Gene Expression Differences in Infected and Noninfected Middle Ear Complementary DNA Libraries

ORIGINAL ARTICLE Gene Expression Differences in Infected and Noninfected Middle Ear Complementary DNA Libraries

Joseph E. Kerschner, MD; Edward Horsey, PhD; Azad Ahmed, MD; Christy Erbe, BS; Pawjai Khampang, MS; Joseph Cioffi, PhD; Fen Ze Hu, PhD; James Christopher Post, MD, PhD; Garth D. Ehrlich, PhD

Objectives: To investigate genetic differences in middle S100 calcium-binding protein A9 (S100A9); secretory leu- ␤ ear mucosa (MEM) with nontypeable Haemophilus in- koprotease inhibitor (SLPI); 2-microglobulin (B2M); fer- fluenzae (NTHi) infection. Genetic upregulation and ritin, heavy-chain polypeptide 1 (FTH1); and S100 cal- downregulation occurs in MEM during otitis media (OM) cium-binding protein A8 (S100A8) were expressed at pathogenesis. A comprehensive assessment of these genetic significantly higher levels in the NTHi-infected library. differences using the techniques of complementary DNA Calcium-binding proteins S100A9 and S100A8 serve as (cDNA) library creation has not been performed. markers for inflammation and have antibacterial effects. Secretory leukoprotease inhibitor is an antibacterial pro- Design: The cDNA libraries were constructed from NTHi- tein that inhibits stimuli-induced MUC1, MUC2, and infected and noninfected chinchilla MEM. Random clones MUC5AC production. were picked, sequenced bidirectionally, and submitted to the National Center for Biotechnology Information Conclusions: A number of genes demonstrate changes (NCBI) Expressed Sequence Tags database, where they were assigned accession numbers. These numbers were during the pathogenesis of OM, including SLPI, which used with the basic local alignment search tool (BLAST) has an impact on mucin gene expression; this expres- to align clones against the nonredundant nucleotide da- sion is known to be an important regulator in OM. The tabase at NCBI. techniques described herein provide a framework for future investigations to more thoroughly understand mo- Results: Analysis with the Web-based statistical pro- lecular changes in the middle ear, which will likely be gram FatiGO identified several biological processes with important in developing new therapeutic and interven- significant differences in numbers of represented genes. tion strategies. Processes involved in immune, stress, and wound re- sponses were more prevalent in the NTHi-infected library. Arch Otolaryngol Head Neck Surg. 2009;135(1):33-39

TITIS MEDIA (OM) IS A examined in detail. Such gene expression common pediatric illness profiles will likely provide insights into the that requires substantial molecular and cellular changes that oc- health care expenditures cur during OM and may provide avenues in treatment. There are an to novel therapeutic treatments. estimated 5 million annual episodes at a cost Cytokines and their role in OM have O 4-6 of $3 to $6 billion per year in the United been studied extensively. Despite these Author Affiliations: Division 1,2 of Pediatric Otolaryngology States. Approximately 5% to 10% of acute advances, less is known about their ex- (Dr Kerschner) and Department OM cases progress to chronic OM with ef- pression on a molecular scale. Tumor ne- of Otolaryngology and fusion (OME), which is a leading cause of crosis factor (TNF), interleukin 1␤ (IL- Communication Sciences hearing loss in children.3 1␤), and other proinflammatory cytokines (Drs Kerschner and Cioffi Despite the considerable potential for are detected at high levels in middle ear and Mss Erbe and Khampang), morbidity from OM and increasing chal- (ME) effusions and likely play an impor- Medical College of Wisconsin, lenges with antimicrobial resistance, there tant role in ME inflammation and the Children’s Hospital of still exist major knowledge deficits with pathologic development of OM.7,8 Tu- Wisconsin, Milwaukee; and Center for Genomic Sciences, respect to the pathogenesis of this dis- mor necrosis factor is a proinflammatory Allegheny-Singer Research ease, particularly on a molecular and ge- cytokine, produced primarily by macro- Institute, Pittsburgh, netic level. Many genes that are upregu- phages in response to bacterial or viral in- Pennsylvania (Drs Horsey, lated and downregulated in the middle ear fection, that has antimicrobial effects, Ahmed, Hu, Post, and Ehrlich). mucosa (MEM) during OM have yet to be stimulates additional cytokine produc-

