MOLECULAR DNA MARKERS in PARENTAGE IDENTIFICATION and CLONAL GENETIC STRUCTURE of Cryptocoryne ×Purpurea Ridl

MOLECULAR DNA MARKERS IN PARENTAGE

IDENTIFICATION AND CLONAL GENETIC STRUCTURE OF

Cryptocoryne ×purpurea Ridl. nothovar. purpurea

HYBRID POPULATIONS

ROSAZLINA BINTI RUSLY

UNIVERSITI SAINS MALAYSIA 2016

MOLECULAR DNA MARKERS IN PARENTAGE IDENTIFICATION AND CLONAL GENETIC STRUCTURE OF Cryptocoryne ×purpurea Ridl. nothovar. purpurea HYBRID POPULATIONS

ROSAZLINA BINTI RUSLY

Thesis submitted in fulfillment of the requirements for the degree of Doctor of Philosophy

July 2016

ACKNOWLEDGEMENTS

Alhamdulillah. First of all, I would like to mention how grateful I am to Allah

S.W.T because with His entire blessing, I have finally completed my research dissertation. Undertaking this PhD has been a truly life-changing experience for me and it would not have been possible to do without the support and guidance that I received from many people. First and foremost, I would like to express my deepest appreciation to my supervisor, Professor Dr Ahmad Sofiman Bin Othman for his guidance, advices, comments and constructive suggestion throughout the period of my study. I have been extremely lucky to have a supervisor who cared so much about my work, and who responded to my questions and queries so promptly. I also would like to address my deepest gratitude to my field supervisor, Associate Professor Dr Marian Ørgaard and

Professor Dr Niels Jacobsen from University of Copenhagen for their valuable advice and friendly help. I would also like to grab this opportunity to express my utmost thanks to Professor Dr Amirul Al-Ashraf Abdullah who introduced me to this field and always giving me a good motivation, moral support and encouragement.

My deepest appreciation also goes to School of Biological Sciences’ staff, En

Bob, En Shukor, En Muthu and En Shanmugam for helping me during field sampling and preparation of herbarium specimens. I am indebted to them for their help. Also, thanks to Puan Sabariah who always helping me in the settlement of purchase order and provided lab apparatus. Completing this work would have been all the more difficult were it not for the support and friendship provided by the members of the Lab 409. I would like to thank all these people for their help and support throughout my study for the last couple of years; Fishah, Farah, Ila, Komala, Shafika, Shakina, Fasih, Jayaraj,

Bad, Veera, Im Hin, Fahmi, Sughanti and also colleague friends from Lab 308; Nurul,

Mira, Daniel, Lim, Jam, Lia, Wani, Kak Adib, Fung and Kak Naz. Not forgetting my best friend Kak Fuzah, Ana, Fatimah, Zai and Fara for their care and joyousness they bring into my days.

To my family especially my father Hj Rusly Bin Yusoff and my mother Hjh

Nina Bt Sahari, thank you very much for everything and I appreciate your love, endless pray and moral support. I owe my loving thanks to my family; Along, Angah, Kak Jia,

Kak Tina and parent-in-law; Mak and Abah for their loving support. Not forgetting my adorable niece Adriana and Addin and my nephew Aariq those bringing colourful days in my life. To my beloved husband, Mohd Sallehudin Bin Mohd Hailani, thank you for your endless love, understanding and encouragements.

I also extend my gratitude to the Postgraduate Research Grant Scheme from

Universiti Sains Malaysia (1001/PBIOLOGI/846007) for funding my research and

MyBrain15 (Ministry of Higher Education, Malaysia) for providing scholarships for my financial support and university tuition fees.

Last but not least, a big thanks to everyone who has contributed, either directly or indirectly towards the success of this study.

iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ii TABLE OF CONTENTS iv LIST OF TABLES viii LIST OF FIGURES x LIST OF PLATES xii LIST OF ABBREVIATIONS xiv ABSTRAK xv ABSTRACT xvii

CHAPTER ONE: GENERAL INTRODUCTION 1

CHAPTER TWO: LITERATURE REVIEW 4 2.1 The Genus Cryptocoryne 4

2.1.1 Natural Hybridization in the Genus Cryptocoryne 5 9 2.1.2 Morphological Characteristics and Habitat

2.2 What is Plant Hybridization? 14

2.3 Effect of Plant Hybridization 15 2.4 Plant Hybrid Identification 16

2.4.1 Nuclear Ribosomal ITS Region 18 2.4.2 Chloroplast DNA Region; matK 21 2.4.3 Microsatellite Markers 25 2.5 Clonal Assignment 30 2.5.1 Amplified Fragment Length Polymorphism (AFLP) 31

CHAPTER THREE: MOLECULAR EVIDENCE FOR THE HYBRID 35 ORIGIN OF Cryptocoryne ×purpurea Ridl. nothovar. purpurea. 3.1 Introduction 35 3.2 Materials and Methods 37 3.2.1 Study Area and Sample Collections 37

3.2.2 Genomic DNA Extraction 38 3.2.3 DNA Quality Assessment 41 3.2.4 PCR Amplification 42 3.2.4(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA) 42 3.2.4(b) trnK−matK Region (Chloroplast DNA) 43 3.2.5 Purification and DNA Sequencing 46 3.2.6 DNA Sequence Alignment 46 3.2.7 Cloning of Hybrid Amplicon 47 3.2.7(a) Ligation of DNA products into pGEM®-T Easy 47 Vector 3.2.7(b) Transformation of Escherichia coli Strain JM109 47 Competent Cells 3.2.7(c) Screening of Positive Clones and Amplification of 49 Plasmid 3.2.8 Molecular Phylogenetic Analysis 50 3.3 Results 50 3.3.1 Quantity and Quality of the Genomic DNA 50 3.3.2 PCR Amplification 50 3.3.2(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA) 50 3.3.3(b) trnK−matK Region (Chloroplast DNA) 52 3.3.3 Alignment of Sequences 52 3.3.3(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA) 52 3.3.3(a)(i) Plasmid Amplification of C. ×purpurea 52 nothovar. purpurea 3.3.3(a)(ii) Plasmid Sequencing Data and Comparison 55 with the Putative Parental Sequences 3.3.3(b) trnK−matK Region (Chloroplast DNA) 60 3.3.4 Phylogenetic Inferences 62 3.3.4(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA) 62 3.3.4(b) trnK−matK Region (Chloroplast DNA) 62 3.4 Discussion 65

3.4.1 ITS1, 5.8S and ITS2 Regions (Nuclear DNA) 65 3.4.2 trnK−matK Region (Chloroplast DNA) 68 3.5 Conclusion 70

CHAPTER FOUR: UTILIZING NEXT GENERATION SEQUENCING TO CHARACTERIZE MICROSATELLITE LOCI FOR CROSS SPECIES 72 AMPLIFICATION AND PARENTAGE ANALYSIS 4.1 Introduction 72 4.2 Materials and Methods 75 4.2.1 Sample Preparation and sequencing 75 4.2.2 Microsatellite Screening and Genotyping Test 77 4.2.3 Data Analysis 78 4.2.4 Cross Species Amplification and Parentage Analysis 79 4.3 Results 82 4.3.1 Analysis of 454 Sequences of Cryptocoryne cordata var. 82 cordata 4.3.2 Cross Species Amplification 86 4.3.3 Parentage Analysis 86 4.4 Discussion 96 4.4.1 Development of Microsatellite through Next Generation 96 Sequencing 4.4.2 Polymorphic Microsatellite Description 100 4.4.3 Cross Species Amplification Ability 101 4.4.4 Parentage Identification 102 4.5 Conclusion 106

CHAPTER FIVE: CLONAL DIVERSITY AND SPATIAL GENETIC STRUCTURE IN Cryptocoryne ×purpurea Ridl. 107 nothovar. purpurea AS DEFINED BY AFLP MARKERS 5.1 Introduction 107

5.2 Materials and Methods 109 5.2.1 Sample Collection 109 5.2.2 DNA Extraction and Quantification 109 5.2.3 DNA Restriction, Digestion and Ligation 109 5.2.4 Preselective Amplification 112 5.2.5 Selective Amplification 114 5.2.6 AFLP Data Scoring 116 5.2.7 Data Analysis 116 5.2.7(a) Clonal Structure and Genotypic Diversity 116 5.2.7(b) Spatial genetic Structure 117 5.3 Results 119 5.3.1 AFLP Profiling and Marker Polymorphism 119 5.3.2 Clonal Structure and Genotypic Diversity 119 5.3.3 Spatial Genetic Structure 127 5.4 Discussion 127 5.4.1 AFLP Marker Development 127 5.4.2 Clonal Structure and Genotypic Diversity 132 5.4.3 Spatial genetic Structure 137 5.5 Conclusion 140

CHAPTER SIX: CONCLUSION 142 REFERENCES 144 LIST OF PUBLICATIONS 174 LIST OF SEMINARS AND PRESENTATIONS 175

vii

LIST OF TABLES Page Table 2.1 The list of known natural hybrids in Cryptocoryne 6 Table 2.2 The summary of morphological characteristics of C. 13 ×purpurea nothovar. purpurea with the putative parents Table 3.1 Taxa, localities, number of samples, voucher numbers and list 39 of abbreviation for sampled Cryptocoryne specimens Table 3.2 The PCR reaction mixture amplification of ITS1, 5.8S and 44 ITS2 regions using primer ITS-1F and ITS-4R Table 3.3 Thermal cycle program for the amplification of ITS1, 5.8S 44 and ITS2 regions Table 3.4 The PCR reaction mixture amplification of trnK － matK 45 region Table 3.5 Thermal cycle program for the amplification of trnK－matK 45 region Table 3.6 Reagent and their concentration used for DNA ligation of ITS 48 DNA fragments into pGEM®-T easy vector Table 3.7 Variable nucleotide sites in ITS sequences comparison 57 between the clones and the putative parental species Table 3.8 Variable nucleotide sites in matK sequences comparison 61 between the hybrid and the putative parental species Table 4.1 The details of Cryptocoryne species used in cross species 80 microsatellite amplification study Table 4.2 The details of Cryptocoryne species used in parentage 81 analysis using microsatellite markers Table 4.3 Microsatellite compound motifs contained di-nucleotide, tri- 84 nucleotide and tetra-nucleotide repeat motif from microsatellite screening Table 4.4 Summary of the statistical evaluation of the primer designed 85 Table 4.5 Characteristics of 11 microsatellite loci isolated for 87 Cryptocoryne cordata var. cordata obtained from 30 individuals

viii

Table 4.6 Characterization of microsatellite loci isolated from C. 88 cordata var. cordata and cross species amplification with eleven others Cryptocoryne species in Peninsular Malaysia Table 4.7 Characterization of six microsatellite loci for parentage 90 identification Table 4.8 Allele sizes and frequencies at six microsatellite loci in five 92 Cryptocoryne species Table 5.1 The details of the C. ×purpurea nothovar. purpurea 110 populations examined for AFLP study Table 5.2 The sequences and stock preparation of adapters 113 Table 5.3 Primer combinations tested for AFLP analysis 115 Table 5.4 Primer combinations used for AFLP analysis 115 Table 5.5 Total number of AFLP loci examined using three primer 121 combinations as well as percentage of polymorphic loci per primer combination Table 5.6 Clonal diversity detected by Cryptocoryne ×purpurea 124 nothovar. purpurea populations Table 5.7 Molecular analysis of variance (AMOVA) comparing within 128 and among populations between regions of Cryptocoryne ×purpurea nothovar. purpurea Table 5.8 Nei’s unbiased genetic distance based on six populations 129

LIST OF FIGURES Page Figure 2.1 The three coding nrDNA repeat in plants. 18S, 5.8S and 26S 19 are nrRNA genes. ITS1 and ITS2 are internal transcribed spacer regions. Figure 2.2 Chloroplast genome map showing the two inverted repeats (IRa 22 and IRb) which separates the large single copy (LSC) from the small single copy (SSC). Figure 2.3 The matK gene is an protein-coding region between 5’ and 3’ 24 exons of trnK gene. Figure 2.4 Overview of the 454 sequencing technology. 29

Figure 2.5 Schematic representations of the steps in AFLP analysis. 34

Figure 3.1 Maximum likelihood phylogenetic tree based on ITS 63 sequences. Figure 3.2 Maximum likelihood phylogenetic tree based on matK 64 sequences. Figure 4.1 The four basic steps of microsatellite marker development via 76 high-throughput next generation DNA sequencing. Figure 4.2 Percentage of microsatellite motifs compound containing di- 84 nucleotide, tri-nucleotide and tetra-nucleotide repeat motifs. Figure 4.3 Genetic relationships among five species generated using 93 Neighbour joining (NJ) calculated from six microsatellite markers. Figure 4.4 Principal component analysis (PCA) based on six microsatellite 94 markers. Figure 4.5 Factorial correspondence analysis (FCA) based on multilocus 95 genotypes from five species derived from six microsatellite markers.

Figure 5.1 Totals for AFLP binary band patterns by Cryptocoryne 121 ×purpurea nothovar. purpurea populations. Figure 5.2 Genotype accumulation curve for 171 individuals ramets of 123 Cryptocoryne ×purpurea nothovar. purpurea genotyped over 63 AFLP loci. Figure 5.3 Pattern of multilocus genotype (MLG) based on Cryptocoryne 124 ×purpurea nothovar. purpurea populations. Figure 5.4 Percentage of molecular variation between Cryptocoryne 128 ×purpurea nothovar. purpurea populations. Figure 5.5 Principal component analysis from six Cryptocoryne ×purpurea 129 nothovar. purpurea populations Figure 5.6 Relationship between pairwise values of Dice genetic distances 130 and geographical distance of Cryptocoryne ×purpurea nothovar. purpurea populations.

LIST OF PLATES Page Plate 2.1 The images of Cryptocoryne ×purpurea Ridl. nothovar. 8 purpurea was published in Hooker’s Icones Plantarum in 1900. Plate 2.2 The morphological characteristics of Cryptocoryne ×purpurea 10 nothovar. purpurea. Plate 2.3 The differences among the limbs of the spathe of Cryptocoryne 12 ×purpurea Ridl. nothovar. purpurea colouration in different locations. Plate 3.1 Map showing the geographical distribution of Cryptocoryne 40 ×purpurea nothovar. purpurea and putative parents in Peninsular Malaysia and neighboring region. Plate 3.2 Genomic DNA extractions results on 0.8% (w/v) agarose gel. 51 Plate 3.3 The PCR amplification products on 2.0% (w/v) agarose gel for 51 ITS region. Plate 3.4 The PCR amplification products on 2.0% (w/v) agarose gel for 53 trnK−matK region using primers trnK-3914F and trnK-2R. Plate 3.5 The PCR amplification products on 2.0% (w/v) agarose gel for 53 trnK−matK region using primers matK-450F and matK-537R. Plate 3.6 The electropherogram of Cryptocoryne ×purpurea nothovar. 54 purpurea from ITS direct sequencing. Plate 3.7 The PCR amplification products on 2.0% (w/v) agarose gel of 54 ITS region cloning plasmids. Plate 3.8 The PCR amplification products of artificial recombinant on 56 2.0% (w/v) agarose gel of ITS region cloning plasmids. Plate 4.1 The PCR amplification products for all 11 polymorphic 85 microsatellite marker of Cryptocoryne cordata var. cordata. Plate 5.1 Map showing the details of the Cryptocoryne ×purpurea 111 nothovar. purpurea populations. Plate 5.2A The PCR amplification products after restriction and ligation. 120

xii

Plate 5.2B The PCR amplification products for preselective amplification. 120 Plate 5.3 The distribution genets found in Melaka region populations 125 based on sampled Cryptocoryne ×purpurea nothovar. purpurea ramets. Plate 5.4 The distribution genets found in Pahang region populations 126 based on Cryptocoryne ×purpurea nothovar. purpurea sampled ramets.

xiii

LIST OF ABBREVIATIONS

AFLP Amplified Fragment Length Polymorphism AMOVA Analysis of molecular variance cpDNA Chloroplast deoxyribonucleic acid CTAB hexadecyl-trimethylamonium bromide DNA Deoxyribonucleic acid dNTP Dinucleotide triphosphate EDTA Ethylenediamine tetra-acetic acid EtBr Ethidium bromide FCA Factorial correspondence analysis HCl Hydrochloric acid HWE Hardy-Weinberg Equilibrium IPTG Isopropyl β-D-1-thiogalactopyranoside ITS Internal Transcribe Spacer LB Luria-bertani NCBI National centre for biotechnology information NJ Neighbour joining nrDNA Nuclear ribosomal DNA PCA Principal component analysis PCR Polymerase chain reaction RAPD Random amplified polymorphic DNA RNA Ribonucleic acid RNase Ribonuclease enzyme SSR Simple sequence repeat TFPGA Tools for population genetic analysis

xiv

PENANDA DNA MOLEKUL DALAM PENGENALPASTIAN INDUK DAN STRUKTUR GENETIK KLONAL BAGI Cryptocoryne ×purpurea Ridl. nothovar. purpurea POPULASI HIBRID

ABSTRAK

Penghibridan semulajadi telah diyakini kerapkali berlaku pada Cryptocoryne

Wydler dan dianggap sebagai sumber kepada kerumitan taksonomi pada genus ini.

Penyelidikan ini melibatkan gabungan kajian daripada data jujukan DNA (kawasan tertranskripsi dalaman (ITS) DNA nuklear ribosom dan gen matK daripada DNA kloroplas) untuk mengenalpasti induk kepada hibrid putatif Cryptocoryne daripada

Semenanjung Malaysia. Berdasarkan kepada ciri-ciri morfologi tumbuhan ini dikenalpasti secara tentatif sebagai Cryptocoryne ×purpurea Ridl. nothovar. purpurea; tumbuhan steril yang telah lama dianggap sebagai hibrid, kemungkinan daripada dua spesies yang berkaitan; Cryptocoryne cordata Griff. var. cordata dan Cryptocoryne griffithii Schott. Status hibrid dan induk-induk ini dibuktikan secara bebas dengan kehadiran pada individu hibrid corak jujukan ITS daripada kedua-dua spesies induk ini.

Tumbuhan hibrid ini berkongsi persamaan jujukan matK daripada C. cordata var. cordata dan C. griffithii, menunjukkan kedua-dua spesies induk putatif ini telah menjadi induk betina. Penghibridan timbal balik di antara kedua-dua spesies ini dilihat sebagai simetri dan bukan satu arah. Kajian ini juga bertujuan untuk membangunkan penanda mikrosatelit menggunakan jujukan generasi (Roche 454 pyrosequencing) daripada DNA genomik C. cordata var. cordata. Sebelas lokus polimorfik baru telah berjaya dipencilkan dan kesemua lokus menyimpang daripada keseimbangan Hardy-Weinberg secara signifikan. Tiada alel nol dan tiada ketidakseimbangan untaian yang signifikan dikesan ke atas semua pasangan lokus. Amplifikasi silang spesies berbeza telah berjaya pada satu panel sebelas spesies Cryptocoryne. Kesamaan saiz alel yang tinggi di antara

C. ×purpurea nothovar. purpurea, C. cordata var. cordata dan C. griffithii telah menyokong idea bahawa C. cordata var. cordata dan C. griffithii merupakan induk kepada C. ×purpurea nothovar. purpurea. Kajian ini telah menyiasat enam populasi semulajadi C. ×purpurea nothovar. purpurea untuk memeriksa kepelbagaian klonal dan hubungan struktur genetik di antara populasi menggunakan analisis polimorfisme kepanjangan fragmen teramplifikasi (AFLP). Tahap kepelbagaian genetik klonal pada C.

×purpurea nothovar. purpurea adalah rendah kerana hadirnya kesterilan yang tinggi di dalam populasi disebabkan oleh asal usul hibrid. Walau bagaimanapun, kehadiran genotip yang berbeza pada sesetengah populasi memberi bukti terhadap kekerapan peristiwa pembentukan hibrid daripada populasi induk yang berbeza dan juga mutasi somatik. Analisis kluster mendedahkan dua kumpulan yang berbeza dengan majoriti variasi genetik tersebar di antara- berbanding di dalam populasi di antara wilayah dan menunjukkan kolerasi di antara jarak genetik dengan jarak geografi. Penemuan ini menunjukkan takson steril klonal ini boleh memelihara sejumlah variasi genetik.

xvi

MOLECULAR DNA MARKERS IN PARENTAGE IDENTIFICATION AND CLONAL GENETIC STRUCTURE OF Cryptocoryne ×purpurea Ridl. nothovar. purpurea HYBRID POPULATIONS

ABSTRACT

Natural hybridization has been confirmed to occur frequently in Cryptocoryne

Wydler and considered a source of taxonomic complexity in this genus. This research involved a combined study of DNA sequencing data (internal transcribed spacer (ITS) of nuclear ribosomal DNA and matK gene of chloroplast DNA) to identify the parentage of a putative Cryptocoryne hybrid from Peninsular Malaysia. Based on the morphological characters the plant was tentatively identified as Cryptocoryne ×purpurea Ridl. nothovar. purpurea; a sterile plant which has long been considered a hybrid, possibly from two related species; Cryptocoryne cordata Griff. var. cordata and Cryptocoryne griffithii Schott. The hybrid status and its putative parents was independently confirmed by the presence in hybrid individuals of an additive ITS sequence pattern from these two parental species. The hybrid plants shared the identical matK sequences from C. cordata var. cordata and C. griffithii, which indicated that both putative parental species had functioned as the maternal parent. Reciprocal hybridization between the two species seems to be symmetrical rather than unidirectional. This study also aimed at developing microsatellite markers using next generation sequencing (Roche 454 pyrosequencing) from the genomic DNA of C. cordata var. cordata. Eleven new polymorphic loci were successfully isolated and all loci departed significantly from Hardy-Weinberg

Equilibrium. No null alleles and no significant linkage disequilibrium were detected across any pairs of loci. Cross species amplification was successful across a panel of eleven Cryptocoryne species. The high similarities of allele sizes between C. ×purpurea nothovar. purpurea, C. cordata var. cordata and C. griffithii supported the idea that C.

xvii

cordata var. cordata and C. griffithii were the parents of C. ×purpurea nothovar. purpurea. This study investigated six natural populations of C. ×purpurea nothovar. purpurea to examine the clonal diversity and spatial genetic structure among populations using Amplified Fragment Length Polymorphism (AFLP) analysis. The level of clonal genetic diversity in C. ×purpurea nothovar. purpurea was low because of the apparent high sterility of the populations due to their hybrid origin. However, the occurrence of different genotypes in certain populations give an evidence of the frequency of hybrid formation events from different parental populations and also somatic mutations. Cluster analyses revealed two distinct groups with the majority of genetic variation distributed among- rather than within populations between regions and showed correlation between genetic distances with geographical distance. These ﬁndings demonstrate that this sterile clonal taxon can preserve substantial amounts of genetic variation.

xviii

CHAPTER ONE

GENERAL INTRODUCTION

Cryptocoryne Wydler is an aquatic plant genus belonging to the family Araceae commonly known as the Water Trumpet which refers to the spathe which is connate along its margin forming a water tight tube resembling a trumpet. Cryptocoryne is popular as ornamental plants for tropical aquaria and aquascaping in Europe since the

1950s (Jacobsen, 1976) due to the unique leaves and the flowers of various species that come in different attractive colours. The genus is native to South East Asia extending from Mainland India and Indo-China through Indonesia to Papua New Guinea.

Cryptocoryne can be viewed as consisting of numerous populations in different river systems, and natural hybridization has been suggested to frequently occur (Jacobsen et al., 2002; Ipor et al., 2005; Othman et al., 2009; Ipor et al., 2015; Jacobsen et al., 2016).

These events therefore would be a driving evolutionary force continuously producing new genotypes to be dispersed all over the ever changing river systems. To date, more than 25 Cryptocoryne natural hybrids have been discovered (Jacobsen et al., 2015).

This thesis will only concentrate on one natural hybrid which can be found in

Peninsular Malaysia namely Cryptocoryne ×purpurea Ridl. nothovar. purpurea. The early identification of this hybrid was based on pollen fertility and morphological character analysis. Jacobsen (1977) observed that the pollen of C. ×purpurea nothovar. purpurea is completely sterile and has been suggested to have C. cordata Griff. var. cordata and C. griffithii Schott as parents owing to observable morphological characters

(broad collar zone – C. cordata, and purple, rough limb of spathe – C. griffithii).

Cytological analysis indicated that C. ×purpurea nothovar. purpurea shared the same

diploid chromosome numbers 2n = 34 with C. cordata var. cordata and C. griffithii

(Jacobsen, 1977). The putative hybrid always shows intermediate morphological features of their parents. However, this character coherence is not always a reliable indicator of hybrid identity (Rieseberg and Ellstrand, 1993; Rieseberg et al., 1999) because morphological features are often under the influence of environmental conditions and thus can be unreliable and prone to misleading interpretation (Hegarty and Hiscock, 2005).

In recent years, use of molecular markers has been proven to be a good method in parentage identification and can provide considerable insight into plant hybridization

(López-Caamal and Tovar-Sánchez, 2014). To date no DNA sequence and characterized molecular markers have been validated for hybrid identification in Cryptocoryne.

Therefore, the first objective in this study is to determine the origin of C. ×purpurea nothovar. purpurea using a combination of DNA sequences namely from the internal transcribed spacer (ITS) of nuclear ribosomal DNA region and matK gene of chloroplast

DNA region. Next, microsatellite DNA markers were developed through Next generation Sequencing (NGS) origin and validate the markers through cross species amplification and then utilised to verify the hybrid origin.

Cryptocoryne ×purpurea nothovar. purpurea propagates only via vegetative propagation through rhizomes known as clonal reproduction. Clonal plants resulting from the replication of an individual by vegetative growth resulting in genetically identical individuals. Therefore all clonally reproducing organisms should have low amounts of genetic diversity. However, most studies have shown the opposite trends where sterile clonal plants tend to show higher genetic diversity than sexually reproducing plants (Ally et al., 2008; Gross et al., 2012; Bobiwash et al., 2013).

Therefore, another objective in this study is to define the possible clonal structure and genotypic diversity among C. ×purpurea nothovar. purpurea clones. The AFLP marker

(Amplified Fragment Length Polymorphism) was used to achieve this objective since this marker can produce many polymorphic loci at a lower cost which is ideal for genet discrimination. The information generated in this study is expected give valuable genetic information for understanding the extent of hybridization in Cryptocoryne.

Thus the specific objectives in this study are:-

1. To verify the hybrid origin of C. ×purpurea nothovar. purpurea using a biparental

inherited nuclear marker namely the internal transcribed spacer (ITS) region of

nuclear ribosomal DNA (nrDNA).

2. To identify the maternal parent of C. ×purpurea nothovar. purpurea using the

chloroplast matK gene.

3. To develop polymorphic microsatellite DNA marker through Next Generation

Sequencing (NGS) and utilize the markers for C. ×purpurea nothovar. purpurea

parentage identification.

4. To define the possible clonal structure and genetic diversity in C. ×purpurea

nothovar. purpurea clones using AFLP (Amplified Fragment Length

Polymorphism) marker.

CHAPTER TWO

LITERATURE REVIEW

2.1 The Genus Cryptocoryne

Cryptocoryne Wydler is an aquatic plant genus, belonging to the aroid family

(Araceae). Cryptocoryne are amphibious herbs and have proliferously dividing subterranean rhizomes, thereby enabling them to form large stands in streams and rivers

(Jacobsen et al., 2015). The first Cryptocoryne species was described in 1779 as Arum spirale by Retzius. The genus was described and established by Wydler in 1830

(Othman et al., 2009). Lagenandra is another genus closely related to the genus

Cryptocoryne (Cusimano et al., 2011). These two genus can be easily differentiated since the leaves of Cryptocoryne exhibit convolute vernation while Lagenandra exhibit involute vernation. The genus name Cryptocoryne is derived from crypto (Latin), meaning hidden, and koryne (Greek), meaning club or the spadix that is totally hidden inside the kettle (Othman et al., 2009).

The ‘Water Trumpet’ is another popular name of Cryptocoryne which refers to the spathe is connate along its margin forming a water tight tube resembling a trumpet.

This genus is locally known as Hati-hati Paya or Hati-hati Air or Keladi Paya

(Peninsular Malaysia), Kiambang Batu (Malays-Sarawak), Kelatai (Iban), and Tropong

Ajer (Banjarmasin, Kalimantan) (Fung, 2008; Ipor et al., 2010). The genus is native to tropical regions of Asia extending from India in the west to the Philippines in the east, onwards to Malaysia, through Indonesia to Papua New Guinea (Othman et al., 2009).

Cryptocoryne is widely used as an aquarium plant since 1910s (Jacobsen, 1982) due to appearance of their attractive colour and shapes of features including leaves, spathes and

limb of the spathes (Othman et al., 2009). They are also heavily exploited for aquarium plants and apparently fetch high prices in the international aquarium market (Mansor,

1991; Othman et al., 2009).

2.1.1 Natural hybridization in the Genus Cryptocoryne

To date, more than 25% of the about 91 named and unnamed Cryptocoryne have proven to be of hybrid origin (54 species, an additional 12 varieties and 25 natural hybrids) (Jacobsen et al., 2015). Natural hybridization has been considered to represent an important factor influencing the high diversity of the genus Cryptocoryne. This genus may frequently be observed in co-existence with two or more close related species inhabiting the same or adjacent streams and these phenomena may lead to hybridization and producing new hybrids within the same area (Jacobsen et al., 2002; Ipor et al., 2005;

Othman et al., 2009; Ipor et al., 2015). The pollinating flies are a major factor in exchanging genes stochastically within operation distance of the flies (Jacobsen et al.,

2015).

Most recently, the genus is made up of 57 species, 17 varieties and 7 named hybrids with several unnamed hybrids (Table 2.1) (Jacobsen et al., 2016). The uncertain status and tendency of Cryptocoryne to hybridise naturally may create more complexity in terms of taxonomic studies and classification. Recently a new hybrid was describe from Sarawak viz. Cryptocoryne ×batangkayanensis 2n = 85, postulated to be a hybrid between C. cordata Griff. var. grabowskii (Engl.) N. Jacobsen and C. ferruginea Engl. var. ferruginea (Ipor et al., 2015). Earlier, Ipor et al. (2008) assigned this hybrid with uncertain status under C. ×purpurea nothovar. borneoensis N. Jacobsen et al. Another hybrid, C. ×timahensis Bastmeijer (2n = 34) with completely sterile pollen can be found in Bukit Timah, Singapore and perhaps in the southern region of Malay Peninsula. It

Table 2.1 The list of known natural hybrids in Cryptocoryne

No Name Putative parent Chromosome no Origin References 1 Cryptocoryne ×purpurea Ridl. C. cordata Griff. var. cordata × C. griffithii 2n = 34 Peninsular Malaysia (Jacobsen, 1982) nothovar. purpurea Schott 2 C. ×decus-silvae De Wit (incl. C. C. cordata var. cordata × C. nurii var. nurii unconfirmed Peninsular Malaysia (Jacobsen et al., jacobsenii De Wit) unpublished) 3 C. ×zukalii Rataj C. cordata var. cordata × C. minima Ridl. 2n = 34 Peninsular Malaysia (Jacobsen et al., unpublished) 4 C. ×purpurea nothovar. C. cordata var. grabowskii N. Jacobsen (as 2n = 51 Kalimantan, (Jacobsen et al., 2002) borneoensis N. Jacobsen et al. C. zonata De Wit) × C. griffithii Indonesia 5 C. ×batangkayanensis Ipor et al. C. cordata var. grabowskii × C. ferruginea 2n = 85 Sarawak, Malaysia (Ipor et al., 2015) Engl. var. ferruginea 6 C. ×timahensis Bastm. C. cordata var. cordata × C. nurii Furt. var. 2n = 34 Bukit Timah, (Bastmeijer and Kiew, nurii (today assumed to be a C. nurii Furt. (originally reported Singapore 2001) var. nurii × C. schulzei De Wit) as 2n = 54) 7 C. ×willisii Reitz C. beckettii Trim/C. walkeri Schott × C. 2n = 28 Sri Lanka (Jacobsen, 1981;1987) parva De Wit 8 C. beckettii hybrid - unnamed C. beckettii × C. walkeri ( as C. lutea 2n = 28 Sri Lanka (Jacobsen, 1981;1987) Alston) 9 C. crispatula Engl. hybrid - C. crispatula var. crispatula × var. 2n = 36 Phu Khieo, Thailand (Jacobsen, 1980) unnamed balansae (Gagnep,) N. Jacobsen 10 C. ferruginea var. sekadauensis C. ferruginea var. sekadauensis × C. fusca 2n = 34 Kalimantan, (Bastmeijer et al., 2013) Bastm. et al. hybrid - unnamed De Wit Indonesia 11 C. crispatula hybrids - unnamed C. crispatula var. crispatula × other 2n = 36 Cheng Khan, (Idei, unpublished in Ipor varieties Thailand et al., 2015) 12 C. crispatula hybrids - unnamed C. crispatula var. crispatula × other 2n = 36 Don Khon, Lao P. D. (Idei, unpublished in Ipor varieties R. Thailand et al., 2015; Jacobsen et al., 2016) 13 C. crispatula hybrids - unnamed C. crispatula var. crispatula × C. 2n = 36 Don Khon, Lao P. D. (Idei unpublished in Ipor mekongensis Idei et al. R. Thailand et al., 2015; Jacobsen et al., 2016) 6

was assumed that C. cordata Griff. var. cordata and C. nurii Furt. var. nurii are the putative parents (Bastmeijer and Kiew, 2001). However, Othman et al. (2009) later suggested to be C. nurii var. nurii and C. schulzei De Wit as the possible parents.

One of the natural Cryptocoryne hybrids that can be found in Peninsular

Malaysia is C. ×purpurea Ridl. nothovar. purpurea. From early description by Ridley, much confusion arose because of wrong interpretation about C. ×purpurea nothovar. purpurea identity. In 1892, H.N. Ridley was the first to collect this plant at Kota Tinggi

(Johor) (Othman et al., 2007; 2009). This plant was then cultivated at the Botanical

Garden in Singapore and sent live to Kew Gardens in 1898 (Othman et al., 2009). Later on, it flowered in 1899 and plate, no. 7719, was published in Hooker’s Icones Plantarum in 1900 under the name C. griffithii (Plate 2.1) (Bastmeijer, 2008). This was corrected shortly afterwards by Ridley (1904) who pointed out that the plate no. 7719 was actually a new species, namely C. ×purpurea nothovar. purpurea. Engler (1920) also mentioned this inconsistency. However, the name accompanying plate 7719 continued to mislead people and was thus up to the 1960s and 1970s incorrectly attached to C. ×purpurea nothovar. purpurea in cultivation in Europe (Othman et al., 2009).

The identification of this hybrid was based on pollen analysis by Jacobsen (1982) who found that the pollen of C. ×purpurea nothovar. purpurea is completely sterile and suggested C. cordata var. cordata and C. griffithii Schott as the parents owing to observable morphological characters (broad collar zone – C. cordata var. cordata, and purple, rough limb of spathe – C. griffithii). De Wit (1990) gave a comprehensive explanation of the differences between C. griffithii, C. cordata var. cordata and C.

×purpurea nothovar. purpurea. Cytological analysis indicated that C. ×purpurea nothovar. purpurea shared the same diploid chromosome numbers 2n = 34 with

Plate 2.1 The images of Cryptocoryne ×purpurea Ridl. nothovar. purpurea was published in Hooker’s Icones Plantarum in 1900 under the name C. griffithii (Hooker, 1900). (Image adapted from Bastmeijer, 2008).

C. cordata var. cordata and C. griffithii (Jacobsen, 1977; 1982). Moreover, C. nurii var. nurii and C. schulzei also became the suspected parents to C. ×purpurea nothovar. purpurea based on certain similarities in morphology characters.

2.1.2 Morphological Characteristics and Habitat

The shape of the leaves and the shape and colours of the limb of the spathe are important diagnostic taxonomic characters in Cryptocoryne (Bastmeijer, 2015). The C.

×purpurea nothovar. purpurea leaf blades are ovate with cuneate to cordate base (Plate

2.2). The upper surface of the leaves is dark green to brownish and purplish mottled. The lower surface is often pale green, purplish mottled; upper and/or lower surface sometimes with a silvery luster. However, the morphological variation of the characters of Cryptocoryne leaves may to a large extent be due to the environment, especially to submerged and emergent habitat and also depending on the amount of light received

(Othman et al., 2009). The C. ×purpurea nothovar. purpurea limb present at the upper most part of the spathe is ovate-acuminate, rugose, dull to bright red colour, absent collar, broad collar zone, red to reddish or more whitish to yellowish towards the opening (Othman et al., 2009). The lower parts of the spathe are tubular with the edges joined forming the kettle. A kettle contains the male and female flowers. Normally, a single whorl of female flowers of the C. ×purpurea nothovar. purpurea has 5 to 7 carpels with broadly rounded stigma and emarginated at the base of the spadix (Othman et al., 2009). In the middle of these female flowers, there is a single whorl of abortive, modified flowers known as the olfactory bodies. There is a long sterile zone above of the olfactory bodies, which is topped by a cluster of male flowers (Othman et al., 2009).

Plate 2.2 The morphological characteristics of Cryptocoryne ×purpurea nothovar. purpurea: 1 and 2. The whole plant with rhizomes; 3. The open kettle; 4. Female flower with olfactory bodies; 5, 6, 7, and 8. Male flower (De Wit, 1990).

