Clinical and Microbiological Features of Dientamoebiasis in Patients

International Journal of Infectious Diseases (2006) 10, 255—261

http://intl.elsevierhealth.com/journals/ijid

Clinical and microbiological features of dientamoebiasis in patients suspected of suffering from a parasitic gastrointestinal illness: A comparison of Dientamoeba fragilis and Giardia lamblia infections§

Olivier Vandenberg a,b,*, Ron Peek c, Hichem Souayah d, Anne Dediste a, Michel Buset e, Robert Scheen a, Patricia Retore a, Georges Zissis a, Tom van Gool c a Department of Microbiology, Saint-Pierre University Hospital, Brussels, Belgium b Infectious Diseases Epidemiological Unit, Public Health School, Free University of Brussels, Brussels, Belgium c Parasitology Section, Department of Medical Microbiology, Academic Medical Centre, Amsterdam, The Netherlands d Department of Paediatrics, Saint-Pierre University Hospital, Brussels, Belgium e Department of Gastro-enterology, Saint-Pierre University Hospital, Brussels, Belgium

Received 31 October 2004; received in revised form 10 May 2005; accepted 19 May 2005 Corresponding Editor: Jonathan Cohen, Brighton, UK

KEYWORDS Summary Dientamoeba; Objectives: To describe the clinical and microbiological features of Dientamoeba fragilis and Giardia; Giardia lamblia infected patients, and to analyze the genetic variation of D. fragilis strains. Genotype; Methods: For a period of two years, all stool samples collected from patients suspected of having Clinical; a parasitic gastrointestinal infection were examined according to our speciﬁc triple feces test Triple feces test (TFT) protocol. A retrospective case-control study was performed on D. fragilis and G. lamblia infected patients. Furthermore, PCR and genotyping by restriction fragment length polymorphism (RFLP) were performed upon the former. Results: D. fragilis (6.3%) and G. lamblia (7.1%) were the most common pathogenic protozoa isolated out of 448 patients studied. Symptoms most frequently encountered with D. fragilis and G. lamblia infection were abdominal pain (69.2% and 72.4%, respectively) and diarrhea (61.5% and 79.3%, respectively). However,patients with D. fragilis infections suffered signiﬁcantly less frequently from nausea and/or vomiting, anorexia and weight loss. After treatment, all D. fragilis and G. lamblia infected patients presenting a negative TFT follow-up also reported a

§ Presented in part at the 11th International Congress on Infectious Diseases, Cancun, Mexico, 4—8 March 2004 (Abstract P63.020). * Corresponding author. Tel.: +32 2 535 4530; fax: +32 2 535 4656. E-mail address: [email protected] (O. Vandenberg).

complete resolution of their symptoms. Only genotype 1 could be detected in D. fragilis infected patients. Conclusions: D. fragilis and G. lamblia were the most frequently encountered parasites in our study population. Improved diagnostic tests are essential tools to study the prevalence and pathogenesis of D. fragilis. # 2005 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Introduction In the absence of international guidelines for parasite stool examination, physicians follow Cumitech 30A’s recom- Dientamoeba fragilis is a protozoan found in the gastroin- mendations and systematically order parasite examination testinal tract of humans. Originally D. fragilis was considered in cases of: eosinophilia, chronic diarrhea, abdominal dis- to be an amoeba with no identified cyst stage, but based on comfort, especially following recent travel in a foreign country, and acute diarrhea after exclusion of common phylogenetic data, ultrastructural characteristics and anti- 11 genic similarity to Trichomonas and Histomonas, it has now causes of diarrhea. The TFTset is a collection kit containing been classified as a flagellate.1,2 It was considered a harmless one empty tube and two tubes filled with sodium acetate commensal organism with a worldwide prevalence varying acetic acid formalin (SAF) preservative; these have to be between 0.5% and 42%.3 However more recent literature filled with stool samples on three consecutive days: at day 1 indicates