A8, Canada. 3Program in Genetics and Genome Biology, been suggested to regulate growth of the heart via restraining The Hospital for Sick Children, Toronto, Ontario M5G 0A4, Canada. 4Ted Rogers cardiomyocyte (CM) proliferation (Jia et al., 2007), as well as Centre for Heart Research, Toronto, Ontario M5G 1M1, Canada. 5Heart and Stroke functioning downstream of Nkx2.5 to prevent ectopic atrial identity Richard Lewar Centres of Excellence in Cardiovascular Research, Toronto, Ontario M5S 3H2, Canada. within ventricular myocardium (Xin et al., 2007; Targoff et al., 2013). More recent work in human pluripotent stem cells has *Author for correspondence ([email protected]) suggested a key function for HEY2 as an effector of NKX2.5 during I.C.S., 0000-0001-6665-1410 cardiomyocyte differentiation (Anderson et al., 2018). Given the evidence linking Hey2 function with CHD in various

Received 8 May 2018; Accepted 13 October 2018 model systems, and the association between CHD and SHF DEVELOPMENT

1 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510 progenitors (Cai et al., 2003; Ward et al., 2005), we hypothesized Expanded cardiomyocyte number at early stages of heart that hey2 may play an earlier than appreciated role in regulating development in hey2 mutants the cardiac progenitor pool. Analysis of a novel null hey2 mutant Having established a hey2 genetic null model, we next evaluated allele revealed increased myocardial cell number as early as the CM number over the course of heart development. As previously linear heart tube stage, with a subsequent more robust and reported (Jia et al., 2007), there was a significant increase in myl7: extended late addition of cardiac progenitors to the heart. hey2 nlsDsRedExpress-positive CM nuclei at 48 hpf in the absence of expression localized to regions overlapping and adjacent to the hey2 when compared with controls (238.7±2.4 in hey2 mutants; 183 nkx2.5-positive cardiac mesoderm, suggestive of a function for ±1.5 in heterozygous controls, mean±s.e.m., Fig. 2A-C). At 26 hpf, Hey2 in cardiac progenitors, prior to cardiac differentiation. hey2 mutants had an irregularly shaped heart that had failed to Through the generation of an inducible lineage-tracing system, we elongate, with an expansion in expression of CM differentiation found that hey2-expressing cells progressively give rise to multiple markers myl7 and tnnt2 at the poles of the heart (Fig. 2D-G, portions of the developing heart. Temporal analysis demonstrated arrowheads), as well as demonstrating an increase in transcript that in the absence of Hey2 function cardiac progenitor cells levels following qPCR (Fig. 2H,I). Given this observation, we used underwent increased proliferation prior to, but not following, antibody staining to count CM number in hey2 mutant Tg(myl7nls: addition to the heart, resulting in an increased cardiac progenitor DsRedExpress) embryos at 24 hpf. Whereas heterozygous hey2+/− pool, with hey2 likely acting in a cell-autonomous manner in this control embryos contained 143.6±5 (mean±s.e.m.) CMs at 24 hpf, context. Taken together, these results suggest that hey2 acts as hey2 mutant embryos contained a significantly greater number both a key brake on the proliferative capacity of early cardiac (182.4±3.9, mean±s.e.m.; Fig. 2J-L). These results highlight that, in progenitors, affecting the extent of cardiomyocyte addition to the absence of hey2, an elevated number of CMs is detectable as the heart. early as 24 hpf, arguing that proliferation of differentiated CMs between 24-48 hpf alone cannot explain the expanded CM RESULTS population present at 48 hpf. Cardiovascular defects in the absence of hey2 function Previous reports have demonstrated the consequences of knocking Myocardial accretion is extended with loss of hey2 down hey2 gene function using either antisense morpholinos (MOs) Previous work has characterized the differentiation and addition of or with existing hey2 mutants: an ENU mutagenesis allele (grlm145, SHF progenitors to the zebrafish heart tube between 24 and 48 hpf (Weinstein et al., 1995; Zhong et al., 2000) and in mosaic TALEN- (de Pater et al., 2009; Hami et al., 2011; Lazic and Scott, 2011). The injected embryos (Hermkens et al., 2015). However, overexpression expanded ectopic expression of myl7 at 24 hpf in hey2 mutants experiments had suggested that the grlm145 allele, which encodes a (Fig. 2E, compare with D) led us to speculate that the SHF Hey2 protein with a 44 amino acid C-terminal extension, retains population may be expanded. We therefore employed transgenic some function (Zhong et al., 2000; Jia et al., 2007). With both this myl7:nlsKikGR embryos to photoconvert CMs at 24 hpf and and recent controversy regarding use of antisense morpholinos to monitor subsequent novel (unconverted at 24 hpf) myocardial assess gene function in zebrafish (Kok et al., 2015) in mind, we addition to the heart (Fig. 3A). Given the difficulty in discerning generated a novel null mutation in hey2 using CRISPR/Cas9- mutants from wild-type embryos at 48 hpf, hey2 morpholino (MO) mediated genome editing. By targeting the gene within exon2, we injection was used for these experiments. Crucially, hey2 morphants generated a mutant with an 8 bp deletion that produces a predicted phenocopied hey2 mutants with respect to multiple parameters premature stop codon at amino acid 53, resulting in deletion of (Fig. S1A-M). We observed a substantial increase in the number of the essential bHLH domain (Fig. 1A). The hey2hsc25 mutant late-differentiating CMs being added to the arterial pole in hey2 phenotype became readily apparent by 72 h post-fertilization morphants (95±7.0) compared with wild-type controls (23.4±1.6), (hpf, Fig. 1B,C), with mutants exhibiting pericardial edemas as shown by green-only cells at the arterial pole of the 48 hpf accompanied by an enlarged atrium and truncated ventricle heart (Fig. 3B-D, brackets; mean±s.e.m.). The normal timing of (Fig. 1D,E). For experiments, hey2 heterozygotes were chosen as termination for myocardial addition has been estimated to be the control group, given their preponderance in the crosses used, and between 36 and 48 hpf (Lazic and Scott, 2011; Jahangiri et al., the observation that no significant differences were observed 2016). Owing to the increase in cell addition observed between between heterozygous and homozygous wild-type embryos. As in 24 and 48 hpf, we wondered whether the window of myocardial grlm145 mutants (Zhong et al., 2001), hey2 mutants demonstrated a accretion was extended temporally in the absence of Hey2. By blockage at the aortic bifurcation, preventing blood flow to the photoconverting embryos at 48 hpf, with subsequent imaging at trunk, evident by the accumulation of gata1+ red blood cells in the 60 hpf, we were further able to more readily evaluate cardiac trunk vasculature (Fig. 1F,G, arrowhead). Hey2 mutant embryos progenitor addition in a mutant background (Fig. 3E). We noted displayed a non-looped heart and a reduction in heart rate SHF-mediated accretion in control embryos occurred at a low level, when compared with controls (Fig. 1H-J; 118.5±0.86 wild-type consistent with previous findings (Fig. 3F,J, 11.9±0.7 cells added, control; 115.0±2.54 hey2 het; 87±3.87 hey2 mutant, mean±s.e.m.). mean±s.e.m.; de Pater et al., 2009; Jahangiri et al., 2016). In Immunofluorescent analysis using the well-characterized contrast, a significant increase in cell addition was evident beyond antibodies MF20 and S46 revealed morphological changes, with 48 hpf in both hey2 morphants (Fig. 3G,J; 11.9±0.79 cells added for apparent denser packing of cardiomyocytes (CMs) in both the atrial controls and 20.3±1.37 for morphants, mean±s.e.m.) and mutants and ventricular chambers at 48 hpf in hey2 mutant embryos (Fig. 3H,I,K; 12.63±0.8 in hey2 heterozygotes versus 29.25±0.9 in (Fig. 1K-L), agreeing with a previously described thickening mutants, mean±s.e.m.). A subpopulation of SHF progenitors gives of the ventricular wall in grlm145 mutants (Jia et al., 2007). This rise to the outflow tract (OFT), a structure containing both phenotype was quantified through quantitative real-time PCR myocardium and smooth muscle at the myocardial-arterial (qRT-PCR) at 48 hpf, revealing a four- and fivefold increase in junction (Waldo et al., 2005; Hami et al., 2011; Zhou et al., 2011; both amhc and vmhc expression in hey2 mutants, when compared to Choi et al., 2013; Zeng and Yelon, 2014). As the OFT appeared heterozygotes (Fig. 1M). lengthened in hey2 morphants and mutants (Fig. 3F-I, brackets), DEVELOPMENT

2 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 1. Cardiovascular defects are observed in the absence of Hey2 function. (A) Schematic representation of the hey2hsc25-null allele generated through CRISPR/Cas9-mediated genome editing. Red lettering shows 8 bp deleted sequence. Protein sequence shows production of premature stop codon at the beginning of exon 2. (B,C) Bright-field images of a sibling control and a hey2hsc25 mutant embryo at 72 hpf. (D,E) Confocal images of Tg(myl7:EGFP) hearts in control (D) and hey2 mutant (E) embryos at 72 hpf. (F,G) Fluorescent images of Tg(gata1:DsRed) showing normal blood flow in controls at 72 hpf (F) and lack of blood flow leading to the accumulation of blood cells in hey2 mutants (G, arrowhead). (H,I) Bright-field images of Tg(myl7:EGFP)inhey2 heterozygous (H) and mutant (I) embryos at 48 hpf. (J) Heart rate analysis represented as beats per minute (bpm) at 48 hpf (N=3, n=4). (K,L) MF20/S46 immunofluorescence imaging at 72 hpf in hey2 heterozygous (K) and mutant (L) embryos. A, atrium; V, ventricle. (M) Quantitative RT-PCR analysis comparing amhc and vmhc gene expression in hey2 heterozygous and mutant embryos at 48 hpf (gene expression normalized to β-actin, fold difference relative to control; N=3, n=3). Data are mean±s.e.m.; **P<0.01; n.s, not significant. Scale bars: 50 µm. we incubated control and hey2 mutant embryos in DAF-2DA, hey2 is expressed in cardiac progenitor cells a compound that specifically labels smooth muscle of the OFT Our temporal analyses of CM number and late myocardial addition (Grimes et al., 2006). We found that loss of hey2 resulted in to the heart strongly suggested that CM proliferation alone is not a significantly longer OFT (Fig. 3L,M,T; 148.42±11.32 versus responsible for the cardiac phenotypes observed following loss of 223.35±4.03 arbitrary units, mean±s.e.m., controls versus mutants, hey2 function. Given previous reports of hey2 expression prior to respectively). This was associated with an increase in OFT cell 24-48 hpf (Winkler et al., 2003), we next carried out a detailed number (Fig. 3N-S,U; 86.83±5.63 versus 150.67±3.57, mean analysis of hey2 expression during key stages of cardiogenesis, ±s.e.m., control versus mutants, respectively), ruling out spanning early cardiac specification to the formation of the linear potential trivial explanations (altered morphology) for the change heart tube. By using double whole-mount RNA in situ hybridization in OFT size. Together, these results demonstrated that in the (WISH), we found hey2 transcripts localized anteromedially to absence of Hey2, there is an extended window of cardiac those of nkx2.5, mef2cb and myl7 in the anterior lateral plate accretion, which ultimately leads to an expansion in SHF-derived mesoderm (ALPM) at 16.5 hpf (Fig. 4A-C). Fluorescent RNA structures. in situ hybridization (FISH) analysis allowed a more detailed DEVELOPMENT