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 33

©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 tion, and enhances fibroblast proliferation.9,10 Interleu- The MEM tissue specimens used in this study were obtained from kin 1␤ is produced by activated macrophages, is also an young adult (6-10 months old), mixed-breed chinchillas weigh- important mediator of the inflammatory response, and ing 400 to 600 g that were obtained free of ME disease as culls is involved in a variety of cellular activities, including cell from the fur industry (McClenahan Chinchilla Ranch, New Wil- proliferation, differentiation, and apoptosis.7 mington, Pennsylvania). Animals were treated in accordance with the Public Health Service Policy on Humane Care and Use of Labo- Mucins are a family of large, heavily glycosylated pro- ratory Animals, the National Institutes of Health Guide for the teins that have been shown to be important in the patho- Care and Use of Laboratory Animals, and the Animal Welfare Act; 11,12 physiologic development of OM. Nineteen human mu- the animal use protocol was approved by the Institutional Ani- cin genes have been described, and their expression mal Care and Use Committee of the Allegheny-Singer Research pattern in MEM has recently been characterized by our Institute. A total of 12 chinchillas, 6 for each of 2 clinical con- laboratory.13 Middle ear epithelial (MEE) mucins can re- ditions, were used to perform the experiments described. sult in ME effusions that are highly viscous, hindering Prior to chinchilla ME inoculation, or MEM harvest in the normal mucociliary clearance14-16 and subsequently re- case of the uninfected cohort, all ears were examined by pneu- sulting in OME and hearing loss. However, mucins also matic otoscopy. Abnormal findings on evaluation would have play an important protective role in MEM by providing required elimination of the animal from the study. One cohort of animals was used to harvest healthy MEMs, and the second a protective barrier to reduce pathogen invasion, as well cohort was infected with a low-passage clinical isolate (PittDD) as aiding in ME clearance of pathogens and antigen pre- of NTHi. The animals in the normal group were evaluated and 17-22 sentation to host immune cells. Tumor necrosis fac- killed immediately after their appropriate acclimation period. Prior tor and IL-1␤ have been shown to mediate a differential to tissue harvest, the chinchillas were anesthetized via intramus- expression and upregulation of mucin gene 1 (MUC1), cular injection of 0.1 mL of a solution of ketamine hydrochlo- mucin gene 2 (MUC2), mucin gene 4 (MUC4), and mu- ride, 100 mg/mL, xylazine hydrochloride, 30 mg/mL, and cin gene 5AC (MUC5AC) in chinchilla MEE.23 acepromazine acetate, 5 mg/mL. Deep anesthesia was con- Nontypeable Haemophilus influenzae (NTHi) is one of firmed by the abolishment of the eye-blink reflex, followed by the leading causative agents of bacterial OM, and in this euthanasia via intracardiac injection of pentobarbital sodium, 2 g investigation we examined the impact of this pathogen on (Abbott Laboratories, North Chicago, Illinois) as approved by the Panel on Euthanasia of the American Veterinary Medical As- gene expression in the chinchilla MEM using complemen- sociation. The temporal bone, including tympanic membrane and tary DNA (cDNA) library techniques. The chinchilla has ME cavity, was removed bilaterally. The tympanic membrane and historically been the animal model of choice for studying ME cavity were examined closely to ensure there was no evi- OM because it is not naturally susceptible to the disease dence of inflammation or infection. Animals in the NTHi group and has favorable anatomy and genetic similarity to hu- were inoculated 3 days prior to MEM harvest. This 3-day time mans.3,23-25 However, gene sequence information for this frame has been employed in previous investigations and was used species is notably lacking owing to relatively limited ap- to allow for a robust episode of OM to develop prior to harvest. plications of this animal model for other areas of research. Anesthesia was induced as described followed by bilateral transpo- 5 With the explosion of sequence data in the past de- lar injection of 0.1 mL of a 10 colony-forming units/mL–NTHi cade, the need for common terminology has become a suspension using a 0.5-in, 27-gauge needle attached to a 1-mL syringe. necessity. The Gene Ontology (GO) project was created in an effort to construct a consistent vocabulary that de- scribes genes and gene products across a wide range of PATHOGEN different databases (http://www.geneontology.org/GO doc.shtml#control).26 Three structured vocabularies PittDD is a low-passage, ampicillin-sensitive NTHi isolate that was obtained from a child with OME at Children’s Hospital of (ontologies) are used to describe gene products in terms Pittsburgh (Pennsylvania). Initially, a culture of PittDD was of their associated biological processes, cellular compo- grown on chocolate agar and then subcultured once in brain nents, and molecular functions in a species-indepen- heart infusion broth (Becton Dickinson, Sparks, Maryland) dent manner. FatiGO is a free, downloadable Web- supplemented with hemin, 10 µg/mL (Fisher Scientific, Pitts- based application (http://babelomics.bioinfo.cipf.es/index burgh), nicotinamide adenine dinucleotide, 2 µg/mL (Sigma, .html) that is used to examine relevant GO terms for a St Louis, Missouri), and thiamine hydrochloride, 20 µg/mL group of genes with respect to a set of genes of refer- (Sigma) and grown at 37°C in a humidified 5% carbon dioxide ence. Relevance is determined by the application of a atmosphere prior to the preparation of frozen stock. For all sub- Fisher exact test that takes into consideration the multiple- sequent studies, 1 part of the initial frozen stock was thawed testing nature of the statistical contrast performed.27 Using and used for culture. FatiGO, an investigator is able to compare differential expression of genes, categorized by biological processes, from cDNA LIBRARY CONSTRUCTION 2 or more different cDNA libraries, and these tech- AND SEQUENCING niques were employed in this investigation. For both the NTHi-infected and noninfected chinchilla cDNA libraries, RNA was extracted from pooled tissue. Blunt-ended METHODS cDNA was made using the Clone tech Super Smart PCR (polymerase chain reaction) cDNA Synthesis Kit (Mountain View, Cali- ANIMAL MODEL fornia) and amplified by long-distance PCR. The double- stranded cDNA samples were treated with Taq polymerase to add The chinchilla model of acute OM has been well described in nu- A overhangs and the vector TA cloned into the pCR II vector merous laboratories, including those of the current investigative using the Dinitrogen TA cloning kit (Carlsbad, California). The team, and was used for all of the current investigations.3,23-25,28,29 library was then transformed into competent bacteria and propa-