that D. fragilis could be a potential enteric patho- in a tube with SAF, at day 2 in an empty tube and at day 3 in gen with symptomatology observed in 20—58% of infected a tube with SAF. cases.4 Symptomatology includes a large range of gastroin- SAF fixed stool specimens were examined for vegetative testinal symptoms, including diarrhea, loose stools, abdom- stages of protozoa using direct wet preparation. From the inal pain and abdominal cramps.3—6 unpreserved stool specimen (TFT2, collected at day 2) sedi- As not all infected persons experience symptoms, various ment obtained with the routine ethylacetate-sedimentation authors have developed the hypothesis that D. fragilis could technique, was studied with a direct wet smear for protozoan be a heterogeneous species with non-pathogenic and patho- cysts and helminth eggs and auramine staining for Cryptos- genic variants with similar morphology but with different poridium. For direct wet mounts, an area equivalent to a pathogenicity.3,7 InafirstreportonthevariabilityinD. coverslip of 22 22 mm was examined by bright-field micro- fragilis, Johnson and Clark analyzed the 16S-like ribosomal scopy at 100 and 400 magnifications. From TFT1 and TFT3 subunit DNA sequence of 12 human isolates obtained from (stool from first and third collection day) direct smears were culture by restriction fragment length polymorphism (RFLP) studied with Kop-Color for vegetative and cyst stages of and found the existence of two genetically distinct types of protozoa. When parasites were observed but identification 8 could not be made on the wet smear, a permanent staining D. fragilis. In a later set of samples, they were able to find 10 only one genotype.3 Recently, Peek et al. described a PCR was performed with chlorazol black. Next, 200 oil-immer- procedure for the effective isolation of D. fragilis from non- sion fields using bright-field microscopy at 600 magnifica- preserved stool specimens, without the need for prior tion were examined. culturing of the organism.9 In this study only genotype 1 All unpreserved stool samples were also examined was observed suggesting that genotype 2 is either very rare macroscopically for gross blood and mucus and routinely or that the culture procedure facilitates detection of the cultured for common bacterial pathogens using conven- more rare genotype 2. Because samples analyzed were only tional culture media (xylose—lysine—deoxycholate (XLD) from Dutch patients it remains unclear whether D. fragilis agar, Salmonella—Shigella (SS) agar, Hektoen enteric (HE) from other countries would also display such a restricted agar, and cefsulodin—irgasan—novobiocin (CIN) agar). A genetic variation. specific culture protocol for the isolation of Campylobacter The aim of this study was to compare the prevalence spp and related organisms consisting of the combination and clinical features of D. fragilis and Giardia lamblia in of one selective media and one filtration method was also patients suspected of suffering from a parasitic gastroin- used. testinal illness. Furthermore genotypic analysis of D. fragilis Stool samples of patients younger than 2 years of age were strains was performed to confirm the existence of two also evaluated for the presence of rotavirus and enteric distinct genotypes. adenovirus since viral diarrhea is mainly observed in this age group. For molecular studies of D. fragilis, unpreserved stool Methods specimens from patients with a positive TFT set for Dien- tamoeba fragilis were frozen at 20 8C. For DNA extraction This study took place at the Saint-Pierre University Hospital a high pure PCR template preparation kit (Roche) was used located in the central area of Brussels. From January 2002 with an additional preparation step for stool samples. to December 2003, 1207 stool samples were obtained from Aliquots of thawed stool samples (approximately 200 mg) 448 outpatients who were clinically suspected to have a were dissolved in 1 ml of 5.6 M guanidine thiocyanate, gastrointestinal infection caused by parasites. These were 18 mM EDTA, 1% Triton X-100, 25 mM Tris-HCl (pH 6.4) examined according to the protocol of our triple feces and vortexed for 1 min. Of the suspension, 200 mlwasmixed test (TFT).10 with 200 ml binding buffer and 40 mlofproteinaseKat Dientamoebiasis in patients with parasitic gastrointestinal illness 257