3 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 2. Loss of Hey2 results in heightened cardiomyocyte number. (A,B) Confocal images showing cardiomyocyte nuclei at 48 hpf in hey2 heterozygous (A) and mutant (B) embryos. (C) Counts of cardiomyocyte numbers in the atrium and ventricle of embryos at 48 hpf (N=3, n=6 per condition). (D-G) RNA in situ hybridization analysis for expression of myl7 (D,E) and tnnt2 (F,G) at 26 hpf. Arrowheads indicate ectopic cells outside the cardiac cone in hey2 mutants. (H,I) Quantitative RT-PCR analysis of tnnt2 (H) and myl7 (I) transcript levels at 26 hpf (gene expression normalized to β-actin, fold difference relative to control; N=3, n=3). (J,K) Confocal images of cardiomyocyte nuclei in 24 hpf hey2 heterozygous (J) and hey2 mutant (K) Tg(myl7:nlsDsRedExpress) embryos. (L) Total cardiomyocyte number at 24 hpf in hey2 heterozygous and mutant embryos (N=3, n=5 per condition). Scale bars: 50 µm. Data are mean±s.e.m.; **P<0.01; ***P<0.001. A, atrium; V, ventricle; OFT, outflow tract. account of hey2 transcript localization, and clearly showed a unique we have termed epicon21, situated 24 kb upstream of hey2 that is anterior domain of hey2 expression (red) adjacent to a region of cells conserved from zebrafish to humans, and that overlaps with a co-expressing hey2 and myl7 (yellow cells, white bracket), with recently identified enhancer bound by NKX2.5 in human myl7+/hey2− cardiac mesoderm (green) found more posteriorly pluripotent stem cells (Fig. S2A; Anderson et al., 2018; Yuan (Fig. 4D,D′). At 20 hpf, when the primitive heart is organized into et al., 2018). Following WISH analysis of Tg(epicon21:EGFP) and a cone of differentiating cardiac cells (Yelon et al., 1999), hey2 myl7 expression at 16.5, 20 and 24 hpf, it was evident that the expression was again evident anteromedially to that of myl7 and transgenic closely matched the endogenous hey2 gene expression mef2cb (Fig. 4E-F). We further observed a domain of hey2 pattern (Fig. 4C,G,K). Higher resolution analysis revealed expression lateral to the heart cone, in the region of the Tg(epicon21:EGFP) expression at 20 hpf was restricted to the pharyngeal mesoderm (Fig. 4E,F, white arrowheads). Analysis anteromedial region of the myl7− and Tg(nkx2.5:ZsYellow)+ heart using FISH further revealed the presence of hey2+ cells in the cone (Fig. 4G,M-M″), with Tg(epicon21:EGFP) co-expression anterior half of the nkx2.5+ heart cone (Fig. 4H, red). A 3D with Tg(nkx2.5:ZsYellow) in the pharyngeal mesoderm also evident reconstruction (Fig. 4H′) revealed a sequential pattern of hey2+/ (Fig. 4M″, asterisk; Paffett-Lugassy et al., 2013). A further domain nkx2.5− (red) cells lying anterior to a hey2+/nkx2.5+ population in of Tg(epicon21:EGFP) expression was also observed immediately the anterior heart cone, with the posterior half of the heart cone anterior to the heart cone, with these cells having no detectable occupied by hey2−/nkx2.5+ cells (green). Following formation of Tg(nkx2.5:ZsYellow) expression (Fig. 4M″; arrowhead), matching the linear heart tube at 24 hpf, hey2 transcripts were detectable both the endogenous position of hey2+ progenitors shown by FISH within and extending from the distal portion of the myl7+ ventricle, (Fig. 4M″, compare with H′), as well as the position of recently a region occupied by mef2cb-positive cells of the presumptive described isl2b-positive SHF cells (Witzel et al., 2017). By 24 hpf, SHF (Fig. 4I,J,L,L′; (Lazic and Scott, 2011). Tg(epicon21:EGFP) expression was evident in the myl7− arterial To further dissect the expression of hey2 with respect to CPCs, we pole (Fig. 4N-N″; arrowheads and arrows indicate ventricular and pursued isolation of key hey2 regulatory regions. Epigenetic atrial regions of the heart tube). Analysis of the expression of analysis of early zebrafish cardiogenesis identified an enhancer, Tg(epicon21:EGFP) against that of Tg(myl7:mCherry-RAS) from DEVELOPMENT

4 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 3. Hey2 restricts late myocardial addition to the heart tube. (A) Schematic representation of cardiomyocyte (CM) photoconversion assay between 24 and 48 hpf. (B,C) Confocal imaging at 48 hpf of control (B) and hey2 MO (C) Tg(myl7:nlsKiKGR) embryos showing cell addition as green-only CMs (bracket). (D) Bar graph showing a significant increase in green-only CMs at 48 hpf in control compared with hey2 MO embryos (N=3, n=7). (E) Schematic representation of photoconversion assay between 48 and 60 hpf. (F-I) Confocal imaging of control (F), hey2 MO (G), hey2−/+ (H) and hey2−/− (I) Tg(myl7:nlsKiKGR) embryos, highlighting cell addition between 48 and 60 h at the arterial pole (bracket). (J,K) Bar graphs documenting green-only CMs at 60 hpf in control and hey2 heterozygotes compared with morphant and mutant embryos (N=3, n=7; N=2, n=8, respectively). (L-O) DAF2-DA labeling of the OFT smooth muscle in hey2 heterozygous (L,N) and hey2 mutant (M,O) embryos at 72 and 96 hpf, respectively. Arrowhead denotes an elongated OFT. (P-S) DAPI labeling of DAF2-DA+ cells at 96 hpf in control (P,R) and hey2 mutant (Q,S) embryos. (T,U) Statistical analysis showing mean OFT lengths (T) and OFT cell number (U) in control and hey2 mutant embryos (lengths: N=2, n=11; cell number: N=3, n=4). Data are mean±s.e.m.; ***P<0.001. Scale bars: 50 µm.

48 until 94 hpf demonstrated specificity to the ventricular hey2 locus (Fig. S2H; Burg et al., 2016). Tg(hey2-V5) embryos were myocardium and outflow tract (OFT), with an absence of viable, demonstrating that this allele was functional. Antibody detectable expression in the atrium and atrio-ventricular canal staining versus V5 at 30 hpf showed V5-Hey2 localization to the (Fig. S2B-G). posterior ventricular region of the heart tube (Fig. S2I; arrowhead, To examine Hey2 protein localization, we further used CRISPR/ ventricle; arrow, atrium), with a region of cardiomyocytes (CMs)

Cas9 genome editing to place an internal V5 epitope tag into the expressing both myl7:mCherry-RAS and V5-Hey2 (Fig. S2I; DEVELOPMENT

5 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 4. Expression of hey2 in CPCs during cardiac development. (A-L′) Double RNA in situ hybridization analysis of hey2 (A,B,D-F,H-J,L,L′) and Tg(epicon21:EGFP) expression (C,G,K) as compared with nkx2.5 (A,H,H′), myl7 (C-E,G,I,K-L′) and mef2cb (B,F,J) in wild-type embryos at 16.5 hpf (A-D), 20 hpf (E-H′) and 24 hpf (I-L′). The arrowheads in D’,E-G indicate hey2+ cells outside of the cardiac (myl7+) region. (M-N″) Immunofluorescence showing Tg(epicon21:EGFP) enhancer expression when compared with Tg(nkx2.5:ZsYellow) at 20 hpf (M-M″) and Tg(myl7:mCherry-RAS) at 24 hpf (N-N″). (O) Schematic representation of hey2 and myl7 progenitor localization and movement patterns from 16.5 to 24 hpf. Scale bars: 50 µm. Asterisk labels pharyngeal mesoderm. Arrows indicate the atrium (N-N″) and arrowheads mark the ventricle (I-L′,N-N′).

