DOCSLIB.ORG

Genetic Linkage Map of the Nucleolus Organizer Region in the Soybean

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Linkage Map of the Nucleolus Organizer Region in the Soybean Copyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.107.081620 Note Genetic Linkage Map of the Nucleolus Organizer Region in the Soybean Kiwoung Yang*,† and Soon-Chun Jeong*,1 *BioEvaluation Center, Korea Research Institute of Bioscience and Biotechnology, Cheongwon, Chungbuk 363-883, Republic of Korea and †Molecular Biotechnology Major, Chonnam National University, Gwangju 500-757, Republic of Korea Manuscript received September 6, 2007 Accepted for publication October 30, 2007 ABSTRACT Simple polymorphisms in ribosomal DNA repeats in the nucleolus organizer region (NOR) permitted the development of markers for the genetic mapping of the soybean NOR. The markers map to the top end of soybean linkage group F, one of either telomeric end predicted in the cytogenetic and primary trisomic studies. HE genetic map of the soybean ½Glycine max (L.) chromatin distribution, which were numbered in de- T Merr., which is an economically important legume, scending order of 1–20 (Singh and Hymowitz 1988). is one of the most densely populated maps among plants, The chromosome harboring the satellite was designated with .3000 published markers (Choi et al. 2007). as chromosome 13 (Singh and Hymowitz 1988). However, its cytogenetic studies have lagged behind Fluorescent in situ hybridization (FISH) using the rDNA those of rice (Oryza sativa L.), maize (Zea mays L.), barley as a probe verified that the satellite region of chromo- (Hordeum vulgare L.), and tomato (Lycopersicon esculentum some 13 is the nucleolus organizer region (NOR) Mill.). Thus, the relationships between soybean molec- (Griffor et al. 1991). FISH resulted in the detection of a ular linkage groups (MLG) and chromosomes remain pair of NORs on the short arm of chromosome 13 in incompletely understood (Cregan et al. 2001; Zou et al. the soybean and its progenitor, G. soja, as well as three 2003). The haploid chromosome number of the soy- strong fluorescent signals in the soybean that are bean plant is 20 (Veatch 1934), which is almost two trisomic for chromosome 13. Subsequently, MLG F times that observed in major diploid crops such as rice was assigned to chromosome 13 with a set of primary (n ¼ 12), maize (10), barley (7), and tomato (12) as well trisomics and simple sequence repeat markers (Cregan as in research plants including Arabidopsis thaliana (5), et al. 2001). However, the accurate genetic location of the Lotus japonicus (6), and Medicago trancatula (8). The soy- soybean NOR on MLG F remains to be determined. bean mitotic metaphase chromosomes evidence small The NOR loci harbor from hundreds to thousands size variations ranging from 1.42 to 2.84 mm and are of 18S-5.8S-26S ribosomal RNA gene units, which are symmetrical without karyotypically visible landmarks clustered into tandem repeats (Flavell and O’Dell (Sen and Vidyabhusan 1960). However, the pachytene 1979). Each of the repeats codes for a ribosomal RNA chromosome analysis of an F1 hybrid between soybean gene unit. An intergenic spacer (IGS) region separates and Glycine soja Sieb. and Zucc., a wild annual progenitor the transcription units of adjacent repeats. The inter- of the soybean, evidenced heterochromatin distribution genic region has been determined to be highly variable on either side of the centromeres, small structural in a range of plants: Triticum aestivum (Apples and differences, and a satellite chromosome, thus allowing Dvorˇa´k 1982), Triticum dicoccoides (Flavell et al. 1986), for the construction of chromosome maps on the basis H. vulgare (Saghai Maroof et al. 1984), Vicia faba of chromosome length and euchromatin and hetero- (Rogers and Bendich 1987), and Z. mays (Zimmer et al. 1988). The high degree of variation in the number of subrepeats in the IGS region has allowed for the Sequence data from this article have been deposited with the GenBank development of molecular markers for the genetic Data Library under accession nos. EU118310–EU118313. mapping of these NORs in several plant species (e.g., 1Corresponding author: BioEvaluation Center, Korea Research Institute Saghai Maroof et al. 1984; Snape et al. 1985; Zimmer of Bioscience and Biotechnology, 685-1 Yangcheongri, Ochangup, openhaver ikaard Cheongwon, Chungbuk 363-883, Republic of Korea. et al. 1988; C and P 1996). However, E-mail: [email protected] the soybean IGS appears to harbor no notable subrepeat Genetics 178: 605–608 ( January 2008) 606 K. Yang and S.