20 mg/ml (both from Roche) and incubated at 70 8Cfor Results 10 min. After centrifugation for 1 min at 14 000 g the supernatant was used for DNA extraction following the TFT sets were filled with stool precisely according to instruc- instruction manual of the kit. At the end, the DNA was tions by 376/448 (83.9%) of the patients. Thirty seven per- eluted in 200 ml prewarmed (70 8C) elution buffer (Tris-HCl cent (139/376) had stools positive for potentially pathogenic 10 mM, pH 8.5). For each series of isolation a mock DNA parasites after examination of the complete TFT test, isolation was performed containing no feces. whereas intestinal parasites were observed in only six 0 0 Primer DF1 (5 CTCATAATCTACTTGGAACCAATT3; (8.3%) of the 72 patients who only filled the second tube 0 positions 100 to 123) and DF4 (5 CCC CGA TTA TTC TCT TTG without SAF fixative. 0 ATA TT 3 ; positions 739 to 761) design was based on the The relative frequency of D. fragilis compared to the sequence of the ssu rRNA gene of D. fragilis (EMBL nucleo- frequency of other enteric parasites over the same periods tide sequence database accession number U37461). Both is shown in Table 1. primers are complementary to the D. fragilis sequence but D. fragilis and G. lamblia were detected in 28 (6.3%) and 0 have several mismatches at their 3 end compared to the 32 (7.1%) of cases respectively. Other identified protozoan ssU rRNA genes from other trichomonads. For each series of pathogens included 7 Cryptosporidium parvum (1.6%) and patient/control samples a negative control, containing no 1 Entamoeba histolytica (0.2%). Non-pathogenic protozoa DNA input was added. The PCR reaction mixture (50 ml) such as Blastocystis hominis (9.8%), and Entamoeba coli contained 20 ml of DNA extract, 100 ng of each primer, (5.4%) were also found. 500 mM deoxynucleoside triphosphate mix, 5 mlof10 Helminths such as Trichuris trichiura (0.7%), Strongyloides magnesium free PCR buffer (Promega), 6 mlof25mMMgCl2 stercoralis (0.4%), Taenia spp (0.4%), and Ascaris lumbri- (Promega), 1 mlofbovineserumalbumin(5mg/ml) coides (0.4%) were also recovered but in small numbers. (Roche), 1 mlofa-casein (20 mg/ml) to relieve PCR inhibi- Enterobius vermicularis and Schistosoma mansoni were each tion by fecal substances, and 0.2 ml(5IU/ml) of Taq poly- observed in 0.2% of patients. merase (in storage buffer B) (Promega). Forty cycles with Microbiological and clinical features of patients with D. denaturation at 94 8C for 1 min, annealing at 52 8Cfor fragilis and G. lamblia infections are shown in Table 2. 1 min, and extension at 72 8C for 1 min were performed Microscopically inflammatory exudates, microscopic blood with an additional extension step (72 8C) at the end for in stool and concomitant infection with another enteric 10 min. parasite, virus or bacteria were encountered in both D. For RFLP 10 ml of the PCR reaction was digested with 10 U of DdeI (Roche) in a final volume of 15 ml for 1 h at 37 8C. Samples were loaded on a 9% polyacrylamide gel and run in Table 1 Intestinal parasites isolated from 448 outpatients 1 TBE (9 mM Tris/10 mM boric acid/1 mM EDTA, pH 8.3) at suspected of suffering from a parasitic gastrointestinal dis- 100 V for 1.5 h. After electrophoresis, gels were stained with ease, at the Saint-Pierre University Hospital in Brussels, from ethidium bromide and photographed. January 2002 to December 2003 To assess the pattern of clinical disease, patients with D. Pathogens Number Prevalence fragilis infection were compared to patients with G. lamblia of patients (%) infection during the same study period. To achieve this, all charts of patients with D. fragilis or G. lamblia infections Potentially pathogenic protozoa were reviewed retrospectively by combining the records of Giardia lamblia 32 7.1 the medical and microbiology departments. Dientamoeba