Archives of Agriculture and Environmental Science

ISSN (Online) : 2456-6632

An International Journal Volume 2 | Issue 2

Agriculture and Environmental Science Academy www.aesacademy.org Scan to view it on the web Archives of Agriculture and Environmental Science (An International Research Journal) (Abbreviation: Arch. Agr. Environ. Sci.)

Aims & Objectives: The journal is an official publication of Agriculture and Environmental Science Academy. Its goal is to publish scientific research views in the field of Agriculture Sciences, and Environmental Sciences; and any other related field to promote speedy propagation of quality research information. Periodicity: Four issues in a year (March, June, September and December)

Editor-in-Chief

Dr. Vinod Kumar Department of Zoology and Environmental Science Gurukula Kangri University, Haridwar (Uttarakhand), INDIA E-mail: [email protected]; [email protected]

Associate Editors

Dr. Sachin Srivastva, Dehradun, India Dr. Temin Payum, Pesighat, India

Advisory Board

Prof. Bharat Raj Subba, Biratnagar, Nepal Prof. Dr. Barbara Sawicka, Lublin Poland Prof. A.K. Chopra, Haridwar, India Prof. N.C. Gupta, Delhi, India Prof. Kavita Shah, Varanasi, India Prof. S.K. Singh, Varanasi, India Dr. T. Ramanathan, Parangipettai, India Er. Omkar Singh, Roorkee, India

Editorial Board

Dr. Adarsh Kumar Pandey, Malaysia Dr. M.F. Alam, Jazan, Saudi Arabia Dr. S.K. Paul, Mymensingh, Bangladesh Dr. Mritunjay K. Pandey, Kanpur, India Dr. Vineet V. Tyagi, Katra, Jammu, India Dr. Naveen Kumar Arora, Lucknow, India Dr. Kuldeep Bauddh, Ranchi, India Dr. Rakesh Kumar, Jammu, India Dr. Zahoor Ahmed Dar, J&K, India Dr. Ram Swaroop Meena, Varanasi, India

Editorial Secretaries

Mr. Jogendra Singh, Haridwar, India Mr. Roushan K. Thakur, Haridwar, India

Information of Membership/Processing fee of MS/Subscription

Membership/Processing Fee/Subscription India Outside India Annual-Membership 1000.00 US $ 100.00 Processing Fee of MS 500.00 US $ 50.00 *Life-Membership 5000.00 US $ 500.00 Annual Subscription (Individual) 2000.00 US $ 200.00 Annual Subscription (Institutional) 5000.00 US $ 500.00

Note: The payments would be accepted preferably online or through Direct Wire Transfer in favor of ' Agriculture and Environmental Science Academy' payable at Haridwar (Uttarakhand) and should be sent by registered/ speed post to Dr. Vinod Kumar, President, AESA, Department of Zoology and Environmental Science, Gurukula Kangri University, Haridwar-249404, (Uttarakhand), India.

Archives of Agriculture and Environmental Science (Abbreviation: Arch. Agr. Environ. Sci.)

ISSN: 2456-6632 (Online)

An International Research Journal of Agriculture and Environmental Sciences

Volume 2 Number 2 2017

Indexed/Abstracted: The journal claims proudly to be a registered member of the following abstracting/indexing agencies: Google Scholar, jGate @ e-Shodh Sindhu, Research Gate.

Disclaimer:

No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without written permission of the publisher. For information regarding permission, write us [email protected].

An official publication of

Agriculture and Environmental Science Academy 86, Gurubaksh Vihar (East) Kankhal Haridwar-249408 (Uttarakhand), India

Website: www.aesacademy.org Email: [email protected] Phone: +91-98911-89197

Archives of Agriculture and Environmental Science (An International Research Journal)

Volume 2 Issue 2 June 2017

Content List

No Title Page No.

Research Articles

1. Effect of planting method on onion (Allium cepa L.) bulb production in 63-67 Faridpur region of Bangladesh R. Sarker*, M. Ratna, S. Ray, A.H.F. Fahim and M.J. Tithi

2. Gene action studies in early maturing maize (Zea mays L.) inbred lines 68-71 Z.A. Dar*, A.A. Lone, G. Ali, I. Abidi, R.A. Lone, S. Gulzar, Abrar Yasin, Yusra Ali and N. Yousuf

3. Use of double-hurdle model to crop residues usage among farming households 72-78 in Argungu Local Government Area, Kebbi State, Nigeria M.S.M. Jabo and A. Gado

4. Growth and yield of amaranths (Amaranthus spp.) as influenced by seed rate 79-85 and variety in Sokoto, Nigeria M.B. Sokoto* and O.I. Johnbosco

5. Effects of integrated nutrient management on agronomical attributes of 86-91 tomato(Lycopersicon esculentum L.) under field conditions A.K.. Chopra, Temin Payum, Sachin Srivastava and Vinod Kumar*

6. Evaluation of physical and chemical properties of some selected soils in 92-97 mangrove swamp zones of Delta State, Nigeria C. Umeri, R.C. Onyemekonwu* and H. Moseri

7. Transcriptional activator gene based phylogenetic analysis of dolichos yellow 98-104 mosaic virus infecting lablab bean (Dolichos lablab L.) Sonam Arya*, Rajat Chaudhary, Vaishali and S.K. Awasthi

8. Importance of weather prediction for sustainable agriculture in Bihar, India 105-108 Vikram Kumar*, Shaktibala and Shanu Khan

9. Taxonomic significance of stem and petiole anatomy of three white varieties of 109-112 Vigna unguiculata (L.) Walp. Aziagba Bibian Okwuchukwu* and Okeke Clement Uwabukeonye

10. Occurrence and floral details of four new invasive alien species in 113-118 Uttarakhand, India Sumita Rana* and Jyotsna Rastogi

11. Occurrence of heavy metals in Ganga canal water at Haridwar 119-123 (Uttarakhand), India: A case study Nitin Kamboj*, Ravinder Singh Aswal and Prashant Singh

12. Climatic fluctuations in Uttarakhand Himalayan region and resulting 124-128 impacts: A review Kavita Tariyal

13. Breeding climate change resilient maize and wheat for food security 129-133 Asima Gazal, Z.A. Dar*, A.A. Lone, Abrar Yasin, Yusra Ali and M. Habib

Archives of Agriculture and Environmental Science 2 (2): 63-67 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Effect of planting method on onion (Allium cepa L.) bulb production in Faridpur region of Bangladesh

R. Sarker 1*, M. Ratna2, S. Ray3, A.H.F. Fahim4 and M.J. Tithi5 1Scientific Officer (Horticulture), Spices Research Sub-centre, Bangladesh Agricultural Research Institute, Faridpur-7800, BANGLADESH 2Scientific Officer (Plant Breeding), Spices Research Sub-centre, Bangladesh Agricultural Research Institute, Faridpur- 7800, BANGLADESH 3Assistant Director (Entomology), Bureau of Manpower, Employment and Training, Manikgonj-1800, BANGLADESH 4Scientific Officer (Agronomy), Spices Research Centre, BARI, Shibganj, Bogra-5810, BANGLADESH 5Agriculture Extension Officer (Plant Breeding), Department of Agriculture Extension, Dhaka-1207, BANGLADESH *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 20 April 2017 The present study was undertaken to evaluate the effective planting method for onion production for Revised received: 22 May 2017 motivating onion producing farmers in Faridpur region of Bangladesh during rabi season 2014-15 Accepted: 25 May 2017 and 2015-16 at spices Research Sub-centre, Faridpur. The number of treatment was four viz., Raised bed + Spices Research Centre (SRC) recommended practice, Raised bed + Farmer’s practice, Flat Keywords method + Spices Research Centre (SRC) recommended practice and Flat method + Farmer’s Bulb production practice. The onion variety BARI Piaz-1 used as planting material. The SRC recommended practice nd Onion consist of seed sowing at 2 week of November + seedlings transplanting at the end of December + Planting method Spacing (10cm × 10cm) + Irrigation (4times) + weeding (four at 15, 25, 45 and 60 DAT) + Fungi- Spices cide application with Rovral and Ridomil gold (four spray when disease appears) + Insecticide application (2-3 spray when/before thrips / insect appears) + Fertilizer doses (cow dung 5 ton ha-1, -1 N120, P54, k75 and S20 kg ha . On the other hand farmer’s practice consist of seed sowing at last week of November in flat seed bed + seedling transplanting at 3rd week of January + Spacing (10cm × 7cm) + Irrigation (2-3 times) + Weeding (2times) + Fungicide application with Rovral, Score and other type of ineffective fungicide at 5-7 days interval + insecticide application with Confidor after -1 thrips / insect appears + Fertilizer doses (N46, P45, k30 and S16 kg ha . The results of the study revealed that planting method and management practices had significant impact on yield and yield attributes of onion and among the treatments the highest yield was found from Raised bed + SRC recommended practice. Significantly highest yield 14.42 t ha-1 in 2014-15 and 12.57 t ha-1 in 2015- 16 was recorded from SRC recommended practice. The lowest yield 8.05 t ha-1 in 2014-15 and 7.66 t ha-1 in 2015-16 was recorded from Flat method + Farmer’s practice. Therefore, the farmers of Faridpur region of Bangladesh are advised to adopt SRC recommended practice with raised bed method for increasing their annual average onion production ©2017 Agriculture and Environmental Science Academy

Citation of this article: R. Sarker, Ratna, M., Ray, S., Fahim, A.H.F. and Tithi, M.J. (2017). Effect of planting method on onion (Allium cepa L.) bulb production in Faridpur region of Bangladesh. Archives of Agriculture and Environmental Science, 2(2): 63-67.

INTRODUCTION having medicinal value also (Kumar et al., 2010; The onion (Allium cepa L.) belongs to the genus Allium of Bosekeng, 2012). It is one of the most important spices as the family Alliaceae (Hanelt, 1990). Onion contributes well as vegetable crops of Bangladesh. It ranks first among significant nutritional value to the human diet and has the spices both in acreage and production (BBS, 2015). medicinal properties and is primarily consumed for its Faridpur is one of the best onion bulb producing areas in unique flavor or for its ability to enhance the flavor of Bangladesh about 376651 MT (BBS, 2015). Farmers of other foods (Randle, 2000). It is rich source of vitamin C Faridpur region cultivate onion in flat method without bed. and E (Block, 2005; El Assi and Abu-Rayyan, 2007); and They used flood irrigation system to cultivate the crops. In

64 R. Sarker et al. /Arch. Agr. Environ. Sci., 2 (2): 63-67 (2017) most cases they apply water more than optimum level at 25 and 50 days after transplanting. which causes water stagnancy in the field that badly Farmer’s practice: In 2014-15 seeds were sown at 30 hampered crop growth and drastically reduced yield. Again November and seedlings were transplanted at 18 January, onion is a shallow rooted crop which need frequent irriga- in 2015-16 seed were sown at 22 November and seedlings tion. It was reported that per unit production can be were transplanted at 07 January in flat method maintaining increased by raised bed methods of cultivation and raised line to line spacing 10 cm and plant to plant spacing 7 cm. -1 bed can save 20-34% irrigation water, 16-69% planting The fertilizer doses were N46, P45, k30 and S16 kg ha . cost and ensure less human labour (Hossain et al., 2010a). Raised bed: The raised bed (10 cm height + 3 m length + Raised beds 6–8 inches high will help to improve water 2 m width) was used to prepare the nursery of onion during drainage in poorly drained soil during rainy periods, such the present study. In case of SRC practice, weeding was as the winter months (Hayslip et al., 1987). Onion is a done at 25, 50 and 75 days after planting while only two photo thermo sensitive plant (Jones and Mann, 1963) weeding was done in farmer’s practice Depending on hence planting time plays an important role in onion maturity, in SRC practice the crop was harvested in 04 cultivation. So, it is important to know about the optimum April, 2015 and 24 March, 2016 respectively. In farmer’s planting time on onion cultivation to harvest better yield. practice crop was harvested in 13 April, 2015 and 02 April, Considering the above facts, the present study was under- 2016 respectively. However, the yield in 2015 was taken to evaluate the effective planting method for onion comparatively low due to attack of high temperature, rain- production for motivating onion producing farmers in fall and storm immediately before harvest. Data on plant Faridpur region of Bangladesh. height (cm), leaves per plant, individual bulb weight (g), bulb length (mm), bulb breadth (mm) and bulb yield (t ha- MATERIALS AND METHODS 1) were recorded. The collected data were analyzed and The experiment was conducted during rabi season 2014-15 mean values were adjusted by DMRT following MSTAT- and 2015-16 at spices Research Sub-centre, Faridpur. The C software (Gomez, 1984). experimental field belongs to high land of Low Ganges RESULTS AND DISCUSSION River Floodplain (AEZ 12) with clay loam in texture and 7.6-8.1 soil pH (FAO, 1998). The experiment was conduct- The yield and yield contributing characters of onion as ed in randomized complete block design (RCBD) with six affected by planting methods and management practices replications. The number of treatments were four viz., are presented in Tables 3 and 4. Raised bed + SRC practice, Raised bed + Farmer’s prac- Spices research centre recommended practice: Spices tice Flat method + SRC practice, Flat method + Farmer’s Research Centre (SRC) recommended the production practice. The onion variety BARI Piaz-1 was used as plant- technology of onion, which include Bed type, seed sowing ing material. The SRC recommended practice consist of time, transplanting time, time and frequency of irrigation, seed sowing at 2nd week of November + seedlings trans- plant protection system and other management practices. It planting at the end of December + Spacing (10cm × 10cm) had significant effect on yield and yield contributing + Irrigation (4times) + weeding (four at 15, 25, 45 and 60 characters of onion bulb production (Tables 3 and 4). The DAT) + Fungicide application with Rovral and Ridomil tallest plant (45.05cm in 2014-15 and 54.65 cm in 2015- Gold (@ 0.5 g l-1 of water at 35, 45, 55 and 65 DAT. + 16), individual bulb weight (23.58 g in 2014-15 and 20.46 Insecticide application ( to control thrips Regent @ 0.5ml/l g in 2015-16), bulb diameter (3.657 mm in 2014-15 and of water was sprayed at 30, 40, 50 and 60 DAT)) + Ferti- 3.657 mm in 2015-16) was obtained from Raised bed with -1 -1 lizer doses (cow dung 5 ton ha , N120, P54, k75 and S20 kg SRC practice. The highest yield 14.42 t ha in 2014-15 ha-1. On the other hand farmer’s practice consist of seed and 12.57 t ha-1 in 2015-16 was also recorded from SRC sowing at last week of November in flat seed bed + seed- recommended practice. ling transplanting at 3rd week of January + Spacing (10cm Earlier researchers also established that sowing date has × 7cm) + Irrigation (2-3 times) + Weeding (2times) + Fun- significant effect on most of the growth parameters of gicide application with Rovral, Score and other ineffective onion like plant height (Malik et al., 1999), number of fungicides at 5-7 days interval + insecticide application leaves plant-1 (Hamma, 2013), foliage fresh weight with Confidor after thrips / insect appears + Fertilizer (Kandil, 2013), number of flowering stalk, number of -1 -1 -1 doses (N46, P45, k30 and S16 kg ha . The different cultural umbels plant , number of capsule umbel , number of seed practices are described below: capsule-1 and seed yield umbel-1 (Malik et al., 1999, Jagtap SRC recommended practice: In 2014-15 seeds were et al., 2014, Mehri et al., 2015). On the contrary, Nayee et sown at 15 November and seedlings were transplanted to al. (2009) reported that, growth parameter like number of raised bed in the main field at 28 December, in 2015-16 leaves plant-1 does not influenced by planting date. In the seeds were sown at 03 November and seedlings were case of early planting, plant gets enough time and compar- transplanted to raised bed in the main field at 20 December atively higher temperature, which induces maximum maintaining plant to plant spacing 10cm and line to line vegetative growth (Rabinowitch, 1990; Ud-Deen, 2008; spacing 10cm. The fertilizers doses were cow dung 5 ton Hamma, 2013). -1 -1 ha , N120, P54, k75 and S20 kg ha . The entire quantity of Farmers recommended practice: Farmers of Faridpur cow dung, P, K, S and half N were applied during land region have their own way to growing onion. They are preparation. Remaining N was applied in two equal splits used to growing onion in local method. Sowing time,

R. Sarker et al. /Arch. Agr. Environ. Sci., 2 (2): 63-67 (2017) 65 transplanting time and other management practices are not ent treatments is present in Tables 5 and 6. In 2014-15 the same as SRC recommended practices. So in 2014-15 and highest gross return (Tk. 937300 ha-1) and net return (Tk. 2015-16 the shortest plant (34.67 cm and 47 cm), Individu- 850903.25 ha-1) and benefit-cost ratio (10.85) from Raised al bulb weight (16.85 g and15.58 g) was obtained from bed + SRC recommended practice. Which was closely Flat method+ Farmer’s practice, respectively. The followed by Flat bed + SRC recommended practice. minimum number of leaves plant-1 4.80 in 2014-15 was The lowest gross return (Tk. 52357 ha-1), net return (Tk. found from Raised bed + Farmer’s practice and 6 in 2015- 445250.5 ha-1) and benefit-cost ratio (6.68) were obtained 16 from Flat method+ Farmer’s practice. The lowest yield from Flat bed + Farmers practice. In 2015-16 the highest 8.05 t ha-1 in 2014-15 and 7.66 t ha-1 in 2015-16 was gross return (Tk. 754200 ha-1) and net return (Tk. 667803.5 recorded from Flat method + Farmer’s practice (Tables 3 ha-1) and benefit-cost ratio (8.73) was obtained from and 4). Late planting often confine required photoperiod Raised bed + SRC practice. Which was closely followed for vegetative growth and as the temperature increases, by Flat bed + SRC recommended practice. The lowest plants start bulb formation, which lead poor bulb yield gross return ( TK 459600 ha-1), net return ( Tk.381275.5 ha (Misra et al., 2014). -1) and benefit-cost ratio (5.87) Flat bed + Farmers Economic analysis: The economic performance of differ- practice.

Table 1. Weather Data at Faridpur from July 2015 to April 2016. Temperature Month Relative Humidity (%) Total rainfall (mm) Max (oC) Min (oC) July 2015 32.07 26.03 87.77 539.30 August 2015 32.68 26.73 86.90 312.20 September 2015 33.46 26.22 85.90 213.37 October 2015 32.92 23.89 81.00 79.4 November 2015 30.62 19.06 80.03 000.0 December 2015 25.93 15.15 81.51 006.0 January 2016 25.16 11.86 80.51 001.5 February 2016 30.06 17.78 75.24 15.8 March 2016 34.07 21.05 68.68 24.4 April 2016 36.11 26.23 74.50 57.2

Table 2. Month wise (July 2015 to June 2016) No. of rainfall days and range.

Month Number of rainfall days Range (mm) July 2015 22 002.1-094.4 August 2015 22 000.2-84.6 September 2015 17 000.2-044.2 October 2015 08 000.6-052.6 November 2015 00 000.0-000.0 December 2015 02 000.8-005.2 January 2016 1 000.0-001.5 February 2016 3 002.6 - 010.0 March 2016 3 001.4 - 021.0 April 2016 3 7.8-33.00

Table 3. Effect of planting method on yield and yield contributing characters of onion bulb production during 2014-15.

Bulb Plant height Number Individual Bulb length Treatments diameter Yield (t ha-1) (cm) of leaves bulb weight (g) (mm) (mm) Raised bed+ Farmer’s practice 37.07 c 4.80 b 18.92 b 2.88 3.09 b 8.94 c Raised bed+ SRC practice 45.05 a 6.68a 23.58 a 3.16 3.65 a 14.42a Flat method+ Farmer’s practice 34.67 c 5.30 b 16.85 c 2.99 2.91 b 8.05c Flat method+ SRC practice 41.18 b 6.20 a 20.21 b 3.11 3.19 b 12.13 b

Level of sigf. ** ** ** NS ** **

CV (%) 5.06 7.57 5.83 11.07 6.93 14.26 NS= Non significant, **= 1% level of significant

66 R. Sarker et al. /Arch. Agr. Environ. Sci., 2 (2): 63-67 (2017) Table 4. Effect of planting method on yield and yield contributing characters of onion bulb production during 2015-16.

Plant height Number Individual Bulb length Bulb diameter Yield Treatments (cm) of leaves bulb weight (g) (mm) (mm) (t ha-1)

Raised bed+Farmer’s practice 47.87b 6.333Bc 17.58b 3.043a 3.440a 8.860bc

Raised bed+SRC practice 54.65a 7.083a 20.46a 3.247a 3.503a 12.57a

Flat method+ Faemer’s practice 47.00b 6.000c 15.58c 3.040a 2.950b 7.667c Flat method+ SRC practice 52.65a 6.533b 18.02b 3.155a 3.335a 10.12b Level of signif. ** ** ** NS ** ** CV (%) 4.2 5.01 8.43 7.12 6.26 13.84 Table 5. Economic performance of different treatments on bulb production of onion during 2014-2015.

Seed yield Gross return Total cultivation cost Net return Benefit-cost Treatment (t ha-1) (Tk. ha-1) (Tk. ha-1) (Tk. ha-1) ratio Raised bed+ Farmers practice 8.948 581620 79100 502520 7.35 Raised bed + SRC practice 14.42 937300 86396 850903 10.85

Flat bed + Farmer practice 8.055 523575 78324 445250 6.68 Flat bed + Farmer practice 12.13 788450 85362 703087 9.24

Table 6. Economic performance of different treatments on bulb production of onion during 2015-2016.

Seed yield Gross return Total cultivation Net return Benefit-cost Treatment (t ha-1) (Tk. ha-1 ) cost (Tk. ha-1 ) (Tk. ha-1) ratio Raised bed + Farmers practice 8.86 531600 79100 452500 6.72 Raised bed + SRC practice 12.57 754200 86396.75 667803.25 8.73 Flat bed + Farmer practice 7.667 459600 78324.5 381275.5 5.87 Flat bed + Farmer practice 10.12 607200 85362.75 521837.25 7.11 Conclusions Gomez, K.A. and Gomez, A.A. (1984). Statistical procedures for agricultural research 2nd ed. John Wiley & Sons, New From the above discussion it was evident that raised bed York, pp: 146-184. with SRC recommended practice showed better perfor- Hamma, I.L. (2013). Growth and yield of onion as influenced by mance than the farmer’s practice with flat method. The planting dates and mulching types in Samaru, Zaria. highest yield 14.42 t ha-1 in 2014-15 and 12.57 t ha-1 in International Journal of Advance Agricultural Research, 1: 2015-16 was recorded from SRC recommended practice. 22-26. So that the farmers of Faridpur region of Bangladesh are Hanelt, P. (1990). Taxonomy, Evolution, and History. In Onions and Allied Crops, edited by Haim D. Rabino witch and advised to adopt SRC recommended practice with raised James L. Brewster, Boca Raton, Fla.: CRC Press, pp: 1-26. bed method for increasing their annual average onion Hayslip, N.C., Gull, D.D., Guzman, V.L., Shumaker, J.R. and production. Sonoda, R.M. (1987). Bulb onion production in Florida. FL Open Access: This is open access article distributed under Coop. Extension Services Bulletin, pp: 238. Hossain, M.I., M.S. Islam, I. Hossain, C.A. Meisner and Rahman, the terms of the Creative Commons Attribution License, M.S. (2010). Seeding performance of two wheel tractor which permits unrestricted use, distribution, and reproduc- operated bed planter for cereal crop establishment. Interna- tion in any medium, provided the original author(s) and the tional Journal of Energy Machinery, 3(1): 63-69. source are credited. Jagtap, K.B., Patil, M.R., Sunil, D. Patil and Kamble, D.M. (2014). Studies on flowering, yield and quality of onion seed REFERENCES cv. Phulesuvarna as influenced by bulb size and planting BBS.(2015). Monthly (July) Statistical Bulletin of Bangladesh. dates, International Science Journal, 1(3): 54-57. Bangladesh Bureau of Statistics, Ministry of Planning, Jones, H.A. and Mann, L.K. (1963). Onions and Their Allies. Government of the People’s Republic of Bangladesh, Leonard Hill, London, pp: 169. Dhaka, pp: 138. Kandil, A.A., Sharief, A. E.and Fathalla, F.H. (2013). Effect of FAO, Food and Agricultural Organization (1988). Food and transplanting dates of some onion cultivars on vegetative Agricultural Organization of the United Nations, Rome, growth, bulb yield and its quality. Crop Production, 2(3): 72 Italy. -82.

R. Sarker et al. /Arch. Agr. Environ. Sci., 2 (2): 63-67 (2017) 67 Malik, Y.S., Singh, N. and Nehra, B.K. (1999). Effect of planting ture, 71(2): 207-210. time, bulb cut and pinching of bolt treatments on yield and Nayee, D.D., Verma, L.R. and Sitapara, H.H. (2009). Effect of quality of onion seed. Vegetable Science, 26(2): various planting materials and different dates of planting on 143-145. growth and bolting of Kharif onion (Allium cepa L.) cv. Mehri, S., Forodi, B.R. and Kashi, A.K. (2015). Influence of Agrifound Dark Red. Asian Science, 4(1): 13-15. planting date on some morphological characteristic and seed Randle,W.M. (2000).Increasing nitrogen concentration in production in onion (Allium cepa L.) Cultivars. Agricultural hydrophonic solution affects onion flavor and bulb quality. Science Development, 4(2):19-21. Journal of Horticultural Science, 125: 254-259. Misra, A.D., Kumar, A. and Meitei, W.I. (2014). Effect of Ud-Deen, M.M. (2008). Effect of mother bulb size and planting spacing and planting time on growth and yield of onion var. time on growth, bulb yield and seed yield of onion. Bangla- N-53 under Manipur Himalayas. Indian Journal of Horticul- desh Journal of Agricultural. Research, 33(3): 531-537.

Archives of Agriculture and Environmental Science 2 (2): 68-71 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Gene action studies in early maturing maize (Zea mays L.) inbred lines

Z.A. Dar1,2, A.A. Lone1, G. Ali1, I. Abidi, R.A1. Lone, S. Gulzar1, Abrar Yasin1, Yusra Ali1 and N. Yousuf1 1Dryland (Karewa) Agricultural Research Station, Budgam, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir-190001 (J & K), INDIA 2Division of Plant Breeding & Genetics, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir -190001 (J&K), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 02 May 2017 The present investigation was aimed to investigate the gene action in early maturing maize (Zea Accepted: 28 May 2017 mays L.) inbred lines. The experimental material comprised of 30 crosses generated by crossing six maize inbred lines in a diallel mating design during Kharif 2013. These 30 crosses along with Keywords standard checks viz., SMH-2 and VMH-45 were evaluated in randomized block design in three Component analysis replications during Kharif 2014 and Kharif 2015. Significant variation was observed for all studied Gene action traits during both the seasons. Both additive (D) and dominance (H1 and H2) components of genetic Diallel variance were found significant under the study. Preponderance of non-additive gene action was Maize observed for all traits under study. Average degree of dominance was in over dominance range for Maize inbreds all characters. The gene distribution was asymmetrical for all traits. The value of KD / KR indicated presence of excess of dominant genes for all traits except 100-grain weight and ear girth. Heritability of most of the traits was low to medium ©2017 Agriculture and Environmental Science Academy

Citation of this article: Dar, Z.A., Lone, A.A., Ali, G., Abidi, I., Lone, R.A., Gulzar, S., Yasin, A., Ali, Y. and Yousuf, N. (2017). Gene action studies in early maturing maize (Zea mays L.) inbred lines. Archives of Agriculture and Environmental Science, 2(2): 68-71.

and Pooni, 1998). Thus, the present study was conducted INTRODUCTION over two environments, to have reliable estimates of the Maize (Zea mays L.) is a cereal crop, grown widely various components of genetic variation for traits related to throughout the world in a range of agro-ecological in a set of elite maize lines. environments that include tropics, sub-tropics and temperate regions; from sea level to 3000 m above (Morris, 2002) MATERIALS AND METHODS both under irrigated to semi-arid conditions. Having origi- Six early maturing maize inbred lines viz. V-351, V-335, nated in Mexico, maize is now grown at least in 164 coun- KDM-332A, KDM-347, KDM-913A and KDM-445A tries around the world and a tremendous choice is availa- were crossed in a diallel mating design during Kharif sea- ble as regards varieties maturing in 85 days to more than son of 2013 and all 30 possible single crosses, along with 200 days (Brink and Belay, 2006) with variability in grain two standard checks viz., SMH-2 and VMH-45 were eval- colour, size and texture. Maize has a worldwide signifi- uated in a randomized block design (RBD) with three cance as food, feed and as a good source of starch, protein replications during Kharif season of 2014 and Kharif sea- and oil. Many countries rely on maize as a primary staple son of 2015 at Dryland (Karewa) Agricultural Research as it meets the protein and calorie requirements of the Station, Budgam, Jammu and Kashmir, India. Observa- human beings (Vasal, 2002). Hayman’s approach of diallel tions were recorded on morphological traits viz., days to analysis (Hayman, 1954) is most suited to determine the 50 % tasseling, 50 % silking, plant height, ear length (cm), type of gene action, controlling the expression of plant in ear girth (cm), number of kernel rows per ear, number of early generations, which is a prerequisite for genetic kernels per row, hundred grain weight and grain yield per improvement of any crop. Knowing the gene actions plant (in grams). Diallel component analysis (Hayman, governing the traits of interest, plant breeders can devise 1954) was performed with the help of statistical software suitable strategies to develop novel germplasm (Kearsey Windostat version 9.1.

69 Z.A. Dar et al. /Arch. Agr. Environ. Sci., 2 (2): 68-71 (2017)

H2 effects was found to be significant and positive for all traits studied revealing that net dominance effect over all RESULTS AND DISCUSSION the loci in heterozygote was more and that too it exhibited Analysis of variance (ANOVA) for all the characters, over dominance in positive direction. Value of F estimate was positive and non significant for all traits studied except the environments, showed significant differences among -1 environments (Kharif seasons of 2015 and 2016), geno- kernels row thus revealing contribution of more recessive types and genotype × environment interaction (Table 1). alleles towards dominance deviation. On the contrary, the value of F estimate was significant and positive for kernels Significant genotype × environment interaction suggested -1 the differential response of genotypes over the environ- row revealing higher frequency of dominant alleles in the ments. Analysis of variance for all the characters under parents for these traits. Proportions of components of study in two different environments indicated significant genetic variations were calculated and results are presented differences among the treatments, i.e. six parents and 30 in Table 3. The average degree of dominance indicated diallel set of crosses. Significant variation among the yield over-dominance for all the traits, over the environments traits in maize was earlier reported by Hussain et al. (2009), which suggested the importance of non-additive type of Haq et al. (2009), Kumar et al. (2012), Dawod et al. (2012) gene action for all the traits. Over-dominance for ear traits and Sarac and Nedelea (2013a) and Dar et al. (2017). and grain yield, similar to present findings was also The components of genetic variation were estimated for all reported by Kumar et al. (2012), Dawod et al. (2012) and the characters and pooled results are presented in Table 2. Sarac and Nedelea (2013a, 2013b). The study of propor- Analysis of the components of genetic variance revealed tions of various genetic components of variance revealed that the proportion of (H /4H ) was less then 0.25 for all that both additive (D) and dominance components (H1 and 2 1 the studied traits indicating asymmetrical gene distribution H2) were significant for all the traits. This finding suggested the involvement of both these dominance components in the parents. Asymmetric distribution of genes for kernels rows ear-1 was reported by Khodarahmpour (2011) (H1 and H2) in the inheritance of these traits, however greater magnitude of dominance component demonstrated which supports the present findings. Also Zare et al. greater role of dominance component in the inheritance of (2011) observed values of H2/4H1 away from 0.25, showing asymmetric distribution of positive and negative domi- these traits. The distribution of alleles in the parents -1 -1 revealed that positive and negative alleles at these loci are nant genes for kernel rows ear and kernels row in their study. The genetic ratio KD/KR which gives the propor- not in equal proportion in parents as H1 exceeds H2 and dominance gene action resulted mainly from positive gene tion of dominant and recessive alleles in the parent was action. Dawod et al. (2012) reported relatively higher found to be greater than unity for all traits studied except estimates of dominance components than additive compo- for ear girth and 100-grain weight where it was less than nent for kernel rows ear-1, kernels row-1 and grain yield unity. This suggested that barring ear girth and 100-grain which are in line with the present findings. Estimation of weight there was higher proportion of dominant alleles in the parents for traits studied and the recessive and domi- Table 1. Pooled analysis of variance for different characters in maize. 100- Days to Days to Plant Ear Ear Kernel Source of Kernels grain Grain yield S.N. d.f 50% 50% height length girth row Variation row-1 weight plant-1 (g) anthesis silking (cm) (cm) (cm) ear-1 (g) 11410.6 11767.2 51406. 395.87 86.889 1410.32 149.29 1. Environments 1 0.195 39540.790** 30** 10** 20** 7** ** 0** 1** 62.657* 60.389* 5602.5 16.962 4.487* 10.758* 86.745* 60.830 2. Treatments 35 3576.861** * * 20** ** * * * ** 22.364* 23.794* 4633.7 8.083* 2.737* 15.233* 55.635* 41.463 3. Parents 5 919.779** * * 33** * * * * ** 28.809* 30.670* 2524.5 6.959* 2.476* 56.725* 42.760 4. Hybrids 29 9.485** 1468.898** * * 78** * * * ** Parents v.s 2737.60 2410.39 6301.4 799.40 149.16 43.851* 3652.50 1565.9 169621.302* 5. 1 Hybrids 9** 5** 00** 9** 5** * 3** 38** * Treatment x 637.31 5.178* 19.873* 5.283* 6. 35 4.494** 3.072** 1.52** 1.936** 389.46** Environments 6** * * * Parent x 507.00 2.358* 7. 5 5.385** 3.252** 1.065* 0.571* 0.315 7.990** 39.916 Environments 4** * Hybrids x 632.68 5.061* 1.516* 18.892* 5.791* 8. 29 4.089** 2.860** 2.217** 385.51** Environments 8** * * * * Parent v. s 14.467* 2337.5 59.126 7.133* 210.735 9.763* 9. Hybrids x 1 15199** 2.447** 53778.4** * 69** ** * ** * Environments 10. Error 70 1.143 1.314 31.848 0.494 0.247 0.364 1.918 0.911 27.199 *, ** significant at 5 and 1 per cent level, respectively.

Z.A. Dar et al. /Arch. Agr. Environ. Sci., 2 (2): 68-71 (2017) 70 Table 2. Estimates of genetic parameters for grain yield and other attributes in maize.

100- Days to Days to Plant Ear Ear Kernel Grain Kernels grain 50% 50% height length girth row yield row-1 weight S.N. Components anthesis silking (cm) (cm) (cm) ear -1 plant-1 (g) (g)

Pooled Pooled Pooled Pooled Pooled Pooled Pooled Pooled Pooled

11150.72 5.55** 5.62** 1.89 0.62** 3.72 13.68** 10.14** 222.40* 1. ** D + 1.87 + 1.80 + 86.43 + 0.70 + 0.12 + 0.42 + 2.17 + 1.12 + 95.55 2414.44* 41.68** 39.84** 11.44** 2.30** 4.05** 53.66** 30.12** 2290.73** 2. * H1 + 3.73 + 3.59 + 152.90 + 1.40 + 0.24 + 0.84 + 4.34 + 2.24 + 191.16 2253.81* 36.17** 34.06** 10.18** 2.19** 3.39** 47.31** 26.66** 2077.34** 3. * H2 + 3.11 + 2.99 + 127.19 + 1.16 + 0.20 + 0.70 + 3.61 + 1.86 + 159.01 17897.58 128.69* 14034.06* 225.64** 199.12** 66.03** 12.24** 3.59** 301.95** 4. ** * * h2 + 2.08 + 2.00 + 82.04 + 0.78 + 1.13 + 0.47 + 2.41 + 1.25 + 106.32

2.87 2.36 124.16 1.37 0.03** 0.70** 8.68 1.17 25.39 5. F + 4.23 + 4.07 + 173.23 + 1.59 + 0.27 + 0.95 + 4.92 + 2.54 + 216.57

0.29 0.33 7.96 0.12 0.06 0.09** 0.48 0.23 6.80 6. E + 0.52 + 0.50 + 21.20 + 0.19 + 0.3 + 0.12 + 0.60 + 0.31 + 26.50 *, ** significant at 5 and 1 per cent level, respectively. D – variance component due to additive genetic effects; H 1- variance component due to dominance deviations; H 2 – estimate of dominance genetic variance due to proportion of positive and negative genes; h 2 – net dominance effect; F – mean of covariance of additive and dominance effects over all the arrays; E – environmental component of variation.

Table 3. Proportion of components of genetic variation for different characters in maize.

100- Grain Days Days to Plant Ear Ear Kernel Kernels grain yield 50% 50% height length girth rows row-1 weight plant-1 S.N. Components anthesis silking (cm) (cm) (cm) ear-1 (g) (g) Pooled Pooled Pooled Pooled Pooled Pooled Pooled Pooled Pooled

2. 1/2 2.74 2.66 1.45 2.46 1.92 1.04 1.98 1.72 3.21 (H1/D)

3. 0.22 0.21 0.23 0.22 0.24 0.21 0.22 0.22 0.23 H2/4H1

(4DH )1/2 +F = KD 4. 1 1.20 1.17 1.08 1.35 0.97 1.20 1.38 0.94 1.04

1/2 (4DH1) - F KR

2 5. h /H2 6.24 5.87 7.94 6.49 5.60 1.06 6.38 4.83 6.76

Heritability 6. 12.16 12.65 33.13 15.19 19.45 50.07 22.58 23.95 18.84 h2 (n.s) 1/2 (H1/D) - average degree of dominance; H2/4H 1 - proportion of dominant genes with positive and negative effects; KD/KR - 2 2 proportion of dominant and recessive genes; h / 2 - proportion of gene(s)/gene(s) blocks exhibiting dominance; h (ns) - narrow sense heritability estimate.

71 Z.A. Dar et al. /Arch. Agr. Environ. Sci., 2 (2): 68-71 (2017) nant genes where nearly equal for traits viz., 100-grain REFERENCES weight and ear girth. Similar to the present findings the Brink, M. and Belay, G. (2006). Plant Resources of Tropical prevalence of dominant genes for ear related traits and Africa 1. Cereals and pulses. PROTA Foundation, grain yield was reported by Zare et al. (2011) and Kumar Wageningen, Netherlands/Backhuys Publishers, Leiden, et al. (2012). The proportion of average degree of Netherland/CTA, Wageningen, Netherland. pp: 233. dominance measured form genetic components of variance Dawod, K.M., Al-Falahy, M.A.H. and Mohammad A.S.A. 0.5 (H1/D) was more than unity thus revealing over domi- (2012). Genetic variations and gene effect controlling grain nance for the traits studied. yield and some of its components in maize. Journal of The narrow sense heritability was highest for kernel rows Agricultural Science and Technology, 2: 814-823. ear-1 (50.07%) followed by plant height (33.13%), 100 Dar, Z.A., Lone, A.A., Wani, S.H., Alaie, B., Abidi, I., Ali, G., grain weight (23.95%) and kernels row-1 (22.58%) (Table Habib, M., Mohammad, I.A. and Wani, M.A. (2017). -1 Analysis of combining ability in maize (Zea mays L.) under 3). The moderate heritability for kernel rows ear suggest- temperate conditions. International Journal of Agriculture ed effectiveness of selection for improvement of this trait. Sciences, 9(2): 3647-3649 -1 Ear length, ear girth and grain yield plant exhibited low Haq, M.I., Ajmal, S.U., Malik, H.N. and Munir, M. (2009). heritabilities (15.19 % 19.45 % and 18.84 %) over the Genetic analysis of grain yield and components in maize. seasons suggesting lower selection efficiency for these traits. Sarhad Journal of Agriculture, 25: 187-195. Low narrow sense heritability for grain yield (~10%) was Hayman, B.I. (1954). The theory and analysis of diallel crosses. reported by Khodarahmpour (2011), and Sarac and Nedelea Genetics, 39: 789-809. (2013b), which also reported relatively less genetic variation Hussain, I., Ahsan, M., Saleem, M. and Ahmad, A. (2009). Gene for yield in their material. Similarly, moderate narrow sense action studies for agronomic traits in maize under normal and water stress conditions. Pakistan Journal of Agricultur- heritability estimates for kernel rows ear-1 (48.4%) and -1 al Sciences, 46: 107-112. kernels row (43.7%) were reported by Zare et al. (2011). Kearsey, M.J. and Pooni, H.S. (1998). Genetical analysis of quantitative traits, 2nd ed. Stanley Thomas Pub. Ltd. Conclusions Khodarahmpour, Z. (2011). Genetic control of different traits in In conclusion, in this study the prevalence of greater maize inbred lines (Zea mays L.) using graphical analysis. magnitude of non additive genetic component of variance African Journal of Agricultural Research, 6: 1661-1666. than additive component suggesting that heterosis breeding Kumar, T.S., Reddy, D.M., Naik, V.S., Parveen, S.I. and Subbai- would be beneficial to utilize the dominance gene effects ah, P.V. (2012). Gene action for yield and morpho physiological traits in maize (Zea mays L.) inbred lines. Journal of of these traits. The low narrow sense heritability of few -1 Agricultural Science, 4: 13-16. traits viz., ear length, ear girth and gain yield plant Morris, M.L. (2002). Impacts of International Maize Breeding suggested that selection for these traits may not be effec- Research in Developing Countries, 1966-98. Mexico, tive and reliable. However, owing to the high heritabilities D.F.:CIMMYT. pp 4. of traits viz., kernel rows ear-1, 100 grain weight and Sarac, N. and Nedelea, G. (2013a). Study of inheritance for ear kernels row-1 selection may be more reliable. length in maize using diallel analysis. Journal of Horticul- ture, Forestry and Biotechnology, 17: 281-284. Open Access: This is open access article distributed under Sarac, N. and Nedelea, G. (2013b). Estimation of gene action and the terms of the Creative Commons Attribution License, genetic parameters for ear yield in maize. Journal of Horti- which permits unrestricted use, distribution, and reproduc- culture, Forestry and Biotechnology, 17: 277-280. tion in any medium, provided the original author(s) and the Vasal, S.K. (2002). Quality protein maize: Overcoming the source are credited. hurdles. Journal of Crop Production, 6: 193-227.