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 34

Gene Forward Primer (5؅-3؅) Reverse Primer (5؅-3؅) Probe Sequence RT-PCR TNFA AGGTCCTCTTCAAGGGCCAAG CTCTGGCAGGGGCTCTTGAT IL1B GACAAAATACCTGTGGCCTTGG TTCTGCTTGAGAGGTGCTGATG S100A9 GTCACTGCTGGAACGCAGCTTA TTTGTGTCCAGGTCCTCCATGA HPRT gctcaagagctactgtaatgac CATATCCAACAACAAACTTGTCTG Real-time PCR TaqMan forward primer (5Ј-3Ј) TaqMan reverse primer (5Ј-3Ј) TaqMan probe sequence (5Ј-3Ј) HPRT GCAGTATAATCCAAAGATGGTCAAGGT TCTGGCCTATATCCAACACTTCGA TTCACCAGCAAGCTTG MUC19 TGACACCTGCTGTGAAATTGGA GGAAGCACCAATCTCATAGTCAGT CTGTGAACCAAGAACATG

Abbreviation: RT-PCR, reverse transcriptase–polymerase chain reaction.

gated under antibiotic selection. The culture was used to pre- cDNA libraries as well as to study the expression of 2 cytokines pare frozen stock that was in 10% glycerol and stored at −80°C. in the noninfected and NTHi-infected libraries. This was neces- Library stocks from the NTHi-infected and noninfected chin- sary given that the libraries used were not normalized and, there- chilla cDNA libraries were plated at a density of approxi- fore, only the most commonly expressed cDNAs were identi- mately 100 to 200 well-isolated colonies per plate. To charac- fied with the initial library investigation presented herein. terize these libraries, 1100 to 1300 colonies were picked at The genes MUC19 (OMIM 612170), TNFA (OMIM 191160), random and transferred to 96-well plates containing 200 L of and IL1B (OMIM 147720) were of specific interest to us and lauria broth (100 µg per l mL of ampicillin) in each well and were therefore chosen for real-time PCR investigation. S100 cal- incubated, shaking at 37°C, overnight. Two microliters of the cium-binding protein A9 (S100A9) was investigated given the overnight culture was transferred to a PCR plate to be se- enormous upregulation demonstrated and to ensure with quan- quenced. The remaining 198 µL was mixed with 50 µL of 50% titative PCR that the results found in our cDNA libraries were glycerol solution, sealed, and stored at −80°C. corroborated. Clones were PCR amplified and prepared for sequencing using For the purpose of designing primers, highly conserved se- the BigDye Primer Cycle Sequencing Kit (Applied Biosystems, quences in IL1B and TNFA were identified by aligning se- Foster City, California). Each clone was sequenced bidirection- quences for the human, rat, mouse, and pig orthologs. Prim- ally with vector primers (T7 and either SP6 or M13 reverse) on ers used in the chinchilla were then designed in regions of high a 3730 DNA Analyzer (Applied Biosystems). The sequence was homology. Primers for S100A9 were designed based on clones returned and was defined as a usable sequence if it was without sequenced from the NTHi-infected library. TaqMan real-time double peaks, low signal intensity, or vector-only derivatives. A PCR primers (Table 1) for chinchilla MUC19 and HPRT (OMIM usable sequence was then submitted for further analysis. 308000) were custom designed using the manufacturer’s soft- ware (Applied Biosystems). Primer pairs used for regular re- SEQUENCE ANALYSIS verse transcriptase–polymerase chain reaction (RT-PCR) are listed in Table 1. All primers were tested on 25 ng of cDNA Raw sequence data were imported into Contig Express (Vector from the NTHi-infected chinchilla MEM library using Plati- NTI Advance 9; Invitrogen) and trimmed according to the fol- num Blue PCR Supermix (Invitrogen) with the following para- lowing algorithm. Vector sequence was removed by identifying meters: 34 cycles of 94°C for 30 seconds, 61°C for 30 seconds, the 5Ј EcoRI site and insert tag and trimming all bases upstream of the tag. The 3Ј end of the sequence was trimmed just prior to 72°C for 30 seconds, preceded by a 5-minute denature at 94°C the poly(A) tail. If no poly(A) tail was found, the sequence was and followed by 72°C elongation. Products were run on a 3% trimmed manually at the first 25 bases containing 6 or more am- agarose gel stained with GelStar (Lonza, Basel, Switzerland) and biguities. For each clone, only the direct sequence was used for visualized with a UV light. The PCR products were purified and analysis. sequenced using the ABI 3100 (Applied Biosystems). Se- Trimmed sequences were submitted to the Expressed Se- quence results were performed using the BLAST process against quence Tags (EST) database at GenBank (http://www.ncbi.nlm the nonredundant nucleotide database at NCBI (http://www ␤ .nih.gov/dbEST/index.html), and each sequence was assigned a .ncbi.nlm.nih.gov/BLAST). Both IL-1 and TNF PCR prod- unique GenBank accession number. These numbers were used ucts from the NTHi-infected chinchilla MEM cDNA library had Ͼ Ͼ ␤ to BLAST each sequence against the nonredundant nucleotide high homology ( 90% homology over 100 bp) to IL-1 and database at the National Center for Biotechnology Information TNF orthologs in the guinea pig. (NCBI) (http://www.ncbi.nlm.nih.gov/blast/). The highest ba- Real-time PCR was performed on cDNA from the nonin- sic logical alignment search tool (BLAST) hit having more than fected and NTHi-infected chinchilla MEM cDNA libraries to 70% homology over more than 100 base pairs (bp) was chosen, test qualitatively and quantitatively for the expression of IL1B and the NCBI Unigene identification numbers and gene sym- and TNF. A 20-µL reaction was set up in triplicate for each gene bols, if available, were recorded. Hits with Unigene annotations consisting of the following: 1X Platinum SYBR Green quanti- in human, mouse, and rat orthologs, respectively, were prefer- tative PCR Supermix-uracil DNA glycosylase (UDG) (Invitro- entially chosen if the hit scores were within 10%. The gene names gen), 0.2µM forward and reverse primers, 150-ng cDNA tem- obtained from the BLAST analysis were used to do a FatiGO analy- plate, and 50nM fluorescein (Invitrogen). Thermal cycling sis of the biological processes represented in the 2 libraries (http: conditions were as follows: UDG decontamination at 50°C for //fatigo.bioinfo.cipf.es/). 2 minutes, initial activation at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, and an- PCR AND REAL-TIME PCR nealing and extension at 60°C for 1 minute. Reactions were run on the BioRad iCycler iQ (BioRad, Hercules, California) and a Both PCR and real-time PCR were used to verify the relative ex- melt-curve analysis was performed at the end of each run to pression of a subset of differentially expressed genes from the check the reactions for primer dimmer artifacts. An aliquot (2 µL)