fragilis 28 6.3 A structured, close-ended questionnaire was used to Cryptosporidium parvum 7 1.6 collect the patient’s history, age, sex and history of inter- Microsporidium spp 2 0.4 national travel. The clinical history included diarrhea Isospora belli 1 0.2 within the preceding three months, nature of the diarrhea, Entamoeba histolytica 1 0.2 abdominal pains, intensity of fever, nausea and/or vomit- Non-pathogenic protozoa ing, urticaria, anal pruritus, anorexia, weight loss and Blastocystis hominis 44 9.8 asymptomatic carriage (routine screening of enteric patho- Entamoeba coli 24 5.4 gens in stools of HIV-infected individuals, other immuno- Iodamoeba bu¨tschlii 6 1.3 compromised states and patients from a foreign country Endolimax nana 5 1.1 referred for surgery). Diarrhea was defined as at least three Chilomastix mesnili 2 0.4 unformed or liquid stools per day for at least three days. Entamoeba hartmanni 1 0.2 Treatment history included antiparasitological drugs and Entamoeba dispar 1 0.2 finally clinical status after one month of treatment (cure, improvement or relapse). Helminths Statistical analyses were performed with the Statistical Trichuris trichiura 3 0.7 Package for Social Sciences 11.5 for Windows (SPSS Inc., Ascaris lumbricoides 2 0.4 Chicago, IL, USA) and EpiInfo v6.04c PLUS for DOS (Centers Strongyloides stercoralis 2 0.4 for Disease Control and Prevention, Atlanta, GA, USA) soft- Taenia spp 2 0.4 ware. All parameters were compared between index patients Schistosoma mansoni 1 0.2 and controls. Comparisons were made by Fisher’s exact test Enterobius vermicularis 1 0.2 for small samples data. Odds ratios and 95% confidence Others helminths 2 0.4 intervals were calculated. 258 O. Vandenberg et al.

Table 2 Microbiological and clinical features of patients with Dientamoeba fragilis and Giardia lamblia infection

Patients with Patients with Odds ratio (95% CI) p Value D. fragilis infection G. lamblia infection (n = 28) (%) (n = 32) (%) Median age (range) 26.1 (1—90 years) 24.2 (1—60 years) Sex, male/female 1.15/1 2.2/1 0.52 (0.18—1.50) NS Microbiological features Leukocytes in stool 1/28 (3.6) 1/32 (3.1) 1.15 (0.07—19.25) NS Red blood cells in stool 2/28 (7.1) 0/32 (0.0) — NS Associated organisms 11/28 (39.3) 11/32 (34.4) 1.24 (0.43—3.54) NS Clinical features Diarrhea 16/26a (61.5) 23/29a (79.3) 0.42 (0.13—1.38) NS Abdominal pain 18/26 (69.2) 21/29 (72.4) 0.86 (0.27—3.75) NS Fever 1/26 (3.8) 0/29 (0.0) — NS Weight loss 4/26 (15.4) 16/29 (55.2) 0.15 (0.04—0.54) 0.004 Nausea and/or vomiting 2/26 (7.7) 20/29 (69.0) 0.04 (0.01—0.19) 0.001 Urticaria 2/26 (7.7) 1/29 (3.4) 2.33 (0.20—27.36) NS Anal pruritus 3/26 (11.5) 0/29 (0.0) — NS Anorexia 3/26 (11.5) 17/29 (58.6) 0.09 (0.02—0.38) 0.001 Travel history 2/26 (7.7) 1/29 (3.4) 2.33 (0.20—27.36) NS Treatment Antiparasitic therapy 19/26 (73.1) 23/29 (79.3) 0.71 (0.20—2.47) NS Relapse 4/19 (21.1) 2/23 (8.7) 2.80 (0.45—17.32) NS NS, p > 0.05. a Two patients with D. fragilis and G. lamblia co-infection were excluded in the comparison of the clinical features and treatment, and the clinical file of one patient with G. lamblia infection was unavailable. fragilis and G. lamblia infections. Eleven patients with D. lamblia infection. Symptoms such as weight loss, nausea fragilis had a co-infection: Campylobacter jejuni (1), Sal- and/or vomiting, and anorexia differed significantly monella enterica (1), and G. lamblia (2). In seven patients between the two infections (Table 2). non-pathogenic protozoa were observed: Blastocystis homi- A similar percentage of patients with D. fragilis (73.1%) nis (2), Entamoeba coli (2), Endolimax nana (2), and Ioda- was treated with antiparasitological drugs as for G. lamblia moeba bu¨tschlii (1). (79.3%) ( p > 0.05). From 26 cases with D. fragilis, 19 (73.1%) In 11 patients with G. lamblia infection, co-infection with were treated, 15 (78.9%) with metronidazole and four other parasites, viruses or bacteria was observed: Salmonella (21.1%) with paromomycin. In cases treated with metroni- enterica (2), Campylobacter jejuni (1), D. fragilis (2), and dazole and