Archives of Agriculture and Environmental Science 2 (2): 72-78 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Use of double-hurdle model to crop residues usage among farming households in Argungu Local Government Area, Kebbi State, Nigeria

M.S.M. Jabo and A. Gado Department of Agricultural Economics, Usmanu Danfodiyo University, Sokoto P.M.B 2346, Sokoto, NIGERIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 15 March 2017 The objective of this research is to examine the crop residues use and its determinants in Argungu Revised received: 13 April 2017 Local Government Area of Kebbi State, Nigeria. A cross sectional data from 120 households select- Accepted: 02 May 2017 ed through a multistage and simple random sampling techniques. This research is timely given the fact that, Nigerian Government is now shifting emphasis from oil-based to agricultural diversified Keywords economy. Data collected were analyzed using descriptive statistics and double hurdle. Such an Crop residue approach has never been previously been applied to analyze crop residue usage in the study area Double-Hurdle and the state at large. The descriptive statistics shows that, farmers preferred using crop residue for Farming feeding (44.1%) than any other purpose. Other important and competing uses of crop residue in- Households cluded stall feeding, fire wood, house construction and mulching. The intensity of legume crop Livestock feed residue was positively and statistically influenced by household education, land ownership, exten- Nigeria sion service and access to credit. However, the intensity to use cereal crop residues was positively influenced by household education, extension service and access to electricity (p<0.05). The study concludes crop residues were mainly used for own animal feeding in the area. Extension contact to farm families, socio-economic variable (educational attainment, access to credit) and quantity of crop residues influenced both the decision and intensity of CRs usage in the study area. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Jabo, M.S.M. and Gado, A. (2017). Use of double-hurdle model to crop residues usage among farming households in Argungu Local Government Area, Kebbi State, Nigeria. Archives of Agriculture and Environmental Science, 2(2): 72-78.

INTRODUCTION 2015). As such, crop and livestock integration is an Crops residues (CRs) are a form of roughages available to integral part farming system in Nigeria for livelihood livestock for feeding livestock after crops were harvested. enhancement of many rural households. It is on record They are distinct from other agricultural by-products (such that, majority of smallholder farmers in Nigerian are as bran, oil cakes etc.) which are produced when crops are involved in crop, livestock, or crop-livestock agriculture. processed. Generally, any plant materials that remain after Nigerian agricultural system is dynamic. Farmers who food crops were harvested are classified as a crop residue were hitherto involved only in crop production have diver- (Jibrin et al., 2013). Crop residues have variety of uses sified into crop-livestock production. Similarly, transhu- among farmers in Nigeria. However, CRs are principally; mant pastoralists are increasingly turning in to agro- used as a livestock feed, fuel firewood for roofing, pastoralists to observed sedentary life (Agyemang et al., construction of local houses, and mulching in most rural 1993). This change is on increased based on perceived areas. Crop residues for livestock feeding are either pilled reciprocal benefits the two systems can offers. in stacks near homesteads for subsequent livestock feeding The presidential committee on livestock production identi- or are left on the farm for the animal to feed. The pilled fied biological limitations of the indigenous breeds of stacks are given to fattened animals in small quantity in the animals, seasonal availability of production inputs such as morning and evening, sometimes to working oxen before feed, water, and good quality pasture to be among the and after work (Jibrin et al., 2013). Alternatively, the major constraints of livestock production in Nigeria. residues are left in the threshing ground and consumed by The small ruminant’s holders in Nigeria do experience a animals together with the standing straws, which are left cyclical feed and pasture shortages for many years. During for aftermath grazing (KEFTASA, 1987; Akinola et al., dry-season both small and large ruminants lost weight and

73 M.S.M. Jabo and A. Gado /Arch. Agr. Environ. Sci., 2 (2): 72-78 (2017) in extreme cases some deaths do occur (Jibrin et al., 2013). in Kebbi state and the study area in particular. Therefore, The scarcity of pasture triggers the migration of pastoralist this study has provides interesting insights and implica- to the southern part of the country. The availability of crop tions for the design of policy toward reducing livestock residue varies with season of the year and geographical feed scarcity especially during the lean season. region. In some regions, there is a scarcity of crop residue only for certain months of the year, while in others, the MATERIALS AND METHODS perennial scarcity may prevail. Improvement in the man- About the study area: Argungu Local Government Area agement of crop residue enables efficient utilization of this is located between latitude 12030'33"N to 12040'54"N and potentially useful feed resource for livestock production. longitude 4020'54"E to 4030'54"E covering an area of 428 One of the way towards achieving self-sufficiency in pro- km2 and elevation of 241 meters above sea level. It is tein for teaming Nigerian population is through improved bounded by Yabo Local Government area of Sokoto state crop residue utilization in Nigeria by Fulani herdsman. to the North-East, in the South by Gwandu and Birnin This could be achieve through the introduction of better Kebbi Local Government areas, while to the North and technology such as crop residue crushing machine, by so West by Augie and Arewa Local Government areas doing the meat and milk production can be enhance (Jibrin respectively. The study area enjoys tropical continental et al., 2013). type of climate, which is largely controlled by two air Animal feeds constitute at least 60 percent of the total vari- masses namely; tropical maritime and tropical continental able costs in livestock production in Nigeria. The rumi- blowing from Atlantic and Sahara desert, respectively. The nants feed mainly came from forages and crop residues air masses determined the two dominant seasons, wet and that are usually affected by seasonality. Hence, ruminants dry. Humidity is 27% while wind blow at 11Km/h in ESE experience seasonal fluctuation in weight annually, espe- direction. Argungu L.G.A receive a mean annual rainfall cially during the early wet season and extreme dry periods of 800mm between May to September with a peak period of the year when the rainfall was about to start. in August, the remaining period of the year is dry. The Increased cropping areas have reduced the availability of average temperature is 260C and can rise up to 400C in the water and grazing land resources to pastoralist in Nigeria, peak of hot season (March-July). However, during consequently, leading to incessant conflicts among pastor- harmattan, season (December- February) temperature falls alists, anglers, and farmers who are the major users of land to 210C. and water resources. The quest to increase the agricultural Sampling technique and data analysis: A multi-stage production in all facets is clarion call of the present sampling technique was used for this study. The first stage government of President Muhammadu Buhari for intensifi- involved a purposive selection of three Districts out of cation of crop production by way of increasing cultivated seven districts and in each district 2 villages were selected. areas and adoption of improved technology, and in CRs The second stage involved a purposive selection of6 villag- processing for efficient utilization by livestock. Livestock es based on the intensity of crop-livestock production man- rearers especially (small and large ruminants) are constant- agement system, marketing and utilization prevailing in the ly face with problem of feed shortage especially during the area. Thirteen (13) households were selected, making 40 dry season. This is as a result of the fact that, they solely households per village. Overall, 120 households were relied on crop residues, that is though cheap but in short interviewed using a structured questionnaire. The sample supply. Hence, ruminants experience seasonal weight gain/ size could have presented a limitation on the ability of the loss during the wet/dry periods respectively during the year study to capture effects adequately at household level. (Philip et al., 2009). More so, conflicts do arise between However, in view of the concentration of households that crop farmers and herders over the use of crop residues. use crop residue in the study area and the sample can to a To achieve improvement in animal production, Powell and large extent describe the scenario of crop residues usage. Williams (1995) asserted that crop production must have Data collected was analyzed using descriptive statistics been expanding by 4% annually. This will require further and double hurdle model. intensification of land use. Under these conditions, full Theoretical model: The use of standard regression analy- integration of crop and livestock production could be sis will provide a misleading and inconsistent estimates achieved and the greatest potential for increasing agricul- due to presence of zero observation in the in the intensity tural productivity in the Nigeria. of crop-residues usage. The application of double-hurdle The use of crop residues as a livestock feed and mulching model initially proposed by Cragg (1971) will take care of material have been documented in the current literature for the inherent limitations associated with standard regression example (Moritz, 2010; Jibrin et al., 2013; Akinola et al., including the Tobit model. The double-hurdle model has 2015). However, studies on the determinants and factors been widely applied in the study of technology adoption that influence the decision of farmers to allocate crop resi- (Damisa et al., 2007; Damisa et al., 2011; Asfaw et al., dues among the competing uses is yet to be fully analysed 2011; Akinola et al., 2015). Aristei and Pieroni (2011) and understood in the study area. The application of double applied double-hurdle modeling in tobacco consumption in -hurdle econometric methodology employed in this study Italy. Newman et al. (1995) modeled Irish household takes into account the fact that the dependent variable con- expenditure on prepared meals. More recently, a paper by tains zero crop residues usage. The approach has never Eakins (2014) studied household expenditure using Central been applied previously in analyzing crop residues usage Statistics Office (CSO) data from 2419523 vehicles using

M.S.M. Jabo and A. Gado /Arch. Agr. Environ. Sci., 2 (2): 72-78 (2017) 74 petrol and diesel in Ireland. ii) Participation equation: The Agricultural Household Model is an appropriate theoretical framework for the study crop residues use. The (3) main aim of the household is to maximize its expected utility and profit subject to several constraints such as income, time and farm inputs. The AHM model treats (4) farms or agricultural households as producers and consum- iii) Intensity of crop residue use ers as against the traditional economic theory that dealt with them separately. (5) In this study crop residue usage in Argungu Local Govern- ment are modeled under the framework of Agricultural Household Models (AHMs) as proposed by (Singh et al., (6) 1986). A number of scientists provide a theory that used the model in the allocation of time by household in the production processes. According to (Singh et al., 1986; Aristei and Pieron, 2011) among others, defined the utility y* is positive usage of crop residue as a livestock feed, function of the household as: (d=1) and actual uses (y**) Empirical model: The double hurdle model fitted the (1) cross sectional data generated by the researcher. The dependent variable, which is both the participation and intensity decisions to use crop residue as livestock feed by Where, CR1 is the quantity of CR utilized (with Price Pi), the farmers, were postulated to be influenced by the CR2…….CRn represents all the alternative uses of CRs, w is a represent covariates of all socio-economic variables explanatory variables such as (Table 1.). that influence decision of crop residue users, and d is a latent variable which is equals to one, if an individual uses crop residues as livestock feed and zero otherwise (i.e. for uses other than livestock feed). Econometric model specification: Recent studies have shown that use of standard Tobit to analyze cross sectional (7) data such as on crop residues usage has some deficiencies, RESULTS AND DISCUSSION hence the importance of double hurdle model (Labeaga, 1999; Eakins, 2014; Akinola et al., 2015). The double- Table 2 summarizes crop residues uses by type and purpos- hurdle model has the advantage of modeling participation es. The legume and cereals crops residues uses were identi- decision and the extent of crop residue usage and their fied, They can be used for redistribute nutrient in the farm- determinants separately. The double-hurdle model was ing systems, grazed by other animals; sold to others on originally by Cragg (1971), the model work on assumption filed; sold later, and the export of nutrients out of the farm- that two separate hurdles or decisions must be crossed. The ing system (e.g. fire wood, construction and used for other first hurdle is the decision on the adoption of crop residue purposes. This is agreement with (Akinola et al., 2015) ten for livestock feed. While the second hurdle is the share of purposes for which crop residues were used in Kano State, crop residue that will be allocated for livestock feed Nigeria. (intensity) of crop residue usage, which is conditional on The result shows that, 52.5% and 37.17% legumes and the first decision (adoption to use crop residue as livestock cereal crop residues were allocated for own animal feeding feed). within the farm. Hence, majority of farmers preferred using It is reasonable to assume that, decision to participate or crop residue for feeding than mulching. Other competing use crop residue as livestock feed is not only an economic uses of crop residues included stall feeding, fire wood and decision but is also influenced by socio-economic and house construction. Table 2 indicates that, 22% of legumes demographic variables, which can appear in both models residues are sold either on the field or later. Legume resi- but may have different effects on the dependent variable. dues were major sources for redistributing nutrient within The two hurdles are assumed to be linear in parameters the farm and between farm units (within the systems). (α&β), with disturbances terms ɛ and ν randomly distribut- However, most of the legumes crop residues were used ed with a bivariate normal distribution. The ƛ and x are the within the farm or community (52.52%) while only small vectors of explanatory variables that are assumed to amount (0.83%) was exported to Niger Republic in influence participation and intensity of crop residues usage particular. as a livestock feed, respectively. Determinants of participation in crop residues usage as a livestock feeds: The estimation results presented in this i) Observed consumption: section emphasize the two main goals of the study: First section presents the various factors that influence the decisions to use crop residue among the competing uses, (2) and to evaluate the intensity of crop residues usage among

75 M.S.M. Jabo and A. Gado /Arch. Agr. Environ. Sci., 2 (2): 72-78 (2017) the smallholder farmers in Argungu Local Government to use legume crop residues as livestock feed and not for Area of Kebbi State, Nigeria. The model was estimated by sales. One percent increase in access to extension facilities maximizing the log-likelihood function. The coefficients in increased the probability of farmer’s intensity to use the first hurdle indicate how a given variable affects the legume crop residues as livestock feed by about 0.1%. This likelihood (probability) to use CRs as livestock feed or is because mobile phones provide a medium for farmer-to- otherwise. The second hurdle denotes how a variable influ- farmer interaction through which information is spread on ences the level of usage, given that a decision is made to technological adoption. A one percent increase in access to utilize crop residue as livestock feed. credit resulted to 3% increase in probability of adopting Factors influencing the participation or adoption of cereal legume crop residue as feed for livestock. This might not and legume crop residues as livestock feeds were analyzed be unconnected with increased production because of and the results presented in Table 3. The decision to partic- better funding ability of farming households. The adoption ipate in the usage of cereal and legume crop residues as of use of legume crop residue as livestock was influenced livestock feeds was positively and significantly influenced by education, land ownership, extension and access to by extension contact, quantity of cereal residue used and credit. quantity of legume crop residue used available to the farm- A year increase in education increased the quantity of crop ers. An increase in extension service by one contact would residue used for feeding livestock by about 11%. A unit lead to 0.9% increase in the probability of using cereal and increase in the size of land ownership increased the quanti- legume crop residues as feeds for livestock. However, a ty of legume crop residue by 10.3%. Extension facilities one percent increase in quantity of cereal crop residues also played significant role in influencing the quantity of increase the probability of using cereal and legume crop legume crop residue used for livestock feed. Increase in residues used as feeds for livestock by 5%. On the other access to extension facilities by 1 unit increased the quanti- hand, a one percent increases in quantity of legume resi- ty of legume crop residue used by 0.12%. Similarly, a unit dues resulted in 05% increase in probability of adopting increase in access to credit increased the quantity of cereal-legume crop residues as livestock feed. As regard legume crop residue used by about 4%. This implied that intensity of use of cereal and legume crop residues used majority of the household have no alternative to access to for livestock feed, increase in farming experience used as credit. Access to credit will provide alternative means of proxied for extension indicated that 1% increased the getting fund for livelihood capital. quantity of cereal and legume crop residues used for live- Factors affecting the intensity of cereals and crop stock feed by about 1.2%. Household heads that have residue used as a livestock feeds; Factors influencing access to extension service preferred using their crop adoption and intensity of adoption of cereal CR as live- residues for livestock feeds than selling it. Access to infor- stock feeds are shown in Table 4. The decision to adopt mation made available by increased education has positive cereal crop residues as livestock feed was positively and and statistical significant influence on the quantity of crop significantly influenced by household education, extension, residues used for the livestock feeding. One (kg) increase and access to electricity available to the farmers. A year in quantity of cereal crop residues increased the quantity of increase in education of average household increased the cereal and legume crop residues used for feeding livestock probability of using cereal crop residue as feeds for live- by about 6%. However, availability of alternate source of stock by about 1%. A one percent increase in extension feed like legume crop residues has a positive influence on service increased the probability of using cereal crop resi- the quantity of cereal and legume crop residues used for dues by about 1.3%. On the other hand, a one percent feeding. This may indicate that farmers are less to know increase in access to electricity resulted to 1.2% increase in the importance of combining cereal and legume crop probability of adopting cereal crop residues as livestock residues to maximize livestock production. feed. As regard intensity of use of cereal, legume crop resi- Factors influencing the intensity legumes crop residues dues for livestock feed, increase in farming experience use as livestock feed: Factors influencing the adoption of used as proxied for extension indicated that 1% increased adoption of legume crop residues were investigated and the quantity of cereal, legume crop residues used for live- results presented in Table 4. Education has positive and stock feed by about 2%. Household heads that have access statistical significant influence on the quantity of legume to extension service preferred using their crop residues for crop residue used for the livestock feeding. Better educated livestock feeds than selling it. Adequate information/ a farmer is the less willing want to sell his legume crop communication, innovation training to the farmers would residues but rather use it as feed. One-year increase in motivate and encourage farmers to know the importance of formal schooling will bring about an increased in the quan- using crop residues for livestock feeds than immediate gain tity of crop residues used for feeding livestock by about of trading that may not be profitable in the long run. Ac- 9%. The size of the farm own by the household also has cess to information made available by increased education positive and significant influence on the decision to use has positive and statistical significant influence on the legume crop residues as feeds for livestock. An increase in quantity of cereal crop residues used for the livestock feed- land ownership by one percent increased probability of ing. A one year increase in education increased the quanti- using legume crop residues as livestock feeds by about ty of crop residue used for feeding livestock by about 9%. Extension facilities made available through the use of 1.2%. Similarly, one-unit increase in access to electricity face to face contact, farm visit, mobile phones and radio increased the quantity of cereal crop residue used for live- was a significant variable positively influencing decision stock feeds by 1.4%.

M.S.M. Jabo and A. Gado /Arch. Agr. Environ. Sci., 2 (2): 72-78 (2017) 76 Table 1. Description and definition of the key variables. Variable Description Units Y dependent variable Quantity of crop residues Kg Household age Age of the household head in years Years Household head educational level Number of years of formal education completed by the household head Years Household size Number of people living together under the same roof and eating from the same pot livestock ownership Livestock holding of the household converted tropical livestock unit equivalent TLU farm size Plot size measured in hactres hactres An ordinal measures of training on crop residues use proxied by household posses- Extension contact sion of radio or mobile phone which are reliable channels of communication in the study area: 1 If possessed, 0 If not. access to electricity Access to electricity. An ordinal measure 1 If there was access, 0 Otherwise. Access to credit measured by the farmers access to source of credit such as coopera- Aceess to credit tive society at a reasonable cost. 1 If there was access, 0 otherwise Table 2. Percent of crop residue usage by purpose and type. Crop Residues Uses (%) Cereals (N=120) Legumes (N=120) Within the Farm (on Farm) Stall Feeding 21.67 44.17 Mulching 0.50 3.33 Grazed by own animals 15.00 5.02 Subtotal on farm 37.17 52.52 Within the system (on site) Graze by other animals 12.00 3.98 Sold to other on field 10.13 22.50 Sold later 30.69 20.17 Subtotal on site 52.82 46.65 Outside the system (exported) Used as fire wood 4.17 0.83 Used for construction 4.17 0.00 Used for other purposes 1.67 0.00 Subtotal exported 8.34 0.83 Total percentage 100.00 100.00 Source: Field Survey (2016). Table 3. Factors affecting adoption of crop residues usage as livestock feed. First hurdle Variables Coefficient z-value Household age 0.463NS -0.73 (0.023) Household educational level 0.251NS -1.15 (0.051) Household size 0.963NS -0.05 (0.048) Livestock ownership 0.284NS -1.07 (0.005) Access to credit 0.574NS 0.56 (0.310) Farm size 0.624NS 0.49 (0.057) Extension contact 0.009*** 2.60 (0.371) Quantity cereal used 0.058** 1.90 (3.06) Quantity of legumes used 0.005*** 5.04 (0.001) Constant 0.783NS 0.28 (1.131) Number of observations 120 Wald chi2(9) 33.64 Log likelihood ratio -46.527373 Pseudo R2 0.3724 Goodness-of-fit testHosmer-Lemeshowchi2(8)Prob> chi2 0.7713 Source: Field Survey, (2016). Note: The figures in parenthesis indicate the standard error, NS indicate the variable is not significance, (***) indicate significance at 1% level, (**) indicate significance at 5% level and (*) indicate significance at 10% level.

77 M.S.M. Jabo and A. Gado /Arch. Agr. Environ. Sci., 2 (2): 72-78 (2017) Table 4. Factors affecting intensity of crop residues usage as livestock feeds. Legume crop residue used Cereal crop residue used Second hurdle Second hurdle Variables Coefficient t-values Coefficient t-values Household age 0.757NS 0.31 0.355NS 0.93 (0.579) (227.6) Household educational level 0.088** -1.72 0.010*** -2.61 (4.211) (2028.8) Household size 0.143NS 1.48 0.277NS -1.09 (1.484) (708.8) Livestock ownership 0.086** -1.73 0.380NS 0.88 (0.147) (70.4) Farm size 0.870NS -0.16 0.896NS 0.13 (0.180) (86.6) Extension contact 0.001*** 3.40 0.013*** -2.51 (9.861) (4711.5) Access to electricity 0.473NS 0.72 0.012*** 2.54 (8929.5) (18.246)

Access to credit 0.029*** -2.21 0.699NS 0.39 (10.127) (4837.6 constant 0.911NS 0.11 0.351NS 0.94 (26.338) (12668.9) 120 Number of observations 120

LRchi2(8) 21.85 18.53 Log likelihood -633.08624 -1365.5289 Prob> chi2 0.0052 0.0176 Sigma 48.50654 23178.06 Source: Field Survey, (2016). Note: The figures in parenthesis indicate the standard error, NS indicated the variable is not significance, (***) indicate significance at 1% level, (**) indicate significance at 5% level and (*) indicate significance at 10% level. Conclusions Open Access: This is open access article distributed under the terms of the Creative Commons Attribution License, The main aim of this paper is to identify the factors that which permits unrestricted use, distribution, and reproduc- determine both the probability of using crop residue as a tion in any medium, provided the original author(s) and the livestock feed and those influencing the intensity of the source are credited. use. Therefore, it is essential to go ahead of the typical binary dependent variable methods applied to cross- sectional and time diary surveys. To this end, this study REFERENCES uses the double-hurdle model to address the phenomenon Akinola, A.A., ayendun, B., Abubakar, M., Shehu, M. and under investigation. The results show that the use of CRs Abdoulaye, T. (2015). Crop residue usage and its determi- for livestock feeding follows two independent decisions: nants in Kano State, Nigeria. Journal of Development and the decision to use it as a feed and the decision concerning Agricultural Economics, 7(4): 162-173. intensity of use. The estimation results also reveal that Aristei, D. and Pieroni, L. (2011). A double-hurdle approach to modelling of tobacco consumption in Italy. Applied decision to use CRs as feed was positively and significant- Economics, 40(19): 2463-2476. ly influenced by extension, quantity of cereal crop residue Agyemang, K., Clifford, D.J. and Little, D.A. (1993). An assess- and quantity of legume crop residue available to the farm- ment of the biological and economic efficiency in ers. As regard intensity of use of cereal, legume crop resi- conversion of milk to meat in N'Dama calves. Animal Sci- dues for livestock feed, increase in farming experience ence, 56: 165-170. DOI: https://doi.org/10.1017/ used as peroxide for extension indicated that 1% increased S0003356100021218/. the quantity of cereal-legume crop residues used for Asfaw, S., Shiferaw, B. and Simtowe, F. (2011). Does Technolo- livestock feed by about 1.2%. Household heads that have gy Adoption Promote Commercialization? Evidence from access to extension service preferred using their crop Chickpea Technologies in Ethiopia. Paper presented at the CSAE 2010 conference on Economic Development in residues for livestock feeds than selling. In contrast, the Africa, University of Oxford, UK. intensity of CRs utilization was is mainly determined by Becker, S.G. (1965). A Theory of Allocation of Time. The respondents’ education level attained, access to electricity Economic Journal, 75(299): 493-517. and extension services. Cragg, J. (1971). Some statistical models for limited dependent

M.S.M. Jabo and A. Gado /Arch. Agr. Environ. Sci., 2 (2): 72-78 (2017) 78 variables with application to the demand for durable goods. Labeaga, J.M. (1999). A double-hurdle rational addiction model Econometrica, 39: 829-844. with heterogeneity: Estimating the demand for tobacco. Damisa, M.A, Abdulsalam, Z. and Ugbabe, O.O. (2007). Farmer Journal of Econometrics, 93: 49-72. Choice of Soil Fertility Management in Subsistence Farming Moritz, M. (2010). Crop livestock interactions in agricultural and in the Northern Guinea Savanna of Nigeria. Water Conser- pastoral systems of West Africa. Agriculture and Human vation Practices. In Soil and Water Management for Poverty Values, 27: 119-128. alleviation and Sustainable Environment. (ed) E.O Uyovbi- Newman, C. Henchion, M. and Matthews, A. (1995). A Double- ser, B.A, Raji, A.A. Yusuf, J.O Ogunwole, L.Aliyu & S.O Hurdle model of Irish household expenditure on prepared Ojeniyi. Proceedings of the 31st Annual Conference of the meals. JEL Classification: D12 Working Paper Series. 1- Soil Science Society of Nigeria. Ahmadu Bello University, 27. Zarai. 13th-17th November, 2006. Philip, D., Ephraim Nkonya, John Pender and Omobowale Ayoo- Damisa, M.A., Saleh, M.K. and Lyocks, S.W.J. (2011). Rural la Oni (2009). Constraints to Increasing Agricultural household perception and response strategies to seasonal Productivity in Nigeria: A Review. International Food Poli- food shortages in the northern Guinea Savanna of Nigeria. cy Research Institute; Nigerian Strategy Support Program Journal of Sustainable Development in Africa, 13(6):118- (NNSP); Background Paper No. NSSP 006, 2-48. 128. Powell, J.M. and Williams, T.O. (1995). An overview of mixed Eakins, J. (2014). An application of the double hurdle model to farming systems in Sub-Saharan Africa. In: JM Powell, S petrol and diesel household expenditures in Ireland. Surrey Fernández-Rivera, TO Williams, C Renard (eds.), Livestock Energy Economics Centre (SEEC) School of Economics and sustainable nutrient cycling in mixed farming systems of University of Surrey, United Kingdom, 1-44. Sub-Saharan Africa. Technical Papers, International Live- Jibrin, M.U., Amonye, M.C., Akonyi, N.S. and Oyeleran, O.A. stock Centre for Africa (ILCA), Addis Ababa, Ethiopia. 2:21 (2013). Design and development of a crop residue crushing -36. machine. International Journal of Engineering Inventions, 2 Singh, I., Squire, L. and Strauss, J. (1986). A survey of agricul- (8): 28-34. tural household models: Recent findings and policy implica- KEFTASA, D. (1987). Role of crop residues as livestock feed in tions. The World Bank Economic Review, 1(1): 149-179. Ethiopia highlands. African Forage Genetic Resources, 1-2. doi:10.1093/wber/1.1.149.

Archives of Agriculture and Environmental Science 2 (2): 79-85 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Growth and yield of amaranths (Amaranthus spp.) as influenced by seed rate and variety in Sokoto, Nigeria

M.B. Sokoto* and O.I. Johnbosco Department of Crop Science, Faculty of Agriculture, Usmanu Danfodiyo University, Sokoto, NIGERIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 07 March 2017 This experiment was conducted at the Teaching and Research Vegetable Garden of the Department Revised received: 08 April 2017 of Crop Science, Usmanu Danfodiyo University, Sokoto during the rainy season of the year 2016. Accepted: 02 May 2017 The objective of the research was to determine the effect of seed rate and variety on the growth and yield of Amaranths (Amaranthus spp.) in Sokoto. The treatment consists of factorial combination of Keywords four (4) seed rates (2.0 kg ha-1, 2.5 kg ha-1, 3.0 kg ha-1 and 3.5 kg ha-1) and two (2) varieties Amaranth Ex-Egypt (‘‘DAN EGYPT) and Ex-Kano "DAN KANO’’. The result indicated that seed rate had no Growth significant effect on plant height of amaranths at 2 Weeks after Planting (WAP). However, at 4, 6 -1 Nigeria and 8 WAP, seed rate significantly (p<0.05) affected plant height. Seed rate at 3.0 kg ha resulted -1 -1 Seed rate to significantly taller plants which did not differ significantly from 3.5 kg ha and 2.5 kg ha . The -1 Sokoto shortest plant was from 2.0 kg ha . The effect of seed rate and variety on number of leaves is not Variety significant (P>0.05) at 2, 4, 6, and 8 WAP. The result also showed that seed rate had significant -1 Yield (P<0.05) effect on fresh and dry weight of amaranths at harvest; seed rate of 3.5 kg ha did not differed significantly from seed rate at 3.0 kg ha-1 and 2.5 kg ha-1, while seed rate at 2.0 kg ha-1 recording the lowest fresh and dry weight of amaranths. Seed rate at 2.5 kg ha-1 and any of the two varieties, Ex-Egypt (DAN EGYPT) or Ex-Kano" DAN KANO’’ would be beneficial for the farmers in Sokoto State and areas with similar environmental conditions. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Sokoto, M.B. and Johnbosco, O.I. (2017). Growth and yield of amaranths (Amaranthus spp.) as influenced by seed rate and variety in Sokoto, Nigeria. Archives of Agriculture and Environmental Science, 2(2): 79-85.

observed that of more than 100 different indigenous leafy INTRODUCTION vegetable species in Africa, Amaranth is the most widely Amaranth belongs to the family Amaranthaceae, the genus consumed. According to Olorode (1984), Amaranthus cru- Amaranthus includes 50-60 species, cultivated for green entus L. is a leafy vegetable commonly cultivated in Nige- leaf and grains and a few wild species (Rai and Yadav, ria and other West African countries. Amaranth, a C4 2005). Amaranth is one of the oldest food crops in the plant, is one of a few dicots in which the first product of world; evidence of its cultivation dates back to as far as photosynthesis is a four carbon compound. Kaul et al. 6700 BC (RSA, 2010). Amaranth is considered one of the (1996) observed that increased efficiency of amaranth to most commonly produced and consumed indigenous vege- use CO2 under a wide range of both temperature and mois- tables on the African continent (Grubben and Denton, ture stress environments could be as a result of its anatomi- 2004). According to Olorode (1984), Amaranthus cruentus cal features and C4 metabolism and this contributes to the L. is a leafy vegetable commonly cultivated in Nigeria and plant's wide geographic adaptability to diverse environ- other West African countries. Aphane et al. (2003) report- mental conditions. African indigenous vegetables play ed that foods of animal origin which are known to be the significant role in the food security of the under-privileged major source of vitamins and proteins are very expensive in both urban and rural settings (Schippers, 1997). Many for poor households. Wehmeyer and Rose (1983) observed communities use vegetables as source of energy and micro that fruits and vegetables could alternatively play a major nutrients in their diets (Gravetti and Ogle, 2000). Vegeta- role in alleviating problems associated with malnutrition bles are usually picked fresh, used as greens in salads or due to their ability to supply proteins, vitamins, calories blanched, steamed, boiled, fried in oil, and mixed with and othernutrients needed in a balanced diet. Laker (2007) meat, fish, cucurbit seeds, groundnut or palm oil. Cooked

80 M.B. Sokoto and O.I. Johnbosco /Arch. Agr. Environ. Sci., 2 (2): 79-85 (2017) greens can be used as a side dish, in soups or as an ingredi- and Chalamila (2005) reported that the average leaf yields ent in sauce and baby food etc. (Grubben, 2004a, b). Ama- of amaranths in Sub-Saharan Africa are less than 1.2 t h-1, ranth grain if rolled or popped can be used in muesli and in against the potential yield of 32-40 t h-1 (Oluoch et al., granola bars. Grain can also be use for beer production. In 2009). Most of existing cultivars of amaranth in Africa are Africa Amaranth species have been used for medicinal generally much smaller, up to 50 cm, strongly branched purposes. In East and West Africa A. graecizans is used to and prostrate with many flowers and small leaves which manufacture a local salt, where by the plants are dried and creates difficulties during harvest e.g. A. blitum, A. graeci- burned to ashes and used as a substitute for common salt. zans (Maundu and Grubben, 2004). These characteristics In Uganda the leaves are chewed and the liquid swallowed contribute to the problem of low yield which farmers to treat tonsillitis. In Senegal, the leaves are used as an experience in production. anthelmintic (Maundu and Grubben, 2004a, b). According Amaranthus an indigenous vegetable can also become to Lehman (1988), the carbohydrates in Amaranth grain popular with commercial growers if suitable high yielding consist primarily of starch made up of both glutinous and variety and appropriate seed rate is applied to promote the non-glutinous fractions. The unique aspect of Amaranth yield and nutritive value of amaranths. Amaranthus, one of grain starch is that the size of the starch granules are much the cultivated indigenous vegetables has short production smaller than found in other cereal grains. The unique size cycle, high yielding with good nutritional value and low and composition of Amaranth starch suggested that the cost of production. The crop can therefore support farmer’s starch may possess unique gelatinization and freeze / thaw income, In Sub-Saharan Africa; about 20-25% of the popu- characteristics which could be of benefit to the food indus- lation is under-nourished due to poor energy and protein try. Several considerations for the use of Amaranth starch intake. In addition 40% of women in childbearing age are in food preparation of custards, pastes, and salad dressing anemic; while a similar proportion of children under-five have been reported by Singhal and Kulkarni (1990 a, b, c). lack enough nutrients for normal physical development The folic acid in amaranth reduces the risk of neural (IFPRI). Research indicates that the vast majority of yield defects in pregnant women and their newborns (AVRDC, growth in African agriculture to date has been due to im- 2011). Amaranth seed is rich in the two essential amino proved seed varieties and appropriate seed rate, as opposed acids (lysine and methionine) that are not frequently found to technological improvements in cultivation practices or in other grains, Lysine plays a vital role in the treatment other inputs (Evenson, 2004). Improved vegetable produc- and prevention of a disease known as osteoporosis that tivity and resources use efficiency could only be achieved, makes bones prone to fracture (Pisarikova et al., 2005). In when appropriate planting technologies and seed density Nigeria A. blitum is used as medicine against lung disorder are available. Vegetables can be grown all year round and (Grubben, 2004a). Grubben (2004b) stated that, A. can be produced even on marginal soils. Amaranth cruentus is use as medicine in different parts of Africa; in requires 40-50% less moisture than maize and survives Senegal the roots are boiled with honey as a laxative for better than most crops under dry and hot conditions infants; in Ghana the water of macerated plants is used as a because of its extensive root system and use of C4 photo- wash to treat pains in the limbs; in Ethiopia it is used as a synthesis mechanism (Stallknecht et al., 1993). Research tapeworm-expeller; the ash from the stems is used as a indicates that the vast majority of yield growth in African wound dressing in Sudan and in Gabon heated leaves were agriculture to date has been due to improved seed varieties used on tumours. and appropriate seed rate, as opposed to technological Patel et al. (2011) reported significant interaction amongst improvements in cultivation practices or other inputs the genotype, row spacing and seed rate on growth and (Evenson, 2004). Most of the important indigenous vegeta- yield of amaranth fodder. According to Rai and Yadav bles including Amaranthus have been identified as having (2005) the seed rate per hectare is between 2 kg to 3 kg. potential for commercial exploitation and production for However for cultivation of Amaranth for grain purpose, human consumption (Taylor and Moss, 1982). Most indig- 1.5 kg seed will be sufficient for a hectare area, because it enous plants are adapted to the prevailing conditions and is sown at wider spacing. Planting Amaranth on narrow require few agricultural inputs and perform well in areas row spacing of 18 cm or less may aid in weed control, by unsuitable for introduced vegetables (Aphane et al., 2003). the shading effect of the amaranth plants (Stallknecht et The objectives of the study are to determine the variety for al., 1990). Esechie (1992) observed that the difference in optimum yield under Sokoto condition and also determine response of plant height to seed rate might be attributed to the appropriate seed rate for optimum yield of Amaranth. the levels of seed rates and condition under which the crop is grown. Since higher densities contain more plants per MATERIALS AND METHODS unit area, dry matter yield per unit area increased with Experimental site: Field experiment was conducted dur- increasing plant density). Gasim (2001) reported that plant ing the year 2016 in the raining season at the Teaching and height increased with increase in seed rate, and number of Research Vegetable garden of the Department of Crop leaves per plant was significantly affected by seed rate. Science, Faculty of Agriculture, Usmanu Danfodiyo Amaranth is considered as underutilized crop and has, until University. Sokoto is located on latitude 13o1’North and recently, received little research attention (NRC, 1984). longitude 5o15’East and altitude of about 350m above the Low crop productivity is a general problem facing most sea level in Sudan Savannah Agroecological Zone of farming systems in Sub-Saharan Africa (SSA). Mabulu Nigeria. The climate of the area is semi-arid with mean

M.B. Sokoto and O.I. Johnbosco /Arch. Agr. Environ. Sci., 2 (2): 79-85 (2017) 81 annual rainfall of 645mm and the temperature ranges from Data analysis: The data collected was subjected to 15o-40oc, Sokoto Energy Research Centre (SERC, 2016). analysis of variance (ANOVA) (Muhammed, 2012; Prior to planting, a composite sample of soil was collected Omary, 2013; Abubakar, 2015), where treatments are from 10 randomly selected points within the experimental significant Duncan’s New Multiple Range Test (DNMRT) site at a depth of 0-30cm using auger. The sample was was used for mean separation. bulked, air-dried and sieved by using 2mm sieve. The bulked sample was used for physico-chemical analysis of RESULTS AND DISCUSSION the soil. Treatment consisted of factorial combination four Physical and chemical properties of soil: The result seed rate (2.0Kg ha-1, 2.5Kg ha-1, 3.0Kg ha-1, and 3.5Kg ha recorded on soil physical and chemical characters are -1) and two varieties (Ex-Egypt (DAN EGYPT) and Ex- presented in Table 1. Based on the results of the analysis, Kano "DAN KANO”) laid out in a randomized complete the soil is sandy loam in texture, low in exchangeable block design replicated three times. Gross plot measuring cations, nitrogen and organic carbon. 2m x 2m (4m2), while the net plot was 1.2m2. Effect of seed rate on plant height: The effect of seed rate on plant height of Amaranths is presented in Table 2. Characteristics of the varieties The result indicated that seed rate had no significant effect Ex-Egypt (DAN EGYPT): Colour of seed is cream; Na- in plant height of amaranths at 2 WAP. However, at 4, 6 tive of Egypt; Leaf is alternate and broad, ready for harvest and 8 WAP, seed rate significantly affected plant height. between 21-28 days after planting. Seed rate of 3.0kg ha-1 resulted to significantly taller plants Ex-Kano (DAN KANO): Colour of seed is black; Native which did not differ significantly from 3.5kg ha-1 and 2.5kg of Kano state; Nigeria, Leaf is alternate and narrow; ready ha-1. The shortest plant was from 2.0kg ha-1. This could be for harvest between 28-35 days after planting. as results of competition for light at higher seeds rates. Cultivation practices: The experimental site was Seed rate of 2 kg ha-1 recorded the shortest plant height ploughed, harrowed and gross plot measuring 2m x 2m which could be as a result of reduced canopy spread which (4m2) prepared. The seeds of two varieties viz., Ex-Egypt could affect light interception increasing rate of evapotran- (‘‘DAN EGYPT) and Ex-Kano "DAN KANO’’of amaranth spiration and also competition between individual plants were obtained from Sokoto Vegetable market [Kasuwa for space and resources in Seed rate of 3.5 kg/ha at a high- Dan Kure]. The seeds of the different seed rates were er seed rate which results to higher plant population per planted by drilling method which was spaced at 40cm be- unit area. Stallknecht and Schulz-Schaeffer (1993), report- tween each row and lightly covered with the soil. Recom- ed that individual cultivars can vary in height, dependent mended fertilizer rate of 70 kg N ha-1, 34 kg P ha-1 and 26 upon plant density and available soil moisture. This result kg Kha-1 was applied in two applications, basal and top is consistent with findings of Gasim (2001), who reported dressing at three weeks after planting. Weeding was done that the effect of seed rate on plant height per plant using hoe. First weeding was carried out at two weeks after increased with increase in seed rate of Teff grass. sowing and second weeding at 4 weeks after sowing. Effect of variety on plant height: The effect of variety on Harvesting was done by uprooting the whole plant at 8 plant height of amaranths is presented in Table 2. The weeks after planting (WAP). result revealed that variety had no significant (p>0.05) Data collection: Data was collected on growth and yield effect on plant height at 2, 4, 6 and 8 WAP. parameters as per Omary (2013); Abubakar (2015). Effect of seed rate and variety on number of leaves: The Plant Height (cm): A meter rule was used to take the effect of seed rate and variety on number of leaves is height of four (4) tagged plants in each experimental unit shown in Table 3. The main effect of seed rate, variety and at 2, 4, 6 and 8 weeks after planting, and the mean was their interaction had no significant effect on number of calculated and recorded. The height was measured from leaves of amaranths at 2, 4, 6, and 8 WAP. the ground level to the tip of the plant following (Omary, Effect of seed rate and variety on leaf area at harvest: 2013; Abubakar, 2015). Leaf area of Amaranths as affected by seed rates, variety Number of leaves: Leaves of four (4) tagged plants were and their interaction during the 2016 rainy season is counted in each experimental unit at 2, 4, 6 and 8 weeks presented in Table 4. The result showed that seed rate, after planting, and the mean determined. Only fully opened variety and their interaction had no significant effect on leaves were counted. leaf area at harvest. Leaf area: The length and width multiplied by a constant Fresh weight at harvest: Fresh weight of Amaranths as (6.6) of the four (4) tagged plants in each experimental unit affected by seed rates, variety and their interaction during was used to obtain this parameter, the mean was calculated the 2016 rainy season is presented in Tables 4 and 5. and recorded. Effect of seed rate and variety on fresh weight of L x W x 6.6 = LA (Muhammed, 2012) amaranths: The result showed that seed rate has signifi- Fresh weight of the plant (kg ha-1): The whole plant in cant effect on fresh weight of amaranths at harvest. Seed the net plots after been uprooted and root washed was rate of 2.5kg ha-13.0kg ha-1 and 3.5kg ha-1 did not differ weighed, and then extrapolated to per hectare. significantly with the highest fresh yield, while seed rate of Dry weight of the plant (kg ha-1): The separated parts of 2.0kg ha-1 recording the lowest yield. This may be due to the leaves and the stems were then sun dried for a week (7 low seed rate resulted in lower fresh yield as a results of days) and weighed to determine the dry matter of the net fewer number of stands/plants as compared to the higher plot and then extrapolated to per hectare. seed rate which produce more/higher number of plants.