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 35

©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 Table 2. Overview of Clone Sequences and Annotations From the Noninfected and NTHi-Infected Chinchilla cDNA Libraries

Good Clones Sequences, Insert Size, Sequences With Useful Sequences With Unique Library Sequenced No. Mean, bp Annotations, No. (%) Gene Symbols, No. (%) Noninfected chinchilla cDNA library 1251 724 340 513 (71) 340 (66) NTHi-infected chinchilla cDNA library 1155 506 375 374 (74) 162 (43)

Abbreviations: bp, base pair; cDNA, complementary DNA; NTHi, nontypeable Haemophilus influenzae infection.

A 16 14 12 10 8 6 Clones, No. 4 2 0 MGP ACTB SPP1 CBLB FAU APOD GNAS LGALS1 TMSL3 LUM Gene B 140 120 100 80 60 Clones, No. 40 20 0 S100A9 SLPI B2M FTH1 S100A8 TMSL3 FAM14A LYZ HP PLUNC Gene

Figure. Relative distribution of the most frequent transcripts in the noninfected vs nontypeable Haemophilus influenzae infection–infected (NTHi) chinchilla middle ear mucosa complementary DNA libraries. A, The 10 genes most frequently isolated from the noninfected library; B, the 10 genes most frequently isolated from the NTHi library.

from each reaction was run on a 2% agarose gel to verify the As illustrated in Table 2, 1251 clones were se- amplicon size. Threshold cycle (Ct) values of HPRT and the quenced from the noninfected chinchilla cDNA library, gene of interest were then used to calculate the relative mean 30 of which 724 (58%) yielded usable sequence data that normalized expression in each gene. could be further analyzed. The mean insert size was 340 Real-time PCR, using TaqMan technology (Applied Biosys- tems) was performed on noninfected and NTHi-infected li- bp. A total of 1155 clones from the NTHi-infected chin- braries to test for the presence of MUC19. Twenty-microliter chilla cDNA library were sequenced, of which 506 (44%) reactions were set up in triplicate for each gene. Each tripli- were of usable quality with a mean insert size of 375 bp. cate reaction contained 30 µL of 2X TaqMan Universal PCR Both the noninfected and infected libraries had similar Mastermix, 1 µL of 20X primer/probe mix, 150 ng cDNA, and numbers with respect to clones with useful annotations water to a total of 60 µL. Thermal cycling conditions were as (71% in the noninfected group and 74% in the infected follows: UDG decontamination at 50°C for 2 minutes, initial group). However, the 2 libraries differed in the number activation at 95°C for 10 minutes, followed by 50 cycles of de- of unique transcripts represented, with the noninfected naturation at 95°C for 15 seconds, and annealing and extension at 60°C for 1 minute, followed by a final 4°C hold. Reac- library having 66% and the infected library 43%. The rela- tions were run on the iCycler iQ (BioRad). The Ct values of tive abundance of transcripts in the noninfected chin- HPRT and MUC19 were then used to calculate the relative mean chilla MEM library and NTHi-infected chinchilla MEM normalized expression.30 library is shown in the Figure. In the noninfected library, the most abundant transcripts (having Ͼ5 cop- RESULTS ies) accounted for 8% of the annotated transcripts. These included matrix gla-protein precursor, ␤-actin, secreted None of the animals in the uninfected group demon- phosphoprotein 1, Cas-Br-M (murine) ecotropic retro- strated evidence of MEM inflammation at the time of har- viral transforming sequence b, Finkel-Biskis-Reilly mu- vest. Each of the animals in the infected group demon- rine sarcoma virus, and ubiquitously expressed FAU. The strated mucosal edema and purulent secretions. most abundant transcripts in the NTHi-infected library

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 36

©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 Table 3. Results of FatiGO Analysis on Noninfected vs NTHi-Infected Chinchilla MEM cDNA Libraries