Currently C. ×purpurea nothovar. purpurea have been found at eight documented locations in Peninsular Malaysia, three of those locations within Tasik Bera i.e., Pos Iskandar, Kg. Jelawat and Paya Kelantong (in the state of Pahang), two locations in the state of Johor (Kg. Sri Lukut, Sg. Sedili Kechil) and three locations in

Melaka namely Kg. Pulau Semut, Padang Tembak and Sungai Udang. Other localities in southern Peninsular Malaysia no doubt also exist, but have not seen them. Interestingly, there are some variations in the colouration and also in the surface structure of the limb of the spathe in C. ×purpurea nothovar. purpurea from different localities. For example, the colour of the limb of the spathe of C. ×purpurea nothovar. purpurea found in

Melaka is dull brownish yellow and this is slightly different to the hybrid found in Johor which have brighter red and C. ×purpurea nothovar. purpurea found in Pahang is dark red. Plate 2.3 shows the differences among the limbs of the spathe colouration in different locations. These differences may indicate that the hybrid has arisen several times independently from different parental populations and maybe from segregation in the F1 offspring. When comparing with the putative parents namely C. cordata var. cordata, C. griffithii, C. nurii var. nurii and C. schulzei (Plate 2.3) (Table 2.2), there are several similarities and differences in morphological characters in C. ×purpurea nothovar. purpurea.

The hybrid grows in different habitat types. The vast submerged stands of C.

×purpurea nothovar. purpurea were found in larger black water swamp in Tasik Bera,

Pahang. The substratum of the black water swamp in the Tasik Bera is very acidic (pH=

4.2-5.2), consisting of decomposed leaves and branches from the swamp forest and sometimes grow together with Barclaya motleyi Hooker f. In Sg. Sedili Kechil, Johor, the plants were found in the freshwater tidal zone, while in Kg. Sri Lukut, Johor, the hybrid plants grow on muddy bottom in small forests streams. In Melaka, the hybrid

A B C

D E F G

Plate 2.3 Upper; The differences among the limbs A of the spathe of Cryptocoryne ×purpurea Ridl. nothovar. purpurea colouration in different locations. A: Padang Tembak, Melaka, B: Kg. Sri Lukut, Johor, C: Pos Iskandar, Pahang. Lower; The images of the putative parental species of the hybrid C. ×purpurea nothovar. purpurea. D: C. cordata Griff. var. cordata, E: C. griffithii Schott, F: C. nurii Furtado var. nurii and G: C. schulzei De Wit. Image A, B, C, E and G: Rosazlina Rusly. Image D and F: Niels Jacobsen.

Table 2.2 The summary of morphological characteristics of C. ×purpurea nothovar. purpurea with the putative parents (Othman et al., 2009)

Species Morphological characteristics

Leaves Spathe tube Limb

C. ×purpurea Ridl. Blade ovate to cordate base. 3-11cm long. 8-17 cm long; whitish on 2-5 cm long, ovate-acuminate, nothovar. purpurea Upper surface dark green to brownish, the outside and inside. rugose; dull to bright red; collar purplish mottled. Lower surface often pale absent; collar zone broad; red to green. reddish. C. cordata Griff. var. Blade narrowly ovate to cordate; sometimes 10-30 cm long; whitish on 3-5 cm long; ovate with a shorter cordata up to 20 cm long. Smooth upper surface the outside; sometimes or longer point; yellow; collar with green or green-brownish or brownish brownish greenish zone broad. markings. Lower surface paler with reddish towards the apex. veins. C. griffithii Schott Blade ovate to rounded; 3-9 cm long. Upper 5-10 cm long; upper part 3-5 cm long; red to black purple; surface mostly purple green; lower surface purplish on the outside; ovate; vertical to reflexed with paler or more clearly reddish. lower part whitish. short point, surface rough with rounded protuberances; collar prominent. C. nurii Furtado var. Blade stiff, ovate to narrowly ovate to 5-20 cm long; the upper 3-5 cm long; cordate; usually nurii elliptic; dark olive green, distinctly darker, part brownish tinged on deep red to dark purple, with red lines, lighter mottled. Lower surface pale the outside. conspicuous, large, irregular, green. branched protuberances; collar narrow. C. schulzei De Wit Blade lanceolate to ovate to obovate with a 4-12 cm long; whitish on 1-2 cm long, recurved; narrow to cuneate to cordate base. Leaves brownish to the outside, sometimes a tail somewhat irregular rugose,

purplish; upper surface striped with purplish-brownish shaded, yellow, vertical opening; collar prominent, purplish markings, lower surface upper part greenish. broad somewhat folded, black paler with reddish. red-purplish.

grows in the muddy swamp area at small forests streams and there are also in stands in the pond exposed to the sun.

2.2 What is Plant Hybridization?

Hybridization is the process of interbreeding between individuals of different species (interspecific hybridization) or genetically divergent individuals from the same species (intraspecific hybridization) (Rieseberg and Wendel, 1993). The broader definition considers hybridization as the cross fertilization of individuals from populations that are distinguishable on the basis of one or more heritable characters

(Harrison, 1990; Arnold, 1997). Hybridization may cause interactions involving a wide range of types and levels of genetic divergence between the parental forms (Abbott et al., 2013). Offspring produced by hybridization may be fertile, partially fertile, or sterile

(Siegel, 2014). The hybridization may result in the duplication of a hybrid’s chromosome complement (allopolyploid) or without a change in chromosome number by the stabilisation of a fertile hybrid segregant (homoploid hybrid) (Rieseberg, 1997;

Soltis et al., 2010; Abbott et al., 2013).

Polyploidy is of major significance in plant evolution with the latest estimates indicating that all extant flowering plants have polyploidy in their ancestry (Wood et al.,

2009; Jiao et al., 2011). Two types of polyploids are normally recognized: autopolyploids in which chromosome sets are derived from the same species and allopolyploids that contain chromosome sets from different species as a consequence of interspecific hybridization. Allopolyploidy is considered to be more common in nature than autopolyploidy (Soltis et al., 2007). Additionally, after polyploidy has occurred, species tend to become reduced in their chromosome number and become homoploid

over evolutionary time (Wisseman, 2007).

2.3 Effect of Plant Hybridization

Natural hybridization is a frequent evolutionary phenomenon in flowering plants

(Rieseberg and Wendel, 1993; Whitney et al., 2010). Hybridization in plants has been found to be most common in species which have certain specific life-history characteristics, including perennial habit, outcrossing breeding systems and asexual reproduction (Wisseman, 2007). Hybridization plays an important evolutionary role since it may lead to a number of consequences that may affect either positively

(formation of new species, increase of the intraspecific genetic diversity of the participating populations) as well as negatively (species extinction through genetic assimilation, increase generation of highly invasive genotypes).

The hybridization events depend on the genetic structure of the participating species, the environmental conditions (i.e., degree of disturbance) and the local abundance of the parental species (Levin and Francisco-Ortega, 1996; Arnold, 2006).

The studies of hybrid zones are important in order to clarify the steps in speciation that yield to complete reproductive isolation between taxa (i.e., reinforcement). The first generation hybrids (F1) exhibit low pollen fertility and it has been proposed as a mechanism of reinforcement of the reproductive barriers between the participating species due to selection against hybrid genotypes (Marshall et al., 2002; Campbell et al.,

2003). The fitness of hybrid individuals appears to be dependent on the environment - high degree of disturbance such as crops, floods, along roadsides and volcanic activity

(Levin and Francisco-Ortega 1996; Lamont et al., 2003; Tucker and Behm, 2011).

Although reinforcement is an important consequence of natural hybridization, it is not the only one; introgression and genetic assimilation may also occur. Introgression is the

movement of genes between species; once F1 individuals are formed, they may act as a bridge whereby alleles may cross from one species to another through repeated backcrossing with genetically distinguishable populations (Rieseberg and Carney, 1998).

If the frequency of the parental species is similar, introgression may lead to an increase of the intraspecific genetic diversity of the parental species, which may enable them to colonize new areas (Caraway et al., 2001). However, when the frequency of the parental species differ, the introgression towards the less abundant species may lead to the loss of its genetic integrity, leading to its extinction through the process known as ‘genetic assimilation’ (Levin and Francisco-Ortega, 1996; Meyerson et al., 2010) and result in the formation of invasive species (Petit et al., 2004; Schierenbeck and Ellstrand, 2009).

2.4 Plant Hybrid Identification

Because of the importance of plant hybridization effects on the taxonomic and genetics, it is of great importance to make a correct identification of hybrid individuals.

Some of the tools employed for hybrid recognition and their pattern of expression in hybrid individuals were morphological characters and secondary metabolite expression as well as chromosome number and DNA fingerprinting techniques. While morphological characters were thoroughly employed during the last century as the main marker for hybrid recognition, nowadays it is known that their pattern of inheritance is considered complex and usually unpredictable (Rieseberg et al., 1999; Hardig et al.,

2000; Ritz and Wissemann, 2003). Although many hybrids have intermediate morphological features between their parents, character coherence is not always a reliable indicator of hybrid identity. It is because the morphological expression in hybrids is highly dependent on the environment (Kiær et al., 2007; Hegarthy et al.,

2008). Also, morphological intermediacy may originate by processes other than

hybridization such as certain species retain plesiomorphic character states of their ancestral population, conducing to an erroneous interpretation of hybridization

(Rieseberg, 1995; Judd et al., 2002; Arnold, 2006).

Plant secondary metabolites have a more reliable inheritance mechanism than morphological characters (Rieseberg and Ellstrand, 1993; Orians, 2000; Cheng et al.,

2011). However, obtaining the chemical profile of hybrids is time consuming, expensive and technically difficult. Their low polymorphism and complex inheritance make them also unreliable tools for hybrid recognition in the absence of other markers. Also, it is a poor predictor of hybrid ancestry in later generation hybrids (Cheng et al., 2011).

Both chemical and morphological markers are phenotypic traits, their expression in hybrids is highly dependent on the environment, reducing their utility to detect hybridization under natural conditions (Mallet, 2005). The chromosome number of putative hybrids may provide information about the hybrid origin of individuals when these exhibit allopolyploidy (Lawton-Rauh, 2003; Strong and Ayres, 2013). However, sometimes hybrids exhibit a homoploid condition compared to its parental species

(Gross and Rieseberg, 2005; Mallet, 2007; Abbott et al., 2010). Due to the complex pattern of expression of phenotypic data and the unreliable data provided by chromosome number counts in putative hybrids, DNA markers appear as a much better option for hybrid recognition due to their high availability in the genome, selectively neutral, strictly under Mendelian segregation ratios and the ease with which large amounts of data may be obtained (Rieseberg and Wendel, 1993; Travis et al., 2010;

López-Caamal and Tovar- Sánchez, 2014).

2.4.1 Nuclear Ribosomal ITS Region

The plant nuclear genome (nDNA) is the largest genome in the plant cell. Plant nuclear genome size is constant in a species and can vary from 60 Mbp to 150 000 Mbp, a remarkable difference of 2300 times (Bennett and Leitch, 2011). The large genome size variation is because of multiplication of parts of, or complete, nuclear genomes

(Heslop-Harrison and Schmidt, 2012; Schranz et al., 2012). The nuclear DNA contains coding and large number of regulatory sequences for genes and repetitive DNA (Kellogg and Bennetzen, 2004). Of all regions within nuclear DNA, the nuclear ribosomal DNA

(nrDNA) is most widely used to infer plant phylogeny (Álvarez and Wendel, 2003).

The nrDNA in plants comprises three coding regions (18S, 5.8S and 26S regions), which are separated by two transcriptional regions - internal transcribed spacers (ITS1 and ITS2) (White et al., 1990) (Figure 2.1). The ITS region is phylogenetically informative at low taxonomic levels and is now extensively employed worldwide (Poczai and Hyvönen, 2010; Tripathi et al., 2013). ITS1 and ITS2 regions are inherently rich in G+C content and these core parts are evolutionary conserved within green plants (Hershkovitz and Lewis, 1996; Hershkovitz and Zimmer, 1996). In addition, the ITS2 region is a favourite marker in taxonomy because of the fast-evolving segment of the nuclear rRNA operon (Coleman and Mai, 1997; Joseph et al., 1999,

Coleman, 2007) and 40% of ITS2 is found to be con served across all angiosperms studied (Hershkovitz and Zimmer, 1996). The nuclear ribosomal internal transcribed spacer regions (nrITS) is part of the ribosomal multigene family that includes hundreds to thousands of copies at one or more chromosomal loci and often used to obtain phylogenetic information due to the level of variation both within and among genera.

Figure 2.1 The three coding nrDNA repeat in plants. 18S, 5.8S and 26S are nrRNA genes. ITS1 and ITS2 are internal transcribed spacer regions. Modified from Soltis and Soltis (1998).

The nrITS sequence has also been proven as potentially effective in detecting the hybrid origin of plants or species, as well as in identifying reticulate evolution by

showing additive peaks on a sequencing electropherogram which contains evidence of hybridization when a species appears to have inherited repeat types from two parental species (Baldwin, 1992; Baldwin, 1993; Baldwin et al., 1995; Widmer and Baltisberger,

1999). Since the hybrids originate by joining of genomes from two different species, detection of parental genome in the putative hybrid taxa can be a direct evidence of a hybrid. The tandem repeats in nrITS are ideally suited for studying hybridization events because co-occurrence of parental nrITS types in a hybrid may be indicative of a recent hybrid origin (Koch et al., 2003) as concerted evolution usually leads to the rapid homogenization of divergent parental ribotypes (Wendel et al., 1995; Page and Holmes,

1998; Graur and Li, 2000). In the absence of sexual reproduction, concerted evolutionary homogenization of sequences by inter chromosomal crossing-over or gene conversion during chromosome pairing at meiosis would not be expected (Krieber and

Rose, 1986; Elder and Turner, 1995; Li, 1997). Consequently, hybrids reproducing strictly vegetatively should retain copies of both divergent sequences for prolonged periods. In such instances, isolation of individual DNA sequences by molecular cloning can reveal the paternal origin of a hybridization event when sequences matching each parental species are recovered (Rossetto, 2005; Du et al., 2009; Zalewska-Gałosz et al.,

2014). In recent years nrITS have been extensively used to investigate plant hybridization. Because of biparental inheritance of these markers, recent hybrids initially possess both divergent parental genotypes, as evidenced by DNA sequence polymorphisms (Zha et al., 2008; Les et al., 2009; Høibová et al., 2011; Kokubugata et al., 2011; Zalewska-Gałosz et al., 2014).

2.4.2 Chloroplast DNA Region; matK

The angiosperm chloroplast genomes are double-stranded molecules, varying little in size, structure, and gene content, ranging from 120 to 200 kilobases (kb) (Soltis and Soltis, 1998). Chloroplast genomes contain a large 20 - 30 kb inverted repeat (IRA and IRB), which divides the remainder of the genome into two regions, one large single copy (LSC) and one small single copy (SSC) region (Figure 2.2) (Olmstead and Palmer,

1994).

Most of the genes within the chloroplast genome code for photosynthetic proteins, while the remainder are transfer RNA or ribosomal RNA genes and conserved

ORFs (open reading frame) or potential protein-coding genes (Ravi et al., 2008).

Wakasugi et al. (1998) constructed the updated gene map from tobacco (Nicotiana tabacum L.) which includes 105 different genes. There are many genes and intergenic spacers in the chloroplast genome that are widespread and sufficiently large (> 1 kb) to be generally useful in comparative sequencing studies and are highly conserved such as matK, rbcL, ndhF, atpB, rpH6, psaB, trnL-trnF and rbcL-accD (Oxelman et al., 1999;

Chiang and Schaal, 2000; Soltis et al., 2000; Yuji et al., 2005; Heinze, 2007; Miz et al.,

2008). These genes are suitable for a wide range of taxonomic levels and encompass a wide range of evolutionary rates (Olmstead and Palmer, 1994). The inheritance of the chloroplast DNA has historically been thought to be exclusively from the maternal parent in angiosperms (Corriveau and Coleman, 1988; Birky, 1995) and can infer a hybrid origin if a species appears to have inherited cpDNA from more than one maternal source (Clegg et al., 1993) due to chloroplast transfer from one species to another (Soltis and Soltis, 1998).

Figure 2.2 Chloroplast genome map showing the two inverted repeats (IRa and IRb) which separates the large single copy (LSC) from the small single copy (SSC). Modified from Soltis and Soltis (1998).

The Maturase K (matK) gene was first identified by Sugita et al. (1985) from N. tabacum L. when they sequenced the trnK gene encoding the tRNA-lysine (UUU) of the chloroplast. The matK gene, formerly known as orfK, is approximately 1500 base pairs long (bp) in most angiosperms and corresponding to around 500 amino acids for the translated protein product (Hilu et al., 1999). The trnK-matK gene is located within an intron of approximately 2600 bp positioned between the 5’ and 3’ exons of trnK gene, in the LSC section adjacent to the inverted repeat (Figure 2.3) (Sugita et al., 1985; Hilu and

Liang, 1997; Soltis and Soltis, 1998). This gene encodes a maturase-like polypeptide which might be involved in splicing Group II introns from RNA transcripts (Neuhaus and Link, 1987; Wolfe et al., 1992). The matK gene has also been effective in addressing many systematic questions in various species that are important in molecular biology and evolution. Plant systematic studies have shown that the matK gene are to be fast-evolving due to the fact that it has a high rate of nucleotide substitutions and more variable sites compared to other genes within cpDNA (Olmstead and Palmer, 1994;

Johnson and Soltis, 1994; Soltis and Soltis, 1998). Olmstead and Palmer (1994) reported that out of 20 genes used in molecular systematics, the matK had the highest nucleotide substitution rate. The rate of nucleotide substitution in matK is three times faster than that of the large subunit of RubisCO (rbcL) in Saxifragaceae and six fold higher for the amino acid substitution rate (Olmstead and Palmer, 1994), denoting it as a fast- or rapidly-evolving gene. The resolution achieved with sequences of matK is a relatively high rate of substitution in the conserved regions of the gene when comparing with eleven other genes combined representing multiple families and nine partial sequences representing monocot families from GenBank (Hilu and Liang, 1997; Hilu et al., 2003).

Based upon the study of species representing different major plant groups, the

2600 bp 1550 bp

trnK 5’ matK trnK 3’

Figure 2.3 The matK gene is an approximately 1.5 kb protein-coding region between two highly conserved 5’ and 3’ exons of trnK gene. Modified from Johnson and Soltis (1994).

conservative 3’ region of the matK gene was found to contain more phylogenetic information than the high variable 5’ region (Hilu and Liang, 1997). This high nucleotide and amino acid substitution rate provides high phylogenetic signal for resolving evolutionary relationships among plants at the family level and below as well as by the presence of indels across its open reading frame (Johnson and Soltis, 1994;

Johnson and Soltis, 1995; Hilu and Liang, 1997; Hayashi and Kawano, 2000; Hilu et al.,

2003; Cameron, 2005). Nucleotide substitution rates are not evenly distributed across the matK ORF, but instead matK has regions displaying high mutation rates (Hilu and

Liang, 1997). In terms of amplification, a sequencing success of 85-88 % was found for the matK gene region through the use of up to 10 combinations of primers or with more sophisticated chemistry at the amplification stage (Piredda, 2011). Given a matK adequate rate of variation, easy amplification and alignment, a portion of the plastid matK gene has been identified as a universal DNA barcode for flowering plants (CBOL

Plant Working Group, 2009). The matK gene has been used effectively in addressing parentage determination in plants and has been used to identify the maternal origin of the hybrid in the families Araceae (Ting et al., 2012), Asteraceae (Kim et al., 2008),

Orchidaceae (Khew and Chia, 2011), Primulaceae (Zhu et al., 2009), Ranunculaceae

(Yuan et al., 2010; Zalewska-Gałosz et al., 2014) and Ruppiaceae (Ito et al., 2010).

2.4.3 Microsatellite Markers

Recently, due to several technical advances made in molecular genetics, genetic variation can be measured at the DNA level by developing different molecular markers.

Among the available molecular markers, microsatellites have gained considerable importance in plant genetics. The genome of higher organisms contains three types of simple repetitive DNA sequences (satellite DNAs, minisatellites, and microsatellites),

organized in clusters of differing sizes (Armour, 1999; Hancock, 1999). Microsatellites was first described in the late 1980s by Litt and Luty (1989). Microsatellites are known by other names such as short tandem repeats (STRs) (Edwards et al., 1991), simple sequence repeats (SSRs) (Jacob et al., 1991) or simple sequence length polymorphism

(SSLPs) (Rassman et al., 1991). Microsatellites are tandem repeats of very short 1–6 base pairs (bp) patterns which are not repeated many times at a particular locus but are distributed relatively evenly in all prokaryotic and eukaryotic genomes (Tautz and Renz,

1984).

Microsatellite markers have gained considerable importance in plant genetics because they are known to be of a codominant in nature, locus specific, have a high reproducibility, relatively abundant, multi-allelic and are useful in detecting high levels of allelic diversity and substantial polymorphisms (Powell et al., 1996). High degree of allelic variation revealed by microsatellite markers results from variation in number of repeat-motifs at a locus caused by replication slippage and/or unequal crossing-over during meiosis (Weber, 1990; Tachida and Iizuka, 1992; Tautz and Schlötterer, 1994).

This variation in number of repeat motifs among different individuals can easily be detected by PCR (Kalia et al., 2011). The variability in length polymorphism of microsatellite loci is associated with its mutation rate, resulting in the increase or decrease in repeat number (Ellegren, 2004). Recombination by unequal crossing over

(UCO) or gene conversion is the primary mechanism reputed to underlie the change in length in microsatellite DNA (Chistiakov, 2005) and also responsible for expansion and contraction of repeat length (Richard and Paques, 2000). In UCO, the two chromosome strands are misaligned during crossing-over phase, which results in a deletion in one

DNA molecule and an insertion in the other (Hancock, 1999). A second model that has been cited to explain the rise of microsatellite polymorphism is slipped-strand

mispairing, SSM (also referred as DNA polymerase slippage) (Hancock, 1999; Zane et al., 2002). During DNA replication, slipping of DNA polymerase III on the DNA template strand at the repeat region can cause the newly created DNA strand to expand or contract in the repeat region if the mismatches are not repaired (Strand et al., 1993; Li et al., 2002; Ellegren, 2004). The interaction of slippage and recombination could also affect microsatellite stability (Li et al., 2002).

In microsatellite loci characterization, several alternative strategies have been devised in order to reduce the time invested in microsatellite isolation and to significantly increase yield of microsatellite loci. Until recently, the most common methods involve microsatellite loci isolation was using labeled probes to identify microsatellite-containing sequences from either bulk genomic DNA or libraries of genomic DNA enriched for microsatellite motives by the Sanger method. Two methods have been developed for microsatellite loci isolation from genomic libraries: (i) selective hybridization (Kandpal et al., 1994; Hamilton et al., 1999) and (ii) primer extension enrichment (Paetkau, 1999). The isolation of microsatellite loci by different methods has been reviewed in detail by Zane et al. (2002). Despite extensive protocol optimization

(Estoup and Turgeon, 1996; Glenn, 1996; Zane et al., 2002; Glenn and Schable, 2005), the development of microsatellites using this approach remains labor intensive and costly. The reduction in cost and labor potentially enables researchers to develop larger number of microsatellites for use in studying non-model plants (Csencsics et al., 2010).

A more recent strategy for the isolation of microsatellite loci involves large sequence databases is Next Generation Sequencing (NGS). The NGS do not require the cloning steps and this approach is more rapid, efficient and available for non-model organisms compared to Sanger sequencing (Zane et al., 2002; Brautigam and Gowik,

2010; Kalia et al., 2011). Various commercially NGS platforms are available such as

Genome Sequencer FLX (454 GS-FLX) (Roche Applied Science, Penzburg, Germany),

Genome Analyzer SOLEXA (Illumina, San Diego, CA), Ion Torrent System (Life

Technologies) and Sequencing by Oligo Ligation and Detection (SOLiD) (Applied

Bioystems, Foster City, CA) (Hudson, 2008). Pyrosequencing technology was originally developed by Pal Nyren in the 1990s (Nyren, 2006). 454 Life Sciences (Roche

Diagnostics, Indianapolis, Indiana, USA) first optimized the pyrosequencing method, and subsequently made it the first NGS platform available as a commercial product

(Margulies et al., 2005; Shendure and Ji, 2008).

Two such methods are now commercialized, sequencing by synthesis (Mardis,

2008) and pyrosequencing with emulsion PCR (emPCR) (Schuster, 2008). Sequencing by synthesis with the SOLEXA (Illumina) or SOLiD (Applied Bioystems ) platforms, gives short 30-40 bp read lengths that are most useful for organisms with a genome sequence, due to the problems associated with de novo assembly of short reads into longer sequences. In contrast, pyrosequencing methods such as 454 give 200-500 base read lengths, depending on the chemistry and equipment, and thus are useful not only for organisms with a known genome sequence, but more importantly ones that lack a genome sequence. This method is sufficient for isolating microsatellites loci together with enough flanking sequence for primer design (Allentoft et al., 2009). The general overview of the 454 sequencing technology is illustrated in Figure 2.4.

Microsatellites have been successfully utilized in a variety of plant research projects due to their hypervariable nature and extensive genome coverage (Agarwal et al., 2008; Parida et al., 2009). The relationship between genetic diversity assessment and phylogenetic construction will provide important information for choosing parental lines

Figure 2.4 Overview of the 454 sequencing technology. Pooled amplicons are clonally amplified in droplet emulsions. Isolated DNA-carrying beads are loaded into individual wells on a PicoTiter™ plate and surrounded by enzyme beads. Nucleotides are flowed one at a time over the plate and template-dependent incorporation releases pyrophosphate, which is converted to light through an enzymatic process. The light signals, which are proportional to the number of incorporated nucleotides in a given flow, are represented in flowgrams that are analyzed and a nucleotide sequence is determined for each read with the GS Amplicon Variant Analyzer software. Adapted from Kozal (2011).

for breeding programs, classification of plant germplasm accessions, and further curation and acquisition of new plant germplasm accessions (Wang et al.,

2009).Comparative genetics has revealed that gene content and order are highly conserved among closely related species (Kalia et al., 2011). Thus, microsatellite primer pairs designed on the basis of the sequences obtained from one species could be used to detect microsatellites in related species and even in other genera of the same family

(Ellis and Burke, 2007; Varshney et al., 2007). The transfer rate will correspond to the phylogenetic distances and extent of sequence conservation between the species under study. The ability to effectively transfer microsatellite markers across the taxa, which is commonly known as ‘transferability’ or cross species amplification has been successfully demonstrated in many species including Athyrium (Woodhead et al., 2003);

Arachis (Gimenes et al., 2007); Ficus (Nazareno et al., 2009) and amplification across genera;- Quercus (Aldrich et al., 2003) and Rosaceae (Lopes et al., 2006). Microsatellite markers have been also efficiently employed in determination of hybrids and their putative parents (Gomez et al., 2008; Pollegioni et al., 2009) where the codominant nature of microsatellites play a key role and allows the allelic contribution of each parent to be detected in sexual and somatic hybrids (Powell et al., 1995).

2.5 Clonal Assignment

Many aquatic plant species including Cryptocoryne are characterized by the ability to reproduce both sexually and clonally. Since the hybrid pollen in C. ×purpurea nothovar. purpurea are completely sterile, the hybrid propagates only via vegetative propagation through rhizomes. Clonality is the replication of an individual by vegetative growth resulting in genetically identical, morphologically complete and potentially individuals (Harper, 1977). Clonal growth is an ancestral morphological trait in the plant

kingdom (Tiffney and Niklas, 1985) and remains a significant component of the life history of many extant Angiosperms (Van Groenendael et al., 1996). In fact, in a taxonomical survey of plant form and function, Klimeš et al. (1997) reported that about

70% of plant species exhibit clonal growth. Clonal growth gives a strong impact in ecological, demographic, and genetic consequences (Harper, 1977).

However, the clonal structure which is still poorly understood (Wilson et al.,

2005). To gain a comprehensive understanding of the consequences, it is necessary to describe the extent of clonality within natural populations. Several ways can be implemented to identify genet in populations, such as excavation (Araki and Ohara,

2008), morphology (De Witte and Stöcklin, 2010), compatibility tests in self- incompatible species (Stoeckel et al., 2006) and molecular markers (Gross et al., 2012;

Vallejo-Marin and Lye, 2013). Compared to other methods, molecular markers are the most efficient and definitive method of genet identification.

2.5.1 Amplified Fragment Length Polymorphism (AFLP)

The Amplified Fragment Length Polymorphism (AFLP) technique was developed by Vos et al. (1995) and has become one of the most reliable, most informative and cost-effective fingerprinting methods. The AFLP technique, originally known as selective restriction fragment amplification (SRFA) (Zabeau and Vos, 1993) which produce hundreds of informative polymerase chain reaction (PCR)–based genetic markers to provide a wide multi-locus screening of any genome (Vos et al., 1995). The first report of the use of AFLPs in trees was by Cervera et al. (1996), who used this marker system to genetically map a disease resistance gene in Populus. Since then the technique has been widely employed in molecular and population genetic studies. AFLP fingerprinting has been of great interest in population genetics because of several

advantageous characteristics. First, it is the method of choice for studies of non-model organisms (Vos et al., 1995; Blears et al., 1998). Second, large numbers (up to several hundreds) of AFLP markers can be typed quickly and at low cost, offering fine-scale genome coverage (Blears et al., 1998). Third, AFLP markers usually reveal a greater amount of diversity compared to microsatellite and random amplified polymorphic

DNAs (RAPDs) (Archak et al., 2003). Finally, AFLP fingerprint is highly reproducible and reliable (Bagley et al., 2001).

AFLP is based on a selectively amplifying subset of restriction fragments from a complex mixture of DNA fragments obtained after digestion of genomic DNA with restriction endonucleases (Mueller and Wolfenbarger, 1999). In details the AFLP protocol can be divided into the following steps: (1) DNA digestion with different restriction enzymes with a combination of a rare cutter for example EcoRI or PstI and a frequent cutter such as MseI or TaqI restriction enzymes (2) ligation of double-stranded adapters to the ends of the restriction fragments to provide known sequences which act as the priming sites for PCR amplification, (3) DNA pre-selective amplification of a ligated product directed by primers with a single selective nucleotide which is complementary to the adapter and restriction site sequences (to ensure there is a reasonable amount of template for the next PCR step), and (4) DNA selective amplification of subsets of restriction fragments is performed using selective AFLP primers (up to three base pairs extension). Selective nucleotides serve to reduce the number of amplified fragments so that not too many bands are amplified causing smears or high levels of band comigration during electrophoresis but sufficient enough to reveal polymorphism (Vos et al., 1995). AFLP fragments are then visualized by automatic

AFLP product resolution systems such as the ABI prism which requires that one of the

primers be labeled with a florescent dye to be detected by the sequencer. A summary of

AFLP steps is shown in Figure 2.5.

Polymorphisms are revealed by the presence of a fragment of a given size in some AFLP profiles versus its absence from other profiles. Three kinds of AFLP polymorphisms can then be observed; (1) the gain or loss of a restriction site; (2) insertion, deletions or reversions within an amplified fragment; (3) non-complementary nucleotide sequences adjacent to the restriction site (Weising et al., 2005). AFLP has proven to be a powerful marker technique and also useful to identify individual genotypes at the landscape, in a species described to be highly clonal (Kreivi et al.,

2005; Kameyama and Ohara, 2006; Lambertini et al., 2010; Nomura et al., 2015) and therefore genotypes are expected to be closely related

Genomic double-stranded DNA 5’------GAATTC ------TTAA------3’ 3’------CTTAAG------AATT------5’

Digest DNA into Fragments

EcoRI site AATTC------T MseI site G------AAT

EcoRI ligation adapter MseI ligation adapter GACTGCGTACC TA CTCAGGACTCATC CTGACGCATGG TTAA GAGTCCTGAGTAG

PCR preselective amplification With 2 user-selected nucleotides

Pre-amplification Pre-amplification with EcoRI primer+A with MseI primer+C 5’-GACTGCGTACCAATTC A------GTTACTCAGGACTCATC-3’ 3’-CTGACGCATGGTTAAGT------C AATGAGTCCTGAGTAG-5’

PCR selective amplification with 4 more user-selected nucleotides

Selective amplification Selective amplification EcoRI primer+ACT MseI primer+CAT 5’-GACTGCGTACCAATTC ACT------ATGTTACTCAGGACTCATC-3’ 3’-CTGACGCATGGTTAAG TGA------TAC AATGAGTCCTGAGTAG-5’

Separation of DNA amplified fragments by capillary electrophoresis

Figure 2.5 Schematic representations of the steps in AFLP analysis (adapted from Saunders et al., 2001).

CHAPTER THREE

MOLECULAR EVIDENCE FOR THE HYBRID ORIGIN OF Cryptocoryne ×purpurea Ridl. nothovar. purpurea

3.1 Introduction

Natural hybridization from interspecific mating is common in flowering plants.

Hybridization has been demonstrated to be an important force in forming new plant species (Gross and Rieseberg, 2005; Soltis and Soltis, 2009) and it plays a crucial role in plant evolution and diversification (Arnold, 2006; Wiesseman, 2007; Abbot et al., 2013).

Well-known examples of plant hybrid includes sunflower, Helianthus (Rieseberg et al.,

1991) and pines, Pinus (Ma et al., 2006; Ren et al., 2012). Cryptocoryne species are no exception in terms of hybridization. The plant genus Cryptocoryne can be viewed as consisting of numerous populations in different river systems, and hybridization would be a driving evolutionary force continuously producing new genotypes to be dispersed all over the ever changing river systems (Ipor et al., 2005; Othman et al., 2009; Ipor et al., 2015).

Natural hybridizations within Cryptocoryne have been reported from Sri Lanka

(Jacobsen, 1981, 1987), Thailand (Jacobsen, 1980), Singapore (Bastmeijer and Kiew,

2001), Kalimantan (Jacobsen et al., 2002; Bastmeijer et al., 2013) and recently discovered from Sarawak (Ipor et al., 2015). Cryptocoryne ×purpurea Ridl. nothovar. purpurea is a natural hybrid, found in Peninsular Malaysia. According to Othman et al.

(2009), the hybrid was first collected from Kota Tinggi, Johor, Malaysia by Ridley in

1892. Furtado and Mori (1982) misidentified this species as C. griffithii due to the similarity of the leaves and the absence of a flower in the examined specimen. Jacobsen

(1982) was the first to document the notion that C. ×purpurea nothovar. purpurea was

an interspecific hybrid between C. cordata var. cordata and C. griffithii based on the coherence of morphological characters (broad collar zone – C. cordata, and purple, rough spathe limb – C. griffithii). Jacobsen (1982) also reported that the pollen of C.

×purpurea nothovar. purpurea is completely sterile. De Wit (1990) gave a comprehensive explanation on the differences between C. griffithii, C. cordata var. cordata and C. ×purpurea nothovar. purpurea. Although many hybrids have intermediate morphological features between their parents, character coherence is not always a reliable indicator of hybrid identity (Rieseberg and Ellstrand, 1993; Rieseberg et al., 1999; Judd et al., 2002). In addition, it is often difficult to clearly ascertain hybrid origin by assessing morphological characters alone because morphological features are often under the influence of environmental conditions and thus can be unreliable and misleading (Hegarty and Hiscock, 2005; Mallet, 2005). Therefore, a putative hybrid requires further investigation.

In recent years, use of molecular markers has provided considerable insight into plant hybridization (reviewed by Hegarty and Hiscock, 2005; López-Caamal and Tovar-

Sánchez, 2014). Molecular techniques provide a powerful means of identifying hybrid genotypes and investigating historical as well as current levels of gene flow (reviewed by Ellstrand, 2014). Combined nuclear and plastid DNA markers provide potentially complementary evidence about hybrids allowing different questions to be investigated.

Firstly, the nuclear ribosomal DNA (nrDNA) internal transcribed spacer (ITS) region can be used to verify the hybrid origin of these intermediate individuals and interspecific divergence between the putative parental species. This nuclear fragment is inherited from both parents and the hybrids usually show additive patterns of both parental species

(Mak et al., 2008; Du et al., 2009; Shin et al., 2014; Zalewska-Gałosz et al., 2014).

Second, the chloroplast matK gene could be applied due to their success in evaluate

interspecific variation in most angiosperms and can be used to identify the maternal origin of the hybrid (Zhu et al., 2009; Dkhar et al., 2011; Khew and Chia, 2011;

Terzioğlu et al., 2012). By integrating data from ITS and matK regions in this study, the specific aim to address the following questions:-

1. Do molecular data support the hypothesis that C. ×purpurea nothovar. purpurea

is an interspecific hybrid between C. cordata var. cordata and C. griffithii?

2. Between C. cordata var. cordata and C. griffithii, which species serve as pollen

donor/recipient in hybridization events?

3. What are the directions of hybridization between the two species, if natural

hybridization did occur?

3.2 Materials and Methods

3.2.1 Study Area and Sample Collections

Individuals of the C. ×purpurea nothovar. purpurea were collected from eight different locations in south Peninsular Malaysia in order to detect potential intraspecific sequence polymorphism. From each location, the samples were collected with two individuals at least 5 m apart in an attempt to cover more genotypes. The presumed parental species C. cordata var. cordata (five accessions) and C. griffithii (five accessions) of different geographic origins were included in the molecular analyses for comparison. In the present study, selected Cryptocoryne species were further examined;

C. nurii var. nurii and C. schulzei, to clarify the hybrid status of C. ×purpurea nothovar. purpurea and its parentage. Voucher specimens have been deposited in the Herbarium

Unit, Universiti Sains Malaysia (Penang, Malaysia) and the Botanical Museum,

Copenhagen (C) (Natural History Museum of Denmark). All accessions are summarized in Table 3.1 and Plate 3.1. Young leaves are cleaned with sterile distilled water before being dried using silica gel. Later these dried leaves were stored at -20°C before use for

DNA extraction.

