Against Dengue Virus Infection

Distinct Antiviral Roles for Human 2′,5′ -Oligoadenylate Synthetase Family Members against Dengue Virus Infection

This information is current as Ren-Jye Lin, Han-Pang Yu, Bi-Lan Chang, Wei-Chun Tang, of September 27, 2021. Ching-Len Liao and Yi-Ling Lin J Immunol 2009; 183:8035-8043; Prepublished online 18 November 2009; doi: 10.4049/jimmunol.0902728

http://www.jimmunol.org/content/183/12/8035 Downloaded from

References This article cites 46 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/12/8035.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Distinct Antiviral Roles for Human 2؅,5؅-Oligoadenylate Synthetase Family Members against Dengue Virus Infection1

Ren-Jye Lin,* Han-Pang Yu,* Bi-Lan Chang,*† Wei-Chun Tang,*‡, Ching-Len Liao,‡§ and Yi-Ling Lin2*†‡§

The 2؅,5؅-oligoadenylate synthetase (OAS) and its downstream effector RNase L play important roles in host defense against virus infection. Oas1b, one of the eight Oas1 genes in the mouse genome, has been identified as a murine flavivirus-resistance gene. Four genes, OAS1, OAS2, OAS3, and OAS-like (OASL), have been identified in the human OAS gene family, and 10 isoforms, including OAS1 (p42, p44, p46, p48, and p52), OAS2 (p69 and p71), OAS3 (p100), and OASL (p30 and p59) can be generated by alternative splicing. In this study, we determined the role of the human OAS/RNase L pathway in host defense against dengue virus (DEN) infection and assessed the antiviral potential of each isoform in the human OAS family. DEN replication was reduced by overexpression and enhanced by knockdown of RNase L expression, indicating a protective role for RNase L against DEN replication Downloaded from in human cells. The human OAS1 p42, OAS1 p46, and OAS3 p100, but not the other OAS isoforms, blocked DEN replication via an RNase L-dependent mechanism. Furthermore, the anti-DEN activities of these three OAS isoforms correlated with their ability to trigger RNase L activation in DEN-infected cells. Thus, OAS1 p42/p46 and OAS3 p100 are likely to contribute to host defense against DEN infection and play a role in determining the outcomes of DEN disease severity. The Journal of Immunology, 2009, 183: 8035–8043. http://www.jimmunol.org/ engue virus (DEN),3 a member of the flavivirus genus of UU dinucleotides (4, 5). Oas1b, one of the eight Oas1 genes in the the Flaviviridae family, is an enveloped and mosquito- mouse genome, has been identified as a flavivirus resistance gene D borne virus that contains a single-stranded, positive- (6, 7). Flavivirus-susceptible mouse strains encode a C-terminally sense RNA genome. DEN infection can result in dengue fever truncated OAS1b protein because of a missense mutation in the (DF), dengue hemorrhagic fever (DHF), and dengue shock syn- Oas1b gene and are more vulnerable to WNV infection. Further- drome (DSS) in humans. Epidemiological studies show that DEN more, genetic knock-in of the Oas1b resistance allele into a sus- infection causes an estimated 50–100 million cases of DF and ceptible mouse strain confers resistance to the yellow fever virus several hundred thousand cases of DHF/DSS annually around the (8). In vitro data also show that cells expressing wild-type OAS1b by guest on September 27, 2021 world (1). Other members of the flavivirus genus, such as West but not C-terminally truncated OAS1b efficiently block WNV rep- Nile virus (WNV), yellow fever virus, and Japanese encephalitis lication (9, 10). Thus, in vivo and in vitro experiments indicate that virus also cause health problems in humans. mouse Oas1b is an important genetic factor in flavivirus resistance. Ј Ј The 2 ,5 -oligoadenylate synthetase (OAS) is an IFN-induced However, how this OAS1b mutation affects flavivirus sensitivity is protein that plays an important role in the antiviral action of IFN. not yet fully understood. There is evidence that RNase L may not In the presence of dsRNA or ssRNA with secondary structures, be involved in this protection, because OAS1b-mediated antiviral OAS can be activated to catalyze the oligomerization of ATP into effects still occur in RNase L-knockdown mouse cells (10) despite Ј Ј 2 ,5 -linked oligoadenylate (2-5A), which in turn can bind to and the establishment of a clear antiviral role for RNase L in WNV activate the latent RNase L (2, 3). Activated RNase L degrades infection (11, 12). viral and cellular RNA, predominantly at single-stranded UA and The human OAS gene family is composed of four genes, termed OAS1, OAS2, OAS3, and OAS-like (OASL), located on chromo- *Institute of Biomedical Sciences, †Genomics Research Center, Academia Sinica; some 12 (2). By alternative splicing, these genes encode 10 dif- ‡ § Graduate Institute of Life Sciences, and Department of Microbiology and Immu- ferent isoforms, including five OAS1 isoforms (p42, p44, p46, p48, nology, National Defense Medical Center, Taipei, Taiwan, Republic of China and p52), two OAS2 isoforms (p69 and p71), a single OAS3 Received for publication August 18, 2009. Accepted for publication October 16, 2009. (p100), and two OASL isoforms (p30 and p59) (13–17). Human The costs of publication of this article were defrayed in part by the payment of page OAS1, OAS2, and OAS3 are composed of one, two, and three charges. This article must therefore be hereby marked advertisement in accordance OAS domains and form a tetramer, a dimer, and a monomer, re- with 18 U.S.C. Section 1734 solely to indicate this fact. spectively (18), whereas human OASL lacks OAS activity (15, 16, 1 This work was supported by grants awarded to Y.-L.L. from the National Science 19). These various human OAS proteins appear to be differentially Council (NSC-95-2320-B-001-031-MY3 and NSC 97-3112-B-001-002) and from Academia Sinica, Taiwan. induced in different types of cells and are characterized by different 2 Address correspondence and reprint requests to Dr. Yi-Ling Lin, Institute of Bio- subcellular locations and enzymatic parameters, suggesting that medical Sciences, Academia Sinica, Number 128, Section 2, Academia Road, Taipei these proteins might have distinct roles (2). Unlike their mouse 115, Taiwan. E-mail address: [email protected] counterparts, the roles of human OAS genes in flavivirus resistance 3 Abbreviations used in this paper: DEN, dengue virus; DF, dengue fever; DHF, are largely unknown. Recently, a genetic variation in the human dengue hemorrhagic fever; Dox, doxycycline; DSS, dengue shock syndrome; MOI, multiplicity of infection; OAS, 2Ј,5Ј-oligoadenylate synthetase; OASL, OAS-like; OAS1 gene was associated with an increased risk of WNV disease RIN, RNA integrity number; rRNA, ribosomal RNA; sh, short hairpin; WNV, West (20). An A/G single nucleotide polymorphism at the exon 6 splice Nile virus. acceptor site of the OAS1 gene alters OAS1 splicing and is asso- Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 ciated with basal OAS activity (13). The frequency of the “A” www.jimmunol.org/cgi/doi/10.4049/jimmunol.0902728 8036 ANTI-DENGUE ACTIVITY OF OAS1 p42/p46 AND OAS3