Noninfected NTHi Biological Processa Level Genes in Noninfected Library Library, % Genes in NTHi-Infected Library Infected, % Defense response 3 SPP1, CRSP7, CD97, LTF, ALOX5AP 2.23 S100A9, CCL4, TNFAIP6, C3, LYZ, 14.13 IL1RN, S100A8, ANXA1, SAA3P, CLU, BNIP3L, F11R, HP Response to external 3 GNAI2, SPP1, CD97, CTGF, 2.23 S100A9, CCL4, TNFAIP6, C3, 11.96 stimulus ALOX5AP IL1RN, S100A8, ANXA1, SAA3P, CLU, F11R, MKKS Response to stress 3 POLD3, TTN, HSPE1, CSDA, 5.8 S100A9, CCL4, TNFAIP6,C3, 15.22 HMGB2, SEPP1, SPP1, AKR1B1, NFE2L2, IL1RN, S100A8, ANXA1, EIF2S1, ANG, CD97, CTGF, SAA3P, TP53INP1, CLU F11R, ALOX5AP EIF2AK2, MAP4K1 Response to biotic 3 HSPE1, IGBP1, HSPA5, LTF 1.79 IFITM2, CCL4, LYZ, NFE2L2, CD53, 7.61 stimulus BNIP3L, EIF2AK2 Immune system process 3 HLA-C, MMP9, THY1, SPP1, IGBP1, 3.57 CCL4, NFKBIA, C3, IL1RN, CD53, 9.78 ELF1, CD97, LTF CLU, EIF2AK2, BCAP31, MAP4K1

Abbreviations: cDNA, complementary DNA; GO, Gene Ontology; MEM, middle ear mucosa; NTHi, nontypeable Haemophilus influenzae infection. a The GO terms for the biological processes in column 1 were significantly more commonly represented in the infected library than the noninfected library (PՅ.05).

accounted for almost 50% of the annotated transcripts. pared with the noninfected library. The gene TNFA was S100A9 was the most abundant, accounting for 35% of expressed at levels 1.2-fold higher in the NTHi-infected annotated transcripts, followed by secretory leukocyte library compared with the noninfected library. The gene ␤ peptidase inhibitor (SLPI); 2-microglobulin (B2M); fer- IL1B was present at levels 23-fold higher in the NTHi- ritin, heavy-chain polypeptide 1 (FTH1); and calcium- infected library compared with the noninfected library. To binding protein A8 (S100A8). Each of the transcripts with verify the expression of the most highly upregulated tran- good sequence data has been submitted to GenBank at script from the NTHi-infected library, we assayed the origi- the NCBI, and a complete catalog of those transcripts is nal RNA from both the noninfected and NTHi-infected beyond the scope of this article. The consecutive Gen- tissue for S100A9 calcium-binding protein. Quantitative Bank accession numbers which have been assigned to the RT-PCR for S100A9 showed a 500-fold increase in expres- submitted sequences from the libraries are as follows: non- sion in the NTHi-infected library compared with the noninfected sequence; EV780884 through EV781607; and infected library. NTHi-infected sequence, EX149816 through EX150319. Additional information on these genes and sequences uti- lizing these accession numbers can be retrieved online COMMENT at http://www.ncbi.nlm.nih.gov/Genbank/. The FatiGO analysis was performed on the anno- Complementary DNA libraries provide the possibility for tated sequences from the noninfected and NTHi- unbiased investigation of gene expression. No a priori de- infected chinchilla MEM cDNA libraries to identify level sign is necessary to decide which genes might be impor- 3 biological process GO terms that were differentially rep- tant or should be investigated. The results from this in- resented (P Ͻ.05) between the 2 libraries (Table 3). This vestigation demonstrate the usefulness of this avenue of differential representation is based on the percentage of discovery for characterization of processes that are im- annotated genes assigned to a particular biological pro- portant in the pathogenesis of OM. A number of the genes cess, independent of the frequency with which the gene discussed in this section have not been specifically in- occurs in the particular library. Therefore, in Table 3, 5 vestigated in NTHi OM pathogenesis and provide con- genes (2.23%) of the total annotated genes from the non- siderable promise for future investigations. The use of a infected library fall into the biological process of de- nonnormalized library, as in this study, allows for com- fense response, whereas 13 genes (14.13%) of the total parison of relative gene expression with an interven- annotated genes from the infected library fall into the bio- tion, in this case, NTHi infection. However, it is more logical process of defense response. The biological pro- limited in the ability to identify more rarely expressed, cesses with the most notable differences (2-fold or higher) yet important, genes, given its concentration on the most are shown in Table 3 and include defense response, re- highly expressed transcripts. Quantitative PCR is an- sponse to external stimulus, response to stress, and re- other technique to assess comparative expression of sponse to biotic stimulus and immune system pro- selected genes as described in this section for TNFA, IL1B, cesses. For all of these groups, the NTHi-infected library and MUC19. had a 2-fold or higher increase in the number of anno- Although not initially cloned from either the NTHi- tated genes assigned to that GO term. infected or noninfected libraries, TNFA, IL1B, and MUC19 We tested our libraries for the presence of MUC19, IL1B, were easily detected by RT-PCR from the RNA used to TNFA, and S100A9 using real-time PCR as described in construct our cDNA libraries. On the one hand, because the “Methods” section. The gene MUC19 was expressed our libraries are nonnormalized, one could expect only at levels 2-fold higher in the NTHi-infected library com- the most common transcripts to be represented in smaller