3.2.2 Genomic DNA Extraction

Total genomic DNA was extracted from the young plant leaves using cetyl trimethylammonium bromide (CTAB) method (Doyle and Doyle, 1990) with some modifications. 20-30 mg of dried leaves were flash frozen with liquid nitrogen before being grounded into fine powder using mortar and pestle. The powder was transferred into a 2.0 ml microcentrifuge tube and 1.0 ml of extraction buffer [2% hexadecyl- trimethylamonium bromide (CTAB); 100 mM trizma hydrochloride (Tris-HCl) pH 8.0;

20 mM ethylenediamine tetra-acetic acid (EDTA) pH 8.0; 1.4 M sodium chloride

(NaCl); 1% polyvinyl-pyrrolidone (PVP); 0.2% 2-mercaptoethanol] was then added and mixed to produce a smooth green paste. The mixture was incubated at 55°C in a water bath for 1 hour for further lysis with inversion every 10 minutes for homogenization.

The tube was allowed to cool for 5 minutes in room temperature before adding 400 μL of chloroform-isoamyl alcohol in a ratio 24:1. The solution was mixed thoroughly to a single phase by gently inverting the tube. The microcentrifuge tube was centrifuged at

10,000 rpm for 8 minutes before transferring the uppermost aqueous layer into a new sterile 2.0 mL microcentrifuge tube. The uppermost layer containing DNA-CTAB complex was then added with 200 μL of 10% CTAB buffer and 400 μL of chloroform- isoamyl alcohol in a 24:1 ratio. The solution was once again mixed thoroughly to a single phase by gently inverting the tube, followed by centrifugation at 10,000 rpm for 8 minutes. Approximately 550 μL of the uppermost aqueous layer was transferred to a 1.5

Table 3.1 Taxa, localities, number of samples, voucher numbers and list of abbreviation for sampled Cryptocoryne specimens

Taxon Locality Number Voucher Year of List of of number collection abbreviation samples C. ×purpurea Ridl. nothovar. purpurea Kg Pulau Semut, Masjid Tanah, Melaka §1 2 RR 11-06 2011 MT Padang Tembak, Masjid Tanah, Melaka §1 2 RR 12-01 2012 PT Sungai Udang Recreational Forest, Melaka §1 2 RR 12-02 2012 SU Pos Iskandar, Tasik Bera, Pahang §1 2 RR 13-07 2013 PI Kg. Jelawat, Tasik Bera, Pahang §1 2 RR 13-08 2013 KJ Paya Kelantong, Tasik Bera, Pahang §1 2 RR 13-09 2013 PK Sg. Sedili Kechil, Kota Tinggi, Johor §1 2 RR 11-10 2011 SED Kg. Sri Lukut, Kahang, Johor §1 2 RR 12-04 2012 SL C. cordata Griff. var. cordata Gunung Arong, Mersing, Johor §1 2 RR 12-05 2012 GA Panti Bird Sanctuary, Kota Tinggi, Johor §1 2 RR 11-07 2011 PAN Muadzam Shah, Pahang §1 2 RR 11-24 2011 MU Sg. Tembangau, Tasik Bera, Pahang §1 2 RR 10-03 2010 ST Bukit Sedanan, Masjid Tanah, Melaka §1 2 RR 11-03 2011 BS C. griffithii Schott Felda Nitar, Mersing, Johor §1 2 RR 15-01 2015 GF Kulai, Johor §1 1 NJM 01-3 2001 KUL Bintan §2 1 NJI 01-14 2004 BIN Singapore Botanical Garden §3 1 NJS 04-21 2004 BOT Singapore (Oriental Aquarium) §3 1 NJS 01-16 2001 SIN C. nurii Furtado var. nurii Kahang-Jemaluang, Mersing, Johor §1 2 RR 11-16 2011 NKJ Sungai Kahang, Johor §1 2 RR 15-03 2015 NSK C. schulzei De Wit Hutan Lipur Panti, Kota Tinggi, Johor §1 2 RR 11-21 2011 SPAN Kahang-Jemaluang, Mersing, Johor §1 2 RR 11-17 2011 SKJ §1 Malaysia; §2 Indonesia; §3 Singapore

AA Tasik Bera, Pahang BA B Muadzam Shah, Pahang

Gunung Arong, Johor BukitBukit Sedanan, Sedanan, Melaka Melaka B Gunung Arong, Johor Bukit Sedanan, Melaka B C FeldaFelda Nitar,Nitar, JohorJohor Masjid Tanah, Melaka A Kahang-Jemaluang, Johor Masjid Tanah, Melaka AAA A CE D AA Kg. Sri Lukut, Johor D Sungai Kahang, Johor E B Panti, Johor A Sg.Sg. Sedili Sedili Kechil, Kechil, Johor Johor Kulai,Kulai,Kulai, JohorJohor Johor C

CCC Singapore CC Bintan

Plate 3.1 Map showing the geographical distribution of Cryptocoryne ×purpurea nothovar. purpurea and putative parents in Peninsular Malaysia and neighboring region. Key A: C. ×purpurea nothovar. purpurea, B: C. cordata var. cordata, C: C. griffithii, D: C. nurii var. nurii and E: C. schulzei.

mL microcentrifuge tube. 200 μL of CTAB precipitation buffer [1% CTAB (w/v); 50 mM Tris-HCl pH 8.0; 10 mM EDTA pH 8.0] and 400 μL of ice-cold propan-2-ol was added to the aqueous layer and was then mixed by inverting the microcentrifuge tube to a single phase solution to precipitate the DNA. The sample was left to stand overnight in

4°C and later was centrifuged at 12,000 rpm for 35 minutes. The supernatant was discarded and the pellet that contained DNA was washed with 600 μL wash buffer (76% ethanol; 2.5 M sodium acetate (NaAc), pH 5.0) for 1 hour at room temperature. The tube was then centrifuged at 10,000 rpm for 1 minute and the supernatant was discarded. The pellet was then washed with 300 μL second wash buffer (76% ethanol; 1 M ammonium acetate (NH4Ac)) for 1 minute and followed by centrifugation at 10,000 rpm for 1 minute. The supernatant was discarded, and the pellet was left to dry at room temperature for about 3 hours in a clean area to avoid contamination. The dried DNA was then reconstituted with 50 μL Tris EDTA (TE) buffer and left to completely solubilize overnight at 4°C.

3.2.3 DNA Quality Assessment

The quantity and quality of genomic DNA were assessed using agarose gel electrophoresis and visualized using The NanoDrop™ 1000 Spectrophotometer (Thermo

Scientific). The 0.8% (w/v) agarose gel was prepared by dissolving 0.8 g of agarose powder (1st Base) in 100 mL of 0.5 X Tris-Borate-EDTA (TBE) buffer (Biotechnology

Grade, BST Techlab) and heated in the microwave oven for 5 minutes until it was totally dissolved. The agarose solution was left to cool to 50°C before 1.0 μL RedSafe™ was added to stain the nucleic acids. It was later poured into a gel-running tray and allowed to be completely solidified. Approximately 1.0 μL of glycerol loading dye [0.25 M

EDTA, 0.1% (w/v) sodium dodecyl sulfate (SDS), 0.01% (w/v) bromophenol blue and

50% glycerol] was mixed with 1.0 μL of each DNA sample and loaded individually into the wells of agarose gel. The size of the DNA fragments was determined using λ

DNA/HindIII Marker (Fermentas). Electrophoresis was carried out using MJ-105

SHORTER MINI Horizontal Gel Electrophoresis Apparatus (Major Science) at 90 V

(BIO-RAD PowerPac Basic TM) for 1.0-1.5 hours in 0.5 X TBE buffer. The image was visualized with UV light on the UV transilluminator (BIO-RAD) and photographed using electrophoresis documentation and analysis system Image Lab™ Software,

Version 5.0. For NanoDrop™ 1000 spectrophotometer reading, the absorbances were at

260 nm and 280 nm. The reading ratio at 260 nm and 280 nm (OD260/OD280) provides an estimation of the quality of DNA with respect to contaminants that absorb UV, such as protein. Pure DNA has an OD260/OD280 ratio of 1.8－2.0.

3.2.4 PCR Amplification

3.2.4(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA)

The amplification reaction for ITS1, 5.8S and ITS2 regions were performed using universal ITS-1F (5’－TCCGTAGGTGAACCTGCGG－3’) and ITS-4R primers

(5’ － TCCTCCGCTTATTGATATGC － 3’) developed by White et al. (1990). The amplification of ITS region required the additives such as bovine serum albumin (BSA) and dimethyl sulfoxide (DMSO) in order to get rid of the misamplification of ITS regions of other organisms. The PCR amplification for all primer pairs ware performed in 25 μL reaction volume containing 1X Magnesium Free Green GoTaq® Flexi Buffer

(Promega), 0.2 mM dNTPs, 2.5 U of GoTaq Flexi DNA polymerase (Promega), 2.0 mM

MgCl2, 1.1 mg/mL of BSA, 11% of DMSO, a primer concentration of 0.2 μM for each of forward and reverse primer, approximately 20 ng of template DNA and sterile distilled water. The contents of PCR mixture for the amplification of ITS region were

summarized in Table 3.2. Polymerase chain reaction (PCR) was performed on MyCycler

Thermal Cycler (Biorad, USA). PCR amplification conditions were as follows: an initial pre-denaturation step at 94°C for 3 minutes, followed by 35 cycles of 1 minute at

94°C, 1 minute at 51°C, and 1 minute at 72°C, with a final primer extension step of 7 minutes at 72°C. The thermal cycle programs were shown in Table 3.3.

3.2.4(b) trnK−matK Region (Chloroplast DNA)

The trnK−matK region, including the 5’ portion of the trnK intron, matK gene and 3’ portion of the trnK intron was amplified as a single fragment by using primers trnK-3914F (5’－TGGGTTGCTAACTCAATGG－3’) (Johnson and Soltis, 1994) and trnK-2R (5’－AACTAGTCGGATGGAGTAG－3’）(Steele and Vilgalys, 1994). The

PCR amplification for all primer pairs ware performed in 25 μL reaction volume containing 1 X Magnesium Free Green GoTaq® Flexi Buffer (Promega), 0.2 mM dNTPs, 2.5 U of GoTaq Flexi DNA polymerase (Promega), 2.0 mM MgCl2, 0.2 mg/mL of BSA, a primer concentration of 0.20 μM for each of forward and reverse primer, approximately 20 ng of template DNA and sterile distilled water. The contents of the

PCR mixture for the amplification of trnK-matK region are summarized in Table 3.4.

PCR amplification conditions for trnK-matK region were as follows (Table 3.5): an ini tial pre-denaturation step at 94°C for 3 minutes, followed by 35 cycles of 1 minute at

94°C, 1 minute at 51°C and 1 minute at 72°C, with a final primer extension step of 5 minutes at 72°C.

Table 3.2 The PCR reaction mixture amplification of ITS1, 5.8S and ITS2 regions using primer ITS-1F and ITS-4R

Reagents Final Volume concentration (µL) 10 X Green GoTaq® Flexi buffer (Promega) 1 X 2.5 10 mM dNTP mix 0.2 mM 0.5 25 mM Magnesium chloride (MgCl2) 2.0 mM 2.0 10 µM ITS-1F 0.2 µM 0.5 10 µM ITS-4R 0.2 µM 0.5 10 mg/mL BSA 1.1 mg/mL 2.75 100% DMSO 11% 2.75 250 ng DNA template 20 ng 2.0 Double sterile water - 11.25 5 U/µL GoTaq® Flexi DNA polymerase (Promega) 2.5 U/µL 0.25 Total 25.0

Table 3.3 Thermal cycle program for the amplification of ITS1, 5.8S and ITS2 regions

Steps Temp (oC) Time (minute) Cycle Initial denaturation 94.0 3 1 Denaturation 94.0 1 Annealing 51.0 1 35 Extension 72.0 1 Final extension 72.0 7 1

Table 3.4 The PCR reaction mixture amplification of trnK－matK region

Reagents Final Volume concentration (µL) 10 X Green GoTaq® Flexi buffer (Promega) 1 X 2.5 10 mM dNTP mix 0.2 mM 0.5 25 mM Magnesium chloride (MgCl2) 2.0 mM 2.0 10 µM trnK-3914F 0.2 µM 0.5 10 µM trnK-2R 0.2 µM 0.5 10 mg/mL BSA 0.2 mg/mL 2.75 250 ng DNA template 20 ng 2.0 Double sterile water - 14.0 5 U/µL GoTaq® Flexi DNA polymerase (Promega) 2.5 U/µL 0.25 Total 25.0

Table 3.5 Thermal cycle program for the amplification of trnK－matK region

Steps Temp (oC) Time (minute) Cycle Initial denaturation 94.0 3 1 Denaturation 94.0 1 Annealing 51.0 1 35 Extension 72.0 1 Final extension 72.0 5 1

3.2.5 Purification and DNA Sequencing

The PCR products were purified using Wizard ® SV Gel and PCR Clean-Up

System (Promega) as described by the manufacturer. Direct dideoxy sequencing of purified DNAs was performed using automated ABI 3100 DNA automated sequencer at

First BASE Laboratories Sdn Bhd, Selangor, Malaysia with two sequencing primers

(ITS-1F and ITS-4R) for ITS region. Direct sequencing of purified matK gene DNAs was performed with four sequencing primers including trnK-3914F and trnK-2R of

Johnson and Soltis (1994) and two newly designed primers; matK-450F (5’-

AGGGCAGAGTAGAGATGGATG-3’) and matK-537R (5’-TATCAGAATCCGGCA

-AATCG-3’). Using the amplified trnK-3914F and trnK-2R gene as a template, the newly primers were designed using PRIMER 3 version 0.4.0 (Rozen and Skaletsky,

2000).

3.2.6 DNA Sequence Alignment

All the sequences obtained were assessed using BLAST search in National

Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov /BLAST) in order to ensure all are Cryptocoryne sequences. Sequences were assembled and aligned using (MEGA) 6.0 (Tamura et al., 2013). The multiple alignments of sequences were initially conducted using Clustal W in MEGA 6.0. The alignments were then adjusted manually based on consensus sequences from forward and reverse sequencing directions. Sequences with high noise were checked for a second time by eye using the chromatogram of the sequences. All nucleotide sequences obtained in this study were submitted and deposited in GenBank nucleotide database.

3.2.7 Cloning of Hybrid Amplicon

Cryptocoryne ×purpurea nothovar. purpurea samples resulted in ambiguous ITS sequences but with composed of superimposed peaks and overlapping ribotype sequences in several sites. ITS regions obtained from sixteen samples of C. ×purpurea nothovar. purpurea were cloned to ensure representative amplification of the parental copies. Cloning was performed using pGEM-T Easy-cloning Vector Kit (PROMEGA) following the manufacturer’s instructions.

3.2.7(a) Ligation of DNA Products into pGEM®-T Easy Vector

The pGEM®-T Easy Vector and Control Insert DNA tube was briefly centrifuged to collect contents at the bottom of the tube. Ligation reactions were prepared as described in Table 3.6. The reactions were mixed by pipetting and incubated for 1 hour at room temperature (20 – 25°C). Subsequently, the reactions were incubated overnight at 4°C to obtain the maximum number of transformants.

3.2.7(b) Transformation of Escherichia coli Strain JM109 Competent Cells

Escherichia coli strain JM109 competent cells (Brown, 1991) were used for transformation. For this, 10 mL of Luria–Bertani (LB) broth [preparation of LB broth:

10 g of tryptone casein peptone, 5 g of yeast extract, 5 g of NaCl, topped up with 1 L of sterile distilled water and adjusted pH to 7.0 with sodium hydroxide (NaOH)] was pre pared. The tubes containing the ligation reactions were centrifuged to collect contents at the bottom of the tube. Two µL of each ligation reaction was transferred into a sterile 1.5 mL microcentrifuge tube placed on ice. The competent cells were placed in an ice bath until just thawed for 5 minutes. Fifty µL of competent cells were added to each tube and the tubes were gently flicked to mix and placed on ice for 20minutes. Subsequently, the

Table 3.6 Reagent and their concentration used for DNA ligation of ITS DNA fragments into pGEM®-T easy vector

Quantity (µL) Reagent Sample Positive Negative Control Control 2 X Rapid Ligation Buffer, T4 DNA Ligase 5 5 5 pGEM®-T Easy Vector (50 ng) 1 1 1 Purified PCR product 3 - - Control Insert DNA - 2 - T4 DNA Ligase (3 U/µL) 1 1 1 Deionized water - 1 3 Total volume 10 10 10

cells were heat-shocked for 45-50 seconds in a water bath at exactly 42°C, and the tubes immediately returned to ice for 2 minutes. Then, 950 µL of super optimal broth with catabolite repression (SOC) medium (room temperature) was added to the ligation reaction transformations and incubated at 37°C for 1.5 hours with shaking at 150 rpm.

Subsequently, 100 µL of aliquots were spread on LB plates [preparation of LB plates: 15 g agar was added to 1 L of LB broth, autoclaved, the medium was allowed to cool to

50°C, added in 49mpicillin to a final concentration of 100 μg/mL, 30-35 mL of medium was poured into 85 mm Petri dishes, left at room temperature to harden and stored at

4°C], 100 µL of 100 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Promega)

[preparation of 0.1 M IPTG: 1.2 g IPTG, added with sterile distilled water to a final volume of 50 mL and stored at 4°C] and 20 µL of 50 mg/mL X-gal (Promega) for selection of transformed bacteria. Finally, the plates were incubated at 37°C overnight

(~16 hours) with inverted position.

3.2.7(c) Screening of Positive Clones and Amplification of Plasmid

Three clones per each amplification product were picked randomly as a template, and ITS inserts have been re-amplified and sequenced using the original ITS primer profile as previously describe in 3.2.4.1 section. The 1:1 mixture of C. cordata var. cordata (GA) and C. griffithii (KUL) DNA as template were also tested to determine whether artificial recombinants will be produced under standard PCR conditions using same ITS primers. The sequences were verified and aligned using the same method as described in section 3.2.5 and 3.2.6.

3.2.8 Molecular Phylogenetic Analysis

Maximum likelihood (ML) inference was carried out with (MEGA) 6.0 (Tamura et al., 2013) using Tamura-Nei model with 1000 replicates. Cryptocoryne longicauda

Engl. (accession number KM433709.1) was used as outgroup for ITS region, meanwhile

C. lingua Engl. (accession number AM920601.1) was used as outgroup for matK region.

3.3 Results

3.3.1 Quantity and Quality of the Genomic DNA

The presence of a single intact molecular weight DNA on agarose gel (Plate 3.2) clearly indicates that the genomic DNA isolated from Cryptocoryne leaf tissue was of high quantity and quality. In addition, the genomic DNA measured by The NanoDrop™

1000 Spectrophotometer also showed a very high quality. DNA concentration of all the isolated DNA samples was around 50.0-100 ng/μL and the OD260/OD280 ratio of between

1.8-1.9 (data not shown), suggesting an extremely low level of contamination with protein.

3.3.2 PCR Amplification

3.3.2(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA)

All plant samples were successfully amplified the ITS1, 5.8S and ITS2 regions with the size of around 700 bp using ITS-1F and ITS-4R primer pairs (Plate 3.3). The

700 bp products were purified using Wizard ® SV Gel and PCR Clean-Up System

(promega) and followed by analysis through 2.0% gel electrophoresis before subjected to DNA sequencing.

Plate 3.2 Genomic DNA extractions results on 0.8% (w/v) agarose gel. Lanes 1-8 (Cryptocoryne ×purpurea nothovar. purpurea; MT, PT, SU, PI, KJ, PK, SED, SL). Lanes 9-13 (C. cordata var. cordata; GA, PAN, MU, ST, BS). Lanes 14-18 (C. griffithii; GF, KUL, BIN, BOT, SIN). Lanes 19-20 (C. nurii var. nurii; NKJ, NSK). Lanes 21-22 (C. schulzei; SPAN, SKJ). Lane M is a λ DNA/HindIII Ladder (Fermentas).

Plate 3.3 The PCR amplification products were visualized on 2.0% (w/v) agarose gel for ITS region. Lanes 1-8 (Cryptocoryne ×purpurea nothovar. purpurea; MT, PT, SU, PI, KJ, PK, SED, SL). Lanes 9-13 (C. cordata var. cordata; GA, PAN, MU, ST, BS). Lanes 14-18 (C. griffithii; GF, KUL, BIN, BOT, SIN). Lanes 19-20 (C. nurii var. nurii; NKJ, NSK). Lanes 21-22 (C. schulzei; SPAN, SKJ). Lane M is a 100 bp DNA Ladder (Lucigen).

3.3.2(b) trnK−matK region (Chloroplast DNA)

All plant samples were successfully amplified the trnK−matK region with the size of around ~2.0 kb using trnK-3914F and trnK-2R primer pairs and ~1.8 kb using matK-450F and matK-537R primer pairs. The products were purified using Wizard ®

SV Gel and PCR Clean-Up System (Promega), followed by analysis through 2.0% gel electrophoresis before subjected to DNA sequencing. Plate 3.4 and Plate 3.5 showed the successfully 2% agarose gel image for all accession samples respectively.

3.3.3 Alignment of Sequences

3.3.3(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA)

The boundaries of ITS1, 5.8S and ITS2 were determined from the published ITS sequences of C. longicauda (accession number KM433709.1). The sequences results of the ribosomal ITS region obtained by direct sequencing had 734 bp (C. griffithii, C. nurii var. nurii), 735 bp (C. cordata var. cordata, C. schulzei). No variation was detected within each putative parental species. Meanwhile for C. ×purpurea nothovar. purpurea samples resulted in ambiguous ITS sequences with composed of superimposed peaks and overlapping ribotype sequences in direct sequencing (Plate 3.6).

3.3.3(a)(i) Plasmid Amplification of C. ×purpurea nothovar. purpurea

ITS regions obtained from sixteen C. ×purpurea nothovar. purpurea samples were cloned to ensure representative amplification of the parental copies. Both replicates per accessions produce relatively good transformation rate. Three clones per plate which act as DNA template showed good amplification in PCR amplification with the size of around 700 bp using ITS-1F and ITS-4R primer pairs (Plate 3.7). The artificial

Plate 3.4 The PCR amplification products were visualized on 2.0% (w/v) agarose gel for trnK−matK region using primers trnK-3914F and trnK-2R. Lanes 1-8 (Cryptocoryne ×purpurea nothovar. purpurea; MT, PT, SU, PI, KJ, PK, SED, SL). Lanes 9-13 (C. cordata var. cordata; GA, PAN, MU, ST, BS). Lanes 14-18 (C. griffithii; GF, KUL, BIN, BOT, SIN). Lanes 19-20 (C. nurii var. nurii; NKJ, NSK). Lanes 21-22 (C. schulzei; SPAN, SKJ). Lane M is a 100 bp DNA Ladder (Lucigen).

Plate 3.5 The PCR amplification products were visualized on 2.0% (w/v) agarose gel for trnK−matK region using primers matK-450F and matK-537R. Lanes 1-8 (Cryptocoryne ×purpurea nothovar. purpurea; MT, PT, SU, PI, KJ, PK, SED, SL). Lanes 9-13 (C. cordata var. cordata; GA, PAN, MU, ST, BS). Lanes 14-18 (C. griffithii; GF, KUL, BIN, BOT, SIN). Lanes 19-20 (C. nurii var. nurii; NKJ, NSK). Lanes 21-22 (C. schulzei; SPAN, SKJ). Lane M is a 100 bp DNA Ladder (Lucigen).

Plate 3.6 The electropherogram of Cryptocoryne ×purpurea nothovar. purpurea from ITS direct sequencing result showing the presence of superimposed peaks with positions marked with asterisks.

Plate 3.7 The PCR amplification products were visualized on 2.0% (w/v) agarose gel of ITS region cloning plasmids. Lanes 1-24 for Cryptocoryne ×purpurea nothovar. purpurea clones (three clones per accession). Lanes 1-3 (MT), lanes 4-6 (PT), lanes 7-9 (SU), lanes 10-12 (PI), lanes 13-15 (KJ), lanes 16-18 (PK), lanes 19-21 (SED), lanes 22- 24 (SL). Lane M is a 100 bp DNA Ladder (Lucigen).

1:1 mixture of C. cordata var. cordata (GA) and C. griffithii (KUL) DNA as template also showed good transformation and PCR amplification (Plate 3.8).

3.3.3(a)(ii) Plasmid Sequencing Data and Comparison with the Putative Parental

Sequences

All 48 clones from hybrid samples and six clones from template mixture were sent for DNA sequencing. The results shows the amplicon average size were 733-736 bp. Comparison of the ITS sequences between C. cordata var. cordata and C. griffithii indicated twelve variable sites distinguishing the C. cordata var. cordata sequences from the C. griffithii sequences at species level (Table 3.7). Among the 48 cloned sequences, fifteen sequences (Type 1) were identical to C. griffithii; six sequences (Type 2) were corresponding to C. cordata var. cordata, and the remaining twenty-seven cloned sequences (Types 3–8) revealed intermediate sequences between C. cordata var. cordata and C. griffithii. Of the six cloned sequences from C. cordata var. cordata and C. griffithii template mixture, one was pure C. griffithii (Type 1), one was pure C. cordata var. cordata (Type 2), and another four revealed intermediate sequences (Type 3). On the other hand, C. nurii var. nurii had ITS sequences different from those of C.

×purpurea nothovar. purpurea at six positions (142, 186, 194, 607, 623 and 660) (Table

3.7) which eliminate C. nurii var. nurii as a possible parent. However, C. schulzei had identical ITS profiles to those of C. cordata var. cordata and C. ×purpurea nothovar. purpurea (Type 2). This additivity strongly supports C. ×purpurea nothovar. purpurea being the hybrid of C. cordata var. cordata and C. griffithii, although the ITS data alone cannot reject the possibility that it is C. griffithii × C. schulzei. All ITS including selected cloned sequences represent the Type 1 to Type 8 were submitted to GenBank.

Plate 3.8 The PCR amplification products of artificial recombinant were visualized on 2.0% (w/v) agarose gel of ITS region cloning plasmids. Lanes 1-6 showed the six clones of mixture from C. cordata var. cordata (GA) and C. griffithii (KUL) as DNA template. Lane M is a 100 bp DNA Ladder (Lucigen).

Table 3.7 Variable nucleotide sites in ITS sequences comparison between the clones and the putative parental species. Only variable sites among the parental sequences are presented here for the ease of comparison

Taxon Type Accession Clone ITS Variable sites Genbank no 0 0 1 1 1 1 2 2 4 4 4 6 6 6 6 6 6 6 Accession 4 4 4 4 8 9 3 5 2 5 7 0 2 4 6 6 6 8 3 4 1 2 6 4 0 0 2 1 9 7 3 2 0 7 8 8 C. ×purpurea nothovar. purpurea 1 MT MT1 C T A A G A G A T C T C A A C − − T KU196170 C. ×purpurea nothovar. purpurea 1 MT MT2 C T A A G A G A T C T C A A C − − T KU196171 C. ×purpurea nothovar. purpurea 1 MT MT4 C T A A G A G A T C T C A A C − − T KU196172 C. ×purpurea nothovar. purpurea 1 MT MT6 C T A A G A G A T C T C A A C − − T KU196173 C. ×purpurea nothovar. purpurea 1 PT PT5 C T A A G A G A T C T C A A C − − T KU196174 C. ×purpurea nothovar. purpurea 1 KJ KJ4 C T A A G A G A T C T C A A C − − T KU196175 C. ×purpurea nothovar. purpurea 1 PK PK1 C T A A G A G A T C T C A A C − − T KU196176 C. ×purpurea nothovar. purpurea 1 PK PK3 C T A A G A G A T C T C A A C − − T KU196177 C. ×purpurea nothovar. purpurea 1 PK PK5 C T A A G A G A T C T C A A C − − T KU196178 C. ×purpurea nothovar. purpurea 1 PK PK6 C T A A G A G A T C T C A A C − − T KU196179 C. ×purpurea nothovar. purpurea 1 SL SL1 C T A A G A G A T C T C A A C − − T KU196180 C. ×purpurea nothovar. purpurea 1 SL SL2 C T A A G A G A T C T C A A C − − T KU196181 C. ×purpurea nothovar. purpurea 1 SL SL3 C T A A G A G A T C T C A A C − − T KU196182 C. ×purpurea nothovar. purpurea 1 SL SL5 C T A A G A G A T C T C A A C − − T KU196183 C. ×purpurea nothovar. purpurea 1 SL SL6 C T A A G A G A T C T C A A C − − T KU196184 C. griffithii 1 GF * C T A A G A G A T C T C A A C − − T KU196185 C. griffithii 1 KUL * C T A A G A G A T C T C A A C − − T KU196186 C. griffithii 1 BIN * C T A A G A G A T C T C A A C − − T KU196187 C. griffithii 1 BOT * C T A A G A G A T C T C A A C − − T KU196188 C. griffithii 1 SIN * C T A A G A G A T C T C A A C − − T KU196189 C. ×purpurea nothovar. purpurea 2 KJ KJ5 T − G A G A T G C T C C A G C G C C KU196198 C. ×purpurea nothovar. purpurea 2 KJ KJ6 T − G A G A T G C T C C A G C G C C KU196199

Table 3.7 (continued)

Taxon Type Accession Clone ITS Variable sites Genbank no 0 0 1 1 1 1 2 2 4 4 4 6 6 6 6 6 6 6 Accession 4 4 4 4 8 9 3 5 2 5 7 0 2 4 6 6 6 8 3 4 1 2 6 4 0 0 2 1 9 7 3 2 0 7 8 8 C. ×purpurea nothovar. purpurea 2 SU SU3 T − G A G A T G C T C C A G C G C C KU196200 C. ×purpurea nothovar. purpurea 2 SU SU4 T − G A G A T G C T C C A G C G C C KU196201 C. ×purpurea nothovar. purpurea 2 SU SU5 T − G A G A T G C T C C A G C G C C KU196202 C. ×purpurea nothovar. purpurea 2 SU SU6 T − G A G A T G C T C C A G C G C C KU196203 C. cordata var. cordata 2 GA * T − G A G A T G C T C C A G C G C C KU196204 C. cordata var. cordata 2 PAN * T − G A G A T G C T C C A G C G C C KU196205 C. cordata var. cordata 2 MU * T − G A G A T G C T C C A G C G C C KU196206 C. cordata var. cordata 2 ST * T − G A G A T G C T C C A G C G C C KU196207 C. cordata var. cordata 2 BS * T − G A G A T G C T C C A G C G C C KU196208 C. ×purpurea nothovar. purpurea 3 MT MT5 C T G A G A T G C T C C A G C G C C KU196213 C. ×purpurea nothovar. purpurea 3 PT PT1 C T G A G A T G C T C C A G C G C C KU196214 C. ×purpurea nothovar. purpurea 3 PT PT3 C T G A G A T G C T C C A G C G C C KU196215 C. ×purpurea nothovar. purpurea 3 PT PT6 C T G A G A T G C T C C A G C G C C KU196216 C. ×purpurea nothovar. purpurea 3 SU SU1 C T G A G A T G C T C C A G C G C C KU196217 C. ×purpurea nothovar. purpurea 3 SU SU2 C T G A G A T G C T C C A G C G C C KU196218 C. ×purpurea nothovar. purpurea 3 PI PI4 C T G A G A T G C T C C A G C G C C KU196219 C. ×purpurea nothovar. purpurea 3 PI PI5 C T G A G A T G C T C C A G C G C C KU196220 C. ×purpurea nothovar. purpurea 3 PI PI6 C T G A G A T G C T C C A G C G C C KU196221 C. ×purpurea nothovar. purpurea 3 PK PK2 C T G A G A T G C T C C A G C G C C KU196222 C. ×purpurea nothovar. purpurea 3 PK PK4 C T G A G A T G C T C C A G C G C C KU196223 C. ×purpurea nothovar. purpurea 3 SL SL4 C T G A G A T G C T C C A G C G C C KU196224 C. ×purpurea nothovar. purpurea 3 SED SED1 C T G A G A T G C T C C A G C G C C KU196225 C. ×purpurea nothovar. purpurea 3 SED SED2 C T G A G A T G C T C C A G C G C C KU196226

Table 3.7 (continued)

Taxon Type Accession Clone ITS Variable sites Genbank no 0 0 1 1 1 1 2 2 4 4 4 6 6 6 6 6 6 6 Accession 4 4 4 4 8 9 3 5 2 5 7 0 2 4 6 6 6 8 3 4 1 2 6 4 0 0 2 1 9 7 3 2 0 7 8 8 C. ×purpurea nothovar. purpurea 3 SED SED3 C T G A G A T G C T C C A G C G C C KU196227 C. ×purpurea nothovar. purpurea 3 SED SED4 C T G A G A T G C T C C A G C G C C KU196228 C. ×purpurea nothovar. purpurea 3 SED SED5 C T G A G A T G C T C C A G C G C C KU196229 C. ×purpurea nothovar. purpurea 3 SED SED6 C T G A G A T G C T C C A G C G C C KU196230 C. ×purpurea nothovar. purpurea 4 PI PI1 C T G A G A T G C T C C A G C − − C KU196190 C. ×purpurea nothovar. purpurea 4 PI PI3 C T G A G A T G C T C C A G C − − C KU196191 C. ×purpurea nothovar. purpurea 4 KJ KJ1 C T G A G A T G C T C C A G C − − C KU196192 C. ×purpurea nothovar. purpurea 4 KJ KJ2 C T G A G A T G C T C C A G C − − C KU196193 C. ×purpurea nothovar. purpurea 5 PT PT2 C T A A G A G A C T C C A G C G C C KU196231 C. ×purpurea nothovar. purpurea 5 PT PT4 C T A A G A G A C T C C A G C G C C KU196232 C. ×purpurea nothovar. purpurea 6 MT MT3 C T A A G A G A T T T C A G C − − T KU196194 C. ×purpurea nothovar. purpurea 7 KJ KJ3 C T G A G A T G C T C C A G C − C C KU196209 C. ×purpurea nothovar. purpurea 8 PI PI2 T − G A G A T G C T C C A G C − − C KU196169 DNA mixture 1 § MIX1 C T A A G A G A T C T C A A C − − T KU196195 DNA mixture 2 § MIX5 T − G A G A T G C T C C A G C G C C KU196210 DNA mixture 3 § MIX2 C T G A G A T G C T C C A G C G C C KU196233 DNA mixture 3 § MIX3 C T G A G A T G C T C C A G C G C C KU196234 DNA mixture 3 § MIX4 C T G A G A T G C T C C A G C G C C KU196235 DNA mixture 3 § MIX6 C T G A G A T G C T C C A G C G C C KU196236 C. schulzei SPAN * T − G A G A T G C T C C A G C G C C KU196211 C. schulzei SKJ * T − G A G A T G C T C C A G C G C C KU196212 C. nurii var. nurii NKJ * C T A G C G G A T C T A G A G − − T KU196196 C. nurii var. nurii NSK * C T A G C G G A T C T A G A G − − T KU196197

*direct sequencing of PCR products; §genomic DNA mixture of C. griffithii; KUL and C. cordata var. cordata; GA. “−” denotes a gap. Colored column indicated twelve variable sites distinguishing the hybrid clones with the C. cordata var. cordata sequences and the C. griffithii sequences at species level.

3.3.3(b) trnK−matK Region (Chloroplast DNA)

The boundaries of matK gene and 5’-3’trnK intron were determined by comparison with the trnK-matK sequence of C. lingua (accession number AM920601.1) obtained from Genbank. The amplicon size for all taxa range from 1980 bp to 1986 bp.

The matK gene varied from nucleotide position number 262/268 bp to 1797/1803 bp and the gene size length about 1535 bp. An alignment of consensus nucleotide sequences from all samples were shown to vary at twenty sites (Table 3.8). From these positions, four substitutions and six single-base pair insertions/deletions (indels) distinguished the

C. cordata var. cordata sequences from the C. griffithii sequences. No variation was identified on the samples from the same accession.

The comparison showed the hybrid samples from PI, KJ and PK had sequences identical to C. cordata var. cordata and was alike to the C. cordata var. cordata; ST and

BS at position 543. Cryptocoryne ×purpurea nothovar. purpurea from SL and SED had sequences identical to C. griffithii (GF, KUL, BOT,SIN). The hybrid from MT, PT and

SU had sequences identical to C. griffithii (BIN) at nucleotide position 148. The matK sequences of C. cordata var. cordata (PAN) have genotype differed by three substitutions; 410, 1050 and 1176 meanwhile C. cordata var. cordata (GA) which are differed by two substitutions at position 367 and 1389 when compared to the other C. cordata var. cordata accessions (Table 3.8). The pattern of the nucleotide positions for

C. schulzei is identical to C. nurii var. nurii and dissimilar to those of C. ×purpurea nothovar. purpurea at position 241, 367, 494 and 1389 which make it unlikely that both

C. schulzei and C. nurii var. nurii as the parents to the C. ×purpurea nothovar. purpurea.

All sequences were submitted to GenBank (Table 3.8).