Table I. Construction of the human OAS, OAS-like, and RNase L cDNA clones in this study

cDNA Lengths Expected Protein Clone Names GenBank Accession No. (bp) Sizes (kDa) Primers Nucleotide Sequences (5Ј33Ј)

OAS1 p42 NM_002534.2 1095 41.7 Forward ATGATGGATCTCAGAAATACCC Reverse TCAAGCTTCATGGAGAGGG OAS1 p44 AJ629455.1 1149 43.9 Forward ATGATGGATCTCAGAAATACCC Reverse CTAAGCAACCTGGAAACTATAGGATAA OAS1 p46 NM_016816.2 1203 46.0 Forward ATGATGGATCTCAGAAATACCC Reverse TCAGAGGATGGTGCAGGTC OAS1 p48 NM_001032409.1 1245 47.5 Forward ATGATGGATCTCAGAAATACCC Reverse TCAGGAGACCTGGGTTCTGTC OAS1 p52 AY730627.1 1383 52.2 Forward ATGATGGATCTCAGAAATACCC Reverse TTATCTATGATAGGATAGAGGGCATAGA OAS2 p69 NM_002535.2 2064 78.8 Forward ATGGGAAATGGGGAGTCCC Reverse TTAGATGACTTTTACCGGCACTTT OAS2 p71 NM_016817.2 2160 82.4 Forward ATGGGAAATGGGGAGTCCC Reverse CTAGAAGTTTCTTTTAGAATTATTATTCAGGA OAS3 p100 NM_006187.2 3264 121.3 Forward GATGGACTTGTACAGCACCCC Downloaded from Reverse TCACACAGCAGCCTTCACTG OASL p59 NM_003733.2 1545 59.2 Forward ATGGCACTGATGCAGGAACTG Reverse CTAACTGGCTGGAAACAGAGCC OASL p30 NM_198213.1 768 29.1 Forward ATGGCACTGATGCAGGAACTG Reverse TCATAGCAACAGTCCTGTTTCAGG

RNase L NM_021133.2 2226 83.5 Forward ATGGAGAGCAGGGATCATAACA http://www.jimmunol.org/ Reverse TCAGCACCCAGGGCTGG allele at this single nucleotide polymorphism, which allows splic- taining 5% FBS. Baby hamster kidney cells (BHK-21) for plaque assay ing to generate OAS1 p48 and p52 but not OAS1 p46, is increased were grown in RPMI 1640 medium containing 5% FBS. The human lung in WNV seroconverters (20). Because WNV infection is less likely epithelial carcinoma cell line A549 was maintained in F-12 medium (Invitrogen) supplemented with 10% FBS. The tetracycline-regulated ex- to result in seroconversion in individuals with the “G” genotype, pression human embryonic kidney 293 cell line (Invitrogen) was grown in which generates OAS1 p46 with higher OAS activity, OAS1 is DMEM (Sigma-Aldrich) containing 10% FBS and 5 ␮g/ml blasticidin likely to play an important antiviral role during the early phase of (InvivoGen). Roferon-A, a recombinant IFN-␣-2a, was obtained from Roche. by guest on September 27, 2021 WNV infection. Hygromycin was purchased from InvivoGen. Doxycycline (Dox) and pu- romycin were obtained from Clontech and Sigma, respectively. Mouse IFN plays an important role in host defense against DEN infec- monoclonal anti-dsRNA Ab (J2 mAb; English & Scientific Consulting), tion in vitro and in vivo (21, 22). Using a microarray, IFN-related rabbit monoclonal anti-hemagglutinin (HA) Ab (Upstate Biotechnology), gene induction has been demonstrated in DEN-infected cells and mouse monoclonal anti-HA Ab (Covance), and mouse monoclonal anti- in patients infected with DEN (23, 24). Furthermore, the majority RNase L Ab (Novus Biologicals) were used. of genes that are strongly up-regulated in the PBMCs of individuals with DF compared with PBMCs of individuals with DHF are Plasmid construction and lentivirus generation IFN-induced genes, suggesting a protective role for the IFN system The cDNAs encoding human OAS (p42, p44, p46, p48, p52, p69, p71, and in DEN infection (25). Despite clinical and experimental evidence, p100), OASL (p59 and p30), and RNase L were amplified from the RNA the antiviral mechanisms of IFN on DEN are not clear and the role of IFN-␣-treated A549 cells. Reverse transcription was conducted by the of the OAS/RNase L system in DEN infection is largely unknown. ThermoScript RT-PCR system (Invitrogen) using oligo(dT) as a primer. The full-length cDNA was then amplified by PCR using the specific prim- For this work we conducted a comprehensive study to test the ers listed in Table I. The cDNA fragments were cloned into the TA vector antiviral potential of the 10 known human OAS isoforms of OAS1, pCR3.1 (Invitrogen) and subcloned to a HA-tagged pcDNA3 expression OAS2, OAS3, and OASL on DEN replication and to clarify the vector (pcDNA3/HA) with an in-frame fusion of HA-tag at the N-termini. possible involvement of RNase L in this antiviral effect. Distinct All of the cDNAs were sequenced, and their sequences were the same as those reported in GenBank (Table I). A pcDNA5/TO vector (Invitrogen) antiviral activity was noted among these 10 OAS members. OAS1 was used for the inducible expression of OAS and RNase L. An R667A p42, OAS1 p46, and OAS3 p100, but not the other members, ex- mutated RNase L was generated by single-primer mutagenesis as previ- hibited anti-DEN activity, and these antiviral effects were largely ously described (27), using the primer annealing to nt 2143–2191 of RNase lost in cells deprived of RNase L expression. Furthermore, RNase L mRNA, with the mutated sequences underlined (5Ј-TGGGTGATCT Ј L activity measured by ribosomal RNA (rRNA) integrity using an GCTAAAGTTCATCGCGAATTTGGGAGAACACATTGATGA-3 . The self-inactivating lentiviral vector (pSIN), in which the expres- RNA chip indicated that human OAS1 p42, OAS1 p46, and OAS3 sion of an inserted gene is under the control of a constitutive spleen p100 triggered potent activation of RNase L during DEN replica- focus-forming virus promoter (28), was used in this study for the ex- tion. Thus, different members of the human OAS family contribute pression of various OAS proteins. For wild-type RNase L and the differently to host defense against DEN infection, and the signif- R667A mutant of RNase L, the pLenti6.3/V5-TOPO expression vector and TOPO TA cloning kit (Invitrogen) were used. A lentivirus-based, icance and implications of this are discussed. short hairpin (sh) RNA (shRNA) construct (pLKO-shRNase L) targeting the 3Ј-untranslated region of human RNase L (5Ј-CCTCTCATTT Materials and Methods GGGCACCTTAA-3Ј; TRCN0000000923) and the negative control Viruses, cell lines, chemicals, and Abs (pLKO-shLuc) targeting firefly luciferase were obtained from the Na- tional RNAi Core Facility (Taiwan). For lentivirus preparation, human The DEN-2 PL046 strain (26) used in this study was propagated in the embryonic kidney 293 T cells were cotransfected with a lentivirus ex- mosquito cell line C6/36, which was grown in RPMI 1640 medium con- pression construct (pSIN or pLenti6.3/V5-TOPO) or pLKO-shRNA and The Journal of Immunology 8037 Downloaded from http://www.jimmunol.org/