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 37

©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 samplings of clones. On the other hand, RT-PCR gives tion in these investigations, given that mucins are in- qualitative as well as quantitative expression on a much volved in both MEM protective functions and pathologic more sensitive scale. By this method we were able to de- characteristics associated with overproduction, will be a tect TNFA, IL1B, and MUC19 at higher levels in the NTHi- clearer understanding of temporal relationships between infected library compared with the noninfected library. gene expression of SLP1 and specific mucin genes during These data support previous findings from our labora- the process of NTHi infection. tory that demonstrate that mucins are upregulated in re- Ferritin, heavy chain 1, is the major intracellular iron sponse to TNFA and IL1B.23 To our knowledge, this is storage protein in both prokaryotes and eukaryotes and the first investigation to examine the response of MUC19 has been shown to have a role in mitogen-activated proin OM, which has only recently been described in our tein kinase 8 signaling by inhibiting TNF-induced apop- laboratory as expressed in the MEE.13 The protein prod- tosis. The affinity of Haemophilus (its name, meaning ucts of MUC2, MUC5AC, MUC5B, and MUC6 in hu- “blood loving,” is of Greek origin) species for iron has mans have been previously identified as gel-forming mu- been well described. Residence and propagation of NTHi cins. The recently identified MUC19 has also been within the human ME, which is a highly iron-restricted characterized as producing a gel-forming protein prod- environment, requires that this organism have an effi- uct, and this glycoprotein is the largest mucin protein cient means by which to acquire iron from its host. Re- identified to date. The genes MUC2, MUC5AC, MUC5B, cently, Harrison et al37 suggested that careful balancing and MUC19 are gel-forming mucins found in the hu- of levels of intracellular iron was important for minimiz- man ME in both in vivo and in vitro models.13 With their ing the effects of oxidative stress during NTHi coloniza- ability to increase ME fluid viscosity and inhibit muco- tion and infection. To our knowledge, the specific link- ciliary clearance, gel-forming mucin products should be age of FTH1 to NTHi infection in the ME has not been a focus of future investigations to understand their func- described and warrants further investigation. tions, regulation, and interactions. To our knowledge, Many genes were shown to be differentially ex- this study is the first to examine the regulation of the pressed in our noninfected and NTHi-infected chin- MUC19 mucin gene in MEM and demonstrates that it also chilla MEM cDNA libraries. Although the upregulation is upregulated in NTHi-mediated OM. of S100A9 and SLPI were not surprising considering their We also assayed the original RNA to verify expres- previously described roles in inflammatory processes, the sion of one of the genes shown to be upregulated in the use of a nonnormalized cDNA library in this investiga- NTHi-infected library. The gene S100A9 was highly abun- tion allowed their identification as excellent candidates dant in clones from the NTHi-infected library, repre- for additional study in NTHi OM pathogenesis and, spe- senting 35% of the annotated transcripts. This impor- cifically, with respect to their interactions with mucin gene tant upregulation is the main factor in the difference in regulation. Likewise, one would also expect the proin- unique transcripts noted in this initial investigation of flammatory cytokines Il-1␤ and TNF to be expressed at these libraries: 66% in the noninfected library and 43% higher levels in infected tissue. The presence of these tran- in the infected library. This upregulation, in essence, over- scripts at higher levels in the NTHi-infected tissue speaks whelms the ability to see other genes. In the ongoing char- to the ability of these libraries to represent the OM dis- acterization of these libraries, the number of unique tran- ease process. Further characterization of these libraries, scripts will be expected to become more even. S100A9 which is ongoing, is expected to yield additional fruitful is a calcium-binding protein that belongs to the S100 fam- insights into this disease process. ily. S100A9 and S100A8, also highly expressed in our NTHi-infected library, are capable of forming a heterodi- Submitted for Publication: September 17, 2008; final re- meric complex, termed calprotectin, which has antimi- vision received February 1, 2008; accepted July 9, 2008. crobial properties as well as the ability to stimulate neu- Correspondence: Joseph E. Kerschner, MD, Depart- trophils.31 Overexpression of S100A9 and S100A8 has been ment of Otolaryngology and Communications Disor- associated with many human inflammatory diseases, in- ders, Children’s Hospital of Wisconsin, 9000 W Wiscon- cluding cystic fibrosis, dermatitis, and rheumatoid ar- sin Ave, Milwaukee, WI 53226 ([email protected]) thritis.32-34 To our knowledge, linkage of S100 proteins, Author Contributions: Drs Kerschner, Horsey, Ahmed, specifically S100A9 and S100A8, to NTHi infection has Cioffi, Hu, and Ehrlich and Mss Erbe and Khampang had not been described. Investigations into these proteins and full access to all the data in the study and take respon- NTHi OM pathogenesis are currently under way. sibility for the integrity of the data and the accuracy of Other genes that were highly represented by the clones the data analysis. Study concept and design: Kerschner, Hu, in our NTHi-infected chinchilla cDNA MEM library in- Post, and Ehrlich. Acquisition of data: Kerschner, Horsey, cluded SLPI, FTH1, and B2M. Secretory leukoprotease in- Ahmed, Erbe, Khampang, and Hu. Analysis and interpre- hibitor is an antibacterial protein secreted by cells at mu- tation of data: Kerschner, Erbe, Cioffi, and Ehrlich. Draft- cosal surfaces. It binds tightly to mucins, protecting them ing of the manuscript: Kerschner, Ahmed, and Erbe. Criti- against proteolysis by neutrophil elastase.35 It has been dem- cal revision of the manuscript for important intellectual onstrated36 that mucin gene expression, induced by cys- content: Kerschner, Horsey, Khampang, Cioffi, Hu, Post, tic fibrosis respiratory stimuli, can be inhibited by SLP1, and Ehrlich. Statistical analysis: Kerschner. Obtained fund- indicating its potential importance as an antimucin agent. ing: Kerschner, Post, and Ehrlich. Administrative, tech- Given these interactions and the importance of mucin in nical, and material support: Kerschner, Horsey, Ahmed, OM pathogenesis, this particular gene and its protein prod- Erbe, Khampang, Cioffi, Hu, and Ehrlich. Study super- uct certainly warrant further investigation. A central ques- vision: Kerschner, Cioffi, Hu, and Ehrlich.