Table 3.8 Variable nucleotide sites in matK sequences comparison between the hybrid and the putative parental species

Taxon 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 Genbank 1 1 1 1 1 1 1 2 2 3 4 4 5 5 0 0 1 1 2 3 Accession 4 6 6 6 6 6 6 4 6 6 1 9 4 5 5 8 7 8 3 8 8 4 5 6 7 8 9 1 3 7 0 4 3 0 0 9 6 2 9 9 C. ×purpurea nothovar. purpurea ; PI G − − − − − − T T G T T T T G A T T C T KU196237 C. ×purpurea nothovar. purpurea ; KJ G − − − − − − T T G T T T T G A T T C T KU196238 C. ×purpurea nothovar. purpurea ; PK G − − − − − − T T G T T T T G A T T C T KU196239 C. cordata var. cordata ; ST G − − − − − − T T G T T T T G A T T C T KU196240 C. cordata var. cordata ; BS G − − − − − − T T G T T T T G A T T C T KU196241 C. cordata var. cordata ; MU G − − − − − − T T G T T G T G A T T C T KU196242 C. cordata var. cordata ; GA G − − − − − − T T T T T G T G A T T C A KU196243 C. cordata var. cordata ; PAN G − − − − − − T T G C T G T A A G T C T KU196244 C. ×purpurea nothovar. purpurea ; SL G C T G T A T T G G C T G G A G G C A T KU196249 C. ×purpurea nothovar. purpurea ; SED G C T G T A T T G G C T G G A G G C A T KU196250 C. griffithii ; GF G C T G T A T T G G C T G G A G G C A T KU196251 C. griffithii ; KUL G C T G T A T T G G C T G G A G G C A T KU196252 C. griffithii ; BOT G C T G T A T T G G C T G G A G G C A T KU196253 C. griffithii ; SIN G C T G T A T T G G C T G G A G G C A T KU196254 C. ×purpurea nothovar. purpurea ; MT A C T G T A T T G G C T G T A G G C A T KU196255 C. ×purpurea nothovar. purpurea ; PT A C T G T A T T G G C T G T A G G C A T KU196256 C. ×purpurea nothovar. purpurea ; SU A C T G T A T T G G C T G T A G G C A T KU196257 C. griffithii ; BIN A C T G T A T T G G C T G T A G G C A T KU196258 C. schulzei ; SPAN G − − − − − − G T T T A G T G A T T C A KU196245 C. schulzei ; SKJ G − − − − − − G T T T A G T G A T T C A KU196246 C. nurii var. nurii; NKJ G − − − − − − G T T T A G T G A T T C A KU196247 C. nurii var. nurii; NSK G − − − − − − G T T T A G T G A T T C A KU196248

Colored column indicated variable sites distinguishing the hybrid accessions between C. cordata var. cordata sequences from the C. griffithii sequences at species level

3.3.4 Phylogenetic Inferences

3.3.4(a) ITS1, 5.8S and ITS2 Regions (Nuclear DNA)

The sequence data in Table 3.7 and C. longicauda (accession number

KM433709.1) as outgroup were analyzed phylogenetically using character based method maximum likelihood (ML) with 1000 of bootstrap replicates number. The tree showed that hybrid clones samples can be divided into two major clades (Figure 3.1).

The first clade representing C. ×purpurea nothovar. purpurea clones stand together to the C. cordata var. cordata and C. schulzei from all accession respectively. The second clade consists of C. ×purpurea nothovar. purpurea stand together with C. griffithii.

However, C. nurii var. nurii accessions were not included between this two groups.

3.3.4(b) trnK−matK Region (Chloroplast DNA)

The topologies resulted from the trnK−matK analyses are similar to those inferred from the ITS region which analyze using data from Table 3.8 and C. lingua

(accession number AM920601.1) as outgroup. The tree showed that Cryptocoryne samples can be divided into two major clades (Figure 3.2). The first clade representing

C. ×purpurea nothovar. purpurea stand together with C. cordata var. cordata. The second clade consists of C. ×purpurea nothovar. purpurea together with C. griffithii.

Meanwhile for C. nurii var. nurii and C. schulzei accessions are not included between this two groups.

C. cordata var. cordata BS

C. cordata var. cordata ST

C. cordata var. cordata MU

C. ×purpurea nothovar. purpurea TYPE 2

schulzei C. cordata var. cordata GA .

purpurea

C. cordata var. cordata PAN

C. schulzei SKJ nothovar.

+C. cordata

C. schulzei SPAN var

C. ×purpurea nothovar. purpurea

purpurea TYPE 4

C. C. ×purpurea nothovar. purpurea C. cordata TYPE 5 C. ×purpurea nothovar. purpurea TYPE 6 C. ×purpurea nothovar. purpurea TYPE 3

C. griffithii GF

C. griffithii SIN

C. griffithii KUL

purpurea

C. griffithii BIN

nothovar.

C. griffithii BOT C. griffithii

C. ×purpurea nothovar. purpurea TYPE 1

purpurea

C. C. ×purpurea nothovar. purpurea TYPE 7

C. ×purpurea nothovar. purpurea TYPE 8 C.nurii var. nurii NKJ

C.nurii var. nurii NSK

C. longicauda KM433709.1

Figure 3.1 Maximum likelihood phylogenetic tree based on ITS sequences. Values on the nodes correspond to bootstrap values and only values >50% are shown. Cryptocoryne longicauda (accession number KM433709.1) was used as the outgroup. Branch lengths are proportional to the genetic distance between nodes.

C. nurii var. nurii NKJ

C. nurii var. nurii NSK

C. schulzei SPAN

C. schulzei SKJ C. cordata var. cordata PAN

C. cordata var. cordata GA

C. cordata var. cordata MU C. cordata var. cordata BS purpurea

. cordata

var C. cordata var. cordata ST +

nothovar.

C. ×purpurea nothovar. purpurea KJ

C. cordata

purpurea

C. ×purpurea nothovar. purpurea PI C. C. ×purpurea nothovar. purpurea PK

C. ×purpurea nothovar. purpurea SU

C. griffithii BIN

C. ×purpurea nothovar. purpurea MT

C. griffithii

C. ×purpurea nothovar. purpurea PT +

C. griffithii GF

purpurea purpurea C. griffithii SIN

C. griffithii KUL nothovar.

C. ×purpurea nothovar. purpurea SED

purpurea

× C. ×purpurea nothovar. purpurea SL

C. griffithii BOT

C. lingua AM920601.1

Figure 3.2 Maximum likelihood phylogenetic tree based on matK sequences. Values on the nodes correspond to bootstrap values and only values >50% are shown. Cryptocoryne lingua (accession number AM920601.1) was used as the outgroup. Branch lengths are proportional to the genetic distance between nodes.

3.4 Discussion

3.4.1 ITS1, 5.8S and ITS2 Regions (Nuclear DNA)

It is well known that nuclear genes are biparentally inherited, and the hybrids should possess both divergent copies of their putative parents (Zha et al., 2008; Kitani et al., 2011; Hodač et al., 2014). The ITS sequences of C. ×purpurea nothovar. purpurea showed nucleotide polymorphism at each site where C. cordata var. cordata and C. griffithii differ, and the results of hybrid taxa exhibited polymorphisms that were consistently additive sequence pattern derived from the two hypothesized parent species

(Table 3.7). Among all the 21 amplicons with parental nrITS types, frequency of C. griffithii dominated over those from C. cordata var. cordata, but both peaks were clearly distinguishable. The present ITS data revealed that C. ×purpurea nothovar. purpurea possessed heterozygous rDNA genotypes; have both ITS sequence types of C. cordata var. cordata and C. griffithii suggests that C. ×purpurea nothovar. purpurea is a natural hybrid between these two species, which supports the hybrid hypothesis of Jacobsen

(1977).

The results also showed that 27 (56.25%) out of the 48 cloned nrITS sequences were intermediate/chimeric (recombined of parental sequence types (Type 3–8)) (Table

3.7). In diploid hybrids, the co-occurrence of parental nrITS types is rarely maintained in subsequent generations due to concerted evolution and if concerted evolution is incomplete, then sampled genes may represent a mixture of non-homogenized paralogous sequences (Wendel et al., 1995). Effects of concerted evolution, commonly occurs after meiosis (sexual reproduction) only in fertile plants (Hodkinson et al., 2002;

Naidoo et al., 2013). However, Jacobsen (1977) reported that the pollen of C. ×purpurea nothovar. purpurea is completely sterile. Because C. ×purpurea nothovar. purpurea is sterile, all C. ×purpurea nothovar. purpurea individuals are initially F1. Since the result of crossing between C. cordata var. cordata and C. griffithii, the C. ×purpurea nothovar. purpurea are F1 individuals and subsequently can accumulate somatic mutation.

Therefore, F1 individuals must poses both parental ITS without any concerted evolution taken effect One explanation for the origin of such recombinants which was caused by

PCR-mediated recombination which describes the process of in vitro chimera formation from related DNA template sequences are co-amplified in a single PCR reaction

(Bradley and Hillis, 1997; Cronn et al., 2002). PCR-mediated recombination is the phenomenon that results from either polymerase template switching during PCR or annealing of prematurely terminated products to non-homologous template (Bradley and

Hillis, 1997; Popp and Oxelman, 2001; Cronn et al., 2002). This minor variation

(usually one or two nucleotide sites) between some clones may have resulted from PCR errors caused by Taq DNA polymerase which nucleotide base wrongly incorporated by

Taq enzyme and would have been propagated (Won and Renner, 2005; Yu et al., 2014).

The incomplete extended copies from one locus serving as primer for subsequent extension from a paralogous locus also explained the PCR-mediated recombination

(Bradley and Hillis, 1997; Popp and Oxelman, 2001). This phenomenon has been well characterized from allotetraploid cotton (Cronn et al., 2002), and has been reported from other sterile hybrid plants including Potamogeton ×intortusifolius J. B. He (Du et al.,

2009) and Aster ×chusanensis Lim et al. (Shin et al., 2014).

PCR-mediated recombination was found in the experiment with the recombinant clone sequences of C. ×purpurea nothovar. purpurea having a C. cordata var. cordata and C. griffithii template mixture. The observed PCR-mediated recombination suggests that chimeric ITS seen in C. ×purpurea nothovar. purpurea can be due to artificial recombinant. Moreover, the chimeric sequences types (Type 3-8) are unequally distributed in the nucleotide positions (Table 3.7) which indicated the process of recombination occurred in a non-random manner during the PCR. This phenomenon suggested that the sequence similarity and secondary structure of the template sequences are closely related to the PCR recombination pattern (Fonseca et al., 2012). Techniques by passing traditional PCR and cloning process are necessary for more direct examination of the structure and evolution of nrITS sequences in C. ×purpurea nothovar. purpurea.

The results also showed the ITS sequences of C. cordata var. cordata and C. schulzei are very similar, so these data confirmed only that the C. ×purpurea nothovar. purpurea populations examined are hybrids of one of these two and C. griffithii. The hybrids can express characters that are identical to either one of the parents or truly intermediate between parents (Rieseberg, 1995, 1997; Rieseberg et al., 1999).

Cryptocoryne species are mainly identified using flower characters, particularly the limb of the spathe. The limb of the spathe provides strong evidence in identification of the parental species by showing intermediate morphology of the two parents; - the broad collar zone present in C. ×purpurea nothovar. purpurea and C. cordata var. cordata; but a rather rugose limb of the spathe with wide pronounced collar is clearly visible in C. schulzei (Othman et al., 2009). A rough purple/red limb of the spathe characters in C.

griffithii which resembles those in C. ×purpurea nothovar. purpurea but C. nurii var. nurii has deep red to dark purple with protuberances that are irregular on the limb of the spathe (Othman et al., 2009). Based on the close similarity between all accessions examined for molecular data and morphology characters, make it unlikely that C. schulzei and C. nurii var. nurii as parents to C. ×purpurea nothovar. purpurea. The phylogenetic tree for ITS region supports the nucleotide sequence alignment analysis which consist one major clades contained C. ×purpurea nothovar. purpurea clones together with C. cordata var. cordata and C. schulzei. The other clade contained C.

×purpurea nothovar. purpurea clones together with C. griffithii.

3.4.2 trnK−matK Region (Chloroplast DNA)

The matK sequences of C. ×purpurea nothovar. purpurea; PI, KJ and PK (all originated from Tasik Bera region) were identical to C. cordata var. cordata and indicated this species as the maternal parent. Neither parent was found in the sampling lake channels, but C. cordata var. cordata (ST) appeared at the nearby swamp. The origin of Tasik Bera dates back to only 4500 B.P. (Morley, 1982). Based on the Othman et al. (2009) explanation, the main drainage of the Tasik Bera is now northwards to the

Sungai Pahang, but there is still a small connection southwards to the Sungai

Palong/Sungai Muar that was formally the main run-off. This event provides the interpretation of C. ×purpurea nothovar. purpurea having arisen as a hybrid between more widespread C. cordata var. cordata and the southernly distributed C. griffithii, which has then spread up along the west coast during the change in drainage systems that have occurred during the last 4500 years.

The sequences of C. ×purpurea nothovar. purpurea from Johor (SL and SED) were identical to the C. griffithii from Johor (KUL and GF) and C. griffithii from

Singapore (BOT and SIN). Currently, the two putative parental species have both recently been found at the Sg. Sedeli Kechil, and previous records showed that the distribution of C. cordata var. cordata and C. griffithii have overlapped in Johor

(Jacobsen et al., 2016). Cryptocoryne griffithii is also indicated as the maternal parent to the hybrid from Melaka (MT, PT and SU), but for these case it is identical to the C. griffithii from BIN (Bintan, Indonesia). Cryptocoryne cordata var. cordata (BS) was found in radius <40 km distance from all hybrid locations in Melaka region but C. griffithii was absent. However, C. griffithii had been recorded growing in several areas in Melaka (Bastmeijer and Kiew, 2001; Othman et al., 2009; Bastmeijer, 2015).

The highly conserved cytoplasmic molecule inherited clonally (without recombination) of cpDNA, has been shown to be a powerful tool to document the parentage of polyploids (Zhu et al., 2009; Khew and Chia, 2011; Ito et al., 2010).

Moreover, because cpDNA is maternally inherited in most angiosperms, the use of that marker may be particularly informative for clarifying genetic relationships in the present study, in which pollen has no influence on gene exchange. The cpDNA was assumed to be maternally inherited, as has been observed in the great majority in angiosperms

(Harris and Ingram, 1991; Birky, 1995) and including certain Cryptocoryne artificial hybrid cases (Jacobsen, 2016; personal communication).

However, cases of bidirectional of interspecific hybrid origin plants are rare in the literature. Example of bidirectional hybridization documented include between

Raphanus sativus L. and R. raphanistrum L. (Ridley et al., 2008); Hieracium alpinum L.

and H. transsilvanicum Fr. (Mráz et al., 2011); Rhizophora stylosa Griff. and R. apiculata Blume (Sahu et al., 2015). From this study, the result indicated that both C. cordata var. cordata and C. griffithii had served as the maternal donor and the hybrid had independent origins. There was no distinct bias of maternal composition for either one of them and suggest that natural hybridization between the two examined species is bidirectional (symmetrical). The phylogenetic tree for trnK−matK region supports the nucleotide sequenced alignment analysis which consists of one major clade containing

C. ×purpurea nothovar. purpurea samples together with C. griffithii and the other clade containing C. ×purpurea nothovar. purpurea samples together with. C. cordata var. cordata. The trnK−matK region of C. ×purpurea nothovar. purpurea samples were identical to C. cordata var. cordata and C. griffithii indicated this two species as the maternal parent.

3.5 Conclusion

The correct identification of hybrids is crucial to answer taxonomic, ecological, and evolutionary questions which will further contribute towards the conservation and management of this genus. Specifically, the combination of nuclear ribosomal DNA

(nrDNA) internal transcribed spacer (ITS) region and the chloroplast DNA for matK gene was successful in clarifying the parentage determination of this hybrid. The ITS network definitely supports the hypothesis that the morphologically intermediate individuals are the products of hybridization between C. griffithii and C. cordata var. cordata. The hybrid plants shared the identical matK sequences from C. cordata var. cordata and C. griffithii and this phenomenon was demonstrated simultaneously in several locations separated by long distances. Further interspecific delimitation and

taxonomic identification of specimens in herbaria could consider the occurrence of hybrids.

In addition, this hybrid may provide a good barrier to interspecific gene flow or may promote homogeneity as hybrid bridges. As C. ×purpurea nothovar. purpurea is sterile, the parental sequences of the nuclear and chloroplast markers could be preserved in the progenies that lack of meiotic recombination. However, the impact of natural hybridization on the evolution and speciation of Cryptocoryne is still not clear because of the lack study of reproductive isolation in Cryptocoryne and selection on hybrid descendants. Even though this study provides substantial evidence for interspecific hybridizations in this genus, it should be interesting to further investigate the population genetics, ploidy level and reproductive behavior of the hybrids. Future work should focus on comparing the fitness of hybrids and their parental species and on considering the effect of natural hybridization. The genetic variation of the wild population of the parental species may shed light on the geographical origins of the parents which would be valuable for understanding the extent of hybridization in Cryptocoryne.

CHAPTER FOUR

UTILIZING NEXT GENERATION SEQUENCING TO CHARACTERIZE MICROSATELLITE LOCI FOR CROSS SPECIES AMPLIFICATION AND PARENTAGE ANALYSIS

4.1 Introduction

Microsatellite markers have become the marker of choice for a variety of applications in population genetics or evolution and conservation (Zalapa et al., 2012;

Antiqueira, 2013, Zhao et al., 2014). Their advantages lie in such features as their distribution throughout the genome, locus specificity, high intraspecific polymorphisms, high reproducibility, codominant nature (allowing a direct measurement of heterozygosity), and are frequently be transferable across related species (Oliveira et al.,

2006; Selkoe and Toone, 2006; Fan et al., 2013). For most biological systems, the most powerful genetic tools for parentage analysis are these microsatellite markers (Jones and

Ardren, 2003). The paternity of parentage analysis can be achieved by any type of genetic markers provided that it is sufficiently polymorphic with hypervariablity, and for that reason, microsatellites are usually preferred (Gerber et al., 2000). This hypervariability, in conjunction with the codominant inheritance of microsatellite alleles, provides a means of distinguishing individuals, and hence a rich source of neutral genetic markers for mating systems studies, including inference of parentage (Ashley and Dow, 1994).

Next Generation Sequencing (NGS) technologies, such as 454 pyrosequencing are revolutionizing molecular ecology by simplifying the development of molecular

genetic markers, including microsatellites (Gardner et al., 2011; Liu et al., 2012; Zalapa et al., 2012). 454 pyrosequencing offers many advantages over traditional enrichment procedures in isolating microsatellite markers due to high-throughput, relatively low cost, quick time and low labor requirements (Rothberg and Leamon, 2008). To date, no published reports are available on Cryptocoryne microsatellites isolated by using high- throughput sequencing. To verify the effectiveness of isolation microsatellites markers through next generation sequencing, this study utilized genomic DNA from

Cryptocoryne cordata var. cordata using a NGS protocol.

The main reason why C. cordata var. cordata was chosen in the characterization of microsatellite markers in this study because this species has some of the most complex varieties present in Cryptocoryne. The Cryptocoryne cordata complex consists of several varieties found from the southern Peninsular Thailand, Peninsula Malaysia, the islands of Sumatera, Borneo and Natuna Islands. The current taxonomic status of

Cryptocoryne cordata recognizes four varieties i.e. var. cordata, var. diderici (De Wit)

N. Jacobsen, var. grabowskii (Engl.) N. Jacobsen and var. siamensis (Gagnep.) N.

Jacobsen & D. Sookchaloem (Jacobsen and Bastmeijer, 2014; Bastmeijer, 2015). The four varieties of C. cordata differ in their chromosome numbers, distribution area, ecological niches and to an extent different morphological characteristics. Cryptocoryne cordata var. cordata is distributed from south-eastern Peninsular Thailand and the

Peninsula Malaysia. It inhabits slow to fast running streams in lowland forest. These streams can either have sandy or leaf peat bottoms. The var. cordata has a distinct chromosome number of 2n = 34 similar with C. griffithii and C. ×purpurea nothovar. purpurea (the other varieties of C. cordata have 2n = 68 or 102). Morphologically C.

cordata var. cordata has cordate leaf blades with a smooth surface and green or green- brownish or brownish upper leaf surface with markings (Othman et al., 2009; Jacobsen and Bastmeijer, 2014). The spathe is a distinct yellow without any brownish shades as those found in the other varieties.

To test the potential of microsatellites markers developed from C. cordata var. cordata for interspecific amplification, they were applied on 11 other Cryptocoryne species within Peninsular Malaysia. Since microsatellite markers have been found to be useful in parentage identification, and later these developed microsatellites markers will be used to verify the hybrid origin of C. ×purpurea nothovar. purpurea since C. cordata var. cordata is one of the putative parent. Even though the hybrid status of C. ×purpurea nothovar. purpurea has been confirmed through sequence analysis between C. cordata var. cordata and C. griffithii as describe in Chapter Three, the effectiveness of microsatellite markers in identification of hybrid status hopefully will give new insights on the variability of molecular markers in Cryptocoryne hybrid identification. Therefore, by identifying shared or private alleles to each taxon, hopefully the result will provide better genetic profiles in the understanding the identity of the hybrids. By integrating data from microsatellite loci in this study, the specific objectives to address the following questions are:-

1. Can these markers to be implement to another Cryptocoryne species by cross

species amplification?

2. Do microsatellite data support the hypothesis that C. ×purpurea nothovar.

purpurea is an interspecific hybrid between C. cordata var. cordata and C.

griffithii?

4.2 Materials and Methods

4.2.1 Sample Preparation and Sequencing

The summary of the experimental procedures involved in microsatellite marker development via high-throughput next generation DNA sequencing are shown in Figure

4.1. Firstly, the genomic DNA was extracted from silica dried leaf tissue using modified

CTAB method according to Doyle and Doyle (1990). The DNA was dissolved in 100

µL of TE buffer. The DNA from Cryptocoryne cordata var. cordata collected from a population at Gunung Arong Recreational Forest, Mersing, Johor, Malaysia was chosen for 454 sequencing. The sample had a concentration of 90.1 ng/µL and a 260/280 of

1.99 quantified as measured on a Nanodrop 2000 (Thermo-Scientific) and was run on a

0.8% agarose gel electrophoresis buffered with 1 X TBE Tris-Borate-EDTA (TBE) buffer (Biotechnology Grade, BST Techlab). A standard DNA ladder λ DNA/HindIII

(Fermentas) was used as a marker. The gel was stained using RedSafe™, and the image was visualized with UV light on the UV transilluminator (BIO-RAD) and photographed using electrophoresis documentation and analysis system Gel-Doc software.

Approximately 5 µg of genomic DNA was sent to the Ecogenics GmbH (Zurich,

Switzerland) for NGS shotgun library preparation and sequencing of 1/8 plate using the

454 Genome Sequencer FLX Technology (Roche Applied Science) following emulsion polymerase chain reaction (emPCR) followed Roche 454 standard protocols. The over view of step by step of NGS by pyrosequencing 454 GS-FLX method was explained by

Puritz and Toonen (2013). Interpretation of post sequencing data in bioinformatics analysis was explained by Fernandez-Silva and Toonen (2013).

Genomic DNA Step 1 Choice of template and library preparation Library preparation

Step 2 Sequencing Choice of sequencing (Roche 454 pyrosequencing) platform

Quality check Step 3 (removal of short reads) SSR discovery and primer design SSR pre-screening (user-defined lower limits)

Sequence similarity detection (removal of candidates with low complexity or repetitive flanking region)

Select SSR loci for marker validation (based on repeat class, repeat number, motif, PCR multiplex potential)

Step 4 Check for primer functionality on small Marker validation testset (PCR product with high-quality banding pattern)

Check for polymorphism on small testset (different individual in a population)

Check for transferability (several species in the same genus)

Figure 4.1 The four basic steps of microsatellite marker development via high- throughput next generation DNA sequencing.

4.2.2 Microsatellite Screening and Genotyping Test

The sequence data received was assembled into contigs in GENEIOUS (v 5.6.7)

(Drummond et al., 2010) to increase the reliability of microsatellite detection and preventing locus duplication. The program Msatcommander version 0.8.2 (Faircloth,

2008) was used to detect contigs containing microsatellite repeats. The search criteria were set to a minimum of six repeats of di- to hexa-nucleotides with perfect repeat motifs. Microsatellite loci with compound (two or more types of repeats) or compound and interrupted repeats were excluded from primer selection and optimization.

Mononucleotide repeats were not considered. Of the repeats identified, subsets of di-, tri- and tetra-nucleotides with at least eight and six perfect repeat motifs respectively were selected. The selection was made on the basis that eight or more repeats should reduce the likelihood of stutter bands and scoring error and also be capable of capturing loci with variation levels that will be most useful for population genetic studies

(Buschiazzo and Gemmell, 2006). Screening for microsatellite loci and direct primer design was performed using PRIMER 3 version 0.4.0 (Rozen and Skaletsky, 2000).

The PCR amplification was carried out to determine the optimum annealing temperature and to establish fragments size ranges for later PCR multiplexing. For every primer pair for each of the microsatellite motif, PCR optimization needs to be carried out. PCR optimizations were first conducted based on magnesium chloride (MgCl2) concentration, DNA concentration and annealing temperature of primers (either by raising the concentration of MgCl2 and DNA or by reducing annealing temperature). In this study, several MgCl2 concentrations were tested namely 1.5 mM up to 3.0 mM.

Different DNA concentrations were tested from 5.0 ng up to 100.0 ng and the annealing

temperature was tested for 12 different temperatures in the range between 55°C up to

65°C. Optimization of annealing temperature was carried out in 0.2 mL tube with a 12.5

μL reaction volumes containing 10 X PCR buffer, 2.0 mM dNTPs, 0.5 U of GoTaq Flexi

DNA polymerase (Promega), 25 mM MgCl2, a primer concentration of 0.2 μM and 20 ng of template DNA. Amplification was carried out on a thermal cycler (Bio-Rad) with cycling parameters were: 5 minutes at 95°C, followed by 34 cycles of 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute, a final extension of 72°C for 10 minutes, followed by a holding temperature of 4°C.

The PCR products of the expected size on 2% agarose gel, and were selected for preliminary tests of polymorphism using microchip electrophoresis system MCE®-202

MultiNA (Shimadzu) to perform DNA size confirmation and quantitation. The potential polymorphic loci were evaluated across a total of 30 C. cordata var. cordata individual plants by using forward or reverse primers labeled with the fluorescent dyes 6-Carboxy- fluorescein (6-FAM); blue, hexachloro-6-carboxy-fluorescein (HEX); green, or 5-

Carboxy-tetramethyl-rhodamine (TAMRA); yellow, performed in a multiplex PCR. The

PCR amplification was carried out as above; based on the best profile for that particular primer. The PCR products were sent to 1st Base laboratories for fragment analysis and were electrophoresed on an ABI 3730XL automated sequencer (Applied Biosystems).

4.2.3 Data Analysis

Electropherograms from the fragment analysis were analyzed using the allele size standard GeneScan-500 LIZ and PeakScanner software version 1.0 (Applied

Biosystems, Inc., Foster City, CA). The DNA fragment sizes measured from the peaks

were converted into discrete alleles by comparison with reference lists of allele sizes.

Amplification products with unscorable peaks were not considered to be useful in the studies of variability due to the possible misinterpretation of data. The number of alleles

(NA), expected heterozygosity (HE), observed heterozygosity (HO), test for deviation from Hardy-Weinberg equilibrium (HWE) and significant linkage disequilibrium were performed using Arlequin ver. 3.0 software (Excoffier et al., 2005). MICRO-CHECKER v. 2.2.3 (Van Oosterhout, 2004) was used to perform a null alleles, large allelic dropout and genotyping errors.

4.2.4 Cross Species Amplification and Parentage Analysis

To verify the transferability of the newly developed microsatellite loci, eleven other Cryptocoryne species; C. affinis, C. ciliata var. ciliata, C. cordata hybrid, 2n = 68,

C. elliptica, C. griffithii, C. minima, C. nurii var. nurii, C. nurii var. raubensis, C.

×purpurea nothovar. purpurea, C. schulzei and C. near zukalli, 2n = 68 (Table 4.1) were tested for cross species amplification. For parentage analysis, several C. ×purpurea nothovar. purpurea, C. cordata var. cordata and C. griffithii from different locations were analyzed (Table 4.2). Based on morphological characteristics and results described in Chapter Three, C. cordata var. cordata and C. griffithii are suggested to be the parents of C. ×purpurea nothovar. purpurea. In the present study, C. nurii var. nurii and C. schulzei were also included in this analysis to clarify the hybrid status of C. ×purpurea nothovar. purpurea and its parentage assignment. But for parentage analysis, only markers that can amplify for all five species examined were chosen for ease of comparisons. The same DNA extraction and PCR conditions were performed as previously described in section 4.2.2. The amplicons were visualized in 2% agarose gel

Table 4.1 The details of Cryptocoryne species used in cross species microsatellite amplification study

Species name Location Date of Voucher collection number C. affinis Hook.f. Sungai Koyan, Kuala Lipis, Pahang 26-03-2011 RR 11–34 C. ciliata (Roxb.) Schott var. ciliata Sungai Perlis, Kangar, Perlis 23-03-2011 RR 11–26 C. cordata Griff. var. cordata Gunung Arong Recreational Forest, Mersing, Johor 05-03-2011 RR 11–18 C. cordata Griff. hybrid, 2n = 68 Jeneri, Sik, Kedah 24-02-2011 RR 11–01 C. elliptica Hook.f. Taman Negeri Bukit Panchor, Penang 17-03-2011 RR 11–25 C. griffithii Schott Felda Nitar, Mersing, Johor 19-02-2015 RR 15–01 C. minima Ridl. Batu Arang, Rawang, Selangor 25-03-2011 RR 11–28 C. nurii Furtado var. nurii Kahang-Jemaluang, Mersing, Johor 05-03-2011 RR 11–16 C. nurii Furtado viz. var raubensis Rumah Pam Galak l, Tersang, Raub, Pahang 25-03-2011 RR 11–32 C. ×purpurea Ridl. nothovar. purpurea Kg. Pulau Semut, Masjid Tanah, Melaka 02-03-2011 RR 11–06 C. schulzei De Wit Hutan Lipur Panti, Kota Tinggi, Johor 05-03-2011 RR 11–21 C. near zukalli Rataj, 2n = 68 Sungai Sik, Kedah 24-02-2011 RR 11–02

*All samples were collected from Peninsular Malaysia.

Table 4.2 The details of Cryptocoryne species used in parentage analysis using microsatellite markers

Taxon Locality Voucher Year of List of number collection abbreviation C. ×purpurea Ridl. nothovar. purpurea Kg Pulau Semut, Masjid Tanah, Melaka §1 RR 11-06 2011 MT Padang Tembak, Masjid Tanah, Melaka §1 RR 12-01 2012 PT Sungai Udang Recreational Forest, Melaka §1 RR 12-02 2012 SU Pos Iskandar, Tasik Bera, Pahang §1 RR 13-07 2013 PI Kg. Jelawat, Tasik Bera, Pahang §1 RR 13-08 2013 KJ Paya Kelantong, Tasik Bera, Pahang §1 RR 13-09 2013 PK Sg. Sedili Kechil, Kota Tinggi, Johor §1 RR 11-10 2011 SED Kg. Sri Lukut, Kahang, Johor §1 RR 12-04 2012 SL C. cordata Griff. var. cordata Gunung Arong, Mersing, Johor §1 RR 12-05 2012 GA Panti Bird Sanctuary, Kota Tinggi, Johor §1 RR 11-07 2011 PAN Muadzam Shah, Pahang §1 RR 11-24 2011 MU Sg. Tembangau, Tasik Bera, Pahang §1 RR 10-03 2010 ST Bukit Sedanan, Masjid Tanah, Melaka §1 RR 11-03 2011 BS C. griffithii Schott Felda Nitar, Mersing, Johor §1 RR 15-01 2015 GF Kulai, Johor §1 NJM 01-3 2001 KUL Bintan §2 NJI 01-14 2004 BIN Singapore Botanical Garden §3 NJS 04-21 2004 BOT Singapore (Oriental Aquarium) §3 NJS 01-16 2001 SIN C. nurii Furtado var. nurii Kahang-Jemaluang, Mersing, Johor §1 RR 11-16 2011 NKJ Sungai Kahang, Johor §1 RR 15-03 2015 NSK C. schulzei De Wit Hutan Lipur Panti, Kota Tinggi, Johor §1 RR 11-21 2011 SPAN Kahang-Jemaluang, Mersing, Johor §1 RR 11-17 2011 SKJ

§1 Malaysia; §2 Indonesia; §3 Singapore

stained with RedSafe™. The loci were considered successfully amplified when at least one band of the expected size was observed. A 100 bp DNA ladder (Lucigen) was used as molecular size marker and was sent for fragment analysis.

Allele frequencies with private alleles were estimated for each locus–species combination by FSTAT 2.9.3 (Goudet, 2001). Genetic distances for constructing phylogenetic trees were performed using POPTREE2 software (Takezaki et al., 2010).

Phylogenetic trees based on the proportion of shared alleles DA distances (Nei et al.,

1983), and 1000 bootstrap replications (Felsenstein, 1985), were constructed using the

Neighbour joining (NJ) method. Principal component analysis (PCA) implemented in

GenALEx version 6.5 (Peakall and Smouse, 2012) was employed on pairwise genetic distances among all 22 individuals species study. Factorial correspondence analysis

(FCA) was performed in GENETIX version 4.05 (Belkhir et al., 2004) to plot multilocus genotypes and visualize species discreteness based on the most distinctive loci. In this analysis, each row (individuals) and each column (alleles) were depicted as a point. The hyperspace had as many dimensions as there were alleles for each locus, and the algorithm attempted to find independent directions in this hyperspace.

4.3 Results

4.3.1 Analysis of 454 Sequences of Cryptocoryne cordata var. cordata

A total of 41,653 reads with an average read length of 380.4 bp and a total amount of 15,846,832 bases was obtained from 454 sequencing analysis. A total of 3636 reads containing microsatellites were found containing di-, tri-, and tetranucleotide repeat motifs. Microsatellites loci candidates were successfully assigned after discarding

reads with too short flanking sequences for a total of 608 repeats. However, 426 of these

(70%) corresponded to AT/TA repeats and were not considered because of self- complementary within DNA strains which could lead to the formation of dimers (Wang et al., 2011). Four, six, and three different types of SSR motifs were observed for di-, tri-

, and tetra-nucleotides, respectively (Table 4.3). About 164 of 182 of the acceptable dinucleotide SSRs belonged to type AG/TC (28%; 51/182) followed by CT/GA (27%;

49/182), AC/TG (23%; 42/182) and then CA/GT (12%; 22/182) (Table 4.3). The six

SSR motifs for trinucleotide were ATG/TAC, ATC/TAG, TCT/AGA, AGG/TCC,

CAT/GTA and TCG/AGC. Tetranucleotide SSR repeats were comprised of three types of repeat motifs, i.e., TGTA/ACAT, TCTA/AGAT and AGAT/TCTA. Of the remaining

182 loci, 164 were dinucleotide (90%), 13 loci trinucleotide (7%) and 5 loci were tetranucleotide (3%) microsatellite loci with more than seven repeat units (Figure 4.2).

From the 182 loci, 72 were randomly selected for initial screening with oligonucleotide primer combinations of GC content of 35–60 % and melting temperature

(Tm) ranging between 53°C and 60°C were tested for optimized PCR amplification on genomic DNA. 52 loci were removed from the analyses; did not amplify and could not be easily genotyped. From 20 loci sent for fragment analysis, 9 were monomorphic. The summary of the statistical evaluation of the primer designed were shown in Table 4.4.

The PCR amplification products for the rest of the 11 loci are shown in Plate 4.1.

For the 11 polymorphic loci, allelic diversity ranged from 2 to 6 alleles per locus from a total of 29 alleles scored in 30 individuals. The observed and expected heterozygosities ranged from 0.8190 to 1.0000 and from 0.5401 to 0.7548 respectively.

No significant linkage disequilibrium was detected across any pairs of loci. All loci

Table 4.3 Microsatellite compound motifs contained di-nucleotide, tri-nucleotide and tetra-nucleotide repeat motif from microsatellite screening

Motif type Repeat motif No. of a given motif type Frequency Dinucleotide AG/TC 51 28.0 CT/GA 49 27.0 AC/TG 42 23.0 CA/GT 22 12.0 Subtotal 164 90.0

Trinucleotide ATG/TAC 4 2.2 ATC/TAG 3 1.65 TCT/AGA 3 1.65 AGG/TCC 1 0.5 CAT/GTA 1 0.5 TCG/AGC 1 0.5 Subtotal 13 7.0

Tetranucleotide TGTA/ACAT 2 1.1 TCTA/AGAT 2 1.1 AGAT/TCTA 1 0.5 Subtotal 5 3.0 Total 182 100

% of nucleotide repeat motifs 90 80 70 60 50 40 30 20 10 0

Figure 4.2 Percentage of microsatellite motifs compound containing di-nucleotide, trinucleotide and tetra-nucleotide repeat motifs.

Table 4.4 Summary of the statistical evaluation of the primer designed

Library Primer Primer Failed to Monomorphic Polymorphic designed validation amplify Dinucleotide 164 54 43 3 8 Trinucleotide 13 13 6 5 2 Tetranucleotide 5 5 3 1 1 Total 182 72 52 9 11

M 1 2 3 4 5 6 7 8 9 10 11

200 bp

Plate 4.1 The PCR amplification products for all 11 polymorphic microsatellite marker of Cryptocoryne cordata var. cordata in 2% agarose gel stained with RedSafe™. Lane M is a 100 bp DNA Ladder (Lucigen). Lane 1-11 (CC-02, CC-03, CC-04, CC-05, CC- 09, CC-11, CC-62, CC-66, CC-67, CC-71 and CC-72).

a significant deviation from HWE (P < 0.05). Information obtained with each 11 polymorphic microsatellite loci is summarized in Table 4.5. No null alleles were detected for any loci examined, suggesting no indications of scoring error owing to stuttering or large allele dropout. All polymorphic microsatellites sequences were submitted online to the National Centre for Biotechnology Information (NCBI), http://www.ncbi.nlm.nih. gov through the GenBank submission tools, BankIt.

4.3.2 Cross Species Amplification

Cross species amplification was generally successful on all 11 other Peninsular

Malaysian Cryptocoryne species. Three loci (CC-11, CC-62 and CC-67) displayed successful amplification with a single product of appropriate size across the whole panel of Cryptocoryne (Table 4.6). Thus, this study not only provides valuable informative microsatellite loci for C. cordata var. cordata but also a subset of usable loci that cross amplifies in other Cryptocoryne. The success of transferability between various species of Cryptocoryne also provides useful information on identification of the species involved in the origin of such interspecific hybrids.