FIGURE 1. The anti-DEN-2 effect of human RNase L. A, A549 cells were transduced with the lentiviral vector expressing the wild-type RNase L or by guest on September 27, 2021 the R667A mutant of RNase L for 72 h, and then cells were infected with DEN-2 (MOI ϭ 5). Twenty-four hours after infection, cells were fixed and permeabilized for an immunofluorescent assay. HA-tagged RNase L (red)-, dengue viral protein NS3 (green)-, and 4Ј,6-diamidino-2-phenylindole (DAPI; blue)-stained cells were photographed using a fluorescent microscope. Arrows indicate the cells expressing HA-tagged wild-type RNase L or R667A mutant of RNase L. The Greek letter ␣ represents the prefix “anti-.” B, T-REx-293 cells transduced with lentiviruses inducibly expressing control vector (Ϫ), HA-RNase L, or HA-RNase L R667A mutant were cultured in the absence (Ϫ) or presence (ϩ) of Dox (1 ␮g/ml) for 16 h and then infected with DEN-2 (MOI ϭ 0.1). At 48 h post infection, the cell lysates were harvested for western blotting with Abs against DEN-2 NS3, HA-tagged RNase L, and actin as indicated. C, A549 cells were transduced with the lentiviral-based shRNA vector targeting RNase L (shRNase L) or negative control luciferase (shLuc). To verify the knockdown effect, cell lysates were harvested for Western blotting with an anti-RNase L Ab. D, Cells with or without RNase L knockdown were infected with DEN-2 (MOI ϭ 0.1 for 72 h and MOI ϭ 5 for 48 h) and then the virus titers (PFU/ml) were determined by plaque-forming assays on BHK-21 cells. Results are averages and SD of two independent experiments. The viral titers of indicated groups were compared by two-tailed Student’s t tests. the two helper plasmids, pMD.G and pCMV⌬R8.91, with Lipo- GE Healthcare). The nitrocellulose membrane was blocked with 5% fectamine 2000 reagent (Invitrogen). Transfected cells were incubated skim milk in PBS-T (25 mM Tris, 0.8% NaCl, 2.68 mM KCl (pH 7.4), at 37°C for 4–5 h and then refed with fresh medium. Cell supernatants and 0.1% Tween 20) and subsequently incubated with the primary Ab containing the viral particles were harvested 24–60 h after transfection overnight. The blots were then treated with a HRP-conjugated second- and stored at Ϫ80°C. Lentivirus titers were determined with the Quick- ary Ab (Amersham/GE Healthcare) and developed with an ECL system Titers lentivirus titer kit, an HIV p24-based ELISA (Cell Biolabs). (Amersham/GE Healthcare). For reblotting, the membrane was washed with 1ϫ ReBlot plus strong Ab stripping solution (Chemicon) for 15 Establishment of stable cell lines min at room temperature. The membrane was then blocked twice with 5% skim milk in PBS-T for 5 min followed by reprobing with the T-REx-293 cells were transfected with pcDNA5/TO encoding HA-tagged primary Ab. wild-type RNase L, a nuclease-dead mutant of RNase L (R667A), OAS p42, or OAS3 p100 and selected with hygromycin (250 ␮g/ml) and blasticidin (5 ␮g/ml) for 8 days. Individual colonies were picked and expanded. Immunofluorescent assay To generate human RNase L knockdown cells, the cells were transduced with lentivirus targeting human RNase L for 24 h and selected with puro- A549 cells were transduced with the lentiviral vectors expressing the var- mycin (10 ␮g/ml) for 72 h. ious HA-tagged OAS proteins for 72 h and then infected with DEN-2 (multiplicity of infection (MOI) ϭ 20) for 24 h. The cells were fixed with Western immunoblotting 4% formaldehyde and permeabilized in PBS with 0.5% Triton X-100. DEN protein expression was detected using a mouse anti-DEN-2 NS3 Ab and Cell lysates were prepared in SDS sample buffer (62.5 mM Tris-HCl Alexa Fluor 488 goat anti-mouse Ab (Molecular Probes). The expression (pH 6.8), 2% SDS, 10% glycerol, 50 mM DTT, and 0.1% bromophenol of HA-tagged OAS was detected with a rabbit anti-HA Ab, biotin-conju- blue) containing a cocktail of protease inhibitors (Roche). Similar gated secondary anti-rabbit Ab (Jackson ImmunoResearch), and streptavi- amounts of proteins were loaded and separated by SDS-PAGE and din-conjugated Cy3 (Jackson ImmunoResearch Laboratories). The nuclei transferred to a nitrocellulose membrane (Hybond-C Super; Amersham/ were stained with DAPI (Molecular Probes). 8038 ANTI-DENGUE ACTIVITY OF OAS1 p42/p46 AND OAS3

aldehyde for 30 min followed by permeabilization with 0.5% Triton X-100 for 10 min. Subsequently, human OAS proteins were stained with a rabbit monoclonal anti-HA Ab and probed with a biotin-conjugated secondary anti-rabbit Ab and streptavidin-conjugated Cy3. Viral dsRNA was detected using a mouse anti-dsRNA Ab and Alexa Fluor 488 goat anti-mouse Ab. Images were taken with an LSM 510 META confocal system (Carl Zeiss) using a Plan- Apochromat ϫ100 oil-immersion objective lens.

