Genetic Variation in PLAG1 Associates with Early Life Body Weight and Peripubertal Weight and Growth in Bos Taurus

SHORT COMMUNICATION doi:10.1111/j.1365-2052.2011.02293.x Genetic variation in PLAG1 associates with early life body weight and peripubertal weight and growth in Bos taurus

M. Littlejohn*, T. Grala*, K. Sanders†, C. Walker*, G. Waghorn*, K. Macdonald*, W. Coppieters‡, M. Georges‡, R. Spelman†, E. Hillerton*, S. Davis† and R. Snell§ *DairyNZ, Hamilton, New Zealand. †LIC (Livestock Improvement Corporation), Hamilton, New Zealand. ‡Unit of Animal Genomics, GIGA-R & Faculty of Veterinary Medicine, University of Lie` ge, Belgium. §School of Biological Sciences, University of Auckland, Auckland, New Zealand

Summary Variation at the pleiomorphic adenoma gene 1 (PLAG1) locus has recently been implicated in the regulation of stature and weight in Bos taurus. Using a population of 942 outbred Holstein–Friesian dairy calves, we report confirmation of this effect, demonstrating strong association of early life body weight with PLAG1 genotype. Peripubertal body weight and growth rate were also significantly associated with PLAG1 genotype. Growth rate per kilogram of body weight, daily feed intake, gross feed efficiency and residual feed intake were not significantly associated with PLAG1 genotype. This study supports the status of PLAG1 as a key regulator of mammalian growth. Further, the data indicate the utility of PLAG1 polymorphisms for the selection of animals to achieve enhanced weight gain or conversely to aid the selection of animals with lower mature body weight and thus lower maintenance energy requirements.

Keywords bovine, genetics, growth, PLAG1

In agriculture, optimizing the growth of livestock species is to two of these polymorphisms. These variants located to of key economic interest. In Bos taurus, selection of animals the bidirectional promoter of the PLAG1 and CHCHD7 with enhanced growth rate and size is desirable in the case genes. Given that Plag1 knock-out mice display marked of beef production. In some dairy-farming systems, this may growth retardation (Hensen et al. 2004), these results sug- be undesirable when, for a given lactation output, increased gest that differential expression of the PLAG1 gene, under animal size costs extra maintenance energy. The availability the control of PLAG1 promoter variation, likely underlies of tools to permit the selection of animals on this basis the chromosome 14 stature and weight QTL. would therefore be of economic benefit. To this end, the The aim of this study was to test for pleiomorphic adenoma identification of the genetic determinants of animal growth gene 1 (PLAG1) genetic effects on animal size and growth in and related traits has been the focus of numerous genetic an independent, outbred population of dairy cattle. Fur- studies. thermore, we aimed to assess whether growth effects med- Karim et al. (2011) recently reported a genomic interval iated by variation in PLAG1 translated to differences in feed on Bos taurus chromosome 14 with a major effect on stature intake, growth rate per kilogram of body weight and feed and weight in dairy cattle. This observation builds on pre- use efficiency in order to give further insight into the vious studies reporting quantitative trait loci (QTL) for phenotypic consequences of PLAG1 variation. growth and stature on chromosome 14 in taurine and Animals used in this study were part of a purpose-bred mixed ancestry beef cattle (Mizoshita et al. 2004; Takasuga trial designed to discover genetic markers for feed conver- et al. 2007; Pryce et al. 2011). Karim et al. (2011) identified sion efficiency and related traits. Female calves with a several tightly linked polymorphisms as potential causative minimum of 15/16 New Zealand Holstein–Friesian (NZHF) genetic elements underlying this QTL and, using gene parentage were selected at birth from the New Zealand expression analysis, demonstrated functional consequences national herd, descended from a total of 47 sires. Ninety-five per cent of the daughter population was represented by 25 Address for correspondence sires only, and 50% was represented by only five sires. M. Littlejohn, LIC, c/- IIB School of Biological Sciences, The University Calves were acquired at 4–7 days of age, with post-partum of Auckland, Private Bag 92019, Auckland, New Zealand. calf weights recorded at an average of 8 days after birth. E-mail: [email protected] Calves were raised by a commercial calf rearer in groups of Accepted for publication 8 August 2011 50 and, following weaning (approximately 90 kg), were

2011 The Authors, Animal Genetics 2011 Stichting International Foundation for Animal Genetics, 43, 591–594 591 592 Littlejohn et al.