4.3.3 Parentage Analysis

These polymorphic microsatellite markers were used to investigate the origin of the interspecific hybrid C. ×purpurea nothovar. purpurea found in several locations in

Peninsular Malaysia. From the cross species amplification table (Table 4.6), it showed that only six primers (CC-03, CC-11, CC-62, CC-66, CC-67 and CC-72) were successfully amplified across these five species namely C. cordata var. cordata, C.

×purpurea nothovar. purpurea, C. griffithii, C. nurii var. nurii and C. schulzei. Thus,

Table 4.5 Characteristics of 11 microsatellite loci isolated for Cryptocoryne cordata var. cordata obtained from 30 individuals: locus name, forward (F) and reverse (R) primer sequences, repeat motif and frequency, expected fragment size, fluorescent dye, (Ta) annealing temperature, (NA) number of alleles, (HE) expected and (HO) observed heterozygosities and GenBank Accession no

Locus Primer Sequence (5’-3’) Repeat Motif Size Dye Ta NA HE HO Accession (bp) (oC) no. CC-02 F: AAGGGCCAACCCCGAATAAG (GA)20 140 FAM 54.0 2 0.5672 0.9800 KR012392 R: AACAAGCACAACATTCCGTC CC-03 F: TTGTCCACAGGGATGAGCAC (TCTA)7 176 HEX 60.0 3 0.5791 0.9200 KR012393 R: GCATGGTAGACAAGTGCAGG CC-04 F: GGCATAGGGTGCTCACAAAG (AGG)9 200 FAM 60.0 4 0.6316 1.0000 KR012394 R: TGCTAGCCACTGTTCTCTCC CC-05 F: CTAGAGGAAGCAATGGCGAC (AG)17 248 FAM 60.0 3 0.5672 0.9800 KR012395 R: CACACATTGGTGACGACTTAAAC CC-09 F: TTTAGAGTGTTCGTTCGTTCG (GA)21 144 HEX 54.0 2 0.5836 1.0000 KR012396 R: GGGTAGTCAGCACTGTCGTC CC-11 F: TCCTTGAACCAACACCTGTC (AG)17 159 TAMRA 60.0 2 0.5791 0.9600 KR012397 R: AGCAATGCATGAACGTGAGG CC-62 F: ATGACCTGCCAAAACTGACG (GA)11 198 HEX 60.0 2 0.5791 0.9600 KR012398 R: ACACTCTCACTAAACATGGCTAAC CC-66 F: AATGCCAAAGGCTGAGATCC (GA)12 228 FAM 60.0 2 0.5672 0.9800 KR012399 R: GTGCAGTCCGTTGAAGTAGG CC-67 F: TGCTGACATTTTAGACAACCC (TCT)14 190 TAMRA 60.0 3 0.5401 0.8190 KR012400 R: GTGACCAATGAGGGAGCTTG CC-71 F: AGACTGGACTAGCCACATCG (GA)11 145 HEX 60.0 4 0.5412 0.9300 KR012401 R: TGTCTTTGCTATTGGCCACC CC-72 F: GGAGAAACAGCAAAATGACCAG (GA)11 179 FAM 60.0 6 0.7548 1.0000 KR012402 R: AGTTCTCTCTCTCTCTCATGAC

Table 4.6 Characterization of microsatellite loci isolated from C. cordata var. cordata and cross species amplification with eleven others Cryptocoryne species in Peninsular Malaysia

Locus C. affinis C. ciliata C. C. C. C. minima C. nurii C. nurii C. C. C. near var. cordata elliptica griffithii var. nurii var. ×purpurea schulzei zukalli, 2n ciliata hybrid, 2n raubensis nothovar. = 68 = 68 purpurea CC-02 2 - - 2 2 - - - 2 2 2 (136-138) (126-128) (142-144) (124-126) (135-137) (147-149) CC-03 - 2 - 2 2 2 2 2 2 2 2 (163-167) (171-175) (171-175) (171-175) (173-177) (173-177) (171-175) (171-175) (167-171) CC-04 - - 2 - - - - - 2 - 2 (194-196) (191-194) (194-198) CC-05 2 ------(256-258) CC-09 - - 2 - - 2 - - 2 - 2 (133-135) (140-142) (124-126) (136-138) CC-11 2 2 2 2 2 2 2 2 2 2 2 (153-155) (155-157) (151-155) (156-158) (161-163) (147-149) (149-151) (149-151) (153-155) (140-142) (151-153) CC-62 2 2 2 2 2 2 2 2 2 2 2 (218-220) (200-202) (184-186) (188-190) (188-190) (190-192) (188-190) (188-190) (198-200) (186-188) (182-184) CC-66 - 2 2 2 2 2 2 2 2 2 2 (215-217) (220-222) (219-221) (218-220) (236-238) (230-232) (230-232) (228-230) (238-240) (228-230) CC-67 2 2 2 2 2 2 2 2 2 2 2 (190-194) (190-194) (190-194) (190-194) (190-194) (189-193) (190-194) (190-194) (190-194) (190-194) (190-194) CC-71 - - 2 - 2 - 2 - 2 - - (140-142) (141-143) (141-143) (140-142) CC-72 2 - 2 - 2 - 2 2 2 2 2 (158-160) (179-181) (179-181) (185-187) (185-187) (180-182) (190-192) (178-180)

Above, number of alleles per locus; below, allele range size per locus; (-), no amplification

these markers were then used in the species examined from different locations in order to detect potential intraspecific sequence polymorphism. The parent of C. ×purpurea nothovar. purpurea was determined by comparing the allele size for six microsatellite loci of four Cryptocoryne species (Table 4.7).

Cryptocoryne ×purpurea nothovar. purpurea DNA samples from eight different locations were compared and the results showed that all samples had the same allele size for locus CC-03 and CC-67 (Table 4.7). For the rest of loci, samples from Tasik Bera

Pahang region (PI, KJ and PK) were grouped together and had the same allele size for each locus. Samples from Johor (SED and SL) and Melaka (MT, PT and SU) shared the same allele size for each locus except for locus CC-62. In this study, C. cordata var. cordata from five different locations showed differences in the allele sizes for all loci, except for CC-03 and CC-67. This was also observed in C. griffithii as there were differences in the allele size from their samples taken from different locations except for locus CC-03 and CC-67. For C. nurii var. nurii accessions, no variation was detected between all locus except for locus CC-62 and CC-67. But for C. schulzei accessions, the variation was only detected for locus CC-11.

The polymorphism of these six microsatellite loci indicated that putative hybrid individuals presented similar genetic profiles to those observed for C. cordata var. cordata and C. griffithii individuals (Table 4.7). Shared alleles between C. ×purpurea nothovar. purpurea and C. schulzei were observed from two loci namely CC-03 and CC-

67. Cryptocoryne nurii var. nurii and C. ×purpurea nothovar. purpurea shared alleles from a single locus namely CC-67. Table 4.8 shows the different allele sizes scored among the

Table 4.7 Characterization of six microsatellite loci for parentage identification

Species Population Locus CC-03 CC-11 CC-62 CC-66 CC-67 CC-72 C. ×purpurea Ridl. nothovar. purpurea MT 171,175 151,153 200,202 220,222 190,194 178,180 PT 171,175 151,153 200,202 220,222 190,194 178,180 SU 171,175 151,153 200,202 220,222 190,194 178,180 PI 171,175 153,155 198,200 228,230 190,194 180,182 KJ 171,175 153,155 198,200 228,230 190,194 180,182 PK 171,175 153,155 198,200 228,230 190,194 180,182 SED 171,175 151,153 198,200 220,222 190,194 178,180 SL 171,175 151,153 198,200 220,222 190,194 178,180 C. cordata Griff. var. cordata GA 171,175 153,155 198,200 228,230 190,194 178,180 PAN 171,175 151,153 200,202 224,226 190,194 176,178 MU 171,175 153,155 200,202 222,224 190,194 178,180 ST 171,175 153,155 198,200 228,230 190,194 180,182 BS 171,175 149,151 198,200 228,230 190,194 180,182 C. griffithii Schott GF 171,175 153,155 192,194 228,230 190,194 180,182 KUL 171,175 153,155 192,194 228,230 190,194 180,182 BIN 171,175 161,163 188,190 218,220 190,194 178,180 BOT 171,175 153,155 198,200 228,230 190,194 180,182 SIN 171,175 153,155 198,200 228,230 190,194 180,182 C. nurii Furtado var. nurii NKJ 173,177 149,151 188,190 230,232 190,194 185,187 NSK 173,177 149,151 186,188 230,232 192,196 185,187 C. schulzei De Wit SPAN 171,175 140,142 186,188 238,240 190,194 190,192 SKJ 171,175 142,144 186,188 238,240 190,194 190,192

Cryptocoryne species and the allelic frequencies with private allele. The number of private allele across species in this study were from 3 (C. cordata var. cordata) to 7 (C. nurii var. nurii). No private alleles were found to be in C. ×purpurea nothovar. purpurea. For C. cordata var. cordata accessions, the PAN (Kota Tinggi, Johor) was the sample which contained the most private alleles and was distinct from the others. For C. griffithii samples, the most distinct allele was from BIN (Bintan, Indonesia).

The genetic relationship among species (Figure 4.3) suggested close affinities among C. ×purpurea nothovar. purpurea and C. cordata var. cordata with a bootstrap value 99% and group together with C. griffithii with a bootstrap value 81%. The PCA analysis of all individuals (Figure 4.4) also showed the close relationship between C.

×purpurea nothovar. purpurea, C. cordata var. cordata and C. griffithii compared to C. nurii var. nurii and C. schulzei. The first three coordinates explained 74.04% of the total variation. In addition, the same results also come out from FCA analysis which showed the proximity of C. cordata var. cordata and C. griffithii genotypes was more apparent, and the hybrids were placed within the distribution of these two taxa (Figure 4.5). For C. nurii var. nurii and C. schulzei genotypes showed more distinctiveness from other species. This analysis considers the entire allele to be a representation of one individual for plotting in the hyperspace.

Table 4.8 Allele sizes and frequencies at six microsatellite loci in five Cryptocoryne species. Private alleles (*). (Bold) = Shared alleles with C. ×purpurea nothovar. purpurea Locus Allele Species C. ×purpurea C. cordata C. griffithii C. nurii C. schulzei Ridl. nothovar. Griff. var. Schott Furtado De Wit purpurea cordata var. nurii CC-03 171 0.5 0.5 0.5 0 0.5 173 0 0 0 0.5* 0 175 0.5 0.5 0.5 0 0.5 177 0 0 0 0.5* 0 CC-11 140 0 0 0 0 0.5* 142 0 0 0 0 0.5* 149 0 0.1 0 0.5 0 151 0.313 0.2 0 0.5 0 153 0.5 0.4 0.2 0 0 155 0.188 0.3 0.2 0 0 159 0 0 0.2* 0 0 161 0 0 0.3* 0 0 163 0 0 0.1* 0 0 CC-62 186 0 0 0 0.25 0.5 188 0 0 0.1 0.5 0.5 190 0 0 0.1 0.25 0 192 0 0 0.2* 0 0 194 0 0 0.2* 0 0 198 0.313 0.3 0.2 0 0 200 0.5 0.5 0.2 0 0 202 0.188 0.2 0 0 0 CC-66 218 0 0 0.1* 0 0 220 0.313 0 0.1 0 0 222 0.313 0.1 0 0 0 224 0 0.2* 0 0 0 226 0 0.1* 0 0 0 228 0.188 0.3 0.4 0 0 230 0.188 0.3 0.4 0.5 0 232 0 0 0 0.5* 0 238 0 0 0 0 0.5* 240 0 0 0 0 0.5* CC-67 190 0.5 0.5 0.5 0.25 0.5 192 0 0 0 0.25* 0 194 0.5 0.5 0.5 0.25 0.5 196 0 0 0 0.25* 0 CC-72 176 0 0.1* 0 0 0 178 0.313 0.3 0.1 0 0 180 0.5 0.4 0.5 0 0 182 0.188 0.2 0.4 0 0 185 0 0 0 0.5* 0 187 0 0 0 0.5* 0 190 0 0 0 0 0.5* 192 0 0 0 0 0.5*

C. nurii var. nurii

C. ×purpurea nothovar. purpurea 99

81 C. cordata var. cordata

C. griffithii

C. schulzei

0.05

Figure 4.3 Genetic relationships among five species generated using Neighbour joining (NJ) calculated from six microsatellite markers. The bootstraps values for 1000 replicates are listed above the branches. Branch lengths are proportional to the genetic distance between nodes.

)

2 Axis (14.48

Axis 1 (74.04)

C. ×purpurea nothovar. purpurea

C. cordata var. cordata

C. griffithii

C. nurii var. nurii

C. schulzei

Figure 4.4 Principal component analysis (PCA) of 22 individuals from five species accessions (C. ×purpurea nothovar. purpurea, C. cordata var. cordata, C. griffithii, C. nurii var. nurii and C. schulzei) based on six microsatellite markers.

Axe

(15.23

(21.99

Axe

Axe 1 (25.99%) C. ×purpurea nothovar. purpurea C. cordata var. cordata C. griffithii C. nurii var. nurii C. schulzei Figure 4.5 Factorial correspondence analysis (FCA) based on multilocus genotypes from five species accessions (C. ×purpurea nothovar. purpurea, C. cordata var. cordata, C. griffithii, C. nurii var. nurii and C. schulzei) derived from six microsatellite markers.

4.4 Discussion

4.4.1 Development of Microsatellite through Next Generation Sequencing

In recent years, microsatellites are among the most frequently used DNA markers in many areas of plant research including examination of genetic relationships between individuals, population genetics, marker assisted selections, mapping of useful genes and construction of linkage maps (review by Kalia et al., 2011). However, their availability and quality are limited by the difficulties of de novo development. The traditional method involved enriched DNA library was the most commonly used procedure for characterization of microsatellite motifs. In addition, cloning and sequencing are difficult, time-consuming and costly. Enrichment methods generally use a few specific repeated motifs, generally selected without prior knowledge of their abundance in the genome (Castoe et al., 2010), hence introducing potential bias in genome representativeness. Recent advances in sequencing technologies, NGS through

454 GS-FLX Titanium (Roche Applied Science) has opened up new opportunities for microsatellite isolation in non-model organisms (Hudson, 2008; Morozova and Marra,

2008; Zalapa et al., 2012). It is possible to significantly lower the cost of microsatellite isolation by incorporating NGS in place of the hitherto conventional Sanger sequencing.

Additionally, NGS based approaches circumvent the cloning step, making it possible to sequence more fragments than those limited by successful cloning into plasmid vectors during library construction in Sanger sequencing (Castoe et al., 2010).

In this study, the use of 454 GS-FLX is feasible to detect microsatellites by shotgun sequencing, whereby candidate microsatellites are identified from a set of randomly sampled shot gun reads as done in the studies by Abdelkrim et al. (2009),

Allentoft et al. (2009) and Castoe et al. (2010). In addition, an enrichment step for specific microsatellites was also incorporated prior to sequencing. Based on Malausa et al. (2011), the enrichment step increased the number of microsatellite loci isolated while reducing the proportion of unwanted motifs such as AT motifs which present difficulty during amplification. Based on their findings, enrichment improved isolation efficiency by close to 300%. Secondly they suggest that enrichment increases the number of multiple reads obtained for a particular microsatellite locus, thus it is possible to design primers targeting non polymorphic sequences that flank microsatellite motifs.

This diminishes the chances of designing markers with a high percentage of null alleles owing to mismatches between primers and polymorphic nucleotides in flanking regions that can occur in some individuals or populations.

The use of 454 GS-FLX in this study has enabled the production of large numbers of sequences at reduced cost and time. Consequently, it has been possible to develop a large number of microsatellites for use in studying Cryptocoryne. This has been achieved without having to sub clone the DNA into vectors and amplifying them in hosts, as it would have been necessary if Sanger sequencing was employed. The technique has resulted in the production of markers that can be easily and reproducibly detected by PCR. These are attributes that make them ideal for future genetic studies in clonal plant Cryptocoryne. In most of the studies, 454 GS-FLX is the dominant platform used for SSR isolation. This is attributed to the fact that the read length of between 350-600 bp per read is sufficiently long to allow detection of SSRs directly from raw reads (Zalapa et al., 2012). Sequence errors are as low as <1% (Margulies et al., 2005). Recently, a number of microsatellites marker isolation studies using 454 GS-

FLX sequencing have been reported in several plant studies including; Typha minima

Hoppe (Csencsics et al., 2010), Rhododendron ferrugineum L. (Delmas et al., 2011, the orchids- Cypripedium kentuckiense C. F. Reed and Pogonia ophioglossoides (L.) Ker

Gawl. (Pandey and Sharma, 2012), Eucalyptus victrix L.A.S. Johnson & K. D. Hill

(Nevill et al., 2013) and Acacia dealbata Link (Guillemaud et al., 2015). In this study, the frequency of microsatellites from C. cordata var. cordata using 454 GS-FLX can be considered relatively high when compared to the microsatellites from C. ×purpurea nothovar. purpurea using enriched library method by Rosazlina et al., (2011). The number of reads generated in this study was about (3636 reads) per sample containing microsatellites motif than the mean number of reads in (95) per plate using the classical sequencing method. This clearly indicates that the efficiency of microsatellite isolation in Cryptocoryne using the next generation sequencing is thousand folds higher than using the traditional method.

The number of dinucleotide SSRs in C. cordata var. cordata was higher than tri- and tetra-nucleotides which indicate that the genomes of these species are rich in dinucleotide repeats. In the analysis of microsatellite distribution in monocots

(Brachypodium, Sorghum and Oryza) and dicots (Arabidopsis, Medicago and Populus) by Sonah et al., (2011), they found that the frequency of SSRs was considerably higher among dicots compared to monocots and the frequency of SSRs decreased stepwise with increase in motif length (mono- to hexa- nucleotide repeats). Other studies have also reported higher percentage of dinucleotide microsatellite repeats than tri-and/or tetranucleotide repeats in plants : e.g., Toth et al., 2000 (55% di-nucleotides, and 45% trinucleotides), Pan et al., 2010 (46% dinucleotides, 34% trinucleotides, 8%

tetranucleotides, and 12% others), Buehler et al., 2011 (89% dinucleotides, 9% trinucleotides and 2% tetranucleotides) and Mantello et al., 2011 (57% dinucleotides and

43% trinucleotides). In plant genomes, the most abundant patterns found are (AT) n,

(GA) n, and (GAA) n where n refers to the total number of repeats, usually ranging from

10 to 100 (Kantartzi, 2013). Increased intra- and inter-genetic variation is observed when the number of repeats is increased (Queller et al., 1993) and was a major consideration in this study to select only locus with repeats motif more than seven for primer validation.

In this study, 426 from 608 microsatellites motifs corresponded to AT/TA repeats and were not considered for primer design because of self-complementary within

DNA strains which could lead to the formation of dimers (Wang et al., 2011) and therefore is difficult to screen for by colony hybridization (Butcher et al., 2000). Other than that, the most abundant dinucleotide motif in C. cordata var. cordata genome was

(AG/TC), (CT/GA), (AC/TG) and this is similar with endemic clonal seagrass Posidonia oceanica (L.) Delile (Alberto et al., 2003), Oryza and Brassica (Uzunova and Ecke,

1999; Guyomarc et al., 2002) and they are well distributed throughout the genome, thus ensuring good genome coverage. Other plant surveys have found that the most frequently occurring dinucleotide repeats (AT) n, with (AG) n and (AC) n as second and third most frequent (Lagercrantz et al., 1993; Morgante and Olivieri, 1993; Wang et al.,

1994; Echt and May-Marquardt, 1997). For example the study by Sonah et al., (2011), found AT/AT repeats were most frequent in Populus, Medicago and Arabidopsis and followed by repeat motif AG/CT and AC/GT. These findings conclude that the distribution of SSRs in different motif types was not uniform and the most frequent

motif type was different for each plant species in dinucleotide repeat category (Sonah et al., 2011; Kantartzi, 2013).

The dominant occurrence of repeat motifs of a particular sequence, length and the unique microsatellite distribution patterns in plant genomes is the outcome from several factors such as codon preference, DNA replication and the mismatch repair system, as well as structural and functional attributes of genomes that are unique to the species or for the particular taxon (Sonah et al., 2011). Moreover, the SSR length, motif structure and G/C content of a genome are considered to be factors influencing microsatellite evolution (Chakraborty et al., 1997; Whittaker et al., 2003). Another explanation, for this variability is that they may simply reflect the differences in developing procedure including enrichment or screening procedures (Butcher et al.,

2000). There is also evidence that the repeat type and number are influenced by the restriction enzyme used to size fractionate the genome when constructing the library

(Hamilton and Fleischer, 1999).

4.4.2 Polymorphic Microsatellite Description

The eleven polymorphic loci produced a total of 29 alleles and the number of alleles detected per locus ranged from 2 to 6 in 30 individuals of C. cordata var. cordata. The microsatellite genotyping results from this study is typical of the low polymorphism phenomenon documented in aquatic plant which propagate through rhizome. This phenomenon is supported by Brzyski (2010), who studied it in development of the rare clonal shrub, Spiraea virginiana Britt. (Rosaceae) using 11 microsatellite loci, the low number of alleles per locus ranged from 1 to 4.

100

In this study, all 11 loci significantly deviated from Hardy-Weinberg Equilibrium

(HWE) (P< 0.05) after sequential Bonferroni adjustment for multiple tests (Rice, 1989).

This is due to limited number of samples from only one and highly clonal population.

The decrease in population size can reduce the number of alleles in populations

(Brennan et al., 2003). Kalinowski (2004) pointed out that large samples are expected to contain more genotypes than small samples. In addition, small populations might lose genotypic variation due to genetic drift and population bottlenecks (Young et al., 1996;

Lowe et al., 2004). The relatively small population size is likely to result in further genetic divergence through drift. No loci were in linkage disequilibrium (LD). No null alleles were detected for any loci examined, suggesting no indications of scoring error owing to stuttering or large allele dropout.

4.4.3 Cross Species Amplification Ability

The ability of primers from one species to amplify homologous loci in related species is crucial to the use of microsatellites for assessing the genetic variation within and among species (Kijas et al., 1995). Microsatellite markers have also been used in several studies to define conserved regions among related species using NGS; including

Prunus virginiana L. (Wang et al., 2012), Grevillea (Hevroy et al., 2013), Macadamia

(Nock et al., 2014), Boswellia (Addisalem et al., 2015) and Carthamus (Ambreen et al.,

2015). Moreover sequenced genomes can be effectively used for the generation of molecular markers and their cross species utilization, specifically for those species where very little or no genomic information is available. The present work was intended to determine the extent to which pairs of primers designed for the amplification of microsatellite loci in C. cordata var. cordata can be used for assessing its sister taxa.

101

Transferability of C. cordata var. cordata microsatellite markers across eleven sister taxa was confirmed in this study. Most of the 11 primer pairs optimized allowed reliable amplification of Cryptocoryne species (Table 4.6), suggesting homology in the genomic segments containing the studied SSR loci. Cross taxa amplification for most SSR primer pairs appears to be common in the genus Cryptocoryne, as has also been shown by

Rosazlina et al. (2011). This indicated that the sequences flanking the microsatellite regions in C. cordata var. cordata are highly conserved across taxa. In some instances, spurious amplification products were produced, but they were outside the expected size range of alleles. A decline of amplification success was observed with the increase of genetic distance among species (Steinkellner et al., 1997; White and Powell, 1997). The result obtained with these microsatellite markers agreed with the findings reported for

ITS of the nrDNA markers (Othman et al., 1997) that C. affinis, C. ciliata, C. elliptica,

C. minima, C. nurii var. nurii and C. schulzei are the species more distantly related to C. cordata var. cordata and certain amplification products were not detected. In species with low degrees of relationship, therefore, the same microsatellite loci cannot be found

(Roa et al., 2000).

4.4.4 Parentage Identification

Genotypic exclusion especially for hybrid identification requires markers with very high exclusion power, which is determined by the number of loci and their level of polymorphism (Evett and Weir, 1998). Dominant markers are very limited in their ability to precisely determine parentage and frequently present problems when conclusively establishing absolute identity between two individual plants due to artifact polymorphisms (Kirst et al., 2005). However, microsatellites have been shown to be

102

almost twice as informative as dominant markers (RAPD and AFLP) and much more informative than RFLPs in soybean (Powell et al., 1996), and approximately six times more informative than RAPD and nine times more informative than allozyme in Popolus

(Rajora and Rahman 2003), being the ideal marker for discriminating individuals and for parentage determinations. Microsatellite are typically codominant and multiallelic allowing precise discrimination even of closely related individuals. Due to the specificity of the PCR assay and its high information content, it also allows the determination of identity between individuals based on formal estimates derived from allele frequencies (Kirst et al., 2005). In this study, the newly developed six diagnostic loci were utilised because they showed high numbers of alleles across species examined.

In some instances, variation was also observed among species indicating the examined loci were highly polymorphic. This may be attributed to mutation events. Microsatellite markers are known to show high levels of mutation rates observed at molecular loci

(Ellegren, 2004). Examples of successful parentage identification using microsatellite markers include between Arachis (Gomez et al., 2008), Gossypium (Asif et al., 2009) and Garcinia (Abdullah et al., 2012).

Cryptocoryne ×purpurea nothovar. purpurea presenting an intermediate morphology were considered to be interspecific hybrids due to their inflorescence morphological traits - especially collar zone and limb of the spathe. Jacobsen (1982) was the first to hypothesize that C. ×purpurea nothovar. purpurea was an interspecific hybrid between C. cordata var. cordata and C. griffithii based on the coherence of morphological characters (broad collar zone – C. cordata, and purple, rough spathe limb

– C. griffithii). Hybrids resulting from crosses between distantly related species exhibit

103

abnormalities during pairing and disjunction (separation) in the meiosis process.

Developing pollen cells, are often difficult to obtain, and when they do occur they are usually sterile (Krebs, 1997). The C. ×purpurea nothovar. purpurea pollen fertility analysis has been done by staining with Lactophenol Cotton Blue (Jacobsen, 1977). The pollen stainability of 0-15%, indicate that C. ×purpurea nothovar. purpurea is a sterile hybrid and possibly from two distantly related species, C. cordata var. cordata and C. griffithii (Jacobsen, 1977).

The variation found between C. ×purpurea nothovar. purpurea accessions (Table

4.7), is assumed to be due to the result of multiple hybridization events between different genotypes of C. cordata var. cordata and C. griffithii. The involvement of different parental genotypes would explain the differences observed in different allele sizes in C. ×purpurea nothovar. purpurea accessions. The putative hybrid possessed alleles that were unique to C. cordata var. cordata or C. griffithii (Table 4.8), thereby highlighting the ability of these markers to identify hybridization between these species.

In addition, due to the high degree of multiallelism and the clear and simple codominant

Mendelian inheritance that bring alleles from one generation to the other, the microsatellites loci used in each C. ×purpurea nothovar. purpurea individuals may hold a unique fingerprint and provide an extremely powerful system for the unique identification of Cryptocoryne individuals for fingerprinting purposes and parentage testing.

The high similarity of allele sizes shared between C. ×purpurea nothovar. purpurea, C. cordata var. cordata and C. griffithii supports the idea that C. cordata var. cordata and C. griffithii are the parents of C. ×purpurea nothovar. purpurea, as

104

suspected by Jacobsen (1982). Meanwhile, C. nurii var. nurii and C. schulzei shared only one and two (respectively) allele size with C. ×purpurea nothovar. purpurea.

Instead, all the possible loci strongly suggested that C. nurii var. nurii and C. schulzei were not involved in contributing allele to C. ×purpurea nothovar. purpurea. The samples for each species from different locations were included in this study to represent the entire geographic distribution of all taxa and to minimize the population effect.

The close relationship between C. cordata var. cordata, C. griffithii and C.

×purpurea nothovar. purpurea was confirmed and supported by this study. The phylogenetic tree, PCA and FCA analysis give strong and clear evidence to the hypothesis that both C. cordata var. cordata and C. griffithii are the parents of C.

×purpurea nothovar. purpurea. Based on the close similarity between all accessions examined for microsatellite data, it is unlikely that C. schulzei and C. nurii var. nurii are parents to C. ×purpurea nothovar. purpurea.

The advantages of using C. cordata var. cordata for microsatellite development is it able to show the evidence of alleles present in putative parent and also the inheritance of the alleles in the hybrid. In fact, Cryptocoryne cordata varieties have been shown to contribute in several natural hybridization events within Cryptocoryne including C. ×purpurea nothovar. purpurea (C. cordata var. cordata × C. griffithii)

(Jacobsen, 1982), C. ×decus-silvae (C. cordata var. cordata × C. nurii var. nurii)

(Jacobsen et al., unpublished), C. ×zukalii (C. cordata var. cordata × C. minima)

(Jacobsen et al., unpublished), C. ×purpurea nothovar. borneoensis (C. cordata var. grabowskii × C. griffithii) (Jacobsen et al., 2002) and C. ×batangkayanensis (C. cordata var. grabowskii × C. ferruginea Engl. var. ferruginea) (Ipor et al., 2015). Since C.

105

cordata is the one of the putative parent in the above hybrids listed, it is worthwhile to isolate microsatellite loci of C. cordata var. cordata and evaluate these microsatellite loci in the cross transferability between taxa and rendering them useful in the determination of other Cryptocoryne hybrids.

These microsatellite data enable the unravelling of these evolutionary processes in future population studies. Moreover, the microsatellite loci used will be able to differentiate various taxa. This results also suggest that microsatellite markers may constitute a useful tool for evolutionary and ecological studies involving these species.

The effects of morphological differences and adaptive genetic differentiation to maintain the processes of speciation involving closely related species with the ability to hybridize in nature raise interesting questions, and Cryptocoryne species are an excellent model for this area of study. A much more detailed sampling procedure is therefore needed to investigate the inter-species polymorphism of microsatellites in Cryptocoryne. Because of such possible mutation events, the diagnostic microsatellite loci showing unambiguous parental contributions to progeny should be sought to diagnose the parentage.

4.5 Conclusion

The diagnostic microsatellite markers described in this study are useful for typing the various Cryptocoryne hybrid and confirmed their parentage. This could not be achieved by using morphological analysis only. Further experiments especially analyses of crossbreeding systems are necessary to answer the remaining evolutionary questions about the Cryptocoryne species and speciation processes within this genus.

106

CHAPTER FIVE

CLONAL DIVERSITY AND SPATIAL GENETIC STRUCTURE IN Cryptocoryne ×purpurea Ridl. nothovar. purpurea AS DEFINED BY AFLP MARKERS

5.1 Introduction

Many aquatic plant species including Cryptocoryne are characterized by the ability to reproduce both sexually and clonally. Based on research by Jacobsen (1977), the pollens in Cryptocoryne ×purpurea nothovar. purpurea are completely sterile. Thus the hybrid propagates only via vegetative propagation (clonal growth) through rhizomes although flowering is frequently observed (Jacobsen, 1977). Within a clonal species, sexually produced seeds give rise to the genetic individual termed the genet (Harper and

White, 1974). Initially, the genet is composed of all tissue originating from one zygote, but through a process of clonal growth, it will produce multiple, potentially autonomous individuals termed ramets. In theory, ramet is an independent part of a genet derived by asexual reproduction, genotypically identical and will be referred to henceforth as clonemates (Eriksson, 1993).

In general, in populations where reproduction is predominantly clonal plants exhibit low levels of genetic diversity (Hamrick and Godt, 1996) and thus will decreases genetic variability in natural populations (Salzman and Parker, 1985). Due to the high sterility in this hybrid, there is no opportunity for the introduction of new genotypic variation through gene flow or recombination. Moreover, clonal populations are expected to be less genotypically diverse, and to exhibit greater among-population

107

genetic divergence (Silvertown, 2008; Vandepitte et al., 2010). There are assumptions that asexual lineages are devoid of genetic variation and may allow sterile hybrids to form persistent populations and stabilize hybrid lineages (Mallet, 2007; Marques et al.,

2011) since heterozygosity is preserved within clonal lineages (Balloux et al., 2003).

High sterility in clonal plants can have an impact on the pattern of genetic variation present within and between populations (Bengtsson, 2003). Given the limited ability to create new genetic combinations in the absence of sexual reproduction, the standing levels of genetic variation in clonal hybrids are likely to be relevant for understanding how sterile taxa persist and spread after their origination (Vallejo-Marin and Lye, 2013).

Since there are some variations in the colouration and also in the surface structure of the limb of the spathe in C. ×purpurea nothovar. purpurea from different localities, it would be important to investigate this hybrid genetic structure to detect any discernible patterns in their genetic diversity. The Amplified Fragment Length Polymorphism (AFLP) analysis has been largely documented in the literature on clonal plant population study because of the high amount of polymorphism they can detect (Mueller and

Wolfenbarger, 1999) and is an efficient tool to identify individual genotypes at the landscape scale in a species described to be highly clonal (Kreivi et al., 2005). Thus, this chapter will be focusing in clonal assignment of C. ×purpurea nothovar. purpurea using

AFLP markers. Therefore the main objectives of this study are:-

1. To develop AFLP markers for C. ×purpurea nothovar. purpurea suitable for

clonal assignment.

2. To define the clonal diversity and spatial distribution of ramets between

populations.

108

5.2 Materials and Methods

5.2.1 Sample Collection

The primary study sites were in two different regions namely Melaka and Pahang represented by three populations in each region. In Melaka, the hybrid grows in the muddy swamp area in the small forests and they are also stands in the pond exposed to the sun. In Pahang, the plants were found in large and deep black water swamp. Every population consist of a different number of patches depending on the size of the populations. Patches were defined as continuous C. ×purpurea nothovar. purpurea cover with no breaks greater than 2 m. Patch margins and sizes were determined using a tape measure throughout the study area. At each sampling point, the leaf was taken from the nearest ramet. Systematic sampling was chosen as it is preferable for autocorrelation analyses (Epperson, 1993). The details of the populations examined is shown in Table

5.1 and Plate 5.1.

5.2.2 DNA Extraction and Quantification

DNA was extracted using CTAB method according to Doyle and Doyle (1990).

The steps of DNA extraction, quantified, and qualified are the same methods used in

Chapter Three and Chapter Four as previously described. AFLP reactions require approximately 500 ng of high quality DNA (low fragmentation and high purity).

5.2.3 DNA Restriction, Digestion and Ligation

The AFLP protocol for C. ×purpurea nothovar. purpurea was adapted from Vos et al. (1995) with additional modifications as suggested by Gastony Lab at Indiana

University (Nakazato et al., 2006) as well as modifications specific to this study. Several

109

Table 5.1 The details of the C. ×purpurea nothovar. purpurea populations examined for AFLP study

Region Population No of Number Voucher Abbreviation Patches of number samples Masjid Kg. Pulau Semut 4 40 RR 11–06 MT Tanah, Padang Tembak 5 20 RR 12–01 PT Melaka Sungai Udang 2 10 RR 12–02 SU

Tasik Pos Iskandar 14 34 RR 13–07 PI Bera, Kg. Jelawat 7 40 RR 13–08 KJ Pahang Paya Kelantong 9 27 RR 13–09 PK

110

Pahang

Melaka

15.3 km 3.5 km

4.0 km

1.5 km

Plate 5.1 Map showing the details of the Cryptocoryne ×purpurea nothovar. purpurea populations together with image of locations studied.

111

procedures were performed to minimize genotyping error in the final data. Briefly, for each individual sample, genomic DNA was digested with EcoRI and MseI restriction enzymes (New England Biolabs (NEB), Ipswich, MA) and was incubated for 1 hour at

37°C and 16°C for 3 hours in a 40 μL reaction mixture. This reaction mixture was then ligated to double-stranded adapters in a reaction containing 1 X T4 ligase buffer [50 mM

Tris-HCl (pH 7.5), 10 mM MgCl2, 10 mM dithiothreitol, 1 mM ATP] [New England

Biolabs (NEB), Ipswich, MA], 0.05 M NaCl, 0.045 mg/ml BSA, 1 μM EcoRI adapter, 5

μM MseI adapter, 5 U EcoRI (NEB), 5 U MseI (NEB) and 1 U T4 DNA ligase (NEB) and was incubated for 3 hours at 16°C. The sequences and stock preparation of adapters used in this study are shown in Table 5.2. The ligation of adaptors to restriction fragments generates a template for the subsequent polymerase chain reactions (PCR).

5.2.4 Preselective Amplification

PCR preselective amplification of the previous restriction/ligation product was performed. The PCR reactions were performed with a thermal cycler (Bio-Rad) in a 20

μL reaction containing the restriction/ligated DNA, a mixture containing 10 μΜ

EcoRI+A primer (5’－GAC TGC GTA CCA ATT CA－3’), 10 μM MseI+C primer (5’

－GAT GAG TCC TGA GTA AC－3’), 2.0 mM MgCl2, 0.2 mM dNTPs, 10 X PCR buffer [100 mM Tris-HCl (pH 8.3), 500 mM KCl] and GoTaq Flexi DNA polymerase

(Promega). The PCR amplification protocol consisted of 72°C for 2 minutes and 94°C for 1 minute followed by 35 cycles of the following profile; 94°C for 30 seconds, 56°C for 30 seconds and 72°C for 1 minute with a final hold of 72°C for 2 minutes. To check the success of the amplification reaction, 10 μL of the preselective amplification product were mixed with 2 μL of 6 X loading dye and run on 2.0% agarose gel in 1 X TBE

112

Table 5.2 The sequences and stock preparation of adapters

EcoRI adapter Reagents Concentration Amount stock (µL) EcoRI adapter 1 (5’－CTC GTA GAC TGC GTA CC－3’) 100 pmoles/µL 1.7 EcoRI adapter 2 (5’－AAT TGG TAC GCA GTC TAC－3’) 100 pmoles/µL 1.5 EcoRI NEB Buffer 10 X 3.0 sdH2O 53.8 Total 60.0 MseI adapter Reagents Concentration Amount stock (µL) MseI adapter 1 (5’－GAC GAT GAG TCC TGA G－3’) 100 pmoles/µL 16.0 MseI adapter 2 (5’－TAC TCA GGA CTC AT－3’) 100 pmoles/µL 14.0 MseI NEB Buffer 10 X 3.0 sdH2O 27.0 Total 60.0

113

buffer at 110 V for 1 hour. A standard DNA ladder 1 kb (Lucigen) was used as a marker.