Assay of RNase L activity A549 cells transduced with the indicated lentivirus (MOI ϭ 2) for 72 h were infected with DEN-2 (MOI ϭ 5) for 24 h. Total cellular RNA was extracted by using an RNeasy total RNA kit (Qiagen) and quantiﬁed by measuring UV absorbance at 260 nm. Cellular RNA (250 ng) was separated with an RNA 6000 Nano Chip and analyzed with a 2100 Bioanalyzer (Agilent Technologies) to determine the integrity of 28S and 18S rRNA.

FIGURE 2. Protein expression patterns of human OAS isoforms. 293 Results cells were transfected with pcDNA3 plasmids encoding various N-termi- RNase L plays an antiviral role against DEN-2 infection in nally HA-tagged OAS1 (p42, p44, p46, p48, and p52), OAS2 (p69 and human cells p71), OAS3 (p100), and OASL (p59 and p30) proteins for 24 h, and cell To assess the role of the human OAS/RNase L system in DEN-2 lysates were then harvested for Western blotting with an anti-HA Ab. Downloaded from replication, we used a lentivirus expression system to overexpress RNase L in human A549 cells. Overexpression of wild-type RNase Confocal imaging L, but not of a nuclease-dead mutant of RNase L (R667A) (29), rendered the cells resistant to DEN-2 infection (Fig. 1A). Similarly, A549 cells were seeded on coverslips in 12-well plates for 16 h and were then transduced with a lentiviral vector expressing the indicated HA-tagged OAS. by an inducible system in human embryonic kidney T-REx-293 Seventy-two hours after transduction, cells were infected with DEN-2 (MOI ϭ cells, overexpression of wild-type RNase L, but not of a control http://www.jimmunol.org/ 20) for 6 h. The cells were rinsed twice with PBS and ﬁxed with 4% form- vector or a nuclease-dead mutant of RNase L (R667A), reduced by guest on September 27, 2021

FIGURE 3. Antiviral assays of human OAS family members against DEN-2 infection. A549 cells were transduced with lentiviral vectors expressing the HA-tagged OAS1 isoforms (p42, p44, p46, p48, and p52) (A–E), OAS2 isoforms (p69 and p71) (F and G), OAS3 (p100) (H), and OASL isoforms (OASL p59 and OASL p30) (I and J). Seventy-two hours after transduction, cells were infected with DEN-2 (MOI ϭ 20) for 24 h. Cells were then fixed and permeabilized for an immunofluorescent assay. HA-tagged OAS (red)-, dengue viral protein NS3 (green)-, and 4Ј,6-diamidino-2-phenylindole (DAPI; blue)-stained cells were photographed by using a fluorescent microscope. The Greek letter ␣ represents the prefix “anti-.” The Journal of Immunology 8039 Downloaded from http://www.jimmunol.org/

FIGURE 4. Overexpression of human OAS1 p42 and OAS3 p100 by an inducible system exhibited an RNase L-dependent anti-DEN-2 effect. Parental T-REx-293 cells and those transduced with lentiviruses inducibly expressing OAS1 p42 (A and B) or OAS3 p100 (C and D) with or without RNase L knockdown were cultured in the absence (Ϫ) or presence (ϩ) of Dox (1 ␮g/ml) for 16 h. The cells were then infected with DEN-2 (MOI ϭ 5) for 24 h before cell lysates were harvested for Western blotting with the indicated Abs (A and C). The culture supernatants of DEN-2 infection (MOI ϭ 5 for 24 h and MOI ϭ 0.1 for 48 h) were collected and virus titers were determined by plaque-forming assays on BHK-21 cells (B and D). Results are averages and

SD of two independent experiments. The titers of the indicated groups were compared by two-tailed Student’s t tests. by guest on September 27, 2021