-C. Jeong TABLE 1 Primer sequences for PCR amplification and sequencing of the soybean ITS1 and IGS regions Target Name Specificity Sequence (59 / 39) ITS1 ITS1-F Forward CCACTGAACCTTATCATTTA ITS1-R Reverse GCAATTCACACCAAGTATC IGS IGS-F Forward GCTGCCACGATCCACTGAG IGS-R Reverse ACATGCATGGCTTAATCTTT IGS-seq-F Sequencing AAAAACCACGAAGTTGAC IGS-seq-R Sequencing CAAAAACATCCCGATTAC IGS-seq-rcF Sequencing TGCTTAAGTTTTTCCATGT IGS-seq-rcR Sequencing TAGTGGTGTCAAGTCTTGC DNA fragments corresponding to ITS1 were amplified via PCR using the ITS1-F primer, which occurs at the 39 part of 18S rDNA, and the ITS1-R primer, which occurs at the 59 portion of 5.8S rDNA, from the Hwangkeum and IT182932 variants. These priming sites were identified via the examination of a Cicer arietinum rDNA sequence (GenBank accession no. AJ577394). DNA fragments corresponding to an IGS were PCR amplified using the IGS-F primer, which occurs at the 39 portion of 18S rDNA, and the IGS-R primer, which occurs at the 59 portion of 5.8S rDNA, from the Hwangkeum and IT182932 variants. These priming sites were iden- tified via the examination of IGS sequences reported by Nickrent and Patrick (1998) and soybean genomic survey sequences, including GenBank accession nos. ED789183 and ER964634. The PCR products were then prepared for sequencing via the excision of a band of the expected size from an agarose gel, followed by purification as described by Jeong et al. (2002). The sequencing of IGS PCR products was completed using the following internal primers: IGS-seq-F, IGS-seq-R, IGS-seq-rcF, and IGS-seq-rcR, in addition to the IGS-F and IGS-R PCR primers. variations (Nickrent and Patrick 1998) among G. max genotype of the locus using an allele-specific PCR variants and between G. max and G. soja, with a GT method, as described by Jeong and Saghai Maroof dinucleotide repeat and several single nucleotide poly- (2004) (Table 2). The IGS sequence of Hwangkeum morphism (SNP) loci. In the coding repeat units, other (GenBank accession no. EU118312) harbors 9 single- variable regions, referred to as internal transcribed spa- base substitutions, 2 single-base deletions, and one 14- cers (ITS), are located on either side of the 5.8 S rRNA base deletion due to a microsatellite repeat variation gene, which are designated as ITS1 and ITS2. The nucle- relative to that of IT182932 (GenBank accession no. otide sequences of the ITS have proven quite useful for EU118313). One of the single nucleotide polymor- phylogenetic studies in many angiosperm groups, due phism loci was genotyped via the design of two specific primarily to their usefulness in resolving relationships at forward primers and a common reverse primer as de- the species level (Arnheim 1983; Wojciechowski et al. scribed above for the ITS1, and the microsatellite repeat 1993; Baldwin et al. 1995). Here, we describe the variation locus was genotyped via the design of a primer genetic localization of the soybean NOR using SNP pair for PCR amplification (Table 2). and microsatellite markers that were developed from a The allele-specific PCR primer sets designed from the SNP locus between the ITS1 nucleotide sequences and ITS1 and IGS sequences generated allele-specific PCR from a SNP locus and a microsatellite repeat locus be- bands, which evidenced the expected ratio of 1:1 (x2 ¼ tween the IGS nucleotide sequences of the soybean and 2.7, P ¼ 0.1) in the HI population as codominant alleles G. soja. of a Mendelian locus. The SNP marker from the ITS1 We utilized a population of 113 F12 recombinant was designated as SN307 and the SNP marker from the inbred lines generated via an interspecific cross between IGS was designated as SN314. The microsatellite mar- the G. max cv. ‘‘Hwangkeum’’ and the G. soja Siebold & ker, designated SM318, cosegregates with the SN307 Zucc. line ‘‘IT182932’’ (hereafter referred to as the HI and SN314 markers in the HI population. The three population). In this HI population, which harbors .400 markers were mapped 0.4 cM away from Satt325 on the mapped marker loci (S.