grazed on pasture until placement in the feeding facility at at weighing as fixed effects. For traits measured during the 6–8 months old. To mimic the nutritional profile of forage feeding trial, animal models were constructed with cohort diets associated with grazing, animals were fed alfalfa and age at trial mid-point as fixed effects. The interaction (Medicago sativa) cubes. Animals entering the facility were effect between cohort and age at trial mid-point was also pre-pubertal, and weight gain and feed intake were assessed included in the trial models. For each trait, two models were over an interval of 50 days. The feeding facility consisted of fitted, one treating the ss319607402 SNP as a class effect 28 pens, each holding eight calves, with a single feed (ÔGenotypeÕ models) and the other treating it as a quanti- bunker per pen that restricted feed access to a single animal tative variable based on the number of allele copies (ÔTrendÕ at a time. Calf weights were recorded three times a week models). P-values were adjusted for multiple testing [FDR during the trial, with feed intakes of animals measured per (Benjamini & Hochberg 1995)], with FDR-adjusted ÔGeno- meal using an electronic monitoring station (Gallaghers typeÕ values reported in text. The proportion of phenotypic Ltd). variance explained by the ss319607402 SNP was calcu- Body weight mid-trial was calculated by linear regression lated for each trait using (2p(1-p)a2)/t where p is the fre- of body weights measured through the course of the trial, quency of the A allele, a is the estimated allele substitution taking the fitted value at 25 days (trial mid-point). Regres- effect and t is the total phenotypic variation. sion coefficients were calculated from the same equations to High-quality genotypes were obtained for 921 animals derive the daily growth rates of each animal. Daily body and used for association analysis. The PLAG1 ss319607402 weight gain per kilogram of body weight (Kleiber ratio) was SNP was in Hardy–Weinberg equilibrium (P > 0.01) and calculated by dividing the daily growth rates of animals by had a minor allele frequency of 0.15, consistent with the mid-trial body weight. Gross feed efficiency was calculated frequency predicted in outbred NZHF sires (Karim et al. by dividing the trial-mean daily feed intakes by daily growth 2011). PLAG1 ss319607402 genotype was strongly asso- rates. Residual feed intake (RFI) was determined by multiple ciated with body weight of new-born calves ) regression of daily feed intakes against the median meta- (P = 1.5 · 10 19), with the ÔAÕ allele of this SNP over-rep- bolic body weight and daily body weight gain (independent resented in animals of increased size (Table 1), consistent variables), with individual RFI calculated from the differ- with the direction of allelic association observed previously ence between actual and fitted intakes derived from the (Karim et al. 2011). Peripubertal body weight and daily model (residuals). A total of 942 calves with robust phe- growth rate were also significantly associated with PLAG1 notypic data were used for subsequent genetic analysis, ss319607402 genotype during the feeding trial period ) comprising five discrete cohorts of animals. These consisted (P = 1.9 · 10 5 and P = 0.035 respectively; Table 1). of a single cohort of 114 calves assessed in 2007, two Daily feed intake, Kleiber ratio, gross feed efficiency and RFI cohorts of 206 calves assessed during 2008 and two cohorts were not significantly associated with PLAG1 ss319607402 of 208 animals assessed during 2009. genotype (P > 0.05; Table 1). The PLAG1 functional polymorphisms ss319607405 This study confirms the results of Karim et al. (2011), (chr14 g.23264810CCG(9_11) VNTR) and ss319607406 who showed that variation in the PLAG1 gene is predictive (chr14 g.23264854G>A SNP) were targeted for genotyp- of animal weight in early life, and in growing, peripubertal ing (bovine genome build Btau4.0). Despite multiple animals. The growth rate of calves was also found to differ attempts, reliable assays for these polymorphisms could not by genotype. Weight differences between genotype groups be generated. Instead, the ss319607402 SNP (chr14 increased with age, with a 17.7-kg difference between g.23232324A>G) was genotyped. This SNP maps to intron adjusted means for homozygote classes in peripubertal 2ofPLAG1 and is in complete linkage disequilibrium with animals versus a 6.9-kg difference in new-born calves. the PLAG1 functional promoter polymorphisms in NZHF Although body weight differences appeared greater in animals (Karim et al. 2011). DNA was extracted from blood peripubertal animals, differences as a percentage of total or ear punch tissue samples using Qiagen BioSprint 96 DNA body weight were striking in new-born animals. Percentage extraction kits. Genotyping of ss319607402 was conducted increases in total body weight (relative to GG animals) were on a Roche LightCycler 480 instrument using a custom +18.8% (AA) and +10.4% (AG). It is noteworthy that there Taqman assay (Applied Biosystems), using the following was no association found between Kleiber ratio and PLAG1 primers and Taqman reporter probes: forward primer genotype. The Kleiber ratio describes the growth rate of CTGTTCCACCAGGATCCTTATTCT, reverse primer GGA animals relative to body weight; the lack of association may AGGGTCCGGGTACCT; reporter 1 CATCTGCCACATCCCA, indicate that differences in growth rates derive partly from reporter 2 TCTGCCGCATCCCA. differences in animal sizes between PLAG1 genotype groups. Associations between the ss319607402 SNP and traits These findings suggest that, in relative terms, much of the were quantified using mixed models in ASReml (Gilmour PLAG1 effect occurs during foetal development. This seems et al. 1995; Gilmour et al. 2009). Models included all a reasonable proposition given that in humans and mice, known pedigree relationships. For the analysis of calf ÔbirthÕ PLAG1 is expressed most strongly in foetal tissues (Kas et al. weights, an animal model was fitted with birth year and age 1997; Kas 1998; Hensen et al. 2004).