DEN-2 NS3 protein expression as measured by Western blotting tein, with or without RNase L knockdown to assess whether the an- (Fig. 1B). Furthermore, A549 cells deprived of RNase L expres- tiviral mechanism was mediated by RNase L. The levels of OAS1 p42 sion by transduction with a lentivirus-based shRNA targeting hu- and OAS3 p100 induction by Dox and RNase L knockdown were man RNase L (shRNase L) (Fig. 1C) resulted in higher levels of veriﬁed by Western blotting (Fig. 4, A and C). The cells were then DEN-2 production as seen by 14- and 39-fold increases in viral infected with DEN-2 at high and low MOIs (MOI ϭ 5 and 0.1), and production for low and high MOI of infection, respectively (Fig. viral titrations were conducted by plaque assays. Like the results for 1D). These results demonstrate that RNase L is involved in con- A549 cells (Fig. 1C), higher viral production was noted in T-REx-293 trolling DEN-2 replication in human cells. cells with RNase L knockdown compared with the parental T-REx- 293 cells at high or low MOIs of DEN-2 infection and regardless of Anti-DEN-2 activity of human OAS family members Dox treatment (Fig. 4, B and D). Furthermore, the induction of human To identify the antiviral potential of human OAS gene family OAS1 p42 resulted in 4.3- and 14-fold decreases in viral yield at high members, we cloned and constructed plasmids that individually and low MOIs, respectively (Fig. 4B). Similarly, 7- and 11-fold viral expressed the N-terminally HA-tagged OAS1 isoforms (p42, p44, reductions were noted in cells inducibly expressing OAS3 p100 at p46, p48, and p52), OAS2 isoforms (p69 and p71), OAS3 (p100), high and low MOIs of DEN-2 infection, respectively (Fig. 4D). Fur- and OASL isoforms (p30 and p59) (Table I). These constructs thermore, the anti-DEN-2 activity of p42 and p100 depended on expressed the proteins of the expected molecular sizes as detected RNase L, because the antiviral effect was lost in cells deprived of by Western blotting with anti-HA Ab (Fig. 2). A549 cells trans- RNase L expression (Fig. 4, B and D). Western blot detection of viral duced with lentiviruses expressing the individual OAS proteins NS3, a nonstructural protein expressed in virus-replicating cells (Fig. were then infected with DEN-2, and immunoﬂuorescent assays 4, A and C), corroborated the results of infectious viral titration (Fig. were conducted to determine the antiviral potential of each human 4, B and D). Thus, our results indicate that human OAS1 p42/p46 and OAS family member. The DEN-2 viral protein NS3 was not de- OAS3 p100 block DEN-2 replication through an RNase L-mediated tected in cells expressing human OAS1 p42 (Fig. 3A), OAS1 p46 mechanism. (Fig. 3C), or OAS3 p100 (Fig. 3H), whereas DEN-2 NS3 was readily detected in cells expressing the other members of human Subcellular localization of OAS and viral RNA in OAS and OASL isoforms. These data indicate that OAS1 p42, DEN-2-infected cells OAS1 p46, and OAS3 p100 possess antiviral activity against As different OAS isoforms have been reported to be associated DEN-2 infection. We then used an inducible system to overexpress with different subcellular fractions (30–32), we tested whether the OAS1 p42 and OAS3 p100 in T-REx-293, a human embryonic different anti-DEN-2 activities triggered by these OAS members kidney 293 cell line stably expressing the tetracycline repressor pro- (Fig. 3) could be attributed to the colocalization of OAS proteins 8040 ANTI-DENGUE ACTIVITY OF OAS1 p42/p46 AND OAS3 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 5. The subcellular localization of OAS isoforms and viral RNA. A, A549 cells were mock infected or infected with DEN-2 (MOI ϭ 20) for 2,4,and6hasindicated above each image. Viral RNA was stained with an anti-dsRNA Ab (green), and the nuclei were stained with DAPI (blue). B, A549 cells transduced with HA-tagged OAS1 (p42, p44, p46, p48, and p52) (a–e), OAS2 (p69 and p71) (f and g), and OAS3 (p100) (h) were infected with DEN-2 (MOI ϭ 20) for 6 h. Cells were fixed and permeabilized for confocal microscopy. Viral RNA was detected using a mouse anti-dsRNA Ab and Alexa Fluor 488 goat anti-mouse Ab (green). Human OAS proteins were detected with a rabbit anti-HA Ab, a biotin-conjugated secondary anti-rabbit Ab, and streptavidin-conjugated Cy3 (red). Nuclei were stained by 4Ј,6-diamidino-2-phenylindole (DAPI; blue). The Greek letter ␣ represents the prefix “anti-.” with viral RNA. A549 cells transduced with the indicated HA- ing RNA chips, as previously described (12). A549 cells trans- tagged human OAS lentiviral expression vectors were infected duced with lentiviruses expressing the indicated human OAS pro- with DEN-2 for 6 h, at which time point viral RNA was readily teins were infected with DEN-2 for 24 h, and cellular RNA was detected by an anti-dsRNA Ab (Fig. 5A). The cellular distributions separated on RNA chips. Cleavage products of 28S and 18S rRNAs of OAS proteins and viral RNA detected by anti-HA and anti- were apparent in cells expressing human OAS1 p42/p46 and dsRNA Abs were observed under a confocal microscope. The OAS3 p100 (Fig. 6, lanes 6, 10, and 20). To a lesser extent, rRNA OAS proteins were mainly localized in the cytoplasm (Fig. 5B), as cleavage products were also detected in cells expressing OAS1 previously reported (18, 33), and perinuclear localization was also p44/p48 and OAS2 p69 (Fig. 6, lanes 8, 12, and 16). The RNA noted for OAS2 p71 (Fig. 5Bg). All of the OAS members colo- integrity number (RIN), developed to estimate RNA integrity (34), calized with dsRNA except for OAS2 p69, for which the merged was also determined using the Agilent 2100 Expert software (Agi- yellow signals were less prominent (Fig. 5Bf). Thus, the discrep- lent Technologies). Interestingly, three of the OAS isoforms with ancy between anti-DEN-2 activities for the various OAS members anti-DEN-2 activity, OAS1 p42/p46 and OAS3 p100, had the low- cannot simply be explained by different cellular compartmental- est RIN values among the tested samples, 9.2, 9.3, and 8.6, re- ization of the OAS family members and viral dsRNA. spectively (Fig. 6). Therefore, these results indicate that human OAS1 p42/p46 and OAS3 p100 trigger higher RNase L activity in RNase L activity in DEN-2-infected cells overexpressing human DEN-2-infected cells, resulting in stronger antiviral activity. OAS isoforms It is known that 2-5A synthesized by activated OAS binds to and The OAS3-mediated rRNA cleavage depends on RNase L activates RNase L, which then degrades viral and cellular RNA. Because OAS3 preferentially synthesizes 2-5A dimers, which have We next determined RNase L activity triggered by the various a lower binding affinity and do not activate RNase L (18, 32, 35, OAS members by detecting the characteristic rRNA cleavage us- 36), we further assessed whether RNase L is indeed involved in the The Journal of Immunology 8041

FIGURE 6. RNase L activity determined by 28S and 18S rRNA cleavage in DEN-2-infected A549 cells overexpressing human OAS isoforms. A549 cells transduced with lentiviral vectors (MOI ϭ 2) expressing the indicated HA-tagged OAS isoforms or enhanced GFP (eGFP) control for 72 h were mock infected or infected with DEN-2 (MOI ϭ 5) for 24 h. The cellular RNA extracts were separated on RNA 6000 Nano Chips and the bands of 28S and 18S rRNA and their cleavage products were analyzed with an Agilent Bioanalyzer 2100. The RIN was determined by Agilent 2100 Expert software. rRNA cleavage triggered by OAS3 p100. We overexpressed OAS3 fection may play an important role in diminishing the progression p100 in A549 cells with or without RNase L knockdown (Fig. 7A) of severe DEN-related diseases. In mice, the Oas1b gene has been Downloaded from and tested for rRNA cleavage patterns in these cells after DEN-2 identified as a flavivirus resistance gene (6–10); however, the role infection. As shown in Fig. 7B, the rRNA cleavage induced by of human OAS family members in flavivirus infection has not yet DEN-2 infection in these OAS3-expressing cells (lanes 7 and 11) been clarified. In this study, we found that three of the 10 human was no longer seen in cells devoid of RNase L expression (lanes OAS family members, OAS1 p42/p46 and OAS3 p100, mediate a 8 and 12). Thus, our results indicate that OAS3 p100 activates potent anti-DEN-2 activity through an RNase L-dependent mech-

