University of Bradford eThesis
This thesis is hosted in Bradford Scholars – The University of Bradford Open Access repository. Visit the repository for full metadata or to contact the repository team
© University of Bradford. This work is licenced for reuse under a Creative Commons Licence.
Platelet micro-particles induce angiogenesis through the delivery of the micro-RNA Let-7a into endothelial cells
Chinedu Anthony ANENE
Submitted for the Degree of Doctor of Philosophy
School of Medical Sciences Faculty of Life Sciences University of Bradford
2017
ABSTRACT
Chinedu Anthony Anene Platelet micro-particles induce angiogenesis through the delivery of the micro- RNA Let-7a into endothelial cells. Keywords: Cardiovascular Diseases, microRNA, Angiogenesis, Endothelial cells, Let-7a, Micro-Particles, Platelet Activation, Molecular Mechanisms.
Cardiovascular disease is a major cause of morbidity and mortality around the globe, which is linked to athero-thrombosis. The risk factors for athero- thrombosis, thus cardiovascular disease is impaired anti-thrombotic and anti- inflammatory functions of the endothelium. Thrombosis is a hallmark of cardiovascular disease/complications characterised by increased platelet activation and increased secretion of platelet micro-particles that induce angiogenesis. This study determined the role of platelet micro-particles derived microRNA in the regulation of angiogenesis and migration, with a focus on the regulation of thrombospondin-1 release by platelet micro-particles delivered Let- 7a. The role of thrombospondin-1 receptors (integrin beta-1 and integrin associated protein) and downstream caspase-3 activation were explored by Let- 7a inhibition prior to PMP treatment. MicroRNA dependent modulation of pro- angiogenic proteins including monocyte chemoattractant protein-1 and placental growth factor, and recruitment of activating transcription factor-4 protein to their promoter regions were explored. Main findings are: 1. Platelet micro-particles induce angiogenesis, migration, and release of novel cytokine subsets specific to platelet micro-particle’s RNA content. 2. The targeting of thrombospondin-1 mRNA by platelet micro-particles’ transferred Let-7a chiefly modulate the angiogenic effect on endothelial cells. 3. The inhibition of thrombospondin-1 translation enable platelet micro-particles to increase angiogenesis and migration in the presence of functional integrin beta-1 and integrin associated protein, and reduced cleaving of caspase-3. 4. Platelet micro-particle modulate the transcription of monocyte chemoattractant protein-1 and placental growth factor in a Let-7a dependent manner. 5. Let-7a induce angiogenesis
i independent of other platelet micro-particle’s microRNAs. Platelet micro-particle derived Let-7a is a master regulator of endothelial cell function in this model, which presents an opportunity for the development of new biomarkers and therapeutic approaches in the management of cardiovascular disease. Future studies should aim to confirm these findings in-vivo.
ii DEDICATION
This work is dedicated to the ever-faithful God for keeping me strong and safe.
To my parents, Dr C. Anene and R. Anene, like gods you set the path, loved, supported financially and emotionally, thank you. I could not have imagined coming this far without your backing.
To my siblings Adora, Ugochukwu, Lotanna and Tochukwu for their inspiration, lost my way but not anymore, my little ones. Thank you for your patience and it time to catch up.
To Lucy for everything, a kind heart and I will always remember the year 2013.
To the memory of more than a cousin, Okwudili Okeke.
iii ACKNOWLEDGEMENT
I would like to express my heartfelt appreciation to my supervisors for their great mentorship. To Dr W. Roberts, thank you for the continuous support, patience, motivation, and immense knowledge. I could not have imagined having a better mentor for this PhD research and the write up process. To Dr. A. Graham, I could not have imagined having interest in vascular biology without your comprehensive introduction to the filed during my MSc project. Without your patience and immense knowledge, the research process and write up would have been rocky. To Dr. J. Boyne, thank you for the continuous support and simplification of the molecular biology. The insightful comments and technical questions you posed helped widen the scope of this research from various perspectives.
My sincere thanks also go to Charles Bridgewood, who facilitated the investigation on MCP-1 and Emtiaz Aziz for the day to day technical support. Our political discussions made the times spent in the laboratory fun. I thank my colleagues (Aziza, Anca, Shabana, Osama, Mahmood, Pouria) for the stimulating discussions, for the exceptional help with recruiting blood donors, and all the fun we have had in the last few years. Last but not the least, I would like to thank Jenny for supporting me emotionally throughout the writing stage. To all the those who supported with their blood, we could not have done it without your eternal gift. Finally, I would like to thank the department of Pharmacy for additional support with reagents.
iv DECLARATION
I declare that this work is my own work and that where the work of others is used, this has been duly acknowledged. The content of this thesis has not been submitted for the award of PhD degree anywhere else.
v TABLE OF CONTENTS
ABSTRACT ...... I DEDICATION ...... III ACKNOWLEDGEMENT ...... IV DECLARATION ...... V TABLE OF CONTENTS ...... VI LIST OF FIGURES ...... X LIST OF TABLES ...... XIII ABBREVIATIONS AND ACRONYMS ...... XIV CHAPTER 1: INTRODUCTION ...... 1 1.1 GENERAL INTRODUCTION ...... 1 1.2 THE ENDOTHELIUM ...... 3 1.3 ATHEROSCLEROSIS AND THROMBOSIS ...... 6 1.4 MICRORNAS: INSIGHT INTO LETHAL-7 (LET-7) ...... 8 1.4.1 Regulation of miRNA transcription ...... 13 1.4.2 Nuclear processing ...... 14 1.4.3 Nuclear export and silencing complex ...... 15 1.5 ANGIOGENESIS ...... 17 1.5.1 Cell-matrix interaction in angiogenesis ...... 17 1.5.2 Role of Growth Factors in angiogenesis ...... 20 1.5.2 Endogenous inhibitors of angiogenesis ...... 22 1.5.3 Role of microRNAs in angiogenesis ...... 26 1.5.4 Angiogenesis in cardiovascular diseases ...... 30 1.6 PLATELET STRUCTURE AND BIOLOGY ...... 33 1.6.1 Platelet Micro-particles ...... 36 1.6.2 Platelet and PMP-miRNA ...... 38 1.6.3 Platelet microRNA in cardiovascular complications ...... 40 1.7 AIMS ...... 41 1.6.1 Objectives ...... 42 CHAPTER 2: MATERIALS AND METHODS ...... 43 2.1 CHEMICALS AND KITS ...... 43 2.2 PLATELET AND PMP ISOLATION AND CHARACTERIZATION ...... 46 2.2.1 Isolation of platelets ...... 46 2.2.2 Isolation of platelet micro-particles ...... 47 2.2.3 Flow cytometry to confirm cell origin of PMP ...... 48
vi 2.3 CELL CULTURE ...... 49 2.3.1 Cell transfection for loss or gain of function analysis ...... 51 2.3.2 Cell transfection to measure reporter gene signal ...... 54 2.3.3 Immunocytochemistry analysis of PMP internalisation ...... 54 2.4 ENDOTHELIAL CELL FUNCTIONAL ASSAYS ...... 55 2.4.1 Endothelial Cell Tube Formation Assay ...... 55 2.4.2 Proliferation assay with CellTiter-Glo ...... 57 2.4.3 Luciferase assay to measure reporter gene signal ...... 57 2.5 PROTEIN ANALYSIS ...... 59 2.5.1 Protein quantification assay with Bio-Rad Bradford assay ...... 59 2.5.2 Protein array of angiogenesis related proteins ...... 60 2.5.3 Enzyme-linked Immunosorbent Assays (ELISA) ...... 62 2.5.3.1 ELISA for THBS-1 ...... 63 2.5.3.2 ELISA for MCP-1 ...... 63 2.5.4 SDS-PAGE and Western blot analysis ...... 64 2.6 MANIPULATION OF NUCLEIC ACIDS ...... 67 2.6.1 RNA degradation experiments with RNAse Treatment ...... 67 2.6.1.1 RNA Isolation for degradation analysis ...... 67 2.6.2 Bacterial culture for plasmid preparation ...... 68 2.6.2.1 Bacterial culture for Plasmid DNA isolation with Qiagen miniprep ...... 69 2.7 GENE EXPRESSION ANALYSIS ...... 70 2.7.1 Total RNA extraction ...... 70 2.7.2 Quantification of RNA for polymerase chain reaction and RNA sequencing .. 72 2.7.3 First strand cDNA synthesis for standard polymerase chain reaction ...... 72 2.7.4 Stem loop cDNA synthesis for miRNA polymerase chain reaction ...... 73 2.7.5 Quantitative Real Time PCR (qPCR) ...... 75 2.7.5.1 qRT-PCR analysis of target miRNA (stem Loop) ...... 75 2.7.5.2 qRT-PCR analysis of target gene mRNA transcripts ...... 76 2.7.5.3 Comparative CT Method for the analysis of qPCR results ...... 77 2.8 CHROMATIN IMMUNOPRECIPITATION ...... 80 2.8.1 Cross-linking of proteins to DNA in PMP treated HUVEC ...... 82 2.8.2 Nuclei Preparation and Chromatin Digestion ...... 82 2.8.3 Analysis of Chromatin Digestion and Concentration ...... 83 2.8.4 Agarose gel electrophoresis to investigate the size of DNA ...... 84 2.8.5 Chromatin Immunoprecipitation ...... 85 2.8.6 Elution of Chromatin and Reversal of Cross-links and DNA purification ...... 86 2.8.7 qRT-PCR for Chromatin Immunoprecipitation ...... 86 2.8.7.1 Percentage input, comparative CT method ...... 87 2.9 RNA SEQUENCING ...... 89 2.9.1 Analysis of RNA sequencing data ...... 90 2.10 COMPUTATIONAL APPROACHES ...... 90 2.11 STATISTICAL ANALYSIS ...... 91 CHAPTER 3: PMP REGULATE ENDOTHELIAL CELL FUNCTION THROUGH RNA ...... 92 3. INTRODUCTION ...... 92 3.1 PLATELET CHARACTERISATION ...... 92 3.2 CHARACTERISATION OF PLATELET MICRO-PARTICLES ...... 95
vii 3.2.1 Differentiation of platelet micro-particles using surface markers ...... 95 3.2.2 Protein quantification of platelet micro-particles ...... 98 3.3 QUANTIFICATION OF PMP BOUND CYTOKINES ...... 100 3.3.1 Quantification of PMP’s RNA content by Illumina RNA Sequencing ...... 103 3.4 PMP INDUCE ROBUST ANGIOGENESIS IN EAHY926 CELLS ...... 106 3.5 PMP INDUCED ANGIOGENESIS IN EAHY926 CELLS IS DEPENDENT ON RNA TRANSFER ...... 108 3.5.1 RNA Degradation ...... 108 3.5.2 Degrading PMP RNA reduces their pro-angiogenic effect on EAhy926 cells 109 3.6 PMPS MODULATE THE PRODUCTION OF ANGIOGENIC CYTOKINES BY EAHY926 CELLS ...... 111 3.6.1 PMPs causes differential release of angiogenic cytokines by EAhy926 ...... 111 3.7 EFFECT OF PLATELET MICRO-PARTICLES ON EAHY926 CELL PROLIFERATION . 114 3.7.1 Optimisation of proliferation assay ...... 114 3.7.2 Optimisation of serum concentration ...... 115 3.7.3 Effect of platelet micro-particles on EAhy926 proliferation ...... 117 3.8 EFFECT OF PLATELET MICRO-PARTICLES ON HUVEC ANGIOGENESIS ...... 120 3.8.1 PMP induced angiogenesis response by HUVEC ...... 120 3.9 PMPS MODULATE THE PRODUCTION OF ANGIOGENIC CYTOKINES BY HUVECS ...... 123 3.9.1 PMP induces differential release of angiogenic cytokines by HUVEC ...... 123 3.10: DISCUSSION ...... 126 CHAPTER 4: PMP-MIRNA REGULATE THSB-1 MRNA TO INDUCE ANGIOGENESIS ..... 134 4.1 INTRODUCTION ...... 134 4.2 PMP EXPRESS THE MICRORNA LET-7A AND MIR-221 ...... 136 4.2.1 PMP express all the subtypes of the microRNA Let-7a and miR-221 ...... 137 4.3 PMP INCREASED THE LEVELS OF LET-7A IN HUVEC ...... 138 4.4 PMP TRANSFER IS REQUIRED TO ELICIT ENDOGENOUS EXPRESSION OF LET-7A IN TREATED HUVEC...... 140 4.4.1 PMP is internalised by HUVEC in time dependent manner ...... 143 4.5 PMPS EXPRESS THBS-1 MRNA ...... 143 4.5.1 PMP express three subtypes of THBS mRNA ...... 145 4.8 PMPS ELICIT POSITIVE FEEDBACK TRANSCRIPTION OF THBS-1 ...... 146 4.9 PMP INHIBIT TRANSLATION OF THBS-1 PROTEIN ...... 147 4.9.1 THBS-1 protein level in HUVEC is not affected by transfection reagent ...... 148 4.9.2 PMP inhibition of THBS-1 protein expression in HUVEC is dependent on its Let-7a content ...... 149 4.10 PMP-LET-7A INHIBITION OF THBS-1 IS NECESSARY AND SUFFICIENT TO PROMOTE ANGIOGENESIS IN HUVEC ...... 151 4.11 FUNCTIONAL INTEGRIN b1 (CD29) AND INTEGRIN ASSOCIATED PROTEIN (CD47) IS INDISPENSABLE IN PMP INDUCED ANGIOGENESIS ...... 153 4.12 TARGETING OF THBS-1 BY TRANSFERRED LET-7A IS CRITICAL IN PMP INDUCED ANGIOGENESIS ...... 155 4.13 PMP INHIBITED CASPASE 3 ACTIVATION IN HUVEC THROUGH A LET-7A DEPENDENT MECHANISM ...... 158
viii 4.14 LET-7A DIRECTLY TARGET THE 3’UTR OF THBS-1 MRNA TO INHIBIT ITS PROTEIN EXPRESSION ...... 160 4.15 PMP DELIVERED RNA CONTENT TARGET THE 3’UTR OF THBS-1 TO INHIBIT ITS PROTEIN EXPRESSION ...... 161 4.16 LET-7A IS A PRO-ANGIOGENIC MIRNA THAT REGULATE ANGIOGENESIS THROUGH THBS-1 ...... 163 4.17: DISCUSSION ...... 165 CHAPTER 5: PMP MEDIATED ANGIOGENESIS REQUIRE TRANSCRIPTION LEVEL REGULATION OF PRO-ANGIOGENIC PROTEINS MCP-1 ...... 171 5.1 INTRODUCTION ...... 171 5.2 PMP INCREASED THE TRANSCRIPTION OF ATF-4 MRNA THROUGH LET-7A DEPENDENT MECHANISM ...... 172 5.3 PMP TREATMENT DID NOT REGULATE ATF-4 PROTEIN LEVEL IN HUVEC ...... 175 5.4 PMP MEDIATE DIFFERENTIAL ENRICHMENT OF ATF-4 PROTEINS AT PROMOTER REGIONS OF PRO-ANGIOGENIC PROTEINS IN HUVEC ...... 177 5.4.1 PMPs mediate ATF-4 enrichment at the MCP-1 promoter in HUVEC through a Let-7a dependent mechanism ...... 177 5.4.2 PMPs mediate ATF-4 enrichment at the placental growth factor (PIGF) promoter in HUVEC through a Let-7a dependent mechanism ...... 180 5.7 PMPS INCREASES HUVEC MRNA LEVELS OF MCP-1 AND PIGF IN RNA DEPENDENT MECHANISM ...... 182 5.9 PMPS INDUCE THE TRANSCRIPTION OF MCP-1 AND PIGF IN HUVEC THROUGH LET-7A DEPENDENT MECHANISM ...... 183 5.10 PMP-LET-7A RELATED TRANSCRIPTION OF MCP-1 CORRELATES WITH INCREASED MCP-1 PROTEIN EXPRESSION...... 186 5.11 PMP ENHANCE HUVEC MIGRATION IS DEPENDENT ON TRANSFERRED LET-7A ...... 188 5.12 DISCUSSION ...... 190 CHAPTER 6: GENERAL DISCUSSION AND FUTURE WORK ...... 195 6.1 DISCUSSION ...... 195 6.2 CONCLUSION ...... 199 6.3 FUTURE WORK ...... 203 PRESENTATIONS AND POSTERS ...... 206 APPENDIX ...... 247
ix LIST OF FIGURES
Figure 1.1: Normal Endothelial Function. 5 Figure 1.2: The progression of an atherosclerotic lesion. 7 Figure 1.3a: Genomic location of the human Let-7 members. 10 Figure 1.3b: Regulation of Let-7 transcription. 11 Figure 1.3c: Molecular and structural characteristics of Let-7 family. 12 Figure 1.4 miRNA biogenesis. 16 Figure 1.5: The structure of THBS-1 protein. 23 Figure 1.6: Platelet structure and biomolecules. 33 Figure 1.7: Platelet activation in blood clothing. 35 Figure 2.1: Representative morphology of HUVEC. 49 Figure 2.2: Principle of in-vitro angiogenesis. 56 Figure 2.3: Protein array method. 61 Figure 2.4: Schematic representation of Human let-7a-2 in pMIR Plasmid Vector and empty expression plasmid. . 68 Figure 2.5: Schematic representation of the human THBS-1 3’UTR vector, full inserted sequence is shown in the appendix. 69 Figure 2.6: Schematic workflow of Chromatin Immunoprecipitation. 81 Figure 2.7 RNA sequencing work flow. 89 Figure 3.1: Characteristics of isolated platelets. 94 Figure 3.2: CD41a characterisation of platelet’s micro-particles. 97 Figure 3.3: Annexin V and CD31 characterisation of platelet micro-particles. 98 Figure 3.4: Representative standard curve for Bradford protein quantification assay. 99 Figure 3.5: Protein array images showing binding of proteins present on the surface of PMPs. 101 Figure 3.6: Relative group functions of predicted mRNA targets for the top 25 highly expressed miRNAs in PMP. 104 Figure 3.7: Relative group disease association of predicted mRNA targets of top 25 highly expressed miRNAs in PMP. 105 Figure 3.8: PMP mediated tube formation and sprouting by EAhy926. 107 Figure 3.9: RNAse degradation of total RNA in PMPs. 109 Figure 3.10: PMP mediated EAhy926 sprouting through RNA. 110 Figure 3.11: PMPs causes differential release of angiogenic cytokines by EAhy926 through RNA dependent mechanism. 113 Figure 3.12: Cell number correlates with luminescent values. 114 Figure 3.13: Optimization of CellTiter-Glo assays using different concentration of serum. 116 Figure 3.14: Effect of PMPs on EAhy926 proliferation. 118 Figure 3.15: Effect of PMPs on Eahy926 cell number. 119
x Figure 3.16: PMP mediated angiogenesis in HUVEC is associated with PMP- RNAs. 122 Figure 3.17: PMPs induce cytokine release by HUVEC through RNA dependent mechanism. 125 Figure 4.1: Predicted target sites of Let-7a and miR-221 on the THBS-1 3’UTR. 134 Figure 4.2: PMPs contain Let-7a and miR-221, which are degraded by RNAase treatment. 135 Figure 4.2a: PMPs express high levels of members of the Let-7 miRNA family. . 136 Figure 4.3: PMPs deliver the microRNA Let-7a to HUVEC. 138 Figure 4.4: PMPs deliver and downregulate the microRNAs miR-221 in HUVEC. 139 Figure 4.5: Actinomycin D induce marginal HUVEC cell death. 140 Figure 4.6: PMPs deliver and increase the expression Let-7a in HUVEC. 142 Figure 4.6a: PMP is internalised by HUVEC in a time dependent manner.143 Figure 4.7: RNAse treatment of PMPs degrades THBS-1 mRNA content. 144 Figure 4.7a: PMP express three subtypes of THBS mRNA. 145 Figure 4.8: PMPs elicit positive feedback transcription of THBS-1. 147 Figure 4.9: THBS-1 is not affected by transfection reagent. 149 Figure 4.10: PMP inhibition of THBS-1 protein release is dependent on its Let- 7a. 150 Figure 4.11: PMP-Let-7a inhibition of THBS-1 is necessary and sufficient to promote angiogenesis in HUVEC. 152 Figure 4.12: Functional Integrin b1 (CD29) and Integrin associated protein (CD47) are indispensable in PMP induced angiogenesis. 154 Figure 4.13: Targeting of THBS-1 by transferred Let-7a is critical in PMP induced angiogenesis. 157 Figure 4.14: PMP inhibits caspase 3 activation through a Let-7a dependent mechanism. 159 Figure 4.15: Let-7a directly targets the 3’UTR of THBS-1 mRNA to inhibit its protein expression. 161 Figure 4.16: THBS-1 3’ UTR is a target of PMP delivered microRNA. 162 Figure 4.17: Overexpression of Let-7a microRNA mediated tube formation and micro vascular sprouting in vitro. 164 Figure 5.1: PMPs increase the transcription of ATF-4 mRNA through a Let-7a dependent mechanism. 174 Figure 5.2: ATF-4 protein is tightly controlled in HUVEC irrespective of PMP treatment. 176 Figure 5.3: PMP mediates ATF-4 enrichment at the MCP-1 promoter through a Let-7a dependent mechanism. 179 Figure 5.4: PMP mediates ATF-4 enrichment at the PIGF promoter through a Let-7a dependent mechanism. 181 Figure 5.5: PMPs mediate transcription of MCP-1 and PIGF through an RNA dependent mechanism. 183 Figure 5.6: PMPs mediates transcription of MCP-1 and PIGF through Let-7a dependent mechanism. 185
xi Figure 5.7: PMP-Let-7a related transcription of MCP-1 correlates with increased protein expression. 187 Figure 5.11: PMP induction of MCP-1 protein is Let-7a dependent. 189 Figure 6.1. Proposed model for the action of PMP transferred Let-7a on endothelial THBS-1 protein level. 201
xii LIST OF TABLES
Table 1.1: The identified miRNAs modulating angiogenic process. 27 Table 2.1: List of chemicals, suppliers and identification numbers. 43 Table 2.2: List of antibodies and proteins, suppliers and identification numbers. 44 Table 2.3: List of assay kits, suppliers and identification numbers. 45 Table 2.4: List of microRNA inhibitors and sequence. 53 Table 2.5: List of Proteins probed. 61 Table 2.6: Details of primary and secondary antibodies and dilution factors. 66 Table 2.7: List of standard primers for gene expression analysis. 78 Table 2.8: List of stem loop primers for miRNA expression analysis. 79 Table 2.9: Immunoprecipitation antibodies and dilution factor. 85 Table 2.10: List of promoter region primers. 88 Table 3.1: Representative absorbance at OD 595 and protein concentration of PMPs samples. 99 Table 3.2: List of potential processes modulated by proteins bound on PMP surface. 102 Table 3.3: List of Top highly expressed miRNAs in PMP. 103 Table 3.4: Relative group biological process association of predicted mRNA targets of top 25 highly expressed miRNAs in PMP. 244 Table 3.6: Relative group molecular functions associated with the predicted mRNA targets of top 25 highly expressed miRNAs in PMP. 245
xiii ABBREVIATIONS AND ACRONYMS
A disintegrin and metalloproteinase with thrombospondin motifs ADAMTS Acid Citrate Dextrose ACD Activating transcription factor ATF Angiogenin ANG Angiopoietin AGIO Angiotensin-converting enzyme ACE Argonaute AGO B-cell lymphoma BCL cAMP response element-binding protein CREB Cardiovascular Disease CVD Caspase 8 associated protein 2 CASP8AP2 Endothelial nitric oxide synthase eNOS Endothelin ET Ephrin-A EFNA Epidermal growth factor EGF Extracellular-signal-regulated kinases ERK Fibroblast growth factors FGF Homeobox A1 HOXA Hypoxia-inducible factor HIF I-kappa-B IKB Intercellular Adhesion Molecule ICAM Interleukins IL Kruppel-like factor KLF Mitogen-activated kinase kinase kinase MAP3K Mitogen-activated protein kinases MAPK Monocyte chemotactic protein-1 MCP-1 Nuclear factor kappa-light-chain-enhancer of activated B cells NF kB P21 activated kinases PAK Peroxisome proliferators activated receptor PPAR Phosphatidylinositol-4,5-bisphosphate 3-kinase PI3K Placental growth factor PIGF Platelet-derived growth factor PDGF Protein kinase C PKC Signal Transducers and Activators of Transcription STAT
xiv Smooth Muscle-Specific SM22 Sprouty-related SPRED Stromal cell-derived factor SDF Synaptosomal-associated protein SNAP Transducin repeat-containing gene bTRC Thrombospodin-1 THBS-1 Transmembrane semaphorin protein Sema Vascular cell adhesion molecule VCAM Vascular endothelial growth factor VEGF Vesicle transport through interaction with t-SNAREs homolog 1A VTI1A
xv CHAPTER 1: INTRODUCTION
1.1 General Introduction Cardiovascular disease (CVD) is a broad term for vascular conditions including coronary heart disease, strokes, peripheral heart disease and aortic disease.
CVD is now at epidemic proportions; in 2016 there were an estimated 5.9 million
CVD suffers in England (Bhatnagar et al. 2016). The heightened prevalence of
CVD is largely driven by an increase in modifiable risk factors such as smoking, high blood pressure, high blood cholesterol, physical inactivity and diabetes mellitus (Delamater et al. 2015). Classical non-modifiable risk factors such as age, sex and family history of vascular complications also contribute in the development of CVD. CVD causes more than 26 percent of all deaths in the UK; approximately 160,000 deaths per-annum – an average of 435 people each day or one death every three minutes (Bhatnagar et al. 2016). The majority of these cases are thought to be preventable if CVD risk factors were more tightly controlled (Townsend et al. 2014).
CVD is characterised by a haemostatic imbalance caused by dysfunctional endothelium and evidenced by a reduction in the release of vasodilators such as nitric oxide (NO) and dysregulation in angiogenesis, proliferation and cell- cell/cell-matrix interactions through increased pro-angiogenic and inflammatory cytokines (Jay Widmer and Lerman 2014). Mechanistically, CVD is associated with a range of metabolic complications, which promote oxidative stress and
1 chronic inflammation, leading to endothelial cell (EC) dysregulation (Delamater et al. 2015). This dysregulation is associated with a switch from a quiescent phenotype to active defence response phenotype (Vanhoutte and Boulanger
1999), which is a key initiating event in the development of atherosclerosis and subsequent CVD.
Atherosclerosis is the build-up of fatty plaques in the arteries that is strongly linked to the development of CVD. Moreover, the pathogenic changes to ECs caused by haemostatic imbalance help drive platelet activation and subsequent thrombosis (Ouviña et al. 2001). Under physiological conditions, platelets circulate in a non-active state, but quickly switch to an adhesive phenotype upon vascular injury to promote clot formation and to stop bleeding (Ouviña et al.
2001). Increased platelet activation, in part a symptom of haemostatic imbalance, is a hallmark of most CVD, accounting for elevated inflammation and thrombotic risk (Creager et al. 2003, Malerba et al. 2016, Vital et al. 2016, Zeller et al. 2005). It is now apparent that hyper-activated platelets enhance haemostatic imbalance in the vasculature and contribute in the development of atherosclerotic plaque, creating a potent amplification loop (Paneni et al. 2013).
However, the full mechanisms involved in this complex process remains elusive and need to be investigated.
Upon activation platelets release micro-particles (PMPs); small membrane bound vesicles which contain an array of proteins, RNA and lipid molecules
(Furman et al. 2001, Leppanen et al. 1999, X. Zhang et al. 2014). PMP release
2 is enhanced in patients with CVD and in individuals with CVD risk factors
(Furman et al. 2001, Leppanen et al. 1999, X. Zhang et al. 2014). PMPs induce
ECs activation and promote the development of CVD (Morel et al. 2006), potentially through inducing angiogenesis (Brill et al. 2005, Janowska-Wieczorek et al. 2005, Kim et al. 2004, Leroyer et al. 2008, Tushuizen et al. 2011).
Angiogenesis, the formation of new blood vessels, may help destabilise atherosclerotic plaques, hence promoting thrombosis.