82 M.B. Sokoto and O.I. Johnbosco /Arch. Agr. Environ. Sci., 2 (2): 79-85 (2017) This may be attributed to fact that low seed rate produced rates, variety and their interaction during the 2016 rainy low number of plants per unit area. The result is in agree- season is presented in Table 4. ment with the results of Mwai et al. (2009) that Amaranths Effect of seed rate and variety: The result showed that total leaf fresh and dry mass increased with an increase in seed rate has significant effect on fresh weight of amaranths plant densities. The result also showed that there was no at harvest. Seed rate of 2.5kg ha-1 3.0kg ha-1 and 3.5kg ha-1 significant difference `as regard to the effect of variety on did not differ significantly with the highest fresh yield, fresh weight at harvest. while seed rate of 2.0kg ha-1 recording the lowest yield. The The result shows that the interaction between seed rate and result indicated that a higher yield was produced with high variety has significant effect on fresh weight of amaranths seed rate. This may be due to low seed rate resulted in lower at harvest. Seed rate of 2.5kg ha-1 3.0kg ha-1 and 3.5kg ha-1 fresh and dry yield compared to the higher seed rate. This did not differ significantly with the highest fresh yield, may be attributed to fact that low seed rate produced low while seed rate of 2.0kg ha-1 recording the lowest yield number of plants per unit area. Although this was not true across each of the variety. The result is in conformity with for seed of 3.5kg ha-1 which did not produce a high yield the results Patel et al. (2011) who reported interaction with high seed rate which may be due to high competition amongst the genotype, method of planting and seed rate on between plants for soil and aerial resources. The main effect growth and yield of amaranths. of seed rate, variety and their interaction had no significant Dry weight: Dry weight of Amaranths as affected by seed effect on dry weight of amaranths at 2, 4, 6, and 8 WAP.

Table 1. Physical and chemical characteristics of the soil.

Particle distribution (g/kg) Value Sand (%) 45.63 Clay (%) 9.53 Silt (%) 44.83 Texture Sandy loam Chemical properties Soil Ph 5.50 Organic Carbon (%) 0.41 Total Nitrogen (%) 0.73 Available Phosphorus (mg/kg) 0.51 Cation Exchange Capacity (CEC) 2.20 Exchangeable Bases (Cmol/kg) Calcium (Ca2+) 0.41 Potassium (K+) 0.23 Magnesium (Mg2+) 0.15 Sodium (Na+) 0.52

Table 2. Effect of seed rate, variety and their interaction on plant height of Amaranths at Sokoto during the 2016 rainy season.

Treatment Plant height (cm) Weeks after planting Seed rate (Kg ha-1) 2 4 6 8 2.0 13.04 32.84b 49.73b 93.42b 2.5 11.51 36.96a 56.98a 91.77b 3.0 14.87 37.01a 57.86a 98.02a 3.5 11.32 35.83a 53.69a 97.86a SE± 0.957 2.579 3.554 3.639 Significance NS * * * Variety Ex-Egypt 13.85 38.32 57.75 97.41 Ex- Kano 11.52 32.99 50.88 90.63 SE± 0.231 0.312 0.331 0.363 Interaction SR × V NS NS NS NS Mean with the same superscript letter in a column are not significantly different (p<0.05) according to Duncan’s New Multiples Range Test; Ns = not significant, * = significant at 5%.

M.B. Sokoto and O.I. Johnbosco /Arch. Agr. Environ. Sci., 2 (2): 79-85 (2017) 83 Table 3. Effect of seed rate, variety and their interaction on number of leaves of Amaranths at Sokoto during the rainy season of the year 2016.

Treatments Number of leaves Weeks after planting Seed Rate (Kg ha-1) 2 4 6 8 2.0 8.06 12.46 20.42 33.04 2.5 8.03 12.00 18.88 29.63 3.0 8.09 11.38 19.42 32.44 3.5 8.08 13.50 19.71 28.89 SE± 0.310 0.360 0.676 1.405 Significance NS NS NS NS Mean with the same superscript letter in a column are not significantly different (p<0.05) according to Duncan’s New Multiples Range Test; Ns = not significant, * = significant at 5%.

Table 4. Effect of seed rate, variety and their interaction on leaf at harvest, Fresh weight at harvest (kg ha-1) and Dry weight (kg ha-1) of Amaranths in Sokoto during the rainy season of the year 2016. Treatments Leaf area at harvest Fresh weight at harvest (kg ha-1) Dry weight (kg ha-1) Seed Rate (Kg ha-1) 2.0 0.08 14166.67b 3194.50b 2.5 0.07 20555.50a 4722.33a 3.0 0.08 20566.83a 4305.50a 3.5 0.14 20545.67a 4305.50a SE± 0.543 0.500 0.476 Significance NS * * Variety Ex-Egypt 0.08 21041.75 4652.83 Ex-Kano 0.19 21005.58 4651.08 SE± 0.432 0.072 0.139 Significance NS NS NS Interaction SR × V NS NS NS Mean with the same superscript letter in a column are not significantly different (p<0.05) according to Duncan’s new multiples range test; Ns = not significant, * = significant at 5%. Table 5. Effect of interaction between seed rate and variety on fresh weight of Amaranths at harvest at Sokoto during the rainy season of the year 2016.

Variety

Seed rate (Kg ha-1) Dan Egypt Dan Kano

2.0 15277.67b 13055.67b 2.5 23611.0a 17500.00a 3.0 21667.00a 16666.67a 3.5 23611.33a 20000.00a SE± 1.404 1.400 Significance * * Mean with the same superscript letter in a column are not significantly different (p<0.05) according to Duncan’s new multiples range test; Ns = not significant, * = significant at 5%.

84 M.B. Sokoto and O.I. Johnbosco /Arch. Agr. Environ. Sci., 2 (2): 79-85 (2017) Conclusions genotypes for grain and fodder use in Central Europe. Die Bodenkultur, 47 (3): 173-181. -1 The research indicated that seed rate at 2.5 kg ha and any Lehman, J. (1988). Carbohydrates of amaranth. Legacy 1: 4-8 of the two varieties, Ex-Egypt (DAN EGYPT) or Ex-Kano (America Amaranth Institute Bricelyn, MN). (DAN KANO) can result in higher growth and yield of Laker, M.C. (2007). Introduction to the special edition of Water amaranths and would be beneficial for the farmers in SA on indigenous crops, water and human nutrition. Water Sokoto State and areas with similar environmental SA, 33 (3): 311-315. conditions. Farmers in this part of the world considered Olorode, O. (1984). Taxonomy of West African Flowing Plants. amaranths as a minor crop, most of the time the farmers do Longman Group Ltd., London, UK, pp: 158. not consider seed rate while planting and this result in sub NRC (1984). Amaranth: modern prospects for an ancient crop.National Research Council. National Academy Press, optimum plant population, the finding will help farmers in Washington, D.C. selection of optimum seed rate for optimum plant popula- Mabulu, R.B. and Chalamila, B.N. (2005). Organic vegetable tion and also varietals selection. production an alternative income generating activity to Open Access: This is open access article distributed under the disease effected coconut farming system in Mkuranga District in Tanzania. African crop science conference the terms of the Creative Commons Attribution License, proceedings, Vol. 7. pp: 1539-1544. which permits unrestricted use, distribution, and reproduc- Maundu, P.M. and Grubben, G.J.H. (2004). Amaranthus graeci- tion in any medium, provided the original author(s) and the zans L. In: Grubben, G.J.H. and Denton, O.A. (Eds). source are credited. PROTA2.Vegetables/Legumes [CD-Rom]. PROTA, Wageningen, Netherlands. REFERENCES Muhammed, J. (2012). Productivity of amaranths (Amaranthus Abubakar, M.J.D. (2015). Effect of different soil amendment spp) as influenced by water stress and pot size in Sokoto rates (chicken manure and NPK fertilizer 15-15-15) on the Sudan Savannah Nigeria. A BSc project, Crop Science growth and yield of vegetable amaranth (Amaranthus Department, Usmanu Danfodiyo University, Sokoto, pp: 14. hybridus) University for development studies, tamale. Mwai, G.N., Onyango, M.O.A., Onyango, J.C., Chadha, M.L. Dissertation submitted to the Department of Horticulture, and Oluoch, M.O. (2009). Effect of plant density on yield Faculty of Agriculture, University for development studies, component of nightshade. Acta Horticulture, 806: 733-739. in partial fulfillment of the requirements for the award of Olorode O. (1984). Taxonomy of West African Flowing Plants. masters of philosophy degree in horticulture. pp: 139. Longman Group Ltd., London, UK, pp. 158. Aphane, J., Chadha M.L. and Oluoch M.O. (2003). Increasing Oluoch, M.O., Pichop G.N., Silue D., Abukutsa-Onyango M,O., the consumption of micronutrient-rich foods through Diouf, M.and Shackleton, C.M. (2009). Production and ha production of indigenous foods. In: FAO / AVRDC Interna- vesting systems for african indigenous vegetable. In: Lich tional Workshop Proceedings, 5 - 8 March 2002, Arusha, fouse, E., Hamelin, M., Nararrete, M. and Debaeke, P. Tanzania. AVRDC - The World Vegetable Centre Shanua, (Eds.): Sustainable Agriculture volume 2. London. EDP Taiwan: AVRDC Publication No. 03 - 561: pp: 1-77. Sciences. Ch. V. AVRDC (2011). New variety releases expand market options for Omary, I.M. (2013). Morphological characteristics, growth and Tanzania’s farmers. Fresh news from AVRDC-The World yield of elite grain and leaf amaranth in northern Tanzania. vegetable center pp: 1-3. Master of Science (research methods). A dissertation Esechie, H.A. (1992). Effect of planting density on growth and submitted in partial fulfillment of the requirements for the yield of irrigated maize in the Batina Costa Region of Oman. degree of Master of Science in research methods in the Jomo Journal of Agricultural Science, 119: 165-169. Kenyatta University of Agriculture and Technology Jomo Evenson, R.E. (2004). Making science and technology work for Kenyata University of Agriculture and Technology. pp: 84. the poor. In: Baidu-Forson, J.J (Ed) Green and Gene Patel, P.A., Smitha, S.C., Alagundagi, C.P., Mansur, V.S., Revolution in Africa. Annual Lectures 2003 sponsored by Kubsad, S.V., Hosamani and Megeri, S.N. (2011). Effect of UNU-INRA and UN ECA, October 2003, pp: 203. row spacing and seed rate on growth, fodder productivity Gasim, S.A. (2001). Effect of nitrogen, phosphorus and seed rate and economics of amaranth genotypes. Karnataka Journal on growth, yield and quality of forage maize (Zea mays). of Agricultural Science, 24 (5): 651-653. MSc Thesis, Faculty of Agriculture, University of Pisarikova, B., Zraly, Z., Kracmar, S., Trckova, M. and Herzig, I. Khartoum. (2005). Nutritive value of amaranth grain (AmaranthusL.) in Gravetti, L.E. and Ogle, M.B. (2000).Value of traditional foods the diets for broiler chickens. Czech Journal of Animal in meeting macro and micronutrient needs: The While Plant Science, 50: 568-573. Connection. Nutrition Research Reviews, 13 (1): 31-46. Rai, N. and Yadav, D.S. (2005). Advances in Vegetable Produc- Grubben, G.J.H. (2004a). Amaranthus blitum L. In: Grubben, tion. Published by Research co Book Center 25-B/2, New G.J.H. and Denton, O.A. (Eds.), PROTA 2. Vegetables/ Rohtak Road Karol Bagh, New Delhi-110005 India, pp: 550 L`egumes [CD-Rom].PROTA, Wageningen, Netherlands, -558. pp: 74-83. RSA. Republic of South Africa (2010). Amaranthus: Production Grubben, G.J.H. (2004b). Amaranthus cruentus L. In: Grubben, guideline. Department of Agriculture, Forestry and G.J.H. and Denton, O.A. (Eds.), PROTA 2. Vegetables/ Fisheries. Pretoria L`egumes [CD-Rom]. PROTA, Wageningen, Netherlands, Schippers, R. (1997). Domestication of indigenous vegetables for pp: 205-213. Sub-Saharan Africa: A strategy paper. African indigenous Grubben, G.J.H. and Denton, O.A., (Eds.) (2004). Plant Genetic vegetables, Workshop Proceedings, January 13-18, 1997, Resources of Tropical Africa 2: Vegetable. Wageningen, Limbe, Cameroon, pp: 125-135. Netherlands: PROTA Foundation. Singhal R.S. and Kulkarni P.R. (1990a). Some properties of Kaul, H.P., Aufhammer, W., Laible B., Nalborczyk, E., Pirog, S. Amaranthus paniculatas (Rajgeera) starch pastes. Starch/ and Wasiak, K. (1996). The suitability of amaranth Starke, 42: 5-7.

M.B. Sokoto and O.I. Johnbosco /Arch. Agr. Environ. Sci., 2 (2): 79-85 (2017) 85 Singhal R.S. and Kulkarni P.R. (1990b). Utilization of Amaran- Conference, Minneapolis, MN Aug 23 - 25. thus paniculatas (Rajgeera) starch in salad dressing. Starch / Stallknecht, G.F. and Schulz-Schaeffer, J.R. (1993). Amaranth Starke 42: 52-53. rediscovered. pp: 211-218. In: J. Janick and J.E. Simon Singhal R.S. and Kulkarni P.R. (1990c). Studies on applicability (eds.). New crops.Wiley, New York. of Amaranthus paniculatas (Rajgeeraa) starch for custard Taylor, F.K. and Moss, H. (1982).The potential for commercial preparation. Starch / Starke 42: 102- 03. utilization of veld products in Botswana.Veld Products SERC, Sokoto Enegy Research Center (2016). Meteorological Institute, Gaborone. data: Usmanu Danfodiyo University, Sokoto, Nigeria. Wehmeyer, A.S. and Rose, E.F. (1983). Important indigenous Stallknecht G.F., Duffus J.E. and Schaeffer J. (1990). Curly top plants in the Transkei as food supplements. Bothalia, 14: virus in grain amaranth. Post Paper. Fourth U.S. Amaranth 613 - 615.

Archives of Agriculture and Environmental Science 2 (2): 86-91 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Effects of integrated nutrient management on agronomical attributes of tomato (Lycopersicon esculentum L.) under field conditions

A. K. Chopra3, Temin Payum1, Sachin Srivastava2 and Vinod Kumar3* 1Department of Botany, Jawaharlal Nehru College, Pasighat-791103 (Arunachal Pradesh), INDIA 2Department of Agriculture and Forestry, Uttaranchal College of Science and Technology, Dehradun-248001 (Uttarakhand), INDIA 3Department of Zoology and Environmental Science, Gurukula Kangri University, Haridwar-249404 (Uttarakhand), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 20 March 2017 In this investigation the effects of different integrated nutrient management on agronomical attrib- Revised received: 10 April 2017 utes of tomato (Lycopersicon esculentum L. cv. F1 Hybrid Arka Rakshak) under field conditions Accepted: 10 May 2017 were investigated. Ten nutrients treatments viz., without nutrient (control) (T1), recommended dose -1 of fertilizer (RDF) (T2), agro residue vermicompost (ARV) @ 5 t ha (T3), sugarcane pressmud Keywords -1 -1 compost (SPC) @ 5 t ha (T4), cattle dung compost (CDC) @ 12.5 t ha (T5), sewage sludge (SS) -1 -1 -1 Agro residue vermicompost @ 2 t ha (T6), T7 (50 % RDF + ARV @ 5 t ha ), T8 (50 % RDF + SPC @ 5 t ha ), T9 (50 % -1 -1 Cattle dung compost RDF + CDC @ 12.5 t ha ) and T10 (50% RDF + SS @ 2 t ha ) were used for the cultivation of L. Lycopersicon esculentum esculentum. The results showed that different treatments showed significant (P<0.05/P<0.01) 3- + + 2+ 2+ Recommended dose of fertilizer change in EC, OC, TKN, PO4 , Na , K , Ca , Mg , Cd, Cr, Cu, Fe, Mn and Zn of the soil. Among Sewage sludge various treatments the most plant height, root length, dry weight, chlorophyll content, LAI, number Sugarcane pressmud compost of flowers/plant, fruits/plant, crop yield/plant, and biochemical ingredient like crude protein, dietary fiber, total carbohydrates and total sugar of L. esculentum was recorded with 50% RDF + ARV @ 5 -1 t ha . The agronomical performance of L. esculentum was recorded in the order of T7 > T10 > T9 > T8 > T3 > T6 > T5 > T4 > T2 > T1 treatments. Thus, sole ARV and 50% RDF along with ARV @ 5 t ha-1 can be used to achieve the maximum crop yield of L. esculentum. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Chopra, A.K., Temin, P., Srivastava, S. and Kumar, V. (2017). Effects of integrated nutrient management on agronomical attributes of tomato (Lycopersicon esculentum L.) under field conditions. Archives of Agriculture and Environmental Science, 2(2): 86-91. INTRODUCTION productivity (Praharaj and Rajendran, 2007; Spurti et al., The use of integrated nutrient management concerned to 2015). the protection of soil productiveness and to provide these Organic fertilizers hold comparatively low concentrations nutrients to the cultivated plants at an most favorable level of nutrients in contrast to chemical one, but they perform for sustaining the desired yield through optimization of the significant functions which the chemical fertilizers do not benefits from all probable sources of organic, inorganic do (Jeyajothi and Nalliah, 2015). The addition of organic and biological ingredients in an integrated way (Prabhakar fertilizers and their appropriate administration can be et al., 2007; Sujatha et al., 2008; Tetarwal et al., 2011). decreased the need for chemical fertilizers thus allowing Soil’s potential to generate agricultural crops is principally the small farmers to save in the part the price of manufac- determined by the environment that the soil provides for ture. Additionally, the discharge of inorganic fertilizers root growth. Roots absorb air, water, nutrients, and plenty compared to organic one is higher. As a result, available space in which they develop (Shanwad et al., 2010). Soil nutrients are utilized and lost rapidly by different means. properties, such as the capability to hold up water, acidity, Alternatively, organic fertilizers were decomposed gradu- depth, and density determine how well roots development. ally and nutrients are accessible for longer period of time Alteration in these soil characteristics unswervingly affects which helps to preserve soil nutrient status (Praharaj and the health of the plant. For example, bulk density, a deter- Rajendran, 2007; Tetarwal et al., 2011). mination of the compactness of a soil, affects agricultural The growth of crop plants is the result of a complex

87 Chopra et al. /Arch. Agr. Environ. Sci., 2 (2): 86-91 (2017) process whereby the crop plants synthesizes sun power, MATERIALS AND METHODS carbon dioxide, water, and nutrients from the soil. In all, between 21 and 24 elements are necessary for plant growth Experimental design: The field experiments were (Kalhapure et al., 2013). The primary nutrients for plant conducted in the Experimental Garden of the Department growth are nitrogen, phosphorus, and potassium (NPK). of Zoology and Environmental Sciences, Gurukula Kangri University Haridwar, India (29o55'10.81'' N and Whilst inadequate, these primary nutrients are mainly ac- o countable for limiting crop development (Antil and Singh, 78 07'08.12'' E) during the year 2013 and 2014. For the cultivation of L. esculentum, ten plots (each plot had an 2007; Pandey and Chandra, 2013). Nitrogen, the most in- 2 tensively used element, is accessible in almost infinite area of 9× 9m ) were selected for the ten treatments viz., quantities in the atmosphere and is repeatedly recycled without nutrient (control) (T1), recommended dose of fertilizer (RDF) (T2), agro residue vermicompost (ARV) @ 5 t among plants, soil, water, and air. However, it is often una- -1 -1 ha (T3), sugarcane pressmud compost (SPC) @ 5 t ha vailable in the right form for proper absorption and synthe- -1 (T4), cattle dung compost (CDC) @ 12.5 t ha (T5), sew- sis by the plant (Togay et al., 2008). -1 age sludge (SS) @ 2 t ha (T6), T7 (50 % RDF + ARV @ As a vegetable tomato (Lycopersicon esculentum) is the -1 -1 5 t ha ), T8 (50 % RDF + SPC @ 5 t ha ), T9 (50 % RDF most essential vegetable crops for human nutrition in most -1 -1 countries (Javaria and Khan, 2010; Pandey and Chandra, + CDC @ 12.5 t ha ) and T10 (50 % RDF + SS @ 2 t ha ) 2013). Tomato is one of the vital vegetable crops cultivat- (Table 1). All the treatments were placed within random- ed in India. Among the major contributing states Andhra ized complete block design. Pradesh, Uttarakhand, Orissa, Karnataka, Madhya Pradesh, Preparation of nursery and transplantation of L. West Bengal, Uttar Pradesh, Bihar and Maharashtra the esculentum: Seeds of a high yield variety of L. esculen- average productivity is highest in (35 t/ha) mostly due to tum, cv. F1 Hybrid Arka Rakshak, were procured from the favorable environmental conditions and adoption of Indian Council of Agriculture Research (ICAR), Pusa, high yielding hybrids. However, India yet to attain the New Delhi, and sterilized with 0.01% Thiram. The nursery yield potential (80-120 t/ha) due to low adoption of was prepared before one month of transplantation of L. hybrids and incidence of pests, diseases and other abiotic esculentum. For the nursery preparation 0.6 g seeds of L. factors (Pandey and Chandra, 2013). esculentum were sown in the nursery beds (farm yard The dearth of plant nutrients causes different alteration in manure mixed soil). The bed for nursery preparation was the physiological and biochemical processes within the covered with mulch of wheat straw till the germination of plant cell resulting in a reduction of growth, delay of seeds. The plants were watered as per requirement and development and qualitative and quantitative decrease of other agronomical practices like weeds removal and yield (Saxena and Diwakar, 2012). The organic sources hoeing for soil preparation were performed till the plants besides supplying N, P and K also formulate unavailable were transplanted in the field. Four weeks old plants of L. basis of elemental nitrogen, bound phosphorus, and other esculentum were transplanted in 6 rows with a distance of micronutrients, and decomposed plant residues into an 60×60 cm between plants (Chopra and Kanwar, 1976; obtainable form to make possible to plant to take up the Saxena and Diwakar, 2012). The plants in each plot were nutrients. But, it is also the fact that most favorable yield irrigated twice in a month with 100 gallons of bore well of maize yield can not be achieved by using only organic water and necessary agronomical practices were manures due to their low nutrient content (Nehra and performed. Hooda, 2002; Islam et al., 2012). The usefulness of organ- Study of crop parameters: The agronomic parameters of ic sources to meet the nutrient requisite of crop is not as L. esculentum at different stages (0-110 days) were deter- assured as mineral fertilizers, but the joint employ of mined following standard methods for plant height, root chemical fertilizers along with various organic sources is length, number of flowers and crop yield (Saxena and capable of improving soil quality and higher crop produc- Diwakar, 2012); dry weight was estimated as per method tivity on long- term basis (Islam et al., 2012). Highest of Denison and Russotti, 1997; chlorophyll content was productivity of crops in sustainable manner with no wors- determined by Porra, 2002 and leaf area index (LAI) was ening the soil and other natural resources could be measured by following Milner and Hughes (1968). The achieved only by applying proper amalgamation of differ- biochemical parameters like crude protein, dietary fiber, ent organic manures and inorganic fertilizers total carbohydrate and total sugar in L. esculentum were (Chandrashekara et al., 2000; Das et al., 2004; Chopra et determined following standard methods (Cerning and al., 2012). It is important to identify the appropriate type of Guilhot, 1973; Chaturvedi and Sankar, 2006). available organic resources which can be used as fertilizers Soil and heavy metals analysis: The soil was analyzed and their best combination with appropriate proportion of after harvest of L. esculentum for various physico-chemical 3- + + 2+ inorganic fertilizer (Venugopalan and Pundarikakshudu, parameters like EC, pH, OC, TKN, PO4 , Na , K , Ca , 1999; Rochester et al., 2001; Basavaneppa and Biradar, Mg2+, Cd, Cr, Cu, Fe, Mn and Zn following standard meth- 2002; Hepperly et al., 2009; Pandey and Chandra, 2013). ods (Jackson, 1973; Chaturvedi and Sankar, 2006). For Keeping in view, this experimental trail was carried out to heavy metals analysis 1.0 g of air dried soil or plants were study the effects of integrated nutrient management on taken in digestion tubes separately. For each sample 3 ml agronomical attributes of tomato (Lycopersicon of concentrate HNO3 was added and digested in an electri- esculentum L.) under field conditions. cally heated block for 1 hour at 145oC. To this mixture 4

Chopra et al. /Arch. Agr. Environ. Sci., 2 (2): 86-91 (2017) 88

o ml of HClO4 was added and heated to 240 C for 1 hour. Effects of integrated nutrients on agronomical charac- The mixture was cooled and it was filtered using the filter teristics of L. esculentum: The mean values of agronomi- paper Whatman # 42. The volume was made to 50 ml by cal parameters of L. esculentum cultivated with different adding double distilled water and used for analysis. Metals treatments are shown in Table 3. The most values of plant were analyzed using an atomic absorption spectrophotome- height (125.40 and 145.86 cm), root length (16.20 and ter (PerkinElmer, Analyst 800 AAS, GenTech Scientific 18.90 cm), dry weight (78.90 and 94.50g), chlorophyll Inc., Arcade, NY) following methods (Chaturvedi and content (4.50 and 4.68 mg/gfwt), LAI (4.78 and 4.84), Sankar, 2006). number of flowers/plant (45.78 and 50.53), fruits/plant Data analysis: Data were statistically analyzed using (38.21 and 45.12), crop yield/plant (4680.20 5680.88 g) of Origin (ver. 6.1). Data were subjected to one-way analysis L. esculentum were recorded with sole ARV (T3) and 50% -1 of variance (ANOVA). The means of the values were RDF along with ARV @ 5 t ha (T7), respectively and it is calculated with Microsoft Excel (ver. 2013, Microsoft likely due to the presence of optimum contents of various Redmond Campus, Redmond, WA) and graphs were nutrients required by L. esculentum. The agronomical prepared through Sigma plot (ver. 12.3, Systat Software, performance of L. esculentum was recorded in the order of Inc., Chicago, IL). T7 > T10 > T9 > T8 > T3 > T6 > T5 > T4 > T2 > T1 treatments (Table 3). Thimma Naik (2006) also reported that mixture RESULTS AND DISCUSSION of different organic fertilizers as 50% farm yard manure, Effects of integrated nutrients on soil characteristics: 50% poultry manure, 50% vermicompost, 50% poultry The physico-chemical characteristics of soil after harvest manure, 50% neem cake and poultry [email protected] t ha-1 to of L. esculentum with different treatments are presented in fertilize the chilli crop significantly increased number of Table 2. The results indicated that the treatments showed branches per plant and plant height, leaf area. The findings 3 significant (P<0.05/P<0.01) change in EC, OC, TKN, PO4 are also in the conformity with Sable et al. (2007) who -, Na+, K+, Ca2+, Mg2+, Cd, Cr, Cu, Fe, Mn and Zn of the reported higher number of branches and fruit yield with the soil. Among various treatments the most values of EC combination of 50% nitrogen by adding neem cake and (1.12 dS m-1), OC (24.85 mg Kg-1), TKN (245.90 mg Kg- 50% nitrogen by applying vermicompost. Moreover, 1 3- -1 + -1 + ), PO4 (64.30 mg Kg ), Na (68.25 mg Kg ), K (140.34 vermicompost moreover as a rich supply of micronutrients mg Kg-1), Ca2+ (280.75 mg Kg-1) and Mg2+ (149.23 mg Kg- also acts as chelating agent and regulates the accessibility 1) in the soil were recorded with 50 % RDF + ARV @ 5 t of metallic micronutrients to the plants and enhances the ha-1 treatment (Table 2) and it might be due to the presence plant growth and yield by supplying nutrients in the acces- of more contents of these parameters in ARV. The most sible form and based on crop requirement. The use of contents of Cd (1.54 mg Kg-1), Cr (1.13 mg Kg-1), Cu (1.83 organics viz., farm yard manure at the rate of 10 t ha -1 mg Kg-1), Fe (2.88 mg Kg-1), Mn (1.84 mg Kg-1) and Zn resulted in higher fruit yield and uptake of nutrients like N, -1 (3.55 mg Kg ) of the soil were observed with treatment T6 P, K, Ca, Mg, S and Fe over RDF alone (Kattimani, 2004). i.e. sewage sludge (SS) (Figure 1). The higher contents of Effects of integrated nutrients on biochemical charac- heavy metals in the soil after treatment with T6 might be teristics of L. esculentum: The mean values of biochemi- due to the presence of more contents of heavy metals in cal parameters of L. esculentum cultivated with different sewage sludge. Patil et al. (2003) reported that use of FYM treatments are shown in Figure 2. During the present study, in the soil reduced soil pH from 7.99 to 7.65 with each the most values of crude protein (1.05 g/100g), dietary dose of FYM, the soil pH changed appreciably due to fiber (1.36 g/100g), total carbohydrates (4.05 g/100g) and organic generation of acids during its decomposition. total sugar (2.78 g/100g) of L. esculentum was recorded -1 Application of organic manures such as FYM, vermicom- with T7 (i.e. 50 % RDF + ARV @ 5 t ha ). It may be likely post, crop residues improved the soil accessible nitrogen, due to the maximum production of these biochemical phosphorus and potassium as compared to recommended parameters in the occurrence of most favorable uptake of dose of fertilizers (Patil et al., 2003). essential nutrients needed by L. esculentum. Prabakaran

Table 1. Description of various treatments used for the cultivation of tomato (L. esculentum). Treatment Description

T1 Without nutrient (Control)

T2 Recommended dose of fertilizer (RDF) -1 T3 Agro residue vermicompost (ARV)@ 5 t ha -1 T4 Sugarcane pressmud compost (SPC) @ 5 t ha -1 T5 Cattle dung compost (CDC) @ 12.5 t ha -1 T6 Sewage sludge (SS)@ 2 t ha -1 T7 50 % RDF + ARV @ 5 t ha -1 T8 50 % RDF + SPC @ 5 t ha -1 T9 50 % RDF + CDC @ 12.5 t ha -1 T10 50 % RDF + SS @ 2 t ha

89 Chopra et al. /Arch. Agr. Environ. Sci., 2 (2): 86-91 (2017) Table 2. Changes in physico-chemical characteristics of soil used for the cultivation of tomato (L. esculentum) after use of various treatments.

EC OC TKN PO 3- Na+ K+ Ca2+ Mg2+ Treatment pH 4 (dS m-1) (mg Kg -1) (mg Kg -1) (mg Kg -1) (mg Kg -1) (mg Kg -1) (mg Kg -1) (mg Kg -1)

T1 0.35 7.52 10.42 124.50 21.34 23.40 45.00 224.44 34.56

T2 0.45ns 7.65ns 10.35ns 140.30* 21.55ns 34.56ns 50.30ns 230.38ns 36.10ns

T3 0.68* 7.23ns 11.24ns 156.90* 36.86* 42.80* 87.22* 278.90* 45.90ns

T4 0.55* 7.34ns 12.56ns 175.44* 35.36* 50.34* 74.50* 225.66ns 38.00ns

T5 0.76* 7.77ns 13.55ns 220.76* 44.98* 47.20* 80.90* 254.60* 40.84ns

T6 0.52ns 7.84ns 23.87* 208.34* 58.90* 35.90ns 82.66* 230.80ns 36.92ns

T7 1.12** 7.65ns 24.85* 245.90** 64.30** 68.25** 140.34** 280.75* 149.23*

T8 0.88* 7.84ns 14.70ns 234.66** 48.77* 54.23* 110.20** 258.45* 124.50*

T9 0.95* 7.45ns 18.45* 240.20** 50.34* 56.88* 118.90** 268.40* 118.77*

T10 1.04** 7.80ns 16.50* 224.80** 46.90* 58.94* 120.86** 260.25* 112.96* F- 3.02 0.34 3.89 20.18 6.10 8.46 12.80 34.20 10.02 calculated CD 2.34 1.12 2.78 9.45 4.06 3.23 7.54 10.24 5.46 Least square means; *, ** significantly different to the control at P<0.05 and P<0.01 level of ANOVA, respectively; ns-not significant; CD- critical difference.

Table 3. Effects of various treatments on agronomical attributes of tomato (L. esculentum).

Root Chlorophyll Flowers/ Fruits/ Plant height Dry weight LAI Yield/plant Treatment Length content plant plant (cm) (g) (g) (cm) (mg/gfwt)

T1 85.25 10.13 20.37 3.45 4.21 30.20 27.12 3245.90

T2 96.80* 12.87ns 34.78* 3.56ns 4.26ns 34.50ns 29.40ns 3350.60ns

T3 125.40** 16.20ns 78.90** 4.50ns 4.78ns 45.78* 38.21* 4680.20*

T4 110.34* 14.20ns 60.55** 3.66ns 4.35ns 37.10ns 31.20ns 3570.55ns

T5 112.37* 15.88ns 65.87** 3.75ns 4.40ns 38.90ns 32.08ns 3780.90ns

T6 120.70** 14.90ns 72.80** 3.80ns 4.70ns 40.78* 35.26ns 4120.10*

T7 145.86** 18.90* 94.50** 4.68ns 4.84ns 50.23** 45.12* 5680.88*

T8 126.30** 18.25* 78.90** 4.02ns 4.45ns 40.22* 35.40ns 3890.45ns

T9 130.55** 17.34* 82.75** 4.45ns 4.54ns 45.42* 36.22ns 4420.60*

T10 135.88** 18.55* 84.50** 4.52ns 4.77ns 46.15* 38.08ns 4890.75* F-calculated 76.34 10.07 8.27 0.24 0.12 4.35 3.55 110.80 CD 12.34 4.52 3.24 1.23 1.10 3.23 2.56 28.57 Least square means; *, ** significantly different to the control at P<0.05 and P<0.01 level of ANOVA, respectively; ns-not significant; CD- critical difference. and Pichai (2002) reported that the application of recom- (0.18 and 0.15 mg Kg-1), Cu (1.28 and 1.26 mg Kg-1), Fe mended quantity of nitrogen in the form of poultry manure (2.25 and 2.20 mg Kg-1), Mn (0.78 and 0.74 mg Kg-1) and recorded highest pH, total soluble solids, titrable acidity, Zn (2.14 and 2.05 mg Kg-1) in L. esculentum were record- contents of reducing sugar, non-reducing sugar, quantita- ed with T6 (i.e. sewage sludge) and T10 (i.e. 50 % RDF + tive crude protein and ascorbic acid content in tomato fruit. SS @ 2 t ha-1), respectively and it is likely due to the pres- Effects of integrated nutrients on contents of heavy ence of more contents of these metals in the sewage sludge metals in L. esculentum: The mean contents of Cd, Cr, and soil treated with these treatments. Kumar and Chopra Cu, Fe, Mn and Zn in L. esculentum cultivated with differ- (2013) also reported the higher contents of Cd, Cr, Cu, Fe, ent treatments are shown in Figure 3. The results revealed Mn and Zn in French bean (Phaseolus vulgaris L.) amend- that the most contents of Cd (0.35 and 0.32 mg Kg-1), Cr ed with sewage sludge.

Chopra et al. /Arch. Agr. Environ. Sci., 2 (2): 86-91 (2017) 90

Crude protein Dietary fiber 4.5 Cd Cr Cu Fe Mn Zn 5 Total carbohydrate Total sugar 4 4.5

) 4

-1 3.5 3.5 3 3 2.5 2.5 2 2

1.5 (g/100g) Content 1.5

Content of metals (mg Kg Content 1 1

0.5 0.5

0 0 T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 Treatment Treatment Figure 1. Contents of heavy metals in the soil used for the Figure 2. Contents of crude protein, dietary fiber, total carbohy- cultivation of tomato (L. esculentum) after use of various drates and total sugar of tomato (L. esculentum) after use of treatments. Error bars are standard error of the mean. various treatments. Error bars are standard error of the mean.

3 Cd Cr Cu Fe Mn Zn REFERENCES 2.5 Antil, R.S. and Singh M. (2007). Effects of organic manures and fertilizers on organic matter and nutrients sta- 2 tus of the soil. Archives of Agronomy and Soil Science, 53(5): 519-528.

1.5 Basavaneppa, M.A. and Biradar, D.P. (2002). Integrated nutrient management practices on the production of cotton-maize- bengal gram sequence under irrigated ecosystem in Tunga- Content (mg Kg-1) Content 1 bhadra Project area. Journal of Cotton Research and Devel- opment, 16:125-129. 0.5 Cerning, J. and Guilhot, J. (1973) Changes in carbohydrates composition during maturation of wheat and barley kernel. 0 Cereal Chemistry, 50: 220-224. T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 Chandrashekara, C.P., Harlapur, S.I., Murlikrishna, S. and Gi- Treatment rijesh, G.K. (2000). Response of maize (Zea maize L.) to Figure 3. Contents of heavy metals in tomato (L. esculentum) organic manures with inorganic fertilizers. Karnataka after use of various treatments. Error bars are standard error of Journal of Agriculture Science, 13(1): 144-146. the mean. Chaturvedi, R.K. and Sankar, K. (2006). Laboratory manual for the physico-chemical analysis of soil, water and plant. Wild- life Institute of India, Dehradun. Conclusion Chopra, S.L. and Kanwar, J.S. (1976). Analytical Agricultural Chemistry, Kalyani Publishers, New Delhi. The present study concluded that different treatments Chopra, A.K., Srivastava, S., Kumar, V. and Pathak, C. (2012) showed significant (P<0.05/P<0.01) change in EC, OC, 3- + + 2+ 2+ Agro-potentiality of distillery effluent on soil and agronomi- TKN, PO4 , Na , K , Ca , Mg , Cd, Cr, Cu, Fe, Mn and cal characteristics of Abelmoschus esculentus L. (okra). Zn of the soil. The results showed that the most plant Environ. Monit. Assess., DOI 10.1007/s10661-012-3052-8. height, root length, dry weight, chlorophyll content, LAI, Das, A., Prasad, M., Shivay, Y.S. and Subha, K.M. (2004). number of flowers/plant, fruits/plant, crop yield/plant, Productivity and sustainability of cotton (Gossypium hirsu- crude protein, dietary fiber, total carbohydrates and total tum L)-wheat (Triticum aestivum L) cropping system as sugar of L. esculentum was recorded with 50 % RDF + influenced by prilled urea, FYM and Azotobacter. Journal ARV @ 5 t ha-1 in the various applied treatments. The of Agronomy and Crop Science, 190: 298-304. Denison, R.F. and Russotti, R. (1997). Field estimates of green agronomical performance of L. esculentum was recorded in leaf area index using laser-induced chlorophyll fluorescence. the order of T7 > T10 > T9 > T8 > T3 > T6 > T5 > T4 > T2 > Field Crops Research, 52: 143-150. T1 treatments. Therefore, sole ARV and 50% RDF along FAO (1998). Guide to efficient plant nutrient management, -1 with ARV @ 5 t ha can be used to achieve the maximum Rome: Land and Water Development Division, Food and crop yield of L. esculentum. Agricultural Organization of the United Nations. Hepperly Paul, Lotter Don, Ulsh Christine Ziegler, Seidel Rita Open Access: This is open access article distributed under and Reider Carolyn (2009). Compost, manure and synthetic the terms of the Creative Commons Attribution License, fertilizer influences crop yields, soil properties, nitrate which permits unrestricted use, distribution, and reproduc- leaching and crop nutrient content. Compost Science Utiliza- tion in any medium, provided the original author(s) and the tion, 17(2): 117-126. source are credited. Islam, M.R., Sikder, S., Bahadur, M.M. and Hafiz, M.H.R.

91 Chopra et al. /Arch. Agr. Environ. Sci., 2 (2): 86-91 (2017) (2012). Effect of different fertilizer management on soil (2003). Effect of fly ash and FYM on physic-chemical prop- properties and yield of fine rice cultivar. Journal of Environ- erties of vertisols. Journal of Soils and Crops, 13(1): 59-64. mental Science and Natural Resources, 5(1): 239-242. Prabhakar, T. Reddy, Umadevi, M., Rao, P.C. and Bhanumurthy, Jackson, M.L. (1973). In: Soil Chemical Analysis. Prentice Hall of V.B. (2007). Effect of fly ash and farm yard manure on soil India Private Limited, New Delhi, India. enzyme activities and yield of rice grown on an inceptisol. Javaria, S. and Khan, M.Q. (2010). Impact of integrated nutrient Crop Research, 34(1-3): 27-31. management on tomato yield quality and soil environment. Rochester, I.J., Peoples, M. B., Hulugalle, N.R., Gault, R.R. and Journal of Plant Nutrition, 34(1): 140-149. Constable, G.A. (2001). Using legumes to enhance Jeyajothi, R. and Nalliah D.S. (2015). Influence of Integrated nitrogen fertility and improve soil condition in cotton crop- Nutrient management Practice on Yield Attributes, and Eco- ping systems. Field Crops Research, 70: 27-41. nomics of Transplanted Rice (Oryza Sative) in South Zone Sable, C.R., Ghuge, T.D., Jadhav, S.B. and Gore, A.K. (2007). of Tamil Nadu. International Journal for Innovative Impact of organic sources on uptake, quality and availability Research in Science & Technology, 1(11): 2349-6010. of nutrients after harvest of tomato. Journal of Soils and Kalhapure, A.H., Shete, B.T. and Dhonde, M.B. (2013). Integrat- Crops, 17(2): 284-287. ed nutrient management in maize (Zea Mays L.) for increas- Saxena, R. and Diwakar, R. (2012). Biochemical Analysis of ing production with sustainability. International Journal of Chlorophyll Content of Brinjal Leaves. VEGETOS, 25 (2): Agriculture and Food Science Technology, 4(3): 195-206. 83-85 Kattimani, S. (2004). Response of chilli (Capsicum annuum L.) Shanwad, U.K., Aravindkumar, B.N., Hulihalli, U.K., Ashok genotypes to integrated nutrient management. M.Sc(Agri) Surwenshi, Mahadev Reddy and Jalageri, B. R. (2010). Inte- Thesis, University of Agriculture Science, Dharwad, Karna- grated nutrient management (INM) in maize- bengal gram taka, India. cropping system in Northern Karnataka. Research Journal Kumar, V. and Chopra, A.K. (2013). Accumulation and transloca- of Agriculture Science, 1(3): 252-254. tion of metals in soil and different parts of French bean Spurti, M., Malavathu, M., Mainak, G., Dulal, C. Ghosh and (Phaseolus vulgaris L.) amended with sewage sludge. Jagadish, T. (2015). Effect of Integrated Nutrient Manage- Bulletin of Environmental Contamination and Toxicology, ment on Growth and Productivity of Hybrid Rice. Journal of 92 (1): 103-108. Agricultural Science and Technology, 5: 297-308 doi: Milner, C. and Hughes, R.E. (1968). Methods for the measure- 10.17265/2161-6264/2015.05.001. ment of primary production of grassland. IBP Handbook Sujatha, M.G., Lingaraju, B.S., Palled, Y.B. and Ashalatha, K.V. No.6 Blackwell Sci. Pub., Oxford, England. (2008). Importance of integrated nutrient management prac- Nehra, A.S. and Hooda, I.S. (2002). Influence of integrated use of tices in maize under rainfed condition. Karnataka Journal of organic manures and inorganic fertilizers on lentil and mung bean yields and soil properties. Research of Crops, 3(1): 11- Agriculture Science, 21(3): 334-338. 16. Tetarwal, J.P., Baldev Ram and Meena, D.S. (2011). Effect of Pandey, S.K. and Chandra, K.K. (2013). Impact of integrated integrated nutrient management on productivity, profitabil- nutrient management on tomato yield under farmers field ity, nutrient uptake and soil fertility in rainfed maize (Zea conditions. Journal of Environmental Biology, 34: 1047- mays). Indian Journal of Agronomy, 56(4): 373-376. 1051. Thimma Naik, M. (2006). Studies on the effect of organic Patil, P.V., Chalwade, P.B., Solanke, A.S. and Kulkarni, V.K. manures on growth, yield and quality of chilli (Capsicum (2003). Effect of fly ash and FYM on physic-chemical prop- annuum L.) under Northern Transition Zone of Karnataka erties of vertisols. Journal of Soils and Crops, 13(1): 59-64. M.Sc (Agri) Thesis, University of Agriculture Science, Porra, R.J. (2002). The chequered history of the development and Dharwad, Karnataka, India. use of simultaneous equations for the accurate determination Togay, N., Togay, Y. and Doğan, Y. (2008). Effects of municipal of chlorophylls a and b. Photosynthesis Research, 73: 149- sewage sludge doses on the yield, some yield components 156. and heavy metal concentration of dry bean (Phaseolus Praharaj, C.S. and Rajendran, T.P. (2007). Long-term quantitative vulgaris L.). African Journal of Biotechnology, 7(17): 3026- and qualitative changes in cotton (Gossypium hirsutum L.) 3030. and soil parameters under cultivars, cropping systems and Venugopalan, M.V. and Pundarikakshudu, R. (1999). Long-term nutrient management options. Indian Journal of Agricultural effect of nutrient management and cropping system on Sciences, 77 (4): 280-285 cotton yield and soil fertility in rainfed vertisols. Nutrient Patil, P.V., Chalwade, P.B., Solanke, A.S and Kulkarni, V.K. Cycling in Agroecosystem, 55: 159-164.