-C. Jeong, unpublished results), top end of MLG F (Figure 1A). all 20 of the soybean MLGs have been identified. DNA The three markers were further tested on 10 soybean sequences corresponding to ITS1 and IGS were de- (G. max) cultivars to investigate their applicability for termined from the Hwangkeum and IT182932 variants mapping the NOR in a population made from a cross (Table 1). The ITS1 sequence of Hwangkeum (Gen- between G. max cultivars. The microsatellite marker Bank accession no. EU1183310) harbors one single- SM318 revealed a novel allele, which is 2 bases longer base substitution relative to that of IT182932 (GenBank than the size of the Hwangkeum allele (Figure 1B). The accession no. EU118311). This SNP locus was geno- size variation was verified by sequencing analysis (Figure typed via the design of a set of two specific forward 1C). SN307 and SN314 revealed the same banding primers and a common reverse primer to determine the patterns as those of Hwangkeum (data not shown). Note 607 TABLE 2 Attributes of SNP and microsatellite markers used for mapping ITS1 and IGS in a recombinant inbred line population from a cross between Hwangkeum and IT182932 Description of Name of Product Target polymorphism primer Primer specificity Primer sequence (59 / 39)a size (bp) ITS1 SNP, T(H)/C(I) SN307-H-F Forward specific to H CCCGCGAACTTGTTTACT 210 SN307-I-F Forward specific to I CCCGCGAACTTGTTTACC SN307-com-R Common reverse CCGAGAGTCATTGTATGTAA IGS SNP, A(H)/C(I) SN314-H-F Forward specific to H TATGGGTTTTCACCCACC 169 SN314-I-F Forward specific to I TATGGGTTTTCACCCAAA SN314-com-R Common reverse CAAAAACATCCCGATTAC GT and GC repeats, SM318-F Forward CATAACATGGCAAGACAC 115(H), GT(11)GC(5)(H)/ 129 (I) GT(7)GC(2)(I) SM318-R Reverse GGTGGTGGATCATCATGTCA H, Hwangkeum; I, IT182932.
Load more

Recommended publications
  • Wide-Spread Polyploidizations During Plant Evolution Dicot
    2/3/2015 Wide-spread polyploidizations during plant evolution Telomere-centric genome repatterning <0.5 sugarcane determines recurring chromosome number 11-15 sorghum ~70 ~50 12-15 maize reductions during the evolution of eukaryotes monocot 1 0.01rice wheat barley Brachypodium 170-235 18- tomato 23 potato euasterids I asterids sunflower euasterids II lettuce ~60 3-5 castor bean poplar Xiyin Wang ? melon eurosids I eudicot 15-23 8-10 soybean Medicago Plant Genome Mapping Laboratory, University of Georgia, USA cotton rosids 13-15 1-2 Center for Genomics and Biocomputation, Hebei United University, China papaya 112- 15-20 eurosids II 156 8-15 Arabidopsis Brassica grape Dicot polyploidizations Chromosome number reduction Starting from dotplot Rice chromosomes 2, 4, and 6 polyploidy •For ancestral chromosome A, after WGD, you have 2 A speciation •A fission model: A => R2 P1 Q1 P2 Q2 A => R4, R6 •Example: Dotplot of rice and •A fusion model: sorghum A1 => R4 A2 => R6 •All non-shared changes are in A1+A2 => R2 sorghum, e.g. two chro. fusion •Likely chromosome fusion •All other changes are shared by Repeats accumulation at rice and sorghum colinearity boundaries, which would not be like that for fission •Rice preserves grass ancestral genome structure 1 2/3/2015 Rice chromosomes 3, 7, and 10 Banana can answer the question •For ancestral chromosome A, after WGD, you have 2 A •A fission model: A => R3 •Fission model: A => R7, R10 One ancestral chromosome split to produce R4 and R6 •A fusion model: Another duplicate – R2 A1 => R7 A2 => R10 • Fusion model: A1+A2 => R3 Two ancestral chromosomes merged to produce R2 •Likely chromosome fusion Two other duplicates-R4 and Repeats accumulation at R6 colinearity boundaries, which would not be like that for fission • Similar to R3, R7 and R10 Grasses had 7 ancestral chromosomes before WGD (n=7) A model of genome repatterning •A1 => R1 •A6 => R8 •A nested fusion model •A1 => R5; •A6 => R9 •A2 => R4 •A7 => R11 •A3 => R6 •A7 => R12 •A2+A3 => R2 •A4 = R7 •A5 = R10 •A4+A5 => R3 Murat et al.