asterisk). These expression data replicate both endogenous CreERT2 construct under the control of the hey2 enhancer element expression of hey2 (Fig. 4I,L) as well as enhancer expression of (validated above) to allow for temporal control over Cre/Lox- hey2 within the heart tube (Fig. 4K,N″). Taken together, our mediated recombination to lineage trace hey2+ cells and their expression analysis revealed subsets of hey2-positive cells between descendants within CMs over a range of developmental stages 15 and 20 hpf that: (1) only express hey2; (2) co-express both (Fig. 5A). To determine the myocardial fate of hey2+ cells, we used hey2 with nkx2.5 and/or myl7 in the cardiac cone; and (3) co-express the reporter strain myl7:loxp-STOP-loxp-GFP, whereby removal of hey2 and nkx2.5 in presumptive cardiac progenitors within the the stop cassette by Cre switches on GFP expression within myl7+ pharyngeal mesoderm. These results, as summarized in Fig. 4O, cells. To precisely quantify clones of hey2+ cells, we first used a suggested that hey2 is a prospective early marker of a subset of mosaic transgene injection approach. Following injection of hey2 CPCs, perhaps including the late-differentiating progenitor epicon21:CreERT2 plasmid into one-cell stage myl7:loxp-stop- population, as it is expressed, in part, in a manner consistent with loxp-GFP embryos, 4-hydroxy-tamoxifen (4-HT) was administered regions shown to contain SHF progenitors (Hami et al., 2011; during multiple stages of heart development: cardiac specification Guner-Ataman et al., 2013). This suggested that Hey2 may have a (16.5 hpf), early and late cone stage (19 and 22 hpf), and finally previously unappreciated function in early cardiac progenitors. heart tube stage (24 hpf, Fig. 5B). CMs (GFP+) derived from hey2- expressing cells were distributed throughout the heart in varying Temporal lineage tracing suggests that hey2+ progenitors proportions (Fig. 5C-H). Following tamoxifen addition at 16.5 hpf, contribute broadly to multiple phases of heart development hey2+ cells contributed to myocardial cells of the atrium, venous Successive waves of myocardial differentiation during heart pole, inner curvature (IC) and outer curvature (OC) of the heart development have been defined in zebrafish, which give rise to (Fig. 5C). The contribution to atrial and venous pole CMs from the discrete regions of the heart (de Pater et al., 2009; Lazic and Scott, hey2+ population decreased with later addition of tamoxifen at 2011). Given the distinct expression of hey2 in a subset of CPCs 24 hpf, resulting in labeling of myocardium predominantly in the prior to 24 hpf, we next aimed to map the regions of the heart made ventricle proper, OC and OFT (Fig. 5F). A stable Tg(epicon21: + hsc104 from hey2 CPCs. To achieve this, we developed an inducible CreERT2) line was subsequently established to validate DEVELOPMENT

6 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 5. Lineage contribution of hey2+ cells to cardiac development. (A,B) Schematic of the experimental design for lineage tracing of hey2+ cells. (C-F) MF20 and EGFP immunofluorescence staining at 48 hpf showing distribution of Cre-marked cardiomyocytes. Arrowheads indicate labelled cardiomyocytes at the poles of the heart. (G) Bar graph illustrating the contribution of recombined cells to various regions of the heart following 4-HT treatment at 16.5, 19, 22 and 24 hpf (N=3, n=12 at 16.5 hpf; n=6 at 19 hpf; n=16 at 22 hpf; n=14 at 24 hpf). (H) Schematic representation showing the cardiac regions used for recombination analysis. (I-L) Representative images of Tg(epicon21: CreERT2)hsc104×Tg(actb2:RSG) hearts at 72 hpf following 4-HT treatment at 16.5 hpf (I), 19 hpf (J), 22 hpf (K) and 24 hpf (L). Recombined cells are shown in green, with unmarked cells of the heart represented in magenta. A, atrium; V, ventricle; OFT, outflow tract. Scale bars: 50 µm.

mosaic plasmid injection experiments. When crossed to a Tg(actb2: hey2 expression should be affected by modulation of signaling RSG) constitutive Cre reporter line (Kikuchi et al., 2010), mosaic pathways that have been previously implicated in regulating the and inconsistent recombination was evident in the ventricle at late-differentiating population. Of these pathways, FGF signaling 72 hpf following 4-HT administration at 16.5, 19, 22 and 24 hpf has a pivotal role during CM addition to the arterial pole of the (Fig. 5I-L, respectively). In contrast, no atrial CM recombination heart tube as well as specifying the cardiac fields during early was evident in these crosses. As the ventricular population development (Ilagan et al., 2006; Park et al., 2008; Zeng and (groups 3, 4 and 5 in Fig. 5H) represented the large majority of Yelon, 2014). Previous reports also identified hey2 as a target of recombination events across all stages of plasmid-based lineage- FGF signaling (Feng et al., 2010; Sorrell and Waxman, 2011). tracing experiments, this may represent a bias in hey2 expression in Following inhibition of FGF activity between 16.5 hpf and 20 hpf ventricular progenitors at 16.5-24 hpf. Unfortunately, the limited using a well characterized inhibitor, SU5402, we noted the and highly mosaic recombination evident in the stable transgenic expected reduction in ventricular CM differentiation but normal line, which may reflect positional effects of transgene site atrial differentiation, as shown by vmhc and amhc expression, integration, precluded a more meaningful examination. Based on respectively (Fig. S3A,B; Pradhan et al., 2017). Administration of mosaic lineage-tracing results, in conjunction with hey2 expression SU5402 during the same timeframe resulted in reduced cardiac analysis, the shift in contribution of hey2+ cells to CMs of the atrium hey2 expression within the heart cone (Fig. S3E,F), with a early, and OC/OFT later, suggested that hey2 expression may coincident loss of detectable expression of the SHF progenitor dynamically mark subsets of cardiac progenitors over the course of marker mef2cb (Fig. S3C,D). Later addition of SU5402, between early heart development. 19 and 24 hpf, resulted in a loss of cardiac hey2 expression, yet no overt change to cardiac myl7 or neural hey2 expression (Fig. S3G-H; FGF signaling acts upstream of hey2 expression in arrowhead, cardiac; asterisk, neural). Moreover, in contrast to FGF cardiac progenitors signaling, inhibition of BMP and Notch signaling pathways had no Basedontheexpressionpatternsofhey2 and the lineage discernable effect on hey2 expression (Fig. S3I-J), indicating that contributions of hey2+ progenitors (Figs 4 and 5), we wanted to between 16.5 and 24 hpf the expression of hey2 is dependent on the further explore a potential link between Hey2 and the late- activity of FGF signaling, consistent with (at least in part) a SHF differentiating SHF progenitor population. We reasoned that progenitor localization. DEVELOPMENT

7 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Increased cardiac progenitors in the absence of increased expression of nkx2.5, hey2 and mef2cb in both hey2 hey2 function mutant (Fig. 6N-V) and morphant (Fig. S4K-Q) embryos. This Given the increased CM number observed in hey2-deficient expansion in gene expression within the early cardiac mesoderm embryos from as early as 24 hpf, and the expression of hey2 in was evident from as early as 12 hpf, as shown by nkx2.5 expression CPCs, we explored the hypothesis that this may be due to an in hey2 MO injected embryos (Fig. S4R,S). To examine the earliest increase in the cardiac progenitor pool. Using WISH and qRT-PCR, events of cardiac specification, nkx2.5 expression was assayed we observed a significant increase in the expression of the FHF and at 11 hpf. To our surprise, although nkx2.5 expression was SHF markers nkx2.5, mef2cb and ltbp3 in hey2 mutants when undetectable by WISH in control (hey2 heterozygous) embryos, compared with heterozygous controls at 24 hpf (Fig. 6A-I), an faint nkx2.5 expression was observed in the ALPM of hey2 mutant observation that was repeated in hey2 morphants (Fig. S4A-J). At embryos (Fig. S4T,U, arrowheads). Overall, these results suggest 48 hpf, we noted a higher number of Mef2+ cells at the arterial pole that hey2 plays an early, previously unappreciated role in restricting and in both chambers of hey2 mutant hearts following double the size of the early cardiac progenitor population. staining of myl7:GFP embryos with Mef2 and GFP antibodies (Fig. 6J-M; arterial pole: 18.3±1.25 versus 70±1.08 (control versus Increased proliferation of cardiac progenitors in hey2 hey2 mutants in L); atrium: 40±4.36 versus 63±1.15 (control versus mutants prior to the linear heart tube stage hey2 mutants in M); ventricle: 90.67±2.03 versus 146.67±8.65 The expansion of CM number in hey2 mutants, coupled with the (control versus hey2 mutants in M), mean±s.e.m.), suggesting an increased expression of CPC-associated genes, led us to examine expansion of Mef2cb+ SHF cells (Lazic and Scott, 2011) in the whether there was increased proliferation of cardiac progenitors distal region of the ventricle; however, the antibody used is not prior to heart formation. We therefore first assessed proliferation via specific to Mef2cb. As the effect of loss of hey2 on CM number was use of a 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay evident by 24 hpf, we next analyzed embryos at 16.5 hpf for gene (Fig. 7A). Using Tg(nkx2.5:ZsYellow) embryos to label CMs of expression changes within the ALPM. Interestingly, we observed both early and late progenitor populations (Guner-Ataman et al.,

Fig. 6. Hey2 negatively regulates the expression of CPC-associated genes. (A-F) WISH staining for SHF markers nkx2.5, mef2cb and ltbp3 at 24 hpf in hey2 heterozygous (A-C) and hey2 mutant (D-F) embryos. (G-I) Quantitative RT-PCR at 24 hpf of mef2cb, ltbp3 and nkx2.5 gene expression. (J,K) Confocal image of Mef2 immunostaining in Tg(myl7:EGFP) hey2 heterozygous (J) and mutant (K) embryos. Arrowheads indicate Mef2+ cells in the arterial pole of the heart. (L,M) Total number of Mef2+ cells in the arterial pole of the heart (L) and in the heart proper (M, with chambers counted separately) in control and hey2 mutant embryos at 48 hpf (N=3, n=4). (N-S) RNA in situ hybridization analysis of expression of nkx2.5, mef2cb and hey2 at 16.5 hpf in hey2 heterozygous (N-P) and mutant (Q-S) embryos. (T-V) Quantitative RT-PCR analysis showing relative expression levels of mef2cb, nkx2.5 and hey2 at 16.5 hpf in hey2 heterozygous and mutant embryos (gene expression normalized to β-actin, fold difference relative to control; N=3, n=3). DEVELOPMENT

8 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 7. Hey2 inhibits cardiac progenitor cell proliferation during early cardiac development. (A) Schematic of experimental approach for EdU analysis. (B-E) Confocal images of EdU incorporation (red) at 16.5 hpf (B-C) and 24 hpf (D-E) in control (B,D) and hey2 MO (C,E) embryos expressing Tg(nkx2.5:ZsYellow) (green). EdU-positive cardiomyocytes are shown as yellow cells following staining at 35 hpf. (F) Proliferation index at 35 hpf in control and Hey2 morphant embryos following EdU pulse at 16.5 hpf (N=2, n=7) and 24 hpf (N=2, n=4). (G,H) EdU incorporation at 48 hpf in control (G) and hey2 MO (H) embryos following EdU pulse at 16.5 hpf. (I) Proliferation index comparing the number of EdU+ CMs in the atrium, ventricle and OFT between control and hey2 MO embryos at 48 hpf (N=3, n=5). (J,K) EdU incorporation at 48 hpf in hey2 heterozygous (J) and mutant (K) embryos following EdU pulse at 16.5 hpf. (L) Proliferation index comparing the number of EdU+ CMs in the atrium, ventricle and OFT at 48 hpf (N=3, n=14). (M-O) Expression of tbx1 in wild-type (M) and hey2 morphant (N) embryos. Quantitative RT-PCR analysis at 16.5 hpf comparing relative tbx1 expression in control embryos with hey2 morphants and hey2 mutants is shown (O). (P-R) Co-expression of hey2 (blue) and tbx1 (orange) at 20 hpf in control (P) and hey2 morphant (Q, boxed area magnified in R) embryos. Arrowheads highlight EdU+/Nkx2.5+ CMs; arrows indicate hey2+/tbx1+ pharyngeal mesoderm. Scale bars: 20 µm. Data are mean±s.e.m.; *P<0.05; **P>0.01; ***P<0.001. WT, wild type.