RNase L and mediates an antiviral effect in DEN-2-infected human anism and may contribute to host defense against DEN infection. http://www.jimmunol.org/ cells. It is well known that the OAS/RNase L system, an IFN-induced antiviral pathway, plays a critical role in innate immunity, con- Discussion trolling the outcome of virus production. RNase L may mediate DEN causes human diseases ranging from mild acute DF to severe antiviral actions by cleavage of viral RNA, by eliminating virus- DHF and DSS. The severity and outcome of DEN infection is infected cells through apoptosis, and by enhancing IFN-␤ produc- determined by complex factors such as amplitude of DEN repli- tion through the MDA5/RIG-I/IPS-1 cascade (40–42). The role of cation, expression of cytokines, activation and proliferation of im- RNase L in controlling WNV replication has been demonstrated, mune cells, host genetic factors, etc (23, 37). Patients with DHF/ with higher WNV production occurring in cells deprived of RNase by guest on September 27, 2021 DSS tend to have higher viremia titers than patients with DF; L activity by using a dominant negative mutant or genetic knock- hence, DEN levels appear to correlate with the severity of DEN down (11, 12). The role of RNase L in DEN infection is more diseases (38, 39). Thus, virus clearance in the early stages of in- obscure, and the antiviral effect of IFN in murine embryonic

FIGURE 7. Human OAS3 triggered RNase L-dependent rRNA cleavage in DEN-2-infected A549 cells. A, Protein expression of A549 cells transduced with lentivirus expressing enhanced GFP (eGFP) control, OAS3, or OAS3 plus shRNase L for 72 h was veriﬁed by Western blotting with the indicated Abs. B, The indicated cells were mock infected or infected with DEN-2 (MOI ϭ 5) for 12 and 24 h. Total cellular RNA was extracted and separated on RNA 6000 Nano Chips for analysis of 28S and 18S rRNA cleavage by an Agilent Bioanalyzer 2100. 8042 ANTI-DENGUE ACTIVITY OF OAS1 p42/p46 AND OAS3

fibroblasts is thought to be independent of RNase L (43). As would be interesting to determine whether these three OAS iso- DEN-2 replication was reduced by RNase L overexpression (Fig. forms also contribute to host defense against other flaviviruses and 1, A and B) and enhanced by RNase L knockdown in human A549 whether they are candidate human genetic factors for determining and T-REx-293 cells (Fig. 1, D and Fig. 4), we provide evidence human susceptibility to and severity of DEN-related diseases. showing that RNase L plays a protective role in host defense against DEN-2 infection in human cells. Acknowledgments The three forms of OAS are characterized by different subcel- We thank the National RNAi Core Facility, Taiwan (supported by the lular locations and enzyme parameters (44, 45). OAS1 and OAS2 National Research Program for Genomic Medicine Grants of National Sci- synthesize higher oligomers of 2-5A, whereas OAS3 tends to syn- ence Council) for shRNA constructs. thesize 2-5A dimers, which do not activate RNase L (18, 32, 35, 36). The notion that OAS3 may not act through RNase L is sup- Disclosures ported by a recent report that human OAS3 exhibits antiviral ac- The authors have no financial conflict of interest. tivity against alphaviruses, such as the Chikungunya virus, the Sindbis virus, and the Semliki Forest virus, through an RNase References 1. Gubler, D. J. 2002. Epidemic dengue/dengue hemorrhagic fever as a public L-independent pathway (46). Our results demonstrate that OAS3 is health, social and economic problem in the 21st century. Trends Microbiol. 10: able to trigger RNase L activation characterized by rRNA cleavage 100–103. (Figs. 6 and 7) and that RNase L is required for the anti-DEN-2 2. Hovanessian, A. G. 2007. On the discovery of interferon-inducible, double- stranded RNA activated enzymes: the 2Ј-5Јoligoadenylate synthetases and the activity of OAS3 (Fig. 4). Although OAS3 preferentially synthe- protein kinase PKR. Cytokine Growth Factor Rev. 18: 351–361. sizes 2-5A dimeric molecules, a small proportion of its products 3. Samuel, C. E. 2001. Antiviral actions of interferons. Clin. Microbiol. Rev. 14: Downloaded from are 2-5A oligomers (18, 32). Moreover, the requirement of dsRNA 778–809. 4. Floyd-Smith, G., E. Slattery, and P. Lengyel. 1981. Interferon action: RNA cleav- concentration for optimal OAS3 activation is ϳ100 times lower age pattern of a (2Ј-5Ј)oligoadenylate–dependent endonuclease. Science 212: than that for human OAS1 and OAS2 (30, 45), suggesting that 1030–1032. 5. Wreschner, D. H., J. W. McCauley, J. J. Skehel, and I. M. Kerr. 1981. Interferon OAS3 might be more sensitive in sensing virus RNA. Thus, we action–sequence specificity of the ppp(A2Јp)nA-dependent ribonuclease. Nature speculate that human OAS3 is activated in the early stages of 289: 414–417. 6. Mashimo, T., M. Lucas, D. Simon-Chazottes, M. P. Frenkiel, X. Montagutelli, DEN-2 infection by low concentrations of viral RNA to synthesize http://www.jimmunol.org/ P. E. Ceccaldi, V. Deubel, J. L. Guenet, and P. Despres. 2002. A nonsense 2-5A, including the majority of 2-5A dimeric molecules and a mutation in the gene encoding 2Ј-5Ј-oligoadenylate synthetase/L1 isoform is as- minority of higher oligomers of 2-5A, which then activate latent sociated with West Nile virus susceptibility in laboratory mice. Proc. Natl. Acad. RNase L to control DEN-2 replication. A recent clinical study Sci. USA 99: 11311–11316. 7. Perelygin, A. A., S. V. Scherbik, I. B. Zhulin, B. M. Stockman, Y. Li, and showing that patients with DSS have lower levels of OAS3 ex- M. A. Brinton. 2002. Positional cloning of the murine flavivirus resistance gene. pression (23) supports our notion that human OAS3 might control Proc. Natl. Acad. Sci. USA 99: 9322–9327. 8. Scherbik, S. V., K. Kluetzman, A. A. Perelygin, and M. A. Brinton. 2007. DEN replication and influence the severity and outcome of DEN Knock-in of the Oas1b(r) allele into a flavivirus-induced disease susceptible diseases. mouse generates the resistant phenotype. Virology 368: 232–237. The human OAS1 gene contains eight exons and through alter- 9. Lucas, M., T. Mashimo, M. P. Frenkiel, D. Simon-Chazottes, X. Montagutelli,