The mechanisms involved in PMP regulation of ECs are yet to be fully characterised. Recent evidence shows that PMPs contain several microRNAs
(miRNA), which they transfer to recipient cells to elicit phenotypic changes
(Andaloussi et al. 2013, Laffont et al. 2013). miRNAs are a class of small non coding RNAs that bind to messenger (mRNA) with complementary sequences, to elicit post-transcriptional regulation of gene expression (He and Hannon
2004). Delivery of miRNA by PMPs may therefore underpin the athero- thrombotic effects of PMPs (Koganti et al. 2016). Therefore, determining the extent to which PMP delivered miRNAs regulate EC function is key to further the understanding of CVD progression. This will help in the development of new biomarkers/therapeutic targets to enable future stratification of aggressive CVD risk and treatment.
1.2 The Endothelium ECs lining blood vessels create a distinct interface between the underlying tissues and the blood (Mombouli 1997). The endothelium is physiologically in a
3 neutral state that favours dilation over constriction, but responds to various stimuli including shear stress, temperature, inflammation, injury and other factors, reviewed extensively by (Verma and Anderson 2002). In response to these stimuli, ECs synthesise and release several regulatory agents such as growth factors, cytokines and nitric oxide (NO) that play an important role in controlling vascular tone (Moncada et al. 1988), thrombosis (Moncada et al.
1977), immune responses (Szekanecz and Koch 2004) and angiogenic pathways (Saba and Saba 2014, Stern et al. 1988, Thompson and Salem 1986).
However, at sites of disrupted blood flow and around atherosclerotic plaques,
ECs lose cardio-protective signalling and produce thrombogenic factors that promote platelet activation and facilitate the process of clot formation
(summarised in Figure 1.1). Indeed, dysfunctions associated with the synthesis, release and signalling of ECs derived factors are the key pathogenic mechanism regulating CVD through reduced vasodilation, a pro-inflammatory state, and pro- thrombotic activity (Rajendran et al. 2013). Molecular processes mediated through mechanical and biochemical stimuli contribute to the development of EC dysregulation leading to CVD (Deanfield et al. 2007). However, the emerging role of non-coding RNAs such as microRNAs (miRNA) in the progression from
EC dysfunction to CVD is a growing area of investigation.
4 Figure 1.1: Normal Endothelial Function. The endothelium controls several physiological functions including; regulation of vascular tone through balanced production of vasodilators and vasoconstrictors such angiotensin II, prostaglandins, endothelin-1, endothelial hyperpolarizing factor. The endothelium also controls blood fluidity and coagulation through production of factors that regulate platelet activity, including tissue plasminogen, plasminogen activator inhibitor-1, thrombomodulin, von Willebrand Factor (vWF), the clotting cascade, and the fibrinolytic system. The regulation of inflammatory processes through expression of cytokines and adhesion molecules such as TNF and IL-6 (Arrebola-Moreno et al. 2012, Rajendran et al. 2013).
5 1.3 Atherosclerosis and thrombosis Atherosclerosis is a serious inflammatory condition contributing to the high mortality rate associated with CVD because of the high risk of thrombosis
(Armstrong et al. 2011, Glass and Witztum 2001, Järvilehto and Tuohimaa
2009). The development of atherosclerotic plaques starts as a fatty streak in the endothelium of artery wells. These fatty streaks are common in large carotid and coronary arteries and the accumulation of fat results in dysfunction of the endothelium, as well as further increase in lipid and cholesterol accumulation.
The next phase is marked by larger infiltration of the plaque by inflammatory cells. Atherosclerotic plaque formation progresses with time, moving from intimal thickening, fatty streaks, and foam cell formation, to lipid and cholesterol rich plaques (Armstrong et al. 2011, Glass and Witztum 2001, Järvilehto and
Tuohimaa 2009). This stage is marked by narrowing and blockade of the arterial lumen, resulting in reduced blood flow (Armstrong et al. 2011, Glass and
Witztum 2001, Järvilehto and Tuohimaa 2009). The instability of the atherosclerotic plaque characterised by increased inflammatory cell content, and enlarged necrotic core has been linked to angiogenesis within the plaques
(summarised in Figure 1.2). Moreover, progression results in the compartmentalisation of the media and sub-intimal space between the layers of the blood vessel to narrow the lumen (Figure 1.2). Subsequent angiogenic stimulation and sprouting from the adventitia results in new blood vessels growing into the atherosclerotic plaque (Herrmann et al. 2001, Khurana et al.
2005). This physiological process increases the supply of oxygen, nutrients and inflammatory cells that destabilise the plaque (Herrmann et al. 2006). The
6 number of intimal micro-vessels correlates with intimal thickening (Van der
Veken et al. 2016). This correlation suggest that angiogenesis plays an important role in plaque progression and instability (Higashida et al. 2008,
Ribatti et al. 2008).
Figure 1.2: The progression of an atherosclerotic lesion; from a normal blood vessel (left) to a vessel with an atherosclerotic plaque and superimposed thrombus (right). Atherosclerotic lesion progress through endothelial cell dysregulation, inflammation, angiogenesis and thrombus formation to cause several diseases, adapted from (Sanz and Fayad 2008).
7 1.4 MicroRNAs: Insight into Lethal-7 (Let-7) miRNAs are small non-coding RNA of about 22 nucleotides that inhibit the translation of mRNAs to proteins, leading to silencing and post-transcriptional modulation of gene expression (Yang et al. 2005). miRNA mediated regulation of gene expression contributes to many normal and pathogenic processes, through modulation of signalling pathways and associated cellular processes
(Yang et al. 2005). Several biological functions in humans, including stem-cell differentiation, cell proliferation and tumour suppression have been attributed to miRNA regulation of their target genes (Büssing et al. 2008, Johnson et al.
2007, Peter 2009). Sequence complementarity between mature miRNA and untranslated regions (UTR) of mRNA result in its degradation or reduced stability. Moreover, multiple genomic locations produce miRNAs with similar sequence, which allows cells to regulate the miRNA more tightly for targeting of the same mRNA UTR or differentially regulate gene expression if one genomic region is targeted by another molecular mechanism. Therefore, differential transcription of different subtypes of the same mature miRNA allows for tight regulation of cellular processes (Büssing et al. 2008, Johnson et al. 2007, Peter
2009).
Recent computer based prediction algorithms like TargetScan have revealed more than 25000 human miRNAs (Chiang et al. 2010, Griffiths-Jones et al.
2008, Kozomara and Griffiths-Jones 2014), most of which remain to be functionally characterised. The importance of miRNAs in normal physiology is highlighted by the observation that approximately 200 miRNAs are evolutionally
8 conserved in mammals (Chiang et al. 2010, Wheeler et al. 2009). While the list of confirmed human miRNAs continues to grow, the Lethal-7 (Let-7) miRNAs were some of the initial miRNAs identified in developmental timing of
Caenorhabditis elegans (Reinhart et al. 2000, Sulston and Horvitz 1977).
Currently, genes encoding microRNA subtypes are denoted with alphabetical suffixes (Figure 1.3c), with the addition of numeric identifiers if the mature miRNA is transcribed from multiple loci (Figure 1.3a). There are ten members of the human Let family of miRNA including Let-7a-g, Let-7i, miR-98 and miR-202, reviewed in (Roush and Slack 2008). Currently, three genomic loci encode the human let-7a miRNAs (Figure 1.3a), which are distinguished by numbers (Let-
7a-1, Let-7a-2 and Let-7a-3) for different isoforms (Pasquinelli et al. 2000) and differ by one or two bases and by genomic location (Figure 1.3c).
Let-7 subgroup is perhaps the most investigated member of the Let family to date (Roush and Slack 2008). Several studies have shown that this conserved miRNA can target a range of human genes including transcription factor MYC, integrin Beta3 and THBS-1 (Dogar et al. 2014, Müller and Bosserhoff 2008, Park et al. 2007, Peter 2009, Sampson et al. 2007), hence regulating apoptosis, cell migration and proliferation. However, Let-7f is the only member of this family that has been linked to the induction of angiogenesis in breast cancer, but the mechanisms of its pro-angiogenic effect are yet to be described (Yan et al.
2008). Physiologically, each miRNA genomic locus results in two mature sequences originating from the 5’ and 3’ ends of the precursor miRNA (pre- miRNA) (such as the Let-7a-3p and Let-7-5p used in this study) (Figure 1.3c.)
9 Though empirical studies are required to determine the most abundant sequence, it is thought that one end (the passenger strand) guides the action of the other (the alternative strand), which results in more abundance and biological activity. Because of the novel approach and cost limitations of this study, both strands of the Let-7a miRNA were targeted.
Figure 1.3a: Genomic location of the human Let-7 members. + or – chromosome strand, locations: including intergenic and intronic clusters. Key: Red, black and blue hairpins represents miR-100 or miR-99, let-7 and miR-125, respectively. The distances between miRNAs or close protein-coding genes are given (Lodish et al. 2008, Roush and Slack 2008).
10
Figure 1.3b: Regulation of Let-7 transcription. Representative regualtion at transcription and post-transcription levels (Lodish et al. 2008, Roush and Slack 2008). T.F: trancription factor, m7G: 7-methylguanosine (m(7)G)-capped (5’). AAAA: adenine tail.
11
Mature Let-7 Precursor Let-7
Figure 1.3c: Molecular and structural characteristics of Let-7 family. Sequence alignment of mature human let-7 members, with near identical mature miRNAs, but variable precursor and primary structures, (Lodish et al. 2008, Roush and Slack 2008).
12 1.4.1 Regulation of miRNA transcription Transcription of human miRNA occurs mainly by RNA polymerase II (RNA Pol
II), which generates a long primary microRNA (pri-miRNA) that contains a hairpin structure (Figure 1.3-1.4). In line with the evidence that most miRNAs are produced from RNA Pol II transcription of their host genes, initial transcription can be regulated by transcription factors associated with this polymerase (Figure
1.3b) (Kim et al. 2009, Krol et al. 2010). Several epigenetic factors including
DNA methylation and histone modifications have also been shown to regulate miRNA transcription (Davis-Dusenbery and Hata 2010). Moreover, some miRNAs can regulate the transcription of other miRNAs through targeting of transcription factors, or other transcription mechanisms (Figure 1.3b) (Newman et al. 2008).
Gene duplication, the occurrence of identical gene coding DNA sequences at multiple genomic locations increases the abundance of similar miRNA sequences by multiple loci transcription (Berezikov 2011, Ho et al. 2011).
Though most of the identified miRNAs are transcribed from different genomic regions, most of the human miRNAs are introngenic i.e. non-coding DNA sequence located between genes (Figure 1.3a). Indeed, most human miRNAs are transcribed from non-coding regions between genes, including protein coding and non-coding genes, and exonic regions coding for genes (Figure
1.3a). Another important aspect of miRNA production is the co-transcription of closely arranged microRNA loci (polycisctronic) (Lee et al. 2002). However, though these clustered miRNAs are transcribed together, differential regulation
13 post-transcription allows tight regulation of gene expression and function (Figure
1.3a). For instance, among the members of the mir-100: let-7: mir-125 clusters, let-7a is post-transcriptionally suppressed in embryonic stem cells but not the mir-100 or mir-125 members of the cluster (Roush and Slack 2008). The actual promoter regions of most miRNAs remain to be identified, but the advances in sequencing technology and results of recent studies suggest that miRNAs transcribed from introns of protein coding genes can share promoter regions of their host gene (Ozsolak et al. 2008). However, the functional importance of these shared promoter regions remains to be fully characterised because miRNAs often have several transcriptions start sites (Ozsolak et al. 2008), and sometimes intronic miRNAs also have different promoters from the same host gene (Monteys et al. 2010).
1.4.2 Nuclear processing Following the tightly regulated transcription of pri-miRNA is the complex process of maturation to produce precursor-miR (pre-miR) that contain a hairpin structure (Lee et al. 2002). The maturation process relies on the activity of
RNase-cofactor activity, and nuclear to cytoplasm transport mechanisms. The basic pri-miRNA sequence consists of a stem (<35 bp), terminal loop and double side (5p and 3p) RNA segments of ~ 22 nucleotides (Figure 1.4). In the nuclear compartment, pri-miRNA is initially processed by the nuclear RNAse
Drosha, a specific double strand RNA nuclease that produce a 70 nucleotide pre-miR (Figure 1.4). To function, Drosha forms a complex with its co-factor
DGCR8 (microprocessor complex), which is a double stranded RNA binding protein (Denli et al. 2004, Gregory et al. 2004, Han et al. 2004, Landthaler et al.
14 2004). In this complex, the role of DGCR8 is majorly to recognise the pri-miRNA
(Han et al. 2006), and to promote the activity of Drosha through its haem-binding domain (Friedman et al. 2009, Weitz et al. 2014). The double stranded RNA activity of Drosha then mediates the cleavage of both the 3’ and 5’ ends of the stem pri-miRNA through its RNAse III domains RIIDa and RIIDb specific activity of the microprocessor complex (Blaszczyk et al. 2001, Zhang et al. 2004) to create the pre-miR.
1.4.3 Nuclear export and silencing complex The microRNA biogenesis and directional movement before regulation of gene expression is summarised in (Figure 1.4). After the nuclear processing, a transport complex involving exportin 5, Ran-GTP-binding protein, a nucleocytoplasmic transport GTPase and pre-miRNA is assembled. This complex transports the pre-miR from the nucleus to the cytoplasm for further processing and incorporation into the RNA-silencing complex (Yi et al. 2003). In the cytoplasm, Dicer, an endonuclease that cleaves the pre-miR at the terminal loop releases the small RNA duplex (Bernstein et al. 2001, Grishok et al. 2001,
Hutvágner et al. 2001). These final RNA species are then loaded onto argonaute
(AGO) RNA binding protein to form the effector complex called the RNA-induced silencing complex (RISC) that guides the miRNA to the target mRNA. Upon binding, the RISC complex guides the gene regulation function of miRNAs
(summarised in Figure 1.4). The AGO proteins including (1-4) contain Piwi-
Argonaute-Zwille domains that form a binding pocket for the 3’ of the incorporated microRNA (Jinek and Doudna 2009). The catalytic activity of RISC resides in the AGO proteins, but in humans only the AGO2 protein has been
15 shown to cleave target RNA’s phosphodiester bonds to inhibit translation (Liu et al. 2004, Meister et al. 2004). In the context of this thesis, the process of miRNA biogenesis predominantly occurs in megakaryocytes (Figure 1.3b), the parent cells of platelets, rather than in platelets themselves (Landry et al. 2009).
However, some processing stages, like the incorporation of miRNA to RISC complex, may happen in platelets, as they have been shown to contain AGO and Dicer (Landry et al. 2009). This aspect of platelets and corresponding transfer to micro-particles are discussed under the sections on platelets, below.
Figure 1.4 miRNA biogenesis. In the canonical pathway. miRNAs are processed by the Drosha–DGCR8 (DiGeorge syndrome critical region 8) complex to generate precursor miRNAs (pre-miRNAs) which are transported by exportin 5 into the cytoplasm. In the cytoplasm, Dicer–TRBP (TAR RNA-binding protein 2) process the miRNA before loading into AGO2/RISCs to target mRNA. miRNAs are also produced though non-canonical pathways, like spliceosome- dependent mechanisms, from (Li and Rana 2014).
16 1.5 Angiogenesis Angiogenesis is the formation of new blood vessels and capillaries from existing vessels (Risau 1997). It is a critical process in normal growth, but physiologically only occurs in adult humans during wound healing/tissue repair (Risau 1997), hair cycle (Yano et al. 2001), and in distinct phases of the female reproductive cycle (Risau 1997). Pathologically, angiogenesis supports cancer growth
(Folkman 2002) and various types of CVD such as the proliferative phase of diabetic induced retinopathy (Crawford et al. 2009) and may help atherosclerosis development (Carmeliet 2003, Khurana et al. 2005).
Angiogenesis sequentially entails EC-mediated degradation of the extracellular matrix, migration of EC to the peri vascular space followed by proliferation, which consequently results in endothelial cell sprouting and tube formation
(Risau 1997, Vandekeere et al. 2015). The survival of ECs and completion of this complex process depends on cell-cell and cell-extracellular matrix interactions (Vandekeere et al. 2015), primarily mediated by integrin receptors on the ECs (Strieter et al. 1999). Moreover, this complex and tightly regulated process is modulated by several growth factors and cytokines, which are produced and released by ECs, platelets, and other vascular cells (Risau 1997).
1.5.1 Cell-matrix interaction in angiogenesis Two central aspects of angiogenesis are EC-extracellular matrix binding and remodelling, which facilitates EC migration and tube formation (Herbert and
Stainier 2011). The complex cell-cell and cell-matrix interactions needed for angiogenesis are modulated primarily by integrins, although adhesion molecules like members of the immunoglobulins family (VCAM-1 and ICAM), selectins and
17 cadherins contribute in this complex interaction (Carmeliet 2000, Lamalice et al.
2007). Integrins are small heterodimeric proteins that are composed of non- covalently bound α and β subunits (Humphries 1999). The identified 18 α and 8
β subunits have been shown to interact with each other in several combinations to form 24 individual heterodimers (Giancotti and Ruoslahti 1999). Though many cells express these proteins, ECs particularly express β1, β3, β4, α1, α2, α3, α5,
α6, αvβ3 and αvβ5 integrins (Hynes 1999, Hynes 2002). For instance, αvβ3 integrin expression is dependent on ECs activation (Bello et al. 2001, Brooks et al. 1994) and once expressed, αvβ3 stimulate the production and activation of matrix metalloproteinase (MMP) -2 and inhibition of the intracellular transcription factor NF kB during the initiation of angiogenesis (Brooks et al. 1996, Leavesley et al. 1993, Scatena et al. 1998). MMP is a zinc containing protease that functions through calcium-depend endopeptidase activity and NF kB is a family of transcription factors that bind to kappaB sites of regulated genes. Increased
MMP-2 and reduced NF kB facilitate EC migration through the degradation of extracellular matrix and promote cell survival through the inhibition of apoptosis, respectively (Silletti et al. 2001). Indeed, inhibition of αvβ3 integrin binding and subsequent inhibition of MMP-2 activation potently suppresses angiogenesis
(Boger et al. 2001). Integrin αvβ3 can also directly stimulate EC proliferation and growth through the activation of the MAP kinase family member of extracellular signal regulated kinase (ERK) (Strömblad et al. 1996), inhibition of the activity of p53 transcription factor (Strömblad et al. 1996), and interaction with vascular endothelial growth factor receptor –2 (VEGF-R2) (Soldi et al. 1999). Other integrins like β1 and α5β1 expressed in both active and quiescent endothelium
18 have been associated with EC adhesion and migration (Languino et al. 1989,
Taverna and Hynes 2001).
In addition to extra cellular matrix remodelling, ECs need adequate cell-cell contact to form capillary networks (Bach et al. 1998). This contact and interaction is mediated by the upregulation of the surface receptors platelet endothelial cell adhesion molecule-1 (PECAM-1), endothelial cadherins and selectins (Newman et al. 1990). PECAM-1 is a member of the immunoglobulin superfamily, highly expressed in the vasculature (Newman et al. 1990). The ligands that bind to this receptor include the integrin αvβ3 (Piali et al. 1995), cyclic ADP ribose hydrolase (CD38) (Muller et al. 1992), and glycosaminoglycan
(Horenstein et al. 1998). PECAM-1 can also influence cell adhesion by interacting with itself on the surface of adjacent ECs (Newton et al. 1997).
Cadherins are transmembrane proteins that form calcium dependent interactions with each other on the surface of cells (Dejana 1996, Feng et al.
2015) and cadherin link to the actin cytoskeleton resulting in firm attachment of
ECs once engaged (Dejana 1996). Because they are highly expressed at cell junctions, cadherins play crucial role in angiogenesis through the modulation of contact inhibition, cell polarity and EC interaction with other vascular cells
(smooth muscles cells, pericytes), reviewed extensively by (Dejana et al. 2009,
Feng et al. 2015, Giannotta et al. 2013).
19 1.5.2 Role of Growth Factors in angiogenesis The best studied mediators of angiogenesis are the growth factors like vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF) and angiopoietins (AGIO) (Yancopoulos et al. 2000). These growth factors are either stored within the extracellular matrix or storage granules of platelets and ECs to ensure a prompt release (Yancopoulos et al. 2000). VEGF-A, the archetypal angiogenic mediator, potently increases EC migration, mitogenesis and angiogenesis (Takahashi and Shibuya 2005). Angiogenic sprouting is quickly observed after increased expression of VEGF-A and its receptor (Gerhardt et al.
2003). However, a splice variant of this growth factor called VEGF-165b can inhibit angiogenesis potentially through the inhibition of VEGF-A mediated angiogenesis (Woolard et al. 2004). VEGFR-2 induces the phosphorylation of phospholipase C gamma (PLCg), which in turn activates protein Kinase C and
Sphingosine kinase (SPK) to induce signal transduction through the mitogen- activated protein kinases (MAPK)/ extracellular signal-regulated kinases (ERK) pathway (Koch et al. 2011). VEGF-A also increase the release of other angiogenic factors from ECs, including von-Willebrand factor, and urokinase plasminogen activator (Sahni and Francis 2000), strengthening the angiogenic response.
FGF produce a potent angiogenic response through the activation of protein kinase C and phospholipase upon receptor ligation, leading to MAPK/ERK mediated transduction of FGF signal (Kanda et al. 1996, Kent et al. 1995, Sa et al. 1995). Additionally, FGF may promote the production of VEGF (Seghezzi et
20 al. 1998). FGF also plays an important role in the remodelling of the extracellular matrix through the induction of matrix proteins like urokinase receptors, collagen, fibronectin, and proteoglycans (Lu et al. 2011). Thus, optimum angiogenesis depend on a multiple cross-talk between several growth factors
(Yancopoulos et al. 2000).
The complexity in the regulation of angiogenesis is further increased as some mediators are context specific. For instance, the angiopoietins (AGIO), which are growth factors that bind to EC-specific Tie receptor kinases can antagonise each other to induce context dependent angiogenic effect (Maisonpierre et al.
1997, Suri et al. 1996). AGIO-1 binding to the receptor Tie-2 results in the phosphorylation and activation of the protein kinase B/ark/FOX01 pathway (Gale and Yancopoulos 1999), promoting EC survival. This AGIO-1 binding also inhibits the binding of pro-angiogenic AGIO-2 (Asahara et al. 1998), while the expression of AGIO-2 and its interaction with Tie-2 receptor cause EC activation and initiation of angiogenesis. The binding of AGIO-2 inhibits AGO-1 mediated phosphorylation of Tie-2 receptor to promote survival, sprouting and tube formation (Maisonpierre et al. 1997, Scharpfenecker et al. 2005). Interestingly, exposure of ECs to angiogenic stimuli is associated with increased expression of AGIO-2 (Pichiule and LaManna 2002, Ray et al. 2000). Moreover, EC derived
AGIO-2 in extracellular bodies can also promote angiogenesis through autocrine promotion of VEGF activity. Though the full role of angiopoietins in angiogenesis remains controversial, their context dependent function relative to other growth
21 factors and pathophysiologic states play an important role in the complex regulation of angiogenesis by growth factors.
1.5.2 Endogenous inhibitors of angiogenesis In addition to positive regulation, angiogenesis is controlled by the release and production of potent angiogenesis inhibitors within the vasculature. Important endogenous inhibitors measured in this study include platelet factor 4 (PF4), tissue inhibitors of metalloproteinases (TIMPs), endogenous inhibitors of MMPs and thrombospondin-1 (THBS-1). PF4 is a chemotactic CXC chemokine produced by megakaryocytes and platelets, released in alpha granules as a homotetramer. PF4 is thought to exhibit anti-angiogenic properties due to its ability to neutralise heparin in a charge mediated mechanism (Bikfalvi 2004).
The in-vitro treatment of EC with recombinant PF4 inhibit both proliferation and migration (Maione et al. 1990). However, its ability to modulate EC activity remains poorly described due to lack of a defined chemokine receptor for PF4
(Lambert et al. 2009). TIMPs (1-4) are broad-spectrum, natural inhibitors of
MMPs that inhibits their ability to degrade extracellular matrix and subsequent induction of anti-angiogenic or pro-angiogenic effects (Sang 1998). Moreover,
TIMP-1 and TIMP-3 may directly inhibit EC motility and proliferation to inhibit angiogenesis. By contrast, TIMP1-4 inhibits anti-angiogenic MMPs-2, -7, -9 and
-12, which may allow them to elicit pro-angiogenic effects (Johnson et al. 1994,
Sang 1998). Therefore, the effects of TMPs on angiogenesis requires a careful consideration of the context and complex interactions they have with MMPs.
22
Figure 1.5: The structure of THBS-1 protein. Domain dependent binding to Ligands and receptors mediate cellular processess including angiogensis (Isenberg et al. 2009).
The THBS family contain five members, that together have been associated with a wide range of developmental processes and disease pathogenesis (Figure
1.5) (Bornstein 2001). THBS-1 is the most studied member of this family, largely because it can be purified readily. THBS-1 is a high molecular weight multi- domain glycoprotein that plays an important role in cell to cell, and cell to matrix interactions (Figure 1.5) (Armstrong and Bornstein 2003). THBS-1 is a trimer of identical polypeptides linked by disulphide bonds, with each polypeptide containing one amino-terminal domain, three repeated domains (including type-
1, type-2 and type-3) and the carboxyl-terminal domain, which are independently implicated in different cellular functions of THBS-1 (Esemuede et al. 2004). The
23 N-terminal domain of the protein binds to heparin sulphate proteoglycans, which facilitates its cellular uptake and clearance from extracellular space (Adams
1997). The amino acid residues in this domain bind to a3b1, a laminin integrin
(Chandrasekaran et al. 1999), inhabiting EC migration, chemotaxis and angiogenesis (Figure 1.5) (Esemuede et al. 2004).
The THBS-1 procollagen domain mediates trimer formation, and inhibits angiogenesis by binding to transforming growth factor β (TGFβ) (Tolsma et al.
1993). Moreover, the other functional domains of THBS-1 can bind to β1 integrins, and the platelet glycoprotein 4 (CD36) and integrin associated protein
(CD47) receptors (Figure 1.5) (Kazerounian et al. 2008). Though the full functional mechanism underlying the anti-angiogenic and anti-proliferative effects of THBS-1continues to be studied, it is thought that different regions of the THBS-1 protein interact with different proteins to induce conformational changes or block growth factor binding (Murphy-Ullrich and Poczatek 2000,
Schultz-Cherry et al. 1995).
The complex cell to cell, and cell-matrix interactions explained above have been studied in the context of angiogenesis. Indeed, the regulation of angiogenesis by
THBS-1 can occur through the direct effect on ECs or indirect effect on inflammatory cells (BenEzra et al. 1993, Nicosia and Tuszynski 1994). Indirectly,
THBS-1 can activate and induce migration of polymorphonuclear cells and myofibroblasts to induce angiogenesis (Nicosia and Tuszynski 1994). The pro- angiogenic response of THBS-1 is consistent with the increase in smooth
24 muscle cell migration (Armstrong and Bornstein 2003). By contrast, direct targeting of ECs by THBS-1 inhibit angiogenesis. However, the opposing evidence on THBS-1 is not contradictory, as they are context and cell type dependent. The direct effect of THBS-1 on ECs results includes apoptosis, which is mediated through TSRs binding to CD36, CD47 and Integrin beta-1
(CD29) (Dawson et al. 1999, Iruela-Arispe et al. 1999, Tolsma et al. 1993).
Moreover, Src family kinase Fyn and JNK-1/MAP kinase downstream of CD36, are important in the inhibition of angiogenesis by THBS-1 (Jiménez et al. 2000,
Jimenez et al. 2001).