The gel was stained using RedSafe™, and the image was visualized with UV light on a

UV transilluminator (Bio-Rad) and captured using electrophoresis documentation and analysis system Gel-Doc software. Successful amplification was confirmed by presence of a smear in the range of 100-800 bp. The amplified products were diluted 20 fold using

TE buffer (15 mM Tris-HCl buffer pH 8.0 containing EDTA) and stored at 4°C.

5.2.5 Selective Amplification

Three primers specific for MseI and another three primers specific for EcoRI were selected which resulted in nine primer pair combinations on a test panel of 12 representative samples (Table 5.3). Selective amplification was conducted using three selective primer sets based on reproducibility, number of band produced and minimal background noise. Three combinations that showed good amplification and acceptable polymorphism across all the provenances were selected for full runs (Table 5.4). 8 μL reaction volume containing 10 X PCR buffer [100 mM Tris-HCl (pH 8.3), 500 mM

KCl], 2.0 mM MgCl2, 0.2 mM dNTPs, 0.625 μM of D4 WellRED dye labeled EcoRI primer (E+3), 0.625 μM MseI primer (M+3), 0.2 Units GoTaq Flexi DNA polymerase

(Promega) and 2 μL of diluted preselective amplification product were used for main selective amplification. The selective amplification PCR profile consisted of an initial denaturation at 94°C for 1 minute then one cycle of 94°C for 20 seconds, 66°C for 30 seconds, and 72°C for 2 minutes, followed by 10 cycles of each with 1°C lowering of annealing temperature and finally 25 cycles of 94°C for 20 seconds, 56°C for 30 seconds and 72°C for 2 minutes with a final hold of 60°C for 30 minutes. To check for the success of selective amplification, the product once again were detected on 2.0 % aga-

114

Table 5.3 Primer combinations tested for AFLP analysis

MseI EcoRI ACT ACC ACG CAT √ √ √ CAA - - - CTT - - -

Table 5.4 Primer combinations used for AFLP analysis

Primer Sequence (5’- 3’) EcoRI + 3-ACT E-ACT GACTGCGTACCAATTC+ACT MseI + 3-CAT M-CAT GATGAGTCCTGAGTAA+CAT

EcoRI + 3-ACC E-ACC GACTGCGTACCAATTC+ACC MseI + 3-CAT M-CAT GATGAGTCCTGAGTAA+CAT

EcoRI + 3-ACG E-ACG GACTGCGTACCAATTC+ACG MseI + 3-CAT M-CAT GATGAGTCCTGAGTAA+CAT

115

rose gel. Following a successful amplification, the AFLP products were sent to 1st Base laboratories for fragment analysis and were electrophoresed on an ABI 3730XL automated sequencer (Applied Biosystems).

5.2.6 AFLP Data Scoring

The fragment data from the ABI Prism 3730 automated sequencer was scored using GeneMapper® 3.7 software (Applied Biosystems, CA) which generated data in a binary form (1=allele presence, 0=allele absence) and AFLP electropherograms of DNA fragments produced by the most optimal primer combinations. Identified loci (referred to as ‘bins’ in GeneMapper) between 50 and 500 base pairs (bp) in size, with all bins being 1 bp wide. Fragments smaller than 50 bp were disregarded to reduce the prevalence of size homoplasy (Vekemans et al., 2002).

5.2.7 Data Analysis

5.2.7(a) Clonal Structure and Genotypic Diversity

The genetic diversity analysis for DNA banding pattern was analyzed using

GenALEx version 6.5 (Peakall and Smouse, 2012) with binary database of AFLP. To determine if the AFLP primers evaluated provide enough power to discriminate among individuals of the population, a genotype accumulation curve was generated with the package poppr (Kamvar et al., 2014) for R version 3.0.3 (The R Foundation for

Statistical Computing, 2014). A multilocus genotype (MLG) was constructed for each individual by combining data for single AFLP fingerprints and individuals with the same

MLG were considered clones. Some analyses were conducted for the global and clone-

116

corrected for the respective population to avoid biases when evaluating the population structure and monomorphic markers were removed.

To estimate clonal diversity, the following parameters were calculated; (1) the proportion of distinguishable genotypes (Ellstrand and Roose, 1987) was measured as

G/N, where G is the number of genets and N is the total number of individuals (ramets) sampled. (2) Simpson’s diversity index (D) modified for finite sample size by Pielou

(1969), measures the probability that two ramets selected at random from a population of N plants will be from different multilocus genotypes. This index thus yields a measure of multilocus genotype diversity. D ranges from 0 to 1, with 1 being the maximum diversity. Each index value was calculated as: D=1-∑[푛푖(푛푖 − 1)]/[푁(푁 − 1)]} where

N is the total number of sampled ramets and 푛푖 is the number of ramets with a given

AFLP pattern 푖 (Pielou, 1969). A number of evenness indices are available and there is no consensus on which one is the best (Smith and Wilson, 1996). Genotypic evenness € measures the distribution of genotype abundance in the population (Ludwig and

Reynolds, 1988; Grünwald et al., 2003) which measures of the disproportionate size/representation of the sampled genets which are calculated as E= (Dobs-Dmin)/(Dmax-

Dmin) where Dmin= [(G-1)(2N-G)]/[N(N-1)] and Dmax= [N(G-1)]/[G(N-1)] and G= the number of genets detected and N is the number of sampled ramets (Fager, 1972).

5.2.7(b) Spatial Genetic Structure

The genetic variation within and among populations was estimated by calculating the analysis of molecular variance (AMOVA) using the GenALEx program, version 6.5 (Peakall and Smouse, 2012). The statistics ΦPR (differentiation among populations), ΦRT (differentiation among region) and ΦPT (analogous to Wright’s FST-

117

differentiation within populations) were calculated. The significance of variance components was conducted 9999 times to estimate the significance and of the Φ statistics was estimated using permutation using Euclidean distance metric.

Genetic similarities among populations C. ×purpurea nothovar. purpurea were estimated based on Nei’s unbiased genetic distances estimated using GenALEx program, version 6.5 (Peakall and Smouse, 2012). Principal component analysis (PCA) was employed to assess population subdivision on the pairwise genetic distances. This analysis is based on calculated pairwise dissimilarity coefficients among individuals using the R-library ade4 (Dray and Dufour, 2007). The metric of dissimilarity based on

Dice genetic distance. The results of the principal component analysis were also used to produce visual summaries of the relationships among each individual ramet of the six populations.

The mean genetic distances were then used to conduct a Mantel test of the correlation between genetic and geographic distance (km) using Tools for Population

Genetic Analysis in (TFPGA) version 1.3 (Miller, 1997). The Mantel test is a matrix correlation which describes the degree of association between two distance matrices, described as a product correlation r, the significance of which is tested through permutations (Sokal, 1979).

118

5.3 Results

5.3.1 AFLP Profiling and Marker Polymorphism

The restriction and ligation of MseI and EcoRI adapters produced visible smears of up to 1500 bp (Plate 5.2 A). However, preselective amplification products create a clearly visible smear in the range of 100-800 bp when run on 2% (w/v) agarose gel

(Plate 5.2 B). After subjected to fragment analysis for selective amplification, a total of

531 fragments ranging in size from 50 to 500 bp was scored using three different primer combinations. The number of polymorphic fragments for each primer varied from 126

(E-ACC/M-CAT) to 158 (E-ACG/M-CAT). The ave rage number of polymorphic loci

(DNA band/fragment) detected was 138.3 per primer combination. The average percentage of polymorphism (polymorphic loci/total loci) was 78.1% with a range among primer combinations of 76.6% (E-ACT/M-CAT), 78.8% (E-ACC/M-CAT) to

79.0% (E-ACG/M-CAT) (Table 5.5). The other primer combination had too many ambiguous fragments for scoring and was not used in the analysis.

5.3.2 Clonal Structure and Genotypic Diversity

Analyzing the total banding patterns by populations, PI presented the highest band quantity (49), followed by KJ (47), then PK (45), MT (40), PT (34) and finally SU

(33) (Figure 5.1). Heterozygote excess was observed at all populations. In relation to the mean of the expected heterozygosity, MT obtained the highest mean value (0.052)

(Figure 5.1).

A genet corresponds to the collection of individuals produced clonally and thus sharing the same multilocus genotype at all loci in the genome (De Meeûs et al., 2007).

119

M 1 2 M 1 2 3 4 5 6 M 7 8 9 10 11 12

2,000 bp

1,000 bp

500 bp

150 bp

A B

Plate 5.2 (A) Lane 1-2: The PCR amplification products after restriction and ligation of MseI and EcoRI adapters. (B) The PCR amplification products for preselective amplification. Lane 1-2 (MT), Lane 3-4 (PT), Lane 5-6 (SU), Lane 7-8 (PI), Lane 9-10 (KJ) and Lane 11-12 (PK). All products were viewed in 2% agarose gel stained with RedSafe™. Lane M is a 1 kb DNA Ladder (Lucigen).

120

Table 5.5 Total number of AFLP loci examined using three primer combinations as well as percentage of polymorphic loci per primer combination

Primer Total no of loci Number of % of polymorphic combination detected polymorphic loci loci E-ACT + M-CAT 171 131 76.6 E-ACC + M-CAT 160 126 78.8 E-ACG + M-CAT 200 158 79.0. Total 531 415 Mean 177.0 138.3 78.1

Band patterns across populations 0 2 4 6 8 No. Bands 60 0.080 40 0.060 0.040 No. Bands Freq. >= 5%

20 0.020 Number 0 0.000 No. LComm Bands

MT PT SU PI KJ PK (<=50%) Heterozygosity Populations Mean Heterozygosity

Figure 5.1 Totals for AFLP binary band patterns by Cryptocoryne ×purpurea nothovar. purpurea populations. Key: MT = Kg. Pulau Semut, PT = Padang Tembak, SU = Sungai Udang, PI = Pos Iskandar, KJ = Kg. Jelawat and PK = Paya Kelantong.

121

Therefore, it is highly likely that individuals sharing the same MLG are ramets of the same genet. The genotype accumulation curve showed that increasing the number of markers can lead to genet reassignment, generally as distinct genets (Figure 5.2).

Obviously, this plateaus and the only way to find additional genets is to increase the sampling effort. The number of loci was reduced from 78 to 63, which had no effect on the clonal assignment decisions, so the number of loci are believed to be sufficient. Loci were reduced so as to include only the clear and unambiguous bands. The number of genets detected is a product of both the discriminatory ability of the marker and the sampling scheme used.

For clonal assignment, polymorphic loci are needed to discriminate between c1onemates. In the 6 analyzed populations, a total of 13 different MLGs were identified.

Certain MLGs were found in shared populations (ex: MT and PT) and (PI and KJ)

(Figure 5.3). Table 5.6 showed the mean number of clonal diversity for Simpson’s diversity index (D=0.021) and genotypic Evenness index (E=0.378) showed a low level of genetic diversity in six of the populations examined (Table 5.6). The highest genotypes found was from MT population (4 genotypes) followed by PI, KJ and PK (3 genotypes) for each populations. Two populations are monoclonal (PT) and (SU) dominated by only one genotype within the population (Table 5.6). The distribution genets found in every population based on sampled ramets are shown in Plate 5.3 and

Plate 5.4.

122

Number of multilocus genotypes of Number

Number of loci sampled Figure 5.2 Genotype accumulation curve for 171 individuals ramets of Cryptocoryne ×purpurea nothovar. purpurea genotyped over

63 AFLP loci.

123

30 MLG 1 25 MLG 2 MLG 3

20 MLG 4 MLG 5 15 MLG 6 MLG 7 10

MLG 8 Number of MLG of Number MLG 9 5 MLG 10 0 MLG 11 MT PT SU PI KJ PK

Populations

Figure 5.3 Pattern of multilocus genotype (MLG) based on Cryptocoryne ×purpurea nothovar. purpurea populations. Key: MT = Kg. Pulau Semut, PT = Padang Tembak, SU = Sungai Udang, PI = Pos Iskandar, KJ = Kg. Jelawat and PK = Paya Kelantong.

Table 5.6 Clonal diversity detected by Cryptocoryne ×purpurea nothovar. purpurea populations

Populations N MLG D E MT 40 4 0.039 0.587 PT 20 1 0.0000 0.000 SU 10 1* 0.0000 0.000 PI 34 3 0.031 0.577 KJ 40 3 0.033 0.567 PK 27 3* 0.025 0.536 Total 171 15 Mean 0.021 0.378 N, sample size; MLG, multilocus genotypes; D, Simpson’s diversity index; E, Evenness index. * No shared genotypes between Cryptocoryne ×purpurea nothovar. purpurea populations. Key: MT = Kg. Pulau Semut, PT = Padang Tembak, SU = Sungai Udang, PI = Pos Iskandar, KJ = Kg. Jelawat and PK = Paya Kelantong.

124

Plate 5.3 The distribution genets found in Melaka region populations based on sampled Cryptocoryne ×purpurea nothovar. purpurea ramets. Key: MT = Kg. Pulau Semut, PT = Padang Tembak, SU = Sungai Udang. The number represent the MLGs type.

125

Plate 5.4 The distribution genets found in Pahang region populations based on 5.3.3 Spatial Genetic Structure Cryptocoryne ×purpurea nothovar. purpurea sampled ramets. Key: PI = Pos Iskandar, KJ = Kg. Jelawat and PK = Paya Kelantong.

126

5.3.3 Spatial Genetic Structure

The analysis of molecular variance (AMOVA) of AFLP genotype data revealed that the majority of the genetic variation (94%) was found between regions. Meanwhile only 3% molecular variance was among populations within region and individuals within populations were observed respectively (Table 5.7 and Figure 5.4). Nei’s unbiased genetic distance varied from 0.004 to 4.208 (Table 5.8) between the six populations. The nearest distance (0.004) was between population PI and population KJ.

The most distance (4.208) was between population PT and population PI. The PCA analysis of all individuals from six populations (Figure 5.5) grouped them into 2 distinct groups obviously based on region observed. The individuals within population overlapped partly and formed discrete small groups based on genotype observed. The pairwise values of genetic differentiation Nei's (1972) original distanc distance among the six populations correlated significantly with the spatial distances (Mantel test: r =

0.9465, P < 0.001) (Figure 5.6).

5.4 Discussion

5.4.1 AFLP Marker Development

This study provides the first characterization of molecular genetic diversity among populations of C. ×purpurea nothovar. purpurea, namely in Peninsular Malaysia using AFLP markers. AFLP is a DNA fingerprinting method with a high reproducibility, covering a great number of genome loci in one analysis. Due to its reproducibility and its discriminating, these markers have been widely used for the characterization and

127

Table 5.7 Molecular analysis of variance (AMOVA) comparing within and among populations between regions of Cryptocoryne ×purpurea nothovar. purpurea % Statistic Source df SS MS Est. Var. Total Phi (Φ) Among Regions 1 2866.447 2866.447 34.269 94% ΦRT Among Populations within Regions 4 110.194 27.549 0.990 3% ΦPR Individual within Populations 165 196.447 1.191 1.191 3% ΦPT

Df: degrees of freedom, SS: Sum of squared, MS: Mean sums of squares, p-value: < 0.05 levels of significance were based on 999 random permutations.

Among Individual Populations within within Regions Populations 3% 3%

Among Regions 94%

Figure 5.4 Percentage of molecular variation between Cryptocoryne ×purpurea nothovar. purpurea populations.

128

Table 5.8 Nei’s unbiased genetic distance based on six populations

Melaka Pahang MT PT SU PI KJ PK MT ***** 0.961 0.921 0.080 0.090 0.096 PT 0.040 ***** 0.962 0.015 0.024 0.030 SU 0.082 0.039 ***** 0.054 0.064 0.069 PI 2.525 4.208 2.923 ***** 0.996 0.982 KJ 2.404 3.709 2.754 0.004 ***** 0.980 PK 2.341 3.493 2.667 0.018 0.021 ***** Pairwise population matrix of Nei’s genetic identity (above diagonal) and pairwise population matrix of Nei’s genetic distance (below diagonal). Key: MT = Kg. Pulau Semut, PT = Padang Tembak, SU = Sungai Udang, PI = Pos Iskandar, KJ = Kg. Jelawat and PK = Paya Kelantong.

Pahang Melaka

(12.23) 2 Axis

Axis 1 (48.72)

Figure 5.5 Principal component analysis of 171 ramets from six Cryptocoryne ×purpurea nothovar. purpurea populations based on 63 AFLP loci. Key: MT = Kg. Pulau Semut, PT = Padang Tembak, SU = Sungai Udang, PI = Pos Iskandar, KJ = Kg. Jelawat and PK = Paya Kelantong.

129

Distance (km) Distance

Genetic distance

Figure 5.6 Relationship between pairwise values of Dice genetic distances and geographical distance of Cryptocoryne ×purpurea nothovar. purpurea populations.

130

genetic analysis of many plants (Vos et al., 1995). AFLP has proven to be a useful technique for assessing genetic clonal diversity in C. ×purpurea nothovar. purpurea although there were difficulties in marker development. AFLP technique requires isolation of DNA with high purity for restriction digestion and particularly sensitive to contamination by exogenous DNA; even low and unobtrusive levels of bacterial or fungal contaminants, for example, may alter the AFLP profiles (Dyer and Leonard,

2000). Isolation of DNA free of polysaccharides, polyphenols and various secondary metabolites such as alkaloids, flavonoids and tannins is most essential because these compounds can irreversibly bind to nucleic acids during extraction steps (Mishra et al.,

2008).

Indeed, a general rule in the AFLP procedure is that the larger the genome is, the larger the required amount of DNA needed (Vos et al., 1995). The objective of restriction digestion is to reduce the big genomic DNA molecules into a mixture of fragments enabling posterior amplification and electrophoretic detection. Restriction enzymes and primer pairs are key parameters in the AFLP procedure which influenced the number of amplified fragments and the level of polymorphism detected. In theory, any restriction enzyme can be used in an AFLP protocol. MseI were chosen since the

DNA of most eukaryotes is AT-rich making MseI (recognition sequence TTAA) the preferred frequent-cutter for AFLP (Vos et al., 1995). The choice of number and sequence of primers that are used for the selective amplification is an important step of the AFLP process because they will later determine the level of polymorphism accessible in the studied species. There are unfortunately no general rules which appropriate primer pairs to use in organisms except that in most cases, an extensive screening of different primer combinations is necessary. Trying all pairwise combinations is a reasonable and effective approach, but it can rapidly become

131

expensive and time-consuming. According to the level of inter and intrapopulation polymorphism analysis in pre-screening of 12 individuals, only three primers from nine combinations with MseI showed good restriction/digestion in this study. A good marker has to fulfill several requirements such as being polymorphic enough to be informative and show clear distinct peak (at least 1 bp) from other peak in the profiles.

5.4.2 Clonal Structure and Genotypic Diversity

Across AFLP loci, the heterozygosity of C. ×purpurea nothovar. purpurea individuals was high. To the extent that parental taxa have different sets of alleles, hybrids are expected to display high levels of heterozygosity. In addition, according to

Halkett et al. (2005), asexuality generates identical genotypes in offspring, so allele associations were transmitted in the same way that they would be transmitted if they were physically linked throughout the whole genome. The initial hypothesis was that as a result of the capacity for extensive clonal growth and the apparent high sterility of the populations due to their hybrid origin, the level of clonal genetic diversity in C.

×purpurea nothovar. purpurea was likely to be low. According to Waycott et al. (1997), the high D value in Simpson’s diversity index means there is a population where all ramet are from distinct genet. Meanwhile, low D value reveals a monoclonal population.

The genotypic evenness E is a measure of the distribution of genotype abundances, wherein a population with equally abundant genotypes yields a value equal to 1 and a population dominated by a single genotype is closer to zero. The levels of clonal diversity in C. ×purpurea nothovar. purpurea in six populations was low (D = 0.021) and (E = 0.378) compared to the average values among plant species which supported the early hypothesis. Janzen (1977) and Loveless and Hamrick (1984) suggested that clonal populations should demonstrate lower genetic variability. The low levels of clonal

132

diversity in C. ×purpurea nothovar. purpurea populations might be due to the facts that the plants were affected by the plants being sterile.

Yet, some sterile clonal populations do have very low genotypic variations such as seven genets for a population of Haloragodendron lucasii (Maid & Betche) Orchad-

(Sydes and Peakall, 1998) or even one in Decodon verticillatus (L.) Elliott (Eckert and

Barret, 1993). However, the occurrence of different genotypes in all populations except monoclonal populations (PT and SU) is perhaps surprising given the high sterility of this

C. ×purpurea nothovar. purpurea individuals. The results demonstrate that even taxa in which sexual reproduction is impaired can maintain polyclonal populations with non- negligible levels of allelic variation, and become relatively widespread. Given the limited opportunities for recurrent formation of C. ×purpurea nothovar. purpurea in the wild and their sexual infertility (Jacobsen, 1977), determining the functional significance of standing levels of genetic variation will be fundamental to increase the understanding of how these populations are able to persist and colonize new environments.

Sterility commonly arises through hybridization between species with the resulting hybrid populations maintained entirely by vegetative propagation and consequently control the genetic diversity in that particular population (Eckert, 2002).

However, in some cases, the levels of genetic variability in sterile populations was high

(Gross et al., 2012; Vallejo-Marin and Lye, 2013). As explained by Gross et al. (2012) the high genotypic diversity as shown in Grevillea rhizomatosa Olde & Marriott sterile populations were determined by several factors including (a) sterile populations were founded by fertile genotypes and sterility has subsequently developed; (b) sterile populations originated from genetically variable but sterile individuals, e.g. F1 hybrids;

133

(c) that populations consist of large clones in which somatic mutation has generated genetic variability but this variability has resulted in a loss of traits.

The detection of genotype variability in sterile C. ×purpurea nothovar. purpurea populations suggests several scenarios including the complex interaction of multiple processes including the amount of genetic diversity initially present in the parents (the hybrid may have arisen several times independently from different parental populations), the frequency of hybrid formation events and somatic mutation. The different genotypes present in C. ×purpurea nothovar. purpurea populations might have originate from different types of crossing involved in the early hybridization process. The first type involved the crossing events between C. cordata var. cordata and C. griffithii in early formation that produced different types of C. ×purpurea nothovar. purpurea of single hybridization. The second type of crossing involve hybridization between C. cordata var. cordata and C. griffithii from different types of parental individuals that bring different sets of alleles which involved a few hybridization events on that particular area.

Another type of hybridization might become from combination of these two types of crosses and explained the variation of genotypes shown in this results.

Cryptocoryne cordata var. cordata are currently present at Tasik Bera. However, there is no record for the presence of C. griffithii within the area. But there has been interpretation that C. ×purpurea nothovar. purpurea having arisen as a hybrid between more widespread C. cordata var. cordata and the southerly distributed C. griffithii, which has then spread up along the west coast of Peninsular Malaysia during the change in drainage systems that have occurred during the last 4500 years (Othman et al., 2009).

For the Melaka region, C. cordata var. cordata has been found near the locality of C.

×purpurea nothovar. purpurea but C. griffithii was not found. However, C. griffithii has

134

previously been recorded from several areas in Melaka (Bastmeijer and Kiew, 2001;

Othman et al., 2009; Bastmeijer, 2015). This could support the hypothesis that both putative parents might have overlapping distribution allowing hybridization resulting in formation of C. ×purpurea nothovar. purpurea. In addition, the distribution pattern of different genets found in every population as shown in Plate 5.3 and Plate 5.4 also can be related with the evidence from maternal inheritance study using cpDNA sequences in the Chapter Three. The results of cpDNA sequence showed C. ×purpurea nothovar. purpurea shared identical matK sequences from either C. cordata var. cordata or C. griffithii, which indicated that both putative parental species had been the maternal parent. In this AFLP study, the different MLGs of C. ×purpurea nothovar. purpurea from a particular population might be due to mixed hybridization events with C. cordata var. cordata or C. griffithii as the maternal parent.

Somatic mutations may have contributed to the different level of observed genotypes diversity detected in these sterile C. ×purpurea nothovar. purpurea populations. In highly clonal populations in which sexual reproduction is very limited or absent, there is growing evidence of accumulation of somatic mutations (Barrett, 2015).

A few recent studies on clonal plants including Populus tremuloides Michx. (Ally et al.,

2008), Grevillea rhizomatosa Olde & Marriott (Gross et al., 2012) and Vaccinium angustifolium Aiton (Bobiwash et al., 2013) provided novel insights on the potential evolutionary significance of somatic mutations on genetic diversity in sterile populations. The influence of somatic mutations on fitness is relevant in sterile plants because of their indeterminate growth and somatic mutations may enter the germline and be transmitted to the progeny (D’Amato, 1997; Barrett, 2015). In vegetative reproducing plants, somatic mutations can be fixed and passed on to the succeeding ramets and the mutation rates vary across the genet (Gill et al., 1995). These mutations can be

135

potentially transmitted from shoot meristems to gametes when flowering occurs. As long as somatic mutations do not limit clonal growth, they should accumulate over the life span of genets (Persson and Gustavson, 2001). Thus, the great size and longevity of clonal plants is predicted to be associated with the accumulation of numerous somatic mutations in cell lineages (Klekowski, 1988; Schultz and Scofield, 2009).

In addition, somatic chromosome doubling is responsible for the origin of autopolyploids and allopolyploids when the chromosome doubling occurs in an F1 sterile interspecific hybrid and under natural conditions, autopolyploids are generated by somatic doubling more frequently than by fusion of unreduced gametes (D’Amato,

1997). However, further work is required in C. ×purpurea nothovar. purpurea to investigate mutation levels in functional alleles.

Although measures of D and E are often included in clonal structure studies, similar sampling schemes are necessary for valid comparison (Barbour et al., 1987,

McLellan et al., 1997). If additional ramet sampling had been done in the populations studied, undoubtedly more genets would be found. The sampling procedure could also have contributed to the observed clonal diversity detected. Besides that, the effective size of clonal plant populations will be a key assessment in revealing the population dynamics and evolution of clonal plants (Lembicz et al., 2011). To study clone size, more detailed studies aimed at determining the extent of stolon/rhizome systems using both physical mapping and genetic markers should be carried out in the future studies.

136

5.4.3 Spatial Genetic Structure

Reproductive systems and the history of a species have often been regarded as the main factors affecting the genetic diversity both among and within populations

(Hamrick and Godt, 1996). Asexual propagation in combination with high sterility reduces levels of genetic diversity and quite often increases the between-population genetic differentiation (Baatout et al., 1991). This suggests that each population may have been founded independently and that different pathways for sterility may be involved. Cryptocoryne ×purpurea nothovar. purpurea grown as an aquatic plant, which combined with vegetative propagation could result in long-lived lineages composed of multiple ramets. Simulations assuming long genet longevity by Watkinson and Powell

(1993) support this suggestion that very low sexuality could be sufficient to maintain genetic variation within clonal populations.

Genet longevity is the cumulative probability of individual ramet survivorship, such that increasing the number of ramets constituting a genet, reduces the mortality risk

(Tanner, 2001). The effectiveness of mortality risk spreading is a function of the scale of the mortality factor such that clonal dispersal would only be effective against patchy and local factor (Sackville Hamilton et al., 1987).

A patchy mortality factors for C. ×purpurea nothovar. purpurea in the Melaka populations would be falling trees, which are frequently found within patches. A significant source of ramet mortality at Pahang region is mainly from heavy flood particularly at Pos Iskandar and Kg. Jelawat populations which are located within a big

137

and deep lake. Based on Erikkson (1994), clonal species may seem to be less vulnerable to extinction factors because of their enhanced survival. But simulations predict that the effects of reduced recruitment imposed for example by fragmentation may not manifest in population dynamics for 50-100 years (Erikkson, 1994). Erikkson (1994) also suggests that this scenario would result in a failure to detect declines in population viability until extinction was inevitable. Ironically, hybrids which form large genets would be at the greatest risk to be incorrectly assessed as being common would require a larger minimum habitat area to accommodate the sufficient number of genets to maintain genetic viability (Erikkson, 1994).

Within population genotypic diversity should reflect, in part, variation that has persisted because of the original colonization of the local population. It is also possible that genotypic diversity may be maintained by recurrent hybrid introductions a long time ago. As shown in the PCA (Figure 5.5), within populations, individuals are clustered together, suggesting that individuals within a population probably originated from a single colonization events.

Theoretical expectations suggest that even low levels of sexual reproduction in highly sterile populations can result in patterns of allelic variation similar to sexual populations (Bengtsson, 2003). In hybrid Cryptocoryne, the ability to proliferate in new environments could be associated with the genetic changes resulting from genome merging, as well as multiple and recurrent origins that may create an influx of genetic variation.

Sterile hybrids could have limited evolutionary significance because of their lack of sexual reproduction and recombination. However, it is well known that sterile hybrids can recover fertility, for example, through polyploidisation, sometimes soon after the

138

breakdown of geographic barriers (Abbott et al., 2009; Symonds et al., 2010). As a consequence, the structure of genetic diversity in asexual populations can be expected to vary widely depending on the relative importance of these factors. Regardless of the genesis of variability, its presence suggests that genetic variation may play an important role in the adaptation of the hybrid. Based on Mantel test results, generally genetic similarity declines with distances, which establishes a correlation between geographical distance and genetic distance resulting in spatial genetic structure. The detection of spatial genetic structure depends on the spatial and temporal scale of the genetic variation (Smouse and Peakall, 1999).

The occurrence of sterility in clonal plants raises many intriguing questions concerning its consequences for the ecology of populations and their evolutionary prospects. The overall clonal genetic diversity has great implications for its long-term survival and continued evolution (Avise and Hamrick, 1996). Ouborg et al. (2006) conclude that molecular measures alone do not accurately reflect the evolutionary potential of populations. However, the information of genetic diversity and differentiation between populations using molecular markers provides initial guidance for conservation and can contribute towards setting conservation priorities between populations (Segelbacher et al., 2010). Results have shown that the diploid hybrid C.

×purpurea nothovar. purpurea composed a large fraction of extant Cryptocoryne populations in the Peninsular Malaysia. Populations of this largely sterile taxon show high levels of heterozygosity as expected from their hybrid origin, and display variable levels of clonal diversity. It would be of interest to determine the extent to which this genetic variation is paralleled by performance differences between genotypes.

Understanding the functional significance of genetic variation in this and other clonal

139

taxa will help us predict the ability of largely sterile taxa to persist and spread in changing environments.

Finally, these indications are solely based on an assessment of clonal assignment through limited AFLP loci and should consider the probability that there is probably more genetic diversity to be discovered. In addition, more sampled ramets from different region should be included in the future study. Therefore, clonal diversity among the populations studied could be higher than those reported in this research. Unfortunately,

C. ×purpurea nothovar. purpurea from Johor region were not included in this study because of limited ramets found in Kg. Sri Lukut, Kahang due to enlargement of streams in 2013 and destroyed several patches in the range ± 2 m. Meanwhile for C. ×purpurea nothovar. purpurea from Sg. Sedeli Kechil, Kota Tinggi are known to be growing together with both the putative parents namely C. cordata var. cordata and C. griffithii

(Jacobsen et al., 2016). Since they are growing together in the same location, it seems impossible in collecting the ramets of a hybrid to prevent the misinterpreting data.

5.5 Conclusion

A knowledge and better understanding of the level and distribution of genetic diversity among and within the populations is important to achieve the conservation objective. It is therefore necessary to investigate other important factors in the hybrid biology which may be crucial for the long-term survival of the populations. The data presented here provide guidance about which populations may be valuable from a genetic perspective and could also serve as a valuable baseline for monitoring the effectiveness of establishing protected areas, and restoring and maintaining genetic

140

diversity. The presence of genetically variable hybrid populations may provide the material for the continued success of asexual taxa in diverse environments.

141

CHAPTER SIX

CONCLUSION

In summary, the four main objectives of this study were successfully achieved.

The findings from this study were validated and cross examined on parentage identification of hybrid C. ×purpurea nothovar. purpurea using several DNA markers including the Internal Transcribed Spacer (ITS) region, chloroplast matK gene (Chapter

Three) and microsatellite DNA (Chapter Four). Based on these three data sets, C.

×purpurea nothovar. purpurea is a confirmed as an interspecific hybrid between C. cordata var. cordata and C. griffithii. These molecular analysis will become a baseline data to resolve some intricate taxonomic problems and contribute to the detection of other Cryptocoryne hybrids. In addition, the future work should focus on the genetic variation of the wild populations of the parental species and may shed light on the geographical origins of the parents which would be valuable for understanding the extent of hybridization in Cryptocoryne.

The application of Next Generation Sequencing (NGS) resulted in the discovery of eleven novel polymorphic microsatellite loci used in this research (Chapter Four) and become a new record on Cryptocoryne microsatellites isolated using high-throughput sequencing. These microsatellite markers also proved successful in cross species amplification for other Cryptocoryne species. In fact, the use of 454 GS-FLX in this study has enabled the production of large numbers of sequences at reduced cost and time and consequently made it possible to develop a large number of microsatellites for use in studying Cryptocoryne.

142

The analysis on clonal diversity of C. ×purpurea nothovar. purpurea using

Amplified Fragment Length Polymorphism (AFLP) (Chapter Five) showed the low genetic diversity which has been expected because of hybrid sterility. However, the occurrence of different genotypes gave evidence of hybrid formation events from different parental populations and somatic mutations. These results also proved that hybrid formation often occurred independently at different sites which was reflected by distinct genotypes found with the majority of genetic variation distributed among- rather than within populations between regions and showed correlation between genetic distances with geographical distance. Finally, these data provide useful information on the genetic status of this taxon and can be exploited for genetic resource management and conservation programs.

143

REFERENCES

Abbott, R. J., Brennan, A. C., James, J. K., Forbes, D. G., Hegarty, M. J. and Hiscock, S. J. (2009). Recent hybrid origin and invasion of the British Isles by a self- incompatible species, Oxford ragwort (Senecio squalidus L., Asteraceae). Biological Invasions 11, 1145–1158.

Abbott, R. J., Hegarty, M. J., Hiscock, S. J. and Brennan, A. C. (2010). Homoploid hybrid speciation in action. Taxon 59, 1375–1386.

Abbott, R., Albach, D., Ansell, S., Arntzen, J. W., Baird, S. J. E., Bierne, N. and Zinner, D. (2013). Hybridization and speciation. Journal of Evolutionary Biology 26 (2), 229–246.

Abdelkrim, J., Robertson, B. C., Stanton, J. L. and Gemmell, N. J. (2009). Fast, cost effective development of species-specific microsatellite markers by genomic sequencing. BioTechniques 46,185–192.

Abdullah, N. A. P., Richards, A. J. and Wolff, K. (2012). Molecular evidence in identifying parents of Garcinia mangostana L. Pertanika Journal of Tropical Agricultural Science 35 (2), 257–270.

Addisalem, A. B., Danny Esselink, G., Bongers, F. and Smulders, M. J. M. (2015). Genomic sequencing and microsatellite marker development for Boswellia papyrifera, an economically important but threatened tree native to dry tropical forests. AoB Plants 7, plu86.

Agarwal, M, Shrivastava, N. and Padh, H. (2008). Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Reports 27, 617– 631.

144

Alberto, F., Correia, L., Arnaud–haond, S., Billot, C., Duarte, C. M. and Serrão, E. (2003). New microsatellite markers for the endemic Mediterranean seagrass Posidonia oceanica. Molecular Ecology Notes 3, 253–255.

Aldrich, P.R., Jagtap, M., Michler, C.H. and Romero Severson, J. (2003). Amplification of North American red oak microsatellite markers in European white oaks and Chinese chestnut. Silvae Genetica 52, 176–179.

Allentoft, M. E., Schuster, S. C., Holdaway, R. N., Hale, M. L., McLay, E., Oskam, C., Thomas, M., Gilbert, P., Spencer, P., Willerslev, E. and Bunce, M. (2009). Identification of microsatellites from an extinct moa species using high throughput (454) sequence data. BioTechniques 46 (3), 195–200.

Ally, D., Ritland, K. and Otto, S. P. (2008). Can clone size serve as a proxy for clone age? An exploration using microsatellite divergence in Populus tremuloides. Molecular Ecology 17(22), 4897–4911.

Álvarez, I. and Wendel, J. F. (2003). Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29, 417–434.

Ambreen, H., Kumar, S., Variath, M. T., Joshi, G., Bali, S., Agarwal, M., Kumar, A., Jagannath, A. and Goel, S. (2015). Development of genomic microsatellite markers in Carthamus tinctorius L. (Safflower) using next generation sequencing and assessment of their cross-species transferability and utility for diversity analysis. PLoS ONE 10(8), e0135443.

Antiqueira, L. M. O. R. (2013). Application of microsatellite molecular Markers in studies of genetic diversity and conservation of plant species of Cerrado. Journal of Plant Sciences 1 (1), 1–5.

Araki, K. and Ohara, M. (2008). Reproductive demography of ramets and genets in a rhizomatous clonal plant Convallaria keiskei. Journal of Plant Research 121, 147–154.

Archak, S., Gaikwad, B., Gautam, D., Rao, V., Swamy, M. and Karihaloo, L. (2003). Comparative assessment of DNA fingerprinting techniques (RAPD, ISSR and AFLP) for genetic analysis of cashew (Anacardium occidentale L.) accessions of India. Genome 46, 362–369.