    [Show full text]
  • Clusters of Alpha Satellite on Human Chromosome 21 Are Dispersed Far Onto the Short Arm and Lack Ancient Layers
    Loyola University Chicago Loyola eCommons Bioinformatics Faculty Publications Faculty Publications 2016 Clusters of Alpha Satellite on Human Chromosome 21 Are Dispersed Far onto the Short Arm and Lack Ancient Layers William Ziccardi Loyola University Chicago Chongjian Zhao Loyola University Chicago Valery Shepelev Russian Academy of Sciences Lev Uralsky Russian Academy of Sciences Ivan Alexandrov Russian Academy of Medical Sciences Follow this and additional works at: https://ecommons.luc.edu/bioinformatics_facpub See next page for additional authors Part of the Bioinformatics Commons, Evolution Commons, and the Genetics Commons Recommended Citation Ziccardi, William; Zhao, Chongjian; Shepelev, Valery; Uralsky, Lev; Alexandrov, Ivan; Andreeva, Tatyana; Rogaev, Evgeny; Bun, Christopher; Miller, Emily; Putonti, Catherine; and Doering, Jeffrey. Clusters of Alpha Satellite on Human Chromosome 21 Are Dispersed Far onto the Short Arm and Lack Ancient Layers. Chromosome Research, 24, : 421-436, 2016. Retrieved from Loyola eCommons, Bioinformatics Faculty Publications, http://dx.doi.org/10.1007/s10577-016-9530-z This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Bioinformatics Faculty Publications by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Springer, 2016. Authors William Ziccardi, Chongjian Zhao, Valery Shepelev, Lev Uralsky, Ivan Alexandrov, Tatyana Andreeva, Evgeny Rogaev, Christopher Bun, Emily Miller, Catherine Putonti, and Jeffrey Doering This article is available at Loyola eCommons: https://ecommons.luc.edu/bioinformatics_facpub/29 Abstract Click here to download Abstract ABSTRACT.docx ABSTRACT Human alpha satellite (AS) sequence domains that currently function as centromeres are typically flanked by layers of evolutionarily older AS that presumably represent the remnants of earlier primate centromeres.
    [Show full text]
  • First Chromosome Analysis and Localization of the Nucleolar Organizer Region of Land Snail, Sarika Resplendens (Stylommatophora, Ariophantidae) in Thailand
    © 2013 The Japan Mendel Society Cytologia 78(3): 213–222 First Chromosome Analysis and Localization of the Nucleolar Organizer Region of Land Snail, Sarika resplendens (Stylommatophora, Ariophantidae) in Thailand Wilailuk Khrueanet1, Weerayuth Supiwong2, Chanidaporn Tumpeesuwan3, Sakboworn Tumpeesuwan3, Krit Pinthong4, and Alongklod Tanomtong2* 1 School of Science and Technology, Khon Kaen University, Nong Khai Campus, Muang, Nong Khai 43000, Thailand 2 Applied Taxonomic Research Center (ATRC), Department of Biology, Faculty of Science, Khon Kaen University, Muang, Khon Kaen 40002, Thailand 3 Department of Biology, Faculty of Science, Mahasarakham University, Kantarawichai, Maha Sarakham 44150, Thailand 4 Biology Program, Faculty of Science and Technology, Surindra Rajabhat University, Muang, Surin 32000, Thailand Received July 23, 2012; accepted February 25, 2013 Summary We report the first chromosome analysis and localization of the nucleolar organizer re- gion of the land snail Sarika resplendens (Philippi 1846) in Thailand. The mitotic and meiotic chro- mosome preparations were carried out by directly taking samples from the ovotestis. Conventional and Ag-NOR staining techniques were applied to stain the chromosomes. The results showed that the diploid chromosome number of S. resplendens is 2n=66 and the fundamental number (NF) is 132. The karyotype has the presence of six large metacentric, two large submetacentric, 26 medium metacentric, and 32 small metacentric chromosomes. After using the Ag-NOR banding technique, one pair of nucleolar organizer regions (NORs) was observed on the long arm subtelomeric region of chromosome pair 11. We found that during metaphase I, the homologous chromosomes show synapsis, which can be defined as the formation of 33 ring bivalents, and 33 haploid chromosomes at metaphase II as diploid species.