Archives of Agriculture and Environmental Science 2 (2): 92-97 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

e-ISSN: 2456-6632 Journal homepage: www.aesacademy.org

ORIGINAL RESEARCH ARTICLE Evaluation of physical and chemical properties of some selected soils in mangrove swamp zones of Delta State, Nigeria

C. Umeri, R.C. Onyemekonwu* and H. Moseri Department of Agricultural Science Education, College of Education, Agbor, Delta State, NIGERIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 22 April 2017 In the present investigation the analysis of physical and chemical properties of some selected soils Revised received: 20 May 2017 of mangrove swamp in Delta State (Latitude 50 and 60 and 30’ North and longitude 50 and 60, 45’ Accepted: 25 May 2017 east) were determined. Hence, representative soil samples were obtained from three locations viz., Koko, Ozoro, Warri (Mangrove swamp) at 0-15cm and 15-30cm depths. The soil samples were Keywords analyzed for their physical and chemical properties viz., soil texture (Sand, silt and clay), pH, EC, + 3+ + Bulb production total organic carbon, available P, Na, K, Mg, Ca , exchangeable acidity (Al , H ), ECEC, OM, Onion Zn, Pb, Fe, Cu and Mn at different study sites. The soil texture of the studied soil samples were Planting method primarily recorded as sand and loamy sand, with sandy texture at different study sites. The soils had Spices a pH range of 5.65 to 6.40 at the surface, and were marginal in organic carbon, total nitrogen; exchangeable Ca, Mg, and ECEC, Zn, Fe, Cu whereas the contents of Mn were recorded to be adequate based on the recognized critical levels for the different nutrients. The potassium levels were found to be deficient in the soils. The pH of the soil showed a significant and positive correlation with K(r = +0.35) and Pb (r = +0.43). Total N positively correlated with the organic carbon (r = +0.92) and Fe (r = +0.63). The soils of the study area were mainly sandy loam indicating that the soils will support arable crop production. From the results of the present study it is recommended that the phosphorus and exchangeable potassium should be artificially supplemented to enhance the nutrients in the soil required for the growth and yield of the crop plants. ©2017 Agriculture and Environmental Science Academy Citation of this article: Umeri, C., Onyemekonwu, R.C. and Moseri, H. (2017). Evaluation of physical and chemical properties of some selected soils in mangrove swamp zones of Delta State, Nigeria. Archives of Agriculture and Environmental Science, 2(2): 92-97.

According to Nkhuzenje et al. (2002) the declining soil INTRODUCTION fertility have been reported as a major limitation to In Nigeria, soils aid tremendously in ensuring food increasing yields, and a threat to sustainability of crops security especially production in the production of crops of (Lawal et al., 2013; Umeri, 2015). which the country spend a huge amount on its importation. In order to realize the full potentials of these soils, there is The quality of soils does not depend on its ability to supply the need to take the inventory of their nutrient status in the adequate nutrients alone but the nutrients must be in the soils. This becomes necessary as information on the profile right proportion as needed by plants (Ayeni and Adeleye, distribution of soil elements in arable crop growing soils 2011; Umeri, 2015). A soil that supplies adequate nutrients will provide the basis for making informed decision with needed by plants with favourable soil pH will produce respect to fertilization and other soil management practic- better crops quality and yield if other conditions of growth es. A good knowledge of the variations of soil physical and such as biological and physical properties of the soil are chemical properties their interactions as it relates to micro- favourable (Anderson, 1991; Olueh, 2014). The capability nutrient status is essential for good land evaluation which or nutrients strength of a soil to maintain and support the is a pre-requisite for sound land use planning (Iloeji, 2003; plant growth generally depends on its physical, chemical Lawal et al., 2013; Olueh, 2014). and biological properties which have been found to play The broad objective of the study was to evaluate the physi- significant roles in crop production. Researchers have cal and chemical properties of some selected soils in reported that the nature of parent material has been found mangrove swamp soils of Delta State. The specific objec- to influence development and characteristics of soils tives of the present study were to evaluate the physical, (Brady and Weil, 2005; Iloeji, 2003; Umeri et al., 2016). chemical properties of some selected soils, to examine the

93 C. Umeri et al. /Arch. Agr. Environ. Sci., 2 (2): 92-97 (2017) micro nutrient of some selected soils and to assess the in- at pH 7.0 (Thomas, 1982). The exchangeable K and Na terrelationship among the nutrients of soils of mangrove contents of the extracts were read on EEL photometer swamp zones of Delta State. while the exchangeable Ca and Mg were determined by titration method (IITA, 1979). Total exchangeable acidity MATERIALS AND METHODS (H+ and Al3+) in the different soils was extracted with 1 N The study was carried out in the mangrove swamp of KLC (Thomas, 1982) and determined by titration method Delta State, which lies between longitude 80 201 and 80 301 0.05N NaOH using phenolphthalein as indicator. The East of the equator. Rainfall occurs mainly between April effective cation exchangeable capacity (ECEC) is the he and October. Annual rainfall is usually between 2000mm- summation of exchangeable bases and total exchangeable 3000mm with an intense sunlight, which lasts for a mini- acidity and was taken as the effective cation exchange mum of 8 hours daily. Temperatures are high for most capacity value and determined following the standard parts of the year, especially in the months of November to procedures (Okalebo, Gathua and Woomer, 2002). April with a mean monthly of 31°C. The annual range of RESULTS AND DISCUSSION temperature is thus small only varying between 3°C and 5° C. Relative humidity varies from 90% during rains to The physical and chemical properties of the soils are about 60% in dry season (Iloeji, 2003). There are three presented in Tables 1 and 2, and the correlation coeffi- types of soils in Delta state. These consist of alluvial soils cients (r) relating the nutrient elements to one another are on the marine deposits along the coast, alluvial and hydro- given in Table 3. During the present study the soil texture morphic soils on marine and lacustrine deposits found in of the selected soils at different study sites varied from the area close to the Niger and Benin Rivers and the feral sand to loamy sand. The soil samples from Koko, Ozoro soils on loose sandy sediments in the dry land area of the and Warri sampling sites were found to be sandy at the north and north east (Iloeji, 2003; Umeri et al., 2016). topsoil and subsoil. Soil samples from Koko and Warri The climatic conditions of Delta State are similar to other were found to be sandy at the surface and loamy sand at parts of Southern Nigeria. There are two distinct seasons; the sub-surface while at Ozoro it was found to be loamy the dry season and the rainy season (Umeri et al., 2016). sand at the surface and sandy at the sub-surface (Table 1). The rainy season starts in February and continues till the The pH values of various locations ranged from 5.65 in end of October. The rainfall regime shows a double Ozoro to 6.40 in Warri, that is, from strongly acidic to maxima which is separated by a comparatively low rainfall slightly acidic (Table 2). But at the subsurface, the pH period (dry period) in August called August Break. The ranged from 5.12 to 5.56; a similar range of moderately length of wet season is at least seven months, i.e. about acidic to strongly acidic. The pH of the soils showed a 220-250 days, with average rain days of 159. Temperatures decrease with depth with the exception of Warri. At the are very high during day with cool night (Iloeji, 2003; locations, mangrove swamp pH values were moderate Umeri et al., 2016). when compared to the suggested pH level of 6-6.5 Soil preparation and analytical methods: Soil samples were (Adeoye and Agboola, 1985) for the production of most collected from three (3) locations within mangrove swamp crops. of Delta State, namely- Koko, Ozoro, Warri in Nigeria. The percentage organic carbon values showed decrease These were chosen to reflect the differences in soil and with depth. At the surface it varied from 0.49% in Ozoro to vegetational characteristics. The surface soils (0-15cm) 1.15% in the soil from Koko (Table 2). At the subsurface, and sub-surface soils (15-30cm) were sampled with a tabu- the value ranged from 0.29% in Ozoro to 0.48% in Koko lar sampling auger. Representative soil samples were taken using a critical value of 0.15% (FDALR, 2004). Koko soils and bulked for each depth and location. The samples were had moderate organic carbon content. Ozoro, Warri, soils air-dried at room temperature depending on moisture were low in organic carbon. The soil samples from all the content for two (2) weeks and crushed to pass through sampling sites showed decrease with depth, reflecting 2mm mesh sieve. Sub-samples of soil from each location lower content of organic carbon at 15-30cm in comparison were further ground to pass through 100-mesh sieve for to 0-15cm. The total N content of the soils at all the determination of organic matter. The rest samples were locations ranged from 0.03% in Ozoro to 0.08% in soil then analyzed for both physical and chemical properties of from Warri (Table 2) at the surface. At the sub-surface, it the soil. varied from 0.02% in Ozoro to 0.04% in soils from Koko Soil analysis: Soil samples were analyzed for physico- using a critical level of 0.15% (FDALR, 2004). The chemical properties as described by the International locations had low total nitrogen contents. Institute for Tropical Agriculture (IITA, 1979) as follows: Available phosphorus: The available phosphorus for all The particle size distribution of the soil samples was done the locations ranged from 9.26mg/kg in Warri to 28.0mg/ by the Hydrometer method as outlined by Juo (1979). The kg in Koko at the surface (Table 2). This ranged from low pH of the soil samples was measured in water at ratio 1:1 to high, while at the sub-surface, the value ranged from (soil: water) by glass electrode pH meter (Mclean, 1982). 22.3 at Koko to 58.8mg/kg at Ozoro and it is indicating The organic matter was determined by wet dichromate acid lower content of phosphorus in the surface soils in compar- oxidation method (Nelson and Sommers, 1982). The ison with subsurface soils. Mangrove swamp had high exchangeable bases (Ca, Mg, K and Na) in the different phosphorus content when compared to the established soil samples were extracted with 0.05N NH4OAc buffered critical value of 17mg/kg (Agboola and Corey, 1993). The

C. Umeri et al. /Arch. Agr. Environ. Sci., 2 (2): 92-97 (2017) 94 exchangeable potassium at all the sampling locations surface depth, the value was highest at Warri followed by ranged from 0.05 to 0.36cmol/kg in the surface and Ozoro. The soil samples from Koko were found to be 0.04cmol to 0.10cmol/kg in subsurface. In the surface deficient in calcium compared to the established critical soils, it was lowest in Koko, followed by Warri while it value of 3.80cmol/kg (Agboola and Corey, 1993). The was highest in Ozoro. In the subsurface, the value was exchangeable sodium value ranged from 0.36cmol/kg to highest in the soils from Ozoro and Warri, based on a criti- 0.46cmo/kg at the surface depth, while at the sub-surface, cal value of 0.24cmol/kg (Agboola and Ayodele, 1987), it ranged from 0.40cmol/kg to 0.49cmol/kg (Table 2). At surface soils obtained from Ozoro were sufficient in ex- the surface, the value was highest in Ozoro followed by changeable potassium while the other locations were defi- Warri, while the value was lowest at Warri. cient. Mangrove swamp locations were deficient in ex- Soil micronutrients: Zinc (Zn) content ranged from 43.9 changeable potassium. mg/kg in Ozoro to 57.0 mg/kg in Koko at the surface soils The exchangeable magnesium value ranged from 0.32 to and from 28.8 mg/kg in Ozoro to 58.1 mg/kg in Koko at 0.96cmol/kg at the surface, while at the subsurface, it the sub-surface soils. Iron (Fe) content ranged from ranged from 0.64 to 1.68 (Table 2). At the surface, the val- 80.4mg/kg in Ozoro to 182 mg/kg in Warri at the surface ue was highest at Ozoro followed by Koko and Warri. soils and from 29.3mg/kg in Ozoro to 80.6mg/kg in Warri Thus indicating lower magnesium at the surface in com- at the sub-surface. The critical value of iron and zinc have parison to the subsurface. Based on the critical level of been given as 3-4.5mg/kg (Adeoye and Agboola, 1985) 1.9cmol/kg (Agboola and Ayodele, 1987), all the locations and 5-9mg/kg (Sillanpan, 1972), respectively. As the upper had moderate exchangeable magnesium content. The layers of the soil, the soil could be considered to be high in exchangeable calcium values ranged from 1.44 to Fe and Zn contents. The lead content ranged from 1.24mg/ 7.36cmol/kg at the surface depth, while at the subsurface it kg in Koko to10.9mg/kg in Warri at the surface soils and ranged from 2.401 to 4.32cmol/kg (Table 2). At the from 0.01 in Warri to 1.82mg/kg in Ozoro at the sub- Table 1. Physical properties of selected soils of mangrove swamp of Delta State. Soil properties Sample Location Depth (cm) Sand Silt Clay Textural class Mangrove swamp g/kg 0 - 15 906.0 54.0 40.0 S KOKO 15-30 846.0 64.0 90.0 LS 0 - 15 894.0 83.0 23.0 LS OZORO 15-30 914.0 63.0 23.0 S 0 - 15 914.0 63.0 23.0 S WARRI 15-30 884.0 6.3 53.0 LS S = Sand; LS = Loamy sand

Table 2. Chemical properties of selected soils of Delta State before cropping.

Exchangeable Sam- Depth pH E Total Av pling OC Na K Mg Ca Al3+ Available (cm) H O C N P location 2 EC H+ OM Zn Pb Fe Cu Mn EC % mg/kg cmol/kg % mg/kg

Man- grove swamp 8.8 1.1 28. 0.3 0.0 0.6 1.4 7.4 10. 57 1. 12 7.4 1.2 5.88 0.08 0.90 19.9 KOKO 0 - 15 5 5 02 6 5 4 4 0 6 .0 24 2 6 0 67. 0.4 22. 0.4 0.0 1.6 2.4 2.8 9.9 58 1. 37. 3.6 1.8 15-30 5.56 0.04 2.60 8.3 3 8 3 0 4 8 0 0 2 .1 43 4 1 8 43. 0.4 18. 0.4 0.3 0.9 4.8 1.9 9.4 43 0. 80. 3.8 4.4 5.65 0.3 1.00 5.0 0 - 15 7 9 2 6 6 6 0 0 8 .9 81 4 1 0 OZORO 36. 0.2 58. 0.4 0.1 0.8 3.8 3.5 9.4 28 1. 29. 2.3 0.3 15-30 5.12 0.02 1.00 48.1 6 9 8 5 0 0 4 0 9 .8 82 3 4 6 12. 0.8 9.2 0.4 0.2 0.3 7.3 3.8 15. 55 10 18 1.0 0.3 6.40 0.07 0.00 14.9 0 - 15 3 6 6 5 4 2 6 0 3 .4 .9 2 2 6 WARRI 48 10. 0.4 32. 0.4 0.1 0.6 4.3 2.7 9.2 0. 80. 13. 0.3 15-30 5.40 0.03 1.00 7.6 .6 0 5 6 9 0 4 2 0 5 01 6 7 0 4 Av. P- Available phosphous; EC- Electrical conductivity; ECEC-Effective cation exchange capacity; OM-Organic matter

95 C. Umeri et al. /Arch. Agr. Environ. Sci., 2 (2): 92-97 (2017) Table 3. Correlation coefficients (r) matrix showing the relationship among physical and chemical properties of some soils in Delta State before cropping.

Total Av EC pH EC OC Na K Mg Ca+ Al H+ OM Zn Pb Fe Cu Mn Sand Silt Clay N P EC ------0.1 0.1 0.0 0.2 0.3 0.1 0.0 0.0 0.1 0.4 0.1 0.1 0.20 pH 1 0.3 0.1 0.1 0.1 0.1 0.4 0.01 20 74 31 60 51 25 27 42 52 34* 18 83 9 99 40 8 61 73 15* 3H ------0.0 0.0 0.2 0.3 0.1 0.2 0.1 0.0 0.3 EC 0.0 0.1 0.1 0.1 0.1 0.0 024 0.2 0.05 0.18 16 31 60 65 03 00 19 33 28 20 37 06 17 94 28 7 47 5 3 0.9 ------0.6 0.6 - - - 0.1 0.0 0.4 0.0 0.0 0.24 Total N 79* 0.1 0.2 0.2 0.1 0.2 0.2 29* 35 0.1 0.2 0.17 15 42 91 34 73 9 * 75 73 59 97 01 22 * ** 18 01 9 ------0.6 0.4 0.5 - - 0.1 0.0 0.0 0.0 0.16 OC 0.2 0.1 0.1 0.2 0.1 0.2 0.2 28* 96 67 0.0 0.61 0.2 10 61 15 09 4 11 98 98 41 34 30 16 * * ** 84 16 ------0.0 0.0 0.0 0.4 0.2 0.0 0.34 Av P 0.4 0.0 0.0 0.3 0.0 0.0 0.2 0.2 0.34 79 04 29 18 82 56 9 75* 18 68 28 93 64 49 81 0 0 - - - 0.5 - 0.0 0.2 0.1 0.0 0.3 0.0 0.2 0.3 0.0 0.44 Na 0.2 0.3 0.0 42 0.46 44 08 21 05 18 63 09 97 96 0* 41 07 92 ** 2* ------0.0 0.5 0.1 0.0 0.07 K 0.2 0.3 0.2 0.3 0.3 0.1 0.1 0.2 0.25 85 08* 16 61 2 19 02 40 53 21 20 97 79 0 - - - - - 0.1 0.4 0.0 0.3 0.0 0.4 0.3 0.1 0.09 Mg 0.2 0.3 0.0 0.19 40 21 60 03 06 45 77 83 5 04 14 82 0 * - 0.5 - - 0.1 0.1 0.4 0.0 0.2 0.12 0.0 - Ca+ 0.0 16 0.1 0.2 78 25 29* 01 34 3 45 0.16 62 * 34 88 - - - - 0.4 - - 0.0 0.0 0.0 0.3 Al 0.9 0.0 0.3 0.2 57* 0.42 0.40 69 11 47 24 52 91 46 37 * 0 9 ------0.6 0.0 0.24 H+ 0.2 0.2 0.3 0.0 0.2 0.1 0.13 71 17 2 07 59 6 05 04 19 5 ** ------ECE 0.1 0.0 0.10 0.0 0.1 0.2 0.1 0.01 0.0 C 95 89 0 94 50 05 04 7 64

- - - - 0.2 0.2 0.12 - Zn 0.0 0.0 0.0 0.0 19 84 4 0.77 03 24 99 65 - - - - 0.1 0.1 0.1 Ph 0.0 0.0 0.02 0.09 95 48 13 04 23 2 1 - - - - 0.1 0.10 Pb 0.2 0.1 0.2 0.15 97 5 19 75 57 1 - - - - 0.14 Fe 0.1 0.3 0.1 0.22 6 21 02 23 8 - - 0.1 0.48 Cu 0.38 0.0 00 2 0 11 - 0.2 0.18 Mn 0.27 10 4 2 - - Sand 0.6 0.78 56* 6** 0.30 Silt 1 Clay 1.00

EC- Electrical conductivity; OM-Organic matter; Av. P-Available phosphorus; ECEC- Effective cation exchange capacity *, **- Significantly different at P=0.05 and P=0.01 level, respectively.

C. Umeri et al. /Arch. Agr. Environ. Sci., 2 (2): 92-97 (2017) 96 surface soil. Copper content ranged from 1.02mg/kg in were the principal objective of this study. The study was Warri to 7.46 in Ozoro mg/kg in the surface soils and from conducted at Mangrove swamp in Delta State. Soil analysis 2.34mg/kg in Ozoro to 13.7mg/kg in Warri at the to determine the levels of plant nutrients in the soils was sub-surface soils. The values were low when compared to carried out. Consequently, the results from this study could the average critical level of 6.35mg/kg (Chude and be summarized as follows: Soils of the area of study were Obigbesan, 1980). mainly sandy loam. The results of the present investigation The available manganese content of the soil ranged from indicated that the soils of the different study sites viz., 0.36mg/kg in Warri to 4.40mg/kg in Ozoro for surface Koko, Ozoro, Warri (Mangrove swamp) in the Delta State soils. These values were low when compared to the estab- of Nigeria had proper pH, and with marginal nitrogen, lished critical values of 10.3-15.7mg/kg (Ayanlaja, 1983). exchangeable calcium, magnesium and ECEC and indicat- Inter-relationships among the nutrients revealed that pH ed that the soils are slightly low in the nutrient contents. had a positive and significant correlation with potassium While these soils were sufficiently supplied with micro- and lead (r = +0.351 and r = +0.434) at 5% level and a nutrients; especially, zinc, lead, iron, copper and manga- negative and significant correlation with silt (r = - 0.415). nese at all the selected sampling sites. Nevertheless, these Organic carbon showed a positive and significant correla- soils are quite deficient in the available phosphorus and tion (r = +0.567 and r = +0.496) at 5% level with Fe and exchangeable potassium. The inter-relationships as per the Zn, respectively. An analysis of soils in the area of study correlation statistics among the nutrients revealed that pH showed that they ranged from sand to loamy sand. During had a positive significant correlation with potassium and the present investigation the textural class of the soil is lead (r = +0.351 and r = +0.434) at 5% level and a negative accounted for the low clay and silt contents in the soil sam- and significant correlation with silt (r = -0.415). Therefore, ples of the study sites. This indicates that the rate of water form the outcome of the present investigation it can be infiltration in these soils may be high and, consequently, recommended that should be artificially fertilized with that the water holding capacity of these soils may be low. phosphorus and exchangeable potassium to enhance the These properties could predispose soils to erosion, particu- nutrients in the soils essential for the growth and yield of larly, that mangrove swamp in Delta state is high. The the agricultural crops. infertile nature of the soil could lead to low crop yields, if Open Access: This is open access article distributed under fertilizers are not applied; and resource poor farmers will the terms of the Creative Commons Attribution License, be unable to meet crop demands. Therefore the entire soils which permits unrestricted use, distribution, and reproduc- are required to maintain the fertility of the soils and modi- tion in any medium, provided the original author(s) and the fy or improve on them (Agboola and Unamma, 1991). The source are credited. low ECEC (Table 2) may be due to leaching. Mangrove swamp of Delta State is a high rainfall area. The soils were REFERENCES acidic with low total nitrogen, available phosphorus, exchangeable potassium and calcium. Adeoye, G.O. and Agboola, A.A. (1985). Soil test for upland rice in Southern western Nigeria. Fertilizer Research, 14: 227-234. The southwestern Nigerian soils have been reported to be Agboola, A.A. and Ayodele, O. (1987). Soil test for upland rice mostly sandy and loamy sand owing to the nature of parent in southwestern Nigeria. Fertilizer Research, 14: 227-234. materials which are predominantly sedimentary (Agboola Agboola, A.A. and Corey, R.B. (1993). Soil test calibration for and Unamma, 1991, Olueh, 2014). Soils become acidic as NPK for maize. Journal of West Africa Science Association, a result of organic matter decomposition and by the addi- 17: 93-100. tion of ammonum (NH4) nitrogen fertilizer. The ions of Agboola, S.A. (1968). Patterns of food crop production in south- hydrogen (H+) produced by these processes and they west Nigeria. Geographical Journal, 11 (2): 135-152. displace the calcium, magnesium and potassium from the Ayanlaja, S.A. (1983). Soil and agrometeological studies on surface or sub surface of the soils. These free salts are then Cocoa CRIN Annual Report 1983. leached from the upper regions of the soil profile by water Ayeni L.S. and Adeleye E.O. (2011). Soil nutrient status and moving downward through the soil (Naidu et al., nutrient interactions as influenced by agro wastes and mineral fertilizer in an incubation 1990).The mean pH was 5.2 in Mangrove swamp. This is study in the Southwest Nigeria. International Journal of Soil suitable for crop production in Nigeria (Lawal et al., Science, 6 (1): 60-68 2013).The nutrient status of the soils was generally low Bremmer, J.M. and Mulvaney, C.S. (1982). Nitrogen-total In: with most of the nutrients having concentrations below the Page et al. (eds). Method of soil analysis Part 2. Agronomy critical limits. Organic carbon content was sufficient at 9. Second edition ASA and SSA Madison Wisconsin. pp: both locations according to the critical value of 1.0% 595-624. recommended by Agboola and Ayodele (1987). Total N, Bouyoucos, G.H. (1962). Hydrometer method of making particle available P and exchangeable K were marginal at man- size analysis of soils. Soil Science Society Annual Proceed- grove swamp based on the recommendation by FDALR ing, 26: 264-265. (2004). Calcium and Mg was deficient at all locations Chude, V.O. and Obigbesan, G.O. (1980). In: Federal Ministry of Agriculture and Natural Resources (FMANR). (1990) Litera- (Lawal et al., 2013, Umeri, 2015). ture review on soil fertility. Investigation in Nigeria, 170-173. Conclusions FDALR (Federal Department of Agric land Resources) (2004): Handbook on Soil Test- Based Fertilizer Recommendation The determination of the physical and chemical properties for Extension Workers. National special programme for food of some selected soils and its correlation coefficients (r) security. pp: 39.

97 C. Umeri et al. /Arch. Agr. Environ. Sci., 2 (2): 92-97 (2017) IITA International Institute for Tropical Agriculture (1979): Okalebo, J.R., Gathua, K.W. and Woomer, P.L. (2002). Labora- Selected methods for soils and plant Analysis Manual series tory Methods of Soil and plant Analysis: A working Manu- No. 1 IITA al.2nd edition. TSBF-CIAT and SACRED Africa, Nairobi, Iloeji, S.I. (2003). General Geography of Nigeria. Heinemann Kenya. pp: 128. Books Ibadan. Olsen, S.R. and Sommers, L.E. (1982). Phosphorous In: Page et Lawal, B.A. Ojanuga, A.G. Isada, P.A. and Mohammed. T.A al, (eds). Method of soil analysis part 2. Agronomy 9 second (2013). Characterization, classification and agric potentials edition ASA and SSA Madison Wisconsin. pp: 595-624. of soils on a Toposequence in Southern Guinea Savanna of Olue, C.E. (2014). Evaluation of potassium status in some soils Nigeria. World Academy of Science Engineering and Tech- of Delta state, Nigeria. Ph.D. Thesis Department of Soil nology. International Journal of Biology, Veterinary, Science, Ambrose, Alli University, Ekpoma, Edo State, Agricultural and Food Engineering, 7 (5): 146-150. Nigeria. Mclean, E.O. (1982). Soil pH and lime requirements. In page, Sillanpaa, M. (1972). Trace elements in soils and Agriculture A.L. et.al, (eds). Method of soil analysis. Part 2 Agronomy 9 Soils Bulletin 17: FAO pp: 67. second edition ASA and SSA Madison Wisconsin. pp: 595- Thomas, G.W. (1982). Exchangeable cations In: Page et al. (eds). 624. Method of soil Analysis part 2. Agronomy 9 second edition Murphy, J. and Riley, J.P. (1962). A modified single solution ASA and SSA Madison Wisconsin pp: 595-624. method for the determination of phosphorus in natural water. Analytica Chimica ACTA, 27: 31-36. Udo, E.J. and Ogunwale, J.A. (1986): Laboratory manual for Naidu, R., Syers, J.K., Tillman, R.W. and Kirkman, J.H. (1990). Analysis of Soil, Plant and Water Samples. Department of Effect of liming and added phosphate on change characteris- Agronomy, University of Ibadan, Ibadan Nigeria pp: 45-47. tics of acid soils. Journal of Soil Science, 41:157-164. Umeri, C. (2015). Nitrogen and potassium status of selected soils Nelson, D.W. and Sommers, L.E. (1982). Total carbon, organic and their effect on the growth, yield and cyanide content of carbon and organic matters. In: Page et al, (eds). Method of cassava (Manihot esculenta Crentz) in Delta State, Nigeria. soil analysis part 2. Agronomy 9 second edition ASA and Ph.D. Thesis Department of Crop Science, Ambrose, Alli SSA Madison Wisconsin pp: 595-624. University, Ekpoma, Edo State, Nigeria. Nkhuzenje, H., Mughogho, S.K., Sakala, W.D. and Saka, A.R. Umeri, C. Moseri, H. and Onyemekonwu, R.C. (2016). Effects of ( 2002). Contribution of promiscuous and specific soybean nitrogen and phosphorus on the growth performance of varieties to soil fertility improvement and maize yield for maize (Zea mays) in selected soils of Delta State, Nigeria. smallholder farmers in Zomba District of Malawi. Advances in Crop Science and Technology, 4 (1): 1-4.

Archives of Agriculture and Environmental Science 2 (2): 98-104 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Transcriptional activator gene based phylogenetic analysis of dolichos yellow mosaic virus infecting lablab bean (Dolichos lablab L.)

Sonam Arya1, Rajat Chaudhary1, Vaishali1 and S.K. Awasthi2 1Department of Biotechnology, Sardar Vallabhbhai Patel University of Agriculture and Technology, Meerut-250110 (Uttar Pradesh), INDIA 2Department of Life Sciences, Chhatrapati Shahu Ji Maharaj University, Kanpur-208024 (Uttar Pradesh), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 01 May 2017 Lablab bean (Dolichos lablab L.) is one the important crop, cultivated as vegetable, pulses as it is Revised received: 22 May 2017 rich in protein. It is affected from viral disease i.e. dolichos yellow mosaic virus. The causative Accepted: 26 May 2017 agent is begomovirus belongs to geminivirus family. Begomovirus contain bipartite genome having two type of DNA-A and DNA-B. DNA- A helps in replication and DNA-B helps in movement. Keywords These DNA have six different type of gene coat protein gene, transcriptional activator gene, replica- Dolichos lablab tion associated gene, replication enhancer gene, pre coat protein involved in different function Dolichos yellow mosaic virus associated with it. The present investigation was carried out to investigate the transcriptional activa- Phylogenetic analysis tor gene based phylogenetic analysis of Dolichos yellow mosaic virus infecting D. lablab. This Transcriptional activator gene study is based on the transcriptional activator gene which is used in transactivation of genes, contains three conserved domains: a basic domain at N-Terminus, a central DNA binding domain and activator domain. The genome databases of dolichos yellow mosaic virus were taken from NCBI site total six genome was available and were used with Clustal W and CLC BIO were the bioinformatic tools for determining sequence homology among genome present in different geographical location. The absence of functional specificity suggests that all begomovirus contains a common element interacts with cellular proteins of other viruses reveals the phylogenetic analysis with the other species Dolichos in the different geographical location. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Arya Sonam, Chaudhary Rajat, Vaishali and Awasthi, S.K. (2017). Transcriptional activator gene based phylogenetic analysis of dolichos yellow mosaic virus infecting lablab bean (Dolichos lablab L.). Archives of Agriculture and Environmental Science, 2(2): 98-104. INTRODUCTION to 7.8. The dried seeds of lablab bean should be boiled in The lablab bean (Dolichos lablab L.) is most ancient culti- two changes of water earlier eating since they have toxins vated crop plants. It is a multipurpose crop grown for substance as Cyanogenic glucosides. It improves the soil pulse, vegetable and forage, widely cultivated due to it is condition and is relatively drought tolerant; it is also a having high nutritive value and having major sources of good cover crop (Raj et al., 1988; Singh et al., 2006, protein. It has ability of nitrogen fixation which helps in 2012). improving soil fertility, and drought resistance (Capoor In dolichos disease named dolichos yellow mosaic disease and Varma, 1948, 1950; Maruthi et al., 2006). In India, the and infected by virus named dolichos yellow mosaic virus lablab bean is grown in the peninsular region and cultivat- (DoYMV) and was shown transmitted by the whitefly Be- ed to large areas of Karnataka and adjoining districts of misia tabaci (Capoor and Varma, 1950; Vanitharani et al., Tamil Nadu, Andhra Pradesh and Maharashtra, Uttar 2004, 2005; Yadava et al., 2010). It having symptoms like Pradesh (Singh et al., 2006, 2012). The lablab bean is ex- faint chlorotic specks on leaf lamina, which later tensively cultivated in the various climatic zones for exam- develop into bright yellow mosaic patches with Small ple arid, semi-arid, sub-tropical and humid regions where Island of green tissue. The leaves are seldom deformed, temperatures vary between 22°C-35°C, low lands and up- but yields are reduced significantly (Capoor and Varma, lands and many types of soils and the pH varying from 4.4 1950; Bisaro, 1996; Zrachya et al., 2006). The viruses

99 Sonam Arya et al. /Arch. Agr. Environ. Sci., 2 (2): 98-104 (2017) having bipartite genomes require these components differ- for the global sequence alignment helps in determining the entiated into two diverse particles; consequently more than maximum similarity within the other viruses (Rojas et al., one virus particle is needed to infect a cell. The total size 2001; Rekha et al., 2005; Saeed et al., 2008; Govindappa of the dolichos yellow mosaic virus is 2760 bp. et al., 2011). Keeping in view, the present study was aimed (Maramorosch and Muniyappa, 1981; Muniyappa Muni- to assess the transcriptional activator gene based phyloge- yappa et al., 2003; Stanley et al., 2005). Its genome is netic analysis of Dolichos yellow mosaic virus infecting divided into the two parts DNA-A and DNA -B and inter- Lablab bean (Dolichos lablab L.). genic region or common region which is common in both the DNA. All the functions related for virus replication, MATERIALS AND METHODS control of gene expression and encapsidation are in coded Description of study materials: There are different type’s in DNA-A and gene involved in intra and intercellular databases available on internet. The NCBI site was used movement are encoded in DNA-B. DNA-A contains six for retrieving the genome of the dolichos yellow mosaic different genes named AC1, AC2, AC3, AC4, AV1, AV2 virus (NCBI, 2016). A total of six isolates of the gene AC2 and each gene have different function. AC2 interacts with and AC4 were identified for the diversity analysis (Table 1). itself and localizes to the nucleus and self interaction cor- Phylogenetic analysis: Sequences were saved in the relates with nuclear localization and efficient activation of FASTA format in a notepad file. Software CLUSTAL-W transcription (Hayes and Buck, 1989; Yang et al., 2007; and CLC-BIO was used for the phlogenetic analysis and Prajapat et al., 2010). Its function as a transcriptional acti- making dendrogram. The neucleotide BLAST was done to vator, three conserved domains has been recognized in this determine the maximum similarity with the other species. protein: a basic domain with a nuclear localization signal The nucleotide sequences of the AC2 gene in the FASTA (NLS) at the N terminus, a central DNA-binding domain format were as follows: with a non classical Zn-finger motif, and an acidic activa- >gi|41057586:c1631-1203 Dolichos yellow mosaic virus, tor domain at C-terminus (Hartitz et al., 1999; Mansoor et complete genome al., 2003; Dhakar et al., 2010). A comparison of steady ATGCGGTCTTCGTCACCCTCGAACAGCCATT- state transcript level and the transcript level determined by GTTCTTACCGAGCATCAAGGCACAGCATCGACAG nuclear run on assay showed that activation of AV1 and GCGAAGAAGCGCAAAACGATTCGGCGTAAGCGA BV1 gene expression by the AC2 protein primarily occurs ATCGATCTGACCTGTGGCTGTTCGTATTACCTAAA at the transcriptional level. Mutational analysis of AC2 in TATCAACTGCCGGAATGACGGATTCACGCACAGG begomoviruses showed that the mutation of this ORF GGAATCCATCACTGCAACTCAACTACAGAGTGGC prevented systemic movement of the virus, produced no GTGTTTATCTGGGAGCTAAAGAATCCCCTGTCTTT capsid protein and accumulated reduced amount of ssDNA CAAAATCCTGGAGCATCACGAGGGGTTCCTGTTC in the transient assay (Hanley-Bowdoin et al., 1999; Harri- GATCCGAACCAACACAGAACCAAGATCCGCATAA son and Robinson, 1999; Markham et al., 1994; Qazi et al., TGTTCAACCACGGGTTGAAGAAAGCGTTGGGGAT 2007). Therefore, AC2 is functionally interchangeable ACACAAGGCATTCTTGGATTTTGTGATTTACCATC among begomoviruses and the absence of active specificity GATTGACTCCGCAATCTGGGCGGATCTTGAATGTA suggests that either all begomovirus late promoters have a TTCAGGAACTTCCTTTTTAA collective sequence element documented by AC2 or AC2 >gb|AY309241.1|:c1631-1203 Dolichos yellow mosaic interacts with cellular proteins common to all begomovirus virus segment DNA-A, complete sequence plant hosts to effect transcriptional activation. AC4 is ATGCGGTCTTCGTCACCCTCGAACAGCCATT- highly variable among begomoviruses. AC4 of ACMV GTTCTTACCGAGCATCAAGGCACAGCATCGGCAG enhanced pathogenecity by increasing the levels of DNA GCGAAGAAGCGCAAAACGATTCGGCGTAAGCGA accumulation of viruses and was also found to have anti- ATCGATCTGACCTGTGGCTGTTCGTATTACCTGAA PTGS activity (Varma et al., 1993; Vanitharani et al., TATCAACTGCCGAAATGACGGATTCACGCACAGG 2004; Yang et al., 2007). They infect a wide range of plant GGAATCCATCACTGCAGCTCAACTACAGAGTGGC species and are responsible for Geminiviruses are a major GTGTTTATTTGGGAGCTAAAGAATCCCCTGTCTTT constraint to agricultural productivity in all tropical and CAAAATCCTGGAGCATCACGAGGGGTTCCTGTTC sub-tropical regions of the world. The molecular phyloge- GATCCGAACCAACACAGAACCAAGATCCGCATAA netic analysis is the scrutiny of hereditary molecular altera- TGTTCAACCACGGGTTGAAGAAAGCGTTGGGGAT tions, mainly in DNA sequences, to gain evidence on an ACACAAGGCATTCTTGGATTTTGTGATTTACCATC organism's evolutionary relationships (Yaraguntaiah and GATTGACTCCGCATTCTGGGCGGATCTTGAATGTA Govindu, 1964; Briddon et al., 1990, 2001; Varma and TTCAGGAACTTCCTTCTTAG Malathi, 2003). The result of a molecular phlyogenetic >gb|AY271891.1|:c1631-1203 Hyacinth bean yellow analysis is expressed in a phylogenetic tree (Dry et al., mosaic Bangladesh virus DNA-A, complete sequence 1997; Swanson et al., 1992; Czosnek et al., 2001). The tree ATGCGGTCTTCGTCACCCTCGAACAGCCATT- was constructed by use of the various type of software. GTTCTCTACCGAGCATCAAGGCACAGCATCGACA The CLUSTAL-W, CLC-BIO and BLAST were used to GGCGAAGAAGCGCAAAACGATTCGGCGTAAGCG study the phylogenetic analysis. The multiple sequence AATCGATCTGACCTGTGGCTGTTCGTATTACCTAA alignment and phylogenetic relationship was done by the ATATCAACTGCCGGAATGACGGATTCACGCACAG help of CLUSTAL-W and CLC-BIO and BLAST is used GGGAATCCATCACTGCAACTCAACTACAGAGTGG