2013), we found a significant increase in the proportion of labeled 28.44±2.22% EdU+ versus 69.05±1.09% EdU+ (ventricular); CMs in hey2 morphant hearts at 35 hpf following an EdU pulse 24.85±3.35% EdU+ versus 67.81±2.71% EdU+ (OFT); at 16.5 hpf (arrowheads, Fig. 7B-F; 9.83±1.92 controls versus mean±s.e.m., hey2 heterozygotes versus mutants, respectively). 27.65±3.04 hey2 MO; mean±s.e.m.). In contrast, pulsing with These results suggest an early role for Hey2 in establishing the EdU at 24 hpf did not result in a significant difference in CM appropriate number of both FHF and SHF cardiac progenitors that labeling between hey2 morphants and wild-type embryos at 35 hpf will be added to the heart prior to heart tube formation, at least in (Fig. 7D-F; 4.7±2.47% EdU+ controls versus 10.6±2.12 hey2 MO; part by limiting the extent of their proliferation. mean±s.e.m.). In order to specifically analyze possible functions for Tbx1 has been shown to regulate the proliferation of late- hey2 in FHF versus SHF progenitor populations, we repeated our differentiating cardiac progenitors, which reside within pharyngeal EdU experiments, but measured the proliferation index at 48 hpf in mesoderm, an area demarcated by tbx1 expression (Chapman et al., order to allow a delineation of the localization of CMs in the heart 1996; Buckingham et al., 2005; Hami et al., 2011; Nevis et al., and infer their FHF/SHF origin. In both hey2 morphants (Fig. 7G-I) 2013). As our initial analysis suggested that hey2(epicon21: and mutants (Fig. 7J-L), increased labeling of CMs was evident in EGFPhsc28) is co-expressed with Tg(nkx2.5:ZsYellow) within the both atrial and ventricular chambers, as well as in (SHF-derived) pharyngeal mesoderm (Fig. 4M″, asterisk), we examined tbx1 OFT myocardium (Fig. 7I, 21.51±12.55% EdU+ versus 59.81± expression in hey2 morphant embryos through WISH and found an 2.67% EdU+ (atrial); 27.12±10.11% EdU+ versus 63.22±3.23% increase in tbx1 transcript levels at 16.5 hpf (Fig. 7M,N). This EdU+ (ventricular); 7.84±5.84% EdU+ versus 46.33±5.36 % EdU+ increase in tbx1 expression was further evident following qRT-PCR (OFT); mean±s.e.m., controls versus hey2 MO, respectively; and in both hey2 morphant and mutant embryos (Fig. 7O). Analysis at + + Fig. 7L, 20.6±5.49% EdU versus 55.82±5.51% EdU (atrial); 20 hpf revealed a partial overlap of hey2 and tbx1 expression DEVELOPMENT

9 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510 domains within the pharyngeal mesoderm, with no tbx1 expression MO cells compared with 27.12±5.35 wild type total cells, mean± detectable within the cardiac cone, consistent with a previous report s.e.m.), further supporting a role for hey2 in regulating (Fig. 7P, arrow) (Nevis et al., 2013). Strikingly, in the absence of cardiomyocyte number. These results suggest, at least in part, a hey2 function, both hey2 and tbx1 transcripts were significantly cell-autonomous function for Hey2, in presumptive cardiac upregulated within the pharyngeal mesoderm, along with the progenitors, that affects the size of the cardiac progenitor pool and expected increase of hey2 within the heart cone itself (Fig. 7Q,R, subsequent addition of CMs to the heart. compare with P). These results suggested a role for Hey2 in restraining CPC proliferation and the size of the progenitor pool DISCUSSION adjacent to the heart prior to 24 hpf. This work has uncovered an unappreciated role for the bHLH factor Hey2 in regulating the size of the cardiac progenitor pool, ultimately hey2 acts cell autonomously to regulate cardiac affecting the extent of the contribution of late-differentiating cardiac progenitor addition to the heart progenitors to the zebrafish heart. As shown by fate-mapping Having established a role for Hey2 in the CPC pool, we finally (Mjaatvedt et al., 2001; Camp et al., 2012) and lineage-tracing (Cai aimed to determine whether Hey2 acts in CPCs proper, or in the et al., 2003; Meilhac et al., 2003) approaches, the vertebrate heart is surrounding environment, to affect early stages of cardiac made via subsequent addition of at least two populations of cardiac development. Given the technical difficulty of measuring progenitors. Whether the cardiac progenitor pools that are added early proliferation of transplanted cells, we used SHF contribution to and late to the heart represent molecularly distinct populations the developing heart as a proxy for CPC behavior. To accomplish remains an unresolved issue. While FHF- and SHF-restricted cells this, Tg(myl7:nlsKikGR) donor embryos, either wild type or can be identified at early gastrulation stages in mouse by clonal injected with hey2 MO, were used. Donor cells at 4 hpf (50% analysis (Lescroart et al., 2010; Devine et al., 2014), this may reflect epiboly) were transplanted to the margin of wild-type host embryos the result of distinct migratory paths and signaling milieus (Fig. 8A), an approach that has been shown to result in myocardial experienced by cells during gastrulation. A recent study using live contribution of donor cells (Stainier et al., 1993; Scott et al., 2007). imaging of cell-lineage tracing and differentiation status suggests that, Transplant embryos were photoconverted at either 24 or 48 hpf and in mouse, a discrete temporal lag can be observed between the first imaged at either 48 or 60 hpf (Fig. 8B,F, respectively). We observed and second waves of differentiation that form the heart (Ivanovitch that hey2 morphant donor Tg(myl7:nlsKikGR) cells displayed a et al., 2017). It is therefore crucial that we gain a greater understanding significant increase in SHF late contribution (green-only CMs) of how the relative size of cardiac progenitor pool(s), the timing of when compared with early myocardial addition (green+red, or their differentiation and the extent to which they are added to various yellow CMs), between 24 and 48 hpf (Fig. 8C-E; percentage of components of the heart all affect cardiac development. donor CMs that are green only: 22.4±3.99 versus 67.1±6.66, control It is important to note that the function of hey2 in zebrafish versus hey2 MO, respectively, mean±s.e.m.). The same result was cardiogenesis has been previously addressed in an elegant study observed between 48 and 60 hpf, with hey2-deficient myl7: (Jia et al., 2007). However, although the overall ‘large heart’ nlsKikGR donors contributing significantly more green-only CMs phenotype observed is shared between our hey2hsc25 and the grlm145 than controls (Fig. 8F-I; percentage green-only: 15.70±2.33 versus mutants, our data suggest a role for hey2 prior to 24 hpf, in cardiac 37.4±2.53, control versus hey2 MO, respectively, mean±s.e.m.). progenitors that subsequently impacts cardiac development. In Although the ratio of late versus early differentiated CMs per heart contrast, Jia and colleagues have reported that grl has minimal effect from hey2 donor cells was consistently increased at both 24-48 and during this time, with grlm145 mutants having comparable 48-60 hpf, an analysis of cell numbers for each category revealed a cardiomyocyte number to controls at 24 hpf. This discrepancy bias in progenitor populations. From 24-48 hpf, the increased late may reflect the nature of the hey2 alleles used, with the hey2hsc25 versus early CM addition ratio observed in hey2 morphants was allele being, we believe, a true null. As the SHF and late myocardial due to a decreased propensity for donor cells to contribute early to addition in zebrafish had not been described at the time of the the heart, as evident by a significant decrease in total number of previous study, this would also have affected the interpretation of yellow CMs in morphants compared with wild-type embryos the results. This highlights the fact that Hey2 likely acts at multiple (Fig. 8J; 17.07±3.02 versus 3.86±1.26, control versus hey2 MO, steps of heart development. However, as the morpholino phenotype respectively, mean±s.e.m.). This was accompanied by an apparent, recapitulates multiple aspects of the CPC phenotype seen in hey2 albeit non-significant, decrease in total CM cell number from hey2 mutants, we do not believe that the differences in our observations morphant donor embryos when compared with controls during the reflect genetic background effects. 24-48 hpf differentiation window (Fig. 8J; 12.42±3.46 total MO Our work has clearly demonstrated a role for Hey2 in restraining cells, 21.85±3.61 total WT cells, mean±s.e.m.). However, when proliferation of cardiac progenitors prior to their addition to the comparing total number of late-differentiating (green-only) heart. Both our mosaic lineage-tracing results (Fig. 5), as well as our CMs contributed, no statistical significance was observed (Fig. 8J; analysis of CM number and proliferation (Figs 2 and 7, respectively) 4.93±0.94 versus 8.57±2.4, control versus hey2 MO, respectively, support an early role for hey2 in preventing both ventricular and mean±s.e.m.). In contrast, the higher late- versus early-addition atrial progenitor populations from expanding. Subsequent to this, ratio observed between 48-60 hpf was due to a significantly higher we observed both increased and extended addition of new CMs to amount of late (post-48 hpf) CM addition, with a relatively the developing heart tube. The earliest currently available marker of equivalent amount of early (pre 48-hpf) CM addition, as noted CPCs, nkx2.5, was expanded in its expression in hey2 mutants, and by no significant change in early CM number between control and indeed appeared to be induced earlier than in wild-type embryos hey2 morphant embryos (Fig. 8K; 3.75±0.62 versus 11±1.05 green; (Fig. S4T,U). Therefore, the most straightforward explanation for 23.38±4.98 versus 19.86±3.52 yellow; control versus hey2 MO, the phenotypes observed in hey2 mutants is that an early increase in respectively, mean±s.e.m.). However, hey2 morphants produced a CPC specification and proliferation results in a later increase in CM modestly (significant) larger number of overall CMs between 48 addition to the heart. This is consistent with the early expression of and 60 hpf when compared with controls (Fig. 8K; 31.87±3.49 total hey2 in the ALPM as early as 10.5 hpf (Winkler et al., 2003). In this DEVELOPMENT