P. E. Ceccaldi, J. L. Guenet, and P. Despres. 2003. Infection of mouse neurones by guest on September 27, 2021 native splicing it gives rise to five isoforms, all of which include by West Nile virus is modulated by the interferon-inducible 2Ј-5Ј oligoadenylate exons 1–5 but differ in their C-terminal sequences (13, 14). It is synthetase 1b protein. Immunol. Cell Biol. 81: 230–236. known that a “G” sequence at the exon 6 splice-acceptor site al- 10. Kajaste-Rudnitski, A., T. Mashimo, M. P. Frenkiel, J. L. Guenet, M. Lucas, and P. Despres. 2006. The 2Ј,5Ј-oligoadenylate synthetase 1b is a potent inhibitor of lows splicing to generate OAS1 p46; whereas an “A” sequence at West Nile virus replication inside infected cells. J. Biol. Chem. 281: 4624–4637. this position drives splicing to occur further downstream to gen- 11. Samuel, M. A., K. Whitby, B. C. Keller, A. Marri, W. Barchet, B. R. Williams, R. H. Silverman, M. Gale, Jr., and M. S. Diamond. 2006. PKR and RNase L erate p48 and p52. Furthermore, the “A” allele has a higher gene contribute to protection against lethal West Nile Virus infection by controlling frequency in individuals with low basal OAS activity than in in- early viral spread in the periphery and replication in neurons. J. Virol. 80: dividuals with high OAS activity (13). Interestingly, this “A” allele 7009–7019. 12. Scherbik, S. V., J. M. Paranjape, B. M. Stockman, R. H. Silverman, and has recently been identified as a risk factor for initial infection with M. A. Brinton. 2006. RNase L plays a role in the antiviral response to West Nile WNV (20). Our results showing that OAS1 p46 but not OAS1 virus. J. Virol. 80: 2987–2999. p48/p52 exhibited anti-DEN-2 activity (Fig. 3) suggest that this 13. Bonnevie-Nielsen, V., L. L. Field, S. Lu, D. J. Zheng, M. Li, P. M. Martensen, T. B. Nielsen, H. Beck-Nielsen, Y. L. Lau, and F. Pociot. 2005. Variation in “A” allele might also be a risk factor for DEN and warrants future antiviral 2Ј,5Ј-oligoadenylate synthetase (2Ј5ЈAS) enzyme activity is controlled study to verify its role in determining the outcome of DEN infec- by a single-nucleotide polymorphism at a splice-acceptor site in the OAS1 gene. Am. J. Hum. Genet. 76: 623–633. tion. Because WNV replicated to higher levels in lymphoid tissues 14. Mashimo, T., P. Glaser, M. Lucas, D. Simon-Chazottes, P. E. Ceccaldi, from donors with the “A” allele, it is likely that WNV is also more X. Montagutelli, P. Despres, and J. L. Guenet. 2003. Structural and functional sensitive to the antiviral action of p46 and not to that of p48/p52. genomics and evolutionary relationships in the cluster of genes encoding murine 2Ј,5Ј-oligoadenylate synthetases. Genomics 82: 537–552. This OAS1 isoform-specific antiviral activity might explain why 15. Hartmann, R., H. S. Olsen, S. Widder, R. Jorgensen, and J. Justesen. 1998. an individual with the “A” allele, who does not generate p46, is p59OASL, a 2Ј-5Ј oligoadenylate synthetase like protein: a novel human gene Ј Ј more susceptible to WNV seroconversion (20). In addition to related to the 2 -5 oligoadenylate synthetase family. Nucleic Acids Res. 26: 4121–4128. OAS1 p46, OAS1 p42 is another potent anti-DEN molecule that 16. Rebouillat, D., I. Marie, and A. G. Hovanessian. 1998. Molecular cloning and we identified (Figs. 3 and 4), and its contribution to host defense characterization of two related and interferon-induced 56-kDa and 30-kDa proteins highly similar to 2Ј-5Ј oligoadenylate synthetase. Eur J. Biochem. 257: against DEN-2 infection deserves further study. It would also be 319–330. interesting to study why these OAS1 isoforms possess such dif- 17. Hovnanian, A., D. Rebouillat, E. R. Levy, M. G. Mattei, and A. G. Hovanessian. ferent antiviral activities, because they all contain an OAS domain 1999. The human 2Ј,5Ј-oligoadenylate synthetase-like gene (OASL) encoding the interferon-induced 56-kDa protein maps to chromosome 12q24.2 in the proximity and only differ in their C termini. of the 2Ј,5Ј-OAS locus. Genomics 56: 362–363. Overall, we demonstrate the importance of the 2Ј-5Ј OAS/ 18. Rebouillat, D., A. Hovnanian, I. Marie, and A. G. Hovanessian. 1999. The 100- Ј Ј RNase L system in controlling DEN replication in human cells and kDa 2 ,5 -oligoadenylate synthetase catalyzing preferentially the synthesis of dimeric pppA2Јp5ЈA molecules is composed of three homologous domains. provide insights into the antiviral capacity of various members of J. Biol. Chem. 274: 1557–1565. the OAS family against DEN replication. The antiviral effects of 19. Andersen, J. B., D. J. Strandbygard, R. Hartmann, and J. Justesen. 2004. Inter- action between the 2Ј-5Ј oligoadenylate synthetase-like protein p59 OASL and human OAS1 p42, OAS1 p46, and OAS3 p100 correlate with their the transcriptional repressor methyl CpG-binding protein 1. Eur J. Biochem. 271: abilities to trigger RNase L activation in DEN-2-infected cells. It 628–636. The Journal of Immunology 8043