In-vitro and in-vivo experiments have shown that synthetic peptides containing the THBS-1 type 1 repeats (TSRs) can inhibit migration. However, there is evidence that THBS-1 still inhibit migration in the absence of CD36, which suggests that other mechanisms might play a role in its modulation of ECs function (Iruela-Arispe et al. 1999). Multiple inhibitory sites in the TSRs act through different mechanisms to modulate angiogenesis. For instance, TSRs bind to EC’s surface proteoglycans to act as co-receptors for growth factors
(Iruela-Arispe et al. 1999). This co-receptor activity can effectively inhibit key steps in angiogenesis. Conversely, the induction of apoptosis also involves p38MAPK and caspase 3 (Jiménez et al. 2000, Nör et al. 2000). Treatment of
ECs with high glucose concentration (25mmol/L) causes phosphorylation of
P38MAPK, and inhibition of caspase 3 blocks phosphorylation of P38MAPK. In addition to apoptosis induction, THBS-1 reduces the expression of survival pathways (Nör et al. 2000). Thus, THSB-1 inhibits angiogenesis through several
25 mechanisms including induction of apoptosis, inhibition of survival, reduced mobilisation of growth factors and reduced receptor binding of angiogenic inducers, which is summarised in Figure 1.6. In summary, several endogenous angiogenic inhibitors including THBS-1 play a role in maintaining angiogenic balance. Depending on the physiological or pathological conditions, changes can influence EC’s angiogenic potential.
1.5.3 Role of microRNAs in angiogenesis miRNAs are becoming recognised as major regulators of both normal vascular physiology and pathogenesis of vascular diseases (Urbich et al. 2008). The early indications of the role of miRNAs in vascular physiology were provided by a study that studied mouse models with mutated genes in the Dicer machinery
(Yang et al. 2005). The data from this study showed that the presence of a hypomorphic dicer allele, a mutation that cause partial loss of function, results in prenatal death of mice due to immature and leaky blood vessels and late induction of embryonic EC markers including VEGF-A, VEGFR-1 and Tie-1 receptor (Yang et al. 2005). Correspondingly, silencing of Dicer expression using siRNA in mature ECs was shown to elicit anti-angiogenic phenotypes through altered microRNA profile (Suárez et al. 2007), providing further evidence that miRNAs are important in angiogenesis. Some of the characterised miRNAs involved in angiogenesis are summarised in Table 1.
26 Table 1.1: The identified miRNAs modulating angiogenic process
Angiogenic miRNA Target Genes Activity References SPRED1/PIK3R2 (Fish et al. 2008, miR-126 Pro Wang et al. 2008) miR 17 – 92 THBS-1 Pro (Gupta et al. 2014) Cluster miR-132 pl20RasGAP Pro (Anand et al. 2010) (Fasanaro et al. miR-210 EFNA3 Pro 2008). (Chen and Gorski miR-296 HGF Pro 2008) miR-23 Sprouty 2/SEMA6A Pro (Bang et al. 2012) SUFU/FUS-1 miR-378 Pro (Lee et al. 2007)
miR-15a VEGF-A/FGF2 Anti (Suzuki et al. 2015) miR-16 VEGF-R2/FGFR1 Anti (Kane et al. 2014) miR-24 GATA2/PAK4/NOS3 Anti (Kane et al. 2014) miR- SIRT1/VEGF/ Anti (Kane et al. 2014) 34a/b/c NOTCH1/SEMA4B miR-92a ITGB5 Anti (Kane et al. 2014) miR-100 mTOR Anti (Kane et al. 2014) miR-503 CCNE1/cdc25A Anti (Kane et al. 2014)
27 The miRNA profile of ECs has been established primarily in human umbilical vein endothelial cells (HUVECs) using qRT-PCR and microarray techniques
(Wang et al. 2008, Wang and Olson 2009). ECs have high expression of specific miRNA clusters including miR-17-92, miR- 23-24, Let family of miRNAs and individual miRNAs including miR-221/222, miR-126 and miR-21, extensively reviewed in (Wang and Olson 2009). Though partial functional characterisation of the above miRNA clusters has been conducted (Wang and Olson 2009), the full extent of their role in angiogenesis and EC activity remains to be identified.
Subsequently, RNA-sequencing techniques revealed differential expression of
400 characterised (annotated) and some novel miRNAs between HUVECs grown in basal conditions and those grown under hypoxia induced angiogenic conditions (Voellenkle et al. 2012). Voellenkle revealed that miR-21 and miR-
126 account for 40% of all the miRNAs detected in HUVECs (Voellenkle et al.
2012). miR-126 play a principal role in sustaining angiogenesis through the inhibition of sprouty related EVH1 domain containing 1 (SPRED1), a negative regulator of growth factor-induced activation of MAP kinase pathway, (Fish et al.
2008) and through targeting of the phosphatidylinositol 3-Kinase (PI3K) regulatory subunit beta PIK3R2, a regulator of growth signalling pathways through additional phosphorylation of phospholipids (Wang et al. 2008). Both
SPRED1 and PIK3R2 inhibit VEGF signalling (Fish et al. 2008, Wang et al.
2008), which reduces angiogenesis, thus their inhibition allows the growth of new vessels. In addition, EC sprouting, an important stage of angiogenesis, relies on the zinc finger transcription factor KLF2a, which induce EC-specific miR-126 that can inhibit SPRED1 and PIK3R2.
28
Whilst one of the most studied, miR-126 is not the only regulator of angiogenesis. EC stimulation with VEGF induces the expression of miR-130a and miR-296 (Chen and Gorski 2008, Würdinger et al. 2008), that promote angiogenesis through the inhibition of negative regulators of angiogenesis including homobox genes like homobox-2 (GAX) (Chen and Gorski 2008), and hepatocyte growth factor (HGF)- regulated tyrosine kinase (Würdinger et al.
2008), respectively. VEGF-A and bFGF also result in miR-132 transcription in
EC, which has been shown to facilitate proliferation and sprouting by the inhibition of p/20RasGAP an important GTPase-activating protein (Anand et al.
2010), which normally regulate cell cycling in G-protein dependent manner.
In-vitro overexpression of miR-210 in HUVECs increases cell migration and sprouting through reduced release of tyrosine kinase ligand, ephrin A3
(Fasanaro et al. 2008). Ephrin A3 elicit negative regulation of angiogenic remodelling and EC activity (Kuijper et al. 2007). Furthermore, miR-424 inhibition of culin 2 (CUL2) and downstream upregulation of HIF-α promotes angiogenesis (Ghosh et al. 2010). Among the members of the miR-17-92 cluster, miR-18a and miR-19a can inhibit several proteins that contain thrombospondin type 1 repeats (Dews et al. 2006, Suárez et al. 2007) like
THBS-1 to promote angiogenesis. miR-17-5p can inhibit TIMP1 (Otsuka et al.
2008) to induce EC migration and proliferation. Furthermore, miR-23 and miR-
27 elicit their pro-angiogenic effect by inhibiting Sprouty2 and Sema6A (Zhou et al. 2011), both of which are known anti-angiogenic proteins. Finally, inhibition of
29 tumour suppressors, Fus-1 and SUFU by miR-378 indirectly upregulate VEGF and angiopoietin-1/2 (Lee et al. 2007) to promote angiogenesis.
In addition to the pro-angiogenic role of EC derived miRNAs, some of the identified miRNAs have anti-angiogenic effects (Poliseno et al. 2006) as summarised in Table 1. For instance, overexpression of miR-221/222 in EC inhibits the stem cell factor (SCF) receptor C-kit (Poliseno et al. 2006), as such inhibit the angiogenic effect of SCF (Poliseno et al. 2006). Among the miR-17-92 cluster, miR-20a and miR-92a negatively modulate angiogenesis, by inhibiting the transcription of VEGF-A and integrin β5, respectively (Bonauer et al. 2009,
Hua et al. 2006). Finally, miR-503 inhibits cdc25A and cyclin E1 (Caporali et al.
2011), resulting in reduced proliferation, sprouting and migration (Caporali et al.
2011).
1.5.4 Angiogenesis in cardiovascular diseases The contribution of angiogenesis in the development of atherosclerosis and associated CVD is a somewhat controversial issue in vascular biology (Khurana et al. 2005). On the one hand angiogenesis is targeted for the treatment of diseases associated with impaired vascular function, while on the other, increased angiogenesis can destabilise the plaques leading to rupture (Khurana et al. 2005). However, angiogenesis is increasingly recognised to be one underlying mechanism in the progression of arthritis, thrombosis and ocular diseases (Armstrong et al. 2011, Glass and Witztum 2001, Järvilehto and
Tuohimaa 2009), which is supported by the numerous trials targeting
30 angiogenesis in the treatment of these conditions (Carmeliet and Jain 2000).
However, emerging evidence have only begun to establish the role of intra- lesion angiogenesis in the plaque instability, potentially enabling thrombosis and cardiovascular complications (Khurana et al. 2005, Layne et al. 2015, Slevin et al. 2008, Yao et al. 2013).
Bleeding in the plaque is a marker of instability because they may weaken plaque, enabling rupture which is driven by immature neo-blood vessel formation (Jain et al. 2007). This suggest that bleeding plays an important role in plaque destabilisation, however bleeding is not the only factor in this pathological process (Jain et al. 2007). Correspondingly, new blood vessels in plaque are fragile and prone to haemorrhage, compared to normal blood vessels. One critical aspect to this association is the fact that such vessels are single layer and lack smooth muscles cells. Immature vessels are significantly increased in patients with unstable atherosclerotic plaques, and leaky vessels are associated with the infiltration of inflammatory cells and an increased risk of bleeding (Jain et al. 2007). Moreover, bleeding is associated with increased release of lipids from lysed red blood cells, which can indirectly increase plaque volume and cause instability. Red blood cell lysis can also activate macrophages through the release of iron, which in turn increases the progression and development of angiogenesis (Jain et al. 2007). Moreover, leaky blood vessels provide an entry route for platelets and PMPs to the plaque, allowing for further inflammation and progression (Li and Cong 2009). Platelets provide a pro-thrombotic interface in plaques, leading to thrombus growth and
31 narrowing of the blood vessels (Li and Cong 2009). The subsequent narrowing mediated increase in shear stress promotes activation of more platelets and shedding of PMP within the plaque environment that cause further increase in plaque destabilisation and rupture (Li and Cong 2009).
The increase in plaque’s necrotic core is associated with instability and rupture.
Disrupted blood flow due to vessel occlusion or narrowing can prevent the clearance of inflammatory cells in the necrotic core, and has increased risk of rupture when combined with the increased supply of nutrients and cells by neo- vessels. In addition to cells, haemorrhage and fatty deposits, the activity of angiogenic proteins can also contribute to rupture. For instance, the activity of
MMPs which are central to migration and sprouting of EC may also contribute in this process. Thus, platelet induced release of pro-angiogenic proteins can contribute to plaque rupture independent of blood vessel formation. Mechanical factors such as strain and stress is increased by angiogenesis to increase the risk of rupture (Jain et al. 2007). Despite the evidence that angiogenesis is important in plaque destabilisation and rupture, the mechanisms driving the initiation of angiogenesis remains to be characterised. The role of platelets in this process is emerging as an important factor, and will be discussed below.
32 1.6 Platelet structure and biology Platelets are anucleate cells, 2-4μm in diameter, which circulate in the blood at approximately 3 x 108 cells/ml. Platelets are produced in the bone marrow at
4000 cells per megakaryocyte (Niswander et al. 2016). As megakaryocytes develop into giant cells they undergo cytoplasmic fragmentation. The fragments
(platelets) circulate in the vasculature for approximately 10 days before spleen elimination. The structure of a resting platelet is divided into four zones, including; membrane, organelle, structural and peripheral zones (Figure 1.6).
Figure 1.6: Platelet structure and biomolecules. Each of the zones, membrane, organelle, structural and peripheral contain unique biomolecules that influnce cellular processes (primary hemostasis).
Surrounding the platelet surface is the glycocalyx, a region rich in adhesion receptors required for the recognition and binding to exposed proteins in blood vessels following damage (Phillips et al. 1988). The key receptors are integrin
33 a2b, GPIb/IX/V and GPIIb/IIIa, which promote activation through binding of collagen, vWF and fibrinogen, respectively (Saboor et al. 2013). Following activation, platelets also express phospholipid phosphatidylserine (PS) on the unit membrane, which interact with the Na/K-ATPase to form a negatively charged surface that initiates and localises the tissue coagulation cascade
(Thiagarajan and Tait 1990). The coagulation cascade converts pro-thrombin to thrombin, which induces clot formation through the conversion of fibrinogen to fibrin (Hemker et al. 2006). Invaginations of the membrane system form the open canalicular network for the absorption of clothing factors (factors I, II, V, V
+ VIII, VII, X, XI, or XIII) and activation of the coagulation process (Van Creveld et al. 1951). Additionally, the actin filaments contained in the sub-membrane region that surrounds the peripheral zone play important role in maintaining the shape of platelets. These actin filaments also promote activation induced spreading and degranulation of platelets.
Platelets contain three types of granules, the contents of which are released following activation. These granule types include alpha granules, dense granules, and lysosomes (Rendu and Brohard-Bohn 2001). The alpha granules contain adhesive proteins like vWF and fibrinogen as well as pro-inflammatory mediators and growth factors like THBS-1, PDGF and cytokines (Rendu and
Brohard-Bohn 2001). The dense granules contain platelet agonists such as
ADP, Ca2+ and serotonin, which act in coordination to enhance platelet activation following vascular injury (Rendu and Brohard-Bohn 2001). Finally, the lysosomes contain hydrolytic enzymes that also play an important role in platelet function, summarised in Figure 1.7.
34
Under physiological conditions, platelets circulate in the blood without interactions with the vessel wall, other platelets, or ECs (Turitto and Hall 1998).
However, following vascular damage caused by injury or plaque rupture, several biochemical processes are activated that facilitate the formation of a platelet- rich plug (Turitto and Hall 1998). The biochemical and cellular processes involved in this blood clot formation can be divided into platelet adhesion, activation, secretion and aggregation, as shown in Figure 1.8 (Harrison 2005,
Monagle 2015, Weiss 1975).
Figure 1.7: Platelet activation in blood clothing. Platelets adhere to a matrix proteins, get activated, secrete granular contents, aggregate via integrins, produce thrombin and form a fibrin cloth (Versteeg et al. 2013).
35 1.6.1 Platelet Micro-particles Micro-particles (MPs) are cell membrane vesicles ranging in size from 0.2 – 1.0 um (Piccin et al. 2007), produced from activated and apoptotic cells (Piccin et al.
2007). The formation of MP requires calcium mediated plasma membrane budding, which is characterised by changes in lipid asymmetry and protein reorganisation (Coleman et al. 2001, Zwaal and Schroit 1997). Formation of MP causes the loss of plasma membrane asymmetry leading to exposure of phosphatidylserine (Daleke 2003, Hamon et al. 2000, Zwaal and Schroit 1997).
This reorganisation is partly linked to the inhibition of translocase/flippase activity and induction of scramblase/floppase/ABC1 activity by calcium (Daleke
2003, Hamon et al. 2000, Zwaal and Schroit 1997). In platelets, calcium mediated activation of calpain, a protease involved in cytoskeleton reorganisation seems to play an important role in MP release (Zwaal and Schroit
1997). Calpain seems to function by the activation of receptors and pro- enzymes (Zwaal and Schroit 1997).
The most abundant MPs in the circulation are from platelets (PMPs). PMPs have been extensively studied in relation to their pro-coagulant activity; platelet coagulation activity is an important step in thrombus formation, a key feature in cardiovascular complications (VanWijk et al. 2003). It has been demonstrated that 25% of the platelet associated pro-coagulant activity in-vitro is linked to
PMP release and activity (Sinauridze et al. 2007, Tans et al. 1991). PMPs promote sustained platelet binding to sub-endothelial matrix at sites of injury
(Merten et al. 1999) through the stimulation of fibrin-fibril formation (Siljander et
36 al. 1996). Studies on mouse models of venous thrombosis showed that PMP injection significantly increased the level of thrombosis (Ramacciotti et al. 2009).
Importantly, PMP levels are significantly elevated in patients with a pulmonary embolism and valvular atrial fibrillation, which are both associated with heightened risk of thrombosis (Azzam and Zagloul 2009, Bal et al. 2010).
MP express surface markers specific to their cells of origin and to a lesser extent, surface markers that represent the activation process of the MP formation. PMPs express platelet adhesion molecules including CD42b (GpIba), integrin αIIbß3 (Schwarz et al. 2004), PECAM-1 (Losy et al. 1999) and P-selectin
(George et al. 1986b), (Flaumenhaft et al. 2009, Scharf et al. 1992). MPs interact with recipient cells through these adhesion receptors, eliciting phenotypic responses (Ratajczak et al. 2006). This is thought to occur through several mechanisms including: the transport of active biomolecules between platelets and other cells (Mause and Weber 2010), communication through receptor-cell ligation (Théry et al. 2002) and through the transfer of miRNAs
(Diehl et al. 2012a). It is becoming apparent that these mechanisms play a role in the pathophysiology of vascular diseases (Diamant et al. 2004). PMPs can activate the production and expression of EC MPs and adhesion molecules, respectively (Barry et al. 1998), induce endothelial progenitor cell apoptosis
(Gambim et al. 2007) and facilitate in-vitro neutrophil aggregation (Jy et al.
1995). PMPs have been shown to release arachidonic acid that can activate the expression of intercellular adhesion molecule-1 (ICAM-1), P-selectin and E- selectin on ECs and monocytes (Abrams et al. 1990, Barry and FitzGerald 1999,
37 Barry et al. 1998, George et al. 1986a, Wencel-Drake et al. 1993). Moreover,
PMPs amplify leukocyte-induced inflammatory and thrombotic disorders (Forlow et al. 2000, Jy et al. 1995). In the context of the current study, PMPs are significantly elevated in patients presenting with risk factors for cardiovascular complications, including hypertension, obesity and diabetes, which promote the production of more PMPs and consequent amplification of their biological functions (Casey et al. 2004, Goichot et al. 2006, Nomura et al. 2009, Nomura et al. 1993, Preston et al. 2003).
1.6.2 Platelet and PMP-miRNA Although platelets are anucleate, they have the cell machinery necessary for translation (Zimmerman and Weyrich 2008). The ability of platelets to carry out mRNA translation to produce proteins has generated significant interest in characterising their messenger RNA and miRNAs profiles (Gidlof et al. 2013,
Laffont et al. 2013, Risitano et al. 2012). Platelets are now known to contain hundreds of miRNAs (Nagalla et al. 2011), which regulate platelet functions, but importantly they release these miRNAs in PMPs upon activation (Nagalla et al.
2011). ECs, monocytes, lymphocytes, and dendritic cells have been demonstrated to be viable recipients of PMP mediated miRNA transfer (Aatonen et al. 2012, Baj-Krzyworzeka et al. 2006, Montecalvo et al. 2012, Valadi et al.
2007, Wahlgren et al. 2012). Once released, PMPs are able to bind to target cells and alter their function (VanWijk et al. 2003). Particularly, the transfer of miRNA to ECs by PMPs has been quantified using flow cytometry and fluorescence techniques (Gidlof et al. 2013, Laffont et al. 2013, Risitano et al.
2012). Laffont et al., (2013), reported increased levels of miR-223 on ECs
38 following incubation with PMPs, which can regulate endogenous gene expression of onco-suppressor (FBXW7) and glycosylphosphatidyl inositol- anchored receptor tyrosine kinase ligand (EFNA1) at both mRNA and protein levels, but the functional importance of these target genes remains to be identified. PMPs act as an intracellular carrier for the Ago2-microRNA complex, which initiates heterotrophic gene regulation in circulatory cells, most especially
EC (Laffont et al. 2013). The sequence of events follows the dicer III production of miRNA, which is integrated with Ago2-complexes. The miRNA translational repression and/or destabilization of mRNA transcripts is known to occur through miRNA modulation of effector complexes that contain Ago proteins and Dicer
(Bartel 2009, Meister et al. 2004).
Activated platelets release most of their miRNAs packaged in the MPs, while a negligible amount is released to the supernatant (Diehl et al. 2012a, Laffont et al. 2013). Thrombin activation of platelets transfected with fluorescent exogenous synthetic miRNA demonstrated the enrichment of synthetic miRNA in PMPs (Gidlof et al. 2013). Functional analysis of activated platelet miRNA profiles demonstrated that platelet miR-223 levels are significantly increased following thrombin activation (Laffont et al. 2013), which induced about 60-fold increase in miR-223 levels in ECs. Using RNA-induced silencing complex
(RISC) assay (Laffont et al. 2013) demonstrated that MP transfer of miR-223 and activity occurs through complex formation with Ago2 protein (Laffont et al.
2013). The importance of platelet miRNA in regulating the functions of recipient cells lies on the sustained function of transferred miRNA. Indeed, platelet
39 miRNA – Ago2 complex remains functional in ECs after thrombin activation
(Laffont et al. 2013).
Moreover, immuno-precipitation, qRT-PCR and RNA-induced silencing of platelets miR-223 showed that Ago2 forms complexes with miR-223 and possibly other functional microRNAs. Interestingly, co-incubation of fluorescently labelled PMPs with HUVEC was demonstrated by confocal microscopy to be internalised by EC and deliver functional Ago2-miR-223 complex (Gildof et al.,
2013). In addition, incubation of human embryonic cell lines (HEK293) with platelets possessing 3’ – UTRs luciferase reporter gene labelled miR-22, miR-
185, miR-320b and miR-423-5p (Gidlof et al. 2013), demonstrated that thrombin activated platelets inhibited ICAM-1 reporter signal compared to control of scrambled pre-mRNA. This supports the notion that functional miR-22 and miR-
320b can be transferred from platelets to ECs. Though miRNA may be transferred to recipient cells through fusion or internalisation, the available evidence seems to support transfer by internalisation rather than fusion.
1.6.3 Platelet microRNA in cardiovascular complications Microarray and sequencing analysis of isolated RNA from individuals suffering from cardiovascular complications including atherosclerosis and ischaemic heart conditions have identified several correlations between disease phenotypes and differentially expressed RNA transcripts. These include links between inflammation related RNA transcript levels and body weight (Freedman et al.
2010). PMPs have been linked to atherosclerosis (Boilard et al. 2010b, Rautou
40 et al. 2011) through enhanced vascular permeability (Cloutier et al. 2012) and coagulation (Owens and Mackman 2011). PMPs induced vascular permeability and platelet coagulation functions promote inflammation, which subsequently increase the risk of developing atherosclerosis (Boilard et al. 2010b, Cloutier et al. 2013).
The role of platelet miRNAs was first investigated by (Gidlof et al. 2013) in myocardial infarction patients. Gidlof proposed that platelet miRNA is important in the progression of myocardial injury, potentially through the repression of anti- inflammatory gene expression. Initial miRNA profiling suggests that patients with myocardial infarction have a unique miRNA profile compared to healthy individuals (Gidlof et al. 2013). Consistent with the above, it is proven that eight miRNAs including (miR- 22, miR- 127-3P, miR- 139-3p, miR- 185, miR- 320b, miR- 423-5p, miR- 1250 and miR- 1307) were down regulated in myocardial infarction patients, while miR–320a was up regulated compared to controls. The study demonstrated that most of the miRNAs differentially expressed in the circulation of myocardial infarction patients are depleted in their platelets. It was thought that they are decreased because of miRNA transfer to endothelium induced by activation of platelets (Gidlof et al. 2013).
1.7 Aims Several lines of evidence suggest that specific miRNAs are preferentially packaged by platelets into PMPs, and these can be released and transferred to
EC to induce angiogenesis. It is now established that PMP plays an important
41 role in CVD, cancer and wound healing, but the mechanisms remain poorly described. The role of PMPs in CVD correlates with the ability to induce angiogenesis, which could be mediated through PMP derived miRNAs.
However, the molecular mechanisms underlying PMP-miRNA in pro-angiogenic response associated with PMPs remains to be investigated. Based on the emerging role of miRNA in angiogenesis, we hypothesised that PMPs induced angiogenesis leading to CVD is driven by miRNA regulation of EC function.
1.6.1 Objectives To achieve these aims we investigated these specific objectives:
i. Determine the angiogenic potential of ECs treated with PMPs.
ii. Determine the profile of angiogenic proteins released by ECs treated with
PMPs.
iii. Quantify other cellular functions modulated by PMPs treatment of ECs.
iv. Determine whether PMPs effect on angiogenesis was mediated by
miRNA.
v. Identify specific miRNAs and its molecular function controlling the effect
of PMPs on angiogenesis.
42 CHAPTER 2: MATERIALS AND METHODS
2.1 Chemicals and Kits All cell culture reagents used were of cell culture grade, and reagents were of experimental grade and stored as directed by the manufacturer’s description.
The name and identification details of key reagents and assays kits are described in Tables 2.1 – 2.4.
Table 2.1: List of chemicals, suppliers and identification numbers.
Chemical Supplier Catalogue Number L-Glutamine Life Technologies 25030081
Dulbecco modified Eagle Life Technologies 31885-023 medium (DMEM)
Penicillin/streptomycin Life Technologies 15140122 Medium 200 Life Technologies M-200-500 Endothelial growth C-22010/ C-22210 PromoCell medium Endothelial growth C-39215 PromoCell medium supplement Low serum growth Life Technologies S-003-K supplement (LSGS) kit
Fast SYBR® Green Life Technologies 4385610/4385612 Master Mix
Lipofectamine® 3000 Life Technologies L3000001 Reagent FuGENE® HD Activemotif 32042 Transfection Reagent
43 Table 2.2: List of antibodies and proteins, suppliers and identification numbers.
Catalogue Antibodies/Proteins Supplier Number APC mouse anti-human CD41a – platelet BD Biosciences 561852 glycoprotein IIb (clone: HIP8) APC mouse IgG1, k Isotype BD Biosciences 555751 control (Clone: MOPC-21) FITC Annexin V BD Biosciences Thrombin Sigma-Aldrich T7009 Ribonuclease A (RNAse A) Sigma-Aldrich R6513 Prostaglandin E1 Sigma-Aldrich P7527 Polyclonal Sheep IgG anti- R&D Systems AF4670 human CD47 Monoclonal mouse IgG1 anti-human Integrin R&D Systems MAB17781 b1/CD29 (Clone: P5D2)
44
Table 2.3: List of assay kits, suppliers and identification numbers.
Catalogue Assay Kits Supplier Number Quick start Bradford protein assay Bio-Rad 5000201 kit Human angiogenesis antibody array R&D Systems 893313 CellTiter-Glo Luminescent Cell Promega G7570/ G9241 Viability Assay Aurum™ Total RNA Mini Kit Bio-Rad 732-6820 SimpleChIP® Plus Kit (Magnetic Cell Signalling 38191 Beads) Endothelial Tube Formation Assay Cell BioLabs CBA-200 iScript ™ cDNA Synthesis Kit Bio-Rad 170-8890 iScript ™ Select cDNA Synthesis Kit Bio-Rad 170-8896 Human Thrombospondin-1 R&D Systems DTSP10 Quantikine ELISA Kit Human CCL2 (MCP-1) ELISA Affymetrix 88-7399-88 Ready-SET-Go® ebioscience MISSION® LightSwitch Luciferase Sigma-Aldrich MLS0001-1KT Assay Reagent™ QIAprep Spin Miniprep Kit Qiagen 27104
45 2.2 Platelet and PMP isolation and characterization 2.2.1 Isolation of platelets Platelets were harvested from whole blood using prostaglandin E1 as described previously by (Gidlof et al. 2013). The method uses prostaglandin E1 to inhibit platelet activation and ensure that platelet response to agonist stimulation is maintained during the process. Venous blood was collected from healthy volunteers into a plastic syringe containing citrate-dextrose solution (ACD)
(113mM glucose, 30mM Tri-sodium citrate, 73mM NaCl, 3mM citric acid, pH 6.4) as anticoagulant. ACD inhibits the coagulation cascade through chelating calcium and lowering the pH to 6.4. Platelet rich plasma (PRP) was prepared by centrifugation at 1000g for 25 min at room temperature and supernatant collected. PRP was centrifuged at 2500g for 12 minutes with the addition of
50ng/ml prostaglandin, which inhibit platelet aggregation through cAMP elevation and subsequent inhibition of calcium mobilization. Following centrifugation, the platelet pellet was re-suspended in 2.6 ml Hepes-Tyrode buffer (150mM NACL, 5mM HEPES, 0.55mM NaH2PO4, 7mM NAHCO3, 2.7mM
KCL, 0.5mM MgCL2, 5.6mM glucose, pH 7.4). Resuspension in 2.6 ml Hepes-
Tyrode ensured optimal platelet number for the activation stage. Platelet yield was determined with haemocytometer by counting 10 small squares within the middle square of the haemocytometer and the sum multiplied by the volume of each small square (0.004) and the dilution factor. Platelets were used for PMP isolation after 60 minutes recovery from prostaglandin treatment.