Sonam Arya et al. /Arch. Agr. Environ. Sci., 2 (2): 98-104 (2017) 100 CGTGTTTATCTGGGAGCTAAAGAATCCCCTGTCTT CTGATGTCAAATCCTACATCACCAAGGACGGTGA TCAAAATCCTGGAGCATCACGAGGGGTTCCTGTT TTACGTCGACTGGGGAACATTTCAGATCGACGGA CGATCCGAACCAACACAGAACCAAGATCCGCATA CGATCTGCTAGAGGAGGTCGTCAGACAGCTGACG ATGTTCAACCACGGGTTGAAGAAAGCGTTGGGGA ATGCTGTAG TACACAAGGCATTCTTGGATTTTGTGATTTACCAT >gb|AY309241.1|:c2480-2235 Dolichos yellow mosaic CGATTGACTCCGCAATCTGGGCGGATCTTGAATGT virus segment DNA-A, complete sequence ATTCAGGAACTTCCTTTTTAA ATGGGA- >gi|116077869:c1631-1203 Dolichos yellow mosaic virus TATGCATCTCCATGCCCTCGTCCATTCAAGGGTAA DNA-A segment, complete sequence, isolate Bangalore-2 GGCCCAGTTCCGAAATGCAAGACATTTCGACCTT ATGCGGTCTTCGTCACCCTCGAACAGCCATT- ACCCATCCTCATAGCACACAGGTTTTCCATGGAAA GTTCTCTACCGAGCATCAAGGCACAGCATCGACA TGTCCAGGGAGCAAAGAGCTCATCTGATGTCAAA GGCGAAGAAGCGCAAAACGATTCGGCGTAAGCG TCCTACATCACCAAGAACGGTGATTACATCGACT AATCGATCTGACCTGTGGCTGTTCGTATTACCTAA GGGGAACATTTCAGATCGACGGACGATCTGCTAG ATATCAACTGCCGGAATGACGGATTCACGCACAG AGGAGGTCGTCAGACAGCTGACGATGCTGTAG GGGAATCCATCACTGCAGCTCAACTACAGAGTGG >gb|AY271891.1|:c2480-2235 Hyacinth bean yellow CGTGTTTATCTGGGAGCTAAAGAATCCCCTGTCTT mosaic Bangladesh virus DNA-A, complete sequence TCAAAATCCTGGAGCATCACGAGGGGTTCCTGTT ATGGGA- CGATCCGAACCAACACAGAACCAAGATCCGCATA TATGCATCTCCATGCCCTCGTCCATTCAAGGGTAA ATGTTCAACCACGGGTTGAAGAAAGCGTTGGGGA GGCCCAGTTCCGAAATGCAAGACATTTCGACCTT TACACAAGGCATTCTTGGACTTAGTAGTTTACCAT ACCCATCCTCATAGCACACAGGTTTTCCATGGAA CGATTGACTCCGCAATCTGGGCGGATCTTGAATGT ATGTCCAGGGAGCAAAGAGCTCATCTGATGTCAA ATTCAGGAACTTCCTTTTTAG ATCCTACATCACCAAGGACGGTGATTACGTCGAC >gi|116077862:c1631-1203 Dolichos yellow mosaic virus TGGGGAACATTTCAGATCGACGGACGATCTGCTA DNA-A segment, complete sequence, isolate Bangalore-1 GAGGAGGTCGTCAGACAGCTGACGATGCTGTAG ATGCGGTCTTCGTCACCCTCGAACAGCCATT- >gi|116077869:c2480-2235 Dolichos yellow mosaic virus GTTCTCTACCGAGCATCAAGGCACAGCATCGACA DNA-A segment, complete sequence, isolates Bangalore-2 GGCGAAGAAGCGCAAAACGATTCGGCGTAAGCG ATGGGACTATGCATCTCCATGCCCTCGTCCAG- AATCGATCTGACCTGTGGCTGTTCGTATTACCTAA TTCAAGGGTAAGGCCCAGTTCCGAAATGCCAGAC ATATCAACTGCCGGAATGACGGATTCACGCACAG ATTTCGACCTTACCCATCCTCATAGCACACAGATT GGGAATCCATCACTGCAGCTCAACTACAGAGTGG TTCCATGGAAATGTCCAGGGAGCAAAGAGCTCAT CGTGTTTATCTGGGAGCTAAAGAATCCCCTGTCTT CTGATGTCAAATCCTACATCACCAAGGACGGTGA TCAAAATCCTGGAGCATCACGAGGGGTTCCTGTT CTACGTCGACTGGGGAACATTTCAGATCGACGGA CGATCCGAACCAACACAGAACCAAGATCCGCATA CGACCTGCTAGAGGAGGTCGGCAGACAGCTGACG ATGTTCAACCACGGGTTGAAGAAAGCGTTGGGGA ATGCTGTAG TACACAAGGCATTCTTGGACTTAGTAGTTTACCAT >gi|116077862:c2480-2235 Dolichos yellow mosaic virus- CGATTGACTCCGCAATCTGGGCGGATCTTGAATGT es DNA-A segment, complete sequence, isolate Bangalore- ATTCAGGAACTTCCTTTTTAG 1 >gi|90185977:c1631-1203 Dolichos yellow mosaic virus ATGGGACTATGCATCTCCATGCCCTCGTCCAG- complete DNA-A segment, strain Mysore TTCAAGGGTAAGGCCCAGTTCCGAAATGCCAGAC AATGCGGTCTTCGTCACCCTCGAACAGCCATT- ATTTCGACCTTACCCATCCTCATAGCACACAGATT GTTCTCTACCGAGCATCAAGGCACAGCATCGACA TTCCATGGAAATGTCCAGGGAGCAAAGAGCTCAT GGCGAAGAAACGCAAAACGATTCGGCGTAAGCG CTGATGTCAAATCCTACATCACCAAGGACGGTGA AATCGATCTGACCTGTGGCTGTTCGTATTACCTAA CTACGTCGACTGGGGAACATTTCAGATCGACGGA ACATCAACTGCCGGAATGACGGATTCACGCACAG CGACCTGCTAGAGGAGGTCGGCAGACAGCTGACG GGGAATCCATCACTGCAGCTCAACTACAGAGTGG ATGCTGTAG CGTGTTTATCTGGGAGCTAAAGAATCCCCTGTCTT >gi|90185977:c2480-2235 Dolichos yellow mosaic virus TCAAAATCCTGGAACATCACGAGGGGTTCCTGTT complete DNA-A segment, strain Mysore CGATCCGAACCAACACAGAACCAAGATCCGCATA GATGGGA- ATGTTCAACCACGGGTTGAAGAAAGCGTTGGGGA TATGCATCTCCATGCCCTCGTCCATCAAGGGTAAG TACACAAGGCATTCTTGGACTTTGTGATTTACCAT GCCCAGTTCCGAAATGCCAGACATTTCGACCTTAC CGATTGACTCCGCAATCTGGGCGGATCTTGAATGT CCATCCTCATAGCACACAGATTTTCCATGGAAATG ATTCAGGAACTTCCTTTTTA TCCAGGGAGCAAAGAGCTCATCTGATGTCAAATC Nucleotide sequence of AC4 gene in the FASTA CTACATCACCAAGGACGGTGACTACGTCGACTGG format: >gi|41057586:c2480-2235 Dolichos yellow mosa- GGAACATTTCAGATCGACGGACGATCTGCTAGAG ic virus, complete genome GAGGTCGTCAGACAGCTGACGATGCTGTA ATGGGACTATGCATCTCCATGCCCTCGTCCAG- TTCAAGGGTAAGGCCCAGTTCCGAAATGCAAGAC RESULTS AND DISCUSSION ATTTCGACCTTACCCATCCTCATAGCACACAGGTT The yellow mosaic diseases are challenging problems in TTCCATGGAAATGTCCAGGGAGCAAAGAGCTCAT the tropics and subtropics. The increase in Bemisia tabaci

101 Sonam Arya et al. /Arch. Agr. Environ. Sci., 2 (2): 98-104 (2017) Table 1. Isolates used for phylogenetic study. S.N. Accession No. Gi.no Description Size of the gene Place of isolate Dolichos yellow mosaic virus isolate DYMV AC2-1203-1631 South and South 1 NC-005338.1 41057586 complete genome AC4-2235-2480 east Asia AY309241.1 Dolichos yellow mosaic virus complete DNA- AC2-1203-1631 2 32187104 Mysore A segment AC4-2235-2480 Dolichos yellow mosaic virus DNA-A, AC2-1203-1631 3 AM157413.1 116077869 Banglore-2 complete sequence. AC4-2235-2480 Dolichos yellow mosaic virus segment DNA- AC2-1203-1631 4 AM157412.1 116077862 India A, complete sequence AC4-2235-2480 Dolichos yellow mosaic virus DNA A, AC2-1203-1631 5 AJ968370.1 90185977 Mysore complete genome AC4-2235-2480 Hyacinth bean yellow mosaic virus segment AC2-1203-1631 6 AY271891.1 33355890 Bangladesh DNA-A, complete sequence AC4-2235-2480 Table 2. BLAST Score result showing maximum similarity with other viruses.

Sonam Arya et al. /Arch. Agr. Environ. Sci., 2 (2): 98-104 (2017) 102

Figure 1. Phylogenetic tree of AC2 gene created by CLC-BIO.

Figure 2. Phylogenetic tree of AC4 gene created by CLC-BIO.

Figure 3. Multiple sequence alignment result of AC2 gene. Figure 4. Multiple sequence alignment result of AC4 gene. populations during the cropping season has also led to isolates from North India and Bangladesh. DoYMV- geminivirus problems in other countries evolution of new [Ban1] and DoYMV-[Ban2] originated from two separate variants of the viruses depends upon the variability among fields in Bangalore and were almost identical (99.1%) viruses l, it arises through mutations, development of (Table 2). Iiyas et al. (2010) reported genetic diversity and recombinants and pseudo recombinants. In the present phylogeography of begomoviruses infecting legumes in study, we examine the influence of variability in Gemini Pakistan. Moreover Maruthi et al. (2006) also reported viruses in relation to new disease problems. Variability in genetic similarities in the different begomovirus causes Gemini viruses is seen especially between isolates from Indian dolichos yellow mosaic disease. In an another study geographically different regions. This has been shown for Maruthi et al. (2006) also concluded that dolichos yellow MSV, where emerging Gemini viruses 6 isolates genomic mosaic virus belongs to a distinct lineage of Old World recombination in Gemini viruses may occur not only begomoviruses and it showed variations in its biological between variants of the same virus but also between virus and molecular properties. species (Tables 1, 2). In the above case, six different During the present study, the sequences of the genomes evolutionary pathways are possible using an out group, (DNA-A components) of the two DoYMV isolates each depicted by a different rooted tree. The sequence of originating from Bangalore (DoYMV-[Ban1] and DoYMV one clone was determined to be 2760 nucleotides in length -[Ban2]) were both 2762 nucleotides in length whereas the (accession number AJ968370) and to be most similar to the length of DoYMV- [Mys] was 2760 nucleotides it has sequences of DoYMV-[Bangladesh] (AY271891) and a been noted previously that the antigenic and genomic further clone of DoYMV originating from India variation in begomoviruses is primarily correlated with (AY309241) at 95·2% and 93·4% nucleotide sequence geography rather than their host range. Viruses infecting identities, respective. The three DoYMV isolates examined different host plants but originating from the same in this study showed the highest levels of sequence identity geographical area are more likely to be closely related than (92.5–95.3%) with the previously described DoYMV viruses infecting the same host but from different

103 Sonam Arya et al. /Arch. Agr. Environ. Sci., 2 (2): 98-104 (2017) geographical areas Dolichos yellow mosaic disease was induction of cotton leaf curl disease. Virology, 285: 234- suspected to be caused by a geminivirus after the success- 243. ful transmission of the pathogen from DYMD-affected Briddon, R.W., Pinner, Mansoor, S., Stanley, J. and Markham, plants by B. tabaci. The phylogenetic trees and multiple P.G. (1990). Geminivirus coat protein replacement alters insect specificity. Virology, 177: 85-94. sequence alignment result of the gene AC2 and AC4 Capoor, S.P. and Varma, P.M. (1948). Yellow mosaic of showed the geographical similarities (Figures 1-4). Phaseolus lunatus L. Current Science, 17: 152-153. The findings are in agreement with Padidam et al. (1996) Capoor, S.P. and Varma, P.M. (1950). New virus disease of Doli- who reported the role of AV2 (precoat) and coat protein chos lablab. Current Science, 19: 242-249. in viral replication and movement in tomato leaf curl Czosnek, H., Ghanim, M., Morin, S., Rubinstein, G., Fridman, V geminivirus. In an almost similar study Muniyappa et al. and Zeidan, M. (2001). Whiteflies; vectors, and victims of (1987) also isolated and characterized of Dolichos yellow geminiviruses. Advances in Virus Research, 57: 291-322 mosaic disease geminivirus causing yellow mosaic Dhakar, K., Gupta, V.K., Rathore, M.S. and Gaur, R.K. (2010). disease of Horsegram (Macrotyloma uniflorum (Lam.) Virus Resistance and Gene Silencing in Plants Infected with Begomovirus. Journal of Applied Sciences,10: 1787-1791. Verdc.). Dry, I., Krake, L.R., Rigden, J.E. and Rezaian, M.A. (1997). A Conclusions novel subviral agent associated with a geminivirus: the first report of a DNA satellite. Proceedings of the National Acad- The present study concluded that variations in Gemini emy of Sciences USA, 94: 7088-7093. viruses were seen especially between isolates from geo- Govindappa, M.R. Shankergoud, I., Shankarappa, K. S. and graphically different regions and this is likely due to the Wickramaarachchi, W.A.R.T. (2011). Molecular Detection MSV, where Emerging Gemini viruses 6 Isolates Genomic And Partial Characterization of Begeomovirus Associated With Leaf Curl Disease Of Sun Flower (Helianthus annuus) recombination in Gemini viruses may occur not only in Southern India. Plant Pathology Journal, 10 (1): 29-35. between variants of the same virus but also between virus Hanley-Bowdoin, L., Settlage, S.B., Orozoo, B.M., Nagar, S. and species. The sequence of one clone was determined to be Robertson, D. (1999). Geminiviruses: models for plant DNA 2760 nucleotides in length (accession number AJ968370) replication, transcription, and cell cycle regulation. Critical and to be most similar to the sequences of DoYMV- Reviews in Plant Sciences, 18: 71-106. [Bangladesh] (AY271891) and a further clone of DoYMV Harrison, B.D. and Robinson, D.J. (1999). Natural genomic and originating from India (AY309241) at 95·2% and 93·4% antigenic variation in whitefly-transmitted geminiviruses. nucleotide sequence identities, respective. The three Annual Review of Phytopathology, 37: 369-398. DoYMV isolates examined in this study showed the high- Hartitz, M.D., Sunter, G. and Bisaro, D.M. (1999). The geminivirus transactivator (TrAP) is a single-stranded DNA and est levels of sequence identity (92.5–95.3%) with the pre- zinc-binding phosphoprotein with an acidic activation do- viously described DoYMV isolates from North India and main. Virology, 263: 1-14. Bangladesh. DoYMV-[Ban1] and DoYMV-[Ban2] origi- Hayes, R.J. and Buck, K.W. (1989). Replication of tomato gold- nated from two separate fields in Bangalore and were en mosaic virus DNA B in transgenic plants expressing open almost identical (99.1%). The sequences of the genomes reading frames (ORFs) of DNA A: requirement of ORF (DNA-A components) of the two DoYMV isolates origi- AL2 for production of single-stranded DNA. Nucleic Acids nating from Bangalore (DoYMV-[Ban1] and DoYMV- Research, 17: 10213-10222. [Ban2]) were both 2762 nucleotides in length whereas the Iiyas, Muhammad, Qazi, Javaria, Mansoor, Shahid and Briddon, length of DoYMV- [Mys] was 2760 nucleotides it has W.R. (2010). Genetic diversity and phylogeography of begomoviruses infecting legumes in Pakistan. Journal of Gen- been noted previously that the antigenic and genomic vari- eral Virology, 91: 2091-2101. ation in begomoviruses is primarily correlated with geog- Maruthi, M.N., Rekha, A.R., Govindappa, M.R., Colvin, J. and raphy rather than their host range. Therefore, viruses Muniyappa, V. (2006). A distinct begomovirus causes Indi- infecting different host plants but originating from the an dolichos yellow mosaic disease. Plant Pathology, 55: same geographical area are more likely to be closely relat- 290. ed than viruses infecting the same host but from different Mansoor, S., Briddon, R. W., Zafar, Y., and Stanley, J. (2003). geographical areas Dolichos yellow mosaic disease was Geminivirus disease complexes: an emerging threat. Trends suspected to be caused by a geminivirus. Plant Science, 8: 128-134. Maramorosch, K. and Muniyappa, V. (1981). Whitefly transmit- Open Access: This is open access article distributed under ted plant disease agents in Karnataka, India. In International the terms of the Creative Commons Attribution License, Workshop on Pathogens Transmitted by Whiteflies, 31 July which permits unrestricted use, distribution, and reproduc- 1981, Association of Applied Biologists, Oxford, UK. Nari- tion in any medium, provided the original author(s) and the ani T.K. (1960) Yellow mosaic of mung (Phaseolus aureus). source are credited. Indian Phytopathology, 13: 24-29. Markham, P.G., Bedford, I.D., Liu, S. and Pinner, M.S. (1994). REFERENCES The transmission of geminiviruses by Bemisia tabaci. Pesti- cide Science, 42: 123-128. Bisaro, D.M. (1996). Geminivirus DNA replication. In DNA Muniyappa, V., Rajeshwari, R., Bharathan, N., Reddy, D.V.R. Replication in eukaryotic Cells, pp. 833-854. Edited by M. and Nolt, B.L. (1987). Isolation and characterization of Dol- L. DePamphilis. Cold Spring Harbor, NY. ichos yellow mosaic disease geminivirus causing yellow Briddon, R.W., Mansoor, S., Bedford, I.D., Pinner, M.S., mosaic disease of Horsegram (Macrotyloma uniflorum Saunders, K., Stanley, J., Zafar, Y., Malik, K. and Markham, (Lam.) Verdc.). Indian Journal of Phytopathology, 119: 81- P.G. (2001). Identification of DNA components required for 87.

Sonam Arya et al. /Arch. Agr. Environ. Sci., 2 (2): 98-104 (2017) 104 Muniyappa, V., Maruthi, M.N., Babitha, C.R., Colvin, J., Brid- Singh, P.K., Rai, N., Singh, D.V. and Singh, A.P. (2012). don, R.W. and Rangaswamy, K.T. (2003). Characterization Incidence of Dolichos yellow mosaic virus (DYMV) and of pumpkin yellow vein mosaic virus from India. Annals of yield potential in Indian bean (Lablab purpureus) F1'S. Applied Biology, 142: 323-331. Journal of Agricultural Technology, 8(4): 1469-1474. Maruthi, M.N., Manjunatha, B., Rekha, A.R., Govindappa, M.R., Swanson, M.M., Varma, A., Muniyappa, V. and Harrison, B.D. Colvin, J., and Muniyappa, V. (2006). Dolichos yellow (1992). Comparative epitope profiles of the particle proteins mosaic virus belongs to a distinct lineage of Old World of whitefly-transmitted geminiviruses from nine crop leg- begomoviruses; its biological and molecular properties. umes in India. Annals of Applied Biology, 120: 425-433. Annals of Applied Biology, 1744-1747. Stanley, J., Bisaro, D.M., Briddon, R.W., Brown, J.K., Fauquet, NCBI (2016). Dolichos yellow mosaic virus. Retrieved from C.M., Harrison, B.D., Rybicki, E.P. and Stenger, D.C. https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax. (2005). Geminiviridea In: Fauquet, C.M., Mayo, M.A., cgi?id=333968. Maniloff, J., Desselberger, U., Ball, L.A. (Eds), VIIIth Padidam, M., Beachy, R. N., and Fauquet, C. M. (1996). The role Report of the International Committee on Taxonomy of of AV2 (precoat) and coat protein in viral replication and Viruses. Virus Taxonomy. Elsevier/Academic Press, Lon- movement in tomato leaf curl geminivirus. Virology, 224: don, pp. 1163-1169. 390-404. Varma, A. and Malathi, V.G. (2003). Emerging geminivirus Prajapat, R., Gaur, R.K., Raizada, R. and Gupta, V.K. (2010). In problems. A serious threat to crop production. Annals of silico analysis of genetic diversity of begomovirus using ho- Applied Biology, 142: 145-164. mology modeling. Journal of Biological Sciences, 217-223. Varma, A., Malathi, V. G., Handa, A., Aiton, M., Harrison, B. Qazi, Javaria, Iiyas, Muhammad, Mansoor, Shahid and Briddon, D. Varma, J.P., Singh, R.P., Singh, M, Srivastava, M. and W.R. (2007). Legume yellow mosaic viruses: genetically iso- Singh, J. (1993). Occurrence of leaf-curl of cotton and okra lated begomoviruses. Molecular Plant Pathology, 343-348. in Northern India. Abstracts of the 6th International Raj, S.K., Aslam, N., Srivastava, K.M. and Singh, B.P. (1988). Congress of Plant Pathology, Montreal, Canada, pp. 17: 5- Association of Geminivirus-like particles with yellow mosa- 14. ic disease of Dolichos lablab. Current Science, 58: 813-814. Vanitharani , R., Chellappan, P., Pita, J.S., Fauquet, C.M. (2004) Rekha, A.R., Maruthi, M.N., Muniyappa, V. and Colvin, J. Differential roles of AC2 and AC4 of cassava geminiviruses (2005). Occurrence of three genotypic clusters of Bemisia in mediating synergism and suppression of posttranscrip- tabaci (Gennadius) and the rapid spread of the B-biotype in tional gene silencing. Journal of Virology, 78: 9487-9498. South India. Entomologia Experimentalis et Applicata, 117: Vanitharani, R., Chellappan, P. and Fauquet, C. M. (2005). 221-233. Geminiviruses and RNA silencing. Trends in Plant Rojas, M.R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Science, 10: 144-151 Sudarshana, M.R., Lucas, W.J. and Gilbertson, R.L. (2001). Yadava, P., Suyal, G. and Mukherjee, S.K. (2010). Begomovirus Functional analysis of proteins involved in movement of the DNA replication and pathogenicity. Current Science, 98:3-10. monopartite begomovirus, Tomato yellow leaf curl virus. Yang, X., Baliji, S., Buchmann, R.C., Wang, H., Lindbo, J.A., Virology, 291 110-125. Sunter, G., and Bisaro, D.M. (2007). Functional modulation Saeed, M., Mansoor, S., Rezaian, M.A., Briddon, R.W. and of the geminivirus AL2 transcription factor and silencing Randles, J.W. (2008). Satellite DNA β overrides the patho- suppressor by self-interaction. Journal of Virology, 81: genicity phenotype of the C4 gene of Tomato leaf curl virus, 11972-11981. but does not compensate for loss of function of the coat Yaraguntaiah, R.C. and Govindu, H.C. (1964). Virus disease of protein and V2 genes. Archives of Virology, 153: 1367-1372. Dolichos lablab var. typicum from Mysore. Current Singh, S.K., Chakraborty, S., Singh, A.K. and Pandey, P.K. Science, 33: 721-722. (2006). Cloning, restriction mapping and phylogenetic rela- Zrachya, A., Glick, E., Levy, Y., Arazi, T., Citovsky, V. and tionship of genomic components of MYMIV from Lablab Gafni, Y. (2006). Suppressor of RNA silencing encoded by purpureus. Bioresource Technology, 97: 1807-1814. tomato yellow leaf curl virus-Israel. Virology, 358: 159-165.

Archives of Agriculture and Environmental Science 2 (2): 105-108 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Importance of weather prediction for sustainable agriculture in Bihar, India

Vikram Kumar1*, Shaktibala2 and Shanu Khan3 1Department of Hydrology, Indian Institute of Technology, Roorkee- 247667 (Uttarakhand), INDIA 2Department of Civil Engineering, Rajasthan Technical University, Kota- 324010 (Rajasthan), INDIA 3Department of Electrical Engineering, Malaviya National Institute of Technology, Jaipur-302017 (Rajasthan), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 22 April 2017 The current study deals with the climate variability leads to economic and food security risks in Revised received: 18 May 2017 Bihar state of India and rest of other part also due to its significant influences on agriculture. In the Accepted: 26 May 2017 Bihar state, where agriculture is underachieve because of monsoon dependence and out of the 100 percent only 30 percent is fed by canal water. Climate is changing and its effects on agriculture are Keywords uncertain, and to get maximize output and to improving their livelihood within the major constraint, Crop management there is need for accurate weather forecast and information. Due to this the dependency of the Climate variability agriculture sector on monsoon correlates accurate weather forecasts with high demand. The key Optimal management Rainfall factor in all agriculture policy is the weather forecasting information which involves enhancing Risk farm risk management. The analysis showed that a 75% accuracy of agro-meteorological infor- Weather forecast mation is necessary for the agro-meteorological information to be worthwhile. However, challenges are there to the uncertainty of climate forecasts and to the complexities of agricultural systems. If better predictions of climate were available three to six months ahead of time, it may be possible to modify decisions to decrease unwanted impacts and to take advantage of expected favourable conditions. Also farmer is better geared to decide about his choice on crop management including appropriate time for sowing, wedding, and harvesting and fertiliser application. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Kumar Vikram, Shaktibala and Khan Shanu (2017). Importance of weather prediction for sustainable agriculture in Bihar, India. Archives of Agriculture and Environmental Science, 2(2): 105-108.

INTRODUCTION conditions and its influence on sowing, irrigation schedul- India is primarily an agricultural country and its economy ing, and overall crop management is predicted by the (despite the growth of the tertiary sectors) is still largely weather forecasting which often helps to advice the influenced by what comes from the farm. The Meteorolog- farmers. Stone and Meinke (2006) looked at weather ical conditions of any region play a crucial role in deter- information as a product for farmers in two distinct mining success or failure of crop production during the forms; tactical (short-term) and strategical (long-term) phase of growth and development of plant. Variability in based on the time range to which key management deci- the weather (i.e. delay in the monsoon, excessive rains, sions are influenced by weather information. Therefore, low rainfall, flood, high temperature, etc.) during the crop understanding the expected short run and long run changes period, would affect the crop growth and the quality and in the weather variables will go a long way to assist small- quantity of the total production. Weather forecast support holder farmers plan for the framing activities with the aim to improve the production of agriculture in scientific way, of lessening the potential effect of the weather. reduce risks and losses, increase crop and water use The Intergovernmental Panel on Climate Change (IPCC) efficiency (Cabrera et al., 2007; Ziervogel and Opere, has prognosticate that considering the spate of changes in 2010; Hansen et al., 2011). By optimum weather forecasts, climatic conditions, rain fed crop production could losses in crop can be optimized by undertaking some crop decrease by 50% by 2050 (IPCC, 2007). The effects of management in time and make selection of agriculture climate change on agriculture are uncertain but globally crops best suitable to the anticipated climatic conditions scientists agreed on the fact that it will make some (Kenkel and Norris, 1995). The real and probable climatic farmer’s environment worse off whilst improving the envi-

106 Vikram Kumar et al. /Arch. Agr. Environ. Sci., 2 (2): 105-108 (2017) ronment of others. Most promising and explored means to The study area has a total geographical area of 93.60 lakh mitigate climate change is the adoption and use of hectares over which it houses a population of 82.9 million, technological innovations such as irrigation, mechaniza- respectively generating a population density of 880 tion, fertilizers, rainwater harvesting technologies, pesti- persons per sq. km (Census 2001). Gross own area in the cides/insecticides, meteorological information and new State is 79.46 lakh hectares, while net sown area is 56.03 crop varieties tolerant to adverse climatic conditions as lakh hectares. Particularly in Bihar, there are around 1.04 solution for climate threat (Chuku and Okoye, 2009). crore land holdings out of which around 83 percent are Foremost the lacks of financial support to farmers and marginal holdings of size less than 1 hectare (Table 1). deficient institutional support have been thought of as the With around 90 percent of the total population living in main reason of the low absorption of technological options rural areas, agriculture as the primary feeder of rural econ- as mitigation strategies for climate change. omy continues to operate not only on margins of land but Rollins and Shaykewich (2003) observes the benefits also on the margins of human enterprise, its potency being generated from weather information usage by commer- among the least in the country. Without increasing returns cial users. Williamson et al. (2002) explained how to these margins, not much can be done realistically to enhanced forecasts made by satellite data tends to develop the agricultural sector. Thus, the role of agricul- several social and economic benefits. In addition, ture keeps up to define both the capability and impulsion to Davidson et al. (2012) suggested that the economic value development in Bihar. Since farmers have small land hold- of environmental prediction of weather information to ings, the agriculture income growth is highly essential to selected enterprises involved in the production, transmis- sustain. Strategic approach and meteorological forecast is sion and distribution of energy. On the other hand, several needed to enhance the farm income and to create better on studies have also looked at value of weather infor- farm opportunities. Agriculture not only provides pollina- mation with respect to agriculture. Predicatori et al. tion support to crops and enhances the yield, but it (2008) govern the real value of weather forecast infor- provides additional income. mation additionally to cost benefits analysis, Spicka and Methodology: The present work was based on Hilton Hnilica (2013) gave overview on data sources and (1981) work which describes the evaluation of agro- evaluation of weather derivatives. meteorological information. The Hilton (1981) supposes Agriculture is the only single largest private sector occupa- that the farmer knows the historical distribution of differ- tion in Bihar and can be considered the insecure business. ent climate conditions and uses this distribution in deter- Hence, the goal of the agricultural production system mining optimal inputs. As each model is different, only the should be to maximize income of land owning and landless general framework to value meteorological forecasts is rural populace to ameliorate their livelihoods. The vulnera- presented. Before the meteorological forecasts are availability to income and consumption shocks makes it impera- ble, the farmer maximizes expected net returns given the tive to develop formal agricultural insurance mechanisms historical distribution on the meteorological condition(s) of to cope with such risks. Thus the aim of the present interest: study is to catalogue study conducted in Bihar relative to the use of agro-meteorological forecasts and to (1) determine the desired information attributes, the most where π(H) is the maximum expected net returns using played strategies by farmers and the mean value added by the historical meteorological distribution (without the the use of these information. This study built a meta- meteorological forecasts), Ec represents the expectation database and by using descriptive statistics it will provide operation taken over the meteorological condition(s) of the mean benefit derived from the use of climate forecast interest, c, and h(c) represents the historical meteoro- and the conditions under which these forecasts are useful logical condition(s) probability density functions (pdf), w or harmful. is net return function, and D represents the decision set. When the decision maker obtains forecast that modifies MATERIALS AND METHODS the decision maker’s knowledge concerning meteorologi- Study area: Bihar is located in the eastern region of India cal condition(s), the problem becomes: along with latitude 24°-20'-10" N ~ 27°-31'-15" N and longitude 82°-19'-50" E ~ 88°-17'-40" E. It is an entirely (2) land–locked state, in a Sub Tropical region of the temper- where ( ) is the maximum expected net returns asso- ate zone. It is surrounded by Nepal in the north and by ciated with forecast and ( / ) is the modified Jharkhand in the south. The river Ganga which flows (probability density functions) density function associated through the middle from west to east divides Bihar plain is with the forecast. Forecast is only one of many possible into two unequal halves. Thus the very geographical forecasts. Expected net returns from using the meteorologi- setting of the State coupled with hydrometeorology, cal forecast information are: hydrology, geomorphology and topography prevailing in the region makes it one of the worst flood affected region (3) in the world. The entire North Bihar is crisscrossed by where ( ) is the maximum expected net returns associat- the major rivers such as: the Ghaghra, the Gandak, the ed with forecast system and ( ) is the density func- Bagmati, the Kamla-Balan, the Kosi and the Mahananda tion associated with receiving the different forecasts, . which all, meet the mighty Ganga on its left bank. The expected value of the meteorological forecasting

Vikram Kumar et al. /Arch. Agr. Environ. Sci., 2 (2): 105-108 (2017) 107 system is: farmers are falls under the marginal category of land holding and do not having good sources of irrigation and they (4) are dependent on the precipitation for growing their crops. The gain from information is the difference between the Similarly the small, semi medium categories of the farmers net returns when the information is used optimally and the in Bihar are dependent on the rainfall for the cultivation of expected net returns when the decisions are made optimal- their land as they do not have their own irrigation sources ly without the forecasts. Consistency is maintained with (Table 1). Therefore, forecasting of weather information is the probability density function associated with the very helpful tool for the planning of agricultural crops in forecasts, such that the system is forecasting climatic the Bihar state. The medium or large categories sometimes events and not altering the overall historical probability of having their own sources of irrigation water and compara- a particular event. tively less dependent on the rainfall (Table 1). In the Bihar state, where agriculture is underachieve because of mon- RESULTS AND DISCUSSION soon dependence and out of the 100 percent only 30 per- According to Murphy (1993), forecasts are considered cent is fed by canal water. The past evidence show that “authentic” when the forecast probability is an exact forecasts predicting normal rainy season is merely useful estimation of the relative frequency of the predicted for farmers and in most studies normal rainy season is used outcome. The use of meteorological forecasts depends as control year (without knowledge regarding the coming highly on the degree of ease of access and the ease of rainy season). Sultan et al. (2009) foresaw in Senegal that use of the forecasts. For meteorological forecasts to be farmer’s income would increase significantly, by 13.8%, valuable it has to be delivered in advance and at the right 8.5% and 15% for one, two and three month in ad- time to enable farmers to make appropriate decisions. The vance forecasts of the rainy season, respectively when the delivery of information in advance and at the appropriate dry season is correctly forecast. To get the optimal lead time is defined as timeliness. Sultan et al. (2009) think that time author have chosen a game theory. The optimal lead this attribute can affect significantly the value of meteoro- time computed is 1-2 month before the onset of rains. The logical forecasts. The simulation model or ex-ante lead time is highly correlated with the accuracy moreover approach generally simplifies farmer’s environment, as- the value of climate forecasts was also highly correlated suming that farmers maximize utility or profit and finally with the accuracy of the agro-meteorological information. varying the characteristics such as lead time, accuracy and The results of the present analysis showed that a 75 % details of the meteorological forecasts to derive the value accuracy of agro meteorological information is necessary of the meteorological forecasts (Sultan et al., 2009). for the meteorological information to be worthwhile. If the The role of rainfall in Indian agricultural system is very accuracy of information is less than 60% then the use of important as in most of the states of the country the culti- meteorological information will be harmful as discuss vation practices like preparation of the schedule of crops (Ziervogel et al., 2005). cultivation, agriculture field, sowing of crops, fertilization Agro-meteorological support for farm management: are rainfall dependent. In most of the regions the scarcity Present section describes about the weather based farm of irrigation water makes the farmers dependent on the advisories as a support system as shown in Figure 1. This weather prediction and weather forecast. Sometimes the system organised after the characterization of agro-climate, lands remain uncultivable due to the failure of monsoon, including length of crop growing period, moisture availa- thus accurate weather forecasting is very important of agri- bility period, distribution of rainfall and evaporative culture in Indian states (Cabrera et al., 2007; IPCC, 2007) demand of the regions, weather requirements of cultivars During the present study, it is clearly indicated from the and weather sensitivity of farm input applications. values presented in the Table 1 that nearly 82.9 percent

Table 1. Distribution of farmers along with land holding in Bihar, India.

Category of Operational No. of holdings farmers holding (in Ha.) Marginal 85, 45,932 (82.9%) 27, 87, 789 (40.8%) (0-1 Ha.) Small 10, 05,650 (9.6%) 13, 00,667 (19.0%) (1-2 Ha.) Semi medium 5, 90,650 (5.7%) 15, 82,279 (23.1%) (2-4 Ha.) Medium 1, 78,295 (1.7%) 9, 75,355 (14.3%) (4-10 Ha.)

Large 11, 570 (0.1%) 1, 93,760 (2.8%) (10- above Ha.) Figure 1. Agro-meteorological advisory service system for farm management. Total 1, 04, 32,417 (100%) 68, 39,850 (100%)

108 Vikram Kumar et al. /Arch. Agr. Environ. Sci., 2 (2): 105-108 (2017) Conclusions REFERENCES The farmers obtain highest output and improve their liveli- Cabrera V. E., Letson, D. and Podesta, G. (2007). The value of hood within the main limitation as dependence on rain-fed climate information when farm programs matter. Agricultur- agriculture, therefore having access to weather forecast al Systems, 93:25-42. DOI 10.1016/j.agsy.2006.04.005. information is very important. It is an urgent need of met- Chuku, C.A. and Okoye, C. (2009). Increasing resilience reduc- rological report that is easily accessible and understanding vulnerability in sub- Saharan African agriculture: strate- able to the farmers. The delivery of the weather infor- gies for risk coping and management. African Journal of mation should be a key factor in all the agricultural Agricultural Research, 4(13): 1524-1535. DOI URL http:// www.academicjournal.org/journal/AJAR/articleabstract/4A policies and discussions in enhancing farm risk manage- 1D72832286. ment. As complexities of agricultural systems and the Davidson, M., Gurtuna, O., Masse, C. and Mills, B. (2012). uncertainties of climate forecasts recommended that a Factors affecting the value of environmental predictions to coordinated effort is needed if this technology is to be rou- the energy sector. Informatics for sustainable energy devel- tinely used in agriculture in the future. In this regard there opment and environmental management. 1(4). DOI is a need to increase complementarily among information, 10.1186/2193-2697-1-4.10. Dec. 2016 technology and public intervention by; improved infor- Hansen, J. W., Mason, S.J., Sun, L. and Tall, A. (2011). Review mation on agro climatic potential i.e., a greater range of of seasonal climate forecasting for agriculture in Sub- measurement, more computer–based analysis, more agro Saharan Africa. Experimental Agriculture 47(2): 205-240. climatic screening of environments to match agricultural DOI 10.1017/S0014479710000876. IPCC, (2007). Summary of policy makers. Climate change 2007. activities to regional weather–types and improve weather Impact, adaptation and vulnerability: fourth assessment re- forecasting or by improved use of new agricultural tech- port. Intergovernmental Panel on Climate Change, Geneva. nologies (such as high–yielding varieties) to increase Cambridge University Press. URL: https://www.ipcc.ch/pdf/ production potential in good years and reduce losses in assessment-report/ar4/wg2/ar4_wg2_full_report.pdf. 08 Oct. poor years; A focus on integrated regional development to 2016. reduce overall vulnerability to drought by increasing pub- Kenkel, P.L. and Norris, P.E. (1995). Agricultural producers lic awareness; and development of a consistently applied willingness to pay for real-time mesoscale weather infor- and widely known set of drought policies to reduce the mation. Journal of Agricultural and Resource Economics 20 uncertainty that stems from ad hoc public intervention. (2): 356-372. This present study provide insight story of determinants to Predicatori, F., Giacomazzi, F., Frontero, P. and Bellodi, M. (2008) Agriculture and climate change: an evaluation of use of climate information related to perception and com- the willingness to pay for improved weather forecast. Final munication, and some evidence that improved presentation FORALPS Conference on Contributions for a wise manage- may overcome some of the barriers and enhance utility. ment of water resources from meteorology and climatology, The weather information should be given by the agro- Trento Italy. meteorological stations before one or two month before the Rollins, K.S. and Shaykewich, J. (2003). Using willingness-to- onset of the rainy season that can allow the farmers to pay to assess the economic value of weather forecasts change critical decisions such as crops sowing schedule, for multiple commercial sectors. Meteorological Applica- crop varieties, cropping ratio, intensification of production, tions, 10: 31-38. DOI 10.1017/S1350482703005048. allocation of labour and capital. The results of the anal- Spicka, J. and Hnilica, J. (2013). A methodical approach to ysis showed that a 75% accuracy of meteorological design and valuation of weather derivatives in agriculture. Advances in Meteorology, Article ID 146036, Vol. 2013: 1- information is necessary for the meteorological infor- 8. DOI 10.1155/2013/146036. mation to be worthwhile. Moreover the weather infor- Stone, R.C. and Meinke, H. (2006). Weather, climate, and farm- mation forecasted by the agro-meteorological can support ers: an overview. Meteorological Application. (Supplement), to plan a smart fertilizer subsidy programme as well as 13: 7–20. DOI 10.1017/S1350482706002519. smart improved seed programme. Moreover, the findings Williamson, R.A., Hertzfeld, H.R. and Cordes, J. (2002). The of this study have contributed interesting additional re- socio-economic value of improved weather and climate search hypotheses, and have influenced the development of predictions. several research larger proposals. Ziervogel, G. and Opere, A. (2010). Integrating meteorological and indigenous knowledge-based seasonal climate fore- Open Access: This is open access article distributed under casts for the agricultural sector: Lessons from participa- the terms of the Creative Commons Attribution License, tory action research in subsaharan Africa. Ottawa, Cana- which permits unrestricted use, distribution, and reproduc- da: International Development Research Centre. URL: tion in any medium, provided the original author(s) and the http://www.eldis.org/go//home&id=59432&typeDocument#. source are credited. WQ8r7m41HIU. 21 Sept.2016.

Archives of Agriculture and Environmental Science 2 (2): 109-112 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Taxonomic significance of stem and petiole anatomy of three white varieties of Vigna unguiculata (L.) Walp.

Aziagba Bibian Okwuchukwu1* and Okeke Clement Uwabukeonye1 1Department of Botany, Nnamdi Azikiwe University Awka, Anambra State NIGERIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 09 March 2017 Anatomical studies were carried out on the stem and petiole of three white varieties of Vigna Revised received: 10 April 2017 unguiculata L. (Walp.) belonging to the family Fabaceae consumed in Awka Anambra State Accepted: 02 May 2017 Nigeria. The structures of the stem and the petiole showed the basic structure of a dicotyledonous plant. The transverse section of the stem and petiole consists of epidermal and collenchyma layers, Keywords parenchyma cells and stele (vascular bundles, secretory cells and pith); however there were differ- Petiole ences in shape and position of the vascular bundles. In the stem, this bundles are located on a Significance continuous ring but in the petiole are cutting and divided into two large adaxial and three abaxial Stem Anatomy bundles forming main foliar trace, which above it lie laterally a pair of secondary bundles. The Taxonomy relationships found in this study provide insights to the phylogeny of the species and revealed the Vigna unguiculata importance of combined data from different taxonomic evidences to have clearer information on varietal relationships to enhance the delimitation of Vigna species. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Aziagba, B.O. and Okeke, C.U. (2017). Taxonomic significance of stem and petiole anatomy of three white varieties of Vigna unguiculata (L.) Walp. Archives of Agriculture and Environmental Science, 2(2): 109-112.