10 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Fig. 8. Hey2 functions cell-autonomously to inhibit myocardial contribution to the heart. (A,B,F) Schematic representations of transplantation strategy. (B-D) Following transplantation of Tg(myl7:nlsKiKGR) wild-type (C) and hey2 morphant (D) donors to wild-type hosts, embryos were photoconverted at 24 hpf and imaged at 48 hpf. (E) Boxplot analysis demarking the percentage of donor transplanted CMs that are green-only in control and hey2 MO embryos (n=13, control and n=7, hey2 MO). (F-H) Transplants in which photoconversion was carried out at 48 hpf, followed by imaging at 60 hpf, using wild-type (G) and hey2 MO (H) donors. (I) Boxplot analysis demarking the percentage of green-only transplanted CMs in control and hey2 MO embryos (n=8, control and n=9, hey2 MO). (J,K) Boxplot analysis displaying total numbers of transplant-derived Tg(myl7:nlsKikGR) control and hey2 MO CMs at 24-48 hpf (J; n=12 wild-type green, n=15 wild-type yellow; n=7 hey2 MO green, n=7 hey2 MO yellow) and 48-60 hpf (K; n=8 wild-type green, n=8 wild-type yellow; n=7 hey2 MO green, n=7 hey2 MO yellow). Green cells indicate later (post-photoconversion) contribution, whereas yellow cells indicate pre-photoconversion contribution. Arrowheads indicate green-only (late addition) cardiomyocytes. Data are mean±s.e.m.; *P<0.05, **P<0.01, ***P<0.001; n.s, no significant difference. For box plots, boxes indicate the 25th to 75th percentiles of values, with each data point shown as a dot. Median is shown as a dark line inside the box, while whiskers extend 1.5 times the ineterquartile range from the 25th to 75th percentiles. Scale bars: 50 µm. model, the expanded CM numbers seen at 24 and 48-72 hpf would of SHF progenitors being available. Subsequent to this, as hey2 be due to an initially greater number of both FHF and SHF expression becomes restricted to the ventricular chamber, its progenitors. The extended window of myocardial addition seen in described role in ventricular CM development would be hey2 mutant hearts post-48 hpf would therefore reflect a larger pool established. Our expression analyses show that at 16.5-20 hpf, DEVELOPMENT

11 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510 hey2 colocalizes with previously identified FHF- and SHF- deployment and subsequent contribution to the development of the associated genes, and is in agreement with fate-mapping work vertebrate heart, which will require a conditional mutagenesis that has shown SHF progenitors to reside in an anteromedial approach. Given the apparent cell-autonomous function of Hey2 in position within the ALPM (Hami et al., 2011). Importantly, we and CPCs, identifying its transcriptional targets will also be of great others have shown that hey2 expression within the myocardium is interest. Previous studies have reported the downregulation of hey2 regulated not by a canonical Notch signaling pathway, but through expression by RA (Feng et al., 2010), which we have also observed FGF signaling (Targoff et al., 2013; Miao et al., 2018), which is a (N.G. and I.C.S., unpublished). Given our findings showing a role key regulator of SHF development. This is consistent with the for Hey2 in restricting cardiac progenitor proliferation, alongside Notch-independent, FGF-mediated expression of Hey2 in other the known role of epicardial RA signaling in zebrafish heart developmental contexts (Doetzlhofer et al., 2009). However, regeneration (Kikuchi et al., 2011), it will be of great interest to although this result showed coincident loss of SHF-associated determine whether Hey2 regulates the process of adult cardiac progenitors and hey2 expression, we could not preclude that regeneration. Dissecting how Hey2 regulates cardiac development the absence of hey2 simply reflected its association with an will help address key unanswered questions with respect to the FGF-dependent ventricular fate (Targoff et al., 2013). regulatory mechanisms that coordinate the size and differentiation In disagreement with a model where Hey2 acts primarily in early timing of cardiac progenitors to allow for proper heart development CPCs, our transplantation data appears to suggest that loss of hey2 to proceed. does not simply result in a higher likelihood for mutant cells to form CMs at 24 hpf, as overall CM output per transplant was not MATERIALS AND METHODS significantly higher than wild type, and indeed it may have been Zebrafish husbandry and transgenic lines lower (Fig. 8). In contrast, CM addition post-48 hpf was clearly Adult AB/TL mixed strain zebrafish (Danio rerio) were maintained as per increased in hey2 morphant transplants. This may suggest roles for Canadian Council on Animal Care (CCAC) and The Hospital for Sick hey2 as a cardiomyocyte-limiting factor for both FHF and SHF Children Animal Services (LAS) guidelines. Zebrafish embryos were grown populations, consistent with functions described for Isl1 in a human at 28.5°C in embryo medium as previously described (Westerfield, 1993). The following transgenic lines were used: Tg(myl7:EGFP)twu34 (Huang iPSC cardiac model (Quaranta et al., 2018). These transplant assays et al., 2003), Tg(nkx2.5:ZsYellow)fb7 (Zhou et al., 2011), Tg(myl7: suggest that cardiac contribution is at the very least delayed with the nlsKikGR)hsc6 (Lazic and Scott, 2011), Tg(myl7:nlsDsRedExpress)hsc4 loss of hey2. The observed phenotypes may reflect: (1) a shift in the (Lou et al., 2011), Tg(gata1:DsRed)sd2 (Traver et al., 2003) ,Tg(myl7: balance between FHF and SHF progenitor proliferation, favoring mCherry-RAS)sd21 (Yoruk et al., 2012) and Tg(-9.8bactin2:loxP-DsRed- the SHF pool; (2) alteration in the timing of cardiac progenitor loxP-EGFP)s928 (bact2:RSG, (Kikuchi et al., 2010). A myl7:lox-stop-lox- differentiation; (3) changes in the number of progenitors allocated to GFPhsc102 transgenic line was made using standard approaches for this the FHF and SHF pools; or (4) a FHF/SHF-agnostic role for Hey2 in study. The hey2hsc25 mutant line was generated using CRISPR/Cas9 genome cardiac progenitor proliferation and differentiation. It is difficult to editing technology, as previously described (Jao et al., 2013). Primers reconcile a cell-autonomous function for Hey2 in CPCs with the TAGGCCAGAAAGAAGCGGAGAG and AAACCTCTCCGCTTCTTTC increased CM number seen at 24 hpf and the stable hey2 enhancer TGG were annealed together and ligated into the pT7-gRNA vector digested with BsmBI to create sgRNA for hey2. An 8 bp deletion allele (starting at Cre recombination results. In contrast to mosaic lineage tracing nucleotide 151 within exon2) resulting in a premature stop codon at amino based on plasmid injection, the stable transgenic results suggest that acid 53 was isolated (Fig. 1A). An additional allele harboring a 5 bp deletion hey2 is primarily active in ventricular progenitors. One possibility is (starting at nucleotide 152 with a premature stop codon at amino acid 55) that hey2 may have additional, non-autonomous functions, perhaps was isolated showing an equivalent phenotype (data not shown). For − in the tbx1+/nkx2.5 pharyngeal mesoderm, to influence cardiac experiments, hey2 heterozygotes were chosen as the control group, given progenitors. These functions would not have been evident in our their preponderance in the crosses used, and the observation that no current transplant experiments. More elegant single cell transplant significant differences were observed between heterozygous and or tissue-specific loss-of-function experiments will be required to homozygous wild-type embryos. hsc28 address this point directly. The hey2 enhancer transgenic epicon21:EGFP , which contains an Previous reports have highlighted that the cardiac malformations epigenetically conserved open chromatin region (epiCon21, also referred to as aCNE21), was identified from comparative epigenetic analysis of open found in animals lacking Hey2 function resemble common human chromatin enriched in zebrafish mesoderm (Yuan et al., 2018). To generate congenital heart defects, including ventricular septal defects, Tg(epicon21:EGFP)hsc28 animals (see ‘Plasmid constructs’ section for tetralogy of fallot and tricuspid atresia (Donovan et al., 2002). construct generation), 25 ng of E1b-Tol2-GFP-gateway plasmid carrying Our data suggest multiple roles for Hey2 in cardiogenesis, first the epiCon21 enhancer was injected into wild-type embryos at the one-cell acting to restrain cardiac progenitor proliferation (and potentially stage with 150 ng Tol2 mRNA. Germline carriers were identified and those affecting diversification of FHF and SHF progenitors) and later siblings showing GFP expression within the ventricles were raised and used affecting the timing of SHF progenitor addition to the developing for hey2 expression analysis. The Tg(epicon21:CreERT2)hsc104 transgenic heart. Hey2 may therefore be an intrinsic regulator of the extent and was similarly generated via Tol2-mediated transgenesis. Stable founders differentiation of the cardiac progenitor pool, possibly acting as a were identified via crosses with the bact2:RSG Cre reporter fish. Generation of Tg(hey2V5)hsc27 was performed as previously described (Burg et al., readout of extrinsic (RA and FGF) niche signals. In this context, it is 2016). nCas9n mRNA was injected at a concentration of 150 pg together interesting to note that Hey2 has recently been shown to be a key with 30 pg of hey2gRNA into the yolks of one-cell embryos. V5 tagging NKX2.5 target required for CM differentiation of human oligo (5′-AGTCATGGCCAGAAAGAAGCGGCAAGCCTATCCCAAA- pluripotent stem cells (Anderson et al., 2018), consistent with the CCCTCTGCTGGGCCTGGACTCCACAGGAGAGGGGTAATTCATAT- loss of hey2 expression observed in nkx2.5/2.7 mutant zebrafish T-3′) was diluted to 25 μg/μl and 1 nl was injected into the yolks (Targoff et al., 2013). immediately after the RNA injections. In conclusion, hey2 has previously unappreciated roles within cardiogenesis by regulating cardiac progenitor numbers of Plasmid constructs potentially both heart fields. It remains to be determined whether An Epicon21:EGFP construct was generated by amplifying a 626 bp