46 Equation 1
!"#$%"%$& () 10 &,#"" &-.#/%& (25000C 3(".$(4) 5#6$4/)
2.2.2 Isolation of platelet micro-particles Platelets micro-particles (PMPs) were isolated as previously described by
(Gidlof et al. 2013). Washed platelet suspensions were activated with the agonist thrombin (0.1U/ml) for 60 minutes at 37oC with gentle agitation.
Thrombin cleave protease-activated receptors to initiate coagulation signalling and activate platelets (Brass 2003). To ensure effective pelleting of platelets and removal of supernatant containing PMPs without cell contamination, platelet activation was stopped with the addition of EDTA (20mM) to a final volume of 3 ml. EDTA act by chelating extracellular calcium required for integrin αIIb/β3 activation. The mixture of platelet suspension and EDTA was centrifuged with
50ng prostaglandin at 3200g for 10 minutes to prepare a platelet free releasate.
The resulting supernatant was split into equal 1ml volumes that can fit in a sticky
1.5ml Eppendorf tube, and PMPs isolated by centrifugation at 18,000g for 90 minutes at 18oC. The PMP pellet was then resuspended in 1ml of Hepes-Tyrode buffer. For experiments needing stained PMPs, washed platelets were incubated with 0.2μM 3,3'-Dihexyloxacarbocyanine Iodide (DiOC6) for 25 minutes before thrombin activation and isolation of PMP as described above.
DiOC6 is a permanent fluorescent dye that bind to cell’s vesicle membranes through its hydrophilic groups (Fath and Burgess 1993). The PMP sample was snap frozen and stored in -80oC for use in experiments. The protein content was measured using Bradford assay and cell origin quantified using flow cytometry as described below (Sections 2.2.3-2.2.4).
47
2.2.3 Flow cytometry to confirm cell origin of PMP The flow cytometry analysis was performed in the centre for skin sciences by Dr
Andrei Mardaryev. The size and proportion of platelets and PMP in the samples were quantified by flow cytometry. Platelets or PMPs (1ml) were diluted in 100 ml PBS and incubated in the presence of APC-conjugated mouse IgG (isotope),
Allophycocyanin (APC)-conjugated anti-human CD41a (BD Biosciences) or
Fluorescein (FITC)-Annexin-V and CD31-anti-FITC for 30 minutes, which binds to CD41a, phosphatidylserine, and CD31, respectively. Anti- CD41a bind to the calcium-dependent GPIIb/IIIa (Von dem Borne et al. 1989) found on platelet precursors and platelets where it mediate platelet adhesion and aggregation
(Hogg 1997). Phosphatidylserine and platelet endothelial cell adhesion molecular (CD31) are surface markers for MP (Marguet et al. 1999, Nomura et al. 2001). Following incubation, the samples were diluted to a final volume of
500mL in PBS and analysed cytometricaly using a forward-scattered light and side-scattered light (BD Biosciences) mounted on CyAn ADP analyzer flow cytometer (Beckman Coulter). The cytometer was calibrated and gated by size before all data acquisition. Forward scatter is proportional to the diameter of the PMPs or platelets and side scatter equates to the granularity of the platelets or PMPs (Huh et al. 2005).
48 2.3 Cell culture Human umbilical vein endothelial cells (HUVEC) and human endothelial cell line
EAhy926 cells were obtained from the ethical tissue bank (University of
Bradford). Human embryonic kidney cells 293T (HEK 293) cell line was obtained from the centre for skin sciences (University of Bradford). For HUVEC, the cobblestone morphology of endothelial cells was observed (Figure 2.1), and cells were used below passage 8.
Figure 2.1: Representative morphology of HUVEC. (A) Phase contrast microscope of confluent HUVEC (magnification of x40), (B) Fluorescent image of HUVEC stained with 1uM Calcein AM (magnification of x100).
The functional characteristics of EAhy926 cell line, including morphology and genetic features are well described (Edgell et al., 1990; Gifford et al., 2004;
Unger et al., 2002). Moreover, the genetic and functional characteristics of HEK
293T are well characterised (Shaw et al. 2002). During normal culture periods, cells were incubated at 37°C in a humidified 5% CO2 enriched atmosphere
(SANYO cell culture incubator).
49 HUVEC were cultured as a monolayer in 75-cm2 flasks (Corning) in Medium 200
(Life Technologies) supplemented with Low Serum Growth Supplement (LSGS) kit (2% v/v foetal bovine serum, (1µg/ml) hydrocortisone, 10ng/ml human epidermal growth factor, 3ng/ml basic fibroblast growth factor, 10µg/ml heparin, and 50-units/ml penicillin:50-ug/ml streptomycin or Endothelial cell growth medium (PromoCell) supplemented with endothelial cell growth supplement kit
(2% v/v fetal calf serum, 0.4% endothelial cell growth supplement, 1µg/ml hydrocortisone, 0.1ng/ml human epidermal growth factor, 1ng/ml basic fibroblast growth factor, 90µg/ml heparin, and 50-units/ml penicillin:50-ug/ml streptomycin.
EAhy926 and HEK 293T cells were cultured as a monolayer in 75-cm2 flasks
(Corning) in DMEM (Life Technologies) supplemented with 10% foetal bovine serum (FBS) (Life Technologies), 50-units/ml penicillin, 50-ug/ml streptomycin
(Life Technologies) and 200mM L- glutamine (Life Technologies). Cells were observed three to four times weekly and at every media change (every 2-3 days), for normal growth by phase contrast microscopy. For confluent HUVEC and EAhy926 cells, medium was aspirated and cells washed twice with phosphate buffered saline (PBS) (mmol/L: 137 NaCL, 2.7 KCl, 10 Na2HPO4, 1.8
KH2PO4), thereafter cells were trypsinised and passaged into a 1:4 dilutions in the appropriate medium. For confluent HEK 293T cells, medium was aspirated and flask agitated by gentle hitting, thereafter cells were resuspended and passaged into 1:3. Cell counts were determined following using the haemocytometer.
50 For experiments requiring low supplements, culture media was removed and the cells were washed in phosphate-buffered saline (PBS) and bathed in either
Medium 200 with 2% v/v foetal bovine serum (HUVEC experiment medium); or
DMEM without serum (EAhy926 experiment medium) (Life Technologies). Cells were cultured in a humidified 5% CO2-enriched atmosphere (SANYO) for 24 hours prior to experimentation. In experiments with HUVEC or requiring transfection, cells were bathed in experiment medium and incubated for 3 hours prior to experimentation.
2.3.1 Cell transfection for loss or gain of function analysis The loss of function effect of miRNA was investigated by transfecting inhibitors using Lipofectamine 3000 reagent (Life Technologies). Transfection using
Lipofectamine 3000 is based on the cationic lipid delivery of nucleic acid into eukaryotic cells (Chesnoy and Huang, 2000; Hirko et al., 2003; Liu et al., 2003).
The cationic lipids are designed to have a positive charged head group and hydrocarbon chain, where the charged group interacts with the phosphate backbone of nucleic acid and the negative charge on the cell membrane to elicit endocytosis. In this biological process, the siRNA/liposome or DNA/liposome complex is deposited into the cells through a membrane bound/intracellular vesicle. On the transfection day, Let-7a inhibitor (ActiveMotif) or non-targeting inhibitor (ActiveMotif) were diluted in Opti-MEM media. For 6 well culture plates
(5x105 cells/well), 90pmol each of combined Let-7a-3p and Let-7a-5p inhibitor or
120pmol of non-targeting inhibitor were prepared in Opti-MEM. Lipofectamine
3000 Reagent was diluted to 1:50 in Opti-MEM media and mixed with the diluted miRNA inhibitors at 1:1 ratio. The mixture was incubated for 15 minutes at room
51 temperature and added to HUVEC cells at a final concentration of 90pmol. miRNA inhibitors contains chemically modified, single strand RNA sequence that recognise and bind to the sequence of a mature miRNAs to inhibit their function, based on the sequence complementarity with the target mRNA. Chemical modification of either the sugar or the linkages of the nucleotide improve binding affinity and reduce degradation by endogenous nuclease.
Transfected cells were cultured in normal conditions, as described in section
2.3.1 for 24 hours before removing the transfection media. Cells were starved for 3 hours in experimental medium before trypsinisation and treatment with
1µg/µl PMP. For receptor inhibition experiments, trypsinised cells were held in suspension in experimental growth medium in the presence of antibodies;
2µg/ml CD47, 2µg/ml CD29, or combined 2µg/ml each of CD47 and CD29 for 1 hour at 37°C in a humidified 5% CO2-enriched atmosphere. The effect of Let-7a inhibition on THBS-1 and MCP-1 prior to PMP treatment was determined by performing ELISA on the transfection media collected after 24 hours.
The effect of overexpressing Let-7a miRNA (gain of function) was investigated by transfecting pmiR expression plasmid with Lipofectamine 3000 reagent (Life
Technologies). On the transfection day, Let-7a expression plasmid or empty expression plasmid were diluted in Opti-MEM media and P3000 reagent. For 24 well culture plates, 1µg of Let-7a expression plasmid or empty expression plasmid were prepared in Opti-MEM and 2µl P3000 reagent to a final volume of
25 µl. Lipofectamine 3000 Reagent was diluted to 0.75:250 in Opti-MEM media
52 and mixed with the diluted expression plasmids at 1:1 ratio. The mixture was incubated for 5 minutes at room temperature and added to HUVEC cells at 75 –
85% confluence. The sequence of the transfected inhibitors are presented in
Figure 2.4. Expression plasmids are independent, circular and self-replicating
DNA molecule that produces the mRNA product of the inserted gene.
Incorporation of sequence for a fluorescent protein provides a quantifiable measure of gene expression and activity. Transfected cells were cultured in normal conditions, as described in section 2.3.1 for 24 hours before removing the transfection media. Cells were starved for 4 hours in experimental medium before trypsinisation and culture on well plates coated with Matrigel. The effect of Let-7a inhibition on MCP-1 treatment was determined by performing ELISA on the transfection media collected after 24 hours.
Table 2.4: List of microRNA inhibitors and sequence.
Inhibitor Supplier Catalogue Sequence Non- Targeting Active INH9002 5’ UUGUACUACACAAAAGUACUG 3’ miRNA Motif Inhibitor V2 Hsa-let-7a- Active INH0002 5’ CUAUACAAUCUACUGUCUUUC 3’ 3p Inhibitor Motif Hsa-let-7a- Active 5’ UGAGGUAGUAGGUUGUAUAGUU INH0002 5p Inhibitor Motif 3’
53
2.3.2 Cell transfection to measure reporter gene signal The effect of Let-7 miRNA on reporter of THBS-1 3’UTR was investigated by co- transfecting 3’UTR, miRNA expression vector and inhibitors using FuGENE HD reagent (ActiveMotif) and Lipofectamine 3000 reagent (Life Technologies), details of the expression plasmids are presented in section 2.6.2. Transfection using FuGENE HD is based on a non-liposomal proprietary reagent that directly deliver reagent/DNA complex into cells. On the transfection day, 3’UTR (30µg/µl stock), expression vector (20µg/µl stock) or Let-7a inhibitor or non-targeting inhibitor (5nmol stock) were diluted in reduced serum Opti-MEM media as described in cell culture section. For 96 well culture plates, 600µg of plasmid
DNA 3’UTR, 200µg of miRNA expression plasmid or 800µg combined 3’UTR and miRNA expression vector plasmids (3:1 ratio of 3’UTR to miRNA expression vector) were diluted in 97µl of Opti-MEM and mixed with 3µl of FuGENE HD reagent. The mixture was incubated for 10-minutes at room temperature and added to HEK 293T cells at 75 – 85% confluence. Transfected cells were cultured in normal conditions, as described in section 2.3.1 for 12 hours before the transfection of Let-7a inhibitor or non-targeting inhibitor as described before
2.3.1. Cells were cultured for additional 2 hours before treatment with 100µg/ml
PMP and cultured for 15 hours in normal culture conditions. The culture media was removed and plates frozen for at least 6 hours to improve cell lysis before reporter assay experiments.
2.3.3 Immunocytochemistry analysis of PMP internalisation The internalisation of PMP by endothelial cells was investigated by treating
HUVEC cells with DioC6 stained PMP before visualisation using a fluorescent
54 microscope. HUVEC cells (1 x 105 cells per well) seeded on a cover slip in normal endothelial growth medium were treated with 100μg/ml of DiOC6 stained
PMPs for 6, 12 or 18 hours. Cells were washed with PBS, fixed with 4% paraformaldehyde for 10 minutes, stained with 4',6-Diamidino-2-Phenylindole,
Dihydrochloride (DAPI) and imagined with a fluorescent microscope. DAPI produces strong blue fluorescent staining of the nucleus because of its ability to pass through an intact cell membrane and bind to A-T rich regions of the DNA
(Kapuscinski 1995).
2.4 Endothelial Cell Functional assays 2.4.1 Endothelial Cell Tube Formation Assay The Endothelial Tube Formation Assay Kit (Cell Biolabs) or Geltrex
(ThermoFisher) were used to quantify angiogenic tube formation and vessel sprouting based on the principle of proteolysis of the extracellular matrix
(Goodwin 2007). The degradation of extracellular matrix promote the activation of angiogenic proteins, release of growth factors and subsequent angiogenesis, summarised in Figure 2.2 (Goodwin 2007). The extracellular matrix gel (ECM gel) was thawed at 4oC overnight to avoid rapid polymerisation and degradation of growth factors contained in the gel. Sterile 96-well cell culture plates were coated with a thin layer of ECM gel (50μL/well) and left to polymerize at 37oC for
60 minutes. HUVEC or EAhy926 cells (2 x 104 cells/mL) in experiment medium were added to each ECM coated well and were treated with 100μl PMPs diluted in the appropriate experiment medium. Cells in 10% serum supplemented
DMEM (EAhy926), untreated cells or transfected untreated cells were setup as positive and two negative controls, respectively. For Let-7a expression
55 experiment, 2 x 104/mL untransfected HUVEC, HUVEC transfected with Let-7a expression plasmid or empty expression plasmid in experiment medium were added to ECM coated well. The plates were incubated at 37oC, for 18 hours and tube formation was observed with Evos fluorescent microscope (Life
Technologies) after staining with 1μM Calcein AM (Cell Biolabs). Four microscope fields were selected at random and photographed. Total tube length and the number of individual branch points per field under x40 magnification was used to quantify tube-forming ability. The quantification was performed with
AngioTool software (National Cancer Institute, United States). The length of tube and branch points was expressed in micrometre and arbitrary numbers, respectively.
Figure 2.2: Principle of in-vitro angiogenesis. PMP mediate endothelial cell release of cytokines and enzymes that cause the breakdown of the Matrigel, sprouting of cells, migration and reorganisation to form capillary like structures.
56
2.4.2 Proliferation assay with CellTiter-Glo The CellTiter-Glo luminescent Cell Viability Assay kit or CellTiter-Glo 2.0 kit
(Promega) was used to measure EC proliferation. This assay is based on the reaction of thermostable luciferase with ATP, which generates a stable glow- type luminescent signal (Crouch et al. 1993). The CellTiter-Glo reagent can be added directly to cultured cells and the luminescent signal can be measured with a plate reader. The resulting luminescent signal is proportional to ATP present in the medium and represents metabolically active cells. HUVEC or EAhy926 cells, suspended in 100μl medium were seeded into black or white 96-well plates at
2000 cells per well in triplicate. Cells were then treated with 100μg/ml of PMPs diluted in 100μl experiment medium, then cells were incubated at 37oC in a humidified 5% CO2 atmosphere for up to 72 hours. After 0, 24, 48 or 72-hours incubation, 200μl of CellTiter-Glo reagent was added to the wells and incubated for 30 minutes at room temperature. Thereafter, the resulting luminescent signal was measured with a plate reader (Promega-GloMax). The Luminescence readings of the blank wells were subtracted from the luminescence of all treatment well, giving a relative proliferation rate for every treatment group.
2.4.3 Luciferase assay to measure reporter gene signal The LightSwitch Luciferase Assay Reagents (ActiveMotif) was used to measure
Renilla luminescent reporter gene (RenSP) signal. This assay is based on the oxidation of coelenterazine substrate by RenSP to generate light at 480nm (Hori et al. 1973). The Luciferase reagent can be added directly to the cultured cells and luminescent signal measured with a plate reader. The resulting luminescent signal is proportional to the products of the expression plasmid. HEK 293T cells
57 suspended in 100μl medium were seeded into black or white 96-well plates at
15000 cells per well in replicates. Cells were transfected with plasmids as
o described above in section 2.3.2 and incubated at 37 C in a humidified 5% CO2 atmosphere for 30 hours. After freezing, 100μl of luciferase reagent diluted to
1:1 ratio in PBS was added to the wells and incubated for 30 minutes at room temperature. Thereafter, the resulting luminescent signal was measured with a plate reader (Promega-GloMax). The luminescence readings of the targeting transfection were normalised to the respective non-targeting controls, giving a percentage ratio of targeting to non-targeting signal (Equation 2).
Equation 2
Specific signal Luminescence signal = non − specific signal
58
2.5 Protein analysis 2.5.1 Protein quantification assay with Bio-Rad Bradford assay Following PMP isolation from venous blood, frozen PMP suspensions were thawed at room temperature and the concentration of solubilized protein in the sample measured by Bio- Rad Bradford assay kit following the manufacturer’s instructions. Moreover, all protein concentration measurements including whole cell extract and cell culture supernatant were measured as described below. The
Bradford protein quantification assay is based on colorimetric change caused by binding of Coomassie Brilliant Blue G-250 dye to proteins (Bradford, 1976). The unbound dye is in the protonated red cationic form, which changes to unprotonated blue form when bound to proteins. Briefly, PMP suspensions were further homogenized by repeated aspiration through a sterile pipette tip (200ul).
Four dilutions (1mg/ml, 0.5mg/ml, 0.25mg/ml and 0.125mg/ml) of BSA in PBS were prepared as standards. 5μl of each standard and sample suspension were pipetted into separate wells of 96-well plates in triplicate and 250μl of diluted
Bio-Rad dye reagent (dye, phosphoric acid and methanol; Bio-Rad Laboratories) added to each well. The mixtures were incubated at room temperature for 5 minutes and absorbance measured spectrophotometrically at wavelength
595nm with microplate reader (Promega-GloMax). The resulting absorbance value was used to generate a protein standard curve and quantify PMP concentrations.
59 2.5.2 Protein array of angiogenesis related proteins To determine the level of angiogenic factors released by EC treated with PMP or cytokines bound to PMP surface, the antibody array method by R&D systems using the Human Angiogenesis Antibody Array and Cytokine panel A. The analysis helped to characterise the angiogeneic factors modulated by PMP or bound to PMP surface. The assay is based on a protein array technique where support surface of nitrocellulose membrane coated with purified antibodies and fluorescent-labelled proteins from samples are added to the membrane, summarised in Figure 2.3 (Kane et al. 2010). Physical interaction between the capture protein and sample proteins emit luminescent signals that are visualized using X-ray film or automated documentation machine. This membrane contains positive controls (3 x 2 spots), negative controls (1 x 2 spots) and 55 x 2 spots for determining known angiogenic proteins, see (table 2.1).
60
Figure 2.3: Protein array method. Interaction between capture and sample proteins produce light signal, (adapted from product insert).
Table 2.5: List of Proteins probed. The actual protein sequence probed are described in the product information sheet.
Activin A FGF-7/KGF PD-ECGF ADAMTS-1 GDNF PDGF-AA Angiogenin GM-CSF PDGF-AB/PDGF-BB Angiopoietin-1 HB-EGF Persephin Angiopoietin-2 HGF CXCL4/PF4 Angiostatin/Plasminogen IGFBP-1 PIGF Amphiregulin IGFBP-2 Prolactin Artemin IGFBP-3 Serpin B5/Maspin Tissue Factor/Factor III IL-1 beta Serpin E1/PAI-1 CXCL16 CXCL8/IL-8 Serpin F1/PEDF DPPIV/CD26 LAP (TGF-beta 1) TIMP-1 EGF Leptin TIMP-4 EG-VEGF CCL2/MCP-1 Thrombospondin-1 Endoglin/CD105 CCL3/MIP-1 alpha Thrombospondin-2 Endostatin/Collagen XVIII MMP-8 uPA Endothelin-1 MMP-9 Vasohibin FGF acidic NRG1-beta 1 VEGF FGF basic Pentraxin 3 VEGF-C FGF-4
61 The detection of the above proteins (Table 2.5) were carried out according to the
User Manual, R&D Systems, human angiogenesis Antibody Array. The antibody immuno complexes that were formed on the appropriate spots with different intensities were visualized by peroxidase-conjugated streptavidin and substrate
(ECL1: luminol, P- coumaric and 1M Tris base pH 8.5, ECL2: 30% hydrogen peroxide 1 M pH 8.5). The resultant membrane with visible spots of variable intensity was captured using G-Box (Gel documentation and analysis, Syngene) using the ECL settings and analysed densitometrically. The quantification was carried out using the Gel plugin on Image J v1.49 software (National Institutes of
Health, United States). Additional comparative analysis was performed with
ImageStudioLite software (LI-COR Biosciences). The level of individual protein was expressed as pixel density and analysed statistically.
2.5.3 Enzyme-linked Immunosorbent Assays (ELISA) ELISA is invaluable in proteomics, where the specificity of antibodies is incorporated with the sensitivity of enzyme activity to quantify absolute amount of proteins. The assay is based on coupling easily assayed enzymes to antibodies or antigens to detect measurable signals. Normal HUVEC, cells transfected with Let-7a inhibitor or transfected with non-targeting inhibitor sequence (2x104 cells/well) were treated with 100μg/ml of PMP or left untreated for 24 hours. The medium was collected and stored at -20oC till further use.
Medium from different functional assays were collected, pooled into three sets and analysed.
62
2.5.3.1 ELISA for THBS-1 The concentration of THBS-1 was analysed using the Human Thrombospondin-
1 Quantikine ELISA Kit (R&D Systems). Prior to assay procedure, samples were diluted to 2-fold using the calibrator diluent. Likewise, 7 standard concentrations
(ng/ml: 500, 250, 125, 62.5, 31.3, 15.6, 7.81) were prepared with the calibrator diluent. All reagents and samples were brought to room temperature, before sequential addition of 100µL of assay diluent and 50µL of standard, control, or sample to each well. Plate were sealed and incubated at room temperature for
2-hours with shaking. The wells were aspirated and washed four times with wash buffer. Thereafter, wells were incubated with 200µL of conjugate at room temperature for 2-hours on the shaker, then aspirated and washed four times with wash buffer. Finally, wells were incubated with 200µL substrate solution in the dark at room temperature for 30 minutes, and reaction stopped with 50µL of stop solution. For both ELISA procedures, fluorescence signal was measured at
450nm and corrected with measurement at 570nm (Tecan). The standard curve was plotted and protein concentration determined using excel spread sheet.
2.5.3.2 ELISA for MCP-1 MCP-1 levels were assessed with the Human CCL2 (MCP-1) ELISA Ready-
SET-Go® (eBiosciences). Nunc Maxisorp® ELISA plate was coated with 100μL of capture antibody diluted in 1X coating buffer, sealed and incubated overnight at 2-8°C. Prior to assay procedure, samples were diluted to a 2-fold and 7 standard concentrations (pg/ml: 25, 50, 100, 200, 400, 600, 1200) were prepared with the 1X ELISA/ELISPOT diluent. The wells were aspirated and
63 washed three times with wash buffer. Then, wells were blocked with 200μL of
1X ELISA/ELISPOT at room temperature for 1-hour, aspirated and washed once with Wash Buffer. 100µL of standard, control, or sample was added to each well, sealed and incubated at room temperature for 2 hours with shaking. The wells were aspirated and washed five times with wash buffer, before the addition of 100μL of detection antibody diluted in 1X ELISA/ELISPOT diluent. Thereafter, wells were aspirated ad washed as described above. Incubated with 100µL of
Avidin-HRP diluted in 1X ELISA/ELISPOT Diluent at room temperature for 30 minutes on the shaker, then aspirated and washed seven times. Finally, wells were incubated with 100μl of 1X TMB solution in the dark at room temperature for 15 minutes, and reaction stopped with 50µL of stop solution.
2.5.4 SDS-PAGE and Western blot analysis The effect of PMP treatment on ATF-4, Histone-3 and caspase-3 levels in EC was investigated by immunoblotting. HUVEC transfected with Let-7a inhibitor or non-targeting inhibitor sequence (2x105 cells/well) were treated with 100ug/ml of
PMP or buffer control for 24 hours. Cells were lysed on ice in 300μl lysis buffer
(0.25M Tris-HCl, pH 6.8, 3.75mM sodium pyrophosphate, 32mM EDTA, 5% w/v
SDS and 15ul β-mercaptoethanol), and the proteins were degraded by boiling at
100oC for 5 minutes in the presence of β-mercaptoethanol. β-mercaptoethanol cleave disulphide bonds between cysteine residues to disrupt the quaternary and tertiary structure of the proteins, which allows the migration by size. The addition of protease inhibitor cocktail reduces the degradation by endogenous proteases released by lysed cells. Approximately, 30μg in 30μl per lane, with
64 0.01% bromophenol blue or 10μl of pre-stained protein ladder (Cell signalling) were separated by 10% sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoresed protein was transferred to a
PVDF membrane (pores size 0.2µm, Bio-Rad, United Kingdom), for 90 minutes at 100 volts on ice. Then, non-specific binding was blocked with 5% BSA in
TBS-T (mM: 150 NaCl, 20 Tris, pH 7.6, and 0.1% Tween 20) for 1-hour at room temperature with gentle shaking. The membrane was washed for 5 minutes with
TBS-T with gentle shaking, before incubation with the appropriate primary anti- body in 5% BSA (Sigma-Aldrich) in TBS-T (Table 2.6) overnight at 4oC.
Immediately, the membrane was washed thrice (5 minutes per wash) with TBS-
T (in mM: 150 NaCl, 20 Tris, pH 7.6, and 0.1% Tween 20). The washed membrane was incubated with the appropriate horseradish peroxidase conjugated secondary antibody (table 1) in 5% non-fat milk (diluted in TBS-T) for
1-hour at room temperature. Following three additional 5-minutes washes with
TBS-T, the immune-reactive bands were visualized using the enhanced chemiluminescent (ECI) substrate (ECL1: luminol, P-coumaric and 1M Tris base pH 8.5, ECL2: 30% hydrogen peroxide 1M pH 8.5). The addition of this peroxide-based reagent facilitates oxidation of luminol resulting in the emission of light, which was captured with an imaging system (G:Box, Gel documentation and analysis, Syngene) or x-ray film. The densitometry of the bands was quantified using the ImageStudioLite (LI-COR Biosciences).
65 Table 2.6: Details of primary and secondary antibodies and dilution factors.
Antibody Host Dilution Manufacturer ATF-4 Rabbit 1:500 Cell Signalling Histone H3 Rabbit 1:1000 Cell Signalling Caspases 3 Rabbit 1:1000 SIGMA Anti-Rabbit IgG Goat 1:2000 SIGMA
66 2.6 Manipulation of Nucleic acids 2.6.1 RNA degradation experiments with RNAse Treatment To investigate the effectiveness of RNA degradation process used for functional assays, PMPs were treated with RNAse A (1U/ml) in 37oC for 60 minutes and reaction stopped by RNAse inhibitor (10 U/ml) for 5 minutes (Gidlof et al. 2013).
2.6.1.1 RNA Isolation for degradation analysis Total RNA was isolated from PMPs treated with RNAse or non-treated control
PMP using Trizol reagent (Invitrogen) according to manufacturer’s instructions.