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 38

©2009 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 Financial Disclosure: Dr Ehrlich serves as a consultant 16. Hutton DA, Fogg FJ, Murty G, Birchall JP, Pearson JP. Preliminary characteriza- to Medtronics Ear, Nose, and Throat (ENT) Division and tion of mucin from effusions of cleft palate patients. Otolaryngol Head Neck Surg. 1993;109(6):1000-1006. also serves on the Medtronics ENT Division infectious 17. Zeiher BG, Hornick DB. Pathogenesis of respiratory infections and host defenses. disease–biofilm panel. Curr Opin Pulm Med. 1996;2(3):166-173. Funding/Support: The investigations detailed in this ar- 18. Velden VH, Versnel HF. Bronchial epithelium: morphology, function and patho- ticle were supported by National Institutes of Health grants physiology in asthma. Eur Cytokine Netw. 1998;9(4):585-597. through the National Institute on Deafness and Other 19. Obregon D, Hou H, Bai Y, et al. CD40L disruption enhances Abeta vaccine- mediated reduction of cerebral amyloidosis while minimizing cerebral amyloid Communication Disorders: K08DC00192 and DC007903 angiopathy and inflammation. Neurobiol Dis. 2008;29(2):336-353. (Dr Kerschner); DC02148, DC04173, and Health Re- 20. Macfarlane GT, Macfarlane S. Growth of mucin degrading bacteria in biofilms. sources and Services Administration (Dr Ehrlich); and Methods Mol Biol. 2000;125:439-452. DC05659 (Dr Post). This work was also supported, in 21. Macfarlane S, McBain AJ, Macfarlane GT. Consequences of biofilm and sessile part, through funding by the Department of Otolaryn- growth in the large intestine. Adv Dent Res. 1997;11(1):59-68. 22. Nikawa H, Nishimura H, Hamada T, Yamashiro H, Samaranayake LP. Effects of gology and Communication Sciences, Medical College modified pellicles on Candida biofilm formation on acrylic surfaces. Mycoses. of Wisconsin and Allegheny Singer Research Institute. 1999;42(1-2):37-40. Previous Presentation: This study was presented at the 23. Kerschner JE, Meyer TK, Burrows A. Chinchilla middle ear epithelial mucin gene 2008 American Society of Pediatric Otolaryngology Sci- expression in response to inflammatory cytokines. Arch Otolaryngol Head Neck entific Program; May 4, 2008; Orlando, Florida. Surg. 2004;130(10):1163-1167. doi:10.1001/archotol.130.10.1163. 24. DeMaria TF, Yamaguchi T, Bakaletz LO, Lim DJ. Serum and middle ear antibody response in the chinchilla during otitis media with effusion induced by nonvi- REFERENCES able nontypeable Haemophilus influenzae. J Infect Dis. 1992;165(suppl 1): S196-S197. 25. Post JC, Aul JJ, White GJ, et al. PCR-based detection of bacterial DNA after an- 1. Bluestone CD, Klein JO. Otitis media, atelectasis, and eustachian tube dysfunction. timicrobial treatment is indicative of persistent, viable bacteria in the chinchilla In: Bluestone CD, Stool SE, Kenna MA, eds. Pediatric Otolaryngology. Philadel- model of otitis media. Am J Otolaryngol. 1996;17(2):106-111. phia, PA: WB Saunders; 1996:388-582. 26. Ashburner M, Ball CA, Blake JA, et al; Gene Ontology Consortium. Gene ontol- 2. Rosenfeld RM, Casselbrant ML, Hannley MT. Implications of the AHRQ evidence report on acute otitis media. Otolaryngol Head Neck Surg. 2001;125 ogy: tool for the unification of biology. Nat Genet. 2000;25(1):25-29. (5):440-448. 27. Al-Shahrour F, Diaz-Uriarte R, Dopazo J. FatiGO: a Web tool for finding signifi- 3. Kerschner JE, Meyer TK, Burrows A, Ehrlich G, Post JC. Mucin gene cDNA se- cant associations of gene ontology terms with groups of genes. Bioinformatics. quence characterization in chinchilla middle ear epithelium. Int J Pediatr 2004;20(4):578-580. doi:10.1093/bioinformatics/btg455. Otorhinolaryngol. 2006;70(8):1449-1456. 28. Canafax DM, Nonomura N, Erdman GR, Le CT, Juhn SK, Giebink GS. Experi- 4. Ophir D, Hahn T, Schattner A, Wallach D, Aviel A. Tumor necrosis factor in middle mental animal models for studying antimicrobial pharmacokinetics in otitis media. ear effusions. Arch Otolaryngol Head Neck Surg. 1988;114(11):1256-1258. Pharm Res. 1989;6(4):279-328. 