Hey2 plays a separate role in orchestrating the timing of SHF enhancer sequence, located 24 kb upstream of the hey2 locus (Fig. S2A) DEVELOPMENT

12 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510 from zebrafish genomic DNA using forward primer 5′-CAAATCCCCTG- CACTACCAGCAGAACACCCC 3′; reverse, 5’ ATGTGATCGCGCTTC- ACCTCTGCTTTGAG-3′ and reverse primer 5′-GACACACAGTGAC TCGTT 3′; vmhc forward, 5′ ACATAGCCCGTCTTCAGGATTTGG 3′; ATGTCCTATTGCG-3′. The resulting PCR product was subcloned into reverse, 5′ GAGAGAAAGGCAAGCAAGTACTGG 3′. Previously the enhancer detection vector E1b-Tol2-GFP-gateway (Addgene 37846; described primers were used for quantification of β-actin (Tang et al., Li et al., 2010). For generation of Epicon21:CreERT2, the GFP sequence in 2007), ltbp3 (Zhou et al., 2011), tbx1 (Zhang et al., 2006) and amhc (Jia the E1b-Tol2-GFP-gateway vector was replaced with CreERT2. et al., 2007) transcript levels. For early stages of development, where morphological features could not be used to distinguish hey2 mutants, Genotyping embryos were individually prepped for both genomic DNA and mRNA, Mutant genotypes were identified by isolating a 300 bp sequence amplified genotyped, and then pooled as appropriate for cDNA synthesis. from genomic DNA of either embryos or adult fin-clips using forward primer 5′-GGGCACCCCTGATCTAAAGT-3′ and reverse primer 5′-AA- Small-molecule treatments AAAAGAAGAAGGGACCGGA-3′. PCR products were subsequently The FGF receptor inhibitor SU5402 (Tocris 3300) was used at a digested using restriction enzyme AciI. The subsequent digested DNA concentration of 10 μM from 16.5 to 20 h post-fertilization (hpf) or from products would contain two fragments of 200 bp and 100 bp in wild-type 19 to 24 hpf. BMP and Notch signaling inhibitors dorsomorphin (Tocris DNA. Heterozygous DNA would contain three fragments consisting of a 3093) and DAPT (Tocris 2634/10), respectively, were used at a 300 bp product from the uncut allele as well as a 200 bp and 100 bp product concentration of 10 μM and 50 μM between 16.5 and 20 hpf. All from the wild-type allele, while mutant DNA would contain a single 300 bp compounds were diluted into 1% DMSO in embryo medium. Vehicle uncut fragment. controls were treated with 1% DMSO. Incubations were performed at 28°C. CreERT2-mediated recombination was performed using the active Morpholinos metabolite of tamoxifen, 4-hydroxy-tamoxifen (4-HT), diluted to 10 μM Morpholino oligos were purchased from Genetools. A morpholino targeting working concentration in embryo medium. At 16.5, 19, 22 and 24 hpf, the translation start site (underlined) of hey2 (ATG hey2:5′-TGCTGTCC- embryos were dechorionated and transferred to petri dishes containing 4-HT TCACAGGGCCGCTTCAT-3′) was used throughout this study. The hey2 medium or DMSO for controls and kept in the dark at 28°C for 4 h. morpholino (5′-CGCGCAGGTACAGACACCAAAAACT-3′) previously Following treatment, 4-HT was removed by extensive washes with fresh described (Jia et al., 2007) was used to test specificity, as both morpholinos embryo medium and development proceeded at 28°C until desired stage was share no sequence overlap. Injection of 1 ng of ATG hey2 morpholino at the reached. one-cell stage yielded a consistent heart phenotype, which phenocopied hey2 mutants in all assays. Imaging Bright-field images were taken using a Zeiss AXIO Zoom V16. RNA in situ Chromogenic RNA in situ hybridization hybridization images were captured using a Leica M205FA microscope with Standard RNA whole-mount in situ hybridization (WISH) was performed as the LAS V6 software package. Confocal microscopy was performed using a previously described (Thisse and Thisse, 2008). The complete coding Nikon A1R laser-scanning confocal microscope and a 40× water immersion sequence of hey2 (ZDB-GENE-000526-1) was PCR amplified (sense, objective. Double-fluorescent RNA in situ hybridization (Fig. 4D,H,L) and 5′-ATGAAGCGGCCCTGTGAGGACAGC; antisense, 5′-TTAAAACGC- DAF-2DA cell labeling (Fig. 3L-S) were captured using a Leica TSC SP8 TCCCACTTCAGTTCC) and used as a riboprobe template. GFP riboprobe STED confocal at 100× magnification. sequence was cloned into pGEM-Teasy and transcribed according to standard techniques. Previously described riboprobes were additionally Immunofluorescence, DAF-2DA staining and cell counting used: myl7 (ZDB-GENE-991019-3), nkx2.5 (ZDB-GENE-980526-321), Whole-mount immunofluorescent staining was carried out as previously mef2cb (ZDB-GENE-040901-7), amhc (ZDB-GENE-031112-1), vmhc described (Alexander et al., 1998). Primary antibodies used were: α-MYH6 (ZDB-GENE-991123-5), tbx1 (ZDB-GENE-030805-5) and ltbp3 supernatant at 1:10 (DSHB, S46); α-MHC supernatant at 1:10 (DSHB, (ZDBGENE-060526-130) (Chen and Fishman, 1996; Yelon et al., 1999; MF20); α-MEF-2 (C21) at 1:250 (Santa Cruz, sc-313); α-RCFP at 1:400 Hami et al., 2011; Lazic and Scott, 2011). DIG and fluorescein-labeled (Clontech, 632475); α-DsRed at 1:200 (Clontech, 632496); α-V5 at 1:500 probes were made using a RNA Labeling Kit (Roche). hey2 mutants were (ThermoFisher Scientific, R960-25) and α-GFP at 1:1000 (Torrey Pines identified either phenotypically (for stages after 48 hpf) or via genotyping Biolabs). Smooth muscle of the bulbus arteriosus was visualized using the following WISH. NO indicator DAF- 2DA (Sigma, D2813), as previously described (Grimes et al., 2006). CM nuclei of myl7:nlsDsRedExpress transgenic embryos were Fluorescent RNA in situ hybridization counted following immunostaining. Embryonic hearts were dissected and Fluorescent RNA in situ hybridization (FISH) was performed as previously flat-mounted prior to confocal imaging. described (Targoff et al., 2013), with minor modifications. Embryo permeabilization using proteinase K was omitted from the protocol. Photoconversion and cell addition analysis Prehybridization, hybridization and SSC washes were performed at 65°C. Photoconversion on myl7:nlsKikGR embryos was carried out as previously Hybridization solution included 10% dextran sulphate, as well as 10 mg described (Lazic and Scott, 2011) using the UV channel on a Zeiss Axio heparin and 100 mg tRNA. Detection of digoxygenin-labeled probes were Zoom V16 microscope. Images were captured using a Nikon A1R laser performed using either 1:25 Alexa Fluor 555 Tyramide (Invitrogen) or by scanning confocal. For mounting, embryos were fixed in 4% PFA for 20 min deposition of 1:50 TSA plus cyanine 3 solution (Perkin Elmer). Detection of and washed three times in PBS. Embryos were agitated in 5% saponin/PBS fluorescein-labeled probes was performed by deposition of 1:50 TSA Plus 0.5%Tx-100 followed by dehydration to 75% glycerol/PBS and left Fluorescein solution (Perkin Elmer). overnight at 4°C. Hearts were dissected and flat mounted prior to imaging.

Quantitative RT-PCR EdU incorporation Quantitative real-time PCR (qRT-PCR) was performed using the Roche EdU incorporation assays were performed as previously described (Zeng LightCycler 480 with Platinum SYBR green master mix used as per the and Yelon, 2014). Embryos were incubated in 10 mM EdU at 16, 22 and manufacturer’s instructions (ThermoFisher Scientific, 11733038). Primers 24 hpf on ice for 30 min. A Click-iT imaging kit (Invitrogen) was used to used were as follows: hey2 forward, 5′ GTGGCTCACCTACAACGACA 3′; visualize EdU incorporation. Tg(nkx2.5:ZsYellow) expression was detected reverse, 5′ CCAACTTGGCAGATCCCTGT 3′; mef2cb forward, 5′ CAG- using α-RCFP (Clontech 632475) with Alexa Fluor 488-conjugated goat CCCAGAGTCAAAGGACA; 3′, reverse, 5′ AGGGCACAGCACATATC- anti-rabbit secondary. The Proliferation Index (Fig. 7) was calculated CTC 3′; nkx2.5 forward, 5′ TCTCTCTTCAGCGAAGACCT 3′; as the percentage of Nkx2.5:ZsYellow+ cells (green) that successfully

reverse, 5′ CTAGGAAGTTCTTCGCGTAA 3′; gfp forward, 5′ incorporated EdU (red) in a given experiment. DEVELOPMENT