Initially, 750μl of Trizol reagent was added to 250μl of PMP sample and lysed by brief vortex. The homogenized PMPs and Trizol reagent mixture were incubated at room temperature for 5-minutes to allow complete dissociation of protein complexes. After incubation, 150μl of lysed PMP sample were added and incubated for 3 minutes at room temperature. Then, the mixture was centrifuged for 15 minutes at 12,000g at 4oC. Following centrifugation, the colourless aqueous phase was transferred to a new tube and incubated at room temperature for 10 minutes in the presence of 375 μl isopropanol (100%). The mixture was then centrifuged at 12,000g for 10 minutes at 4oC. Then, the supernatant was discarded and the RNA pellet washed in 1000μl of 75% ethanol. The RNA pellet was vortexed and centrifuged at 7500g for 5 minutes at
4oC. The ethanol was discarded and RNA pellet was air-dried for 5-10 minutes.
Finally, the washed RNA pellet was resuspended in 20-50μl of nuclease free water and incubated for 15 minutes at 60oC.
67 2.6.2 Bacterial culture for plasmid preparation To investigate the effect of Let-7a expression on reporter THBS-1 3’UTR and angiogenic response. Precursor Let-7a expression plasmid was prepared from glycerol stock purchased from (Vigene biosciences) cloned and empty plasmid maps are shown in Figure 2.4. The THBS-1 3’UTR vector was purchased ready to transfect from Activemotif, and the vector map is shown in Figure 2.5 and the cloned sequence of THBS-1 3’UTR shown in the appendix.
Figure 2.4: Schematic representation of Human let-7a-2 in pMIR Plasmid Vector and empty expression plasmid (provided by the supplier, Vigene biosciences).
68
Figure 2.5: Schematic representation of the human THBS-1 3’UTR vector. Full inserted sequence is shown in the appendix (provided by the supplier, Activemotif).
2.6.2.1 Bacterial culture for Plasmid DNA isolation with Qiagen miniprep For the precursor Let-7a expression plasmid, the bacterial stock was grown
Luria-Bertani (LB) agar plate containing 40ug/ml kanamycin (Sigma-Aldrich).
The expression plasmid has kanamycin resistant gene to facilitate selective culture. Bacteria streaked agar plate was incubated overnight at 37oC before transferring a single bacteria colony to a 15ml Falcon tube containing 2ml LB broth with 40ug/ml kanamycin. The tube was then incubated overnight at 37oC and 250 revolution per minutes (rpm). Thereafter, the LB broth culture was centrifuged at 13000g for 10-minutes at 4oC and bacteria pellet re-suspended in
69 buffer P1 (Qiagen), with RNAse A. Bacteria was lysed with buffer P2 for 5 minutes and precipitated with cold buffer P3 at room temperature for 15 minutes.
Precipitated lysate was centrifuged at 20000g for 30minutes at 4oC before removing the supernatant containing plasmid DNA. Additional centrifugation of the supernatant at 20000g for 15minutes at 4oC was performed to clarify the plasmid DNA before passing the sample through buffer QC equilibrated Qiagen tip. Plasmid DNA was eluted with buffer QF and precipitated with 0.7 volumes of isopropanol at room temperature. Thereafter, the mixture was centrifuged at
13000g for 30minutes at 4oC and supernatant discarded. Plasmid DNA pellet was washed with 70% ethanol, centrifuged at 15000g for 10minutes at 4oC.
Supernatant was discarded without disturbing the pellet and air-dried for
10minutes in a culture hood to avoid contamination. The dried plasmid DNA was suspended in filter sterilised TE buffer (pH 8.0) and stored at -80oC till further use. DNA concentration and quality was determined by spectrophotometer and agarose gel electrophoresis as described before.
2.7 Gene expression analysis
The effect of PMP treatment on Let-7a expression and role of Let-7a PMP mediated changes in gene expression was investigated by quantitative reverse transcriptase real-time PCR (qRT-PCR).
2.7.1 Total RNA extraction Total RNA used for cDNA preparation or cDNA library construction was extracted from treated cells in 6 well plates (2x105) or from platelets from 30mls venous blood (~2x109 cells/ml), respectively. The Aurum total RNA Mini kit (BIO-
70 RAD) was used for both samples, based on RNA binding to solid phase silica under optimal pH and slat concentration. HUVEC, cells transfected with Let-7a inhibitor or transfected with non-targeting inhibitor sequence (2x105) were treated with 100ug/ml of PMP or buffer control for 24 hours. Cells were washed with sterile PBS and lysed in 350μl lysis buffer supplemented with 1% β- mercaptoethanol. The addition of β-mercaptoethanol facilitates the degradation of intracellular RNases released during cell lysis, which promotes the recovery of high quality RNA sample. This reducing agent, combined with guanidinium isothiocyanate present in the lysis buffer denatures RNases, through the reduction of disulphide bonds and irreversible destruction of the functional conformation of RNases. Cells were homogenized by repeated pipetting (with
1ml pipet tips) before the addition of 350μl of 70% ethanol to the lysate and further homogenization. The lysates were poured into an RNA binding column placed in a cap-less wash tube and centrifuged for 30seconds at 14000g. Flow through was discarded and column washed with 700μl of low stringency solution for 30 seconds at 14000g. Thereafter, DNA contaminates were degraded by treating bound nucleic acid with 80μl DNase1 (diluted to 1:15 (v/v) DNase1 dilution solution) for 15 minutes at room temperature. DNase hydrolyses the phosphodiester linkages of DNA backbone that holds nucleotides together.
Then, the column was washed consecutively with 700μl of high stringent and low stringent solution for 30seconds each, at 14000g. Washed column was dried with further 60seconds centrifugation at 14000g, and transferred to a nuclease- free 1.5ml microfuge tube. Then, the purified RNA was incubated with 50μl of elution buffer for 1minute at room temperature and eluted with centrifugation for
71 2minutes at 14000g. The RNA samples were quantified as described below
(section 2.7.2) before immediate synthesis of first strand cDNA or stem-loop cDNA, cDNA library construction for RNA-seq or storage at -80oC.
2.7.2 Quantification of RNA for polymerase chain reaction and RNA sequencing Total RNA concentration was quantified by spectrophotometry, using the
(NanoPhotometer P330, Implen GmbH, Munich, Germany) programmed to measure the concentration of RNA or DNA at 0.2mm path length. Thereafter, the spectrophotometer was blanked using 3.5μl of elution buffer pipetted onto the measuring window. Likewise, the concentration was measured at 260nm
(RNA) and 280nm (DNA) in μg/ml. The RNA purity was considered good at 260- nm/280 nm ratio of 1.8-2.2 (Rodrigo et al. 2002). The RNA concentration was determined based on the equation 2:
Equation 2
RNA concentration (µg/ml) = 44 (µg/ml) x A260 x Dilution factor
Where, 44 μg of RNA per ml corresponds to absorbance reading of 1 unit at 260 nm.
Equation 2.1
Total amount of RNA (µg) = Concentration (µg/ml) x volume of samples (ml)
2.7.3 First strand cDNA synthesis for standard polymerase chain reaction First strand cDNA was generated using iScript cDNA Synthesis Kit (BIO-RAD).
In-vitro cDNA synthesis is based on RNA-dependent DNA polymerase of single
72 strand RNA molecule. Briefly, reactions were set up in a nuclease-free 200μl
PCR tube by mixing 5x iScript reaction mix (4μl) (containing; RNase H+, RNase inhibitor, deoxy-thymidine nucleotides (oligo(dT)) and random hexamer primers), nuclease-free water (up to 20μl), RNA (400ng) and 1μl iScript reverse transcriptase (from Moloney murine leukemia virus). Oligo(dT) binds to the poly-
A tail to provide a 3’-OH end that is extended by the reverse transcriptase. In each set of samples extra tube of no reverse transcriptase negative control was prepared as above, where reverse transcriptase was replaced with 1μl of water.
The reaction tubes were incubated in thermal cycler as follows;
§ Primed with random hexamer primer and Oligo(dT) at 25 ̊C for
5 minutes.
§ RNA template was reverse transcribed at 42 ̊C for 30 minutes.
§ The reverse transcriptase was inactivated at 85 ̊C for 5
minutes.
The cDNA samples were stored at -80 ̊C till use in downstream application.
2.7.4 Stem loop cDNA synthesis for miRNA polymerase chain reaction Stem loop cDNA was generated using iScript Select cDNA Synthesis Kit (BIO-
RAD). Stem loop cDNA synthesis mitigates the challenge of transcribing short miRNA sequence of 17 – 24 nucleotides (nt) in length. The RT-primer contains a highly stable stem-loop structure that lengthens the target cDNA, and promote specific and efficient amplification of target sequence. Briefly, reactions were set up in a nuclease-free 200μl PCR tube by mixing 5x iScript reaction mix (4μl)
(containing; RNase H+, RNase inhibitor and deoxynucleotide (dNTPs)), let-7a,
73 miR-221 and U6S stem loop primers at a concentration of (400nM) each, gene specific primer enhancer solution (2μl), nuclease-free water (up to 20μl), RNA
(400ng) and 1μl iScript reverse transcriptase (from Moloney murine leukemia virus). The proprietary gene specific enhancer solution improves cDNA yield and detection in downstream applications. Moreover, additional tube of no reverse transcriptase negative control was prepared as above, where reverse transcriptase was replaced with 1μl of water. The reaction tubes were incubated in thermal cycler as follows;
§ RNA template was reverse transcribed at 42 ̊C for 30 minutes.
§ The reverse transcriptase was inactivated at 85 ̊C for 5
minutes (see Appendix for summary).
The stem loop cDNA samples were stored at -80 ̊C till use in downstream application.
74 2.7.5 Quantitative Real Time PCR (qPCR) SYBR Green dye was utilised in the quantification of primer amplification of both gene and miRNA analysis. SYBR Green is a fluorogenic dye that emits a strong fluorescent signal upon binding to double-stranded DNA, as opposed to low fluorescence in solution. The dye form complex with DNA through intercalation and external binding, which is supported by the biphasic dependence of increasing guanidinium hydrochloride on observed fluorescence intensities
(Zipper et al. 2004). The qPCR assays were set up for first strand cDNA and stem loop cDNA as described below.
2.7.5.1 qRT-PCR analysis of target miRNA (stem Loop) qRT-PCR reactions were set up for detection of Let-7a and miRNA-221 expression using iQ SYBR® green supermix, as described by (Yoon et al.
2011). The primer set are summarised in Table 2.8 and derived from (Yoon et al. 2011). The design of the primers involved the addition of extra nucleotides to the mature microRNA sequence. This serves to optimise the melting temperature and increase assay specificity. The universal reverse primer disrupts the stem loop formed during the cDNA synthesis. The qPCR master mixes were prepared by mixing 2x iQ SYBR® green supermix (10μl), Let-7a,
U6S or miRNA-221 forward primers (400nM), universal reverse primer (400nM), nuclease-free water (to a final volume of 20μl). Thereafter, 5μl of stem loop cDNA was added to 15μl of Master mix described above in each well of Clear
96-well PCR plate, briefly mixed and centrifuged using a benchtop plate centrifuge. Each reaction mix was set up in triplicate, on ice and assay
75 performed as described below in Step-one Real-Time PCR Detection System
(Applied Biosystems):
§ One cycle of initial denaturation and polymerase activation at
95°C for 30 seconds.
§ 40 cycles of denaturation at 95°C for 15 seconds followed by
annealing and extension at 60°C for 30 seconds, with plate
read.
§ Final melt curve analysis from 65-95°C (+1°C increments, 5
seconds/increment) with plate read.
2.7.5.2 qRT-PCR analysis of target gene mRNA transcripts qPCR reactions were set up for expression analysis of THBS-1, PIGF, ATF-4,
MCP-1 and GAPDH using Fast SYBR® Green Master Mix (Applied
Biosystems), primer sets are summarised in Table 2.7, with sources of primer sequence. For primers not retrieved from literature, the design process is presented in section 2.10. Briefly, reaction Master Mix (MM) were prepared according to the following scale, 2x iTaq Universal SYBR Green Supermix
(10μl), forward and reverse primers (300nM each), nuclease-free water (up to
20μl) and 1μl of first strand cDNA per well of a Clear 96-well PCR plate on ice.
Reactions were briefly mixed and centrifuged using a benchtop plate centrifuge.
Each reaction mix was set up in triplicate and assay performed as described below in Step-one Plus Real-Time PCR Detection System:
76 § One cycle of initial denaturation and polymerase activation at
95°C for 30 seconds.
§ 40 cycles of denaturation at 95°C for 15 seconds followed by
annealing and extension at 60°C for 30 seconds, with plate
read.
§ Final melt curve analysis from 65-95°C (+1°C increments, 5
seconds/increment) with plate read.
2.7.5.3 Comparative CT Method for the analysis of qPCR results The amplification plot and melt curve were viewed using the step one-plus software and gene expression analysed using excel template based on the
ΔΔCT (Livak) method. The method was implemented in excel in two steps.
Equation 3
ΔCT (Basal or PMP treatments) = CT (Target) – CT (Reference)
Equation 3.1
ΔΔCT = ΔCT (PMP treatments) – ΔCT (Basal)
The ΔΔCT was used for statistical analysis and represented as relative expression.
77 Table 2.7: List of standard primers for gene expression analysis.
Primer Forward/Reverse primer Sequence THBS-1 (Cui F- 5’ CCAGATCAGGCAGACACAGA 3' et al. 2015). R- 5’ TCACACTGATCTCCAACCCC 3' F- 5’ TGATCTCCCCTCACACTTTGC 3' PIGF R- 5’ CACCTTGGCCGGAAAGAA 3' ATF-4 (Nemetski and F- 5’ GACGGAGCGCTTTCCTCTT 3' Gardner R- 5’ TCCACAAAATGGACGCTCACC 3' 2007). F- 5’ TTGACCCGTAAATCTGAAG CTAAT 3' MCP-1 (Xu et R- 5’ al. 2016). TCACAGTCCGAGTCACACTAGTTCAC 3' GAPDH F- 5' ACAACTTTGGTATCGTGGAAGG (Wang et al. 3' 2015). R- 5’ GCCATCACGCCACAGTTTC 3'
78 Table 2.8: List of stem loop primers for miRNA expression analysis.
Primer Sequence 5’ Stem Loop 221 GTCGTATCCAGTGCAGGGTCCGAGGTATTCG CACTGGATACGACGAAACC 3' 5’ Stem Loop U6s GTCGTATCCAGTGCAGGGTCCGAGGTATTCG CACTGGATACGACTCACGA 3' 5’ Stem Loop let 7a GTCGTATCCAGTGCAGGGTCCGAGGTATTCG CACTGGAT ACGACAACTA 3' Universal Reverse miR 5’ AAAAAAAAAAGTGCAGGGTCCGAGGT 3' 5’ Has-miR 221 F AAAAAAAAAAGCCCGCAGCTACATTGTCTGCT
G 3' 5’ Has-miR U6s F AAAAAAAAAAGCCCGCCTGCGCAAGGATGAC 3' 5’ Has-let 7a F AAAAAAAAAAGCCCGCTGAGGTAGTAGGTTGT A 3'
79 2.8 Chromatin immunoprecipitation
Initial search for transcription factors that are indirectly targeted by Let-7a to increase the release of some angiogenic proteins revealed that ATF-4 is predicted target that can affect some of the proteins increased by PMP.
Therefore, binding of ATF-4 protein to the promoter regions of the increased protein through Let-7a mediated mechanism was explored. The simple CHIP immunoprecipitation assay kit (Cell signalling) was used to investigate the interaction between ATF-4-DNA at selected promoter regions of the increased proteins, stages of chromatin immunoprecipitation are summarised in Figure 2.6.
Physiologically, gene expression involves complex spatial and temporal relationship between transcription factors and gene promoter regions. Initiation or inhibition of gene transcription proceeds through transcription factors mediated regulation of Polymerase activity (Levine and Tjian 2003).
80
Figure 2.6: Schematic workflow of Chromatin Immunoprecipitation.
81 2.8.1 Cross-linking of proteins to DNA in PMP treated HUVEC HUVEC transfected with Let-7a inhibitor or with non-targeting inhibitor sequence
(1x106) were treated with 100μg/ml of PMP or buffer control for 24 hours.
Chromatin was cross-linked with 1% formaldehyde for 10 minutes at room temperature. Formaldehyde derived methylene bridge facilitates cross-linking of proteins to DNA by connecting the exocyclic amino and nucleophilic nitrogen or sulphur that are present in nucleoside and amino acids, respectively (Lu et al.
2010). The cross-linking was stopped by incubating the cells with 125mM glycine for 5minutes at room temperature. Media was removed before performing double washes with 20ml of ice-cold PBS. Cells were scraped into
2ml ice-cold PBS with protease inhibitor cocktail (1x), and centrifuged at 1,500 rpm for 5minutes at 4°C to pellet the cross-linked cells. The supernatant was removed and nuclei preparation was started immediately.
2.8.2 Nuclei Preparation and Chromatin Digestion To digest the DNA to approximately 150-900bp, 0.5μl of Micrococcal nuclease was mixed with the samples by repeated inverting. Chromatin digestion to 150-
900bp results in effective immunoprecipitation. Then, samples were incubated for 20minutes at 37°C with frequent mixing every 4minutes. Micrococcal nuclease preferentially cleave 5’ side of Adenine or Thymine to produce nucleotides with 3’ phosphates. Moreover, the enzyme also cleave double stranded DNA and RNA. The reaction was stopped with 10μl of 0.5M EDTA and centrifugation at 13,000 rpm in a micro-centrifuge for 1minute at 4°C to pellet the nuclei. The supernatant was removed and pellet resuspended in 100μl of 1X
ChIP buffer with protease inhibitor cocktail. The samples were incubated on ice
82 for 10minutes before sonication at 3 sets of 20-sec pulse to ensure homogenous digestion of chromatin (Ultra-Sonic). The samples were incubated for 30seconds on ice between pulses and nuclei lysis and investigated with light microscope.
The lysed nuclei were clarified by centrifugation at 10,000rpm for 10minutes at
4°C and cross-linked chromatin transferred to a new tube for immunoprecipitation using the antibodies in Table 2.9. Cross-linked chromatin was stored at -80°C until further use.
2.8.3 Analysis of Chromatin Digestion and Concentration For analysis of chromatin digestion and concentration, 50μl chromatin sample was mixed with 100μl nuclease-free water, 6μl 5M NaCl, and 2μl RNAse A, vortexed and incubated for 30 minutes at 37°C. The RNAse A digested sample was incubated with 2μl Proteinase K at 65°C for 2hours to degrade cellular proteins. Thereafter, the remaining DNA was purified as described before.
Purified DNA was assessed for fragmentation by electrophoresis on a 1% agarose gel with a 100bp DNA marker. Additionally, DNA concentration and purity was determined using Nanodrop. The concentration was measured at
260nm (RNA) and 280nm (DNA) in μg/ml and DNA purity was considered good at 260-nm/280 nm ratio of ~1.8 (Rodrigo et al. 2002). The DNA concentration was determined based on the equation:
83 Equation 4
WXY Z[\Z]\^_`^a[\ (\b/cd) = ef (\b/cd) g Yhif g Wadj^a[\ k`Z^[_
Where, 50ng of DNA per ml corresponds to absorbance reading of 1 unit at 260 nm.
2.8.4 Agarose gel electrophoresis to investigate the size of DNA Agarose gel electrophoresis was used to assess the quality of immuno- precipitated chromatin DNA, plasmid DNA or qRT-PCR amplicons. This established procedure allows for the visualization and purification of DNA based on size (in base pairs). The application of electrical field to agarose gel matrix moves the negatively charged DNA to a positive electrode at a rate dependent on size. 1% agarose (Fisher Scientific) gel was mixed in 100ml of 1x Tris-borate
EDTA (TBE) buffer (89mM Tris, 89mM boric acid, 2mM EDTA pH 7.6) and heated in a microwave for 2minutes. The mixture was cooled at room temperature for 5minutes before the addition of ethidium bromide (EtBr) to a final concentration of 0.5μg/ml. EtBr intercalates between the hydrophobic base pairs of DNA, whilst removing water molecules from ethidium cation. The increase in ethidium fluorescence because of this dehydrogenation process facilitates the visualisation of DNA under ultraviolet light. Thereafter, DNA samples were loaded on the casted gels and electrophoresed for 45minutes at
120 Volts. Visual analysis of the agarose gel was performed with the gel documentation system (G:Box).
84 2.8.5 Chromatin Immunoprecipitation The digested chromatin from section 2.8.2 was diluted in immunoprecipitation buffer to a final volume of 500μl. 20μl of the diluted chromatin was transferred to a microfuge tube as the 4% input sample, and stored at -20°C until further use.
Thereafter, 480μl of the diluted chromatin was transferred to a 1.5 ml micro- centrifuge tube and immunoprecipitation antibodies added as shown in Table
2.9.
Table 2.9: Immunoprecipitation antibodies and dilution factor.
Antibody Source Dilution Reference
Histone H3 Rabbit 1:10 Positive control
Normal Rabbit Rabbit 1:50 Negative control IgG
ATF-4 Rabbit 1:50 Target
Immediately after incubation, 30μl of Protein G Magnetic Beads were added to each immunoprecipitation (IP) reaction and incubate for 2hours at 4°C with rotation. In a magnetic stand, the protein G magnetic beads were pelleted and supernatant removed. Then, three consecutive wash with 1ml of low salt solution and high salt solution at 4°C for 5minutes with rotation was performed to remove unbound DNA fragments. Both wash was repeated twice before placing the tubes on a magnetic stand to pellet the beads, and supernatant removed.
85
2.8.6 Elution of Chromatin and Reversal of Cross-links and DNA purification Briefly, 150μl of the 1X ChIP Elution Buffer was added to the 4% input sample tubes collected before in section 2.8.5 and kept at room temperature. IP sample was mixed with 150μl of the 1X ChIP Elution Buffer before eluting the chromatin from the antibody/protein G magnetic beads for 30minutes at 65°C with periodic mixing every 2minutes. Thereafter, the tubes were placed on magnetic stand to pellet the beads, and eluted chromatin supernatant collected to a new tube. The
DNA-protein cross-link was reversed in both the 4% input sample and IP samples with 6μl 5M NaCl and 2μl Proteinase K for 2 hours at 65°C.
Immediately after reversing the cross-links above, 750μl of DNA binding buffer was added to the DNA samples and the 4% input sample, vortexed and poured into a DNA binding column placed in a cap-less wash tube and centrifuged for
30 seconds at 14000rpm. Flow through was discarded and column washed with
700μl of DNA wash buffer for 30seconds at 14000g. DNA binding column was dried with further 30seconds centrifugation at 14000g, and transferred to a nuclease-free 1.5ml microfuge tube. Then, the purified DNA was incubated with
40μl of DNA elution buffer for 1minute at room temperature and eluted with centrifugation for 1 minute at 14000g. The DNA samples were stored at -80 oC before qRT-PCR analysis.
2.8.7 qRT-PCR for Chromatin Immunoprecipitation qRT-PCR reactions were set up for enrichment analysis of promoter regions of
MCP-1 and PIGF using Fast SYBR® Green Master Mix (Applied Biosystems),
86 primer sets are summarised in table 2.10. Briefly, reaction master mix (MMs) were prepared according to the following scale, 2x Fast SYBR® Green Master
Mix (10μl), forward and reverse primers (500nM each) in 2μl, nuclease-free water (up to 20μl) and 2μl of CHIP per well of a Clear 96-well PCR plate on ice.
Reactions were briefly mixed and centrifuged using a benchtop plate centrifuge.
Each reaction mix was set up in triplicate and assay performed as described below in Step-one Real-Time PCR Detection System:
§ One cycle of initial denaturation and polymerase activation at
95°C for 30 seconds.
§ 40 cycles of denaturation at 95°C for 15 seconds followed by
annealing and extension at 60°C for 60 seconds. This step
include plate read.
§ Final melt curve analysis from 65-95°C (+1°C increments, 5
seconds/increment) with plate read.
2.8.7.1 Percentage input, comparative CT method The CT of the input samples were normalised before evaluating the percentage enrichment.
Equation 5
ΔCT = CT (IP) - CT (Input) - Log2 (Input Dilution Factor).
Where, ΔCT (normalized to the input samples) for basal or PMP treatment.
87 Equation 5.1
l\mj^ Wadj^a[\ n`Z^[_ = n_`Z^a[\ [k ^o] a\mj^ Zo_[c`^a\ × l\mj^ radj^a[\ k`Z^[_ s]k[_] tuvw.
Here, 20μl of Input chromatin and 480μl IP equates to 24 times fractions. For qRT-PCR runs Input was diluted 1.5 times, input dilution factor was 24 x 1.5 =
36.
Therefore,
• Equation 5.2
ΔCT = CT (IP) - CT (Input) - Log2 (48).
• Equation 5.3
Input % = 100/2 ΔCt (normalized ChIP)
Where, Input % value represents the enrichment of each promoter per PMP treatment. The amplicon was collected and assed by 1% agarose gel electrophoresis.
Table 2.10: List of promoter region primers.
Primer Sequence 5' AAAACCCGAAGCATGACTGG MCP-1 3' 5 GCCATCACGCCACAGTTTC 3' 5' CTAGGGGTGTGGGCATGG 3' PIGF 5' CATCCAGGAGTCCAGCGTC 3'
88 2.9 RNA sequencing
RNA sequencing was used to explore the RNA content of PMP from healthy donors including miRNAs, mRNAs and long-noncoding RNAs. Total RNA was extracted as described before and sequenced at the Next Generation
Sequencing facility (Leeds Institute of Molecular Medicine, Saint James’s
University Hospital). The sequencing was and bioinformatics analysis was performed as summarised in Figure 2.7 by Dr Saly Harrison at the University of
Leeds.
Figure 2.7: RNA sequencing work flow.
89 2.9.1 Analysis of RNA sequencing data Initial alignment of RNA sequence shorts reads, transcript counts and normalisation were performed by the sequencing facility. Thereafter, the normalised transcript counts contained in excel was visualised using R and functional clustering analysis performed using David bioinformatics tools at https://david.ncifcrf.gov and KEGG pathway platform (through NCBI:
Biosystems). The top highly expressed miRNAs were extracted from the normalised data and used to generate extensive list of predicted mRNA targets.
The targets were analysed for functional cluster using David bioinformatics tool.
2.10 Computational approaches
For primer design, the target cDNA was obtained from https://www.ncbi.nlm.nih.gov, and exported to http://bioinfo.ut.ee/primer3/ for design of appropriate primer sets. For miRNA profiling and target search several databases were investigated including http://www.mirbase.org http://mirmap.ezlab.org/app/ and http://www.microrna.org. The primers used for the analysis of promoter region were designed as described below. First, the functions, genomic location, expression and profile of the genes of interest were investigated on http://www.genecards.org, then the link to Ensembl: under
External Ids was used to identify the DNA sequence. Thereafter, the whole promoter region including the first exon was copied to the UCSC website at http://genome.ucsc.edu/cgi-bin/hgBlat?command=start. From the graphical view, the sequence link was followed and the genomic sequence was investigated, with the exons in capitals and 3000 base pairs of the promoter sequence extracted. The promoter region was identified and filtered down to the
90 location with potential ATF-4 or CREB binding consensus before primer design using the primer3 website.
2.11 Statistical Analysis
The results are expressed as mean ± standard error of mean. Differences among more than two experimental groups were analysed using ANOVA analysis. The significance of differences between groups was assessed by
Tukey SD post hoc test, as indicated in figure legends and variance in mean assessed by Independent samples Kruskal-Wallis Test. For comparisons between two experimental groups, the student T-test was used. Significance was defined for a p value of <0.05. The statistical analysis was performed using
IBM SPSS statistics v22 software (IBM, International Business Machines Corp) or R programme (R Studio) and graphs plotted in GraphPad PRISM 6
(GraphPad Software Inc, United States).
91 CHAPTER 3: PMP REGULATE ENDOTHELIAL CELL FUNCTION THROUGH
RNA
3. Introduction
The central aim of this project was to investigate the role of miRNA regulated mechanisms in PMP stimulated angiogenesis. Angiogenesis plays an important role in wound healing (Zampetaki et al. 2008), while in cardiovascular diseases
(CVD) it may destabilise atherosclerotic plaque and increases the risk of thrombosis (Virmani et al. 2005). A large range of miRNAs have been identified in PMPs (Diehl et al. 2012c), and have been shown to be delivered to endothelial cells (EC) (Laffont et al. 2013). Importantly, PMPs are significantly elevated in areas where platelets are activated, such as atherosclerotic plaques.