Armour, J. A. L., Alegre, S. A., Miles, S.,William, L. and Badge, R. M. (1999). Minisatellites and mutation processes in tandemly repetitive DNA. Microsatellites: Evolution and Applications. In: Goldstein, D. B. and Schlötterer, C. (eds.), Oxford University Press, New York, pp. 24–33.

Arnold, M. L. (1997). Natural hybridization and evolution. Oxford University Press, New York.

Arnold, M. L. (2006). Evolution through genetic exchange. Oxford University Press, New York.

145

Ashley, M. V. and Dow, B. D. (1994). The use of microsatellite analysis in population biology: Background, methods and potential applications. Molecular Ecology and Evolution: Approaches and Applications. In: Schierwater, B.S.B., Wagner, G. P. and DeSalle, R. (eds.), Birkhauser Verlag, Basel, Switzerland. pp. 185– 201.

Asif, M., Rahman, M., Mirza, J. I. and Zafar, Y. (2009). Parentage confirmation of cotton hybrids using molecular markers. Pakistan Journal of Botany 41 (2), 695– 701.

Avise, J. C. and Hamrick, J. L. (1996). Conservation genetics, case histories from nature. Chapman and Hall, New York, pp. 1–9.

Baatout, H., Combes, D. and Marrakchi, M. (1991). Reproductive system and population structure in two Hedysarum subspecies. I. Genetic variation within and between populations. Genome 34, 396–406.

Bagley, M. J., Anderson, S. L. and May, B. (2001). Choice of methodology for assessing genetic impacts of environmental stressors: polymorphism and reproducibility of RAPD and AFLP fingerprints. Ecotoxicology 10, 239–244.

Baldwin, B. G. (1992). Phylogenetic Utility of the internal transcribed spacer of nuclear ribosomal DNA in plants: An example from the Compositae. Molecular Phylogenetics and Evolution 1, 3–16.

Baldwin, B. G., Sanderson, M. J., Porter, J. M., Wojciechowski, M. F., Cambell, C. S. and Donoghue, M. J. (1995). The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82, 247–277.

Baldwin, B.G. (1993). Molecular phylogenetics of Calycadenia (Compositae) based on ITS sequences of nuclear ribosomal DNA: Chromosomal and morphological evolution reexamined. American Journal of Botany 80, 222–238.

Balloux, F., Lehmann, L. and de Meeus, T. (2003). The population genetics of clonal and partially clonal diploids. Genetics 164, 1635–1644.

Barbour, M. G., Burk, J. H. and Pitts, W. D. (1987). Terrestrial Plant Ecology. Benjamin/Cummings, Menlo Park, CA.

Barrett, S. C. H. (2015). Influences of clonality on plant sexual reproduction. Proceedings of the National Academic of Sciences of the United States of America 112 (29), 8859–8866. Bastmeijer, J. D. (2008). http://www.nationaalherbarium.nl/Cryptocoryne/inde x.html.

Bastmeijer, J. D. (2015). The Crypts Pages. http://crypts.home.xs4all.nl/Cryptocoryne/in-dex.html (accessed 18.11.15).

Bastmeijer, J. D. and Kiew, R. (2001). A New Cryptocoryne hybrid (Araceae) from the Bukit Timah Nature Reserve, Singapore. Garden Bulletin of Singapore 53, 9–17.

146

Bastmeijer, J. D., Kishi, H., Takahashi, N., Wongso, S. and Jacobsen, N. (2013). Eine neue Varietät der Cryptocoryne ferrruginea Engl. von Sekadau, West Kalimantan, Indonesien. Aqua Planta 38 (3), 84–93.

Belkhir, K., Borsa, P., Goudet, J., Chikhi, L. and Bonhomme, F. (2004). GENETIX v.4.05 logiciel sous WindowsTM pour la génétique des populations. Laboratoire Genome, Populations, Interactions CNRS UMR 5000, University of Montpellier II, Montpellier.

Bengtsson, B. O. (2003). Genetic variation in organisms with sexual and asexual reproduction. Journal of Evolutionary Biology 16, 189–199.

Bennett, M. D. and Leitch, I. J. (2011). Nuclear DNA amounts in angiosperms: targets, trends and tomorrow. Annals of Botany 107(3), 467–590.

Birky, C. W., Jr. (1995). Uniparental inheritance of mitochondrial and chloroplast genes: mechanism and evolution. Proceedings of the National Academy of Sciences, Sciences of the United States of America 92, 11331–11338.

Blears, M. J., De Grandis, S. A., Lee, H. and Trevors, J. T. (1998). Amplified fragment length polymorphism (AFLP): a review of the procedure and its applications. Journal of Industrial Microbiology and Biotechnology 21, 99–114.

Bobiwash, K., Schultz, S. T. and Schoen, D. J. (2013). Somatic deleterious mutation rate in a woody plant: Estimation from phenotypic data. Heredity (Edinb) 111(4), 338–344.

Bonin, A., Bellemain, E., Bronken Eidesen, P., Pompanon, F., Brochmann, C. and Taberlet, P. (2004). How to track and assess genotyping errors in population genetic studies. Molecular Ecology 13, 3261–3273.

Bradley, R. D. and Hillis, D. M. (1997). Recombinant DNA sequences generated by PCR amplification. Molecular Biology and Evolution 14 (5), 592–593.

Brautigam, A. and Gowik, U. (2010). What can next generation sequencing do for you? Next generation sequencing as a valuable tool in plant research. Plant Biology 12, 831–841.

Brennan, A. C., Harris, S. A. and Hiscock, S. J. (2003). The population genetics of sporophytic self–incompatibility in Senecio squalidus L (Asteraceae): avoidance of mating constraints imposed by low S–allele number. Philosophical Transactions of the Royal Society B 358, 1047–1050.

Brown, T. A. (1991). Essential molecular biology, a practical approach. Vol 1. BIOS, Oxford.

Brzyski, J. R. (2010). Isolation and characterization of microsatellite markers in the rare clonal plant, Spiraea virginiana (Rosaceae). American Journal of Botany e20– e22.

Buehler, D., Graf, R., Holderegger, R. and Gugerli, F. (2011) Using the 454 pyrosequencing-based technique in the development of nuclear microsatellite

147

loci in the alpine plant Arabis alpine (Brassicaceae). American Journal of Botany 98, e103–e105.

Buschiazzo, E. and Gemmell, N. J. (2006). The rise, fall and renaissance of microsatellites in eukaryotic genomes. Bioessays 28, 1040–1050.

Butcher, P. A., Decroocq, S., Gray, Y. and Moran, G. F. (2000). Development, inheritance and cross–species amplification of microsatellite markers from Acacia mangium. Theoretical and Applied Genetics 101, 1282–1290.

Cameron, K. M. (2005). Leave it to the leaves: A molecular phylogenetic of Malaxideae. (Epidendroideae, Orchidaceae). American Journal of Botany 92, 1025–1032.

Campbell, D. R., Alarcón, R. and Wu, C. A. (2003). Reproductive isolation and hybrid pollen disadvantage in Ipomopsis. Journal of Evolutionary Biology 16, 536–540.

Caraway, V., Carr, G. D. and Morden, C. W. (2001). Assessment of hybridization and introgression in lava-colonizing Hawaiian Dubautia (Asteraceae: Madiinae) using RAPD markers. American Journal of Botany 88, 1688–1694.

Castoe, T. A., Poole, A. W., Gu, W., Jason de Koning, A. P., Daza, J. M., Smith, E. N. and Pollock, D. D. (2010). Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence. Molecular Ecology Resources 10, 341–347.

CBOL Plant Working Group (2009). A DNA barcode for land plants. Proceedings of the National Academic of Sciences of the United States of America 106, 12794– 12797.

Cervera, M. T., Gusmao, J., Steenackers, M., Peleman, J., Storme, V., Van den Broeck, A., Van Montagu, M. and Boerjan, W. (1996). Identification of AFLP molecular markers for resistance against Melampsora larici-populina in Populus. Theoretical and Applied Genetics 93, 733–737.

Chakraborty, R., Kimmel, M., Stivers, D. N., Davison, L. J. and Deka, R. (1997). Relative mutation rates at di-, tri-, and tetranucleotide microsatellite loci. Proceedings of the National Academic of Sciences of the United States of America 94, 1041–1046.

Cheng, D., Vrieling, K. and Klinkhammer, P. G. L. (2011). The effect of hybridization on secondary metabolites and herbivore resistance: Implications for the evolution of chemical diversity in plants. Phytochemistry Reviews 10, 107–117.

Chiang, T. Y. and Schaal, B. A. (2000). Molecular evolution and phylogeny of the atpB- rbcL spacer of chloroplast DNA in the true mosses. Genome 43, 417–426.

Chistiakov, D. A., Hellemans, B. and Volckaert, F. A. M. (2005). Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture 255, 1–29.

Clegg, M., Gaut, B., Duvall, M. and Davis, J. (1993). Inferring plant evolutionary history from molecular data. New Zealand Journal of Botany 31, 307–316.

148

Coleman, A. W. (2007). Pan-eukaryote ITS2 homologies revealed by RNA secondary structure. Nucleic Acids Research 35, 3322–3329.

Coleman, A. W. and Mai, J. C. (1997). Ribosomal DNA ITS-1 and ITS-2 sequence comparisons as a tool for predicting genetic relatedness. Journal of Molecular Evolution 45, 168–177.

Corriveau, J. L. and Coleman, A. W. (1988). Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species. American Journal of Botany 75, 1443–1458.

Cronn, R., Cedroni, M., Haselkorn, T., Grover, C. and Wendel, J. F. (2002). PCR- mediated recombination in amplification products derived from polyploid cotton. Theoretical and Applied Genetics 104, 482–489.

Csencsics, D., Brodbeck, S. and Holderegger, R. (2010). Cost–effective, species specific microsatellite development for the endangered dwarf bulrush (Typha minima) using next-generation sequencing technology. Journal of Heredity 101(6), 789– 793. Cusimano, N., Bogner, J., Mayo, S. J., Boyce, P. C., Wong, S. Y., Hesse, M., Hetterscheid W. L. A., Keating, R. C. and French J. C. (2011). Relationships within the Araceae: Comparison of morphological patterns with molecular phylogenies. American Journal of Botany 98 (4), 654–668.

D’Amato, F. (1997). Role of somatic mutations in the evolution of higher plants. Caryologia 50 (1), 1–15.

De Meeûs, T., Prugnolle, F. and Agnew, P. (2007). Asexual reproduction: genetics and evolutionary aspects. Cellular and Molecular Life Sciences 64, 1355 –1372.

De Wit, H. C. D. (1990). Aquarienpflanzen (2nd edition). Stuttgert, Ulmer.

De Witte, L. C. and Stöcklin, J. (2010). Longevity of clonal plants: why it matters and how to measure it. Annals of Botany 106 (6), 859–870.

Delmas, C. E., Lhuillier, E., Pornon, A. and Escaravage, N. (2011). Isolation and characterization of microsatellite loci in Rhododendron ferrugineum (Ericaceae) using pyrosequencing technology. American Journal of Botany e120–e122.

Dkhar, J., Kumaria, S. and Tandon, P. (2011). Nymphaea alba var. rubra is a hybrid of N.alba and N.odorata as evidenced by molecular analysis. Annales Botanici Fennici 48 (4), 317–324.

Doyle, J. J. and Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus 12, 13–15. Dray, S. and Dufour, A. B. (2007). The ade4 package: implementing the duality diagram for ecologists. Journal of Statistical Software 22, 1–20.

Drummond, A. J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, M., Heled, J., Kearse, M., Markowitz, S., Moir, R., Stones-Havas, S., Sturrock, S., Thierer, T. and Wilson, A. (2010). Geneious v5.5 http://www.geneious.com.

149

Du, Z-Y., Yang, C-F., Chen, J-M. and Guo, Y-H. (2009). Nuclear and chloroplast DNA sequences data support the origin of Potamogeton intortusifolius J.B. He in China as a hybrid between P. perfoliatus Linn. and P. wrightii Morong. Aquatic Botany 91, 47−50.

Dyer, A. T. and Leonard, K. J. (2000). Contamination, error, and nonspecific molecular tools. Phytopathology 90, 565–567.

Echt, C. S. and May-Marquardt, P. (1997). Survey of microsatellite DNA in pine. Genome 40, 9–17.

Eckert, C. G. (2002). The loss of sex in clonal plants. Evolutionary Ecology 15, 501– 520.

Eckert, C. G. and Barret, S. C. H. (1993). Clonal reproduction and patterns of genotypic diversity in Decodon verticillatus (Lythraceae). American Journal of Botany 80, 1175–1182. Edwards, A., Civitello, A., Hammond, H. A. and Caskey, C. T. (1991). DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. American Journal of Human Genetics 49, 746–756.

Elder, J. F. and Turner, B. J. (1995). Concerted evolution of repetitive DNA sequences in eukaryotes. The Quarterly Review of Biology 70, 297–320.

Ellegren, H. (2004). Microsatellites: simple sequences with complex evolution. Nature Reviews Genetics 5, 435–445.

Ellis, J. R. and Burke, J. M. (2007). EST–SSRs as a resource for population genetic analyses. Heredity 99, 125–132.

Ellstrand, N. C. (2014). Is gene flow the most important evolutionary force in plants? American Journal of Botany 101 (5), 737–753.

Ellstrand, N. C. and Roose, M. L. (1987). Patterns of genotypic diversity in clonal plant species. American Journal of Botany 74, 123–131.

Epperson, B. K. (1993). Recent advances in correlation studies of spatial of genetic variation. Evolutionary Biology 27, 95–155.

Eriksson, O. (1993). Dynamics of genets in clonal plants. Trends in Ecology and Evolution 8, 313–316.

Eriksson, O. (1994). Stochastic population dynamics of clonal plants: Numerical experiments with ramet and genet models. Ecological Research 9, 257–268.

Estoup, A. and Turgeon, J. (1996). Microsatellite markers: Isolation with non- radioactive probes and amplification. Version of 12/1996 Laboratoire de Génétique des Poissons, INRA 78352 Jouy-en-Josas France.

Evett, I. W. and Weir, B. S. (1998). Interpreting DNA Evidence: Statistical Genetics for Forensic Scientists. Sinauer Associates, Sunderland, Massachusetts.

150

Excoffier, L., Laval, G. and Schneider, S. (2005). Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50.

Fager, E. W. (1972). Diversity: a sampling study. American Naturalist 106, 293–310.

Faircloth, B. C. (2008). MSATCOMMANDER: detection of microsatellite repeat arrays and automated, locus-specific primer design. Molecular Ecology Resources 8, 92–94.

Fan, L., Zhang, M. Y., Liu, Q. Z., Li, L. T., Song, Y., Wang, L. F., Zhang, S. L. and Wu, J. (2013). Transferability of newly developed pear SSR markers to other Rosaceae species. Plant Molecular Biology Reporter 31, 1271–1282.

Farell, E. M. and Alexandre, G. (2012). Bovine serum albumin further enhances the effects of organic solvents on increased yield of polymerase chain reaction of GC-rich templates. BMC Research Notes 5, 257.

Fehrer, J., Krak, K. and Chrtek, J. Jr. (2009). Intra-individual polymorphism in diploid and apomictic polyploid hawkweeds (Hieracium, Lactuceae, Asteraceae): Disentangling phylogenetic signal, reticulation, and noise. BMC Evolutionary Biology 9 (239), 1–23.

Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791.

Fernandez-Silva, I. and Toonen, R. J. (2013). Optimizing selection of microsatellite loci from 454 pyrosequencing via post-sequencing bioinformatic analyses. Methods in Molecular Biology 1006, 101–120.

Fonseca, V. G., Nichols, B., Lallias, D., Quince, C., Carvalho, G. R., Power, D. M. and Creer, S. (2012). Sample richness and genetic diversity as drivers of chimera formation in nSSU metagenetic analyses. Nucleic Acids Research 40, e66. Fung, M. C. M. (2008). Molecular genetics analysis of selected Cryptocoryne species (Araceae) in Peninsular Malaysia. M.Sc Thesis, Universiti Sains Malaysia.

Furtado, J. I. and Mori, S. (1982). Origin and history. In Tasek Bera: The ecology of a freshwater swamp. Monographiae Biologicae (vol.47). In: Furtado, J. I. and Mori, S. (eds.), The Hague, Dr. W. Junk Publishers.

Gardner, M. G., Fitch, A. J., Bertozzi, T. and Lowe, A. J. (2011). Rise of the machines – recommendations for ecologists when using next generation sequencing for microsatellite development. Molecular Ecology Resources 11, 1093–1101.

Gerber, S., Mariette, S., Streiff, R., Bodénès, C. and Kremer, A. (2000). Comparison of microsatellites and amplified fragment length polymorphism markers for parentage analysis. Molecular Ecology 9, 1037–1048.

Gill, D. E., Chao, L., Perkins, S. L. and Wolf, J. B. (1995). Genetic mosaicism in plants and clonal animals. Annual Review of Ecology and Systematics 26, 423–444.

151

Gimenes, M., Hoshino, A., Barbosa, A., Palmieri, D. and Lopes, C. (2007). Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea). BMC Plant Biology 7, 9.

Glenn, T. C. (1996). The microsatellite manual version 6, July 27, 1996 Laboratory of Molecular Systematics—MRC 534. MSC Smithsonian Institution, Washington, DC 20560. Glenn, T. C. and Schable, N. A. (2005). Isolating microsatellites DNA loci. Methods in Enzymology 395, 202–222.

Gomez, S. M., Denwar, N. N., Ramasubramanian, T., Simpson, C. E., Burow, G., Burke, J. J., Puppala, N. and Burow, M. D. (2008). Identification of peanut hybrids using microsatellite markers and horizontal polyacrylamide gel electrophoresis. Peanut Science 35, 123–129.

Goudet, J. (2001). FSTAT, a program to estimate and test gene diversities and fixation indices Version 2.9.3. http://www.unil.ch/izea/softwares/fstat.html.

Graur, D. and Li, W.-H. (2000). Fundamentals of Molecular Evolution (Sinauer, Sunderland, MA), 2nd Ed.

Gross, B. L and Rieseberg, L. H. (2005). The ecological genetics of homoploid hybrid speciation. Journal of Heredity 96, 241–252.

Gross, C. L., Nelson, P. A., Haddadchi, A. and Fatemi, M. (2012). Somatic mutations contribute to genotypic diversity in sterile and fertile populations of the threatened shrub, Grevillea rhizomatosa (Proteaceae). Annals of Botany 109, 331–342.

Grünwald, N. J., Goodwin, S. B., Milgroom, M. G. and Fry, W. E. (2003). Analysis of genotypic diversity data for populations of microorganisms. Phytopathology 93,738–746.

Guillemaud, T., Broadhurst, L., Legoff, I., Henery, M., Blin, A., Ducatillion, C., Ferrando N. and Malausa, T. (2015). Development of 23 polymorphic microsatellite loci in invasive Silver Wattle, Acacia dealbata (Fabaceae). Applications in Plant Sciences 3 (5), 1500018.

Guyomarc, H., Sourdille, P., Charmet, G., Edwards, K. J. and Bernard, M. (2002). Characterization of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D–genome of bread wheat. Theoretical and Applied Genetics 104, 1164–1172.

Halkett, F., Simon, J. C. and Balloux, F. (2005). Tackling the population genetics of clonal and partially clonal organisms. Trends in Ecology and Evolution 20, 194– 201.

Hamilton, M. B. and Fleischer, R. C. (1999). Cloned microsatellite repeats differ between 4-base restriction endonucleases. Journal of Heredity 90, 561–563.

152

Hamilton, M. B., Pincus, E. L., Di–Fiore, A. and Fleischer, R. C. (1999). Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27, 500–507.

Hamrick, J. L. and Godt, M. J. (1996). Effects of life history traits on genetic diversity in plant species. Philosophical Transactions: Biological Sciences 351, 1291–1298.

Hancock, J. M. (1999). Microsatellites and other simple sequences: genomic context and mutational mechanisms. Microsatellites-evolution and Applications. In: Goldstein, D. B. and Schlötterer, C. (eds.), Oxford University Press, New York, pp. 1–9.

Hardig, T. M., Brunsfeld, S. J., Fritz, R. S., Morgan, M. and Orians, C. M. (2000). Morphological and molecular evidence for hybridization and introgression in a willow (Salix) hybrid zone. Molecular Ecology 9, 9–24.

Harper, J. L. (1977). Population Biology of Plants. Academic Press, London.

Harper, J. L. and White, J. (1974). The demography of plants. Annual Reviews in Ecology and Systematics 5, 419–463.

Harris, S. A. and Ingram, R. (1991). Chloroplast DNA and biosystematics: The effects of intraspecific diversity and plastid transmission. Taxon 40, 393–412.

Harrison, R. G. (1990). Hybrid zones: windows on evolutionary process. Oxford Surveys in Evolutionary Biology 7, 69–128.

Hayashi, K. and Kawano, S. (2000). Molecular systematics of Lilium and allied genera (Liliaceae): phylogenetic relationships among Lilium and related genera based on the rbcL and matK gene sequence data. Plant Species Biology 15, 73–93.

Hegarty, M. J, Barker, G. L, Brennan, A. C., Edwards, K. J., Abbot, R. J. and Hiscock, S. J. (2008). Changes to gene expression associated with hybrid speciation in plants: further insights from transcriptomic studies in Senecio. Philosophical Transactions of the Royal Society, Series B, Biological Sciences 363, 3055–3069.

Hegarty, M. J. and Hiscock, S. J. (2005). Hybrid speciation in plants: new insights from molecular studies. New Phytologist 165 (2), 411–423.

Heinze, B. (2007). A database of PCR primers for the chloroplast genomes of higher plants. Plant Methods 3, 4.

Hershkovitz, M. A. and Lewis, L. A. (1996). Deep level diagnostic value of the rDNA- ITS region: the case of an algal interloper. Molecular Biology and Evolution 13, 1276–1295.

Hershkovitz, M. A. and Zimmer, E. A. (1996). Conservation patterns in angiosperm rDNA ITS2 sequences. Nucleic Acid Research 24, 2857–2867.

Heslop-Harrison, J. S (Pat) and Schmidt, Thomas. (2012). Plant Nuclear Genome Composition. In: eLS. John Wiley and Sons, Ltd: Chichester.

153

Hevroy, T. H., Moody, M. L., Krauss, S. L. and Gardner, M. G. (2013). Isolation, via 454 sequencing, characterization and transferability of microsatellites for Grevillea thelemanniana subsp. thelemanniana and cross-species amplification in the Grevillea thelemanniana complex (Proteaceae). Conservation Genetic Resources 5(3), 887–890.

Hilu, K. W. and Liang, H. (1997). The matK gene: sequence variation and application in plant systematics. American Journal of Botany 84, 830–839.

Hilu, K. W., Alice, L. A. and Liang, H. (1999). Phylogeny of Poaceae inferred from matK sequences. Annals of the Missouri Botanical Gardens 86, 835–851.

Hilu, K. W., Borsch, T., Muller, K., Soltis, D. E., Soltis, P. S., Savolainen, V., Chase, M. W., Powell, M. P., Alice, L. A., Evans, R., Sauquet, H., Neinhuis, C., Slotta, T. A. B., Rohwer, J. G., Campbell, C. S. and Chatrou, L. W. (2003). Angiosperm phylogeny based on matK sequence information. American Journal of Botany 90, 1758–1776.

Hodač, L., Scheben, A. P., Hojsgaard, D., Paun, O. and Hörandl, E. (2014). ITS polymorphisms shed light on hybrid evolution in apomictic plants: A case study on the Ranunculus auricomus complex. PLoS ONE 9 (7), e103003.

Hodkinson, T. R., Chase, M. W., Takahashi, C., Leitch, I. J., Bennett, M. D. and Renvoize, S. A. (2002). The use of DNA sequencing (ITS and trnL-F), AFLP, and fluorescent in situ hybridization to study allopolyploid Miscanthus (Poaceae). American Journal of Botany 89 (2), 279–286.

Høibová, E., Èížková, J., Christelová, P., Taudien, S., de Langhe, E. and Doležel, J. (2011). The ITS1-5.8S-ITS2 sequence region in the Musaceae: Structure, diversity and use in molecular phylogeny. PLoS ONE 6, e17863.

Hudson, M. E. (2008). Sequencing breakthroughs for genomic ecology and evolutionary biology. Molecular Ecology Notes 8, 3–17.

Ipor, I. B., Ørgaard, M. and Jacobsen, N. (2015). Cryptocoryne ×batangkayanensis (Araceae), a new hybrid from Sarawak. Willdenowia 45, 183–187.

Ipor, I. B., Tawan, C. S. and Jacobsen, N. (2005). A new species of Cryptocoryne (Araceae) from Borneo. Garden Bulletin of Singapore 57, 1–6.

Ipor, I. B., Tawan, C. S., Abai, J., Saupi, N. and Meekiong, K. (2008). Notes on occurrence and distribution of Cryptocoryne species in Sarawak. Folia Malaysiana 10 (2), 115–138. Ipor, I. B., Tawan, C., Jacobsen, N., Wongso, S., Idei, T., Ariff, N. H. M. and Roslan, H. A. (2010). Genotyping natural hybrids of Cryptocoryne purpurea in Borneo and Peninsular Malaysia. Journal of Tropical Biology and Conservation 7, 81–86.

Ito, Y., Ohi, T., Murata, J. and Tanaka, N. (2010). Hybridization and polyploidy of an aquatic plant, Ruppia (Ruppiaceae), inferred from plastid and nuclear DNA phylogenies. American Journal of Botany 96, 1156–1167.

154

Jacob, H. J., Lindpaintnesr, K., Kusumir, E. L., Bunkery, K., Mao, I. P., Gantenv, D., Dzau, J. and Lander, E. S. (1991). Genetic mapping of a gene causing hypertension in the stroke-prone spontaneously hypertensive rat. Cell 67, 213– 224.

Jacobsen, N. (1976). Notes on the Cryptocoryne of Sri Lanka (Ceylon). Botaniska Notiser 129, 179–190.

Jacobsen, N. (1977). Chromosome numbers and taxonomy in Cryptocoryne (Araceae). Botaniska Notiser 130, 71–87.

Jacobsen, N. (1980). The Cryptocoryne albida group of mainland Asia (Araceae). Meded. Landbouwhogeschool Wageningen 19, 183–204.

Jacobsen, N. (1981). Cryptocoryne undulata Wendt und Bemerkungen zu anderen Arten – ein Nachtrag. Aqua Planta 6 (4), 92–94.

Jacobsen, N. (1982). Cryptocoryne. Translated from kernen verlag, stuugart.

Jacobsen, N. (1987). Cryptocoryne in: A Revised Handbook to the Flora of Ceylon, Vol. VI. pp. 85–99.

Jacobsen, N. and Bastmeijer, J. D. (2014). On Cryptocoryne cordata var. siamensis. The Aquatic Gardener 27(2), 28–39.

Jacobsen, N., Bastmeijer, J. B., Bogner, J., Budianto, H., Ganapathy, H. B., Idei, T., Ipor, I. B., Komala, T., Othman, A. S., Rosazlina, R., Siow, J., Wongso, S. and Ørgaard, M. (2016). Hybrids and the Flora of Thailand – 2: Hybridization in the Southeast Asian genus Cryptocoryne (Araceae). Thai Forest Bulletin (Botany) 44, submitted.

Jacobsen, N., Bastmeijer, J. D. and Sasaki, Y. (2002). Cryptocoryne ×purpurea Ridley nothovar. borneoensis N. Jacobsen, Bastmeijer & Y. Sasaki (Araceae), eine neue Hybridvarietät aus Kalimantan. Aqua Planta 27(4), 152–154.

Jacobsen, N., Bastmeijer, J. D., Christensen, C., Idei, T., Lange, C. A., Orabi, J., Sookchaloem, D., Toneato, F. and Ørgaard, M. (2015). The use of AFLP markers to elucidate relationships within Cryptocoryne (Araceae). Aroideana 38E (1).

Janzen, D. H. (1997). What are dandelions and aphids? American Naturalist 111, 586– 589.

Jiao, Y., Wickett, N. J., Ayyampalayam, S., Chanderbali, A. S., Landherr, L., Ralph, P. E., Tomsho, L. P., Hu, Y., Liang, H., Soltis, P. S., Soltis, D. E., Clifton, S. W., Schlarbaum, S. E., Schuster, S. C., Ma, H., Leebens-Mack, J., de, Pamphilis, C. W. (2011). Ancestral polyploidy in seed plants and angiosperms. Nature 473, 97–100.

Johnson, L. A. and Soltis, D. E. (1995). Phylogenetic inference in Saxifragaceae sensu stricto and Gilia (Polemoniaceae) using matK sequences. Annals of the Missouri Botanical Gardens 82, 149–175.

155

Johnson, L. A. and Soltis, D. E. (1994). MatK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. str. Systematic Botany 19 (1), 143–156.

Jones, A. G. and Ardren, W. R. (2003). Methods of parentage analysis in natural populations. Molecular Ecology 12, 2511–2523.

Joseph, N., Krauskopf, E., Vera, M. I. and Michot, B. (1999). Ribosomal internal transcribed spacer 2 (ITS2) exhibits a common core of secondary structure in vertebrates and yeast. Nucleic Acids Research 27, 4533–4540.

Judd, W. S., Campbell, C. S., Kellogg, E. A., Stevens, P. F. and Donoghue, M. J. (2002). Plant systematics, a phylogenetic approach. Sinauer Associates, Massachusetts.

Kalia, R. K., Rai, M. K., Kalia, S., Singh, R. and Dhawan, A. K. (2011). Microsatellite markers: an overview of the recent progress in plants. Euphytica, 177, 309–334.

Kalinowski, S. T. (2004). Counting alleles with rare faction: private alleles and hierarchical sampling designs. Conservation Genetics 5, 539–543. Kameyama, Y. and Ohara, M. (2006). Genetic structure in aquatic bladderworts: Clonal propagation and hybrid perpetuation. Annals of Botany 98, 1017–1024.

Kamvar, Z. N., Tabima, J. F. and Grünwald, N. J. (2014). Poppr: an R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2, e281.

Kandpal, R. P., Kandpal, G. and Weissman, S. M. (1994). Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region–specific markers. Proceedings of the National Academic of Sciences of the United States of America 91, 88–92.

Kantartzi, S. K. (2013). Microsatellites: Methods and Protocols. Methods in Molecular Biology, vol. 1006. ISBN 978-1-62703-389-3.

Kaplan, Z. and Fehrer, J. (2011). Erroneous identities of Potamogeton hybrids corrected by molecular analysis of plants from type clones. Taxon 60 (3), 758–766.

Kellogg, E. A. and Bennetzen, J. L. (2004). The evolution of nuclear genome structure in seed plants. American Journal of Botany 91, 1709–1725.

Khew, G. S.-W. and Chia, T. F. (2011). Parentage determination of Vanda Miss Joaquim (Orchidaceae) through two chloroplast genes rbcL and matK. AoB Plants plr018.

Kiær, L., Philipp, M., Jørgensen, R. and Hauser, T. (2007). Genealogy, morphology and fitness of spontaneous hybrids between wild and cultivated chicory (Cichorium intybus). Heredity 99, 112–120.

Kijas, J. M. H., Fowler, J. C. S. and Thomas, M. R. (1995). An evaluation of sequenced tagged microsatellite site markers for genetic analysis within Citrus and related species. Genome 38, 349–355.

156

Kim, S-C., Mejías, J. A. and Lubinsky, P. (2008). Molecular confirmation of the hybrid origin of the critically endangered western Mediterranean endemic Sonchus pustulatus (Asteraceae: Sonchinae). Journal of Plant Research 121(4), 357–364.

Kirst, M., Cordeiro, C. M., Rezende, G. D. S. P. and Grattapaglia, D. (2005). Power of microsatellite markers for fingerprinting and parentage analysis in Eucalyptus grandis breeding populations. Journal of Heredity 96, 161–166.

Kitani, Y., Zhu, S., Batkhuu, J., Sanchir, C. and Komatsu, K. (2011). Genetic diversity of Ephedra plants in Mongolia inferred from Internal Transcribed Spacer Sequence of nuclear ribosomal DNA. Biological and Pharmaceutical Bulletin 34 (5), 717–726.

Klekowski, E. J. (1988). Mutation, Developmental Selection and Plant Evolution. Columbia University Press, New York.

Klimeš, L., Klimešova, J., Hendricks, R. and van Groenendael, J. (1997). Clonal plant architecture: A comparative analysis of form and function. The Ecology and Evolution of Clonal Plants. In: De Kroon, H. and van Groenendael, J. (eds.), Backhuys Publishers, Leiden, pp. 1–29.

Koch, M. A., Dobeš, C. and Mitchell-Olds, T. (2003). Multiple hybrid formation in natural populations: Concerted evolution of the internal transcribed spacer of nuclear ribosomal DNA (ITS) in North American Arabis divaricarpa (Brassicaceae). Molecular Biology and Evolution 20, 338−350.

Kokubugata, G., Kurihara, T., Hirayama, Y. and Obata, K. (2011). Molecular evidence for a natural hybrid origin of Ajuga × mixta (Lamiaceae) using ITS sequence. Bulletin of the National Museum of Nature and Science. Series B, Botany 37, 175–179.

Kozal, M. J. (2011). New technology to detect low-level drug-resistant HIV variants. Future Virology 6 (1), 17–26.

Krebs S. L. (1997). A cytogenetic study of sterile Rhododendron hybrids. Journal American Rhododendron Society 51 (2). 70–74.

Kreivi, M., Rautiainen, P., Aspi, J. and Hyvarinen, M. (2005). Genetic structure and gene flow in an endangered perennial grass, Arctophila fulva var. pendulina. Conservation Genetics 6, 683–696.

Krieber, M. and Rose, M. R. (1986). Molecular aspects of the species barrier. Annual Reviews in Ecology and Systematics 17, 465–85.

Lagercrantz, U., Ellegren, H. and Andersson, L. (1993). The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Research 21, 1111–1115. Lambertini, C., Riis, T., Olesen, B., Clayton, J. S., Sorrell, B. K. and Brix, H. (2010). Genetic diversity in three invasive clonal aquatic species in New Zealand. BMC Genetics 11, 52.

157

Lamont, B. B., He, T., Enright, N.J., Krauss, S.L. and Miller, B. P. (2003). Anthropogenic disturbance promotes hybridization between Banksia species by altering their biology. Journal of Evolutionary Biology 16, 551–557.

Lawton-Rauh, A., Robichaux, R. H. and Purugganan, M. D. (2003). Patterns of nucleotide variation in homoeologous regulatory genes in the allotetraploid Hawaiian Silversword alliance (Asteraceae). Molecular Ecology 12, 1301–1313.

Lembicz, M., Piszczałka, P., Grzybowski, T., Woźniak, M., Jarmołowski, A., Borkowska, L. and Falińskae, K. (2011). Microsatellite identification of ramet genotypes in a clonal plant with phalanx growth: The case of Cirsium rivulare (Asteraceae). Flora 206, 792–798.

Les, D. H., Murray, N. M. and Tippery, N. P. (2009). Systematics of two imperiled pondweeds (Potamogeton vaseyi, P. gemmiparus) and taxonomic ramifications for subsection Pusilli (Potamogetonaceae). Systematic Botany 34, 643−651.

Levin, D. A. and Francisco-Ortega, J. (1996). Hybridization and the extinction of rare plant species. Conservation of Biology 10, 10–16.

Li, W-H. (1997). Gene structure, genetic codes, and mutation. Molecular Evolution. In: Li, W-H. (ed.), Sinauer Associates, Inc., Sunderland, MA, pp. 25–27.

Li, Y., Korol, A. B., Fahima, T., Beiles, A. and Nevo, E. (2002). Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review. Molecular Ecology 11, 2453–2465.

Litt, M. and Luty, J. A. (1989). A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. American Journal of Human Genetics 44, 397–401.

Liu, L., Li, Y., Li, S., Hu, N., He, Y., Pong, R., Lin, D., Lu, L. and Law, M. (2012). Comparison of next-generation sequencing systems. Journal of Biomedicine and Biotechnology 251364.

Lopes, M. S., Maciel, G., Mendonca, D., Gil, F. S. and Machado, A. D. C. (2006). Isolation and characterization of simple sequence repeat loci in Rubus hochstetterorum and their use in other species from the Rosaceae family. Molecular Ecology Notes 6, 750–752.

López-Caamal, A. and Tovar-Sánchez, E. (2014). Genetic, morphological, and chemical patterns of plant hybridization. Revista Chilena de Historia Natural 87, 16.

Loveless, M. D. and Hamrick, J. L. (1984). Ecological determinants of genetic structure in plant populations. Annual Review of Ecology and Systematics 15, 65–95.

Lowe, A. J., Harris, S. A. and Ashton, P. A. (2004). Ecological genetics: Design, analysis, and application. Oxford: Blackwell Publishing.

Ludwig, J and Reynolds, J. (1988). Statistical ecology. A primer on methods and computing. New York, USA: John Wiley and Sons.

158

Ma, X. F., Szmidt, A. E. and Wang, X. R. (2006). Genetic structure and evolutionary history of a diploid hybrid pine Pinus densata inferred from the nucleotide variation at seven gene loci. Molecular Biology and Evolution 23, 807–816.

Mak, C. Y., Cheung, K. S., Yip, P. Y. and Kwan, H. S. (2008). Molecular evidence for the hybrid origin of Bauhinia blakeana (Caesalpinioideae). Journal of Integrative Plant Biology 50 (1), 111–118.