paromomycin, 12/15 and 4/4, respectively, had a rotavirus (1). In five cases co-infection was observed with follow-up TFTone month later to check parasitological effec- non-pathogenic enteric protozoa: Blastocystis hominis (3), tiveness. Treatment with metronidazole was parasitologi- Entamoeba coli (1), and Iodamoeba bu¨tschlii (1). cally effective in 8/12 (66.7%) and paromomycin in 4/4 Because medical records were unavailable for one patient (100%). All patients presenting a parasitological cure also with G. lamblia infection and because two patients were reported a clinical cure, whereas among the four patients co-infected with D. fragilis and G. lamblia, 26 cases of D. with persistent D. fragilis infection three of them improved fragilis were compared against 29 cases of G. lamblia for the their health status and in one there was no difference in clinical features of the infection. The median age of cases symptomatology after treatment. with D. fragilis was 26.1 years (95% CI: 18.6—35.3) and with From the 29 cases with G. lamblia, 23 (79.3%) received G. lamblia 24.2 years (95% CI: 16.1—29.7). Sex distribution as treatment, 20 (87.0%) with nitroimidazole drugs such as well as history of international travel was similar for patients metronidazole or tinidazole, whereas two (8.7%) and one colonized by either species. (4.3%) were treated with albendazole and paromomycin, ThemostfrequentsymptomsassociatedwithD. fragilis respectively. Among these, 16/23 had a follow-up TFT one infection were abdominal pain (69.2%) and diarrhea (61.5%) month later to check parasitological cure, 15 patients trea- (Table 2). Less frequently observed were weight loss ted with nitroimidazole drugs and one patient treated with (15.4%), anorexia (11.5%), and anal pruritus (11.5%). Only paromomycin. Treatment with nitroimidazole was parasito- four out of 26 were asymptomatic. The most important logically effective in 13/15 (86.7%) cases and paromomycin symptomatology in cases with G. lamblia infection were in the one (100.0%) case. All patients with a treated G. diarrhea (79.3%), abdominal pain (72.4%), nausea and/or lamblia infection, with negative TFT follow-up, were clini- vomiting (69.0%), anorexia (58.6%), and weight loss (55.2%). cally cured whereas in the two patients with persistent Diarrhea, abdominal pain, fever, and urticaria were G. lamblia infection there was no difference in symptoma- observed as frequently in cases with D. fragilis as in G. tology after treatment. Dientamoebiasis in patients with parasitic gastrointestinal illness 259

Similar results were obtained by van Gool et al., who showed that TFT in a routine clinical setting strongly improved diagnosis of intestinal parasites when compared to the conventional method of examination of one unpreserved stool specimen after ether-sedimentation. In this study, the conventional method and TFTallowed the recovery of one or more parasitic species in the stools in 106/462 (22.9%) and 209/462 (45.2%) cases, respectively.10 From earlier studies it is known that a proportion of patients infected with D. fragilis remain asymptomatic.5,20 This was also true for 15.4% of patients in our study population. Several studies have also shown that a large Figure 1 Restriction endonuclease digestion with DF1/DF4 proportion of G. lamblia infected patients will not develop PCR products from nine patient samples (lanes 1—9) and of any enteric symptoms or that cysts of G. lamblia may be PCR products of D. fragilis genotype 1 (lane 11) and genotype shed in the stool of infected patients for weeks to months 2 (lane 10) with DdeI. The marker (lane M) is a 100 bp ladder. after symptoms disappear.21,22 One hypothesis to explain this phenomenon could be that D. fragilis constitutes a heterogenic species with similar morphology but with From the 15 samples conserved in good storage conditions genetic diversity. We therefore tested several isolates with for PCR testing, nine samples were positive for D. fragilis (six a recently developed PCR/RFLP for D. fragilis.9 As observed from patients with abdominal complaints and three from in the