Given the known regulatory functions of miRNAs in angiogenesis, we hypothesised that PMP delivered miRNA is a key regulator of angiogenesis.
3.1 Platelet Characterisation
In the first instance, the ability to isolate a pure platelet population using the method described in chapter 2 was determined. This was important as other blood cells can release MPs, though in much lower quantities their contribution in the pool of the isolated PMPs required exclusion. Following isolation of platelets from venous blood by differential centrifugation (Laffont et al. 2013,
Lagarde et al. 1980), cells were incubated with an anti- CD41a (Integrin αIIb),
CD41a is a surface marker for platelets, and were analysed by flow cytometry.
92 Flow cytometry analysis showed that the platelet suspension contained single population of cell cluster (Figure 3.1). The analysis also showed that approximately 99.5% of all the events counted by the cytometer were positive for CD41a staining, which suggested that the isolation method yielded pure platelet population. The high purity (99.5%) of platelets in the samples analysed by flow cytometer excluded significant contamination by other cells. Therefore, the platelet isolation method was suitable for subsequent PMP isolation.
93
Figure 3.1: Characteristics of isolated platelets. Isolated platelets (40000 cells in 100μl of PBS) were incubated with 20μl of APC-labelled anti-CD41a or IgG isotope control (20μl/ml) for 30 minutes in the dark at room temperature. The flow cytometer was gated for side scattering against forward scattering, and CD41a bound platelets. Images represents: (A) Dot plot of side scattering against forward scattering; Region R2 represents events used for further analysis and region outside R2 represents instrument noise and buffer debris. (B) R2 histogram of event counts against APC-labelled CD41a staining; Region R4 represents platelets (events positive for CD41a), accounting for 99.5% of total events. (C) Dot plot of IgG isotope control against forward scattering of platelets showing the size of platelets (D) Dot plot of APC-labelled CD41a against forward scattering of bound platelets showing the size of platelets. All data shown are Log of events counted.
94 3.2 Characterisation of platelet micro-particles
Consistent isolation of PMPs was central to this research project; hence the ability to isolate PMPs with similar surface markers and of the same size using the methods described in chapter 2 was determined. Determining the surface expression markers and physical characteristics of PMPs was crucial because platelets also release exosomes, granules and apoptotic bodies (Italiano et al.
2008, Théry et al. 2009), which differ in size and are known to contain different class of biomolecules. Therefore, the inclusion of non-PMP cellular bodies could elicit different biological effects on EC.
3.2.1 Differentiation of platelet micro-particles using surface markers Micro-particles (MPs) have been shown to express surface proteins inherited from their parent cells (Ratajczak et al., 2006, Burnier et al., 2009), which can act as a marker of origin. PMPs express CD31 (PECAM), a non-specific surface marker expressed by platelets, EC and other types of MP. They also express
CD41a, a specific marker for PMPs and platelets that is inherited from parent megakaryocytes. Since the expression of both CD31 and CD41a by PMPs is heterogeneous, both markers were used to show that the sample contained
PMPs. In addition, MPs from all cells expresses phosphatidylserine, which binds to Annexin V and differentiates debris from particles (Freyssinet, 2003).
Phosphatidylserine is a phospholipid membrane protein that is exposed during
MP formation. To ensure that our sample suspensions contained MPs rather than other vesicles, we gated for the reported size of PMPs (0.1–1.0μm)
(Heijnen et al., 1999), then determined the expression of platelet markers.
95
The MP suspension was incubated with an anti-CD41a, Annexin V or anti-CD31 antibodies and analysed by flow cytometry. In three independent analyses,
22.18% of the total events were CD41a positive, highlighting the presence of the platelet specific marker (Figure 3.2B). The expression of platelet’s surface markers by PMPs is highly heterogeneous and depends on the activation mechanisms of platelet (Perez-Pujol et al., 2007), which is supported by the negative events counted. Further analysis for Annexin V and anti-CD31 binding, which are both ubiquitous MP markers, showed that 93% of the events captured by the flow cytometer were positive for Annexin V and 100% positive for CD31
(Figure 3.3A), thus the CD41a negative events recorded in (Figure 3.2) were also MPs. Together, these results confirmed that platelets release a heterogeneous population of PMPs following thrombin activation, which is line with the data from other studies (Perez-Pujol et al., 2007).
96
Figure 3.2: CD41a characterisation of platelet’s micro-particles. Isolated PMPs (100µg/ml) were incubated with APC-labelled anti-CD41a or IgG isotope control (2µg/ml) for 30 minutes in the dark at room temperature. The Flow cytometer was first gated to PMPs specific size (0.1–1.0 μm), then gated for side scattering against forward scattering, and anti-CD41a binding. (A) Dot plot of side scattering against forward scattering; Region R2 represents events used for further analysis and region outside R2 represents instruments noise and buffer debris. (B) R2 histogram of event counts against APC-labelled CD41a; Regions R1 and R4 represents MPs of platelet origin, accounting for 23.18% and 21.33% of total events, respectively. (C) R2 dot plot of APC-labelled CD41a against forward scattering; Regions R3 represents MPs of platelet origin, accounting for 21.25% of total events. All data shown are Log of events.
97
Figure 3.3: Annexin V and CD31 characterisation of platelet micro- particles. A. Isolated MPs were incubated with FITC-labelled Annexin V or IgG isotope control for 30 minutes in the dark at room temperature and analysed by flow cytometry. Flow cytometer was gated for side scattering against forward scattering, and Annexin V binding. Representative histogram of event counts against FITC-labelled Annexin V; Region R5 represents Annexin V negative events and region outside R5 (blue histogram) represents 90% of MPs. B. Isolated MPs were incubated with APC-labelled anti-CD41a and FITC-labelled anti-CD31 for 30 minutes in the dark at room temperature and analysed with flow cytometer. Flow cytometer was gated for side scattering against forward scattering and anti-CD41a binding. Dot plot of APC-labelled anti-CD41a against FITC-labelled anti-CD31; Regions R9 represents MPs positive for anti-CD31, accounting for 98.1% of total events, and region R7 represents MPs positive for ant-CD41a and anti-CD31, which accounts for 1.8% of all events.
3.2.2 Protein quantification of platelet micro-particles The protein concentration of the PMP sample was determined by the Bradford protein assay using a Bio-Rad assay kit (Lan Zhang et al. 2014). Determination of protein concentration facilitated the use of set PMP amounts in future experiments. The data showed that the protein content of our PMPs suspensions differed, ranging from 0.24μg to 1.07mg/ml (Table 3.1). The
98 platelet counts on the samples before isolation of PMPs showed similar numbers of cells, which did not affect the protein concentration of PMPs (Table
3.1 and Figure 3.4). This data would suggest that some platelet samples more readily produce PMPs as reported by others (Morel et al. 2011).
1.4
1.2 y = 0.404x + 0.3625 R² = 0.99677 1 0.8 0.6 0.4 0.2 Absorbance OD 595 nm 0 0 0.5 1 1.5 2 2.5 Concentration mg/ml
Figure 3.4: Representative standard curve for Bradford protein quantification assay. OD 595 corrected to the blank absorbance. The slope equation was used to quantify protein concentration. Blue points represents absorbance for the concentration of standards.
Table 3.1: Representative absorbance at OD 595 and protein concentration of PMPs samples.
Platelet Count Sample ID Mean Absorbance Concentration mg/ml Cells/ml 7100 0.46 0.24 9 x 106 7103 0.794 1.07 8.7 x 106 7101 0.574 0.52 3 x 106
99 3.3 Quantification of PMP bound cytokines
To begin to understand the characteristics of PMPs that may influence their ability to regulate EC, the cytokine profile of PMPs was investigated. In addition to the expression of specific surface markers, several cytokines remain bound to the receptors on PMPs (Théry et al. 2009). The presence of 36 cytokines was investigated by detecting surface bound cytokines on PMP. Equal volumes of 20 biological replicates of PMP samples were pooled to 100µg/ml and measured by the human cytokine array panel A kit (R&D). The results showed that 12 different cytokines were bound to PMP (Figure 3.7) including: serpin E1,
RANTES, CD40 Ligand, complement component 5a (C5/C5a), GROa, soluble intercellular adhesion molecule-1 (sICAM-1), interleukin (IL)-16, IP-10, macrophage migration inhibitory factor (MIF), interferon-inducible T-cell alpha chemoattractant (I-Tac) (.3), IL-1 receptor antagonist (rA) and IL-13 (217.8)
(Figure 3.5). Functional analysis on Uniprot website (http://www.uniprot.org) revealed potential biological and molecular functions. These functions could be related to PMPs release and activity, including functions in cell-cell adhesion and signalling, platelet activation and degranulation, chemotaxis, migration and exocytosis, the functional effect of the top 6 protein on PMP surface are summarised in Table 3.2.
100
Figure 3.5: Protein array images showing binding of proteins present on the surface of PMPs. A) Protein array image showing proteins bound on the surface of PMPs. B) Quantitative data of pixel density expressed in pixels. Data shown are mean ± standard error of mean, n=4 technical measures of pixel density in each group and n=20 biological samples of healthy PMPs. The green highlights represent the postive control spots, while the red highlight shows the negative control spots.
101 Table 3.2: List of potential processes modulated by proteins bound on PMP surface. CD40L MIF ICAM-1 RANTES C5/C5a Inflammatory Y Y Y Y Y response
Cell-cell Y Y Y adhesion Platelet Y Y activation Migration Y Chemotaxis Y Viral receptor Y Y activity
102 3.3.1 Quantification of PMP’s RNA content by Illumina RNA Sequencing To further characterise the content of PMPs that could play a role in the regulation of EC, their RNA content was analysed using Illumina RNA sequencing (n=3). This analysis revealed the presence of more than 50000 RNA transcripts including mRNA, long non-coding RNA and miRNA. Specifically, the analysis revealed 836 miRNAs, with a clear high expression of Let-7 miRNA family members that accounted for most of the top 25 miRNAs transcripts in the analysed PMP (Table 3.3). Therefore, we hypothesised that at least a fraction of the PMPs mediated regulation of cellular process is represented by the Let-7 miRNA members. In theory, members of the Let-7 family have the capacity to regulate translation of many mRNAs and indirectly regulate the functions of transcribed mRNAs.
Table 3.3: List of Top highly expressed miRNAs in PMP. 1st Top 10 2nd Top 3rd Top 5 10 hsa-let-7f-2 hsa-mir- hsa-mir-21 3184 hsa-let-7f-1 hsa-mir- hsa-mir-127 92a-1 hsa-let-7i hsa-mir- hsa-mir-222 320a hsa-let-7g hsa-let-7b hsa-let-7e hsa-mir-486-1 hsa-mir- hsa-mir-4433b 92a-2 hsa-mir-486-2 hsa-mir- 584 hsa-let-7a-1 hsa-let-7d hsa-let-7a-3 hsa-mir-151a hsa-let-7a-2 hsa-mir- 744 hsa-mir-423 hsa-mir- 30d
103 Next, to understand the potential functions of these highly-expressed miRNAs in
PMP, we extracted the predicted mRNA targets for the top 25 miRNAs (Table
3.3) using TargetScan. The strongly predicted mRNAs targets was analysed with DAVID bioinformatics functional analysis tool to investigate potential regulatory targets. The analysis revealed that functional networks with the highest enrichment scores were cytoplasm, nucleus, transcription and transcription regulation (Figure 3.6). The analysis revealed a potential contribution in the pathogenesis of CVD. Specifically, the results revealed the enrichment of metabolic, cardiovascular, neurological, and renal diseases related processes (Figure 3.7).
%
Transcription Disease mutation regulation DNA-binding
Transcription Secreted
Methylation Developmental protein
Cytoplasm Lipoprotein Cell junction Kinase
Nucleus Other
Figure 3.6: Relative group functions of predicted mRNA targets for the top 25 highly expressed miRNAs in PMP. The Pie chart is proportional to enrichment scores.
104
%
NEUROLOGICAL DEVELOPMENTAL
RENAL
OTHER
METABOLIC
CARDIOVASCULAR
PSYCH UNKNOWN
Figure 3.7: Relative group disease association of predicted mRNA targets of top 25 highly expressed miRNAs in PMP. The Pie chart is proportional to enrichment scores.
Next, we investigated the biological, cellular and molecular functions of these predicted mRNA targets for the top 25 miRNAs in PMPs. The results showed potential regulation of several biological process including angiogenesis, proliferation, cell-cell adhesion and aging (Appendix: Table 3.4), which are linked to progression and athero-thrombosis leading to CVD, renal complications, neurological complications and metabolic conditions. Finally, we investigated the enrichment of molecular pathways and the enrichment of corresponding molecular functions. The results showed that pathways in cancer
105 (potentially due to the role of angiogenesis in cancer), MAPK signalling pathway,
Ras signalling pathways cytokine-cytokine receptor pathways, and VEGF signalling pathways were significantly enriched. The importance of these pathways in angiogenesis are well described and support the role of PMP- derived miRNA in pathologic angiogenesis. Indeed, the molecular functions mediating the link between these pathways and angiogenesis where significantly enriched including protein C activity, cytokine activity, and interestingly miRNA binding suggesting a potential functional loop (Appendix: Table 3.6). In conclusion, the RNA sequencing results show that PMP derived miRNAs might target key EC proteins to modulate pathways that are linked to proliferation, adhesion, sprouting and chemotaxis.
3.4 PMP induce robust angiogenesis in EAhy926 cells
Initially we wished to determine if PMPs induce angiogenesis and if this might depend on miRNA transfer. EAhy926 cells, 3 x 104 cells per well, seeded on
Matrigel were treated with 10% serum (as a positive control), serum free media or 25μg/ml – 100μg/ml PMPs in serum free medium, for 18 hours. Angiogenesis was assessed by measuring tube length and the number of branch points (Jung et al. 2015, Lee et al. 2015, Wilson et al. 2015), and quantified fluorescent images with AngioTool software. Incubation with 25μg/ml – 100μg/ml PMPs caused a significant increase in angiogenesis (Figure 3.8) compared to basal level. The lowest concentration of PMPs (25μg/ml) significantly increased tube formation to 6256μm (Figure 3.8A) and branching to 11 (p<0.05) (Figure 3.4B).
106 While further increase in tube length (8376μm) (Figure 3.6A) and branching (14)
(p<0.05) (Figure 3.8B) were achieved with (100μg/ml) PMP treatment.
Figure 3.8: PMP mediated tube formation and sprouting by EAhy926 in- vitro. EAhy926 cells 3 x 104 cells per well seeded on ECM matrix were treated with 10% serum, serum free media or 25μg/ml – 100μg/ml PMPs in serum free media, for 18 hours. Angiogenesis tubes were captured with a florescent microscope and data quantified with AngioTool software. A) Quantitative data of total tube length expressed in μm and B) Quantitative data of total number of branching. Data shown are mean ± standard error of mean, n=3 in each group. *P<0.05 ANOVA, for PMP treatment compared with the basal level. (C) Representative photomicrographs (×40 magnification) showing extracellular matrix gel-based, capillary-like tube formation by human EAhy926 cells.
107 3.5 PMP induced angiogenesis in EAhy926 cells is dependent on RNA transfer
Since the results from the angiogenesis experiments showed that treatment with
PMPs increased in-vitro angiogenesis by EAhy926, we investigated the role played by PMPs-RNAs by RNAse treatment, which was a first step towards investigating the transfer of miRNAs by PMPs.
3.5.1 RNA Degradation To determine if the induction of angiogenesis by PMPs were RNA dependent, we degraded total RNA in PMPs suspension by treating the samples with
RNAse (Laffont et al. 2013). Before incubation of EAhy926 with RNA free PMPs, it was critical to investigate the potency of RNAse-A in degrading PMP’s total
RNA. Trizol reagent was used to isolate total RNA from PMPs treated with
RNAse and non-treated PMPs. The concentration of RNA was determined by spectrophotometric analysis using Nanodrop. RNAse treatment caused complete degradation of RNA in PMPs solution compared to untreated PMP
(p<0.001) (Figure 3.9).
108
Figure 3.9: RNAse degradation of total RNA in PMPs. Representative RNA extraction result, total RNA was isolated from PMPs treated with RNAse and non-treated PMPs using TRIzol reagent and total RNA concentration quantified with spectrophotometer. Data shown are mean concentration (μg/ml) ± standard error of mean, n=3 in each group.
3.5.2 Degrading PMP RNA reduces their pro-angiogenic effect on EAhy926 cells Next, the effect of degrading total PMP-RNA on induced angiogenesis was investigated as described before. EAhy926 cells 3 x 104 cells per well were treated with 100μg/ml PMPs treated with RNAse (1U/ml) or untreated in serum free media, for 18 hours and angiogenesis assessed. RNAse treatment did not reduce PMP stimulated tube length in EAhy926 but significantly decreased sprouting (Figure 3.10) compared to complete 100μg/ml of PMPs. The PMPs treated with RNAse increased tube formation to 7328μm (p<0.05) (Figure 3.10A) and reduced branching to 11 compared to untreated PMPs (p<0.05) (Figure
3.10B). The data suggest that PMPs-RNAs is associated with sprouting but not tube formation in EAhy926.
109
Figure 3.10: PMP mediated EAhy926 sprouting is associated with PMP- RNAs. EAhy926 cells (3 x 104 cells per well) seeded on ECM matrix were treated with 10% serum, serum free media or 100μg/ml PMPs in serum free media, for 18 hours. Angiogenesis was measured using an in-vitro tube formation assay kit and data quantified with AngioTool software. A) Quantitative data of total tube length expressed in μm and B) Quantitative data of total number of branching. Data shown are mean ± standard error of mean, n=3 in each group. *P<0.05 ANOVA, total tube length or branching between untreated PMPs and RNAse treated PMPs. (C) Representative photomicrographs (×40 magnification) showing extracellular matrix gel-based, capillary-like tube formation of EAhy926 cells incubated in: EC) serum free medium (EC+) 10% serum (EC+PMP) in the presence of 100μg/ml of PMPs and (EC+PMP+RNAse) 100μg/ml of PMPs with RNAse in serum free medium, respectively.
110 3.6 PMPs modulate the production of angiogenic cytokines by EAhy926 cells
Having demonstrated that PMPs increased angiogenesis, we began to assess potential mechanisms. As a start point, we investigated the effect of PMPs on
EAhy926 release of cytokines and growth factors known to modulate angiogenesis. Cytokine release was measured by the Human angiogenesis proteome profiler array kit (R&D) (Santhekadur et al. 2012).
3.6.1 PMPs causes differential release of angiogenic cytokines by EAhy926 EAhy926 cells (2 x 104 cells per well) were serum starved for 24 hours before incubation in either 10% serum (as a positive control), serum free media or with
25μg/ml – 100μg/ml PMPs in serum free medium, (with prior RNAse or control treatment), for 18 hours. Conditioned media was removed and the presence of cytokines assessed. Treatment of EAhy926 cells with PMPs caused a significant increase in the releases of Interleukin-8 (IL-8), C-C motif chemokine 2 (MCP-1),
Platelet-derived growth factor- subunit-A (PDGF-AA), Platelet Factor 4 (PF4),
Placental growth factor (PIGF), Metalloproteinase inhibitor 1 (TIMP-1) and
Urokinase-type plasminogen activator (uPA) compared to cells cultured in serum free medium (p<0.05) (Figure 3.11). Furthermore, PMPs caused a significant reduction in the release of Endothelin-1 (p<0.05) compared to negative controls
(Figure 3.11). The data also suggests that there could be a concentration dependent effect, because treatment with 25μg/ml of PMPs caused a significant increase in the release of cytokines highly increased in 100μg/ml of PMPs treatment, including significant increase in the release of PF4, PIGF, and uPA
111 when compared to basal levels (Figure 3.11). RNAse treatment of PMPs caused a significant decrease in their ability to stimulate the release of MCP-1, PDGF-
AA, PF4, PIGF, TIMP-1 and uPA by EAhy926 cells compared to control PMPs
(p<0.05) (Figure 3.11B). The 100μg/ml of PMPs treated with RNAse also caused a significant increase in the release of Serpin F1 and Thrombospodin-1
(p<0.05) compared to 100μg/ml of PMPs treatment (Figure 3.11).
112
Figure 3.11: PMPs causes differential release of angiogenic cytokines by EAhy926 through RNA dependent mechanims. Protein array images showing binding of proteins present in EAhy926 cell culture supernatents in: A-I) absent of serum (A-II) 100μg/ml of PMPs, and (A-III) in the presence of 100μg/ml of PMPs with RNAse. Quantitative data of pixel density expressed in pixels (B). Data shown are mean ± standard error of mean, n=3 in each group. *P<0.05 Tukey SD individual protein expressions between basal levels and 100μg/ml of PMPs, between PMPs and PMPs with RNAse. The arrow head indicate the direction of the comparison. The green highlights represent the postive control spots, while the red highlights shows the negative control spots.
113 3.7 Effect of platelet micro-particles on EAhy926 cell proliferation
Our data demonstrate that PMPs increase angiogenesis and modulate cytokine release from EAhy926, partly through transfer of RNA (potentially miRNA). We next investigated the effect of PMPs on EAhy926 cell proliferation because proliferation is a further step in angiogenesis.
3.7.1 Optimisation of proliferation assay CellTiter-Glo was used to measure EC proliferation (Thoreen et al. 2009). In the first instance, we confirmed the sensitivity of the reagent by measuring increasing numbers of cells (1000, 2000, 4000, 8000 cells per well). The luminescence values showed a linear relationship with cell number. A concentration of 2000 cells/well seems to have optimal luminescence value
(Figure 3.12) whilst not being so confluent that further growth would not occur.
Hence, 2000 cells were used for subsequent experiments.
Figure 3.12: Cell number correlates with luminescent values. Representative graph of CellTiter-Glo specificity test for EAhy926 cells. Cells were plated in 96 well plates at (1000, 2000, 4000, 8000 cells per well) and incubated with CellTiter-Glo reagent. Luminescence signal was measured using plate reader and plotted aginst cell number.
114 3.7.2 Optimisation of serum concentration Initial attempts to use serum free medium for the proliferation assay resulted in cell death (data not shown). Hence, we performed optimization experiments to determine the concentration of serum that will allow EAhy926 cells to remain viable without inducing robust proliferation. This control experiment allowed us to determine if PMPs can induce proliferation. EAhy926 cells (2000 cells/well) were cultured in different concentrations of serum (0-, 10%) for 72 hours and proliferation was measured by CellTiter-Glo kit. EAhy926 cells cultured in less than 0.5% serum did not survive to 72 hours (luminescence values of 100)
(Figure 3.13), but EAhy926 cells cultured in 1% to 10% serum survived for 72 hours, with luminescence values of 20000, 18300 and 30000, respectively compared to 10000 at time 0 (Figure 3.14). EAhy926 cells cultured in 1% serum had proliferation rates that were lower than EAhy926 cells cultured in 10% serum, which were 17232 in 1% serum and 22000 in 10% serum at 48 hours
(Figure 3.13). The data suggests that further experiments using 1% would allow cells to grow within the range that is suitable to detect any change caused by
PMP treatment.
115
Figure 3.13: Optimization of CellTiter-Glo assays using different concentration of serum. EAhy926 cells (2000 cells/well) were incubated in different concentrations of serum (0.5%, 1%, 5% and 10%) or serum free medium for 72 hours and cell numbers was quantified every 24 hours. Data shown are mean luminescence ± standard error of mean, n=1 for no serum, 0.5% serum and 5% serum, and n=2 for 1% serum and 10% serum.
116 3.7.3 Effect of platelet micro-particles on EAhy926 proliferation Optimisation experiments showed that 1% serum could sustain EAhy926 cell survival, without inducing strong proliferation. To determine if PMPs can induce long-term EC proliferation, EAhy926 cells (2000 cells per well) were incubated with either 10% serum (positive control), 1% serum (as basal level) or with
25μg/ml - 100μg/ml PMPs in 1% serum, and proliferation was quantified luminescently. The result show no significant effect on luminescence signals.
After 48-hours incubation, treatment with 25μg/ml or 100μg/ml PMPs seems to increase EAhy926 proliferation with luminescence values of 13300 and 12340, respectively compared to the basal level with luminescence value of 8201
(Figure 3.14). However, treatment with 25μg/μl or 100μg/ml PMPs seems to reduce EAhy926 cell proliferation after 24 hours at 20000 and 18560, respectively, compared to the basal level at 23129 (Figure 3.14). Generally, there seems to be no difference in EAhy926 proliferation before 24 hours, while
PMPs seems to sustain cell survival after 24 hours (Figure 3.14).
117
Figure 3.14: Effect of PMPs on EAhy926 proliferation. Proliferation of EAhy926 cells in the presences of 1% serum (negative control), presence of 10% serum (positive control), and in the presence of 25μg/ml or 100μg/ml of PMPs were incubated with CellTiter-Glo reagent and Luminescence measured with a plate reader. Data shown are mean luminescence ± standard error of mean, n=3 in each group.
To confirm these proliferation results, viability assay was conducted with the trypan blue assay. EAhy926 cells were incubated in 10% serum (positive control), 1% serum (basal level) or with 25μg/ml – 100μg/ml PMPs in 1% serum and cell number counted. The result show no significant effect on cell number.
After 24-hours incubation, treatment with 25μg/ml or 100μg/ml PMPs seems to
118 decrease proliferation with cell numbers of 3432 and 2100, respectively (Figure
3.15) compared to negative control (3123). Furthermore, after 48 hours and 72 hours the cell number reduced even further to (48 hours; 25μg/ml: 3310,
100μg/ml: 2231 compared to basal level: 6821, 72 hours; 25μg/ml: 4210,
100μg/ml: 2612 compared to basal level (7129). PMPs seem to fairly reduce cell number in a time dependent manner (Figure 3.15), but the results were not significant within the same time point.
Figure 3.15: Effect of PMPs on Eahy926 cell number. Proliferation of Eahy926 cells in the presences of 1% serum (negative control), presence of 10% serum (positive control), and in the presence of 25μg/ml or 100μg/ml of PMPs trypsinised and counted using haemocytometer. Data shown are mean cell number ± standard error of mean, n=3 in each group.
119 3.8 Effect of platelet micro-particles on HUVEC angiogenesis
Having optimised the angiogenic effects of PMPs using Eahy926, we wished to assess these responses in primary HUVECS. The differences between immortalised cell lines and primary cells including genetic and signalling differences are well documented. Indeed, the transformation of cell lines to achieve sustained and increased growth requires significant modifications to several molecular profile and function (Lidington et al. 1999). A study showed differences in signalling mechanisms between different types of endothelial cells, which suggests that EAhy926 cells might respond differently to PMP treatment compared to primary HUVEC cells (Boerma et al. 2006). Moreover, genome wide analysis of HUVEC and EAhy926 cells treated with similar amount of atorvastatin showed 103 differential expressed genes in HUVEC compared to
466 genes in EAhy926. Therefore, we determined the effect of PMPs on
HUVEC angiogenesis and mapped the extent of the differences between the two cell types.
3.8.1 PMP induced angiogenesis response by HUVEC The effect of PMP and RNAse treated PMPs on angiogenesis was measured using Matrigel assays. HUVEC (3 X104 cells/well) were cultured with Medium
200 supplemented with 1% serum, 100μg/ml PMPs or RNAse treated PMP in
1% serum, for 18 hours. The angiogenesis potential was assessed by measuring tube length and the number of branch points (Jung et al. 2015, Lee et al. 2015, Wilson et al. 2015), and fluorescent images were quantified with
Angiotool. Incubation of HUVEC with PMPs caused a significant increase in
120 angiogenesis (Figure 3.16) compared to basal level. Treatment with PMPs increased tube length to 29000μm (p<0.05) (Figure 3.16A) and branching to 150
(p<0.05) compared to basal level at 18000μm tube length and 98 branching.
Pre-treatment of PMPs with RNAse significantly decreased their ability to induce tube formation and tube length compared to the effect of untreated PMP,
19000μm tube length and 99 branching. However, HUVEC treated with RNAse degraded PMP showed both reduced tube length and branching (Figure 3.16B) compared to only reduced branching observed following treatment of EAhy926 cells with RNAse treated PMPs (Figure 3.10). This result suggests a potential role for the differences in signalling mechanisms between both types of EC.