INTRODUCTION research on Costaceae family observed differences on the features of vegetative anatomy and suggested a separate Vigna unguiculata (L.) Walp belongs to the family Faba- specific status for Costus afer and Costus lucanusianus ceae. It is one of the most ancient human food sourc-es and which opposed the conspecific treatment given to them by has probably been used as a crop plant since Neolithic previous researchers. In leguminoceae-Ceasalpinoideae, times. An annual dicotyledonous legume and a warm the unicellular and multicellular trichomes described in weather crop, well adapted to drier regions of the tropics certain species of Senna tournex Mill and Senna hirsuta like Nigeria, where other food legumes do not thrive well was diagnostic in the acquisition of these two types of tri- (Sankie et al., 2012). Nigeria is the largest producer and chomes (Edooga and Osakwe, 1996). In anatomical study consumer of V. unguiculata, accounting for about 45 per- of the transverse section of the root of Capsicum species, cent of its world‘s production (Lowenberg-Deboer and homodorminant anatomical features was reported which Ibro, 2008; Ndong et al., 2012) while the whole of Africa strengthens the affinity relationship in the genus Capsicum accounts for about 75% (Brissibe et al., 2011). Four sub- (Aziagba et al., 2014). Ezeabara et al. (2013) also recorded species are recognized; of which three are cultivated (more affinity relationship in the study of stem anatomy of Citrus exist, including textilis, pubescens, and sinensis). Anatomi- species. Type, size, shape, stella patterns, vascular bundles, cal characters are very useful in the determination of rela- rays, parenchyma, epidermal and phloem cells are some of tionship in orders and genera and their features have the basic anatomical characters of well established taxo- played an increasingly important role in phylogenetic rela- nomic value (Sharma, 1993; Pandey, 2007). In view of tionships. Stace (1984) discovered that trichome anatomy this, anatomy has been a critical tool to Taxonomist in the is of immerse significance in classification at levels from classification and separation of taxa (Illor et al., 2011). the circumscription of the family down to the separation of Therefore, this research was to investigate the transverse species and even varieties. In particular it has led to an section of the stem and petiole of three white varieties of improved tribal classification within the largest genus V. unguiculata (Var. Potiskum, Sokoto guzo and Iron Combretum. Edeoga and Okoli (1997) carried out a beans) popularly called cowpea to ascertain the use of stem

110 Aziagba Bibian Okwuchukwu and Okeke Clement Uwabukeonye /Arch. Agr. Environ. Sci., 2 (2): 109-112 (2017) and petiole micro morphology in the identification and were arranged in a slide rack and placed in an oven at 70°C classification of Vigna species which will be useful in to melt off wax from the sections. This lasted for 12 hours. understanding the affinity relationship that exist among the For staining, the sections of the stems and the petioles genus Vigna. were dehydrated by passing slides across xylene and xylene/absolute ethanol series (3:1, 1:1 and 1:3 v/v), absolute MATERIALS AND METHODS ethanol, 95, 70,50 and 30% ethanol. The slides bearing the Procurement of materials: The seeds of V. unguiculata stems and petioles of three varieties were briefly immersed for this study were sourced from various markets in Anam- in water, then stained with 0.1% alcian blue and counter bra state where there were major distributors from the stained with 1% safranin. Stained slides were rinsed briefly North. (Eke Awka, Aforigwe, Nkpor, Ose okwodu) Tags in tap water dehydrated through the ethanol series and bearing numbers and alphabets were used for the identifi- cleared across the xylene /absolute ethanol series. cation of the places and varieties collected. This was Mounting of the slides bearing the stems and petioles of authenticated by a Taxonomist Prof C.U. Okeke and the three white varieties was carried out by placing one Aziagba, B.O. of the Department of Botany, Nnamdi drop of Canada balsam on a clean slide and carefully Azikiwe University Awka. Three white varieties; covering the sections with the cover slip in a way that the Potiskum, Sokoto guzo and Iron beans were then selected Canada balsam will spread and covered the specimen for the experiment. The voucher specimen was deposited sections overlaid by the cover slip. They were studied and at the Herbarium in the Department of Botany Nnamdi photomicrographs taken with DSWC 230 Sony Camera. Azikiwe University Awka Anambra State Nigeria. Plant- This method was the method of AOAC (1984). ing of the seed was between the month of August and Sep- RESULTS AND DISCUSSION tember. Planting was done in rows and seeds spaced at 2 to 8cm in the row at the dept of 1 to 6cm deep ensuring Results of the anatomy of the stems and petioles of the good seed and soil contact. This was on complete random- three white varieties Potiskum, Sokoto guzo and Iron ized design (CRD). The stems and petioles for the study beans V. unguiculata are presented in Plates 1-6. were collected thereafter at the flowering stage of the The transverse section of the stem of the three varieties plant. appeared in ribbed form. The epidermal layers showed Anatomical studies: The stems and petioles of the three single layer of epidermis covered with rectangular cells white varieties of Vigna unguiculata under study were and a thick cuticle. There was presence of ring pores which collected from the experimental site and preserved in vials are round and appeared in multiple radial indicating containing formaldehyde, glacial acetic acid and alcohol in growths. Apotrachial parenchyma in var. potiskum was the ratio of 1:1:8 respectively. The specimens were dehy- banded and paratrachial were also banded, possessing oval drated in ethanol series (30% 50% 70% and 95%) each for cells and thin walls inside the cortex, this was also 2 hours. The specimens were stored in absolute ethanol observed in var. iron beans and sokoto guzo. Collenchyma (99.6%) overnight to ensure complete dehydration of the was present near the epidermis. There was presence of stem and petiole specimens of the tree white varieties of V. xylem and phloem. Xylem is composed of protoxylem unguiculata. The specimens were then cleared in 3:1, 1:1 toward the plant center and metaxylem at the apical side of and 1:3 ethanol/chloroform each for 3 hours. Anatomical plant. The secretory cells were located very close to the Wax was melted at 70°C in an oven. The cleared speci- phloem. These bundles are relatively of different sizes and mens were then put in molten anatomical wax and alcohol numbers. The vascular bundles were more in number in and allowed to stay at 70°C for 24 hours for effective infil- Potiskum and Iron bean. There was also presence of large tration of wax into the specimen to replace the chloroform pith in the stem center which consists of polygonal paren- which was gradually lost by evaporation. Embedding was chymatous cells which tend to decrease in size towards the carried out after infiltration. Embedding of the stems and periphery. Intercellular spaces were small and visible in petioles of the varieties for this research was performed by the three white varieties and vessels of different sizes smearing glycerin inside the clean molds and the molten (Plates 1-3). The slight variations and similarities in the wax poured into the molds. This was done carefully to number of vascular bundles, ring pores, parenchyma cells ensure that the molten wax suits the type of sections cut. and collenchyma cells in the stem showed intra and Cooling of the wax in the mould was to allow it to block. interspecific relationship among the varieties. Ajuru and These wax blocks were brought out from the mould stuck okoli (2013) noted variation in the layers of collenchymas on wooden holder and labelling of the specimens were in Mormodica species as a distinguishing character. In the done prior to the time for sectioning. petiole, the upper and lower epidermis of the three varie- Wax blocks which was freed from the holder was trimmed ties is covered with thick cuticle. These layers are single- and affixed on the sledge microtome. Sectioning was per- layered with rectangular cells .The stomata observed are formed at 15-20 microns thickness for the entire specimen. paracytic as in Fabaceae family which consist of guard The thin sections were fixed on clean slides already cells typical of kidney shape. These stomata occur on both smeared with a thin film of egg albumen. The sectioned the lower and upper epidermis but most frequently on the stems and petioles were stretched by passing them over hot lower surface. The mid rib is well developed. The xylem plate. This also made them to become attached to the and phloem seen were collateral on the three varieties. slides. Slides bearing sections of the stems and petioles Xylem is towards the upper side while phloem is on the

Aziagba Bibian Okwuchukwu and Okeke Clement Uwabukeonye /Arch. Agr. Environ. Sci., 2 (2): 109-112 (2017) 111 lower side. These variations are diagnostic and could be opposed the conspecific treatment given to them by used to differentiate the varieties. Among these characters previous researchers. In Leguminosae-Caesalpinoideae, the the parenchymatous layers and number of vascular bundles nature of unicellular and multicellular trichomes described which are more in number in Potiskum and Sokoto guzo in certain species of Senna Tourn ex Mill and Senna and of various sizes at the apical portion of the petiole was hirsuta was reported to be diagonostic in acquisition of found to be constracting. Metcalfe and Chalk (1950) and these two types of trichomes (Edeoga and Osawe, 1996). Abbas et al. (2006) have noted that the number of petiolar The cambium initials were observed in the primary vascu- bundles is a reliable delimiting character among dicotyle- lar bundle between the xylem and phloem at the basal part donous plants. The character has been used in the taxono- of the stem. These tissues are seen in many fabaceae my of many plant families. Norani et al. (2016) revealed families. There are many unicellular trichomes on the the use of petiole bundle as a taxonomic tool in the identi- petiole transverse section. The morphology and density of fication of some species of the tribe Dipterocarpeae. leaf trichomes vary considerably among plant species this Devades and Brck (1972 and Ataslar (2004) also reported was reported by Edeoga and Osakwe (1996) and they also that vascular bundles form a continuous ring, this is in stated that it may also vary among populations and within agreement with Ataslar (2004) that vascular bundles are individual plants. Thus, the structure of the trichomes can also seen in many points of the adaxial and abaxial surfac- range from unicellular to multicellular and it can be es of the leaf. Shaheen (2006) reported variations in the straight, spiral, hooked branched or unbranched. (Edoga number of secondary vascular bundles in the petioles of and Osakwe, 1996). The presence of collenchyma cells in some mimosoid species, and thus used as distinguishing layers and position are of taxonomic importance (Shaheen, characters among the taxa. The presence of trichomes 2006, 2007). In general, the anatomical structures of the varies among the varieties (Plate 3-6). These differences stem and petiole of the three white varieties were very suggested moderate affinity in the white varieties. The important and could be used in the diagonostic key of the variations in the position of the rays and pore sizes and taxa at all taxonomic levels. The variations seen in some of numbers strengthen the reliability of anatomical characters the anatomical structures can be attributed to environmen- in systematic botany as stated by Ayensu (1970). Scientific tal conditions or gene breakdown observed in some importance and implications of anatomical features in angiosperms while the similarities were more accurate different groups of plants has been reported in many litera- showing the three varieties are phylogenetically related. tures. They include Dioscoreaceae, where certain anatomi- Although no character is absolutely immutable, some are cal features were used in the characterization of Dioscorea fixed than others and it is on those that are less plastic that alata (L.) and Dioscorea smilacifolia (L.) (Edeoga, 2002). the systematic anatomists rely because they are not really Edeoga and Okoli (1997) conducted their research on affected by environmental conditions (Guerra and Costaceae family observed differences in the features of Nogueira, 1990). Therefore comparative plant petiole and vegetative anatomy and suggested a separate specific stem anatomy have been observed to be reliable in plant status for Costus afer and Costus lucanusianus which taxonomy and systematic of many angiosperm species.

1 2 6

Plate 4-6. Transverse section of Petiole of V. unguigulata (Var. 3 4 Potiskum, Sokoto guzo and Iron beans × 40), respectively. Conclusions The present study concluded that there is need for additional ways to identify morphological similarity between varieties of V. unguiculata (L.) and stem and petiole anatomy is one of them because it revealed the intra and interspecific relationship in and between the three white varieties of V. unguiculata. A dichotomous key to aid the identification of Vigna varieties is provided. A dichotomous key for the identification of white Plate 1-3. Transverse section of stem of V. unguigulata (Var. varieties of V. unguiculata Potiskum, Sokoto guzo and Iron beans × 40), respectively.

112 Aziagba Bibian Okwuchukwu and Okeke Clement Uwabukeonye /Arch. Agr. Environ. Sci., 2 (2): 109-112 (2017) 1 Stem of white varieties 2 Root and Tuber Crop, (5): 33-38. 1 Petiole of white varieties 3 Edeoga, H.O. and Okoli, B.E. (1997). Anatomy and systematic in 2 Shape of ring pores round 3 the Costus afer, Costus lucanusianus complex (Costaceae). 2 Shape of ring pores scattered Sokoto guzo Acta Phytotaxonomy and Geobotany, 45: 151-158. 3 Apotrachial parenchyma Terminal Sokoto guzo Edeoga, H.O. and Osawe, I.O. (1996). Cuticular studies of some Nigerian species of Senna Tourn. Ex Mill. (Syn Casia 3 Apotrachial parenchyma banded 2 Tourn. Ex. L): Leguminosae Caesalpinoideae. Acta Phyto- 4 Collenchyma layers single 5 taxonomy and Geobotany, (47): 41-46. 4 Collenchyma layers 1-2 Iron beans Ezeabara, A.C., Okeke, C.U., Aziagba, B.O., Muoka R.O. and 5 Intercellular spaces normal 7 Ilodibia C.V. (2013). Transverse section of stem of Citrus 5 Intercellular spaces narrow and aggregate Sokoto guzo species and their taxonomic significance. International 6 Number of vascular bundles stem 22-28 Journal of Plant Research, 3 (3): 23-26. 6 Number of vascular bundles petiole 10-14 Guerra, M.D. and Nogueira, M.T.M. (1990). The cytotaxonomy of Emillia spp.(Asteraceae; Senecioneae) occurring in Open Access: This is open access article distributed under Brazil. Plant Systematic Evolution, 170: 229-236. the terms of the Creative Commons Attribution License, Illoh, H.C. and Adedeji, A.A. (2011). Comparative systematic which permits unrestricted use, distribution, and reproduc- foliar morphological and anatomical studies of three Cleome tion in any medium, provided the original author(s) and the (Linn.) Species in Nigeria. Nigerian Journal of Botany, 24 source are credited. (1): 17-42. Lowenberg-Deboer, J. and Ibro, G. (2008). A study of cowpea REFERENCES value chain in Kano State, Nigeria from Apro-poor and Gender perspective. A paper commissioned by Gate project Abbas Azim, R, Jamzad, Z Sefidkon F. and Baklish-Khaniki, G. pp: 16 (2006). The potential value of phytoche Mical and micro morphological characters in taxonomic treatment of genus Ndong, A., Kebe, K.H., Thiaw C.H., Diome, T. and Senbene, M. Vitex L. Lamiaceae. Iran Journal of Botany, 12(1): 15-35. (2012). Genetic distribution of the cowpea (Vigna unguicu- Ajuru, M.G. and Okoli, B.E. (2013). Comparative vegetative lata L.Walp.) (Bruchid Callosobruchus malculates F. Cole- anatomy of some species of the family Cucurbitaceae Juss in optera of Bruchidae) population in different agro-ecological Nigeria. Research Journal of Botany, 8:15-23. area of west. African Journal of Animal Science Advances, 2 AOAC (1984).Official Methods of Analysis.14th Edn, Associa- (7): 616-630. tion of Official Analytical chemists, Washington DC USA Norami, T., Ruzi, A.R, Ismail, B.S., Ummuhani, B., Salwa, S. pp: 522-533. and Aziaze yanty, J. (2016). Petiole vascular bundle and its Ataslar, E. (2004). Morphological and anatomical investigations taxonomic value in the tribe Dipterocarpea on the Saponaria kotschyi Bioss. (Caryophyllaceae). Turkey (Dipterocarpaceae) Journal of Sains Malaysaiana, 45(2): Journal of Botany, (28): 198-199. 247-253. Ayensu, E.S. (1970). Comparative anatomy of Dioscorea rotun- Pandey, B.P. (2007). A text Book of Botany Angiosperms. S. data poir and Dioscorea cayenensis LAM. Botanical Journal Chand and Company Ltd., New Delhi pp: 990. of the Linnanean Society, (1): 127-136. Sankie, L., Agbogidi, O.M. and Egho, E.O.(2012). Evaluation of Aziagba, B.O., Okeke, C.U., Ezeabara, C.A., Uka, C.J. and eight varieties of cowpea Vigna unguiculata (L.) Walp. Egboka, T.P. (2014). Transverse section of the root of European Journal of Sustainable Development, 1(2): 303- Capsicum species and their taxonomic importance. Journal 314. of Plant Sciences, 2(5): 222-225. Sharma, O.P. (1993). Plant Taxonomy .Tata McGraw-Hill Brissibe, E.A., Adugbo, S.E., Ekanem, U., Brissibe, F. and Publishing Company Limited, New Delhi pp: 482. Figuerira G.M. (2011). Controlling Bruchid Pest’s pest of Shaheen, A.M. (2007). Characteristics of stem-leaf transitional stored cowpea seeds with dried leaves of Artemesia annua zone in some species of Caesalpiniodeae (Leguminosae). and two other Botanicals. African Journal of Biotechnology, Turkey Journal of Botany, (31): 297-310. 10(47): 9586-9592. Shaheen, A.M. (2006). The value of vascular supply of the peti- Devadas, C. and Brck, C.B. (1972). Comparative morphology of ole trace characteristics in the Systematics of some species the primary vascular systems in some species of Rosaceae of subfamily Mimosoideae: Leguminosae. Assuit and Leguminosae. American Journal of Botany, (59): 557- University Journal of Botany, (35): 193-213. 567. Stace, C.A. (1984). The Taxonomic importance of the Leaf Sur- Edeoga, H.O. (2002). Anatomical studies on the roots of some face .In: Heywood, V.H. and Moore, D.M. (eds) Current Dioscorea L. species (Dioscoreaceae). African Journal of Concepts in Plant Taxonomy, London. 67-105.

Archives of Agriculture and Environmental Science 2 (2): 113-118 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

ORIGINAL RESEARCH ARTICLE Occurrence and floral details of four new invasive alien species in Uttarakhand, India

Sumita Rana* and Jyotsna Rastogi Department of Biological Sciences, College of Basic Sciences and Humanities, G. B. Pant University of Agriculture and Technology, Pantnagar-263145 (Uttarakhand), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 21 May 2017 The present paper deals with the communication of four new species which are addition to the old Accepted: 02 June 2017 reported species out of these 91 species which were studied. Four new invasive alien species (IAS) are Acmella radicans (Jacq. R.K. Jansen), Eclipta prostrata (L.) L., Euphorbia cyathophora Murray Keywords and Senna alata (L.) Roxb. was recorded as new elements in IAS flora of Uttarakhand. The study is Eradication conducted during 2011- 2015 to compile a comprehensive list of Invasive alien species. A total of Flora 91 Invasive Alien Species were collected from the different areas of Pantnagar. These 91 IAS Invasion belonged to 70 genera under 30 families. Dicotyledons were representing by 82 species belonging Invasive alien species to 63 genera under 25 families, whereas monocotyledons were represented by 9 species belonging Uttarakhand. to 7 genera under 5 families. The taxonomic analysis of IAS revealed dominance of Asteraceae with 16 species in 14 genera followed by Amaranthaceae with 10 species in 7 genera, Fabaceae with 8 species in 6 genera, Malvaceae with 7 species in 6 genera, Convovlvulaceae with 7 species in 3 genera, Solanace- ae with 6 species in 4 genera, Poaceae with 4 species in 3 genera and Euphorbiaceae with 4 species in 2 genera. Results of this study clearly indicate presence of 52.60% of IAS flora of India and 55.82% of IAS flora Uttarakhand in such a small area of Pantnagar. Eradication of these species is impractical and costly; however, their population needs regular monitoring and any new introduction need eradication as early as possible. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Rana Sumita and Rastogi Jyotsna (2017). Occurrence of new species of invasive alien flora in Uttarakhand, India. Archives of Agriculture and Environmental Science, 2(2): 113-118.

INTRODUCTION many native species. Invasive alien species compete with Environment is an intricate system of various elements native flora for resources such as nutrients, light, physical which are related to each other on this earth. Plants are space, water and food. Such species are considered as inva- the major group of organisms present on the earth. Every sive alien species (IAS). They are known by several other species has its own role to play in the environment (Sala names such as non native, introduced, non indigenous, et al., 2000; McNeely, 2001; Balakrishan et al., 2012). exotic and foreign species. Invasive alien species occur in Humans and most other animals are totally depending on all groups of plants and animals (McNeely et al., 2001; the plants directly or indirectly. Introduction of a plant in Sharma et al., 2005). IAS is widely distributed in all type an area may be natural or in a planned manner. Some spe- of ecosystem throughout the world and includes all catego- cies become established in a new environment outside ries of living organism. The invasive alien plants are the their natural range, spread rapidly and cause harm to other subgroup of naturalized plants that produce reproductive species, communities or entire ecosystem and to human off springs, often in a very large numbers, at significant well beings. Plant invasion is recognised as an important distances from the parent plants, and consequently have driver of global biodiversity change around the world. An the capability to spread in the large areas (McNeely, 2001). invasive alien species (IAS) is considered as a species that Invasive alien species are one of the most significant is non-native to the ecosystem and cause negative impact drivers of environmental change worldwide (Mooney and on the biodiversity. Invasion by the alien species dramati- Hobbs, 2000; Sala et al., 2000). The invasive species cally affect the distribution, abundance and reproduction of generally have dramatic and negative effect on the other

114 Sumita Rana and Jyotsna Rastogi /Arch. Agr. Environ. Sci., 2 (2): 113-118 (2017) species and even entire ecosystem to the extent that it largest university in the world, in terms of continuous area. includes the extinction of species or sometimes even the In Pantnagar area natural stands of Tarai forest vegetation hydrology and nutrition cycles of entire ecosystems have are completely removed for cultivation or activities related changed. Invasive alien species may be found in all taxo- with urbanization. As such this area presents a good exam- nomic groups from prokaryotes to the higher plants and ple of removal of native flora partially or completely and animals. These species have a quality that they exploit bare invasion of vegetation by alien elements. soil and empty niches (Singh et al., 2010; Balakrishan et Floristic account: A tentative list of IAS species based on al., 2012). The first step to manage these species is to Reddy (2008) and Sekar et al. (2012) was compiled and recognise them. Plant invasion is a continuous process so attempts were made to search these species in the study its take several year to remove invasive species in that area. Plants of the invasive alien species were collected particular area. If invasive species is well established it is from the different localities in Pantnagar. These localities very difficult to remove it from the area. Invasion of were visited in different seasons to find out the exact flow- species in any region takes place in different phases. First- ering and fruiting time of these plants. Collected speci- ly, the invasive species arrival in that area by numbers of mens were accompanied with information on locality, date, way, intentionally or unintentionally. Then the establish- and other important information as suggested by Jain and ment of that species takes place and finally the species Rao (1976), Simpson (2010). Later on, plant specimens spread in that place successfully. So mostly the invasive were identified with the help of different floras relevant to species are the successfully invaders (Sharma et al., 2005; this area like Duthie (1903-29), Babu (1977), Gaur (1999), Karthikeyan et al., 2009; Singh et al., 2010; Balakrishan et Maheshwari (1963), Osmaston (1927), Raizada (1976), al., 2012). Flora of India vol. 1-5,12,13,23 (Sharma et al.,1993; A new challenge is to identifying these alien species and Sharma et al., 1993; Sharma and Sanjappa, 1993; Hajra et removal or control of these species in that area. Most of al., 1997; Singh et al., 2000; Hajra et al., 1995; Balakrish- the countries facing the problem of invasion and the nan et al., 2012) and other important taxonomic docu- impact of invasion are mostly irreversible. The biological ments. The origin and invasive nature of the plants were invasion of the plants species is a natural phenomenon. mainly determined according to Babu (1977); Bailey The biological invasion of invasive plants presents one of (1949); Duthie (1903-1929); Gaur (1999); Graf (1992); the most serious threats to the sustainability of the health Khuroo et al. (2007); Negi and Hajra (2007); Rao (1994); of the ecosystem and their biodiversity (Westman, 1990; Reddy (2008); Sharma and Pandey (1984); Sekar et al. Tyser and Key, 1988; Graft, 1992). Moreover, it may pose (2012). a major threat to the endemic or indigenous diversity of the Collection of plants: Plants of the Invasive alien species livings. Thus, the biological invasion and invasive species were collected from different localities in Pantnagar are becoming a growing issue to many scientists during the including different research centres, gardens, residential last few decades (Kubinova and Krahulee, 1999, Pysek et areas, wastelands, areas along roads of University, Nagla al., 1995) and therefore, there is an urgent need with an bypass, NH 109 in different seasons of the year. Field trips unparallel opportunity for ecological studies on the biolog- were regularly made in different parts of study area and ical invasions (Vitousek, 1990; Pysek et al., 1995). Plant observations were made on habit, habitat, colour of flower invasion is a global problem and need global coordination and other morphological character of the plant species with for its effective monitoring and management (McNeely, special attentions on abundance, flowering and fruiting and 2001; Sharma et al., 2005; Karthikeyan et al., 2009; Singh other important information as suggested by Jain and Rao et al., 2010; Balakrishan et al., 2012). Therefore, in the (1976), Simpson (2010). With the help of the field press present study was conducted for the exploration of new fresh plant specimens were dried to prepare herbarium species of invasive alien flora in Uttarakhand, India. specimens. A field notebook was used to record information like date of collection, habitat, locality, flower MATERIALS AND METHODS colour, place of collection, vernacular names etc. The present work is an outcome of exploration of invasive Identification and nomenclature of plant specimens: alien flora in the entire area of Pantnagar during August Plants specimens were primarily identified with the help of 2011 to December 2015. Previous floristic literature and available regional floras like Flora of Upper Gangetic plain reports about flowering plants of Pantnagar, herbarium (Duthie, 1903-29), Flora of Delhi (Maheshwari, 1963), Sup- specimens available in G.B. Pant University Herbarium plement to Duthie’s Flora of Upper Gangetic Plain (Raizada, Pantnagar (GBPUH) and study of flora Pantnagar (Rawat 1976), Herbaceous Flora of Dehradun (Babu, 1977), Flora and Rao, 2015) was also undertaken to compile the infor- of Chamoli, (Naithani, 1984-1985) and Flora of District mation during this period. Garhwal Northwest Himalayas (Gaur, 1999). More recent- Study area: The study area is the campus of G.B. Pant ly, few important international floras like Flora of China, University of Agriculture and Technology having a perim- Flora of Pakistan, Flora of North America are now freely eter of 28.52 km and 10,000 acres of land area. It is the available online at www.efloras.org. These are also used, first Agriculture University of India established on 17 No- wherever needed, for confirmation of identity. In addition to vember 1960 by the first Prime Minister of India Pt. Ja- conventional floras a new web source ‘eflora of waharlal Nehru. The University area is spread in an area India’ (https://sites.google.com.site/efloraofindia/home) of 12,661 acres (51.24 Km2) which makes it the second having multiple images of large number of species of India

Sumita Rana and Jyotsna Rastogi /Arch. Agr. Environ. Sci., 2 (2): 113-118 (2017) 115 which are also used for identification of species. The fresh solid. Leaves 30-60 cm long, alternate, stipulate, auricu- plant specimens were also compared with the plant images late, unipinnate compound. Leaflets 4-15 pairs, sessile or available in eflorapantnagar (Rawat and Rao, 2015) having shortly petiolulate, 5-15 × 3.5-7.0 cm, obovate-oblong, identified images of more than 425 flowering plant species emarginated, mucronate at apex. Inflorescence axillary or of Pantnagar area. In addition to literature method, plant terminal raceme. Flowers yellow in color, bracteates, specimens were also compared with authentically identi- bisexual. Calyx 5 or 4, 1.4-1.5 × 0.6-0.7 cm long, unequal. fied specimens housed at the Herbaria of Botanical Survey Petals 5, yellow, 1.8-2.3 × 1.2-1.4 cm long, one posterior of India (BSD), Dehradun and National Botanical odd petal larger than other 4 petals. Stamens 10, free, une- Research Institute, Lucknow, India. qual, 7 fertile, 3 sterile. Ovary stipitate, linear, lanceolate, Preparation of herbarium style long, slender, stigma simple. Pod tetragonal, black, Pressing and drying of plant specimens: Collected plant many seeded. Seeds dark brown, compressed, deltoid. specimens were pressed under field press in between the Eclipta prostrata (L.) Mant. Pl. 2 286 1771. Hook. f., Fl. sheets of news papers following the method suggested by Brit. India 3: 309. 1881; Duthie, FUGP 1: 427. 1903-29; Lawrence (1951) and Smith (1971). Maheshwari, Fl. Delhi 197. 1963; Babu, Herb. Fl. D.Dun Poisoning and preservation of plant specimens: Herbar- 242.1977; Naithani, Fl. Chamoli 1: 324. 1985; Rao et al., ium specimens are damaged by insect attack and to avoid Fl. ind. enum. Asterac. 34. 1988; Hajra et al., Fl. India 12: this, the specimens were preserved by the use of repellents 381.1995; Gaur, Fl. District Garwhal 560. 1999; Flowering or insecticides. Pressed plant materials are poisoned with Pl. Uttarakhand 155. 2007; Karthikeyan et al. (2009) HgCl2 solutions, as suggested by Lawrence (1951), to pre- Flowering Pl. India- Dicot 1: 227. 2009 (Figure 3). vent the attack the pest, fungi during storage. Naphthalene Vernacular name: False Daisy (English), Bhringraj balls are used as insect repellent in storage of specimen. (Sanskrit), Kesharaj (Hindi) Mounting: The specimens were mounted on the standard Annual, prostrate or erect herbs. Stems hairy, creeping and Herbarium sheets (11.5 × 16.5 inch) and labeled by a label branching at the base. Leaves subsessile, elliptic, oblong or of 6.5 × 10.5cm as suggested by Jones and Luchsinger oblong lanceolate, papery, hairy, base narrow, margin (1987). serrulate, and apex acuminate. Heads 0.6-1.0 cm across, Nativity of species: The origin and invasive nature of the axillary or terminal, peduncle slender, 2-4.5 cm. Involucral plants were determined according to regional flora (Babu, bracts ovate- lanceolate, acute 0.5 - 0.3 × 0.4 - 0.2 cm. Ray 1977; Duthie, 1903-29; Gaur, 1999), important research florets 0.4 cm long, in 2-3 series with bi dentate corolla, publications (Khuroo et al., 2007; Negi and Hajra, 2007; white. Disc florets 0.2 cm, many, corolla 0.4 cm long, 4 Reddy, 2008; Sekar et al., 2012), publication on ornamen- lobed. Stamens sagittate. Achene 0.2-0.25 cm long, margin tal and cultivated plants (Bailey, 1949; Graf, 1992; ribbed, oblong-turbinate, dark brown. Karthikeyan, 2000), other publication (Rao, 1994; Sharma Euphorbia cyathophora Murray Comment. Soc. Regiae and Pandey, 1984) and web resources like Global compen- Sci. Gott. 7: 81 1786. Balakrishnan et al., Fl. India 23: 329. dium of weeds (GCW, 2017). 2012 (Figure 4). Vernacular name: Fire on the mountain, Painted leaf RESULTS AND DISCUSSION (English) Acmella radicans (Jacq.) R.K. Jansen Syst. Bot. Monogr. Annual or sub-perennial, erect, herbs. Stem branched, 8: 69. 1985. 69 1985; Spilanthes radicans Jacq. Hajra et glabrous, hollow, woody at base. Leaves alternate, stipu- al., Fl. India 12: 409. 1995; Karthikeyan et al., 2009 Flow- late, brownish glands, caducous, lower leaves ovate, mid- ering Pl. India- Dicot 1: 278. 2009 (Figure 1). dle leaves panduriform, upper leaves elliptic-lanceolate, Vernacular name: White spot flower (English) margins shallowly and irregularly toothed, apex obtuse, Annual, erect herbs. Stem terete, minutely pubescent. leaves entirely red, 3-8 × 2-4 cm long. Cyathia 0.2-0.3 cm Leaves ovate, obtuse at the base, acute at apex, petiole long, terminal involucre barrel shaped, glabrous, margin hairy. Inflorescence terminal or in leaf axils. Head white, deeply and bluntly toothed, basal bracts similar to leaves solitary, discoid, 0.8cm long, peduncles, 0.3 cm long, with bright orange red blotch, upper bracts smaller, lanceo- receptacles glabrous, palea, solitary concave boat shaped, late, red. Male floret in 3 or 4 fasicles of 5 or 6 flowers glabrous, homogenous. Involucral bracts oblong or subu- each. Bracteoles ligulate, feathery. Stamens 1.2 cm long. late, obtuse 0.5 cm long, 3 nerve from the base, minutely Female floret 0.4 cm long, ovary 2.5 cm long, pedicellate, hairy from the outside. Disc florets 50-60, corolla white, glabrous; style 0.1 cm long, connate at base, stigma 0.5 cm long, lobes papillose, triangular-ovate, corolla tube capitate. Fruits 0.3 × 0.5 cm long, glabrous, pedicels 2.5 × 0.3 cm long. Achene dimorphic brownish- black, marginal 0.3 cm long, deeply 3 lobed. Pedical 2.5 × 0.3 cm. Seeds trigonous, others ellipsoid, laterally compressed. Pappus of ovoid-conical, 0.2 × 0.2 cm long, greyish black. 2 subequal bristles, 0.2 cm long. In the present study four species viz., Acmella radicans Senna alata (L.) Roxb. Sp. Pl. 378. 1753; Cassia alata L., (Jacq.) R.K. Jansen. (Asteraceae), Senna alata L. Baker in Hook. f., Fl. Brit. India 2: 264. 1878; Sanjappa, (Fabaceae), Eclipta prostrata (L.) L. (Asteraceae), Euphor- Legumes India. 14. 1992 (Figure 2). bia cyathophora Murray (Euphorbiaceae) was collected. Vernacular name: Candle bush (English), Dadmurdan These species were not recorded in the invasive alien flora (Hindi) of Uttarakhand Himalaya (Sekar et al., 2012) and thus are Annual, erect, shrubs. Stem branched, greenish brown, new records to IAS flora of the Uttarakhand state. Acmella

116 Sumita Rana and Jyotsna Rastogi /Arch. Agr. Environ. Sci., 2 (2): 113-118 (2017) radicans (Jacq.) R.K. Jansen (Spilanthes radicans) was throughout India within a short span of one and a half recorded in and around the construction sites and this indi- decade. Sekar et al. (2012) did not mention this species in cates its introduction in Pantnagar through building materi- Uttarakhand. It appears that it is a recent introduction in the al, particularly sand from adjacent areas. This species state and need to be monitored in future as in worst scenar- seems to be one of the greater threat as in Flora of India io it may invade the native vegetation like other noxious (Chowdhery, 1995) reported distribution of this species weeds of Asteraceae like Parthenium hysterophorus L. and only in Kerala state of India. Later, Karthikeyan et al. Eupetorium adenophorum, Acmella radicans (Jacq.) R.K. (2009) reported its occurrence in North and South India. Jansen and Senna alata (L.) Roxb. are also new additions These two references suggest a rapid spread of this species to the flora of the Uttarakhand state.

Flowering and fruiting: October- January Seeds production: 400- 500 seeds/plant Seed germination: 14.50% Multiplication method: Seeds Method of seed dispersal: Animals, wind, humans. Nativity: This species is a native of South America (Chandra Sekar et al., 2012; Chandra Sekar, 2012; Singh et al., 2010; Reddy, 2008). Distribution: Recorded along the roadsides and in waste lands. Figure 1. Floral description of Acmella radicans (Jacq.).

Flowering and fruiting: October- December Seed production: 150-200 seeds/plant Multiplication method: Seeds Method of seed dispersal: Wind, humans Nativity: This species is native of Tropical America (Reddy 2008). Distribution: Rare, recorded along roads in Haldi.

Figure 2. Floral description of Senna alata (L.) Roxb. Flowering and fruiting: July- December Seeds production: 600- 700 seeds/plant Seed germination: 51.00% Multiplication method: Seeds Method of seed dispersal: Human, wind and animals Nativity: This species is a native of Tropical America (Chandra Sekar et al., 2012; Chandra Sekar, 2012, Singh et al., 2010; Reddy, 2008). Distribution: Commonly present along the roadsides, waste land, crop fields and garden in moist area etc.

Figure 3. Floral description of Eclipta prostrata (L.).

Flowering and fruiting: April- November Seeds production: 50-60 seeds/plant Seed germination: 96.00% Multiplication method: Seeds Method of seed dispersal: Human, wind Nativity: This species is a native of Tropical America (Reddy 2008). Distribution: Common weed along the roadside, waste and, cultivated fields.

Figure 4. Floral description of Euphorbia cyathophora Murray Comment.

Sumita Rana and Jyotsna Rastogi /Arch. Agr. Environ. Sci., 2 (2): 113-118 (2017) 117 Conclusions GCW (2017). Global compendium of weeds. Retrieved from www.hear.org/gcw/index.html. It is concluded from the present study that the invasive Graft, A.B. (1992). Hortica. Roehrs Company Publishers East alien species viz., A. radicans, S. alata, E. prostrate and E. Rutherfort, USA. pp: 1152. cyathophora was not listed previously. Biological species Hajra, P.K., Rao, R.R., Singh D.K. and Uniyal B.P. (1995). Flora which acre introduced to a new geographic area other than of India Vol. 12 Asteraceae (Anthemideae- Heliantheae). its natural home range are called as alien, exotic or Botanical Survey of India: Calcutta. non- native species. Some of the alien species invade the Hajra, P.K., Rao, R.R., Singh D.K. and Uniyal B.P. (1997). Flora of India Vol. 14 Malpighiaceae- Dichapetalaceae. Botanical natural vegetation and called invasive alien species. These Survey of India: Calcutta. species are introduced in any area both accidentally or Jain, S.K. and Rao, R.R. (1976). A handbook of field and herbari- intentionally. The presence of these species in that area um method, New Delhi. Today and Tomorrow Publishers. modifies the structure and the function of the ecosystems. pp: 157. Biological diversity faces many threats throughout the Jones, S.B. and Luchsinger, A.E. (1987). Plant Systematics. 2nd world. One of the major threats to native biological diver- Edition. McGraw-Hill Book Company. New York. sity is caused by Invasive Alien Species (IAS). IAS is Karthikeyan, S. (2000). A statistical analysis of flowering plants causing enormous damage to the biodiversity and the valu- in India. In: Flora of India, Introductory volumes. (Singh, able natural agricultural system upon which we depend. N.P., Singh, D.K., Hajra, P.K. and Sharma, B.D. eds.): 201- 217 BSI, Calcutta. The impacts of IAS are increasing serious damage to Karthikeyan, S., Sanjappa, M. and Moorthy, S. (2009). Flowering nature and these effects are irreversible. IAS represses or Plants of India Dicotyledons- Vol I (Acanthaceae – Avicen- replaces native species either directly or indirectly by out- niaceae), BSI Kolkata. competing them for resources and also alters the species Khuroo, A.A., Rashid, I., Reshi, Z., Dar, G.H. and Wafai, B.A. composition in an ecosystem. Invasive alien plants are (2007). The alien flora of Kashmir Himalaya. Biological capable to reproduce large number of reproductive Invasions, 9(3): 269-292. offspring’s and are able to disperse rapidly over extensive Kubinov, D. and Krahulec, F. (1999). Phenology of Rumex longi- area. These invasive alien species are the successful folius: a key factor for the success of an invasive species? invaders because these species are very adaptable, repro- Preslia. 70: 339-348. Lawrence, G.H.M. (1951). Taxonomy of vascular plants, Oxford duce quickly, develop rapidly and evolve viable population and IBH. New Delhi. pp: 823. at low resources. There are some factors determining the Maheshwari, J.K. (1963). Studies on the naturalised flora of In- success rate of invasive species in an area. The G. B. Pant dia. In: Maheswari P, Johri BM, Vasil IK (eds) Proceedings University of Agriculture and Technology Pantnagar is a of the summer school of botany. Sree Sarawati Press, Cal- small land area devoid of natural stands of vegetation and cutta. pp: 156-170. suffer from continuous agricultural operations and human McNeely, J.A. (2001). The Great Reshuffling: Human Dimension activities, which seems to be the reasons behind the of Invasive Alien Species. IUCN, Gland, Switzerland and presence of large number of IAS flora here. Cambridge, UK. pp: 239. Mooney, H.A. and Hobbs, R.J. (2000). Invasive species in a Open Access: This is open access article distributed under changing world. Washington DC, Island Press. pp: 461. the terms of the Creative Commons Attribution License, Naithani, B.D. (1984). Flora of Chamoli Vol. I. Botanical Survey which permits unrestricted use, distribution, and reproduc- of India, Howrah. pp: 341. tion in any medium, provided the original author(s) and the Naithani, B.D. (1985). Flora of Chamoli Vol. II. Botanical Survey source are credited. of India, Howrah. Negi, P.S. and Hajra, P.K. (2007). Alien flora of Doon Valley, REFERENCES Northwest Himalaya, Current Science, 92(7): 968-978. Osmaston, A.E. (1927). A Forest flora for Kumaon. United Prov- Babu, C.R. (1977). Herbaceous flora of Dehradun. C.S.I.R., New ince Supreintendent Government Press, Allahabad. pp: 605. Delhi. pp: 671. Pysek, P., Richardson, D.M., Rejmanek, M., Webster, G.L., Wil- Bailey, L.H. (1949). Manual of cultivated plants. MacMillian liamson, M. and Kirschner, J. (1995). Alien plants in check- Publishing, New York, NY. lists and floras: towards better communication between tax- Balakrishan, N.P., Chakarbarty, T., Sanjappa, M., Lakshminar- onomists and ecologists. Taxonomy, 53(1): 131-143. simhan, P. and Singh, P. (2012). Flora of India Vol. 23 Raizada, M.B. (1976). Supplement to Duthie’s flora of Upper Loranthaceae Daphniphyllaceae. Botanical Survey of India, Gangetic Plain and of the adjacent Siwalik and Sub- Kolkata. Himalayan tracts. Dehradun. pp: 355. Chandra Sekar, K., Manikandan, R. and Srivastava, S.K. (2012). Rao, R.R. (1994). Biodiversity in India (Floristic Aspects). Invasive Alien plants of Uttarakhand Himalaya. Proceeding BSMPS, Dehradun. pp: 281-292. of the National Academy of sciences, India section B. Jour- Rawat, D.S. and Rao, P.B. (2015). E-florapantnagar: A Virtual nal of Biological Science, 82(3): 375-383. Flora of Pantnagar. Retrieved on 17 May 2017 from http:// Chowdhery, H.J. (1995). Heliantheae Cass. In: Hajra, P.K., Rao, sites.google.com/sites/ eflorapantnagar/. R.R., Singh, D.K. and Uniyal, B.P. (eds.) Flora of India Vol. Reddy, C.S. (2008). Catalogue of invasive alien flora of India. Life 12 Asteraceae. BSI, Calcutta. pp: 358-429. Science Journal, 5(2): 84-89. Duthie, J.F. (1903–1929). Flora of the upper Gangetic plain and Sala, O.E., Chaplin III, F.S., Armestro, J.J., Berlows, E., Bloom- of the adjacent Siwalik and Sub-Himalayan tracts .Calcutta. field, J., Dirzo, R., Huber-Sanwald, E., Huenneke, L.F., Jack- Gaur, R.D. (1999). Flora of the district Garhwal, North West son, R.B., Kinzig, A., Leemans, R., Lodge, D.M., Mooney, Himalaya. With ethnobotanical Notes, Trans Media Srinagar H.A., Oesterheld, M., Poff, N.L.F., Sykes, M.T., Walker, (Garhwal). pp: 811. B.H., Walker, M. and Wall, D.H. (2000). Global biodiversity

118 Sumita Rana and Jyotsna Rastogi /Arch. Agr. Environ. Sci., 2 (2): 113-118 (2017) scenarios for the year 2100. Science, 287: 1770-2100. Singh, K.P., Shukla, A.N. and Singh, J.S. (2010). State-level Sekar, K.C., Manikandan, R. and Srivastava, S.K. (2012). Invasive lnventory of invasive alien plants, their source regions and alien plants of Uttarakhand Himalaya. Proceedings of the use potential. Current Science, 99(1): 107-114. National Academy of Sciences, India Section B: Biological Singh, N.P., Vohra, J.N., Hajra, P.K. and Singh, D.K. (2000). Sciences, 82(3): 375-383. Flora of India Vol 5 Olacaceae-Connaraceae. BSI Dehradun. Sharma, B.D. and Pandey, D.S. (1984). Exotic flora of Allahabad Smith, C.E. (1971). Preparing herbarium specimens of vascular District, BSI, Howrah. plants. Agriculture Information Bulletin No. 348, US Govt. Sharma, B.D. and Sanjappa, M. (1993). Flora of India Vol. 3 BSI Printing Office. Washington DC. pp: 30. Calcutta. Tyser, R.W. and Key, C.H. (1988). Spotted knapweed in natural Sharma, B.D., Balakrishnan, N.P., Rao R.R. and Hajra, P.K. area fescue grasslands: An ecological assessment. Northwest (1993). Flora of India Vol. 1 Ranunculaceae- Barclayaceae. Science, 62(4): 151-159. BSI Calcutta. Vitousek, P. M. (1990). Biological invasions and ecosystem pro- Sharma, G.P., Raghubanshi, A.S. and Singh, J.S. (2005). Lantana cesses: towards an integration of population biology and invasion: An overview. Weed Biology Management, 5(4): 157- ecosystem studies. In Ecosystem Management Springer New 165. York, pp: 183-191. Simpson, M.G. (2010). Plant Systematics II ed. Elsevier, Amster- Westman, W.E. (1990). Managing for biodiversity. Bioscience, 1: dam. pp: 740. 26-33.