2011 The Authors, Animal Genetics 2011 Stichting International Foundation for Animal Genetics, 43, 591–594 PLAG1 associates with bovine growth 593

Table 1 Statistics for PLAG1 ss319607402A>G genotype association with post-partum calf weight (Kg), peripubertal calf weight (Kg), peripubertal growth rate (Kg/day), Kleiber ratio (growth rate/body weight), feed intake (Kg/day), gross feed efﬁciency (intake/growth rate) and residual feed intake (measured intake minus predicted intake).

Genotype Trend Trend Genotype phenotypic parameter Trend phenotypic AA (n = 657) AG (n = 252) GG (n = 12) P-value variance (%) estimate P-value variance (%)

) ) Postpartum 43.26 (±0.69) 40.18 (±0.73) 36.41 (±1.51) 1.52 · 10 19 8.4 )3.14 (±0.32) 1.46 · 10 20 7.14 calf weight ) ) Peripubertal 196.46 (±3.09) 192.73 (±3.18) 178.74 (±5.20) 1.94 · 10 5 5.7 )4.52 (±1.02) 3.91 · 10 5 1.52 calf weight Peripubertal 0.924 (±0.023) 0.909 (±0.023) 0.830 (±0.042) 0.035 2.1 )0.020 (±0.008) 0.041 0.39 growth rate ) Kleiber ratio 0.0047 0.0047 0.0046 0.803 – 7.7 · 10 6 0.863 – ) (±0.0001) (±0.0001) (±0.0002) (±4.4 · 10 05) Feed intake 7.69 (±0.17) 7.61 (±0.17) 7.19 (±0.28) 0.098 – )0.11 (±0.54) 0.094 – Gross feed 8.32 (±0.22) 8.42 (±0.23) 8.79 (±0.40) 0.306 – 0.12 (±0.08) 0.164 – efﬁciency Residual feed )0.151 (±0.093) )0.101 (±0.10) 0.049 (±0.164) 0.239 – 0.058 (±0.33) 0.109 – intake

With genotype ﬁtted as a class effect (ÔGenotypeÕ models), adjusted least-square means of genotype groups, FDR-adjusted P-values and percentages of phenotypic variance explained by PLAG1 ss319607402A>G genotype are indicated in left most columns. Parameter estimates, FDR-adjusted P- values and percentages of phenotypic variance explained by PLAG1 ss319607402A>G genotype ﬁtted as a quantitative variable based on the number of allele copies (ÔTrendÕ models) are indicated in right-most columns. Least-square mean values and parameter estimates are given ±SE, and P-values are adjusted for multiple testing using the procedure of Benjamini & Hochberg (1995).

Allelic effects of PLAG1 in NZHF animals may not be molecule for PLAG1 (Voz et al. 2000), the precise molecular strictly additive, with the differences between genotype pathways through which PLAG1 regulates growth in Bos groups suggesting possible partial dominance. This differs taurus remain to be elucidated. from the observations of Karim et al. (2011), although it This study suggests robust association of PLAG1 genetic could be a function of the limited number (n = 12) of G variation in determining bovine growth rates and animal allele homozygotes in the NZHF population. The low size and further implicates PLAG1 as a major regulator of frequency of the PLAG1 ss319607402 ÔGÕ allele may have mammalian growth across species. These data support the limited our power to detect the associations for intake- utility of animal selection using PLAG1 markers, presenting related effects. Some effect of PLAG1 genotype on intake, the opportunity for the selection of faster-growing, heavier gross feed efficiency, RFI or all three of these traits was animals in beef production systems. For dairy populations expected, because animals must increase the intake of such as the one assessed in the current analysis, selecting nutrients or use existing nutrient sources more efficiently to cows with reduced overall size may be preferred, owing to support increases in growth and size. Analyses using more an anticipated corresponding reduction in energetic main- animals will be required to clarify the role of PLAG1 in tenance requirements. intake and feed utilization. PLAG1 has been implicated in the aetiology of human Acknowledgements tumour formation (Hibbard et al. 2000; Martins et al. 2005), specifically through the dysregulation of gene This work was partially funded by DairyNZ Inc. (Hamilton, expression (Kas et al. 1997). Homozygous Plag1 knock-out New Zealand) and the Foundation for Research, Science, mice are viable but are 30% smaller than wild-type litter and Technology (Wellington, New Zealand). mates at birth (Hensen et al. 2004). Subsequent growth rate is also lower in knock-out mice (Hensen et al. 2004), and References recent genomewide association studies in humans have implicated the PLAG1 syntenic region in human height Benjamini Y. & Hochberg Y. (1995) Controlling the false discovery regulation (Gudbjartsson et al. 2008; Lango Allen et al. rate: a practical and powerful approach to multiple testing. 2010). Gene expression changes arising as a result of bovine Journal of the Royal Statistical Society. Series B. Methodological 57, PLAG1 promoter variation, as demonstrated by Karim et al. 289–300. (2011), could thus result in the growth modulation Gilmour A.R., Gogel B.J., Cullis B.R. & Thompson R. (2009) ASReml User Guide Release 3.0. VSN International Ltd, Hemel observed by Karim et al. (2011) and in the current study. Hempstead, HP1 1ES, UK. Although some evidence suggests IGF2 as an effector