Malausa, T., Gilles, A., Meglécz, E., Blanquart, H., Duthoy, S., Costedoat, C., Dubut, V., Pech, N., Castagnone-sereno, P., Délye, C., Feau, N., Frey, P., Gauthier, P., Guillemaud, T., Hazard, L., Le Corre, V., Lung-Escarmant, B., Malé, P.G., Ferreira, S. and Martin, J. (2011). High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources 11, 638–644.

Mallet, J. (2005). Hybridization as an invasion of the genome. Trends in Ecology and Evolution 20, 229–237.

Mallet, J. (2007). Hybrid speciation. Nature 446, 279–283. Mansor, M. (1991). Culture and reproduction of freshwater aquarium plants in Malaysia. In: Dawes J. A. (ed.), Aquarama Proceeding Vol. 1. Malaysia. Academic Association, Pte, Ltd, pp. 89–96.

Mantello, C. C., Suzuki, F. I., Souza, L. M., Gonçalves, P. S. and de Souza, A. P. (2011). Development of microsatellite molecular markers and genetic diversity in Hevea Braziliensis. BMC Proceedings 5, (Suppl 7): P11.

Mardis, E. R. (2008). Next generation DNA sequencing methods. Annual Review of Genomics and Human Genetics 9, 387–402.

Margulies, M., Egholm, M, Altman, W. E., Attiya, S., Bader, J. S., Bemben, L. A., Berka, J., et al., (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437, 376–380.

Marques, I., Nieto Feliner, G., Martins-Loucao, M. A. and Fuertes Aguilar, J. (2011). Fitness in Narcissus hybrids: low fertility is overcome by early hybrid vigour, absence of exogenous selection and high bulb propagation. Journal of Ecology 99, 1508–1519.

Marshall, J. L., Arnold, M. L. and Howard, D. J. (2002). Reinforcement: the road not taken. Trends in Ecology and Evolution 17, 558–563.

McLellan, A. J., Prati, D, Kaltz, O. and Schmid, B. (1997). Structure and analysis of phenotypic and genetic variation in clonal plants. The Ecology and Evolution of Clonal Plants. In: De Kroon, H. and van Groenendael, J. (eds.), Backhuys Publishers, Leiden. pp. 185–210.

Mclver, C. J. (2011). PCR troubleshooting and optimization: The Essential Guide. In: Kennedy, S. and Oswald, N. (eds.), Caister Academic Press.

159

Meyerson, L. A., Viola, D. V. and Brown, R. N. (2010). Hybridization of invasive Phragmites australis with a native subspecies in North America. Biological Invasions 12, 103–111.

Miller, M. P. (1997). TFPGA Version 1.3. A Windows program for the analysis of allozyme and molecular population genetic data. Department of Biological Sciences Northern Arizona University, pp. 30.

Miranda, V. F. O., Martins, V. G., Antonio, F. and Bacci J. M. (2010). Plant or fungal sequences? An alternative optimized PCR protocol to avoid ITS (nrDNA) misamplification. Brazilian Archives of Biology and Technology, 53(1), 141– 152.

Mishra, K. M., Rani, S. N., Ram, A. S. and Sreenath, H. L. (2008). A simple method of DNA extraction from coffee seeds suitable for PCR analysis. African Journal of Biotechnology 7, 409–413.

Miz, R. B., Mentz, L. A. and Souza-Chies, T. T. (2008). Overview of the phylogenetic relationships of some southern Brazilian species from section Torva and related sections of “spiny Solanum” (Solanum subgenus Leptostemonum, Solanaceae). Genetica 132, 143–158.

Morgante, M. and Olivieri, A. M. (1993). PCR–amplified microsatellites as markers in plant genetics. Plant Journal 3, 175–182.

Morley, R. J. (1982). Origin and history. In: Tasek Bera: The ecology of a freshwater swamp. Monographiae Biologicae (vol.47). In: Furtado, J. I. and Mori, S. (eds.). The Hague, Dr. W. Junk Publishers, pp. 12–46.

Morozova, O. and Marra, M. A. (2008). Applications of next-generation sequencing technologies in functional genomics. Genomics 92, 255–264.

Mráz, P., Chrtek, J. and Fehrer, J. (2011). Interspecific hybridization in the genus Hieracium s. str.: evidence for bidirectional gene flow and spontaneous allopolyploidization. Plant Systematics and Evolution 293, 237–245.

Mueller, U. G. and Wolfenbarger, L. L. (1999). AFLP genotyping and finger printing. Tree 14, 38–394.

Naidoo, K., Steenkamp, E. T., Coetzee, M. P. A., Wingfield, M. J. and Wingfield, B. D. (2013). Concerted evolution in the Ribosomal RNA Cistron. PLoS ONE 8, e59355.

Nakazato, T., Jung, M. K., Housworth, E. A., Rieseberg, L. H. and Gastony, G. J. (2006). Genetic map-based analysis of genome structure in the homosporous fern Ceraopteris richardii. Genetics 173, 1585–1597.

Nazareno, A. G., Pereira, R. A. S., Feres, J. M., Mestriner, M. A. and Alzate-Marin, A. L. (2009). Transferability and characterization of microsatellite markers in two Neotropical Ficus species. Genetics and Molecular Biology 3, 1–4.

160

Nei, M. (1972). Genetic distance between populations. American Naturalist 106, 283– 292.

Nei, M., Tajima, F. and Tateno, Y. (1983). Accuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data. Journal of Molecular Evolution 19, 153–170.

Neuhaus, H. and Link, G. (1987). The chloroplast tRNALYS(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide. Current Genetics 11, 251–257.

Nevill, P. G., Bradbury, D., Jørgensen, T., Krauss, S., Samaraweera, S. and Gardner, M. G. (2013). Microsatellite primers identified by 454 sequencing in the floodplain tree species Eucalyptus victrix (Myrtaceae). Applications in Plant Sciences 1 (5), 1200402.

Nock, C. J., Elphinstone, M. S., Ablett, G., Kawamata, A., Hancock, W., Hardner, C. M. and King, G. J. (2014). Whole genome shotgun sequences for microsatellite discovery and application in cultivated and wild Macadamia (Proteaceae). Applications in Plant Sciences 2(4), 1300089.

Nomura, K., Harada, T., Saotome, N., Kubota, M. and Katori, M. (2015). Clonal Structure of Two Wild Lotus (Nelumbo nucifera Gaertn.) Populations Inferred from Amplified Fragment Length Polymorphism Fingerprints.

Noor, M. A. F. and Feder, J. L. (2006). Speciation genetics: Evolving approaches. Nature Review Genetics 7, 851–61.

Nyren, P. (2006). The history of pyrosequencing. Methods in Molecular Biology 373, 1– 14.

Oliveira, E. J., Padua, J. G., Zucchi, M. I., Vencovsky, R. and Vieira, M. L. C. (2006). Origin, evolution and genome distribution of microsatellite data. Genetics and Molecular Biology 29 (2), 294–307.

Olmstead, R. G. and Palmer, J. D. (1994). Chloroplast DNA systematics: a review of methods and data analysis. American Journal of Botany 81, 1205–1224.

Orians, C. M. (2000). The effects of hybridization in plants on secondary chemistry: Implications for the ecology and evolution of plant-herbivore interactions. American Journal of Botany 87, 1749–1756.

Othman, A. S. (1997). Molecular systematics of the tropical aquatic plant genus, Cryptocoryne. Phd Thesis, St. Andrews University.

Othman, A. S., Jacobsen, N. and Mansor, M. (2009). Cryptocoryne of Peninsular Malaysia: A portrait of an enchanting plant genus. Universiti Sains Malaysia Press, Pulau Pinang, Malaysia.

Ouborg, N. J., Vergeer, P. and Mix, C. (2006). The rough edges of the conservation genetics paradigm in plants. Journal of Ecology 94, 1233–1248.

161

Oxelman, B., Backlund, M. and Bremer, B. (1999). Relationships of Buddjaceae s.l. investigated using parsimony jackknife and branch support analysis of chloroplast ndhF and rbcL sequence data. Systematic Botany 24, 164–182.

Paetkau, D. (1999). Microsatellites obtained using strand extension: an enrichment protocol. Biotechniques 26, 690–697.

Page, R. D. and Holmes, E. C. (1998). Molecular evolution. A Phylogenetic Approach. Blackwell Scientific, Oxford, pp. 76–77.

Pan, L., Xia, Q., Quan, Z., Liu, H., Ke, W. and Ding, Y. (2010). Development of novel EST-SSRs from sacred lotus (Nelumbo nucifera Gaertn) and their utilization for the genetic diversity analysis of N. nucifera. Journal of Heredity 101, 71–82.

Pandey, M. and Sharma, J. (2012). Efficiency of microsatellite isolation from orchids via next generation sequencing. Open Journal of Genetics 2, 167–172.

Parida, S. K., Kalia, S. K., Sunita, K., Dalal, V., Hemaprabha, G., Selvi, A., Panditm A., Singh, A., Gaikwad, K., Sharma, T. R., Srivastava, P. S., Singh, N. K. and Mohapatra, T. (2009). Informative genomic microsatellite markers for efficient genotyping applications in sugarcane. Theoretical and Applied Genetics 118, 327–338.

Peakall, R. and Smouse, P. E. (2012). GenALEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 28, 2537–2539.

Persson, H. A. and Gustavson, B. A. (2001). The extend of clonality and genetic diversity in ligonberry (Vaccinium vitis–idaea L.) revealed by RAPDs and leaf– shape analysis. Molecular Ecology 10, 1385–1397.

Petit, R. J., Bodénès, C., Ducousso, A., Roussel, G. and Kramer, A. (2004). Hybridization as a mechanism of invasion in oaks. New Phytologist 161, 151– 164.

Pielou, E. C. (1969). An introduction to mathematical ecology. Wiley-Interscience, New York, USA.

Piredda, R., Simeone, M. C., Attimonelli, M., Bellarosa, R. and Schirone, B. (2011). Prospects of barcoding the Italian wild dendroflora: oaks reveal severe limitations to tracking species identity. Molecular Ecology Resources. 11(1), 72– 83. Poczai, P. and Hyvönen, J. (2010). Nuclear ribosomal spacer regions in plant phylogenetics: Problems and prospects. Molecular Biology Reports 37, 1897– 1912. Pollegioni, P., Woeste, K., Mugnozza, G. S. and Malvolti, M. E. (2009). Retrospective identification of hybridogenic walnut plants by SSR fingerprinting and parentage analysis. Molecular Breeding 24, 321–335.

162

Popp, M. and Oxelman, B. (2001). Inferring the history of the polyploid Silene aegaea (Caryophyllaceae) using plastid and homoeologous nuclear DNA sequences. Molecular Phylogenetics and Evolution 20, 474–481.

Powell, W., Machray, G. C. and Provan, J. (1996). Polymorphism revealed by simple sequence repeats. Trends in Plant Science 1, 215–222.

Powell, W., Morgante, M., Andre, C., McNicol, J. W., Machray, G. C., Doyle, J. J., Tingey, S. V. and Rafalski, J. A. (1995). Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome. Current Biology 5, 1023–1029.

Prugnolle, F., Roze, D., Theron, A. and Meeus T, D. (2005). F–statistics under alternation of sexual and asexual reproduction: a model and data from schistosomes (platyhelminth parasites). Molecular Ecology 14, 1355–1365.

Puritz, J. B. and Toonen, R. J. (2013). Next-generation sequencing for high-throughput molecular ecology: a step-by-step protocol for targeted multilocus genotyping by pyrosequencing. Methods Molecular Biology 1006, 89–99.

Queller, D. C., Strassmann, J. E. and Hughes, C. R. (1993). Microsatellites and kinship. Trends in Ecology and Evolution 8, 285–288.

Rajora, O. P. and Rahman, M. H. (2003). Microsatellite DNA and RAPD fingerprinting, identification and genetic relationships of hybrid poplar (Populus × canadensis) cultivars. Theoretical and Applied Genetics 106, 470–477.

Ralser, M., Querfurth, R., Warnatz, H. J., Lehrach, H., Yaspo, M. L. and Krobitsch, S. (2006). An efficient and economic enhancer mix for PCR. Biochemical Biophysical Reserach Communications 347(3), 747–51.

Rassman, K., Schlötterer C. and Tautz, D. (1991). Isolation of simple–sequence loci for use in polymerase chain reaction–based DNA fingerprinting. Electrophoresis 12, 113–118.

Ravi, V., Khurana, J. P., Tyagi, A. K. and Khurana, P. (2008). An update on chloroplast genomes. Plant Systematics and Evolution 271, 101–122.

Ren, G., Abbott, R., Zhou, Y., Zhang, L., Peng, Y. and Liu, J. (2012). Genetic divergence, range expansion and possible homoploid hybrid speciation among pine species in Northeast China. Heredity 108, 552–562.

Rice, W. R. (1989). Analyzing tables of statistical tests. Evolution 43, 223–225.

Richard, G. F. and Paques, F. (2000). Mini- and microsatellite expansions: the recombination connection. EMBO Reports 1, 122–126.

Ridley, C. E., Kim, S.-C. and Ellstrand, N. C. (2008). Bidirectional history of hybridization in California wild radish, Raphanus sativus (Brassicaceae), as revealed by chloroplast DNA. American Journal of Botany 95, 1437–1442.

163

Rieseberg, L. H. (1995). The role of hybridization in evolution: Old wine in new skins. American Journal of Botany 82, 944–953.

Rieseberg, L. H. (1997). Hybrid origins of plant species. Annual Reviews in Ecology and Systematics 28, 359−389.

Rieseberg, L. H. and Carney, S. E. (1998). Plant hybridization. New Phytologist 140, 599–624.

Rieseberg, L. H. and Ellstrand, N. C. (1993). What can molecular and morphological markers tell us about plant hybridization? Critical Review in Plant Sciences 12, 213–241.

Rieseberg, L. H. and Wendel, J. F. (1993). Introgression and its consequences in plants. Hybrid Zones and The Evolutionary Process. In: Harrison, R. G. (ed.), Oxford University Press, Oxford, pp. 70–109.

Rieseberg, L. H., Archer, M. A. and Wayne, R. K. (1999). Transgressive segregation, adaptation, and speciation. Heredity 83, 363–372.

Rieseberg, L. H., Choi, H. and Ham, D. (1991). Differential cytoplasmic versus nuclear introgression in Helianthus. Journal of Heredity 82, 489–493.

Ritz, C. M. and Wissemann, V. (2003). Male correlated non-matroclinal character inheritance in reciprocal hybrids of Rosa, section Caninae (DC) Ser. (Rosaceae). Plant Systematics and Evolution 241, 213–221.

Roa, A. C., Chavarriaga–Aguirre, P., Duque, M. C., Maya, M. M., Bonierbale, M. W., Iglesias, C. and Tohme, J. (2000). Cross–species amplification of Cassava (Manihot esculenta) (Euphorbiaceae) microsatellites: allelic polymorphism and degree of relationship. American Journal of Botany 87 (11), 1647–1655.

Rosazlina, R., Jacobsen, N. and Othman, A. S. (2011). Isolation and characterization of microsatellite DNA loci in Cryptocoryne ×purpurea Ridl. nothovar. purpurea (Plantae: Araceae) and cross-species amplification with its putative parents. Molecular Ecology Resources 11, 1124–1126.

Rossetto, M. (2005). A simple molecular approach for identifying a rare Acronychia (Rutaceae) provides new insights on its multiple hybrid origins. Biological Conservation 121, 35–43.

Rothberg, J. M. and Leamon, J. H. (2008). The development and impact of 454 sequencing. Nature Biotechnology 26, 1117–1124.

Rozen, S. and Skaletsky, H. J. (2000). Primer 3 on the WWW for general users and for biologist programmers. Bioinformatics methods and protocols: Methods in Molecular Biology. In: Krawetz, S. and Misener, S. (eds.), Humana Press, Totowa, New Jersey, pp. 365–386.

164

Sackville Hamilton, N. R., Schmid, B. and Harper, J. L. (1987). Life-history concepts and the population biology of clonal organisms. Proceedings of the Royal Society of London Series B 232, 35–57.

Sahu, S. K., Singh, R. and Kathiresan, K. (2015). Deciphering the taxonomical controversies of Rhizophora hybrids using AFLP, plastid and nuclear markers. Aquatic Botany 125, 48–56.

Salzman, A. G. and Parker, M. A. (1985). Neighbours ameliorate local salinity stress for a rhizomatous plant in a heterogeneous environment. Oecologia (Berlin) 65, 273–277.

Saunders, J. A., Mischke, S. and Hemeida, A. A. (2001). The use of AFLP techniques for DNA fingerprinting in plants. CEQ 2000XL Beckman coulter manual.

Schierenbeck, K. A. and Ellstrand, N. C. (2009). Hybridization and the evolution of invasiveness in plants and other organisms. Biological Invasions 11, 1093–1105.

Schranz, M. E., Mohammadin, M. and Edger, P. P. (2012). Ancient whole genome duplications, novelty and diversification: the WGD Radiation Lag-Time Model. Current Opinion in Plant Biology 15, 147–153.

Schultz, S. T. and Scofield, D. G. (2009). Mutation accumulation in real branches: Fitness assays for genomic deleterious mutation rate and effect in large-statured plants. The American Naturalist 174 (2), 163–175.

Schuster, S. C. (2008). Next-generation sequencing transforms today's biology. Nature Methods 5, 16–18.

Segelbacher, G., Cushman, S. A., Epperson, B. K., Fortin, M-J., Francois, O., Hardy, O. J., Holderegger, R., Taberlet, P., Waits, L. P. and Manel, S. (2010). Applications of landscape genetics in conservation biology: concepts and challenges. Conservation Genetics 11, 375–385.

Selkoe, K. A. and Toone, R. J. (2006). Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology Letters 9 (5), 615–629.

Shendure, J. and Ji, H. (2008). Next-generation DNA sequencing. Nature Biotechnology 26, 1135–1145.

Shin, H., Oh, S.-H., Lim, Y., Hyun, C.-W., Cho, S.-H., Kim, Y.-I. and Kim, Y.-D. (2014). Molecular evidence for hybrid origin of Aster chusanensis, an endemic species of Ulleungdo, Korea. Journal of Plant Biology 57 (3), 174–185.

Siegel, F. R. (2014). Countering 21st Century Social-Environmental Threats to Growing Global Populations. Springer Briefs in Environmental Science. Publisher Springer, ISBN: 3319096869.

Silvertown, J. (2008). The evolutionary maintenance of sexual reproduction: evidence from the ecological distribution of asexual reproduction in clonal plants. International Journal of Plant Sciences 169, 157–168.

165

Simonović, A., Trifunović, M., Raspor, M., Cingel, A., Bogdanović, M., Dragićević, M. and Subotić, A. (2012). Dimethyl Sulfoxide improves sensitivity and specificity of RT-PCR and QRT-PCR amplification of low-expressed transgenes. Archives of Biological Science Belgrade, 64 (3), 865–876.

Smith, B. and Wilson, J. B. (1996). A consumer’s guide to evenness indices. Oikos 76, 70–82.

Smouse, P. E. and Peakall, R. (1999). Spatial autocorrelation analysis of individual multiallele and multilocus genetic structure. Heredity 82, 561–573.

Sokal, R. R. (1979). Testing statistical significance of geographic variation patterns. Systematic Zoology 28, 227–232.

Soltis, D. E. and Soltis, P. S. (1998). Choosing an approach and an appropriate gene for phylogenetic analysis. Molecular Systematics of Plants II: DNA Sequencing. In: Douglas, P. S. S., Soltis, E. and Doyle. J. J. (eds.), Kluwer Academic Publishers, Boston, pp. 2–31.

Soltis, D. E., Buggs, R. J. A., Doyle, J. J. and Soltis, P. S. (2010). What we still don’t know about polyploidy. Taxon 59, 1387–1403.

Soltis, D. E., Soltis, P. S., Chase, M. W., Mort, M. E., Albach, D. C., Zanis, M., Savolainen, V., Hahn, W. H., Hoot, S. B., Fay, M. F., Astell, M., Swensen, S. M., Prince, L. M., Kress, W. J., Nixon, K. C. and Farris, J. S. (2000). Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences. Botanical Journal of the Linnaean Society 133, 38–46.

Soltis, D. E., Soltis, P. S., Schemske, D. W., Hancock, J. F., Thompson, J. N., Husband, B. C. and Judd, W. S. (2007). Autopolyploidy in angiosperms: Have we grossly underestimated the number of species? Taxon 56, 13–30.

Soltis, P. S. and Soltis, D. E. (2009). The role of hybridization in plant speciation. Annual Review of Plant Biology 60, 561–588.

Sonah, H., Deshmukh, R. K., Sharma, A., Singh, V. P., Gupta, D. K., Gacche, R. N., Rana, J. C., Singh, N. K. and Sharma, T. R. (2011). Genome-wide distribution and organization of microsatellites in plants: An insight into marker development in Brachypodium. PLoS ONE 6 (6), e21298.

Steele, K.P. and Vilgalys, R. (1994). Phylogenetic analyses of Polemoniaceae using nucleotide sequences of the plastid gene matK. Systematic Botany 19, 126–142.

Steinkellner, H., Lexer, C., Turetschek, E. and J. Glössl. (1997). Conservation of (GA)n microsatellite between Quercus species. Molecular Ecology 6, 1189–1194.

Stoeckel, S., Grange, J., Fernández-Manjarres, J. F., Bilger, I., Frascaria-Lacoste, N. and Mariette, S. (2006). Heterozygote excess in a self-incompatible and partially clonal forest tree species – Prunus avium L. Molecular Ecology 15, 2109–2118.

166

Strand, M., Prolla, T. A., Liskay, R. M. and Petes, T. D. (1993). Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365, 274–276.

Strong, D. R and Ayres, D. R. (2013). Ecological and evolutionary misadventures of Spartina. Annual Reviews in Ecology and Systematics 44, 389–410.

Sugita, M., Shinozaki, K. and Sugiura, M. (1985). Tobacco chloroplast tRNALys (UUU) gene contains a 2.5-kilobase-pair intron: an open reading frame and a conserved boundary sequence in the intron. Proceedings of the National Academy of Science USA 82, 3557–3561.

Sydes, M. and Peakall, R. (1998). Extensive clonality in the endangered shrub Haloragodendron lucasii (Haloragaceae) revealed by allozymes and RAPDs. Molecular Ecology 7, 87–93.

Symonds, V. V., Soltis, P. S. and Soltis, D. E. (2010). Dynamics of polyploid formation in Tragopogon (Asteraceae): recurrent formation, gene flow, and population structure. Evolution 64, 1984–2003.

Tachida, H. and Iizuka, M. (1992). Persistence of repeated sequences that evolve by replication slippage. Genetics 131, 471–478.

Takezaki, N., Nei, M. and Tamura, K. (2010). POPTREE2: Software for constructing population trees from allele frequency data and computing other population statistics with windows interface. Molecular Biology and Evolution 27, 747– 752.

Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30 (12), 2725–2729.

Tanner, J. E. (2001). The influence of clonality on demography: Patterns in expected longevity and survivorship. Ecology 82, 1971–1981.

Tautz, D. and Schlötterer, C. (1994). Simple sequences. Current Opinion in Genetics and Development 4, 832–837.

Tautz. D. and Renz, M. (1984). Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Research 12, 4127–4138.

Terzioğlu, S., Coşkunçelebi, K. and Gültepe, M. (2012). Primula × uzungolensis (Primulaceae): a new natural hybrid from NE Anatolia. Turkish Journal of Botany 36, 9–19. Tiffney, B. H. and Niklas, K. J. (1985). Clonal growth in land plants. Population Biology and Evolution of Clonal Organisms. In: Jackson, J. B. C., Buss, L. W. and Cook, R. E. (eds.), Yale University Press, New Haven, pp. 35–66. Ting, A. P. J., Wong, S. Y., Jamliah, J. and Boyce, P. C. (2012). Phylogenetic study of the Schismatoglottis Nervosa Complex (Araceae: Schismatoglottideae). Garden’s Bulletin Singapore 64 (1), 211–219.

167

Toth, G., Gaspari, Z. and Jurka, J. (2000). Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Research 10, 967–981.

Tovar-Sánchez, E., Rodríguez-Carmona, F., Aguilar-Mendiola, V., Mussali-Galante, P., López-Caamal, A. and Valencia-Cuevas, L. (2012). Molecular evidence of hybridization in two native invasive species: Tithonia tubaeformis and T. rotundifolia (Asteraceae) in Mexico. Plant Systematics and Evolution 298, 1947– 1959.

Travis, S. E., Marburger, J. E., Windels, S. and Kubátova, B. (2010). Hybridization dynamics of invasive cattail (Typhaceae) stands in the western great lakes region of North America: A molecular analysis. Journal of Ecology 98, 7–16.

Tripathi, A. M., Tyagi, A., Kumar, A., Singh, A., Singh, S., Chaudhary, L. B. and Roy, S. (2013). The Internal Transcribed Spacer (ITS) Region and trnhH-psbA are suitable candidate loci for DNA barcoding of tropical tree species of India. PLoS ONE 8(2), e57934.

Tucker, R. T. and Behm, J. E. (2011). Hybridization, species collapse, and species reemergence after disturbance to premating mechanisms of reproductive isolation. Evolution 65, 2591–2605.

Uzunova, M. I. and Ecke, W. (1999). Abundance, polymorphism and genetic mapping of microsatellites in oilseed rape (Brassica napus L.). Plant Breeding 118, 323– 326.

Vallejo-Marin, M. and Lye, G. C. (2013). Hybridisation and genetic diversity in introduced Mimulus (Phrymaceae). Heredity 110, 111–122.

Van Groenendael, J., Klimeš, L., Klimešova, J. and Hendricks, R. (1996). Comparative ecology of clonal plants. Philosophical Transactions of the Royal Society of London 351, 1331–1339.

Van Oosterhout, C., Hutchinson, W. F., Wills, D. P. and Shipley, P. (2004). MICRO– CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4, 535–538.

Vandepitte, K., Honnay, O., De Meyer, T., Jacquemyn, H. and Roldán-Ruiz, I. (2010). Patterns of sex ratio variation in the dioecious forest perennial Mercurialis perennis. Plant Ecology 206, 105–114.

Varshney, R. K, Thudi, M., Aggarwal, R. and Börner, A. (2007). Genic molecular markers in plants: Development and applications. Genomics Assisted Crop Improvement: Genomics Approaches and Platforms. In: Varshney, R. K. and Tuberosa, R. (eds.), vol 1. Springer, Dordrecht, pp. 13–29.

Vekemans, X., Beauwens, T., Lemaire, M. and Roldan-Ruiz, I. (2002). Data from amplified fragment length polymorphism (AFLP) markers show indication of size homoplasy and of a relationship between degree of homoplasy and fragment size. Molecular Ecology 11, 139–151.

168

Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research. 11, 4407–4414.

Wakasugi, T., Sugita, M., Tsudzuki, T. and Sugiura, M. (1998). Updated gene map of Tobacco chloroplast DNA. Plant Molecular Reporter 16, 231–241.

Wall, P. K., Leebens-Mack, J., Chanderbali, A. S., Barakat, A., Wolcott, E., Liang, H., Landherr, L., Tomsho, L. P., Hu, Y., Carlson, J. E., Ma, H., Schuster, S. C., Soltis, D. E., Soltis, P. S., Altman, N. and DePamphilis, C. W. (2009). Comparison of next generation sequencing technologies for transcriptome characterization. BMC Genomics 10, 347.

Wang, H., Walla, J. A., Zhong, S., Huang, D. and Dai, W. (2012). Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.). Plant Cell Reports 31(11), 2047–2055.

Wang, M. L., Barkley, N. A. and Jenkins, T. M. (2009). Microsatellite markers in plants and insects. Part I: Applications of Biotechnology. Genes, Genomes, and Genetics (Special Issue 1), 54–67.

Wang, Y. W., Samuels, T. D. and Wu, Y. Q. (2011). Development of 1,030 genomic SSR markers in switchgrass. Theoretical and Applied Genetics 122(4), 677–686.

Wang, Z., Weber, J. L., Zhong, G. and Tanksley, S. D. (1994). Survey of plant short tandem DNA repeats. Theoretical and Applied Genetics 88, 1–6.

Watkinson, A. R. and Powell, J. C. (1993). Seedling recruitment and the maintenance of clonal diversity in plant populations–computer simulation of Ranunculus repens. Journal of Ecology 81, 707–717.

Waycott, M., James, S. H. and Walker, D. (1997). Genetic variation within and between populations of Posidonea australis, a hydrophilous, clonal sea grass. Heredity 79, 408–417.

Weber, J. L. (1990). Informativeness of human (dC-dA)n. (dG-dT)n polymorphisms. Genomics 7, 524–530

Weising, K., Nybom, H., Wolff, K. and Kahl, G. (2005). DNA fingerprinting in plants: Principles, methods, and applications, Second Edition. Taylor and Francis, Boca raton– CRC Press.

Wendel, J. F., Schnabel, A. and Seelanan, T. (1995). Bidirectional interlocus concerted evolution following allopolyploid speciation in cotton (Gossypium). Proceedings of the National Academic of Sciences of the United States of America 92, 280−284.

White, G. and Powell, W. (1997). Cross–species amplification of SSR loci in the Meliaceae family. Molecular Ecology 6, 1195–1197.

169

White, T. J., Bruns, T. D., Lee, S. and Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols, A guide to Methods and Amplifications. In: Innis, M. A., Gelfand, D. H., Sninsky, J. J. and White, T. J. (eds.), Academic Press, San Diego, California, USA, pp. 315–322.

Whitney, K. D., Ahern, J. R., Campbell, L. G., Albert, L. P. and King, M. S. (2010). Patterns of hybridization in plants. Perspective in Plant Ecology 12, 175–182.

Whittaker, J. C., Harbord, R. M., Boxall, N., Mackay, I., Dawson, G. and Sibly, R. M. (2003). Likelihood-based estimation of microsatellite mutation rates. Genetics 164, 781–787.

Widmer, A. and Baltisberger, M. (1999). Molecular evidence for allopolyploid speciation and a single origin of the narrow endemic Draba ladina (Brassicaceae). American Journal of Botany 86, 1282–1289.

Wilson, A. S. G., Ritland, B. J. and van der Kamp, K. (2005). Spatial genetic and clonal structure in Maianthemum dilatatum as defined by AFLP markers. Canadian Journal of Botany 83, 1126–1132.

Wissemann, V. (2007). Plant evolution by means of hybridization. Systematics and Biodiversity 5 (3), 243–253.

Wolfe, K. H., Morden, C. W. and Palmer, J. D. (1992). Function and evolution of a minimal plastid genome from a nonphotosynthetic parasitic plants. Proceedings of the National Academy of Sciences, USA 89, 10648–10652.

Won, H. and Renner, S. S. (2005). The internal transcribed spacer of nuclear ribosomal DNA in the gymnosperm Gnetum. Molecular phylogenetics and evolution 36 (3), 581–597.

Wood, T. E., Takebayashi, N., Barker, M. S., Mayrose, I., Greenspoon, P. B. and Rieseberg, L. H. (2009). The frequency of polyploidy speciation in vascular plants. Proceedings of the National Academic of Sciences of the United States of America 106, 13875–13879.

Woodhead, M., Russell, J., Squirrell, J., Hollingsworth, M., Cardle, L., Ramsay, L., Gibby, M. and Powell, W. (2003). Development of EST-SSRs from the alpine lady-fern, Athyrium distentifolium. Molecular Ecology Notes 3, 287–290.

Young, A., Boyle, T. and Brown, A. H. D. (1996). The population genetic consequences of habitat fragmentation for plants. Trends of Ecology and Evolution 11, 413– 418.

Yu, J., Kuroda, C. and Gong, X. (2014). Natural Hybridization and Introgression between Ligularia cymbulifera and L. tongolensis (Asteraceae, Senecioneae) in four different locations. PLoS ONE 9(12), e115167.

Yuan, T., Wang, L. Y. and Roh, M. S. (2010). Confirmation of Clematis hybrids using molecular markers. Scientia Horticulturae 125, 136–145.

170

Yuji, M., Hitoshi, Y., Hiruke, K., Tomomi, U., Ken-ichi., Yukio, S. and Sakihito, K. (2005). Sequence variation in the rbcL-accD region in the chloroplast genome of Moraceae. Plant Biotechnology 22, 231–233.

Zabeau, M. and Vos, P. (1993). Selective restriction fragment amplification: A general method for DNA fingerprinting. European patent application, publication no. EP 0534858-A1, No. 92402629.7.

Zalapa, J. E., Cuevas, H., Zhu, H., Steffan, S., Senalik, D., Zeldin, E., Mccown, B., Harbut, R. and Simon, P. (2012). Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. American Journal of Botany 99 (2), 193–208.

Zalewska-Gałosz, J., Jopek, M. and Ilnicki, T. (2014). Hybridization in Batrachium group: Controversial delimitation between heterophyllous Ranunculus penicillatus and the hybrid Ranunculus fluitans × R. peltatus. Aquatic Botany 120, 160–168.

Zane, L., Bargelloni, L. and Patarnello, T. (2002). Strategies for microsatellite isolation: a review. Molecular Ecology 11, 1–16.

Zha, H. -G., Milne, R. I. and Sun, H. (2008). Morphological and molecular evidence of natural hybridization between two distantly related Rhododendron species from the Sino- Himalaya. Botanical Journal of the Linnean Society 156, 119–129.

Zhang, W., Wendel, J. F. and Clark, L. G. (1997). Bamboozled again! Inadvertent isolation of fungal rDNA sequences from bamboos (Poaceae: Bambusoideae). Molecular Phylogenetics and Evolution 8, 205–217.

Zhao, D-W., Yang, J-B., Yang, S-X., Kato, K. and Luo, J-P. (2014). Genetic diversity and domestication origin of tea plant Camellia taliensis (Theaceae) as revealed by microsatellite markers. BMC Plant Biology 14 (14).

Zhu, X.-F., Li, Y., Wu, G.-L., Fang, Z.-D., Li, Q.-J. and Liu, J.-Q. (2009). Molecular and morphological evidence for natural hybridization between Primula secundiflora Franchet and P. poissonii Franchet (Primulaceae). Acta Biologica Cracoviensia Series Botanica 51 (2), 29–36.

171

LIST OF PUBLICATIONS

1.1 Rosazlina, R., Jacobsen, N., Ørgaard, M. and Othman, A. S. (2015). Utilizing next generation sequencing to characterize microsatellite loci in a tropical aquatic plant species Cryptocoryne cordata var. cordata (Araceae). Biochemical Systematics and Ecology 61, 385–389.

1.2 Jacobsen, N., Bastmeijer, J. D., Ganapathy, H. B., Mangsor, K. N. A., Mansor, M., Othman, A. S., Rahman, S. N. A., Rusly, R. and Siow, J. (2015). Crytocoryne nurii var. raubensis: a new calcicolous variety from Pahang, Peninsular Malaysia. The Aquatic Gardener 28 (2), 32–43.

1.3 Jacobsen, N., Bastmeijer, J. D., Ganapathy, H. B., Mangsor, K. N. A., Mansor, M., Othman, A. S., Rahman, S. N. A., Rusly, R. and Siow, J. (2013). A new calcicolous variety of Cryptocoryne nurii Furtado (Araceae) from Pahang, Peninsular Malaysia. Malayan Nature Journal 65 (4), 230–239.

1.4 Rusly, R. and Othman, A. S. (2012). The Water Trumpet of Johore. In: Natural Resources of Kampung Peta Endau-Rompin National Park. 62–67. Eds; Othman A.S and Shahrul Anuar M.S. ISBN: 978-983-42850-3-6. School of Biological Sciences, USM, Penang.

1.5 Rusly, R., Jacobsen, N., Ørgaard, M. and Othman, A. S. (2016). Molecular evidence for the hybrid origin of Cryptocoryne ×purpurea Ridl. nothovar. purpurea (Araceae). Manuscript in progress.

172

LIST OF SEMINARS AND PRESENTATIONS

1.2 Rosazlina, R. and Othman, A. S. (2015). The Water Trumpet of Johor; Molecular Contributions to Conservation. International Conference on Biodiversity (ICB). 16-17 November 2015. Universiti Tun Hussein Onn Malaysia. ORAL PRESENTATION.

1.2 Rosazlina, R., Jacobsen, N., Ørgaard, M. and Othman, A. S. (2014). Population genetic analysis and origin discrimination of Cryptocoryne × purpurea Ridl. nothovar. purpurea using microsatellite markers. The 9th Regional IMT-GT Uninet Conference. In: Integrated Multidisciplinary & Transboundary Research for Global Transformation. 3-5 November 2014. Gurney Hotel, Penang, Malaysia. ORAL PRESENTATION.

1.3 Rosazlina, R., Jacobsen, N., Ørgaard, M. and Othman, A. S. (2014). Spatial distribution pattern of Cryptocoryne ×purpurea Ridl. nothovar. purpurea, a natural aquatic plant hybrid of the Malay Peninsular. Malaysia International Biological Symposium. In: Sustainable Bioresources for Bioeconomy. 28-29 October 2014. Palm Garden Hotel IOI Resort, Putrajaya, Malaysia. ORAL PRESENTATION.

1.4 Rosazlina, R. and Othman, A. S. (2013). Parental origin of Cryptocoryne ×purpurea Ridl. nothovar. purpurea, a natural aquatic plant hybrid of the Malay Peninsular. In Proceedings of the 8th Postgraduate PPSKH Colloquium. 5-6 June 2013. School of Biological Sciences, USM. ORAL PRESENTATION.

1.5 Rosazlina, R., Jacobsen, N. and Othman, A. S. (2012). Isolation and Characterization of Microsatellite DNA Loci in Cryptocoryne ×purpurea Ridl. nothovar. purpurea (Plantae: Araceae) and Cross-species Amplification with its Putative Parents. Malaysia International Biological Symposium 2012. In: Sustainable Management of Bioresources. 11-12 July 2012. Residence Hotel UNITEN, Selangor, Malaysia. POSTER PRESENTATION

173

174