Archives of Agriculture and Environmental Science 2 (2): 119-123 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

CASE STUDY Occurrence of heavy metals in Ganga canal water at Haridwar (Uttarakhand), India: A case study

Nitin Kamboj1*, Ravinder Singh Aswal1 and Prashant Singh2 1Department of Zoology and Environmental Science, Gurukula Kangri University, Haridwar-249404 (Uttarakhand), INDIA 2Department of Chemistry, D.A.V. (P.G.) College, Dehradun-248001 (Uttarakhand), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 03 March 2017 The present investigation was framed to assess the contamination of heavy metals in Ganga canal Revised received: 25 April 2017 water at Haridwar (Uttarakhand). The samples of Ganga canal water were collected from five Accepted: 27 May 2017 sampling sites namely Bhimgoda Barrage, Haridwar (origin point); Premnagar Ashram Ghat, Haridwar; Pathari Power Plant, Bahadrabad; Rail Bridge, Roorkee and Uttam Sugar Mills Limited, Keywords Narsan (exit point). The samples were analyzed for seven metals viz., copper, manganese, cadmium, Analysis of variance (ANOVA) lead, zinc, chromium and iron in Ganga canal water monthly during March, 2014 to August, 2014. Ganga canal The concentration of manganese was found greater than its desirable limit (0.1 mg/L), while iron Heavy metals contamination was observed more than its permissible limit (0.3 mg/L) according to Bureau of Indian Standards Monthly variation (BIS) specifications. The water quality data was further analyzed using analysis of variance Spatial variation (ANOVA) for monthly and spatial variations. The ANOVA analysis revealed that the contents of different metals such as copper, manganese, lead, zinc, chromium and iron were found statistically significant (P≤0.05) as per temporal study. These monthly variations in Ganga Canal water quality parameters might be ascribed due to the anthropogenic and hydro-geological activities. However, none of the metals showed significant site variation at any of the sampling site of Ganga Canal. Therefore, the present study emphasized the need of regular monitoring of Ganga canal water to avoid the contamination of heavy metals in the water. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Kamboj, N., Aswal, R.S. and Singh, P. (2017). Occurrence of heavy metals in Ganga canal water at Haridwar (Uttarakhand), India: A case study. Archives of Agriculture and Environmental Science, 2(2): 119-123.

INTRODUCTION water quality of Ganga canal is being degraded increasing- Haridwar has plenty of water resources in the form of ly from year to year due to increase in pollutant loads Ganga River and Ganga canal and their water is being used particularly from commercial and domestic sources, sew- for domestic and drinking purposes. Ganga canal origi- age discharge and industrial effluents. The effluents may nates from Ganga River after diversion at Bhimgoda be inorganic and/ or organic, which may be toxic in nature Barrage near Har ki Pauri at Haridwar, which is a famous depends on their source (Kamboj et al., 2013). Owing to place for the mass bathing of pilgrims. The sacredness of spirituality, lots of pilgrims pertaining activities have led to Ganga canal water has attracted millions of tourists, the problem of water pollution in Ganga canal. Among pilgrims and also local peoples of Haridwar. The Ganga anthropogenic sources of pollution, domestic and munici- canal is the important source of drinking and irrigation pal sewages are also contributing to polluting the water water located at the bank and in the vicinity of the canal quality of Ganga canal. Heavy influx of floating tourists, (Kamboj et al., 2013). pilgrims and local peoples of Haridwar exert stress through The Ganga canal moves from Haridwar and passes through organic as well as inorganic wastes (Kamboj, 2012). vicinity of Bharat Heavy Electricals Limited (BHEL), Markandya and Murty (2004) have also reported that most Ranipur, Bahadrabad, Piran Kaliyar, Roorkee, Uttam of the untreated or partially/ treated sewage about 1.3 Sugar Mill Ltd. and Gurukul Narsan, which are densely billion liters/ day of human waste and 260 million liters of populated areas of Haridwar district and also face pressure industrial waste primarily from agricultural fertilizers and from tourists and pilgrims entering into Uttarakhand. The pesticides from surrounding cities enter into the Ganga

120 Kamboj et al. /Arch. Agr. Environ. Sci., 2 (2): 119-123 (2017) basin waterways. Due to easy channel of transportation, Haridwar (S2); Pathari Power Plant, Bahadrabad (S3); Rail solid and liquid wastes are easily dumped into river water Bridge, Roorkee(S4) and Uttam Sugar Mill Ltd., Narsan and therefore, in Ganga canal water directly or through (exit point) (S5) of Ganga Canal in Uttarakhand, India. The ground channels. Change in pH of stream water may affect details of all the five sampling sites (S1) along with their co aquatic life indirectly through affecting other aspects of -ordinates and elevation above mean sea level (MSL) are water chemistry e.g. water with low pH can increase the given in Table 1. solubility of certain heavy metals, which allows the metals Collection, preservation and analysis of samples: The to be more easily absorbed by aquatic organisms samples of Ganga canal water from all the five sampling (Simeonov et al., 2003). Apart from domestic and industri- sites were collected through grab sampling. The samples of al pollutants, hundreds of human corpses and thousands of Ganga canal water were preserved and analyzed for differ- animal carcasses are also released into the Ganga water ent heavy metals i.e. copper, manganese, cadmium, lead, every day due to spiritual rebirth (Haritash et al., 2016). It zinc, chromium and iron in water samples were performed has become major challenge and thus, posed threat up to by adopting standard protocols and methods cited in large extent to the human beings of local population of APHA (2012) and BIS (2012). Haridwar district as well as millions of tourists and Statistical analysis: Data was statistically analyzed using pilgrims of country and abroad. Heavy metals are usually analysis of variance (ANOVA) to determine the monthly present in wastewater and when, it gets mixed with adja- and spatial variations of mean concentrations of different cent water body contaminates the aquatic environment. heavy metals in the Ganga canal water (Elbag, 2006). Due to drainage of sewage effluent into adjacent water bodies, there might be significant increase in total RESULTS AND DISCUSSION dissolved solids (TDS), turbidity, biological oxygen de- The values of seven heavy metals in Ganga canal water at mand (BOD), chemical oxygen demand (COD), chlorides, all the five sampling sites namely Bhimgoda Barrage, sulphates, and nitrate nitrogen, total phosphorus including Haridwar (origin point) (S1); Premnagar Ashram Ghat, heavy metals like iron, zinc, cadmium, chromium, copper, Haridwar (S2); Pathari Power Plant, Bahadrabad (S3); Rail nickel, manganese and lead (Egborge, 1991; Simeonov et Bridge, Roorkee (S4) and Uttam Sugar Mill Ltd., Narsan al., 2003; Jaji et al., 2007). (exit point) (S5) are presented in Table 2. Besides, pace of modernization and increasing industriali- Copper: The maximum concentration of copper (0.043 zation, urbanization, agriculture and other human activities mg/L) was recorded at the Uttam Sugar Mill Ltd., Narsan are among serious aspects for causing Ganga canal water (exit point) (S5), which was observed below the desirable pollution and resulted deterioration in its water quality. limit (0.05 mg/L) of BIS, 2012. However, the content of Rapid industrial growth and urban development have re- copper was detected minimum (0.001 mg/L) at three study sulted into inclusion of variety of pollutants into Ganga sites viz., Bhimgoda Barrage, Haridwar (origin point) (S1), canal. Haridwar district has also grown up as industrial hub Pathari Power Plant, Bahadrabad (S3) and Rail Bridge, of the Uttarakhand state, therefore assessment and moni- Roorkee (S4). The results are in line with Kumar and toring of metals in Ganga canal has become necessary for Chopra (2012) who reported the higher contents of copper assessing metals pollution of various metals namely calci- in abandoned old Ganga canal at Haridwar (Uttarakhand), um, copper, magnesium, manganese, cadmium, lead, zinc, India. Kumar et al. (2012) also reported higher concentra- chromium and iron in its water. Presence of metals in tion of copper in the water of sub canal of upper Ganga water leads metal contamination, when found in excess canal at Haridwar (Uttarakhand), India due to the than desirable or permissible limits and thus, it has become discharge of untreated textile effluent. an issue of concern (Kansal et al., 2013). These metals are Manganese: Manganese is usually occurred with iron and entered into rivers naturally through rocks weathering as is observed as an essential element for various living or- well as variety of human accelerated activities such as ganisms. It is naturally found in surface water, sub-surface mining, smelting, electroplating and other industrial pro- water and ground water as well as in the soil. The manga- cess. In addition, rapid growth of industrialization and ur- nese concentration was found to be varied from 0.015 mg/ banization are also adding metals into the river water sys- L at three study sites viz., Bhimgoda Barrage, Haridwar tem (Simeonov et al., 2003; Seth et al., 2006; Kansal et al., (origin point) (S1); Premnagar Ashram Ghat, Haridwar 2013). Therefore, major objective of present study was to (S2); Pathari Power Plant, Bahadrabad (S3) to 0.293 mg/L assess the monthly and spatial variations in the concentra- at Pathari Power Plant, Bahadrabad (S3). All the sampling tion of heavy metals in Ganga canal water at district sites have been found to have higher values of manganese, Haridwar, (Uttarakhand), India. which was greater than its desirable limit as per BIS, 2012 MATERIALS AND METHODS specifications. The concentration of manganese in water is mainly increased by various anthropogenic activities. The Study area: Ganga canal was selected for the present compounds of manganese might be present in atmosphere study to determine the contamination of heavy metals in as suspended particulates resulting from industrial emis- the water. The samples of Ganga canal water were collect- sions, soil erosion, and volcanic emission and burning of ed on monthly basis from during March, 2014 to August, Methylcyclopentadienyl Manganese Tricarbonyl (MMT) 2014 selecting five sampling sites viz., Bhimgoda Barrage, containing petrol (IPCS, 1999). Manganese is an essential Haridwar (origin point) (S1); Premnagar Ashram Ghat, element for all living organisms and the lack of manganese

Kamboj et al. /Arch. Agr. Environ. Sci., 2 (2): 119-123 (2017) 121 might exhibit impaired growth, skeletal abnormalities, health point of view (Seth et al., 2014). Chromium was reproductive effects, etc. Whereas, its overexposure might detected 0.001 mg/L as minimum concentration at all the cause manganism, which causes weakness, muscle pain, study sites, whereas its maximum value was found as apathy, slow speech and slow clumsy movement of limbs 0.007 mg/L at Uttam Sugar Mill Ltd., Narsan (exit point) in the human beings (Bowman et al., 2011). (S5) sampling site. The BIS (2012) has prescribed its desir- Cadmium: The minimum content of cadmium (0.001 mg/ able limit up to 0.05 mg/L, but there is no relaxation L) was traced at all the studied sites. However, it was de- beyond this range. tected highest (0.003 mg/L) at three sites viz., Bhimgoda Iron: The iron contamination during water supply may Barrage, Haridwar (origin point) (S1); Premnagar Ashram arise from materials such as iron, which can corrode to Ghat, Haridwar (S2); and Rail Bridge, Roorkee (S4) and it release iron oxides or from ingress of pollutants into the might be due to the anthropogenic or geogenic processes. distribution system (Fawell and Nieuwenhuijsen, 2003). The BIS (2012) has determined desirable and permissible Iron is a necessary element for various physiological activ- limits as 0.003 mg/L for cadmium in drinking water. Cad- ities of all living organisms. The minimum concentration mium causes both acute and chronic toxicity in the human of iron was found as 0.284 mg/L at site Bhimgoda Barrage, beings. Cadmium intake might cause acute gastrointestinal Haridwar (S1), while maximum was recorded as 1.087 mg/ problems i.e. vomiting and diarrhea (Nordberg, 2009). Its L (more than permissible limit of BIS) at S-5 site. Its maxi- chronic exposure may cause kidney damage, reproductive mum concentration at all sites exceeded permissible limit problems, bone damage and cancer (Frery et al., 1993). (0.3 mg/L) as per BIS (2012). Iron pollution in water is Lead: Minimum concentration (0.003 mg/L) of lead was mainly attributed due to weathering of rocks, industrial recorded at four study sites out of five namely Premnagar waste, etc. (Seth et al., 2016). However, its deficiency and Ashram Ghat, Haridwar (S2); Pathari Power Plant, overload both can pose harmful threats to animals as well Bahadrabad (S3); Rail Bridge, Roorkee (S4) and Uttam as plants (Anonymous, 2008). These exceeded concentra- Sugar Mill Ltd., Narsan (exit point) (S5). While, maximum tions in the Ganga canal water may pose possible negative concentration (0.007 mg/L) of lead was detected at two consequences on the health of local peoples, pilgrims, tour- Bhimgoda Barrage, Haridwar (origin point) (S1) and Rail ists along with its surrounding environment. Moreover, the Bridge, Roorkee (S4) sampling sites. Further, lead concen- overload of iron is less common than its deficiency. Its tration did not exceed the desirable limit (0.01 mg/L) of overexposure can even lead to several serious health’s re- BIS in analyzed water samples of Ganga Canal. Kumar et lated problems viz., cancer, diabetes, liver and heart diseas- al. (2012) also reported the contamination of lead in the es as well as neurodegenerative disorders in the human water of sub canal of upper Ganga canal in Haridwar due beings (Sayre et al., 2000). Simeonov et al. (2003) also to the drainage of textile effluent. reported that the nutrients (micro and macro) in the surface Zinc: Minimum zinc concentration was recorded as 0.008 water in northern Greece are likely due to the anthropogen- mg/L at two monitored sites Premnagar Ashram Ghat, ic activities. Haridwar (S2) and Pathari Power Plant, Bahadrabad (S3) Monthly variation in the content of heavy metals: during the study period. Whereas, maximum zinc value Monthly variation was determined by analyzing seven was detected as 0.127 mg/L at Rail Bridge, Roorkee (S4) metals. There were total six data points namely March, sampling site during the study period, which was observed April, May, June, July and August months for each water well below than its desirable limit (5 mg/L) of BIS, 2012 quality parameter at each sampling site. According to and it might also be due to the a number of anthropogenic monthly variation, computed P-values for each water qual- activities like mass bathing, discharge of urban waste and ity parameter by ANOVA are depicted in Table 3. There runoff etc. as also reported earlier by Kumar and Chopra were total nine metals such as calcium, copper, magnesi- (2012). um, manganese, lead, zinc, chromium and iron, which Chromium: It is considered as one of the essential nutri- were found statistically significant because of P-value ents for several living organisms only in trace amount (P≤0.05) during the study. Seth et al. (2016) reported that (Okendro et al., 2007 and Sati and Paliwal, 2008). The the pollution of Gola, Kosi, Ramganga, Saryu and Loha- concentration of chromium in drinking water is usually wati rivers in the Kumaun Region, Uttarakhand, India are found only at trace level, but chromium (VI) in exceeded due to the excess tourism, anthropogenic, geogenic concentration is extremely toxic to the consumers from processes and eutrophication.

Table 1. Description of different sampling sites at Ganga canal in Haridwar.

Name of sampling sites Sampling sites code Latitude/ Longitude Elevation above MSL (m)

Bhimgoda Barrage, Haridwar S1 N 29º 60’ 25.9”/ E 078º 14’ 28.1” 275

Premnagar Ashram Ghat, Haridwar S2 N 29º 55’ 48.8”/ E 078º 08’ 10.3” 266

Pathari Power Plant, Bahadrabad S3 N 29º 55’ 41.5”/ E 078º 02’ 24.7” 240

Rail Bridge, Roorkee S4 N 29º 50’ 59.4”/ E 077º 52’ 49.0” 244

Uttam Sugar Mill Ltd., Narsan S5 N 29º 44’ 00.7”/ E 077º 51’ 30.9” 242

122 Kamboj et al. /Arch. Agr. Environ. Sci., 2 (2): 119-123 (2017)

Table 3. Showing analysis of variance (ANOVA) for monthly

0.095 0.000 0.001 0.036 0.003 0.250

0.016 and spatial variations in different heavy metals in Ganga Canal at

ANOVA Monthly ANOVA Spatial

0.015 0.105 0.001 0.005 0.045 0.002 0.923

Mean

5 Parameter Variation Variation

P-value P-value

-11

0.043 0.280 0.002 0.006 0.111 0.007 1.087

Max Copper 1.529* × 10 0.997

-10

Manganese 5.217* × 10 0.956

Min

0.033 0.001 0.003 0.017 0.001 0.444

0.003 Cadmium 0.824 0.861

Lead 0.031* 0.922 SD

Permissible Permissible limit. -6

0.017 0.120 0.001 0.001 0.047 0.001 0.298

- Zinc 2.030* × 10 0.935

Chromium 0.046* 0.420

-6

0.116 0.002 0.004 0.038 0.001 0.744

0.018 Iron 3.726* × 10 0.653

Mean

*- Values are statistically significant at P ≤ 0.05 for monthly and

Desirable Desirable PLlimit; spatial variations.

0.040 0.287 0.003 0.007 0.127 0.002 0.998 Max

Spatial variation in the content of heavy metals: Total

seven metals were analyzed to find out spatial variation

Min

0.028 0.001 0.003 0.009 0.001 0.295

0.001 among five sampling sites of Ganga Canal at Haridwar

district. There were five data points as Bhimgoda Barrage,

0.113 0.001 0.001 0.027 0.001 0.269

0.011 Haridwar (origin point) (S1); Premnagar Ashram Ghat,

Haridwar (S2); Pathari Power Plant, Bahadrabad (S3); Rail

Bridge, Roorkee (S4) and Uttam Sugar Mill Ltd., Narsan

0.011 0.097 0.001 0.004 0.030 0.707

0..001

Mean

3 (S5) sites for each water quality parameter during each

Uttam Uttam Sugar Mill Ltd., DLNarsan;

5 monitoring month. According to the spatial variation, the

0.028 0.293 0.002 0.006 0.079 0.002 0.962

Max calculated data of ANOVA analyses are also presented in

Table 3, which showed P-value of each metal as per site

variation. Further, none of the water quality characteristic

Min

0.015 0.001 0.003 0.008 0.001 0.291

0.001 was found statistically significantly (P≥0.05) different at

different sampling sites of Ganga canal. Kansal et al.

0.016 0.098 0.001 0.001 0.038 0.002 0.286 Rail Bridge, Rail Roorkee; S

(2013) reported the higher content of Fe, Zn, Cu and Pb in -

4 Himalayan Rivers like Ganga, Yamuna and their tributaries

is from Uttarakhand state of India.

0.015 0.081 0.001 0.004 0.039 0.002 0.653

Mean

S Conclusions

This investigation concluded that the water quality assess-

0.041 0.270 0.003 0.005 0.110 0.005 0.949

Max ment and regular monitoring of Ganga canal water

between origin and exit points at Uttarakhand is essential

Min

0.015 0.001 0.003 0.008 0.001 0.288

0.002 in order to determine level of metals in its water and

Pathari Pathari Power Plant, Bahadrabad; S

subsequently, to adopt corrective and preventive actions to

3 avoid from further deterioration of its quality. Out of

0.092 0.001 0.001 0.032 0.002 0.277

0.014 seven metals, only one metal i.e. manganese exceeded its

desirable limit (0.1 mg/L), whereas iron was found more

0.073 0.002 0.005 0.031 0.003 0.627

0.014 than its respective permissible limit (0.3 mg/L) as per BIS

Mean

S standards. This might be ascribed due to geo-genic activi-

ties and discharge of untreated/ partially treated consumer

0.034 0.255 0.003 0.007 0.093 0.004 0.921

Max waste into Ganga canal water. ANOVA showed that any

of the analyzed water quality parameter does not show

Min

0.015 0.001 0.004 0.009 0.001 0.284

0.001 significant site variation at any site of Ganga Canal. Premnagar Ashram Ghat, Haridwar; S

Contrary to this, a total of eight metals such as calcium,

copper, magnesium, manganese, lead, zinc, chromium and

0.3 No No No No

1.50

Relax Relax Relax Relax iron were found statistically significantly (P≤0.05) differ-

ent as per monthly investigation. These variations in water

(2012)

BIS: 10500 10500 BIS: 0.3

0.1 quality parameters of Ganga canal might be attributed

0.05 0.01 0.05 0.003 mainly due to the anthropogenic and hydro-geological

activities. Therefore, anthropogenic and hydro-geological Contents of different heavy metals in Ganga Canal water Canal sites. sampling different at in water metals heavy Ganga different Contentsof

activities should be prevented to avert the contamination

of heavy metals in the water of Ganga canal at Haridwar

Bhimgoda Barrage, Haridwar; S

Parameter Copper Copper (mg/L) Manganese (mg/L) Cadmium (mg/L) Lead (mg/L) Zinc (mg/L) Chromium (mg/L) Iron (mg/L) Table 2. Table S (Uttarakhand), India.

Kamboj et al. /Arch. Agr. Environ. Sci., 2 (2): 119-123 (2017) 123 Open Access: This is open access article distributed under India. Journal of Sustainable Environmental Research, 1 the terms of the Creative Commons Attribution License, (2): 125-128. which permits unrestricted use, distribution, and reproduc- Kamboj, N. Singh, J., Pandey, C.P. and Aswal, R.S. (2013). tion in any medium, provided the original author(s) and the Physico-chemical parameters of industrial and domestic wastes at SIDCUL Area, Haridwar (Uttarakhand). Journal source are credited. of Sustainable Environmental Research, 2(1): 125-131. REFERENCES Kansal, A., Siddiqui N.A, Gautam A. (2013). Assessment of heavy metals and their interrelationships with some physico- APHA, American Public Health Association, American Water chemical parameters in eco-efficient rivers of Himalayan Works Association (AWWA) and Water Environment Fed- Region. Environmental Monitoring and Assessment, 2013 eration (WEF) (2012). Standards for Examination of Water 185(3): 2553-63. doi: 10.1007/s10661-012-2730-x and Wastewater. 22nd Ed., American Public Health Associa- Kumar, V. and Chopra, A. K. (2012). Hydrological characteris- tion, Washington, DC, USA. tics of abandoned old Ganga canal at Haridwar Anonymous (2008). Assessment of surface water for drinking (Uttarakhand) India. Journal of Chemical and Pharmaceuti- quality. Directorate of Land Reclamation Punjab, Irrigation cal Research, 4(11):4774-4782. and Power Department, Canal Bank, Mughalpura, Lahore, Kumar, V., Chopra, A.K. and Chauhan, R.K. (2012). Effects of Pakistan. textile effluents disposal on water quality of sub canal of upper Bowman, A.B., Kwakye, G.F., Hernández, E.H. and Aschner, M. Ganga canal at Haridwar (Uttarakhand), India. Journal of (2011). Role of manganese in neurodegenerative diseases. Chemical and Pharmaceutical Research, 4(9): 4206-4211. Journal of Trace Elements in Medicine and Biology, 25(4): Markandya, A. and Murty, M.N. (2004). Cost–benefit Analysis 191-203. of Cleaning the Ganges: Some emerging environment and BIS, Bureau of Indian Standards (2012). Specification for drink- development issues. Environment and Development ing water. 1S: 10500, Bureau of Indian Standards, New Economics, 9(1): 61-81. Delhi. Nordberg, G.F. (2009). Historical perspectives on cadmium Egborge, A.B.M. (1991). Industrialization and heavy metal pollu- toxicology. Toxicology and Applied Pharmacology, 238(3): tion in Warri River, University of Benin Press, Inaugural 192-200. Lecture Series, 32. Okendro, S.N., Surinder, K., Mahantpal, P.C., Pande, M.K. and Elbag, M.A. (2006). Impact of surrounding land uses on surface Gopimohon, S.N. (2007). Evaluation of water quality from water quality. Worcester Polytechnique Institute, Massachu- Gaula River by factor analysis. Journal of Ecophysiology setts, Amherst. and Occupational Health, 7: 3-4. Fawell, J. and Nieuwenhuijsen, M.J. (2003). Contaminants in Sati, S. and Paliwal, P.C. (2008). Physico-chemical and bacterio- drinking water. British Medical Bulletin, 68: 199-208. logical analysis of Kosi River Water Central Himalaya. Pol- Frery, N., Nessmann, C., Girard, F., Lafond, J., Moreau, T., Blot, lution Research, 27(1): 179-183. P., Lellouch, J. and Huel, G. (1993). Environmental Sayre, L.M., Perry, G., Atwood, C.S. and Smith, M.A. (2000). exposure to cadmium and human birth weight. Toxicology, The role of metals in neurodegenerative diseases. Cellular 79(2): 109-118. and Molecular Biology (Noisy-le-Grand, France), 46(4): Haritash, A.K., Gaur, S. and Garg, S. (2016). Assessment of wa- 731-741. ter quality and suitability analysis of river Ganga in Seth, R., Mohan, M., Dobhal, R., Gupta, V.K., Singh, P., Singh, Rishikesh, India. Applied Water Science, 6(4): 383-392, doi: R. and Gupta, S. (2014). Application of chemometric tech- 10.1007/s13201-014-0235-1 niques in the assessment of groundwater quality of Udham IPCS, International Programme on Chemical Safety (1999). Man- Singh Nagar, Uttarakhand, India. Water Quality, Exposure ganese and its compounds. Geneva, World Health Organiza- and Health, 6(4): 199-216, doi:10.1007/s12403-014-0127-5 tion, International Programme on Chemical Safety (Concise Seth, R., Mohan, M., Singh, P., Singh, R., Dobhal, R., Singh, International Chemical Assessment Document 12). K.P. and Gupta, S. (2016). Water quality evaluation of Him- Retrieved on 10 November, 2016 from www.bvsde.ops- alayan Rivers of Kumaun Region, Uttarakhand, India. oms.org/bvsacd/who/ipcs.pdf Applied Water Science, 6(2): 137-147, doi: 10.1007/s13201 Jaji, M.O., Bamgbose, O., Odukoya, O.O. and Arowolo, T.A. -014-0213-7 (2007). Water quality assessment of Ogun River, South West Simeonov, V., Stratis, J.A., Samara, C., Zachariadis, G., Voutsa, Nigeria. Environmental Monitoring and Assessment, 133(1): D., Anthemidis, A., Sofoniou, M. and Kouimtzis, T. (2003). 473-482. doi: 10.1007/s10661-006-9602-1 Assessment of the surface water quality in northern Greece. Kamboj, N. (2012). Evaluation of some water quality parame- Water Research, 37(17): 4119-4124, doi.org/10.1016/S0043 ters of river Ganga during Kanwer Mela-2011 at Haridwar, -1354(03)00398-1.

Archives of Agriculture and Environmental Science 2 (2): 124-128 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

REVIEW ARTICLE Climatic fluctuations in Uttarakhand Himalayan region and resulting impacts: A review

Kavita Tariyal Department of Applied Sciences and Humanities, THDC Institute of Hydropower Engineering and Technology, (Constituent Institute of Uttarakhand Technical University, Dehradun), Bhagirthipuram, Tehri Garhwal- 249001 (Uttarakhand), INDIA E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 02 May 2017 The Himalayan Mountains are the stock of precious biodiversity and water, and providers of Revised received: 25 May 2017 ecosystem goods and services on which local communities depend. These “clean” regions are Accepted: 28 May 2017 becoming victims of transport of atmospheric pollutants and climate-altering substances. Uttarak- hand state has become victim of several catastrophic events such as Cloud bursts, landslides and Keywords Floods in past few years. The young Himalaya is facing worse calamities with every passing year. Biodiversity The devastation in Uttarakhand in June, 2013 showed that some of the effects of climate change are Cloud bursts already upon us. Flash floods in Uttarakhand were inevitable, given the record rainfall. But their Ecosystems strength was multiplied by glacial lake outbursts. And the effects were worsened many times by Fragile ecosystems ill-planned development. It ought to serve as a wake-up call to desist from a development model Himalayan Mountains that upsets fragile ecosystems on a large scale and impoverishes people who are already highly vulnerable to a wide range of social and economic problems. The economy of the mountain communities of Uttarakhand is largely dependent on its natural resource base and climate-sensitive livelihoods like subsistence agriculture, and forestry. However, the impacts of climate change are visible in mid- and high- altitude regions in the shape of changes in ecosystems and changes in seasons. These changes have both positive and negative effects on resource-based livelihoods. There is a need to identify the changes that are currently visible in the mountain regions, analyze them and help the local communities to adapt to them. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Tariyal, K. (2017). Climatic fluctuations in Uttarakhand Himalayan region and resulting impacts: A review. Archives of Agriculture and Environmental Science, 2(2): 124-128.

INTRODUCTION alluvium. South of the foothills are the Tarai and Duars The Himalayas are known as the youngest mountains in plains, which are heavily farmed. the world, and with this, they are acutely fragile. Any The Uttarakhand disaster which took place at the change in the climate here affects the people ecologically, beginning of the 2013 monsoon season is an outcome of socially, economically and culturally, not just in the re- ignorance of the ecological systems that hold up the flimsy gion, but beyond. Uttarakhand lies on the southern slopes Himalayas, and greed to profit from the exploitation of the of the central, western Himalaya. It extends latitude wise rich natural and cultural heritage of the region. Today the from 280N to 310N and Longitude wise from 770E to 810E. ecologically brittle Himalayas and our sacred rivers are Its elevation ranges from 300 meters to 3,600 meters span- being ruthlessly exploited. The disaster which has led to ning the Great, Middle and Sub-Himalaya (Figure 1). The around 5,000 deaths on current estimates and the disap- Great Himalaya comprises a stretch above the tree-line pearance of nearly 1 lakh people is a wakeup call to stop with snow-covered peaks and few or temporary habita- the destruction of environment. Present paper reviews the tions. The Middle Himalaya region, about 80 km. wide, is literature on the potential biophysical and economic a complex mosaic of forest-covered ranges and fertile val- impacts of climate change in the Himalayas. The fragile leys. The Sub-Himalaya, the southernmost zone, is a large landscapes of the Himalayan region are highly susceptible number of long, flat-bottomed valleys known as duns, to natural hazards, leading to ongoing concern about which are usually spindle-shaped and filled with gravelly current and future climate change impacts in the region.

125 Kavita Tariyal /Arch. Agr. Environ. Sci., 2 (2): 124-128 (2017) several ecosystem services, such as cleaning water and removing carbon from the atmosphere. A number of precious services of ecosystems viz., land and water resources, agriculture, biodiversity will experience a wide range of stresses together with pests and pathogens, invasive species, atmospheric pollution, acute events, wildfires and floods. Direct pressures posed due to climate change may get intensified by high temperatures, decreased water availability, and altered frequency of extreme events and severe storms. Climate change will potentially make a threat on the obtainability of, and access to, water resources (Tariyal et al., 2014; Tariyal, 2014, 2015). Retreating Himalayan glaciers: The Himalayan region has the largest concentration of glaciers outside the polar caps. With glacier coverage of 33,000 sq km, the region is aptly called the “Water Tower of Asia”, as it provides around 86,000,000 cubic meters of water annually. These Himalayan glaciers feed seven of Asia‟s greatest rivers; the Ganga, the Indus, the Brahmaputra, the Salween that pass- Figure 1. Map of Uttarakhand Himalayan region. es through China and Myanmar, the Mekong, the Yangtze Global climatic change: Global climate change is one of and the Huang Ho. They ensure a year-round water supply the most important challenges which are being faced by about 1 billion people. The changes in climate variability the international community nowadays. Scientists have have led to a rapid retreat of mountain glacier systems, presented overwhelming evidence that climate change is which are considered the lifeline of river basins and eco- certainly happening, that human action has contributed to systems. Scientific studies have shown that 67 percent of the problem, and that it will have far-reaching implications glaciers are retreating at a startling rate in the Himalayas as for ecosystems, including human settlements (Salehyan, a result of various factors including climate change. Such 2008). The human systems that are highly vulnerable to changes in average global surface temperatures can have climate change are water resources, agriculture, forestry, serious consequences on the stability of the glacial fisheries, energy production, industry, insurance and other systems. The impact of global warming is perhaps already financial services, and human health (particularly a net upon the Himalayas. The 30.2-km-long Gangotri glacier, increase in the geographic range of malaria and dengue). the second largest among the 6,500-odd small and large Much of Earth‟s surface may not be habitable by 2300 due glaciers in the Himalayas and which feeds the perennial to the limits to human tolerance of heat. Though it is Ganga, is receding at a rate that is worrying (Tariyal et al., normal for local temperature to fluctuate, but over the past 2013; Tariyal and Bartwal, 2014). 50 years the average global temperature has amplified at The melting of the Gangotri Glacier in India is accelerating the fastest rate in recorded history. Carbon dioxide and with an average rate of retreat of 30 meters annually. The other air pollutants that are accumulating in the atmosphere immediate or short-term impact of a receding Gangotri (or like a thickening blanket, trapping the sun‟s heat and any other large glacier) would be an increased risk of causing the planet to warm up, generally called greenhouse glacial hazards, such as incidents of landslips, changes in effect. the courses of rivers and floods. The higher melt means Climate change in Himalayan region: The Himalayan more discharge into rivers and reservoirs. Already there is region expresses a huge changeability of climates, hydro- evidence to this effect, there have been instances of flood- logical and ecological systems, plus a diversity of cultures ing in the Ganga basin during drought years and this is and communities. It is an essentiality to the ecological obviously because of increased melt. This increased flow security of the Indian landmass, by providing evergreen can also lead to landslips downstream by triggering unsta- forest cover, feeding recurrent rivers that are the source of ble flow along the area evacuated by the receding glacier potable water, irrigation, and hydropower, conserving because the soil, rocks and the vegetation on them are biodiversity, providing a rich foundation for high value loose and can give way to surging water easily. The UN agriculture, and outstanding landscapes for supportable panel report warns that glaciers across the Himalayas are tourism in the Himalayan region. Increasing concentration melting at an alarming rate and may disappear altogether of greenhouse gases in the troposphere and the consequen- by 2035. Such an event will not only have a severe impact tial global warming is posing a great environmental men- on the Himalayan ecology and the people living in the ace to water and food security at widespread level. The region, but also cause a wide swath of misery downstream. alterations in the climate of the Himalayan region may This is because most of India‟s great northern rivers, like affect exposures to air pollutants by affecting weather, the Ganga and the Yamuna, are dependent on the glaciers anthropogenic emissions, and by changing the dispersal for perennial water supply (Chengappa, 2007). and types of airborne allergens. Therefore, this possible The Himalayan region has shown consistent trends in over- variability in climate will have a thoughtful impact on all warming during the past 100 years (Yao et al., 2006;

Kavita Tariyal /Arch. Agr. Environ. Sci., 2 (2): 124-128 (2017) 126 Tariyal et al., 2013). The rate of retreat for the Gangotri system (Tariyal et al., 2014). Climate change has made the Glacier over the last three decades was more than three future of mountain indigenous people and their livelihoods times the rate during the preceding 200 years. Recent more vulnerable and uncertain. According to present scien- studies have shown that permafrost shrinkage is increasing, tific evidence, climate change will place significant stress and this has distorted the whole hydrological cycle on the rural livelihoods of mountain people. Efforts to (Lawrence and Slater, 2005; Xu et al., 2007). Climate reduce vulnerability and enhance the adaptive capacity of change has been resulting into changes in the frequency at-risk groups need to take a practical approach that and magnitude of extreme weather events. It is now addresses the social processes leading to vulnerability and globally accepted that global warming is associated with the structural inequalities that are often at the root of social the most severe fluctuations, particularly in combination -environmental vulnerabilities (Eriksson et al., 2009). It is with intensified monsoon circulations (Xu et al., 2007; noteworthy that poor and marginalized people already face Tariyal et al., 2013). Large fluctuations in the melting of all of the difficulties that are usually associated with snow and ice can result in excessive or insufficient water climate change. They are already facing poor health, supplies: heavy snowfalls can block roads or overload susceptibility to floods and landslides, and a lack of ade- structures. The action of frost and melting of permafrost quate shelter, food, and water. While they do need climate can pose ecological and technological dangers. The most change adaptation, they need poverty alleviation even more destructive hazards are mostly those which are direct (Eriksson et al., 2009). Within these populations and com- consequences of changes in the Cryosphere (Xu et al., munities, the impacts of climate change are not evenly 2007; Tariyal et al., 2013). distributed, either in intensity within the region, or among Climate imposed impacts and common livelihood: different sectors of society. There is seen earlier and great- Issues associated with modernization like GHG emission, er impact of climate change on fragile ecosystem and poor- air pollution, land use conversions; fragmentation, defor- er and more marginalized people (Eriksson et al., 2009; estation and land degradation have badly affected the Tariyal et al., 2014; Tariyal, 2015). Himalayan region. The landscapes and communities in the Vanishing biodiversity due to climate crisis: Human Himalayan region are being simultaneously affected by behaviour has already caused the destruction of over one rapid environmental and socioeconomic changes. Identifi- third of the world‟s forest. The rapidly rising demand for cation and understanding of key ecological and socioeco- natural resources is resulting genes, species and habitat to nomic parameters of the mountain ecosystems, including vanish at an unprecedented rate. Even at the global level, their sensitivities and vulnerabilities to climate changes, these forests are important in terms of combating green- have become crucial for planning and policy making for house gases, soil erosion and climate change. In a due environmental management and sustainable development time, as a result of use and abuse of these forests and with of the mountain regions as well as the downstream areas wrong or inappropriate property rights and institutional (Tariyal et al., 2014). The Himalayan ecosystem is not arrangements, they are subjected to severe degradation and only a home for mountain goods and services but also for depletion resulting in loss of biodiversity. The core causes biodiversity, community diversity and cultural diversity. of habitat and biodiversity loss are largely institutional and Mountains are sensitive to global warming and are gradu- socio-economic. A key challenge in addressing the threat ally showing the signs of fragmentation and degradation to biodiversity for emerging economies is to balance con- (Tariyal et al., 2014; Eriksson et al., 2009). The impact of servation with the use of their natural resources for growth; climate change on health conditions can be divided into and to find ways to protect vital natural resources, without three major categories: (i) direct impacts from phenomena causing suffering to vulnerable and poor citizens who like drought, heat waves, and flash floods, (ii) indirect depend on them for their daily subsistence needs (Tariyal effects due to climate-induced economic dislocation, et al., 2013; Tariyal and and Bartwal, 2014). Impact of decline, conflict, crop failure, and associated malnutrition Climate Change on forest ecosystems is a subject of recent and hunger, and (iii) indirect effects due to the spread and origin. In this context biophysical models in association provoked intensity of infectious diseases due to changing with regional Climate Change scenarios need to be used to environmental conditions (Eriksson et al., 2009). Valuable assess the impact of Climate Change on forest ecosystems infrastructure, such as hydropower plants, roads, bridges, at national and regional levels in terms of the (i) shifts in and communication systems, will be increasingly at risk boundary of forest ecosystems and upward movement of from climate change. Entire hydropower generation tree lines, (ii) forest ecosystem change matrix, (iii) change systems established on many rivers will be jeopardized if in species mix and composition of vegetation types, and landslides and flash floods increase, and hydropower (iv) species vulnerability to identify vulnerable forest eco- generation will be affected if there is a decrease in the systems, regions and hotspots. Implications of Climate already low flows during the dry season. Engineers will Change on biodiversity, biomass production and net prima- have to consider how to respond to these challenges ry productivity also need to be kept in view in designing (WHO, 2005). This would not only impact the sustainabil- programmes of work (Tariyal, 2014). It is envisaged that ity of the indigenous communities in uplands but also the the effects of Climate Change on the sub-alpine and alpine life of downstream dwellers across the country and be- plant species that inhabit mountain ranges with restricted yond. Hence, there is an urgent need for giving special habitat availability, above the tree line, would experience attention on the present conditions of the Himalayan Eco- severe fragmentation, habitat loss, or even local extinction

127 Kavita Tariyal /Arch. Agr. Environ. Sci., 2 (2): 124-128 (2017) if they fail in moving to higher elevations (Singh et al., witnessed by the region at least over the last 100 years. 2010). Identification and management of corridors for Thus, this disaster can be considered as an Extreme Cli- facilitating effective movement of biota in the face of matic Event of the century. The extent and intensity of the Climate Change have, therefore, gained global attention. tragedy can easily be visualised by the fact that all the There is imminent need at the regional level, to have relia- famous shrines of the Uttarakhand state, located in high ble information to predict the most vulnerable forest types mountainous, snow bound areas such as Badrinath, Kedar- as well as regions. Likewise, research based evidences are nath, Gangotri, Yamunotri, and Hemkund Shahib were required to project future scenarios of shifts in boundaries, badly affected by this extreme fury of the nature. The an- and/or to highlight potential corridors for movement of cient Shri Kedarnath shrine was among the worst affected forest species and wildlife under changing climate. These areas where maximum damage and casualties were report- aspects and many more, require immediate attention of the ed. Active erosion of the loose soil and debris began due to planners, researchers, and forest managers with adequate this excessive flow in all the gulleys/streams causing ex- sensitization of stakeholders. cessive water and sediment accumulation in the rivers. The Uttarakhand disaster: Witness of the impact: Recent voluminous water with unconsolidated debris moved rap- climate changes have a significant impact on high moun- idly towards and smacked Shri Kedarnath town, washing tain glacial environment. Due to continuous rising air away the peripheral part of the town as well as old iron temperatures, on regional and global scales, the precipita- bridge over the Mandakini River and damaging infrastruc- tion pattern at higher altitude can change from snow to rain ture including houses, hotels and shops, etc. This natural (Immerzeel et al., 2010). This high altitude rain causes hazard turned into a major disaster due to the overcrowd- rapid melting of snow, ice and therefore formation and ing of the town by the pilgrims and local population. As expansion of moraine dammed, supra glacial and cirque month of June is a peak time for the visit of pilgrims, the lakes, creating the potential danger in the downstream entire state of Uttarakhand was crowded with people from valley. Exceptional early monsoon rains between June 15 different places as they wanted to have sight of deities and and 17, 2013 combined with melting of snow caused volu- worship in Holy Shrines before the monsoon sets in. The minous floods in the rivers of Uttarakhand (Bhagirathi, unusual timing of very heavy rainfall and its consequences Alaknanda, Mandakini, Dhauliganga and Kali) and subse- made people helpless as it did not let them even realise to quently triggered widespread mud- and landslides. Thou- find ways to escape. If the same event was happened in the sands of pilgrims got stranded at various pilgrimage places month of July-August the number of lives lost could have and en route. However, the majority of casualties took been very less as the movement of the people during these place in the Kedarnath Valley and en route. Heavy down- months is far less than in the month of June. pour activated widespread landslides and flash floods in the region that caused irreparable damage to lives and Conclusions property in the Mandakini valley including complete dam- Thus the human induced climate change will continue in age of 60% of the 14 km pedestrian route from Gaurikund the decades and centuries to come and actions to mitigate to Shri Kedarnath town. The moraine-dammed Chorabari climate change may slow the rate of climate change, but Lake, about 1.5 km upstream the town of Shri Kedarnath, will almost certainly not stop it. To prepare our societies breached and deposited loose unconsolidated moraine de- better for the changes in climate ahead, and to identify bris downstream. This was the main cause of the maxi- possible critical thresholds in the climate system, consider- mum devastation in the downstream of the Kedarnath val- able efforts have been made to project the likely regional ley. The Mandakini River completely washed off Rambara and global climate consequences of the range of plausible and partially washed off Gaurikund, Sonprayag and settle- socio-economic development pathways. Therefore, the ments near the river course. This flash flood event brought world community must come up with an effective response major changes to the landscape of Uttarakhand thus mak- in curbing global warming by evolving norms and taking ing the whole region more fragile and vulnerable (Dobhal strategic steps to mitigate climate change and achieve sta- et al., 2013). The Uttarakhand disaster that has been wit- bilization of greenhouse gas atmospheric concentrations nessed at the beginning of the 2013 monsoon season is a through good laws and implementing machinery. Climate consequence of ignorance of the ecological systems that change is the biggest sustainable development challenge hold up the fragile Himalayas, and greed to profit from the the international community has had to tackle to date. The exploitation of the rich natural and cultural heritage of the process to address the climate change needs to be com- region. Today the ecologically fragile Himalayas and our pletely compatible with the international community‟s sacred rivers are being ruthlessly exploited. The disaster wider ambitions for economic growth and human advance- which has led to around 5,000 deaths on current estimates ment. It is a challenge that transcends borders and requires and the disappearance of nearly 1 lakh people is a wakeup solutions not only at national levels but at the international call to stop the destruction of environment (Deccan Herald, level as well. The challenge is to translate and adapt the 2013; Tariyal, 2014, 2015; Tariyal et al., 2014). national level policy imperatives and equity considerations The flash flood together with landslides incurred heavy to sub-national level actions, and the State Governments losses to the infrastructure, agricultural fields, human and have a key role to play in incorporating climate change animal lives, roads and widespread destruction of natural concerns in everyday governance and adopting climate- resources. Such a magnitude of disaster was perhaps not friendly policies, and investment decisions.