    [Show full text]
  • Molecular Cytogenetics of Eurasian Species of the Genus Hedysarum L
    plants Article Molecular Cytogenetics of Eurasian Species of the Genus Hedysarum L. (Fabaceae) Olga Yu. Yurkevich 1, Tatiana E. Samatadze 1, Inessa Yu. Selyutina 2, Svetlana I. Romashkina 3, Svyatoslav A. Zoshchuk 1, Alexandra V. Amosova 1 and Olga V. Muravenko 1,* 1 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 32 Vavilov St, 119991 Moscow, Russia; [email protected] (O.Y.Y.); [email protected] (T.E.S.); [email protected] (S.A.Z.); [email protected] (A.V.A.) 2 Central Siberian Botanical Garden, SB Russian Academy of Sciences, 101 Zolotodolinskaya St, 630090 Novosibirsk, Russia; [email protected] 3 All-Russian Institute of Medicinal and Aromatic Plants, 7 Green St, 117216 Moscow, Russia; [email protected] * Correspondence: [email protected] Abstract: The systematic knowledge on the genus Hedysarum L. (Fabaceae: Hedysareae) is still incomplete. The species from the section Hedysarum are valuable forage and medicinal resources. For eight Hedysarum species, we constructed the integrated schematic map of their distribution within Eurasia based on currently available scattered data. For the first time, we performed cytoge- nomic characterization of twenty accessions covering eight species for evaluating genomic diversity and relationships within the section Hedysarum. Based on the intra- and interspecific variability of chromosomes bearing 45S and 5S rDNA clusters, four main karyotype groups were detected in the studied accessions: (1) H. arcticum, H. austrosibiricum, H. flavescens, H. hedysaroides, and H. theinum (one chromosome pair with 45S rDNA and one pair bearing 5S rDNA); (2) H. alpinum and one accession of H. hedysaroides (one chromosome pair with 45S rDNA and two pairs bearing 5S rDNA); Citation: Yurkevich, O.Y.; Samatadze, (3) H.
    [Show full text]
  • Protein Synthesis
    Lecture Note Subject: HAP, 201T SEM-2nd UNIT-V Submitted By: Prasenjit Mishra HCP-345-BBSR CHROMOSOME Definition – Chromosome means: chroma - colour; some - body) Waldeyer coined the term chromosome first time in 1888. A chromosome is a thread-like self-replicating genetic structure containing organized DNA molecule package found in the nucleus of the cell. E. Strasburger in 1875 discovered thread-like structures which appeared during cell division. In all types of higher organisms (eukaryote), the well organized nucleus contains definite number of chromosomes of definite size, and shape. The somatic chromosome number is the number of chromosomes found in somatic cell and is represented by 2n (Diploid). The genetic chromosome number is half of the somatic chromosome numbers and represented by n (Haploid). The two copies of chromosome are ordinarily identical in morphology, gene content and gene order, they are known as homologus chromosomes. Features of eukaryotic chromosome Chromosomes are best visible during metaphase Chromosomes bear genes in a linear fashion Chromosomes vary in shape, size and number in different species of plants and animals Chromosomes have property of self duplication and mutation Chromosomes are composed of DNA, RNA and protein Chromosome size, shape and number Chromosome size is measured at mitotic metaphase generally measured in length and diameter Plants usually have longer Chromosome than animals Plant Chromosomes are generally 0.8-7µm in length where as animal chromosomes are 0.5-4µm in length. Chromosomes size varies from species to species Chromosome shape The shape of chromosome is generally determined by the position of centromere. Chromosomes generally exits in three different shapes, rod shape, J shape and V shape Chromosome number Each species has definite and constant somatic and genetic chromosome number Somatic chromosome number is the number of chromosome found in somatic cells while genetic chromosome number is the number of chromosome found in gametic cells.