former study, all nine D. fragilis isolates tested asymptomatic carriers). Digestion with DdeI revealed that belonged to genotype 1. Similar results were also found all nine samples presented a restriction fragment pattern by Windsor et al. who were unable to find genotype 2 in a identical to the genotype 1 of D. fragilis (Figure 1). series of 43 culture isolates of this protozoon.23 The failure to obtain PCR products in six of 15 unpreserved stool specimens tested is probably due to inadequate storage Discussion conditions and/or an excessive delay before starting the extraction procedure as recently described by Stark et al.24 Since its first description by Jepps and Dobell in 1918, Although the number of isolates is small and differences Dientamoeba fragilis continues to be a neglected cause in genotypic variation can go unnoticed, our findings sug- of gastrointestinal symptomatology in many countries. In gest that this may not be the predominating factor for our study, D. fragilis was the second most frequent patho- pathogenicity. genic intestinal protozoan detected with a prevalence of Several reports from many parts of the world describe an 6.3% in patients suspected of having a parasitic infection of association between D. fragilis and clinical symptomatology, the gastrointestinal tract. In other industrialized countries, principally abdominal pain, diarrhea, nausea, vomiting and estimated prevalence of infection among the general popu- flatus.3—7,25 In our study, complaints of diarrhea and abdom- lation ranges from 1.5% to 42%, according to the diagnostic inal pain also predominated. Clinical symptomatology of G. methods used.3 Much higher rates are seen in institutions or lamblia and D. fragilis infection did show many similarities. crowded settings where hygiene is inadequate. In a semi- However, patients with D. fragilis infections suffered sig- communal group of adults in the USA an infection rate as nificantly less frequently from nausea and/or vomiting, high as 53% has been reported.12 D. fragilis is also common anorexia and weight loss. Anal pruritus was not more com- in developing countries,13,14 and accounts for 2.25% of mon in patients with D. fragilis than in those with G. lamblia enteric parasites isolated from children with diarrhea in infection. Links between D. fragilis and anal pruritus have Honduras.15 In Oman, Windsor observed D. fragilis to be the been described by Spencer et al.4 Several authors have second most common pathogenic organism observed (5.1%) suggested that D. fragilis could be transmitted by the eggs in stool specimens after the non-pathogenic protozoan of Enterobius vermicularis. Burrows and Swerdlow were the Blastocystis hominis (15.6%).16 first to publish a study that showed a greater than expected Variations in parasitological routine diagnosis procedures incidence of co-infections of D. fragilis with E. vermicu- used in different laboratories may account for disparity in laris.26 We were unable to confirm this finding in our study results. In most European countries, parasitological routine population. Also, contrary to Yang and Scholten, we could diagnosis is usually performed with the examination of only not find an association between D. fragilis infection and one unpreserved stool specimen. Because vegetative stages urticaria.2 of protozoa are fragile and intestinal parasites are intermit- Use of antiparasitic drugs in patients with D. fragilis tently shed, the yield of this examination is low.17,18 To infection led to an improvement of symptoms in 78.9%, improve the yield in routine diagnosis of intestinal parasites, and in 75.0% a disappearance of parasites from stool. Par- the triple feces test (TFT) was developed; this combines the omomycin proved to be the most effective drug with para- collection of three samples on three consecutive days, the sitological cure in all four cases. This was also reported by use of sodium acetate acetic acid formalin (SAF) preservative Simon et al. who cured all 21 cases of D. fragilis infection and permanent staining with chlorazol black.10 The introduc- using 