13 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Transplantation Davis, R. L. and Turner, D. L. (2001). Vertebrate hairy and Enhancer of split Transplantation was performed as previously described (Scott et al., 2007). related proteins: transcriptional repressors regulating cellular differentiation and At 4 hpf, 20-30 cells from a myl7:nlsKikGR donor, either uninjected or embryonic patterning. Oncogene 20, 8342-8357. de Pater, E., Clijsters, L., Marques, S. R., Lin, Y.-F., Garavito-Aguilar, Z. V., injected with hey2 MO, were placed into two locations along the margin of Yelon, D. and Bakkers, J. (2009). Distinct phases of cardiomyocyte wild-type host embryos. Host embryos were subjected to UV illumination at differentiation regulate growth of the zebrafish heart. Development 136, 24 hpf, and subsequently scored at 48 hpf for contribution of donor cells to 1633-1641. early- (green and red) or late-differentiating (green-only) CMs. Devine, W. P., Wythe, J. D., George, M., Koshiba-Takeuchi, K. and Bruneau, B. G. (2014). Early patterning and specification of cardiac progenitors in gastrulating mesoderm. eLife 3, e03848. Statistical analysis Doetzlhofer, A., Basch, M. L., Ohyama, T., Gessler, M., Groves, A. K. and Segil, Excel softwarewas used to perform Student’st-test with two-tailed distribution. N. (2009). Hey2 regulation by FGF provides a Notch-independent mechanism for Graphs display mean±s.e.m. unless otherwise stated. Box plot graphs were maintaining pillar cell fate in the organ of Corti. Dev. Cell 16, 58-69. prepared using BoxPlotR web-tool (http://www.boxplot.tyerslab.com). Donovan, J., Kordylewska, A., Jan, Y. N. and Utset, M. F. (2002). Tetralogy of fallot and other congenital heart defects in Hey2 mutant mice. Curr. Biol. 12, 1605-1610. Acknowledgements Feng, L., Hernandez, R. E., Waxman, J. S., Yelon, D. and Moens, C. B. (2010). We thank Angela Morley and Allen Ng for expert fish care and maintenance. Paul Dhrs3a regulates retinoic acid biosynthesis through a feedback inhibition Paroutis at the Hospital for Sick Children Imaging Facility provided valuable support mechanism. Dev. Biol. 338, 1-14. for microscopy experiments. We thank previous reviewers of this manuscript Gerrard, D. T., Berry, A. A., Jennings, R. E., Piper Hanley, K., Bobola, N. and for thoughtful suggestions and insights. Neil Chi kindly provided the myl7:EGFP, Hanley, N. A. (2016). An integrative transcriptomic atlas of organogenesis in and Caroline and Geoffrey Burns provided the nkx2.5:ZsYellow transgenic lines. human embryos. Elife 5, e15657. Grimes, A. C., Stadt, H. A., Shepherd, I. T. and Kirby, M. L. (2006). Solving an Competing interests enigma: arterial pole development in the zebrafish heart. Dev. Biol. 290, 265-276. The authors declare no competing or financial interests. Guner-Ataman, B., Paffett-Lugassy, N., Adams, M. S., Nevis, K. R., Jahangiri, L., Obregon, P., Kikuchi, K., Poss, K. D., Burns, C. E. and Burns, C. G. (2013). Zebrafish second heart field development relies on progenitor specification in Author contributions anterior lateral plate mesoderm and nkx2.5 function. Development 140, Conceptualization: I.C.S., N.G., S.L.; Methodology: I.C.S., N.G., S.L.; Validation: 1353-1363. N.G., A.R.D.; Formal analysis: N.G.; Investigation: N.G., X.Y., A.R.D., M.L.; Hami, D., Grimes, A. C., Tsai, H.-J. and Kirby, M. L. (2011). Zebrafish cardiac Resources: X.Y.; Writing - original draft: I.C.S., N.G., S.L.; Writing - review & editing: development requires a conserved secondary heart field. Development 138, I.C.S., N.G., M.D.W.; Visualization: N.G., X.Y.; Supervision: I.C.S., M.D.W.; Project 2389-2398. administration: I.C.S.; Funding acquisition: I.C.S., M.D.W. Hermkens, D. M. A., van Impel, A., Urasaki, A., Bussmann, J., Duckers, H. J. and Schulte-Merker, S. (2015). Sox7 controls arterial specification in conjunction Funding with hey2 and efnb2 function. Development 142, 1695-1704. N.G. and X.Y. were kindly supported by a Labatt Family Heart Centre Philip Witchel Huang, C.-J., Tu, C.-T., Hsiao, C.-D., Hsieh, F.-J. and Tsai, H.-J. (2003). Germ-line post-doctoral fellowship and a Hospital for Sick Children Restracomp studentship, transmission of a myocardium-specific GFP transgene reveals critical regulatory respectively. Research funding was generously provided by the Heart and Stroke elements in the cardiac myosin light chain 2 promoter of zebrafish. Dev. Dyn. Foundation of Canada (to I.C.S. and M.D.W., Grant-in-Aid G-16-00013798), the 228, 30-40. Natural Sciences and Engineering Research Council of Canada (to I.C.S., RGPIN Hutson, M. R., Zeng, X. L., Kim, A. J., Antoon, E., Harward, S. and Kirby, M. L. 341545-12/17) and the Canadian Institutes of Health Research (operating grant (2010). Arterial pole progenitors interpret opposing FGF/BMP signals to proliferate or differentiate. Development 137, 3001-3011. MOP–123223 to I.C.S. and Project Grant PJT - 153343 to I.C.S. and M.D.W.). Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y.-P., Jiao, K., Schwartz, R. J., Klingensmith, J. and Meyers, E. N. (2006). Fgf8 is required for anterior heart Supplementary information field development. Development 133, 2435-2445. Supplementary information available online at Ivanovitch, K., Temiño, S. and Torres, M. (2017). Live imaging of heart tube http://dev.biologists.org/lookup/doi/10.1242/dev.167510.supplemental development in mouse reveals alternating phases of cardiac differentiation and morphogenesis. Elife 6, e30668. Jahangiri, L., Sharpe, M., Novikov, N., González-Rosa, J. M., Borikova, A., References Nevis, K., Paffett-Lugassy, N., Zhao, L., Adams, M., Guner-Ataman, B. et al. Abu-Issa, R., Waldo, K. and Kirby, M. L. (2004). Heart fields: one, two or more? (2016). The AP-1 transcription factor component Fosl2 potentiates the rate of Dev. Biol. 272, 281-285. myocardial differentiation from the zebrafish second heart field. Development Alexander, J., Stainier, D. Y. R. and Yelon, D. (1998). Screening mosaic F1 143, 113-122. females for mutations affecting zebrafish heart induction and patterning. Dev. Jao, L. E., Wente, S. R. and Chen, W. (2013) Efficient multiplex biallelic zebrafish Genet. 22, 288-299. genome editing using a CRISPR nuclease system. Proc. Natl. Acad. Sci. USA Anderson, D. J., Kaplan, D. I., Bell, K. M., Koutsis, K., Haynes, J. M., Mills, R. J., 110, 13904-13909. Phelan, D. G., Qian, E. L., Leitoguinho, A. R., Arasaratnam, D. et al. (2018). Jia, H., King, I. N., Chopra, S. S., Wan, H., Ni, T. T., Jiang, C., Guan, X., Wells, S., Srivastava, D. and Zhong, T. P. (2007). Vertebrate heart growth is regulated by NKX2-5 regulates human cardiomyogenesis via a HEY2 dependent functional antagonism between Gridlock and Gata5. Proc. Natl. Acad. Sci. USA transcriptional network. Nat. Commun. 9, 1373. 104, 14008-14013. Buckingham, M., Meilhac, S. and Zaffran, S. (2005). Building the mammalian Kelly, R. G. (2012). The second heart field. Curr. Top. Dev. Biol. 100, 33-65. heart from two sources of myocardial cells. Nat. Rev. Genet. 6, 826-835. Kikuchi, K., Holdway, J. E., Werdich, A. A., Anderson, R. M., Fang, Y., Burg, L., Zhang, K., Bonawitz, T., Grajevskaja, V., Bellipanni, G., Waring, R. and Egnaczyk, G. F., Evans, T., MacRae, C. A., Stainier, D. Y. R. and Poss, K. D. Balciunas, D. (2016). Internal epitope tagging informed by relative lack of (2010). Primary contribution to zebrafish heart regeneration by gata4(+) sequence conservation. Sci. Rep. 6, 36986. cardiomyocytes. Nature 464, 601-605. Cai, C.-L., Liang, X., Shi, Y., Chu, P.-H., Pfaff, S. L., Chen, J. and Evans, S. Kikuchi, K., Holdway, J. E., Major, R. J., Blum, N., Dahn, R. D., Begemann, G. (2003). Isl1 identifies a cardiac progenitor population that proliferates prior to and Poss, K. D. (2011). Retinoic acid production by endocardium and epicardium differentiation and contributes a majority of cells to the heart. Dev. Cell 5, 877-889. is an injury response essential for zebrafish heart regeneration. Dev. Cell 20, Camp, E., Dietrich, S. and Munsterberg, A. (2012). Fate mapping identifies the 397-404. origin of SHF/AHF progenitors in the chick primitive streak. PLoS ONE 7, e51948. Kok, F. O., Shin, M., Ni, C.-W., Gupta, A., Grosse, A. S., van Impel, A., Chapman, D. L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S. I., Gibson- Kirchmaier, B. C., Peterson-Maduro, J., Kourkoulis, G., Male, I. et al. (2015). Brown, J. J., Cebra-Thomas, J., Bollag, R. J., Silver, L. M. and Papaioannou, Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish. Dev. Cell 32, 97-108. V. E. (1996). Expression of the T-box family genes, Tbx1-Tbx5, during early Lazic, S. and Scott, I. C. (2011). Mef2cb regulates late myocardial cell addition mouse development. Dev. Dyn. 206, 379-390. from a second heart field-like population of progenitors in zebrafish. Dev. Biol. Chen, J. N. and Fishman, M. C. (1996). Zebrafish tinman homolog demarcates the 354, 123-133. heart field and initiates myocardial differentiation. Development 122, 3809-3816. Lescroart, F., Kelly, R. G., Le Garrec, J.-F., Nicolas, J.-F., Meilhac, S. M. and Choi, S. Y., Chacon-Heszele, M. F., Huang, L., McKenna, S., Wilson, F. P., Zuo, Buckingham, M. (2010). Clonal analysis reveals common lineage relationships X. and Lipschutz, J. H. (2013). Cdc42 deficiency causes ciliary abnormalities between head muscles and second heart field derivatives in the mouse embryo.

and cystic kidneys. J. Am. Soc. Nephrol. 24, 1435-1450. Development 137, 3269-3279. DEVELOPMENT