5. Yellon RF, Leonard G, Marucha PT, et al. Characterization of cytokines present 29. Mason KM, Munson RS Jr, Bakaletz LO. Nontypeable Haemophilus influenzae in middle ear effusions. Laryngoscope. 1991;101(2):165-169. gene expression induced in vivo in a chinchilla model of otitis media. Infect Immun. 6. Juhn SK, Tolan CT, Garvis WJ, Cross DS, Giebink GS. The levels of IL-1 beta in 2003;71(6):3454-3462. human middle ear effusions. Acta Otolaryngol Suppl. 1992;493:37-42. 30. Muller PY, Janovjak H, Miserez AR, Dobbie Z. Processing of gene expression 7. Smirnova MG, Kiselev SL, Gnuchev NV, Birchall JP, Pearson JP. Role of the pro- data generated by quantitative real-time RT-PCR. Biotechniques. 2002;32(6): inflammatory cytokines tumor necrosis factor-alpha, interleukin-1 beta, inter- 1372-1374, 1376, 1378-1379. leukin-6 and interleukin-8 in the pathogenesis of the otitis media with effusion. 31. Kerkhoff C, Klempt M, Sorg C. Novel insights into structure and function of MRP8 Eur Cytokine Netw. 2002;13(2):161-172. (S100A8) and MRP14 (S100A9). Biochimica Biophysic. 1998;1448(2):200-211. 8. Samuel EA, Burrows A, Kerschner JE. Cytokine regulation of mucin secretion in 32. Roth J, Sunderkotter C, Goebeler M, Gutwald J, Sorg C. Expression of the calcium- a human middle ear epithelial model. Cytokine. 2008;41(1):38-43. binding proteins MRP8 and MRP14 by early infiltrating cells in experimental con- 9. Tracey KJ, Cerami A. Tumor necrosis factor and regulation of metabolism in in- tact dermatitis. Int Arch Allergy Immunol. 1992;98(2):140-145. fection: role of systemic versus tissue levels. Proc Soc Exp Biol Med. 1992; 33. Frosch M, Strey A, Vogl T, et al. Myeloid-related proteins 8 and 14 are specifi- 200(2):233-239. cally secreted during interaction of phagocytes and activated endothelium and 10. Tracey KJ, Cerami A. Tumor necrosis factor: a pleiotropic cytokine and thera- are useful markers for monitoring disease activity in pauciarticular-onset juve- peutic target. Annu Rev Med. 1994;45:491-503. doi:10.1146/annurev.med.45.1 nile rheumatoid arthritis. Arthritis Rheum. 2000;43(3):628-637. .491. 34. Wilkinson MM, Busuttil A, Hayward C, Brock DJ, Dorin JR, Van Heyningen V. 11. Brown DT, Litt M, Potsic WP. A study of mucus glycoproteins in secretory otitis Expression pattern of two related cystic fibrosis-associated calcium-binding pro- media. Arch Otolaryngol. 1985;111(10):688-695. teins in normal and abnormal tissues. J Cell Sci. 1988;91(pt 2):221-230. 12. Carrie S, Hutton DA, Birchall JP, Green GG, Pearson JP. Otitis media with effu- 35. Klingmann KL, Murphy TF. Genetics of bacteria: role in pathogenesis of infec- sion: components which contribute to the viscous properties. Acta Otolaryngol. tion of the respiratory tract. In: Senior RM, ed. Molecular Biology of the Lung. 1992;112(3):504-511. Vol 1. Berlin, Germany: Birkhäuser Verlag; 1998:149-162. 13. Kerschner JE. Mucin gene expression in human middle ear epithelium. 36. Griffin S, Carroll TP, Greene CM, O’Neill SJ, Taggart CC, McElvaney NG. Effect of Laryngoscope. 2007;117(9):1666-1676. pro-inflammatory stimuli on mucin expression and inhibition by secretory leu- 14. Hutton DA, Guo L, Birchall JP, Severn TL, Pearson JP. MUC5B expression in middle coprotease inhibitor. Cell Microbiol. 2007;9(3):670-679. doi:10.1111/j.1462-5822 ear mucosal glands. Biochem Soc Trans. 1998;26(2):S117. .2006.00819.x. 15. FitzGerald JE, Green GG, Stafford FW, Birchall JP, Pearson JP. Characterization 37. Harrison A, Ray WC, Baker BD, Armbruster DW, Bakaletz LO, Munson RS Jr. of human middle ear mucus glycoprotein in chronic secretory otitis media (CSOM). The OxyR regulon in nontypeable Haemophilus influenzae. J Bacteriol. 2007; Clin Chim Acta. 1987;169(2-3):281-297. 189(3):1004-1012.

(REPRINTED) ARCH OTOLARYNGOL HEAD NECK SURG/ VOL 135 (NO. 1), JAN 2009 WWW.ARCHOTO.COM 39