20. Lim, J. K., A. Lisco, D. H. McDermott, L. Huynh, J. M. Ward, B. Johnson, 34. Schroeder, A., O. Mueller, S. Stocker, R. Salowsky, M. Leiber, M. Gassmann, H. Johnson, J. Pape, G. A. Foster, D. Krysztof, et al. 2009. Genetic variation in S. Lightfoot, W. Menzel, M. Granzow, and T. Ragg. 2006. The RIN: an RNA OAS1 is a risk factor for initial infection with West Nile virus in man. PLoS integrity number for assigning integrity values to RNA measurements. BMC Mol. Pathog. 5: e1000321. Biol. 7: 3. 21. Diamond, M. S., T. G. Roberts, D. Edgil, B. Lu, J. Ernst, and E. Harris. 2000. 35. Dong, B., and R. H. Silverman. 1995. 2-5A-dependent RNase molecules dimerize Modulation of dengue virus infection in human cells by ␣, ␤, and ␥ interferons. during activation by 2-5A. J. Biol. Chem. 270: 4133–4137. J. Virol. 74: 4957–4966. 36. Dong, B., L. Xu, A. Zhou, B. A. Hassel, X. Lee, P. F. Torrence, and 22. Johnson, A. J., and J. T. Roehrig. 1999. New mouse model for dengue virus R. H. Silverman. 1994. Intrinsic molecular activities of the interferon-induced vaccine testing. J. Virol. 73: 783–786. 2-5A-dependent RNase. J. Biol. Chem. 269: 14153–14158. 23. Simmons, C. P., S. Popper, C. Dolocek, T. N. Chau, M. Griffiths, N. T. Dung, 37. Coffey, L. L., E. Mertens, A. C. Brehin, M. D. Fernandez-Garcia, A. Amara, T. H. Long, D. M. Hoang, N. V. Chau, T. T. Thao le, et al. 2007. Patterns of host P. Despres, and A. Sakuntabhai. 2009. Human genetic determinants of dengue genome-wide gene transcript abundance in the peripheral blood of patients with virus susceptibility. Microbes Infect. 11: 143–156. acute dengue hemorrhagic fever. J. Infect. Dis. 195: 1097–1107. 38. Libraty, D. H., T. P. Endy, H. S. Houng, S. Green, S. Kalayanarooj, 24. Fink, J., F. Gu, L. Ling, T. Tolfvenstam, F. Olfat, K. C. Chin, P. Aw, J. George, S. Suntayakorn, W. Chansiriwongs, D. W. Vaughn, A. Nisalak, F. A. Ennis, and V. A. Kuznetsov, M. Schreiber, et al. 2007. Host gene expression profiling of A. L. Rothman. 2002. Differing influences of virus burden and immune activation dengue virus infection in cell lines and patients. PLoS Negl. Trop. Dis. 1: e86. on disease severity in secondary dengue-3 virus infections. J. Infect. Dis. 185: 25. Ubol, S., P. Masrinoul, J. Chaijaruwanich, S. Kalayanarooj, T. Charoensirisuthikul, 1213–1221. and J. Kasisith. 2008. Differences in global gene expression in peripheral blood 39. Vaughn, D. W., S. Green, S. Kalayanarooj, B. L. Innis, S. Nimmannitya, mononuclear cells indicate a significant role of the innate responses in progression of S. Suntayakorn, T. P. Endy, B. Raengsakulrach, A. L. Rothman, F. A. Ennis, and dengue fever but not dengue hemorrhagic fever. J. Infect. Dis. 197: 1459–1467. A. Nisalak. 2000. Dengue viremia titer, antibody response pattern, and virus 26. Lin, Y. L., C. L. Liao, L. K. Chen, C. T. Yeh, C. I. Liu, S. H. Ma, Y. Y. Huang, serotype correlate with disease severity. J. Infect. Dis. 181: 2–9. Y. L. Huang, C. L. Kao, and C. C. King. 1998. Study of Dengue virus infection 40. Li, X. L., J. A. Blackford, and B. A. Hassel. 1998. RNase L mediates the antiviral in SCID mice engrafted with human K562 cells. J. Virol. 72: 9729–9737. effect of interferon through a selective reduction in viral RNA during encepha- 27. Makarova, O., E. Kamberov, and B. Margolis. 2000. Generation of deletion and lomyocarditis virus infection. J. Virol. 72: 2752–2759. point mutations with one primer in a single cloning step. BioTechniques 29: 970–972. 41. Li, G., Y. Xiang, K. Sabapathy, and R. H. Silverman. 2004. An apoptotic sig- Downloaded from 28. Godfrey, A., J. Anderson, A. Papanastasiou, Y. Takeuchi, and C. Boshoff. 2005. naling pathway in the interferon antiviral response mediated by RNase L and Inhibiting primary effusion lymphoma by lentiviral vectors encoding short hair- c-Jun NH2-terminal kinase. J. Biol. Chem. 279: 1123–1131. pin RNA. Blood 105: 2510–2518. 42. Malathi, K., B. Dong, M. Gale, Jr., and R. H. Silverman. 2007. Small self-RNA 29. Dong, B., M. Niwa, P. Walter, and R. H. Silverman. 2001. Basis for regulated generated by RNase L amplifies antiviral innate immunity. Nature 448: 816–819. RNA cleavage by functional analysis of RNase L and Ire1p. RNA 7: 361–373. 43. Diamond, M. S., and E. Harris. 2001. Interferon inhibits dengue virus infection 30. Chebath, J., P. Benech, A. Hovanessian, J. Galabru, and M. Revel. 1987. Four by preventing translation of viral RNA through a PKR-independent mechanism. different forms of interferon-induced 2Ј,5Ј-oligo(A) synthetase identified by im- Virology 289: 297–311. 44. Hovanessian, A. G., and J. Justesen. 2007. The human 2Ј-5Јoligoadenylate syn- munoblotting in human cells. J. Biol. Chem. 262: 3852–3857. http://www.jimmunol.org/ 31. Hovanessian, A. G., J. Svab, I. Marie, N. Robert, S. Chamaret, and A. G. Laurent. thetase family: unique interferon-inducible enzymes catalyzing 2Ј-5Ј instead of 1988. Characterization of 69- and 100-kDa forms of 2-5A-synthetase from in- 3Ј-5Ј phosphodiester bond formation. Biochimie 89: 779–788. terferon-treated human cells. J. Biol. Chem. 263: 4945–4949. 45. Rebouillat, D., and A. G. Hovanessian. 1999. The human 2Ј,5Ј-oligoadenylate 32. Marie, I., J. Blanco, D. Rebouillat, and A. G. Hovanessian. 1997. 69-kDa and synthetase family: interferon-induced proteins with unique enzymatic properties. 100-kDa isoforms of interferon-induced (2Ј-5Ј)oligoadenylate synthetase exhibit J. Interferon Cytokine Res. 19: 295–308. differential catalytic parameters. Eur J. Biochem. 248: 558–566. 46. Brehin, A. C., I. Casademont, M. P. Frenkiel, C. Julier, A. Sakuntabhai, and 33. Marie, I., J. Svab, N. Robert, J. Galabru, and A. G. Hovanessian. 1990. Differ- P. Despres. 2009. The large form of human 2Ј,5Ј-oligoadenylate synthetase ential expression and distinct structure of 69- and 100-kDa forms of 2-5A syn- (OAS3) exerts antiviral effect against Chikungunya virus. Virology 384: thetase in human cells treated with interferon. J. Biol. Chem. 265: 18601–18607. 216–222. by guest on September 27, 2021