    [Show full text]
  • Analysis of Human Chromosomal Variants by Quantitative Electron Microscopy I
    ANALYSIS OF HUMAN CHROMOSOMAL VARIANTS BY QUANTITATIVE ELECTRON MICROSCOPY I. GROUP D CHROMOSOME WITH GIANT SATELLITES H. M. GOLOMB AND G. F. BAHR Armed Forces Institute of Pathology, Washington, D. C. 20305 AND D. S. BORGAONKAR Division of Medical Genetics, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 Received May 6, 1971 HE so-called “normal” variations in the human karyotype found in clinically Tnormal individuals have been useful for linkage studies as chromosome markers (e.g., No. 1 and No. 16 chromosomes) (DONAHUEet al. 1968; MAGENIS, HECHTand LOVIEN1970). The old order Amish in the United States are an inbred group that has been extensively studied genetically ( MCKUSICK,HOSTET- LER and EGELAND1964). During chromosome screening of Amish males for patrilinear variation in the length of the Y chromosome (BORGAONKARet al. 1969), a D group chromosome was found to have a giant satellite knob (inset, Figure 1). Extensive cytogenetic studies are in progress, and the data collected so far indicate that this giant-satellite carrying marker D chromosome is present in about 10% of the Amish in Lancaster County, Pa. Autoradiographic studies indicate that the marker chromosome may be a number 14 chromosome since it is labeled more heavily in the region proximal to the centromere (MCKUSICK 1969). Karyotyping of single human chromosomes by determinations of dry mass from electron micrographs has recently become possible (BAHRand GOLOMB 1971) and allow for rather precise grouping and evaluation of individual marker chromosomes. This technique is applied to the giant-satellite carrying large acrocentric chromosome in this study. Our study is the first in a series of detailed analyses of abnormal human chro- mosomes in which quantitative electron microscopy demonstrates the capacity of rendering new information in two orders of magnitude below the resolution of the light microscope.
    [Show full text]
  • The Changing Governance of Genetic Intervention Technologies
    The Changing Governance of Genetic Intervention Technologies An Analysis of Legal Change Patterns, Drivers, Impacts, and a Proposed Reform Neil Harrel Thesis submitted to the University of Ottawa in partial fulfillment of the requirements for the Doctorate in Philosophy (Ph.D.) degree in Law Faculty of Law University of Ottawa © Neil Harrel, Ottawa, Canada, 2021 . Abstract Major breakthroughs in biotechnology are leading to the emergence of novel methods to select and alter future individuals’ genomes. Genetic intervention technology is evolving from the medical practice of screening for life-threatening congenital malformations to the selection against embryos that might develop mild disabilities. Scientific research suggests that heritable genome-editing technology would enable the custom alteration and the enhancement of human biological characteristics, including appearance, athletic and intellectual abilities. These novel developments and their potential long-term impacts raise the question of how effective are the laws on genetic interventions in setting limits to rapidly evolving biotechnologies. This thesis examines genetic intervention laws in the United Kingdom and France and shows it exhibits a pattern of continuous legal changes over the past several years to permit a broadening range of genetic interventions that were previously prohibited. This pattern is characterized by the regulatory licensing of genetic interventions that specific legal restrictions have sought to disallow, such as screening against conditions that are mild, treatable and not predominantly determined by genes. Moreover, governments are currently considering replacing their bans on inheritable human genetic modification with regulations that will allow the alteration of genes linked to conditions deemed “serious” and for “therapeutic” purposes. This proposed regulatory model would enable licensing the very same type of genomic alterations intended to be prohibited – genetic enhancements of human physiological and cognitive capabilities.
    [Show full text]
  • Identification of Chromosomes with Secondary Constrictions in Melilotus Species
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Agronomy & Horticulture -- Faculty Publications Agronomy and Horticulture Department 1984 Identification of Chromosomes with Secondary Constrictions in Melilotus Species S. E. Schlarbaum Kansas State University L. B. Johnson United States Department of Agriculture Herman J. Gorz United States Department of Agriculture Francis A. Haskins University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/agronomyfacpub Part of the Plant Sciences Commons Schlarbaum, S. E.; Johnson, L. B.; Gorz, Herman J.; and Haskins, Francis A., "Identification of Chromosomes with Secondary Constrictions in Melilotus Species" (1984). Agronomy & Horticulture -- Faculty Publications. 307. https://digitalcommons.unl.edu/agronomyfacpub/307 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Agronomy & Horticulture -- Faculty Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. The Journal of Heredity 75:23-26. 1984. Identification of chromosomes with secondary constrictions in Me/ilotuB species ABSTRACT: Secondary constrictions were determined in one chromosome pair in the com­ plements of M. intesta, M. macrocarpa, M. italica (subgenus Micromeli/otus), and M. alba and M. officinalis (subgenus Meli/otus). The karyotypes of M. intesta and M. macrocarpa were found to be similar. Chromosomes of M. italica were larger than the chromosomes of the other four Melilotus species. The chromosome size in M. italica suggests the pres­ ence of large chromosomes in an ancestral or pro-Melilotus prototype. The chromosomes with satellites of M. intesta and M.