121
Figure 3.16: PMP mediated angiogenesis in HUVEC is associated with PMP-RNAs. HUVEC cells (2 x 104 cells per well) seeded on ECM matrix were treated with 1% serum, 100μg/ml PMPs or PMPs treated with RNAse in Medium-200 supplemented with 1% serum for 18 hours. Angiogenesis was measured using an in-vitro Tube formation assay kit and data quantified with AngioTool. (A) Representative images (×40 magnification) showing extracellular matrix gel-based capillary-like tube formation of HUVEC cells incubated in: supplemented 1% serum (EC), in the presence of 100μg/ml PMPs (EC+PMP), in the presence 100μg/ml PMPs pre-treated with RNAse in 1% serum (EC+PMP+RNAse). (C) Quantitative data of total tube length expressed in μm and (B) Quantitative data of total number of branching. Data shown are mean ± standard error of mean, n=3 in each group. * P<0.05 ANOVA, total tube length and branch point between treatment group.
122 3.9 PMPs modulate the production of angiogenic cytokines by HUVECS
Having demonstrated that treatment with PMPs increased HUVEC angiogenesis and cell sprouting, the underlying molecular mechanisms was investigated.
Similar to the initial experiments on EAhy926, the effect of PMPs and RNAse treated PMPs on HUVEC’s release of cytokines and growth factors known to modulate angiogenesis was investigated by the human angiogenesis proteome profiler array kit (Santhekadur et al. 2012).
3.9.1 PMP induces differential release of angiogenic cytokines by HUVEC HUVEC cells (3 x 104 cells per well) were incubated in 1% serum for 24 hours.
Cells were then treated for 18 hours in Medium-200 with 1% serum, or 100μg/ml
PMPs (plus/minus prior RNAse treatment). Conditioned media was collected and analysed for the presence of cytokines using angiogenesis proteome array
(R&D). The data was quantified with ImageStudioLite and ImageJ (Version
5.2.5, by LI-COR Biosciences: National Institute of cancer). Treatment of
HUVEC with PMPs caused a significant increase in the release of C-C motif chemokine 2 (MCP-1), Platelet Factor 4 (PF4), Placental growth factor (PIGF),
Metalloproteinase inhibitor 1 (TIMP-1), Pentraxin 3, Endothelin-1, Endoglin,
Angiogenin, Angiopoietin-2, Insulin-like growth factor binding protein 3 (IGFBP-
3) and Serpin F1 protein compared to 1% serum treatment (p<0.05) (Figure
3.17). Furthermore, PMPs caused a significant reduction in the release of
Thrombospondin-1 and Serpin E1 (p<0.05) compared to basal level (Figure
3.18). Pre-treatment of PMPs with RNAse reduced the ability of PMPs to stimulate HUVEC release of MCP-1, PF4, PIGF, TIMP-1, Endothelin-1,
123 Endoglin, Angiogenin and IGFBP-3 (p<0.05) (Figure 3.17). HUVEC treated with
RNAse degraded PMPs significantly released higher levels of Thrombospodin-1,
EGF and IGFBP-2 (p<0.05) compared to HUVEC incubated with untreated
PMPs (Figure 3.17). Combined with the tube formation results, the differences in the profile of angiogenic proteins between HUVEC and EAhy926 resulted in the use of HUVEC for the remaining part of the project. Moreover, HUVEC is physiologically relevant in cardiovascular diseases compared to Eahy926.
124
Figure 3.17: PMPs induce cytokine release by HUVEC through RNA dependent mechanism. Protein array images showing binding of proteins present in HUVEC cell culture supernatants in: A-I) 1% serum, (A-II) 100μg/ml PMPs, and (A-II) 100μg/ml PMPs treated with RNAse. Quantitative data of pixel density expressed in pixels. Data shown are mean ± standard error of mean, n=4 technical measures of pixel density in each group and n=4 biological samples of PMPs. *P<0.05 Tukey SD individual protein expressions between untreated HUVEC and HUVEC treated with 100μg/ml PMPs, between HUVEC treated with 100μg/ml PMPs and 100μg/ml PMPs pre-treated with RNAs.The green highlights represent the postive control spots, while the red highlights shows the negative control spots.
125 3.10: Discussion
The endothelium plays an important role in maintaining vascular tone (Moncada et al. 1988) and haemostasis (Rubanyi 1993), as well as providing barrier functions (Verma and Anderson 2002). The healthy endothelium is quiescent
(Rubanyi 1993), but once activated by pathological conditions, endothelial cells
(ECs) express inflammatory mediators, adhesion receptors and release a range of cytokines and growth factors (Dzau and Gibbons 1991). Such changes causes an increase in angiogenesis and proliferation (Pober and Sessa 2007).
Increased angiogenesis combined with increased supply of nutrient to plaques can cause destabilisation of arteriosclerotic lesions, which is a common pathological features of CVD (Carmeliet 2003).
Upon activation by agonists produced at sites of vascular injury such as thrombin, which is often increased in CVD patients (Juhan-Vague et al. 2000,
Tregouet et al. 2009), platelets release large quantities of PMPs (Kahn et al.
1998). Consistently PMPs are elevated in the blood of patients with cardiovascular complications (VanWijk et al. 2003, Willis 2015). PMPs play a role in vascular damage through the modulation of pathogenic pathways in ECs
(Adrover and Hidalgo 2015, Coughlin 2000, George et al. 1986a, Undas et al.
2009) such as downregulating protective nitric oxide synthase expression and inducing inflammatory mediators such as interleukin-6, MCP-1, intercellular adhesion molecule-1, vascular cell adhesion molecule-1 and E-selectin, which promote signalling causing dysfunction (Barry et al. 1997). Co-incubation of ECs with PMPs in-vitro causes ECs proliferation and migration (Boilard et al. 2010a),
126 induces inflammation and promotes angiogenesis (Barry et al. 1997, Brill et al.
2005). These responses are all upregulated in CVD. However, the molecular mechanisms by which PMPs induce these changes, leading to the development and progression of athero-thrombosis, remain to be fully determined (Laffont et al. 2013).
We tested our hypothesis that the diverse miRNAs already identified within
PMPs, which can be transferred to ECs (Laffont et al. 2013) underpin this process. We show that treatment of EAhy926 and primary HUVEC cells with
PMPs caused increased tube formation and EC sprouting (Figure 3.6 and 3.8), confirming that PMPs can induce angiogenesis as previously shown (Kim et al.
2003). The observed angiogenesis in our experiments was equally comparable to levels induced by just whole platelets in-vitro (Brill et al. 2005), demonstrating a robust response, relevant to pathological conditions. The levels of MP in the circulation of healthy individuals ranges from 5μg/ml – 50μg/ml (Antwi-Baffour et al. 2010), which increases by more than 2-folds in CVD including hypertension, thrombosis and diabetes (Nomura et al. 2000, Nomura et al. 1995, Tan and Lip
2005). Therefore, PMP released during CVD is comparable to the concentration used in this study. The induction of angiogenesis by PMPs was significantly blocked by degrading the RNA content of the PMPs with RNase. Degrading of the RNA in PMPs increased PMPs induced tube formation but significantly reduced PMP induced sprouting in EAhy926 cells (Figure 3.11). However, in
HUVEC, the primary cells, both tube formation and branching was reduced by degrading RNA content of PMP (Figure 3.17). Because RNase treatment has
127 previously been shown to blunt the ability of PMPs to transfer miRNAs (Laffont et al. 2013), these data thus suggest a potential role for PMP-miRNA in the induction of angiogenesis and may contribute in the development of CVD. The differences in the responses elicited by PMP treatment of the EC line EAhy926 and primary HUVECs is likely due to the different cytokine and signalling signatures of these cell types, as described in the results section. We further investigated this response and the underpinning mechanisms by assaying the released angiogenic cytokine profile of both cell types before and after PMP treatment.
Our results show that PMPs caused the release of a distinct angiogenic protein signature from ECs. We found increased release of PIGF, TIMP-1, MCP-1, PF4,
IL-8, angiopoietin-2, Endoglin, IGFBP-2 and uPA in both EAhy293 and HUVEC
(Figure 3.9). Interestingly, PIGF, MCP-1, IL-8, uPA and angiopoietin-2 are pro- angiogenic in nature, but both TIMP-1 and PF4 have anti-angiogenic functions
(Gomez et al. 1997, Maione et al. 1990). THBS-1, a key anti-angiogenic protein, was reduced in HUVEC but remained largely undetected in EAhy926 cells.
Conversely, anti-angiogenic endothelin-1 was increased in HUVEC but reduced in EAhy926 cells. EAhy296 cells have undergone genetic transformation combining EC and fibroblast function to improve growth and survival (Edgell et al., 1990; Gifford et al., 2004; Unger et al., 2002). The genetic differences arising from this hybridization could result in different response to PMP treatment
(Edgell et al., 1990; Gifford et al., 2004; Unger et al., 2002).
128 Given the critical role played by cytokines in angiogenesis (Senger 1996), the induction of angiogenesis seen in our study is likely due to modulation of these released modulators by PMPs. IL-8 and MCP-1 both stimulate endothelial cell migration (Bhadada et al. 2011, Distler et al. 2003) by directly binding to the
CXCR1, and CXCR2 and CCR2 receptors, respectively to induce direct cell response (Salcedo et al. 2000). Migration is a key early step for angiogenesis.
MCP-1, a member of the chemokine superfamily, is additionally implicated in several cellular responses linked to CVD development, including inflammation, angiogenesis, atherosclerosis, and tissue remodelling (Deshmane et al. 2009).
The functions and the implications of increased MCP-1 release are discussed in
Chapter 5.
IL-8 belongs to the CXC family of chemokine, which has been shown to mediate angiogenic activity through CXCR2 binding (Addison et al. 2000).
Moreover, IL-8 is a potent mediator of inflammatory responses and a growth factor for ECs (Schraufstatter et al. 2001). Schraufstatter et al (2001) also showed that IL-8 activates the small G protein Rho and Rac signalling pathways through ECs CXCR receptor 1 and receptor 2 (Schraufstatter et al. 2001), enabling adhesion and leucocyte rolling. IL-8 also has been shown to increase endothelial MMP-2 and MMP-9 mRNA (Li et al. 2003), which once translated into protein, will increase the degradation of the extracellular matrix, promoting angiogenesis.
129 The increase in PIGF release is important because it is a member of the VEGF tyrosine kinase family, the archetypical angiogenesis regulators. There are different isoforms including PIGF-1, -2, -3 and -4, which all mediate their effect through VEGFR-1 (Ylä-Herttuala and Alitalo 2003). Data on the angiogenic effects of PIGF remains inconsistent however. Roy et al (2005) showed PIGF -
VEGFR-1 ligation had no effect on EC growth and angiogenesis (Roy et al.
2005), but Autiero et al reported that PIGF/VEGFR-1 signalling facilitates angiogenesis and promotes EC viability (Autiero et al. 2003). It is thought that
PIGF modulates EC activity by eliciting its signalling or amplifying VEGF –driven angiogenesis (Autiero et al. 2003). Indeed, overexpression of PIGF-2 has been found to cause significant increase in angiogenesis in tissues (Ahmed et al.
2000, Luttun et al. 2002). The regulation of PIGF by PMPs therefore warrants further investigation.
The high levels of the MMP inhibitor TIMP-1 detected is surprising considering that angiogenesis is characterised by MMP degradation of the extracellular matrix (Rundhaug 2005), which allows EC migration and formation of new blood vessels (Rundhaug 2005). TIMP-1 can inhibit this function and ultimately angiogenesis. The finding that PMPs caused tube formation and sprouting despite elevated TIMP-1, suggests that TIMP-1 levels could not completely inhibit the angiogenic effects of MMPs or possible feed-forward mechanism, where increased MMP causes upregulation of TIMP but not enough to overcome the effect of the MMPs. The fact that TIMP-1 is detected in atherosclerotic plaques (Crisby et al. 2001) also suggests potential pathological
130 functions independent of angiogenesis, maybe through regulation of inflammatory mediators (Crisby et al. 2001). Additionally, MCP-1 and IL-8 are both capable of inhibiting TIMP-1 (Friedman 2000), both of which we also found to be released by ECs treated with PMP, suggesting that the high levels of
TIMP-1 could be remedied by MCP-1 and IL-8.
Our proliferation data seem to show that PMP inhibited EAhy293 and HUVEC cell proliferation, this result is contrary to the reported PMP-induced increase in proliferation by another study (Kim et al. 2003). The Kim study used HUVEC from commercial sources, which have often been selectively sorted for proliferation capacity, compared to the cell line and primary HUVECs isolated from donors used in this PhD study. Unfortunately, the study by Kim et al., 2003 did not measure the release of angiogenic proteins, which made it difficult to determine if the protein response between the cells in both studies were different. Another likely explanation is the known negative effect of PF4 and
TIMP-1 on EC proliferation (Gomez et al. 1997, Maione et al. 1990), where increased in our study. TIMP-1 has been shown to inhibit human EC proliferation through mechanisms independent of its proteinase activity on MMP.
In addition, PF4 has been demonstrated to inhibit EC entry into the S phase, inhibiting cell proliferation independent of the type and concentration of stimuli used to induce angiogenesis (Gupta and Singh 1994).
Degrading PMP RNA before EC co-incubation blunted the ability of PMPS to alter the angiogenic profile of ECs. We show for the first time that RNA
131 degradation of PMPs from healthy donors reduced MCP-1, PIGF, PF4, TIMP-1 and uPA release, whilst increasing THBS-1 production compared to treatment with non-RNase incubated PMPs. Of particular interest is THBS-1, a matrix- cellular glycoprotein that binds to extracellular matrix proteins, such as fibronectin (Bale et al. 1985) strongly inhibit angiogenesis. The protein has high affinity for heparin sulphate proteoglycans and some integrins, which enables it to modulate angiogenesis, chemotaxis, and adhesion (Bornstein 1995). Given the profound anti-angiogenic role of THBS-1, and that its production from ECs fitted a miRNA regulated pattern (a reduction after PMP treatment but not after
RNase-PMP treatment), we investigated its role in PMP mediated angiogenesis in Chapter 4.
We confirmed the existence of miRNAs in PMPs and revealed the potential complex molecular, cellular and biological functions of these miRNAs using RNA sequencing and computational, functional analysis. Platelets are key elements of the cardiovascular system and contain a diverse transcriptome of miRNA
(Landry et al. 2009) that can be packaged into PMPs to target many protein coding genes in recipient cells, including ECs (Laffont et al. 2013). In support of this functional role, predictive functional analysis of some of the mRNAs targeted by highly-expressed miRNAs in PMP including many members of the Let-7 miRNA family, revealed many pathways and cellular processes associated with angiogenesis. Considering that angiogenesis plays a critical role in athero- thrombosis, targeting of its components pathways like Ras signalling pathway and cytokine-cytokine signalling, and cellular processes like cell adhesion and
132 migration by PMP-miRNA suggests they may promote the development and progression of CVD and associated comorbidities like renal and neurological complications. This hypothesis was strengthened by the observation that the predicted mRNAs targets of the top highly expressed PMP-miRNA are linked to cardiovascular, metabolic, renal and neurological diseases. These diseases have been shown to strongly correlate with the events preceeding the rupture of atherosclerotic plaques (Kuzemczak et al. 2016, Yusuf et al. 2001).
133 CHAPTER 4: PMP-MIRNA REGULATE THSB-1 MRNA TO INDUCE
ANGIOGENESIS
4.1 Introduction
This part of the study was based on the hypothesis that miRNAs played a role in
PMP induction of angiogenesis. Chapter 3 highlighted the important role of PMP transferred RNAs in modulating the release of angiogenic cytokines by ECs with corresponding induction of tube formation. PMP induced reduction in THBS-1 protein level was reversed by pre-treatment of PMP with RNAse, and this correlates with the observed angiogenesis profile. miRNAs primarily target mRNAs to inhibit protein production, the reduction of THBS-1 protein release by
PMP correlates with this regulation process. THBS-1 is a potent endogenous inhibitor of angiogenesis, which acts by reducing EC migration and survival, as well as antagonising the angiogenic activity of some growth factors like VEGF
(BenEzra et al. 1993, Kazerounian et al. 2008, Lawler 2002). Thus, the inhibition of THBS-1 release will reverse these inhibitory effects to allow a robust angiogenesis response. Therefore, we investigated the mechanisms of PMP inhibition of THBS-1 protein release.
Initially, miRNAs that target THBS-1 were identified in silico using TargetScan, a prediction tool for miRNA targets. The potential targets were probed against the published list of miRNAs in PMPs (Diehl et al. 2012b). The target identification process revealed that Let-7a and miR-221 can target THBS-1 (Figure 4.1). This
134 computational result is supported by a recent study that reported several chemically synthesised miRNAs, including Let-7a and miR-221 that inhibit
THBS-1 expression (Dogar et al. 2014).
Figure 4.1: Predicted target sites of Let-7a and miR-221 on the THBS-1 3’UTR (TargetScan).
135 4.2 PMP express the microRNA Let-7a and miR-221 To confirm the microarray/computational search results (Figure 4.1), we determined the expression of Let-7a and miR-221 in our PMPs by stem-loop qRT-PCR. PMP pellets were lysed and RNA extracted as described in section
2.10.1. Specific stem-loop primers for Let-7a, miR-221 and U6s, a small non- coding nuclear RNA reference gene (Koch et al. 2011), were used to generate stem-loop cDNA and expression levels analysed by qRT-PCR using specific forward primers and universal reverse primers. PMPs treated with RNAse were used to confirm efficiency. The results show that PMPs contain both miRNA Let-
7a and miR-221 compared to RNAse treated PMP (Figure 4.2). Moreover, the analysis of RNAse treated PMPs revealed total degradation of Let-7a and miR-
221 (Figure 4.2).
Figure 4.2: PMPs contain Let-7a and miR-221, which are degraded by RNAase treatment. Levels of miRNAs Let-7a and miR-221 in PMP were measured by stem-loop qRT-PCR. Bar represents relative expression of microRNA Let-7a and miR-221 in PMPs treated with RNAse 0.1 Units/ml or control buffer. Data shown are mean ± standard error of mean, n=3.
136 4.2.1 PMP express all the subtypes of the microRNA Let-7a and miR-221 Three subtypes of Let-7a including Let-7a-1, Let-7a-2 and Let-7a-3 have been identified in the human genome, and published data on miRNA contents of PMP show they contain different subtypes of Let-7a members. Therefore, we investigated if the different members of Let-7a miRNA family were in our PMPs.
Total RNA samples from PMPs were analysed by Ilumina RNA sequencing. The normalised transcript counts showed that the PMP contain large amounts of Let-
7a subtypes (Figure 4.2a). The analysis showed that members of the Let-7a family are amongst the most highly-expressed miRNAs in PMPs.
Figure 4.2a: PMPs express high levels of members of the Let-7 miRNA family. Total RNA was isolated from healthy PMPs and analysed by Ilumina RNA sequencing. Data represents normalised transcript counts, n=3 biological replicates.
137 4.3 PMP increased the levels of Let-7a in HUVEC
Let-7a has been shown to target THBS-1 mRNA and repress its protein expression in Hela cells, and our data demonstrate that PMPs inhibit THBS-1 protein release. We next investigated the transfer of Let-7a to HUVEC. HUVEC
(3 x105) were cultured in Medium 200 supplemented with 1% serum or 100μg/ml
PMPs (with and without prior RNAse treatment) in 1% serum for 24 hours. Total
RNA was extracted and the expression of Let-7a and miR-221 measured with stem-loop qRT-PCR. Treatment of HUVEC with 100μg/ml PMPs caused a significant increase in Let-7a levels (2-fold ± SEM, p<0.05) compared to basal levels, which was blocked by pre-treating PMPs with RNAse (Figure 4.3).
Figure 4.3: PMPs deliver the microRNA Let-7a to HUVEC. Relative miRNA expression of Let-7a miRNA in HUVEC cultured in: (EC) 1% serum, (EC+PMP) 100μg/ml PMPs, or (EC+PMP+RNAse) in the presence of 100μg/ml PMPs treated with RNAse for 24 hours. Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD individual miRNA expression level between EC and EC+PMP, or between EC+PMP and EC+PMP+RNAse.
138 Surprisingly, treatment of HUVEC with 100μg/ml PMPs caused a significant decrease in miR-221 levels (0.63-fold) compared to the basal level (Figure 4.4).
This was further decreased by treatment with 100μg/ml PMPs pre-treated with
RNAse (0.25-fold) (p<0.05) (Figure 4.4) compared to the complete PMP treatment or basal level. The results suggest that PMPs could inhibit the endogenous expression of miR-221, even though the PMP miRNA is actively delivered to the endothelial cells. Though this result limited our selection to Let-
7a for further analysis, further investigation to confirm this result and the potential implications will be insightful.
Figure 4.4: PMPs deliver and downregulate the microRNAs miR-221 in HUVEC. Relative miRNA expression of miRNA-221 in HUVEC cultured in (EC) 1% serum, (EC+PMP) 100μg/ml PMPs, or (EC+PMP+RNAse) in the presence of 100μg/ml PMPs treated with RNAse for 24 hours. Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD individual miRNA expression level between EC and EC+PMP, or between EC+PMP and EC+PMP+RNAse.
139 4.4 PMP transfer is required to elicit endogenous expression of Let-7a in treated HUVEC. To confirm that the observed increase in Let-7a levels in PMP-treated HUVEC is dependent on active transfer rather than increased EC endogenous production of Let-7a, we inhibited active transcription with actinomycin D (actD). The binding of actD to DNA and inhibition of transcription is associated with cell death. Therefore, initial cell viability assessment was performed by manual counting. The result show that 4-hours pre-treatment with 0.25ng/µl of actD before 24-hours cell culture caused cell death, but allowed enough cells to survive for subsequent PMP treatment and RNA analysis by stem-loop qRT-
PCR.
Figure 4.5: Actinomycin D induce marginal HUVEC cell death. Cell number of HUVEC cultured in 1% serum (EC) or pre-treated with (0.25ng/µl) of actinomycin D in 1% serum for 4-hours before culture for 24-hours. Data shown are mean ± standard error of mean, n=3 independent experiments.
140 HUVEC were cultured either in 1% serum, pre-treated with 0.25ng/µl of actD in
1% serum, treated with 100μg/ml PMPs in 1% serum or pre-treated with
0.25ng/ul of actD in 1% serum for 4-hours before treatment with 100μg/ml PMPs in 1% serum, for 24-hours. Total RNA was extracted, converted to stem-loop cDNA and Let-7a levels assessed by stem-loop qRT-PCR. Treatment with
100μg/ml PMPs caused a significant increase in Let-7a levels (184.129-folds) compared to basal level (Figure 4.6), which was consistent with the results in
Figure 4.3. Moreover, treatment of actD treated cells with 100μg/ml PMPs also caused a significant increase in Let-7a levels (64.64-fold) compared to basal levels, which suggest that PMP transferred this Let-7a. However, Let-7a levels after consecutive actD and 100μg/ml PMPs treatment had significantly reduced level of Let-7a compared to 100μg/ml PMPs treatment (Figure 4.6). Hence, the increased level of Let-7a is in part because of endogenous increase in expression but is predominantly mediated by PMP transfer.
141
Figure 4.6: PMPs deliver and increase the expression Let-7a in HUVEC. Relative miRNA expression of Let-7a in HUVEC cultured in 1% serum (EC), pre- treated with 0.25ng/ul of actinomycin D for 4-hours before 24-hours culture in 1% serum (EC+actD), treated with 100μg/ml PMPs in 1% serum (EC+PMP) or pre-treated with 0.25ng/ul of actinomycin D for 4-hours in 1% serum before treatment with 100μg/ml PMPs in 1% serum, for 24-hours (EC+actD+PMP). Data shown are mean ± standard error of mean, n=3 pooled biological samples of healthy PMPs. *P<0.05 Tukey SEM individual miRNA expression level between EC and EC+PMP, EC+actD+PMP and EC+PMP and EC+actD+PMP and EC.
142 4.4.1 PMP is internalised by HUVEC in time dependent manner To further confirm the transfer of PMP content, HUVEC cells 1 x 105 cells were treated with DiOC6 dye stained PMP for 6, 12 or 18 hours and visualised with a fluorescent microscope. The results showed that HUVEC internalise PMP in a time dependent manner (Figure 4.6a).
Figure 4.6a: PMP is internalised by HUVEC in a time dependent manner. HUVEC cells (1 x 105 cells per well) seeded on a cover slip were treated with 100μg/ml of DiOC6 stained PMPs for 6, 12 or 18 hours. PMP internalisation was capture with a florescent microscope. Images show representative treatments of three biological replicates.
4.5 PMPs express THBS-1 mRNA To exclude the contribution of transcription level effect on THBS-1 on the reduced THBS-1 protein shown before in Figure 3.19, we used a standard qRT-
PCR to measure the mRNA transcripts of THBS-1 in primary HUVEC treated with PMP. Because of the reported presence of THBS-1 mRNA in PMP, we initially investigated the presence of THBS-1 mRNA in PMP. Though transfer of
THBS-1 mRNA transcript from PMP would cause high expression value in qRT-
PCR analysis of PMP treated HUVEC, these transcripts are unlikely to be
143 translated to functional THBS-1 protein because of pre-binding of miRNAs contained in PMPs (Probst et al. 2007). Total RNA extracted from PMPs or
RNAse treated PMPs were converted to cDNA and analysed for the presence of
THBS-1 mRNA by qRT-PCR. The data show that PMPs do contain THBS-1 mRNA (1-fold), which was degraded by RNAse treatment (Figure 4.7).
Figure 4.7: RNAse treatment of PMPs degrades THBS-1 mRNA content. Relative expression of THBS-1 in (PMP) untreated PMPs and (PMP+RNAse) PMP treated with RNAse. Data shown are mean ± standard error of mean, n=3.
144 4.5.1 PMP express three subtypes of THBS mRNA There are currently four identified human subtypes of THBS including THBS-1,
THBS-2, THBS-3 and THBS-4, but the levels of these subtypes in PMP has not been previously described. Therefore, we measured the levels of the four types of THBS mRNA in PMPs to support the transfer of THBS-1 mRNA transcripts to treated HUVEC. Total RNA samples from PMPs were analysed by Ilumina RNA sequencing. The normalised transcript counts showed that PMP contain large amounts of THBS transcripts (Figure 4.3). The analysis showed that THBS-1 was highly-expressed compared to THBS-3 and THBS-4, while THBS-2 is absent.
Figure 4.7a: PMP express three subtypes of THBS mRNA. Total RNA was isolated from PMP and analysed by Ilumina RNA sequencing. Data represents normalised transcript counts, n=3 biological replicates (Figure 4.3).
145 4.8 PMPs elicit positive feedback transcription of THBS-1
Having shown that PMPs induce angiogenesis, which was associated with reduced THBS-1 protein levels, we investigated the potential contribution of altered mRNA levels of THBS-1 mRNA. HUVEC (3 x 105 cells/well) were cultured with either 1% serum, 100μg/ml PMPs or RNAse treated PMP in 1% serum, for 24-hours. Extracted total RNA was converted to cDNA and mRNA expression of THBS-1 quantified by qRT-PCR. The results showed that 24- hours treatment with 100μg/ml PMPs, or PMPs pre-treated with RNAse caused a significant increase in THBS-1 mRNA levels (1.9-fold) (Figure 4.8) compared to basal level (1-fold). THBS-1 mRNA in treatment with 100μg/ml PMPs pre- treated with RNAse (1.5-folds) was significantly lower than levels in cells treated with 100μg/ml PMPs (Figure 4.8). Thus, treatment with PMPs induce increased transcription of THBS-1 in HUVECS, independent of transferred mRNA transcript, whilst transferring its THBS-1 mRNA content.
146
Figure 4.8: PMPs elicit positive feedback transcription of THBS-1. Relative mRNA expression of THBS-1 in HUVEC cultured in (EC) 1% serum, (EC+PMP) 100μg/ml PMPs, or (EC+PMP+RNAse) in the presence of 100μg/ml PMPs treated with RNAse for either. Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD individual miRNA expression level between EC and EC+PMP, or between EC+PMP and EC+PMP+RNAse.