2011 The Authors, Animal Genetics 2011 Stichting International Foundation for Animal Genetics, 43, 591–594 594 Littlejohn et al.

Gilmour A.R., Thompson R. & Cullis B.R. (1995) Average infor- Martins C., Fonseca I., Roque L., Pereira T., Ribeiro C., Bullerdiek J. mation REML: an efficient algorithm for variance parameter & Soares J. (2005) PLAG1 gene alterations in salivary gland estimation in linear mixed models. Biometrics 51, 1440–50. pleomorphic adenoma and carcinoma ex-pleomorphic adenoma: Gudbjartsson D.F., Walters G.B. & Thorleifsson G. et al. (2008) a combined study using chromosome banding, in situ hybrid- Many sequence variants affecting diversity of adult human ization and immunocytochemistry. Modern Pathology : An Official height. Nature genetics 40, 609–15. Journal of the United States and Canadian Academy of Pathology, Inc Hensen K., Braem C., Declercq J., Van Dyck F., Dewerchin M., Fiette L., 18, 1048–55. Denef C. & Van de Ven W.J.M. (2004) Targeted disruption of the Mizoshita K., Watanabe T., Hayashi H., Kubota C., Yamakuchi H., murine PLAG1 proto-oncogene causes growth retardation and Todoroki J. & Sugimoto Y. (2004) Quantitative trait loci analysis reduced fertility. Development, Growth & Differentiation 46, 459–70. for growth and carcass traits in a half-sib family of purebred Hibbard M.K., Kozakewich H.P., Dal Cin P., Sciot R., Tan X., Xiao S. Japanese Black (Wagyu) cattle. Journal of Animal Science 82, & Fletcher J.A. (2000) PLAG1 fusion oncogenes in lipoblastoma. 3415–20. Cancer Research 60, 4869–72. Pryce J.E., Hayes B.J., Bolormaa S. & Goddard M.E. (2011) Poly- Karim L., Takeda H. & Lin L. et al. (2011) Variants modulating the morphic regions affecting human height also control stature in expression of a chromosome domain encompassing PLAG1 cattle. Genetics 187, 981–4. influence bovine stature. Nature Genetics 43, 405–13. Takasuga A., Watanabe T., Mizoguchi Y. et al. (2007) Identification Kas K. (1998) Transcriptional activation capacity of the novel of bovine QTL for growth and carcass traits in Japanese Black PLAG family of zinc finger proteins. Journal of Biological Chemistry cattle by replication and identical-by-descent mapping. Mamma- 273, 23026–32. lian Genome : Official Journal of the International Mammalian Genome Kas K., Voz M.L., Roïjer E., Astro¨m A.K., Meyen E., Stenman G. & Society 18, 125–36. Van de Ven W.J. (1997) Promoter swapping between the genes Voz M.L., Agten N.S., Van de Ven W.J. & Kas K. (2000) PLAG1, the for a novel zinc finger protein and beta-catenin in pleiomorphic main translocation target in pleomorphic adenoma of the adenomas with t(3;8)(p21;q12) translocations. Nature Genetics salivary glands, is a positive regulator of IGF-II. Cancer Research 15, 170–4. 60, 106–13. Lango Allen H., Estrada K., Lettre G. et al. (2010) Hundreds of variants clustered in genomic loci and biological pathways affect human height. Nature 467, 832–8.

2011 The Authors, Animal Genetics 2011 Stichting International Foundation for Animal Genetics, 43, 591–594