    [Show full text]
  • The Differences Between Cis- and Trans-Gene Inactivation Caused by Heterochromatin in Drosophila
    HIGHLIGHTED ARTICLE | INVESTIGATION The Differences Between Cis- and Trans-Gene Inactivation Caused by Heterochromatin in Drosophila Yuriy A. Abramov,*,1 Aleksei S. Shatskikh,*,1 Oksana G. Maksimenko,† Silvia Bonaccorsi,‡ Vladimir A. Gvozdev,*,2 and Sergey A. Lavrov*,2 *Department of Molecular Genetics of the Cell, Institute of Molecular Genetics, Russian Academy of Science, Moscow 123182, Russia, and †Institute of Gene Biology, Russian Academy of Sciences, 119334 Moscow, Russia, and ‡Department of Biology and Biotechnology “Charles Darwin,” Sapienza University of Rome, 00185, Italy ABSTRACT Position-effect variegation (PEV) is the epigenetic disruption of gene expression near the de novo–formed euchromatin- heterochromatin border. Heterochromatic cis-inactivation may be accompanied by the trans-inactivation of genes on a normal homologous chromosome in trans-heterozygous combination with a PEV-inducing rearrangement. We characterize a new genetic system, inversion In(2)A4, demonstrating cis-acting PEV as well as trans-inactivation of the reporter transgenes on the homologous nonrearranged chromosome. The cis-effect of heterochromatin in the inversion results not only in repression but also in activation of genes, and it varies at different developmental stages. While cis-actions affect only a few juxtaposed genes, trans-inactivation is observed in a 500-kb region and demonstrates а nonuniform pattern of repression with intermingled regions where no transgene repression occurs. There is no repression around the histone gene cluster and in some other euchromatic sites. trans-Inactivation is accompanied by dragging of euchromatic regions into the heterochromatic compartment, but the histone gene cluster, located in the middle of the trans-inactivated region, was shown to be evicted from the heterochromatin.
    [Show full text]
  • Metaphase Karyotypes of Anopheles of Thailand and Southeast Asia: I. the Hyrcanus Group
    MARCH 1993 Merepnesr K.rRyotyprs oF ANopHELEs METAPHASE KARYOTYPES OF ANOPHELES OF THAILAND AND SOUTHEASTASIA: I. THE HYRCANUSGROUP VISUT BAIMAI,' RAMPA RATTANARITHIKUL, eNo UDOM KIJCHALAO' . AB.STRACT.Metaphase karyotypes of 6 speciesof the_HyrcanusSpecies Group of the subgenus Anophelesshow constitutive heterochromatin variation in X and y cfrro'-osomes. A'nophelespeditaei- iotus exhibits the most extensivevariation in the size and shape of h;;t;;1;;-atic sex ch.o-oso-es, with 3 types -ofX and 5 tlpes of Y chromosomes.Anophel.es n;i;a"s strowsihe -tt"u" l"u.t variation, with only 2 types of X chromosomes.Anoph.ebs sinensis and'An. crawfordi "r"li 2 forms "f ;"t"p;;;; karyotype in the heterochromatin of the Y chromosome. It is not k"";; whether the 2 forms oi metaphase karyotype in these 2 speciesrepresent inter- or intraspecifrc diif"."rr""*. The 2 forms of heterochromatic sex chromosomesobserved in An. argyropn ^nA ii.- iijirrt^* -"y ."gg*i1h" existenceof siblingspecies complexes within eachof theie species. INTRODUCTION the different amount and distribution of consti- The genusAnopheles is one of the most im- tutive heterochromatincan be a usefulcvtotax- portant groupsof mosquitoesin terms of disease onomictool in separatingclosely related species, particularly transmissionin the world. This genusconsists homosequentialspecies as exempli- ofmore than 400described species (Colless 19b6. fied in the LeucosphyrusGroup (Baimai et al. Reid 1968,Harrison and Scanlon1925, Harrison 1981,1988a, 1988b; Baimai 1988). 1980, Harrison et al. lggl). The subgenera We report here on the metaphasekaryotlpe of 6 species, Anopheles and Cellia are the 2 larsest of the 6 including various forms, of tle Hyrcanus subgenerabelonging to the genus.Harrison et Group of the subgenus Anopheles, which occur al.