14 RESEARCH ARTICLE Development (2018) 145, dev167510. doi:10.1242/dev.167510

Li, Q., Ritter, D., Yang, N., Dong, Z., Li, H., Chuang, J. H. and Guo, S. (2010). Tang, R., Dodd, A., Lai, D., McNabb, W. C. and Love, D. R. (2007). Validation of A systematic approach to identify functional motifs within vertebrate zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR developmental enhancers. Dev. Biol. 337, 484-495. normalization. Acta Biochim. Biophys. Sin. (Shanghai) 39, 384-390. Li, D., Sinha, T., Ajima, R., Seo, H.-S., Yamaguchi, T. P. and Wang, J. (2016). Targoff, K. L., Colombo, S., George, V., Schell, T., Kim, S.-H., Solnica-Krezel, L. Spatial regulation of cell cohesion by Wnt5a during second heart field progenitor and Yelon, D. (2013). Nkx genes are essential for maintenance of ventricular deployment. Dev. Biol. 412, 18-31. identity. Development 140, 4203-4213. Lou, X., Deshwar, A. R., Crump, J. G. and Scott, I. C. (2011). Smarcd3b and Thisse, C. and Thisse, B. (2008). High-resolution in situ hybridization to whole- Gata5 promote a cardiac progenitor fate in the zebrafish embryo. Development mount zebrafish embryos. Nat. Protoc. 3, 59-69. 138, 3113-3123. Tirosh-Finkel, L., Zeisel, A., Brodt-Ivenshitz, M., Shamai, A., Yao, Z., Seger, R., Mandal, A., Holowiecki, A., Song, Y. C. and Waxman, J. S. (2017). Wnt signaling Domany, E. and Tzahor, E. (2010). BMP-mediated inhibition of FGF signaling balances specification of the cardiac and pharyngeal muscle fields. Mech. Dev. promotes cardiomyocyte differentiation of anterior heart field progenitors. 143, 32-41. Development 137, 2989-3000. Meilhac, S. M., Kelly, R. G., Rocancourt, D., Eloy-Trinquet, S., Nicolas, J. F. and Traver, D., Paw, B. H., Poss, K. D., Penberthy, W. T., Lin, S. and Zon, L. I. (2003). Buckingham, M. E. (2003). A retrospective clonal analysis of the myocardium Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutants. Nat. Immunol. 4, 1238-1246. reveals two phases of clonal growth in the developing mouse heart. Development van den Berg, G., Abu-Issa, R., de Boer, B. A., Hutson, M. R., de Boer, P. A. J., 130, 3877-3889. Soufan, A. T., Ruijter, J. M., Kirby, M. L., van den Hoff, M. J. B. and Moorman, Miao, L., Li, J., Li, J., Tian, X., Lu, Y., Hu, S., Shieh, D., Kanai, R., Zhou, B.-Y., A. F. M. (2009). A caudal proliferating growth center contributes to both poles of Zhou, B. et al. (2018). Notch signaling regulates Hey2 expression in a the forming heart tube. Circ. Res. 104, 179-188. spatiotemporal dependent manner during cardiac morphogenesis and Waldo, K. L., Hutson, M. R., Ward, C. C., Zdanowicz, M., Stadt, H. A., Kumiski, trabecular specification. Sci. Rep. 8, 2678. D., Abu-Issa, R. and Kirby, M. L. (2005). Secondary heart field contributes Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J., myocardium and smooth muscle to the arterial pole of the developing heart. Dev. Eisenberg, C. A., Turner, D. and Markwald, R. R. (2001). The outflow tract of the Biol. 281, 78-90. heart is recruited from a novel heart-forming field. Dev. Biol. 238, 97-109. Ward, C., Stadt, H., Hutson, M. and Kirby, M. L. (2005). Ablation of the secondary Moorman, A. F. M., Christoffels, V. M., Anderson, R. H. and van den Hoff, heart field leads to tetralogy of Fallot and pulmonary atresia. Dev. Biol. 284, 72-83. M. J. B. (2007). The heart-forming fields: one or multiple? Philos. Trans. R. Soc. Weinstein, B. M., Stemple, D. L., Driever, W. and Fishman, M. C. (1995). Gridlock, Lond. B Biol. Sci. 362, 1257-1265. a localized heritable vascular patterning defect in the zebrafish. Nat. Med. 1, Nevis, K., Obregon, P., Walsh, C., Guner-Ataman, B., Burns, C. G. and Burns, 1143-1147. C. E. (2013). Tbx1 is required for second heart field proliferation in zebrafish. Westerfield, M. (1993). The Zebrafish Book: A Guide for the Laboratory Use of Dev. Dyn. 242, 550-559. Zebrafish Danio (Brachydanio) rerio, 2nd edn. Oregon: University of Oregon Paffett-Lugassy, N., Singh, R., Nevis, K. R., Guner-Ataman, B., O’Loughlin, E., Press. Jahangiri, L., Harvey, R. P., Burns, C. G. and Burns, C. E. (2013). Heart field Winkler, C., Elmasri, H., Klamt, B., Volff, J.-N. and Gessler, M. (2003). origin of great vessel precursors relies on nkx2.5-mediated vasculogenesis. Nat. Characterization of hey bHLH genes in teleost fish. Dev. Genes Evol. 213, Cell Biol. 15, 1362-1369. 541-553. Park, E. J., Watanabe, Y., Smyth, G., Miyagawa-Tomita, S., Meyers, E., Witzel, H. R., Jungblut, B., Choe, C. P., Crump, J. G., Braun, T. and Dobreva, G. Klingensmith, J., Camenisch, T., Buckingham, M. and Moon, A. M. (2008). (2012). The LIM protein Ajuba restricts the second heart field progenitor pool by An FGF autocrine loop initiated in second heart field mesoderm regulates regulating Isl1 activity. Dev. Cell 23, 58-70. morphogenesis at the arterial pole of the heart. Development 135, 3599-3610. Witzel, H. R., Cheedipudi, S., Gao, R., Stainier, D. Y. R. and Dobreva, G. D. Pradhan, A., Zeng, X.-X. I., Sidhwani, P., Marques, S. R., George, V., Targoff, (2017). Isl2b regulates anterior second heart field development in zebrafish. K. L., Chi, N. C. and Yelon, D. (2017). FGF signaling enforces cardiac chamber Sci. Rep. 7, 41043. identity in the developing ventricle. Development 144, 1328-1338. Xin, M., Small, E. M., van Rooij, E., Qi, X., Richardson, J. A., Srivastava, D., Prall, O. W. J., Menon, M. K., Solloway, M. J., Watanabe, Y., Zaffran, S., Bajolle, Nakagawa, O. and Olson, E. N. (2007). Essential roles of the bHLH transcription F., Biben, C., McBride, J. J., Robertson, B. R., Chaulet, H. et al. (2007). An factor Hrt2 in repression of atrial gene expression and maintenance of postnatal nkx2-5/bmp2/smad1 negative feedback loop controls heart progenitor cardiac function. Proc. Natl. Acad. Sci. USA 104, 7975-7980. specification and proliferation. Cell 128, 947-959. Yelon, D., Horne, S. A. and Stainier, D. Y. R. (1999). Restricted expression of Quaranta, R., Fell, J., Rühle, F., Rao, J., Piccini, I., Araúzo-Bravo, M. J., Verkerk, cardiac myosin genes reveals regulated aspects of heart tube assembly in A. O., Stoll, M. and Greber, B. (2018). Revised roles of ISL1 in a hES cell-based zebrafish. Dev. Biol. 214, 23-37. model of human heart chamber specification. Elife 7, e31706. Yoruk, B., Gillers, B. S., Chi, N. C. and Scott, I. C. (2012). Ccm3 functions in a Rochais, F., Mesbah, K. and Kelly, R. G. (2009). Signaling pathways controlling manner distinct from Ccm1 and Ccm2 in a zebrafish model of CCM vascular disease. Dev. Biol. 362, 121-131. second heart field development. Circ. Res. 104, 933-942. Yuan, X., Song, M., Devine, P., Bruneau, B. G., Scott, I. C. and Wilson, M. D. Ryckebusch, L., Wang, Z., Bertrand, N., Lin, S.-C., Chi, X., Schwartz, R., Zaffran, (2018). Heart enhancers with deeply conserved regulatory activity are established S. and Niederreither, K. (2008). Retinoic acid deficiency alters second heart field early in development. Nat. Commun. (in press). formation. Proc. Natl. Acad. Sci. USA 105, 2913-2918. Zeng, X.-X. I. and Yelon, D. (2014). Cadm4 restricts the production of cardiac Sakata, Y., Kamei, C. N., Nakagami, H., Bronson, R., Liao, J. K. and Chin, M. T. outflow tract progenitor cells. Cell Rep 7, 951-960. (2002). Ventricular septal defect and cardiomyopathy in mice lacking the Zhang, L., Zhong, T., Wang, Y., Jiang, Q., Song, H. and Gui, Y. (2006). TBX1, a transcription factor CHF1/Hey2. Proc. Natl. Acad. Sci. USA 99, 16197-16202. DiGeorge syndrome candidate gene, is inhibited by retinoic acid. Int. J. Dev. Biol. ’ Scott, I. C., Masri, B., D Amico, L. A., Jin, S.-W., Jungblut, B., Wehman, A., 50, 55-61. Baier, H., Audigier, Y. and Stainier, D. Y. R. (2007). The G-protein coupled Zhao, C., Guo, H., Li, J., Myint, T., Pittman, W., Yang, L., Zhong, W., Schwartz, receptor Agtrl1b regulates early development of myocardial progenitors. Dev. Cell R. J., Schwarz, J. J., Singer, H. A. et al. (2014). Numb family proteins are 12, 403-413. essential for cardiac morphogenesis and progenitor differentiation. Development Sirbu, I. O., Zhao, X. and Duester, G. (2008). Retinoic acid controls heart 141, 281-295. anteroposterior patterning by down-regulating Isl1 through the Fgf8 pathway. Zhong, T. P., Rosenberg, M., Mohideen, M. A., Weinstein, B. and Fishman, M. C. Dev. Dyn. 237, 1627-1635. (2000). gridlock, an HLH gene required for assembly of the aorta in zebrafish. Sorrell, M. R. J. and Waxman, J. S. (2011). Restraint of Fgf8 signaling by retinoic Science 287, 1820-1824. acid signaling is required for proper heart and forelimb formation. Dev. Biol. Zhong, T. P., Childs, S., Leu, J. P. and Fishman, M. C. (2001). Gridlock signalling 358, 44-55. pathway fashions the first embryonic artery. Nature 414, 216-220. Stainier, D. Y., Lee, R. K. and Fishman, M. C. (1993). Cardiovascular development Zhou, Y., Cashman, T. J., Nevis, K. R., Obregon, P., Carney, S. A., Liu, Y., Gu, A., in the zebrafish. I. Myocardial fate map and heart tube formation. Development Mosimann, C., Sondalle, S., Peterson, R. E. et al. (2011). Latent TGF-beta 119, 31-40. binding protein 3 identifies a second heart field in zebrafish. Nature 474, 645-648. DEVELOPMENT