25—35 mg/day for 4—5 days.27 Apart from the direct tion of this protocol in our laboratory allowed us to increase action of the drug, disappearance of symptoms could also be the recovery of intestinal parasites up to 37% as compared to due to a self-limiting character of the infection, as can be 11% with the procedure using only one fresh stool specimen.19 observed in cases with G. lamblia infection.28 Indeed, among 260 O. Vandenberg et al. the seven patients with D. fragilis infection who were not 8. Johnson JA, Clark CG. Cryptic genetic diversity in Dientamoeba treated, only two had persistent symptoms. In a recent study, fragilis. J Clin Microbiol 2000;38:4653—4. Bosman et al. reported strong clinical improvement in 27/33 9. Peek R, Reedeker FR, van Gool T. Direct amplification and (82%) of children effectively treated with clioquinol for D. genotyping of Dientamoeba fragilis from human stool specimens. J Clin Microbiol 2004;42:631—5. fragilis infection.29 Treatment with clioquinol was parasito- 10. van Gool T, Weijts R, Lommerse E, Mank TG. Triple Faeces Test: logically effective in 81% and nitro-imidazoles, metronida- 29 an effective tool for detection of intestinal parasites in routine zole or tinidazole in 69% of cases. In our study, the clinical clinical practice. Eur J Clin Microbiol Infect Dis 2003;22:284— effect of 10 days metronidazole treatment was moderate 90. (66.7%). Similar results have been reported by Preiss et al. 11. Garcia LS, Smith JW, Fritsche TR. In: Cumitech 30A. Selection who observed a 70% success rate.30 and use of laboratory procedures for diagnosis of parasitic Long-term treatment with high doses of clioquinol has infections of the gastrointestinal tract. Garcia LS, coordinating been associated with neurological and ocular side-effects.31 ed. Washington DC: ASM Press; 2003, p. 5—7. In our hospital this drug is therefore not recommended for 12. Millet V, Spencer MJ, Chapin M, Stewart M, Yatabe JA, Brewer T, clinical use. Instead, paromomycin and nitroimidazoles can et al. Dientamoeba fragilis, a protozoan parasite in adult members of a semicommunal group. Dig Dis Sci 1983;28: be used for the treatment of D. fragilis. In vitro studies have 335—9. also demonstrated effectiveness of paromomycin and metro- 32 13. Mackie TT, Larsh JE, Mackie JW. A survey of intestinal parasitic nidazole upon D. fragilis. Because these studies were infections in the Dominican Republic. Am J Trop Med Hyg 1951; performed with dixenic cultures in which bacteria are neces- 31:825. sary for growth of the parasite, results may have been biased 14. Gatti S, Swierczynski G, Robinson F,Anselmi M, Corrales J, Moreira by the simultaneous effect upon bacterial growth. Develop- J, et al. Amebic infections due to the Entamoeba histolytica- ment of susceptibility testing on axenic cultures is therefore Entamoeba dispar complex: a study of the incidence in a remote much needed. rural area of Ecuador. Am J Trop Med Hyg 2002;67:123—7. In conclusion, in our study population, D. fragilis was 15. Kaminsky RG. Parasitism and diarrhoea in children from two rural found to be the second most common pathogenic protozoan communities and marginal barrio in Honduras. Trans R Soc Trop Med Hyg 1991;85:70—3. isolated. Symptomatology of patients infected with D. fra- 16. Windsor JJ, Rafay AM, Shenoy AK, Johnson EH. Incidence of gilis did show many similarities with G. lamblia infection, and Dientamoeba fragilis in faecal samples submitted for routine most patients receiving treatment showed good parasitolo- microbiological analysis. Br J Biomed Sci 1998;55:172—5. gical responses and health improvement. 17. Yang J, Scholten T. A fixative for intestinal parasites permitting the use of concentration and permanent staining procedures. Am Acknowledgments J Clin Pathol 1977;67:300—4. 