    [Show full text]
  • A De Novo Marker Chromosome 15 in a Child with Isolated Developmental Delay
    Journal of Genetics (2020)99:72 Ó Indian Academy of Sciences https://doi.org/10.1007/s12041-020-01231-9 (0123456789().,-volV)(0123456789().,-volV) RESEARCH NOTE A de novo marker chromosome 15 in a child with isolated developmental delay MADHAVAN JEEVAN KUMAR1,2*, KALPANA GOWRISHANKAR2, VENKATASUBRAMANIAN HEMAGOWRI1,2 and JAYARAMA KADANDALE3 1Department of Genetic Engineering, SRM Institute of Science and Technology, Kattankulathur 603 203, India 2Department of Medical Genetics, CHILDS Trust Medical Research Foundation (CTMRF), Kanchi Kamakoti CHILDS Trust Hospital, Chennai 600 034, India 3Department of Molecular Cytogenetics, Centre for Human Genetics, Bengaluru 560 100, India *For correspondence. E-mail: [email protected]. Received 17 December 2019; revised 16 June 2020; accepted 17 June 2020 Abstract. We report a rare case of a 14-month-old male child who was referred for developmental delay. Clinical examination revealed a hypotonic infant with speech delay and no dysmorphic features. The banding cytogenetics revealed a small supernumerary marker chromosome. Upon silver staining, the marker showed the presence of satellite regions on either ends. Further, analysis using fluorescence in situ hybridization on marker chromosome revealed its origin from chromosome 15. Keywords. cytogenetics; satellite chromosome; fluorescence in situ hybridization; marker chromosome; uniparental disomy. Introduction Materials and methods Small supernumerary marker chromosome (sSMC) is a Clinical report structurally abnormal chromosome fragment of unknown origin (ISCN 2013). In general, sSMC is unique in its size, A 14-month-old boy was referred to clinical genetic evalu- and banding pattern and characterization of sSMC using ation of developmental delay. The three generation pedigree routine banding cytogenetics is not achievable (Liehr et al.
    [Show full text]
  • Enlarged Satellites As a Familial Chromosome Marker HERBERT L
    Enlarged Satellites as a Familial Chromosome Marker HERBERT L. COOPER' AND KURT HIRSCHHORN2 Department of Medicine, New York University School of Medicine, New York, N. Y. RECENT ADVANCES in the techniques of cytogenetics have made possible the detailed examination of human chromosomes, both in normal and abnormal individuals. Initial efforts were directed toward establishing the major iden- tifying features of the normal human chromosome complement, and toward investigating various disease syndromes related to gross chromosomal aberrations. (For reviews see Hirschhorn and Cooper, 1961-a; Miller, Cooper, and Hirsch- horn, 1961.) Recently, technical improvements have made possible a more detailed examination of less obvious chromosomal details. Such details are the satellite bodies, secondary constrictions, chromosome associations, and possible population polymorphisms with respect to length and arm ratios of homologous chromosomes. This paper wvill present some observations on the small satellite bodies extending from the short arms of the acrocentric autosomes, a normal feature of the human chromosome set (Fig. 1). Satellited chromosomes are well known to cytologists working with other organisms, and it is believed that the satellite body arises because of a secondary constriction of the chromosome near its end (Heitz, 1931). Theoretically, any length of chromosome distal to a secondary constriction may be considered to be a satellite body, but for the purposes of this paper, we shall consider only those secondary constrictions of the short arms of the acrocentric chromosomes which pinch off a tiny length of the chromosome, seldom longer than it is wide. The region of the chromosome near the secondary constriction has been shown, in plants, to be the nucleolar organizing portion of the chromosome (Heitz, 1931), and it has been suggested that the satellite regions of human chromosomes have a similar function (Chu and Giles, 1959; Ohno, Trujillo, Kaplan, and Kinosita, 1961).
    [Show full text]