Kavita Tariyal /Arch. Agr. Environ. Sci., 2 (2): 124-128 (2017) 128 Open Access: This is open access article distributed under climate in Himalayan Region. Journal of Studies in Manage- the terms of the Creative Commons Attribution License, ment and Planning, 1(5): 441-449. which permits unrestricted use, distribution, and reproduc- Tariyal, K., and Bartwal, D.M. (2014). Potential impacts of tion in any medium, provided the original author(s) and the climatic variability on Indian Himalayan Region. Octa Journal of Environmental Research, 2(4): 369-376. source are credited. Tariyal, K., Bartwal, D.M. and Bartwal, D.M. (2014). An assess- REFERENCES ment of recent catastrophic event in Uttarakhand: Role of changing climate and human interferences. Journal of Earth Chengappa, Raj (2007). Apocalypse Now, India Today, April 23, Science and Climate Change, 5(5): 1-5. 2007, pp: 42. Tariyal, K., Bartwal, D.M. and Melkania, U. (2013). Glacial Dobhal, D.P., Gupta, A.K., Mehta, M. and Khandelwal, D.D. melting in Himalaya: Local Impacts of climate change on (2013). Kedarnath disaster: Facts and Plausible Causes. mountain ecosystems and livelihoods. Journal of Advanced Current Science, 105(2): 171-174. Laboratory Research in Biology, 5(3): 99-104. Eriksson, M., Jianchu, X., Bhakta, A., Vaidya, R.A. and Nepal, S. Deccan Herald (2013). Uttarakhand: A heavy price for reckless (2009). The changing Himalayas - Impact of climate change destruction of the Himalayas, Deccan Herald, July 19, 2013, on water resources and livelihoods in the Greater Himalayas. pp: 19. International Centre for Integrated Mountain Development, WHO (2005). Human health impacts from climate variability and Kathmandu, Nepal. climate change in the Hindu Kush- Himalaya region. Report Immerzeel, W.W., Van Beek, Ludovicus, P.H., Bierkens and from an Inter-Regional Workshop, Mukteshwar, India. Marc, F.P. (2010). Climate Change Will Affect the Asian Xu, J., Shrestha, A., Vaidya, R., Eriksson, M. and Hewitt, K. Water Towers. Science, 328: 1382-1385. (2007). The melting Himalayas: Regional challenges and Lawrence, D.M. and Slater, A.G. (2005). A Projection of Severe local impacts of climate change on mountain ecosystems and Near-surface Permafrost Degradation during the 21st Centu- livelihoods. ICIMOD Technical Paper. International Centre ry‟. In Geophysical Research Letters, 32(L24401): 1-5. for Integrated Mountain Development (ICIMOD) Kathman- Salehyan, Idean (2008). Climate Change to Conflict? No Consen- du, Nepal. ISBN 978 92 9115 047 2. sus Yet, Journal of Peace Research, 45(3): 315-326. Xu, Z., Gong, T. and C. Liu. (2007). Decadal trends of climate in Singh, S.P., Singh, V. and Skutsch, M. (2010). Rapid warming in the Tibetan Plateau-regional temperature and precipitation. the Himalayas: Ecosystem responses and development Hydrological Processes, 22: 3056-3065. options. Climate & Development, 2: 221-232. Yao, T.D., Guo, X.J., Lonnie, T., Duan, K.Q., Wang, N.L., Pu, Tariyal, K. (2014). Climate crisis and escalating threat to forest J.C., Xu, B.Q., Yang, X.X. and Sun, W.Z. (2006). „δ18O biodiversity. International Journal of Education & Applied Record and Temperature Change over the Past 100 years in Sciences Research, 1(8): 11-19. Ice Cores on the Tibetan Plateau. Science in China: Series D Tariyal, K. (2015). Vulnerability assessment in case of changing Earth Science, 49(1): 1-9.

Archives of Agriculture and Environmental Science 2 (2): 129-133 (2017)

This content is available online at AESA

Archives of Agriculture and Environmental Science

Journal homepage: www.aesacademy.org e-ISSN: 2456-6632

REVIEW ARTICLE Breeding climate change resilient maize and wheat for food security

Asima Gazal, Z.A. Dar1,2, A.A. Lone1, Abrar Yasin1, Yusra Ali1 and M. Habib1 1Dryland (Karewa) Agricultural Research Station, Budgam, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir-190001 (J & K), INDIA 2Division of Plant Breeding & Genetics, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir -190001 (J&K), INDIA *Corresponding author’s E-mail: [email protected]

ARTICLE HISTORY ABSTRACT Received: 02 May 2017 Climate change is affecting agriculture directly or indirectly, worldwide and is an important Accepted: 27 May 2017 challenge that threatens the long-term production growth of cereals. Fluctuating temperature, greenhouse gases, rainfall, and high humidity directly affect the crops, pathogens, insects, and weeds. Keywords Several new diseases, weeds, and insect pests have started appearing with the changing climate. Climate change Maize and wheat are the two of the most important food crops worldwide with too are getting Maize affected. Predictions suggest that climate change will reduce maize and wheat production this will Wheat coincide with a substantial increase in demand for maize and wheat due to rising populations. Maize Food security and wheat research has a crucial role to play in enhancing adaptation to and mitigation of climate change while also enhancing food security. The varieties of agricultural crops with increased tolerance to heat and drought stress and resistance to pests and diseases are serious for handling existing climatic variability and for adaptation to progressive climate change. Numerous climate resilient agricultural technologies such as zero tillage (no tillage), laser land leveling, happy seeder, raised-bed planting, tensiometer, and rotavator have been invented for the conservation of agriculture. Further, drip irrigation and fertigation, leaf color chart (LCC) for need-based application of nitrogen, integrated nutrient management (INM) systems, integrated pest management (IPM) systems, integrated disease management (IDM) systems, site-specific management systems using remote sensing, GPS, and GIS, and Web-based decision support systems for controlling diseases and insect pests are being commercialized to mitigate the climate change. ©2017 Agriculture and Environmental Science Academy

Citation of this article: Asima, G., Dar, Z.A., Lone, A.A. Yasin, A., Ali, Y. and Habib, M. (2017). Breeding climate change resilient maize and wheat for food security. Archives of Agriculture and Environmental Science, 2(2): 129-133.

INTRODUCTION food security, however, is a complex one that is also Climate change refers to changes in the statistical distribu- shaped by economic policies and political decisions. tion of weather across a period of time that ranges from Appropriate climate change research, therefore, involves decades to millions of years. It can be a change in the aver- researchers from a broad spectrum of disciplines along age weather or a change in the distribution of weather with other stakeholders. Maize and wheat are two of the events around an average. The climate change may be most important cereal crops in the world and there is limited to a particular region, or might happen across the increasing concern about the impact of predicted climate entire Earth, and this kind of climate change has been change on the production and productivity of these key recognized (Sahney et al., 2010). The farmers have a very cereal crops. long record of adapting to the impacts of climate variabil- Role of maize and wheat for food security: Maize and ity but forecast of climate change represents a massive wheat are vital for global food security and poverty reduc- challenge that will test farmer’s capability to adapt and tion. Together with rice, maize and wheat jointly provide improve their livelihoods (Adger et al., 2007). Climate at least 30% of the food calories to more than 4.5 billion change is a threat to agriculture and food security and there people in 100 developing countries. In Africa, maize is the is an urgent need to identify priorities for future research. most widely grown staple crop, and it is rapidly expanding The relationship between climate change, agriculture and in Asia. The current cultivated area in over 125 developing

130 Asima Gazal et al. /Arch. Agr. Environ. Sci., 2 (2): 129-133 (2017) countries exceeds 100 million ha. About 67% of the total supra-optimum temperatures and mechanisms of tolerance maize production comes from low and lower middle depend on the severity, duration and timing of heat stress income countries, indicating the vital role the crop plays in together with the developmental stage of the plant. The the livelihoods of millions of poor farmers. Owing to the most significant factors associated with yield reduction growing demand for feed and bio energy, the demand for under heat stress are increased sterility, shortened life maize in the developing world is expected to double by cycle, reduced light interception and the perturbation of 2050 and that for wheat to increase from 621 million tons carbon assimilation processes (photosynthesis, transpira- during 2004 to 2006 to more than 900 million tons in 2050 tion, and respiration) (Reynolds et al., 2010). The effect of (Rosegrant et al., 2007). Many small-scale maize farmers a combination of stresses such as heat and drought stress in Africa, Asia and Latin America cannot afford irrigation on crop yields will be greater than the effect of each stress even when it is available and, hence, grow maize under individually. rain-fed conditions. The crop is, therefore, very vulnerable Increasing temperatures and a higher frequency of to climatic variability and change (Bänziger and Araus, droughts and flooding will also affect ecosystem resilience, 2007). Historical trends clearly show that maize yields increasing outbreaks of pests and diseases (Young and fluctuate more widely from year-to-year than is the case Lipton, 2006). Temperature influences insect development, for rice and wheat. The current probability of failed sea- survival and distribution. As temperatures increase, insect sons in maize farming systems varies between 8 and 35% populations are likely to increase and diversify. The cli- (Hyman et al., 2008). Production fluctuations often give mate changes will also affect the development of maize rise to price fluctuations that can adversely affect both and wheat diseases, with enhancing temperatures and inci- poor producers and consumers. Although considered a dents of drought exacerbating plant stress and increasing temperate species, wheat is the most widely grown of any plant susceptibility (Garrett et al., 2011; Savary et al., crop with around 220 million ha cultivated annually in 2011). The climate represents the key agro-ecosystem driv- environments ranging from very favourable in Western ing force of fungal colonization and mycotoxin production Europe to severely stressed in parts of Asia, Africa, and (Paterson and Lima, 2010). If the temperature increases in Australia (Braun et al., 2010). Wheat is one of the most cool or temperate climates, the relevant regions may susceptible crops to climate change and is especially sensi- become more susceptible to aflatoxins. Maize is particular- tive to heat. Poor productivity growth or stagnation in the ly vulnerable particularly to climate change as exemplified Green Revolution areas of South Asia and low yields in by outbreaks of lethal aflatoxicoses in Kenya (Lewis et al., Africa, coupled with climate change, will make it more 2005). difficult to meet the growing demand for wheat (Rosegrant The effects of climate change on wheat production will et al., 2009). vary greatly depending on region. While future climate Impact of climate change: Climate change is likely to scenarios may be beneficial for the wheat crop in high lead to increased water scarcity in the coming decades latitudes, global warming will reduce productivity in (Lobell et al., 2008; Hendrix and Glaser, 2007). Changes zones where favorable temperatures already exist, for in precipitation patterns will lead to more short-term crop example in the Indo-Gangetic Plains (IGP) of South Asia. failures and long-term production declines. Water scarcity, The IGP, currently part of the favourable, high potential, due to a reduction in rainfall, is projected to become a irrigated, low rainfall mega-environment, accounts for more important determinant of food scarcity than land 15% of global wheat production. By 2050 and due to scarcity and the resulting decline in global per capita food climate change, 51% of the region might suffer from a production will threaten future food security (Brown and significant reduction in wheat yields unless farmers adopt Funk, 2008; Gleditsch et al., 2006). In some regions, appropriate cultivars and crop management practices (Ortiz changes in rainfall distribution will result in temporary et al., 2008). excessive soil moisture or water logging in maize produc- Climate change adaptation and mitigation options: tion areas. Currently water logging regularly affects over Climate change poses huge challenges to food security and 18% of the total maize production area in South and South- the livelihood security of millions. Thus, development and east Asia. Climate change is also likely to lead to an in- dissemination of improved germplasm and risk-reducing crease in temperature. Climate models show a high proba- management options have the potential to offset some of bility (>90%) that by the end of this century, growing the yield losses linked to climate change. Communities season temperatures will exceed the most extreme seasonal may adapt in different ways, including switching to water temperatures recorded in the past century (Battisti and efficient or drought and heat tolerant crops better suited to Naylor, 2009). In Sub-Saharan Africa, maximum tempera- a warmer and drier climate (Lobell et al., 2008) and/or tures are predicted to increase by an average of 2.6°C diversifying livelihood strategies across crops and across maize mega-environments (Cairns et al., 2012). livestock (Seo, 2010). Food security in an era of climate While an increase in temperature of a few degrees is likely change may be possible if farmers transform agricultural to increase crop yields in temperate areas, in many tropical systems via the use of improved seed and fertilizer along areas even minimal increases in temperature may be detri- with improved governance (Brown and Funk, 2008). Mod- mental to food production. High temperatures result in a els of the global food economy suggest that trade will also reduction in crop yields by affecting an array of physiolog- represent an important but not complete buffer against ical, biochemical and molecular processes. Sensitivity to climate change induced yield effects (Rosenzweig and

Asima Gazal et al. /Arch. Agr. Environ. Sci., 2 (2): 129-133 (2017) 131 Parry, 1994). crop so that critical growth stages do not coincide with The International Wheat and Maize Improvement Center stressful conditions or simply to finish the life cycle early (CIMMYT) together with international and national before severe stress conditions occur. Another is to lessen agricultural research institutes are working to develop the incidence of stress with the development of a good root maize and wheat technologies for climate vulnerable coun- system that, in the case of drought, permits water to be tries. Work on maize in Africa is coordinated with the accessed deeper in the soil and, in the case of heat, allows International Institute of Tropical Agriculture (IITA) while transpiration rates that better match evaporative demand, that on wheat in the West Asia and North Africa (WANA) thus approving maximal carbon fixation with the added region is coordinated with the International Center for benefit of cooler plants (Reynolds et al., 2010). Given the Agricultural Research in the Dry Areas (ICARDA). time lag between technology development, deployment Maize: The development of climate-adapted germplasm is and on-farm adoption of new varieties, current research likely through a amalgamation of conventional, molecular also needs to focus on institutional innovations and policy and transgenic breeding methods. In conventional breeding options that facilitate farmers’ access to existing and new for tropical maize, the application of proven drought germplasm to enhance local adaptive capacity to climate breeding methodologies in managed stress screening has change. resulted in significant grain yield increases under drought Conclusions stress (Bänziger et al., 2006). Hybrids developed through CIMMYT’s stress tolerance breeding program have a yield Changing environment is regarded as a major threat to crop advantage of up to 20% compared to commercially availa- productivity, worldwide. To mitigate the effect of climate ble hybrids (Bänziger et al., 2006). In maize, donors with change, there is the need to develop matching crop increased tolerance to drought stress have been identified varieties and production/protection technologies. New and are being incorporated into the breeding pipeline. innovative approaches, such as conservation agriculture Furthermore, novel alleles associated with drought, heat (CA), precision agriculture (PA), and biotechnology (BT), and water logging tolerance, and stress combinations have hold great promise for sustaining agricultural production. also been identified using the latest advances in whole ge- Conservation agriculture involves techniques of “no nome sequencing. Together these developments should tillage” and crop residue management (recycling) and speed up the development of climate adapted maize helps conserve natural resources such as water, soil, and germplasm. Within the primary maize and wild relatives nutrients. Several CA technologies have been developed, gene pool there exists unexploited genetic diversity for for example, zero tillage (no tillage), raised-bed planting, novel traits and alleles (Ortiz et al., 2009) that might be tensiometer, laser land leveling, happy seeder, rotavator. applicable for breeding new high yielding and stress toler- The “precision agriculture” is the need of the hour to apply ant cultivars through conventional methods. Where limited right amount of inputs, at right time, at right place, and in genetic variation in maize exists for biotic and abiotic right manner with right hardware. Several techniques stress tolerance, transgenes will provide the opportunity to ensuring “precision agriculture” have been developed and increase genetic variation into breeding programs (Juma, are being commercialized. Most popular technologies 2011). On-going research at CIMMYT suggests that large include: drip irrigation and fertigation, leaf color chart for genetic variation exists within tropical maize for adapta- need-based application of nitrogen, sensor-based yield tion to heat stress and that a breeding program can take monitors; nitrogen sensors/green seekers, special-purpose advantage of this. More research is needed on the interac- vehicles with sensor-based input applicators; integrated tion of heat and drought stress in cereals (Barnabás et al., nutrient management (INM) systems, integrated pest man- 2008). agement (IPM) systems, integrated disease management Wheat: Wheat yields decline at supra-optimal tempera- (IDM) systems, site-specific management systems using tures (Wardlaw et al., 1989; Reynolds et al., 1994) and remote sensing, geographical positioning system (GPS), significant breeding effort will be required to maintain and geographical information system (GIS), Web-based productivity in regions closer to the equator. Nonetheless, decision support systems for controlling diseases and wheat is relatively well adapted to water deficits and is insect pests, germplasm enhancement for biotic and abiotic grown widely in semi-arid regions such as Central Asia, stress management. Conservation agriculture can also Australia, and throughout the Mediterranean region. In facilitate sequestration of carbon. One way of mitigating regions that become progressively more arid, wheat may CO2 concentration in the atmosphere is through carbon become more competitive than crops, such as maize, that sequestration in the above ground biomass and in the soils, are currently grown. Wheat breeding has had considerable hence directly contributing to climate change mitigation. impact in marginal environments as well as temperate “Seed is the carrier of technology”; therefore, plant breed- ones. Recent effort has focused on breeding for earlier ing involving innovative approaches of biotechnology can maturing cultivars that escape terminal heat stress and play a dominant role in developing climate resilient varie- encompass resistance to diseases associated with warm ties. A series of high-yielding crop cultivars possessing humid environments (Joshi et al., 2007) as well as the resistance to diseases and insect pests and with improved highly virulent Ug99 stem rust strain. One of the most quality have been developed following the conventional effective research strategies for wheat has been, and will methods such as introduction, selection, hybridization, continue to be, to change the phenological pattern of the polyploidy, and mutation breeding. However, these meth-

132 Asima Gazal et al. /Arch. Agr. Environ. Sci., 2 (2): 129-133 (2017) ods are very time consuming and laborious. Moreover, it and salt tolerant crops. has been rather difficult to develop improved varieties in Bänziger, M., Setimela, P.S., Hodson, D. and Vivek, B. (2006). vegetatively propagated and seedless crops. Plant genetic Breeding for improved abiotic stress tolerance in Africa in engineering and DNA marker technologies have now maize adapted to southern Africa. Agriculture Water Management, 80:212-214. become a valuable adjunct in crop improvement for rapid Barnabás, B., Jäger, K. and Fehér, A. (2008). The effect of precision breeding for specific purposes. Maize and wheat drought and heat stress on reproductive processes in cereals. are among the three most important crops for global food Plant Cell Environment, 31: 11-38. security. Climate change will have variable impacts of Battisti, D.S. and Naylor, R.L. (2009). Historical warnings of supply and demand patterns for these crops. Although future food insecurity with unprecedented seasonal heat. wheat production might expand in high latitude temperate Science, 323:240-244. regions, the global warming will decrease production in Braun, H.J., Atlin, G., Payne, T. (2010). Multi-location testing as low rainfall tropical growing regions. Maize production in a tool to identify plant response to global climate change. pp: the developing countries will suffer significantly from 71-91 In: Climate Change and Crop Production. Reynolds MP (Ed). CABI, London, UK. climate change. Climate change will therefore undermine Brown, M.E. and Funk, C.C. (2008). Food security under climate food and livelihood security and complicate efforts to fight change. Science, 319: 580-581. poverty, hunger and environmental degradation. Adapta- Cairns, J. E., Sonder, K., Zaidi, P. H., Verhulst, N., Mahuku, G., tion options include the following: Babu, R., Nair, S.K., Das, B., Govaerts, B., Vinayan, M.T., 1. Technological strategies (investment in research and Rashid, Z., Noor, J.J., Devi, P., San Vicente, F. and Prasan- development of stress tolerant and widely adapted crop na, B.M. (2012). Maize production in a changing climate: varieties, irrigation and natural resource management impacts, adaptation, and mitigation strategies. In D Sparks options). (Ed). Burlington: Academic Press. Advances in Agronomy 2. Policy options (finance, weather index insurance, 114:1-58. Garrett, K.A., Forbes, G.A., Savary, S., Skelsey, P., Sparks, A.H., strategic food reserves, etc.) Valdivia, C., Van Bruggen, A.H.C., Willocquet, L., Djurle, 3. Capacity building (institutional plus physical infrastruc- A., Duveiller, E., Eckersten, H., Pande, S., Vera Cruz, C. and ture including water storage, irrigation systems, food Yuen, J. (2011). Complexity in climate change impacts: A storage, processing, forecasting and disaster preparedness). framework for analysis of effects mediated by plant disease. 4. Income diversification (within and outside of agricul- Plant Pathology, 60:15-30. ture). Gleditsch, N.P., Furlong, K., Hegre, H., Lacina, B., Owen, T. Despite some uncertainties on the spatially differentiated (2006). Conflicts over shared rivers: resource scarcity or impact of climate change on agricultural production, there fuzzy boundaries? Political Geography, 25:361-382. is little doubt that new germplasm, more suited to future Hendrix, C.S. and Glaser, S.M. (2007). Trends and triggers: Climate, climate change and civil conflict in Sub-Saharan climates, is critical along with improved agronomic and Africa. Political Geography, 26: 695- 715. crop management practices. There is an urgent need to Hyman, G., Fujisaka, S., Jones, P., Wood, S., de Vicente, C. and develop climate-adaptable crop varieties with improved Dixon, J. (2008). Strategic approaches to targeting technolo- tolerance to heat stress, and combined heat and drought gy generation: Assessing the coincidence of poverty and stress. In some cases, climate change may create new drought-prone crop production. Agricultural System, 98: biotic stresses brought by new conditions conducive to 50-61. pest and disease infestations. Decision support systems Joshi, A.K., Ferrara, O., Crossa, J., Singh, G., Sharma, R., Chand, (crop modelling) may help project any likely effects of R. and Parsad, R. (2007). Combining superior agronomic climate change on the outbreak and spread of disease and performance and terminal heat tolerance with resistance to spot blotch (Bipolaris sorokiniana) in the warm humid pest epidemics. Gangetic plains of south Asia. Field Crop Research, 103: Open Access: This is open access article distributed under 53-61. the terms of the Creative Commons Attribution License, Juma, C. (2011). Preventing hunger: biotechnology is key. which permits unrestricted use, distribution, and reproduc- Nature, 479:471-372. Lewis, L., Onsongo, M., Njapau, H., Schurz-Rogers, H., Luber, tion in any medium, provided the original author(s) and the G., Kieszak, S., Nyamongo, J., Backer, L., Dahiye, A.M., source are credited. Misore, A., DeCock, K. and Rubin, C. (2005). Aflatoxin contamination of commercial maize products during an out- REFERENCES break of acute aflatoxicosis in eastern and central Kenya. Adger, W.N., Agrawala, S., Mirza, M., Conde, C., O'Brien, K., Environmental Health Perspectives, 113:1763-1767. Pulhin, J., Pulwarty, R., Smit, B. and Takahashi, K. (2007). Lobell, D., Burke, M., Tebaldi, C., Mastrandera, M., Falcon, W. Assessment of adaptation practices, options, constraints and and Naylor, R. (2008). Prioritizing climate change adapta- capacity. pp. 717-743. In: Climate Change 2007: Impacts, tion needs for food security in 2030. Science, 319: 607-610. Adaptation and Vulnerability (Contribution of Working Ortiz, R., Sayre, K.D., Govaerts, B., Gupta, R., Subbarao, G.V., Group II to the Fourth Assessment Report of the Intergov- Ban, T., Hodson, D., Dixon, J.A., Ortiz-Monasterio, J.I. and ernmental Panel on Climate Change), Parry ML, Canziani Reynolds, M. (2008). Climate change: Can wheat beat the OF, Palutikof JP, vander Linden PJ, Hanson CE (Eds.), heat? Agriculture Ecosystem and Environment, 126:46-58. Cambridge University Press, Cambridge, (UK). Ortiz, R., Taba, S., Tovar, V.H.C., Mezzalama, M., Xu, Y., Yan, Bänziger, M. and Araus, J.L. (2007). Recent advances in breed- J. and Crouch, J.H. (2009). Conserving and enhancing maize ing maize for drought and salinity stress tolerance. p. 587- genetic resources as global public goods -a perspective from 601. In: Advances in molecular breeding towards drought CIMMYT. Crop Science, 50:13-28.

Asima Gazal et al. /Arch. Agr. Environ. Sci., 2 (2): 129-133 (2017) 133 Paterson, R. and Lima, N. (2010). How will climate change affect Rosenzweig, C. and Parry, M.L. (1994). Potential impact of mycotoxinsin food? Food Research International, 43:1902- climate change on world food supply. Nature, 367:133-138. 1914. Sahney, S., Benton, M.J. and Falcon-Lang, H.J. (2010) Rainforest Reynolds, M.P., Balota, M., Delgado, M.I.B., Amani, I. and Fisch- collapse triggered Pennsylvanian tetrapod diversification in er, R.A. (1994). Physiological and morphological traits associ- Euramerica. Geology, 38:1079-1082. ated with spring wheat yield under hot, irrigated conditions. Savary, S., Nelson, A., Sparks, A.H., Willocquet, L., Duveiller, Australian Journal of Plant Physiology, 21:717-730. E., Mahuku, G., Forbes, G., Garrett, K.A., Hodson, D., Reynolds, M.P., Hays, D. and Chapman, S. (2010). Breeding for Padgham, J., Pande, S., Sharma, M., Yuen, J. and Djurle, A. adaptation to heat and drought stress. p. 447-454. In: (2011). International Agric. Res. tackling the effects of Climate Change and Crop Production, Reynolds (Ed). MP global and climate changes on plant diseases in the develop- CABI, London (UK). ing world. Plant Disease, 95:1204-1216. Rosegrant, M.R., Ringler, C., Sulser, T.B., Ewing, M., Palazzo, Seo, S.N. (2010). Is an integrated farm more resilient against A., Zhu, T., Nelson, G.C., Koo, J., Robertson, R., Msangi, S. climate change? A micro-econometric analysis of portfolio and Batka, M. (2009). Agriculture and Food Security under diversification in African agriculture. Food Policy, 35(1): Global Change: Prospects for 2025/2050. Background note 32-40. for supporting the development of CGIAR Strategy and Wardlaw, I.F., Dawson, I.A., Munibi, P. and Fewster, R. (1989). Results Framework. International Food Policy Research The tolerance of wheat to high temperatures during Institute: Washington, D.C. reproductive growth. I. Survey procedures and general Rosegrant, M.W., Ringler, C., Msangi, S., Zhu. T., Sulser, T., response patterns. Australian Journal of Agricultural Valmonte-Santos, R. and Wood, S. (2007). Agriculture and Research, 40:1-13. food security in Asia: The role of agricultural Res. Young, K.R. and Lipton, J.K. (2006). Adaptive governance and knowledge in a changing environment. Journal of Semi-Arid climatic change in the tropical highlands of western South Tropical Agricultural Research, 4:1-35. America. Climatic Change, 78: 63-102.

About the Journal

Official Cover Page

ISSN Number : 2456-6632 (Online) Name : Archives of Agriculture and Environmental Science Periodicity : Four issue in a year (March, June, September and December) Publisher : Agriculture and Environmental Science Academy Haridwar-249408 (Uttarakhand), India

he journal Archives of Agriculture and Environmental Science (AAES) is a peer- reviewed, multi-disciplinary, open access International Journal that provides rapid publication (on T monthly basis) of original research articles as well as review articles. It publishes research papers in all areas of Agricultural and Environmental Sciences. All papers are subjected to peer review by members of the editorial board or qualified reviewers by the use of double blind peer review system and if accepted it will be published in the coming issues (March, June, September and December) of the journal. Agricultural chemistry, Agricultural development, Agricultural economics, Agricultural engineering, Agricultural entomology, Agricultural extension, Agricultural genomics, Agricultural microbiology, Agro- ecology, Agronomy, Animal science, Aquaculture, Bioinformatics, Bio-processing, Bioremediation, Crop science, Cytogenetics, Dairy science, Ecosystems services, Environmental impacts, Environmental pollution, remediation and restoration, Environmental microbiology, Environmental toxicology, Environmental sciences, Epigenetic, Food and nutritional sciences, Forestry, GIS and remote sensing applications, Horticulture, Irrigation Science, Lives stock production, Marine science, Medicinal plants, Natural resource ecology and management, Nutrient recycling, Pesticide science, Plant breeding, Plant pathology, Plant protection, Pollution Research, Post-harvest biology and technology, Poultry science, Seed science research, Soil science, Stored products research, Sustainable Development, Systematic biology, Tree fruit production, Toxicology, Vegetable Science, Waste management, Water resources management and Weed biology and other related disciplines.

Dr. Vinod Kumar Editor-In-Chief

About the journal Guidelines for Authors

The journal ‘Archives of Agriculture and Environmental Science’ publishes papers of international significance relating to the Agricultural, Biological and Environmental Science and related fields.

Types of papers  Original papers (Regular papers) should report the results of original research. The material should not have been published previously elsewhere, except in a preliminary form.  Reviews should cover a part of the subject of active current interest. They may be submitted or invited.  A Short communication is a concise, but complete, description of a limited investigation, which will not be included in a later paper. Short communications should be as completely documented, both by reference to the literature and description of the experimental procedures employed, as a regular paper. They should not occupy more than 6 printed pages (about 12 manuscript pages, including figures, etc.).  Letter to the Editor: correspondence.

Language The manuscripts must be written in good English (American or British usage is accepted, mixture of these should be avoided).

Ethics in publishing For information on Ethics in publishing and Ethical guidelines for journal publication read the guidelines.

Conflict of interest All authors are requested to disclose any actual or potential conflict of interest including any financial, personal or other relationships with other people or organizations within three years of beginning the submitted work that could inappropriately influence, or be perceived to influence, their work.

Copyright Upon acceptance of an article, authors will be asked to complete a 'Journal Publishing Agreement' (for more information on this and copyright. An e-mail will be sent to the corresponding author confirming receipt of the manuscript together with a 'Journal Publishing Agreement' form or a link to the online version of this agreement.

Online Submission The research papers/reviews/short communications can be submitted for its forthcoming issues. The research papers can be submitted any time preferably online at www.aesacademy.org or via email to [email protected] or [email protected]. All correspondence, including notification of the Editor's decision and requests for revision, will take place by e-mail. All submissions must be accompanied by a cover letter detailing what you are submitting.

Referees Authors are required to identify four persons who are qualified to serve as reviewers. Authors are requested not to suggest reviewers with whom they have a personal or professional relationship, especially if that relationship would prevent the reviewer from having an unbiased opinion of the work of the authors. A working e-mail address for each reviewer is essential for rapid review in the event that reviewer is selected from those that are identified by the authors. You may also select reviewers you do not want to review your manuscript, but please state your reason for doing so.

2 | Guideline for Authors

Article structure  Title of the manuscript: The title of the manuscript should be short, specific and informative. The author(s) name and their full address with the name of the department, institute, city, pin code, state and country. Complete addresses of corresponding author along with E-mail id must be provided on the title page and the name of corresponding author must be indicated by star (*) in the names of authors.  Abstract: Abstract (not to exceed 250 words) should be written with the aim, major findings (numerical values) and a conclusion statement including novelty of the work.  Keywords: At least three to five keywords must be added at the end of abstract. Keywords must not be included in the title of the manuscript.  Introduction: Clearly write the introduction of research problem, objectives of the work and provide an adequate background, avoiding a detailed literature survey or a summary of the results and significance of the study in the introduction section.  Materials and Methods: Materials and methods should be written clearly and systematically. Standard methods used in the study should be mentioned. Provide sufficient detail to allow the work to be reproduced. Methods already published should be indicated by a reference: only relevant modifications should be described.  Results and Discussion: Results should be clear and concise and should be presented either in the tables and figures. Repetition of results should be avoided. Results should be discussed with input of current references and should explore the significance of the results of the work, not repeat them. A combined Results and Discussion section is often appropriate. Avoid extensive and old citations and discussion of published literature.  Conclusions: The main conclusions of the study may be presented in a short conclusions section followed by Results and Discussion section. Conclusion should be written in view of the major findings of the study. Do not use non-standard or case-specific abbreviations in the Conclusions. Citations should be avoided in the conclusion section.  Acknowledgements: Funding agency that provided financial support for the conduct of the research : and/or preparation of the manuscript and to briefly describe the role of the sponsor(s), if any, in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the article for publication should be acknowledged. Grant number/file number must be mentioned for a funding agency.  Abbreviations: Abbreviations should be defined in the text where they are used first.  Tables: Tables should not be excessively large. All the tables should be cited consecutively in accordance with their appearance in the text. Place footnotes to tables below the table body and indicate them with superscript lowercase letters. Carefully use the tables and ensure that the data presented in tables do not duplicate results described elsewhere in the article. Table caption for each table must be provided.  Figures: Colour or gray scale figure with high resolution must be provided. In case of graphs well defined axis should be preferred. Figure caption for each figure must be provided.  References: All the references should be cited both in the text and reference section of the manuscript and vice versa.  Citation in the text For single author: The author's name (without initials, unless there is ambiguity) and the year of publication, Example: (Chopra, 2015). For two authors: Both authors' names and the year of publication, Example: (Kumar and Chopra, 2015). For three or more authors: First author's name followed by 'et al.' and the year of publication, Example: (Kumar et al., 2015). Groups of references: should be listed chronologically of their publication year. More than one reference from the same author(s) in the same year must be identified by the letters 'a', 'b', 'c', etc., placed after the year of publication. , Example: (Kumar and Chopra, 2014a; 2014b; 2014c).

3 | Guideline for Authors

 Citation in reference section Reference to a journal publication For single author: Kumar, V. (2014). Fertigation response of Abelmoschus esculentus L. (Okra) with sugar mill effluent in two different seasons. International Journal of Agricultural Science Research, 3(9): 164-180. For two authors: Kumar, V. and Chopra, A.K. (2014). Ferti-irrigational impact of sugar mill effluent on agronomical characteristics of Phaseolus vulgaris (L.) in two seasons. Environmental Monitoring and Assessment,186:7877–7892.DOI 10.1007/s10661-014-3974-4 For three or more authors: A.K., Srivastava, S., Kumar, V. and Pathak C. (2013). Agro-potentiality of distillery effluent on soil and agronomical characteristics of Abelmoschus esculentus L. (Okra). Environmental Monitoring and Assessment, 185: 6635-6644. DOI 10.1007/s10661-012-3052-8  Reference to a book publication Mettam, G.R., Adams, L.B. (2009). How to prepare an electronic version of your article, in: Jones, B.S., Smith, R.Z. (Eds.), Introduction to the Electronic Age. E-Publishing Inc., New York, pp. 281–304.  Reference to a book chapter Kumar, V. and Chopra, A.K. (2013).Contamination of heavy metals in vegetables irrigated with textile effluent at Haridwar (Uttarakhand). Climate Change Effects on Agriculture and Economy, Biotech Books, New Delhi, 73-80.  Reference to an online documentation The Royal Society and the Royal Academy of Engineering. (2004). Nanoscience and Nanotechnologies: Opportunities and Uncertaintie. pp, 20-22. Retrieved August, 18 2006 from www.nanotec.org.uk/finalreport.htm

Submission checklist The following list will be useful during the final checking of an article prior to sending it to the journal for review. Please consult this Guide for Authors for further details of any item. Ensure that the following items are present:  One author has been designated as the corresponding author with contact details:  E-mail address  Full postal address  All necessary files have been uploaded, and contain:  Keywords  All figure captions  All tables (including title, description, footnotes)  Further considerations  Manuscript has been 'spell-checked' and 'grammar-checked'  References are in the correct format for this journal  All references mentioned in the Reference list are cited in the text, and vice versa  Permission has been obtained for use of copyrighted material from other sources (including the Internet)

Submission and publication Manuscripts can be submitted any time on-line at http://www.aesacademy.org/ . The author membership is not necessary for submission of the manuscript. The author shall submit processing fee (Rs. 500/- inside India / USD $50 outside India) once the manuscript number is allotted. On the receipt of processing fee, the manuscript will come under the review process. On completion of the review process and depending on the quality of the manuscript, it would be accepted for publication. The decision of Editor-in-Chief would be final for the acceptance of the manuscript for publication in the journal. On acceptance of the manuscript, administrative (Rs. 1500/- inside India / USD $100 outside India) fee would be charged for

4 | Guideline for Authors

publication. It may be noted that the processing fee does not guarantee acceptance of the manuscript. It will be non-refundable, even if manuscript is not accepted. The processing fee for Annual Members will be waived for one manuscript in the membership year. The processing fee for the Life-members will be waived for one manuscript every year. However, administrative fee will be charged for publication of the manuscript. For any subsequent manuscript, separate processing and administrative fee would be charged.

Proofs Galley proofs of the accepted manuscript will be sent to the corresponding author and should be returned within five days of receipt by e-mail. However, on non-receipt of the proof, the care would be taken by the publisher to get the papers corrected and published at the earliest possible. As part of our Go Green initiative, AESA has decided to publish the journal online. This will help us to fulfill our environmental commitment to care of our mother earth for ourselves and generations to come. There will be nominal charges to cover publication and administrative costs. A secured e-print (pdf file) of the published research paper/review article would be provided free of cost by e-mail to the members of Agriculture and Environmental Science Academy. Authors will be able to access the manuscript published in the journal after free registration on the website of the journal.

Other contributions The book reviews/announcements of forthcoming seminars/conferences and their reports/ book reviews/letters to the editors would also be considered by the Editors for publication.

*Fellow of the Academy (FAESA): The life members of the academy will be considered for the fellow of the academy. The payments would be accepted preferably online /or through Bank draft in favour of ' Agriculture and Environmental Science Academy' payable at Haridwar (Uttarakhand) and should be sent by registered/ speed post to Dr. Vinod Kumar, President, AESA, Department of Zoology and Environmental Science, Gurukula Kangri University, Haridwar-249404, (Uttarakhand), India. Cheques will not be accepted.

5 | Guideline for Authors

Agriculture and Environmental Science Academy

Archives of Agriculture and Environmental Science An International Journal | eISSN: 2456-6632

Journal homepage: www.aesacademy.org

Subscription Form Name of applicant (In capital latters): Km/Mr./Miss/Dr./Prof./______Designation: ______

Department: ______Affix a passport Institution /Organization: ______sizephotograph Educational Qualifications: ______Research Field: ______

Type of Membership (Check √): Annual ( ) / Lifetime ( ) / Individual ( ) / Institutional ( ) Year of Membership: From ____/____/______to ____/____/______or lifetime ( ) or renewal ( ) Mailing Address: ______Phone (with code): ______Fax (with code): ______E-mail: ______

Self Declaration I herby declare that all the information given by me are true. I am enclosing herewith an Online payment in- voice No. ______of worth INR/USD ______(in words ______) in favor of “Agriculture and Environmental Science Academy” payable at Haridwar towards my selected membership/subscription. I accept the rules and regulations of Agriculture and Envi- ronmental Science Academy.

Dated: ______Signature of Applicant Instructions: 1. All fields are necessary. 2. A valid bank-draft and this form (completely filled) should be sent by registered/speed post to the address “Dr. Vinod Kumar (President), Agriculture and Environmental Science Academy 86, Gurubaksh Vihar (East) Kankhal Haridwar-249408, Uttarakhand, India.” 3. Do not staple the form with demand draft or any other document.

Membership/Subscription Information

*Fellowship of the Academy (FAESA): The life members of the academy will be considered for the fellow of the academy. For any query email us at [email protected] Agriculture and Environmental Science Academy | Archives of Agriculture and Environmental Science For any query visit journal homepage or email us at [email protected]

Archivesof Agriculture and Environmental Science

Archives of Agriculture and Environmental Science

An International Journal Volume 1 | Issue 1

An International Journal International An

Volume

Issue

Agriculture and Environmental Science Academy 2017