18. Hiatt RA, Markell EK, Ng E. How many stool examinations are necessary to detect pathogenic intestinal protozoa? Am J Trop The authors wish to thank the personnel of the Department of Med Hyg 1995;53:36—9. Microbiology for its daily technical assistance. The authors 19. Vandenberg O, Dediste A, Van den Wijngaert S, Peltier C, Van are also grateful to Sigi Van den Wijngaert for his help in Laethem Y, Retore P, et al. [Abstract P1392] Evaluation of new collecting clinical data and to Dominique Monnet for his help commercialised systems for the concentration and staining of in controlling the statistical analysis. We also thank the intestinal parasites in faecal specimens under routine laboratory Fondation Vesale Research fellowship (foundation for med- conditions. In: Program and abstracts of the 13th European ical research) for financial support. Congress of Clinical Microbiology and Infectious Diseases, Glas- Conflict of interest: No conflict of interest to declare. gow, UK, May 10-13, 2003:337. 20. Colea A, Silard R, Panaitescu D, Florescu P, Roman N, Capraru T. Studies on Dientamoeba fragilis in Romania. II. Incidence of References Dientamoeba fragilis in healthy persons. Arch Roum Pathol Exp Microbiol 1980;39:49—53. 1. Gerbod D, Edgcomb VP, Noel C, Zenner L, Wintjens R, Delgado- 21. Horman A, Korpela H, Sutinen J, Wedel H, Hanninen ML. Meta- Viscogliosi P, et al. Phylogenetic position of the trichomonad analysis in assessment of the prevalence and annual inci- parasite of turkeys, Histomonas meleagridis (Smith) Tyzzer, dence of Giardia spp and Cryptosporidium spp infections in inferred from small subunit rRNA sequence. J Eukaryot Microbiol humans in the Nordic countries. Int J Parasitol 2004;34:1337— 2001;48:498—504. 46. 2. Yang J, Scholten T. Dientamoeba fragilis: a review with notes on 22. Ortega YR, Adam RD. Giardia: overview and update. Clin Infect its epidemiology, pathogenicity, mode of transmission, and diag- Dis 1997;25:545—9. nosis. Am J Trop Med Hyg 1977;26:16—22. 23. Windsor JJ, Clark CG, Macfarlane L. Molecular typing of Dienta- 3. Johnson EH, Windsor JJ, Clark CG. Emerging from obscurity: moeba fragilis. Br J Biomed Sci 2004;61:153—5. biological, clinical, and diagnostic aspects of Dientamoeba fra- 24. Stark D, Beebe N, Marriott D, Ellis J, Harkness J. Detection of gilis. Clin Microbiol Rev 2004;17:553—70. Dientamoeba fragilis in fresh stool specimens using PCR. Int J 4. Spencer MJ, Chapin MR, Garcia LS. Dientamoeba fragilis:a Parasitol 2005;35:57—62. gastrointestinal protozoan infection in adults. Am J Gastroen- 25. Norberg A, Nord CE, Evengard B. Dientamoeba fragilis–—a pro- terol 1982;77:565—9. tozoal infection which may cause severe bowel distress. Clin 5. Grendon JH, DiGiacomo RF, Frost FJ. Descriptive features of Microbiol Infect 2003;9:65—8. Dientamoeba fragilis infections. J Trop Med Hyg 1995;98:309— 26. Burrows RB, Swerdlow MA. Enterobius vermicularis as a probable 15. vector of Dientamoeba fragilis. Am J Trop Med Hyg 1956;5:258— 6. Windsor JJ, Johnson EH. Dientamoeba fragilis: the unflagellated 65. human flagellate (a review). Br J Biomed Sci 1999;56:293—306. 27. Simon M, Shookhoff HB, Terner H, Weingarten B, Parker JG. 7. Shein R, Gelb A. Colitis due to Dientamoeba fragilis. Am J Paromomycin in the treatment of intestinal amebiasis; a short Gastroenterol 1983;78:634—6. course of therapy. Am J Gastroenterol 1967;48:504—11. Dientamoebiasis in patients with parasitic gastrointestinal illness 261

28. Lane S, Lloyd D. Current trends in research into the waterborne 31. Konagaya M, Matsumoto A, Takase S, Mizutani T,Sobue G, Konishi parasite Giardia. Crit Rev Microbiol 2002;28:123—47. T, et al. Clinical analysis of longstanding subacute myelo-optico- 29. Bosman DK, Benninga MA, van de Berg P, Kooijman GC, van Gool neuropathy: sequelae of clioquinol at 32 years after its ban. J T. Dientamoeba fragilis: possibly an important cause of persis- Neurol Sci 2004;218:85—90. tent abdominal pain in children. Ned Tijdschr Geneeskd 32. Chan FTM, Guan MX, Mackenzie AM, Diaz-Mitoma F.Susceptibility 2004;148:575—9. testing of Dientamoeba fragilis ATCC 30948 with iodoquinol, 30. Preiss U, Ockert G, Broemme S, Otto A. On the clinical impor- paromomycin, tetracycline, and metronidazole. Antimicrob tance of Dientamoeba fragilis infections in childhood. J Hyg Agents Chemother 1994;38:1157—60. Epidemiol Microbiol Immunol 1991;35:27—34.