4.9 PMP inhibit translation of THBS-1 protein
Previous sections showed that PMPs transfer Let-7a miRNA to HUVECS, and that increased angiogenesis corresponds to reduced THBS-1 protein release. mRNA levels of THBS-1 were increased, likely due to exogenous transfer.
Binding of miRNA to target mRNA can inhibit protein production without altering mRNA levels. Therefore, we transfected HUVEC with a selective Let-7a inhibitor using Lipofectamine 3000 before treating the cells with PMPs to investigate the contribution of Let-7a in PMP mediated regulation of THBS-1 protein level.
HUVEC (3 X105 cells/well) were cultured in 1% serum overnight before
147 transfection of Let-7a inhibitor or non-targeting miRNA inhibitor. 24 hours after incubation untransfected or transfected cells were treated with PMP or control and THBS-1 levels analysed by ELISA.
4.9.1 THBS-1 protein level in HUVEC is not affected by transfection reagent The effect of Lipofectamine reagent on endothelial cell production and release of
THBS-1 has not been investigated. Therefore, we performed additional control experiments to ensure that the effect of Let-7a inhibitor on PMP mediated regulation of THBS-1 protein is specific and independent of the transfection reagent. Cell culture media collected after transfection before PMP treatments as described above was analysed by THBS-1 ELISA. The result showed that
24-hours transfection of Let-7a or non-targeting inhibitor had no effect on the release of THBS-1 protein (Let-7a:1544ng/ml) and (non-targeting inhibitor:1571ng/ml) compared to un-transfected cells (EC: 1426ng/ml) (Figure
4.9). Therefore, the effect of Let-7a inhibitor on the ability of PMP to inhibit
THBS-1 protein level can be interpreted independent of the effect of transfection reagents.
148
Figure 4.9: THBS-1 is not affected by transfection reagent. THBS-1 protein concentration released in the growth medium of HUVEC cultured in 1% serum (EC), transfected with Let-7a inhibitor for 24-hours (EC+7aI) or transfected with non-targeting inhibitor for 24-hours (EC+SC). Data shown are mean ± standard error of mean, n=15 pooled experimental samples. *P<0.05 Tukey SD protein concentration comparisons between EC, EC+7aI and EC+SC.
4.9.2 PMP inhibition of THBS-1 protein expression in HUVEC is dependent on its Let-7a content The data showed that 24-hours PMPs treatment of untransfected ECs, caused a significant reduction in the release of THBS-1 protein (134.4ng/ml) compared to untreated HUVEC (221.5ng/ml), transfected with Let-7a inhibitor (241.7ng/ml) or
EC transfected with non-targeting inhibitor (235.4ng/ml) (p<0.05) (Figure 4.10).
Transfecting scrambled control was unable to block the effect of PMP treatment
(150.2ng/ml) compared to untreated and EC at 1191ng/ml (p<0.005) (Figure
4.11A), confirming a Let-7a specific effect. The transfection reagent had no effect on the release of THBS-1 protein in untransfected HUVEC, transfected with Let-7a or transfected with non-targeting inhibitor because no significant difference was observed. These data show that 24-hours treatment with PMPs reduces THBS-1 from HUVEC through transferring Let-7a.
149
Figure 4.10: PMP inhibition of THBS-1 protein release is dependent on its Let-7a. Absolute thrombospodin-1 protein concentration released 24hours post treatment in the growth medium of HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let- 7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of healthy PMPs. *P<0.05 Tukey SD relative protein expression of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
150 4.10 PMP-Let-7a inhibition of THBS-1 is necessary and sufficient to promote angiogenesis in HUVEC
Following the observation that the inhibition of THBS-1 release was dependent on post-translation regulation by Let-7a, we then investigated the functional implications by in-vitro angiogenesis assay. HUVEC (3 X105 cells/well) were cultured in 1% serum overnight before transfection with the Let-7a inhibitor or non-targeting miRNA inhibitor. An additional 24 hours after incubation (3x104 cells/well) untransfected or transfected cells were treated with PMP (100μg/ml) or left untreated as a negative control. Angiogenesis was measured by Matrigel and quantified by measuring tube length and the number of branch points.
Treatment of HUVEC with PMP caused a significant increase in tube length
(12494uM) and branch point (86.33) compared to untreated HUVEC: tube length
3599uM and branching 86.33 (Figure 4.11) as reported in chapter 4. In HUVEC transfected with the Let-7a inhibitor, PMPS had a significantly weaker effect on tube length (8005uM) and branching (55.50) compared to HUVEC treated with
PMP alone: tube length (13505uM) and branching (93.17) (Figure 4.11).
Scrambled inhibitor had no effect on PMP mediated angiogenesis. Similarly, transfection alone did not change the angiogenic response. The result show that
PMP mediated angiogenesis is through Let-7a inhibition of THBS-1 protein release. However, let-7a inhibition did not fully blunt the angiogenic effects of
PMPs, suggesting that additional mechanisms contribute to PMP induced angiogenesis.
151
Figure 4.11: PMP-Let-7a inhibition of THBS-1 is necessary and sufficient to promote angiogenesis in HUVEC. Representative images (×40 magnification) showing extracellular matrix gel-based, capillary-like tube formation of HUVEC cells incubated in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD total tube length or branch points of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
152 4.11 Functional Integrin b1 (CD29) and Integrin associated protein (CD47) is indispensable in PMP induced angiogenesis
Our data show that the inhibition of Let-7a blocks PMP mediated downregulation of EC’s THBS-1 release, and inhibits PMP induced angiogenesis. Therefore, we assessed if the reduction in THBS-1 release from HUVECS was directly responsible for promoting the observed angiogenesis. The activity of THBS-1 has been linked to its binding to the surface receptors, integrin subunit beta1
(CD29) and integrin associated protein (CD47) (Nör et al. 2000). Therefore, we used blocking antibodies against both receptors in an in-vitro angiogenesis assay to see if the functional effect of THBS-1 inhibition could be rescued.
HUVEC (3 X105 cells/well) were cultured in 1% serum overnight before transfection of Let-7a inhibitor or the control, non-targeting miRNA inhibitor for
24 hours, followed by subsequent 1 hour treatment with combinations of blocking antibodies for CD29 and CD47 at 2µg/ml. PMP treatment was then applied to HUVEC on Matrigel for 18 hours and tube formation measured as described before. Unfortunately, both antibodies ablated angiogenesis regardless of PMP treatment or Let-7a inhibition, so could not be used as tools to interrogate if Let-7a inhibition of THBS-1 release drives angiogenesis (Figure
4.12). However, the results suggest that both functional CD29 and CD47 are vital for HUVEC angiogenesis.
153
Figure 4.12: Functional Integrin b1 (CD29) and Integrin associated protein (CD47) are indispensable in PMP induced angiogenesis. A) Representative images (×40 magnification) showing extracellular matrix gel-based, capillary-like tube formation of HUVEC cells, (B and C) quantitative tube length and branch point, respectively. Transfected or untransfected HUVEC cells 2 x 104 cells per well on ECM matrix were treated with a combination of anti-CD29 and anti-CD47 before treatment with PMP, for 18-hours. Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs.
154 4.12 Targeting of THBS-1 by transferred Let-7a is critical in PMP induced angiogenesis
Next, we used a blocking antibody against THBS-1 (Clone A.4.1) in the Matrigel angiogenesis assay to see if altered THBS-1 levels in our system were responsible for angiogenesis. PMP treatment of HUVECs reduced THBS-1 levels (Figure 3.18) and at the same time increased angiogenesis (Figure 3.17).
This was blocked by pre-transfection with a targeted Let-7a inhibitor (Figure 4.10 and Figure 4.11), where THBS-1 levels remained high and angiogenesis remained low. If the decreased THBS-1 levels after PMP treatment were responsible for inducing angiogenesis, and inhibiting Let-7a blocked the induction of angiogenesis through stopping the decrease in THBS-1, then antibody inhibition of THBS-1 followed by PMP treatment would induce angiogenesis in both Let-7a inhibitor and non-targeting inhibitor transfected
HUVECs. HUVECs (3 X105 cells/well) were cultured with 1% serum, then transfected for 24 hours with the Let-7a inhibitor or non-targeting inhibitor.
HUVEC were then incubated with a THBS-1 blocking Ab (Clone A4.1 at 2ug/ml) or control for incubation time, followed by treatment with PMPs as before. The results showed that HUVEC treatment with PMP caused a significant increase in tube length (12494uM) and branch point (86.33) compared to untreated HUVEC: tube length 3599uM and branching 86.33 (p<0.05) (Figure 4.13). In HUVEC transfected with Let-7a inhibitor, PMPs had a significantly weaker effect on tube length (8005uM) and branching (55.50) compared to HUVEC treated with PMP alone: tube length (13505uM) and branching (93.17) (Figure 4.13).
155 Treatment of Let-7a transfected HUVEC with THBS-1 blocking antibody before
PMP caused a significant increase in tube length (14237uM) and branching (46) compared to transfection controls and untreated HUVEC (Figure 4.13). PMP treatment of HUVEC in the presence of THBS-1 neutralising antibody caused significant increase in angiogenesis independent of the transfection of Let-7a or non-targeting inhibitors. However, tube length (14237uM) and branch point (73) were significantly higher in untransfected HUVEC treated with neutralising
THBS-1 antibody and PMPs compared to treatment of HUVEC transfected with let-7a inhibitor or non-targeting inhibitor with THBS-1 and PMPs. However, there were no difference between HUVEC transfected with let-7a inhibitor or non- targeting inhibitor treated with neutralising THBS-1 antibody and PMPs. The result show that imbibition of THBS-1 protein allowed PMP to induce angiogenesis independent of Let-7a inhibition.
156
Figure 4.13: Targeting of THBS-1 by transferred Let-7a is critical in PMP induced angiogenesis. Representative images (×40 magnification) showing extracellular matrix gel-based, capillary-like tube formation of HUVEC cells, (B and C) quantitative tube length and branch point, respectively. HUVEC cells 2 x 104 cells per well on ECM matrix were treated with 1% serum (EC), pre-treated with THBS-1 antibody (EC+THBS-1) or treated with 100μg/ml PMPs after pre- treatment with THBS-1 (EC+THBS-1+PMP), treated with: THBS-1 after 24- hours transfection of Let-7a inhibitor (EC+7AI+THBS-1), THBS-1 after 24-hours transfection of non-targeting inhibitor (EC+SC+THBS-1), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor followed by pre-treatment with THBS-1 (EC+7aI+THBS-1+PMP) or 100μg/ml PMPs after 24-hours transfection of non- targeting inhibitor followed by pre-treatment with THBS-1 (EC+SC+THBS- 1+PMP) Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD total tube length or branch points for all shown comparisons between.
157 4.13 PMP inhibited caspase 3 activation in HUVEC through a Let-7a dependent mechanism
One of the key mechanism of THBS-1 regulation of angiogenesis is the induction of apoptosis through the activation of caspase pathway (Nör et al.
2000). Specifically, caspase 3 is a reliable marker of apoptosis, an executioner which acts in coordination, downstream of other caspases to induce programed cell death. Therefore, we investigated the effect of PMP treatment on the level of activated caspase 3 in HUVEC by western blot to see if PMP mediated changes in THBS-1 protein through Let-7a correlated with reduced caspase 3 activation.
HUVEC (3 X105) were cultured in 1% serum overnight before transfection of Let-
7a inhibitor (EC+7aI) or non-targeting miRNA inhibitor. Additional 24 hours after transfection cells were treated with PMP or left untreated as negative transfection controls. Whole protein sample was isolated and used for immunoblotting. Treatment of HUVEC with PMP caused a significant reduction in activated caspase 3 (2050) compared to untreated HUVEC (4200) (Figure
4.14A). In HUVEC transfected with Let-7a inhibitor, PMPs significantly induced caspase 3 activation (4000) compared to HUVEC treated with PMP. The results showed that PMP mediated inhibition of caspase 3 activation is a Let-7a dependent mechanism, potentially through inhibition of THBS-1 protein release.
Let-7a inhibition completely reversed the anti-caspase activation effect of PMPs, suggesting that Let-7a mechanism might be the sole mechanism involved.
Transfection with non-targeting inhibitor or Let7a inhibitor alone did not largely alter caspase 3 activation.
158
Figure 4.14: PMP inhibits caspase 3 activation through a Let-7a dependent mechanism. (A) Representative blots (B) Relative quantification of cleaved caspase 3 by western blot of whole cell lysate of HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24- hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24- hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of healthy PMPs. *P<0.05 Tukey SEM relative protein expression of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
159 4.14 Let-7a directly target the 3’UTR of THBS-1 mRNA to inhibit its protein expression
Our data show that PMPs transfer Let-7a to HUVEC to inhibit THBS-1 protein release and induce angiogenesis. Therefore, we assessed if direct Let-7a targeting of THBS-1 mRNA was responsible for reducing THBS-1 protein levels.
The activity of Let-7a on THBS-1 protein levels has been linked to its binding to the 3’UTR of THBS-1 mRNA (Nör et al. 2000). Therefore, we used a reporter plasmid expressing the THBS-1 3’UTR in a Luciferase assay to see if the reporter signal of THBS-1 3’UTR construct can be reduced by overexpressing
Let-7a miRNA through an expression plasmid. HEK 293T cells (1.3 X104) were cultured in 10% serum overnight, before the co-transfection of the reporter plasmid for THBS-1 3’UTR or empty reporter plasmid and Let-7a expression plasmid or empty miRNA expression plasmid. After 12 hours, transfected HEK
293T cells were further treated with PMP. Reporter signal was measure by
LightSwitch luciferase assay reagent. The results showed that expression of Let-
7a completely reduced the reporter signal of THBS-1 mRNA 3’UTR (4% targeting to non-targeting ratio) compared to (1100% targeting to non-targeting ratio) (P<0.05) (Figure 4.15). Inhibition of Let-7a by transfection with the Let-7a inhibitor significantly rescued the effect of Let-7a expression on the reporter signal of THBS-1 3’UTR construct (430% targeting to non-targeting ratio) (Figure
4.15). This confirms that Let-7a directly target THBS-1 by binding to its 3’UTR. It is likely we did not get full reversal due to the large levels of Let-7a produced by the transfected plasmid.
160
Figure 4.15: Let-7a directly targets the 3’UTR of THBS-1 mRNA to inhibit its protein expression. HEK 293T cells transfected with THBS-1 3’UTR where transfected with Let-7a pmiR plasmid or empty pmiR plasmid and Let-7a miRNA inhibitor or non-targeting miRNA inhibitor. Luciferase signal for the 3’UTR was measured by Lightswitch luciferase reagent. Data represents mean ratio of treatment signal to non-specific control signal in percentages, n = 6 +- SEM. *P<0.05 Tukey SEM relative luminesces signal of all shown comparisons.
4.15 PMP delivered RNA content target the 3’UTR of THBS-1 to inhibit its protein expression
Next, we explored the ability of PMP to inhibit the reporter signal of THBS-1
3’UTR, which would confirm the mechanism of PMP mediated reduction in
161 THBS-1. HEK 293T cells (1.3 X104) were cultured in 10% serum overnight before transfection of reporter plasmid for THBS-1 3’UTR or empty reporter plasmid. After 12 hours, transfected HEK 293T cells were treated with PMPs and luciferase signal measured by Lightswitch luciferase assay reagent. The results showed that treatment with PMP completely reduced the reporter signal of THBS-1 3’UTR (8% targeting to non-targeting ratio) compared to (1120% targeting to non-targeting ratio) (Figure 4.16). Therefore, the results confirm that
PMP delivered contents directly target THBS-1 3’ UTR.
Figure 4.16: THBS-1 3’ UTR is a target of PMP delivered microRNA. HEK 293T cells transfected with THBS-1 3’UTR were treated PMP. Data represents mean ratio of treatment signal to non-specific control signal in percentages, n = 6 +- standard error of mean. *P<0.05 T-test.
162 4.16 Let-7a is a pro-angiogenic miRNA that regulate angiogenesis through
THBS-1
Having shown that Let-7a miRNA plays an important role in PMP mediated angiogenesis by inhibiting the production of THBS-1, we assessed the direct ability of Let-7a to induce angiogenesis independent of other biological components of PMPs. The direct angiogenic effect of Let-7a has not previously been investigated. HUVEC (3 X104) cultured with Medium 200 supplemented with 1% serum were transfected with a Let-7a expression plasmid or empty miRNA expression plasmid for 12 hours. The angiogenesis potential was assessed by measuring tube length and the number of branch points in Matrigel assays, and fluorescent images were quantified with Angiotool. Overexpression of Let-7a in HUVEC caused a robust significant increase in angiogenesis, where tube length increased to 20000μm (p<0.05) (Figure 3.14A) and branching to 97
(p<0.05) compared to basal levels of 11000μm and a mean 48 branch point
(p<0.05) (Figure 4.17). This data show for the first time that Let-7a is a pro- angiogenic miRNA and further confirm our hypothesis that PMP delivered LET-
7a is responsible for angiogenesis.
163
Figure 4.17: Overexpression of Let-7a microRNA mediated tube formation and micro vascular sprouting in vitro. HUVEC 2 x 104 cells untransfected, pre-transfected with Let-7a expression vector or empty expression vector per well were seeded on ECM matrix coated plates for 16 hours. Angiogenesis was measured using an in-vitro Tube formation assay kit and data quantified with AngioTool software. A) Representative photomicrographs (×40 magnification) showing extracellular matrix gel-based, capillary-like tube formation by human HUVEC cells. B) Quantitative data of total tube length expressed in μm and C) Quantitative data of total number of branching. Data shown are mean ± standard error of mean, n=4 in each group. *P<0.05 ANOVA, for PMP treatment compared with basal or empty plasmid.
164 4.17: Discussion
Angiogenesis is a clear feature of atherosclerotic plaques (Khurana et al. 2005,
O'Brien et al. 1994) but the role it plays in destabilisation hence CVD progression is debated. However, the number of leaky and immature neo-blood vessels are significantly increased in unstable atherosclerotic plaques (Jain et al. 2007). Angiogenesis in plaques increases the infiltration of inflammatory cells and promotes bleeding, which further destabilises plaques (Jain et al. 2007).
Weakening of plaques is critical to adverse cardiovascular events as rupture allows athero-thrombosis, which contributes to the increased morbidity and mortality among patients with CVD (Yusuf et al. 2001). A common feature of patients at high risk of cardiovascular disease is platelet activation, which is known to cause enhanced release of PMPs (Minuz et al. 2002, Rückerl et al.
2007, VanWijk et al. 2003). PMPs induce endothelial cell activation and angiogenesis (Diamant et al. 2004). However, the full molecular mechanisms by which PMPs regulate angiogenesis are poorly understood.
This chapter provides several lines of evidence showing that the PMP delivered miRNA Let-7a, and subsequent reduction of THBS-1 release, help drive this phenotype. These results presented are strongly supported by published studies that inhibited angiogenesis by directly increasing the levels of THBS-1 through exogenous THBS-1 protein treatment or endogenous overexpression of THBS-1
(Isenberg et al. 2005, Short et al. 2005). Correspondingly, the pro-survival and migratory effects of a different miR (miR-200a) on HUVEC is linked to the inhibition of THBS-1 protein release (Li et al. 2011). THBS-1 inhibit EC migration
165 through the binding of its TSRs to the surface receptors CD36 and integrin β1
(CD29) (Dawson et al. 1997, Short et al. 2005). Moreover, the inhibition of nitric oxide activity through CD36 and CD47 dependent mechanisms allow THBS-1 to directly inhibit angiogenesis (Isenberg et al. 2009, Roberts et al. 2007). We confirm that PMPs induce angiogenesis and alter the angiogenic secretome of
ECs, including down regulating THBS-1. TargetScan analysis show THBS-1 is targeted by Let-7a, which has been reported to be present in platelets. We show with RNA-Seq, validated by qRT-PCR, that Let-7a is in PMPs, and show it is delivered to primary ECS. Functional luciferase experiments confirmed that Let-
7a directly target THBS-1. Let-7a inhibition strongly reversed the downregulation of THBS-1 release and angiogenesis induced by PMPS. Antibody neutralisation of THBS-1 reversed the negative effect of inhibiting Let-7a on PMP induced angiogenesis. Finally, overexpression of Let-7a alone induced robust angiogenesis. However, functional CD29 and CD47 are required for PMP induced angiogenesis.
Let-7a was one of the first miRNAs described (Roush and Slack 2008), and can target several mRNA 3’UTRs including THBS-1, MYC transcription factor, type 1 collagen and integrin β3 (Makino et al. 2013, Müller and Bosserhoff 2008,
Sampson et al. 2007). Synthetic Let-7a and miR-221 have been reported to directly target the 3’ UTR of THBS-1 mRNA using dual luciferase assay and western blot in Hela cells (Dogar et al. 2014). Let-7a plays a role in a range of cellular process including proliferation (Johnson et al. 2007), differentiation of cardiovascular system and migration (Bao et al. 2013), through a coordinated
166 and complex regulation of translation and potential indirect regulation of transcription (Roush and Slack 2008). These potential functions can be related to the data in this project because of the importance of proliferation and migration in angiogenesis. Concerning the increased levels of Let-7a shown in this thesis, published work on different miRNA (223) demonstrated in a series of morphological and molecular techniques showed that PMP contained (miR-223) can be effectively transferred to ECs and incorporated into the endogenous
RISC complex within these cells (Pan et al. 2014). Moreover, our result showed that PMP is internalised by HUVEC in a time dependent manner. Thus, the increase in Let-7a in HUVEC following PMP treatment in our experiments is consistent with the results reported by Pan et al. 2014.
Target prediction by TargetScan algorithm revealed the miRNAs Let-7a and miR-221 as potential modulators of THBS-1. Both miRNAs have been reported by microarray analysis to be present in platelets (Gidlof et al. 2013) and our
RNA-Seq data confirmed that they are transferred to PMPs in large amounts
(Laffont et al. 2013). We validated this data with stem-loop qRT-PCR, but failed to observe increase in miR-221 in ECs treated with PMP. Though miR-221 was excluded from further analysis because of cost limitations, the implications of this downregulation require further investigation. miRNA-221 is implicated in the effect of hyperglycaemia on ECs, where it inhibits C-kit the receptor for stem cell factor in HUVECs to inhibit EC migration (Li et al. 2009). In ECs, miR-221 inhibits proliferation and migration, while promoting apoptosis, but causes the opposite effect on vascular smooth muscle cells (Xiaojun Liu et al. 2012). Thus,
167 the reduced miR-221 in our study correlates with increased angiogenesis we observed. This highlights the tight control of the effects of PMP-miRNA on ECs, which leads to increased migration and angiogenesis. Mechanisms underpinning this process could be miRNA directed downregulation of endogenous miR-221 or selective degradation of delivered PMP-miRNA.
However, the mechanisms for this tight control require investigation.
Actinomycin D inhibition of transcription in HUVEC before PMP treatment showed some of the Let-7a increase in PMP treated HUVEC was due to EC production of Let-7a rather than direct PMP transfer. Indeed, miRNAs can target transcription factors to regulate endogenous expression of itself or other miRNAs (Caporali and Emanueli 2011). Moreover, these effects will have influence on multiple signalling pathways by the altered release of angiogenic modulators induced by PMP treatment. For instance, increased levels of VEGF can increase the expression of miR-191 by increasing its transcription (Suarez et al. 2007, Suárez et al. 2008). Though reported in B-cells, the transcription factor MYC that is targeted by Let-7 family members can also regulate Let-7a-1 by binding at the promoter of the Let-7a-1, 7f and 7d cluster (Chang et al. 2008,
Zifeng Wang et al. 2011). However, these mechanisms remain to be explored in our model and would require RNA-Seq of ECs treated with PMP to identify the global changes in transcription factors.
The results in this chapter revealed the presence of THBS-1 mRNA in PMP and corresponding increases in the treated ECs. PMPs have been shown to contain different classes of RNA and RNA sequencing of PMP revealed the expression
168 of THBS-1, THBS-3 and THBS-4 in our study. However, some reports suggest that the functional effect of transferred mRNA by platelets is significantly blunted by the activity of the massive amount of miRNA they contain. The regulatory effects of miRNAs are dependent on the number of complementary binding sites occupied by miRNAs on their target mRNA and their bioavailability, therefore it is unlikely that the THBS-1 mRNA transferred is not complexed with miRNA
RISC complex. The proposed interactions will inhibit the translation of PMP derived THBS-1 by the ECs (Landry et al. 2009, Pan et al. 2014). Moreover, the sequencing results showed high levels of Let-7 miRNA family members that can potentially target THBS-1 due to the similarities in their mature RNA sequence.
The idea that transferred THBS-1 mRNAs is redundant is supported by the evidence that PMP miRNA are distributed between pre-miRNA that require further processing and mature miRNA that are complexed with RISC (Landry et al. 2009, Pan et al. 2014). Moreover, PMP treatment can induce a negative feedback effect by increasing the transcription of THBS-1 gene in ECs to control angiogenesis. This idea is in-line with numerous lines of evidence supporting the homeostatic functions of ECs in vascular function through differential expression of angiogenic genes. However, the function of miRNA is exacted through inhibition of translation or degradation of mRNA transcripts, thus the targeting of
THBS-1 by Let-7a will ensure that transcription increase does not correlate to increased THBS-1 protein.
Inhibiting the binding of THBS-1 to its receptors CD47 and CD29 with neutralising antibodies fully blocked angiogenesis regardless of PMP treatment
169 or Let-7a inhibition. These data show functional CD47 and CD29 are indispensable in the induction of angiogenesis by PMPs. CD47 and CD29 strengthen the attachment and interaction of ECs with the extracellular matrix
(Albelda and Buck 1990, Eliceiri and Cheresh 2001, Schwartz and DeSimone
2008). Moreover, CD29 has been shown to activate several signalling molecules including focal adhesion kinase (FAK) and Ras/ERK pathways that are known to play an important role in the interaction between extracellular proteins and integrins (Schober and Fuchs 2011, Qin Wang et al. 2011). This interaction is central to cell migration, matrix remodelling and angiogenesis (Mettouchi and
Meneguzzi 2006). Embryonic deletion of CD29 from ECs in a mouse model resulted in lethal blood vessel defects (Tanjore et al. 2008). Therefore, it can be concluded that CD29 is indispensable in the induction of angiogenesis by PMP.
Likewise, CD47 interacts with numerous integrin subunits particularly α2β1 integrins to mediate spreading, cytokine synthesis, migration and proliferation
(Wang and Frazier 1998). Thus, while the inhibition of CD29 and CD47 in this study would effectively inhibit THBS-1 activity, the critical processes required for
ECs migration and spreading will also be inhibited. Concerning reduced protein levels of activated caspase 3, THBS-1 has been shown to regulate the p38 kinase signalling pathway through CD36 to activate caspases-3 (Nör et al. 2000,
Volpert 2000). This result suggests that inhibition of THBS-1 by PMP delivered
Let-7a modulates the signalling mechanism targeted by THBS-1 to inhibit angiogenesis. The enhanced understanding of how PMPs induce angiogenesis through the THBS-1 pathway identified in this thesis highlight this as potential therapeutic target for the management of athero-thrombosis.
170 CHAPTER 5: PMP MEDIATED ANGIOGENESIS REQUIRE TRANSCRIPTION
LEVEL REGULATION OF PRO-ANGIOGENIC PROTEINS MCP-1
5.1 Introduction
One of the key phenotypes driving angiogenesis is increased migration, which has been shown to be mediated by chemokines including members of the C-C family, characterised by two adjacent cysteines near their amino terminus. They can increase angiogenesis by increasing ECs migration. In addition to the alterations in THBS-1 identified in this thesis, protein array analysis of released angiogenesis modulators revealed that PMPs increased the release of PIGF and
MCP-1 as shown in Figure 3.18. The effect on MCP-1 was particularly strong, and MCP-1 has been shown to positively regulate angiogenesis through increased migration of endothelial cells (Salcedo et al. 2000). Importantly,
RNAse treatment of PMPs blocked their ability to induce the release of MCP-1.
This does not fit with the common direct action of miRNAs, where the central dogma is inhibition of protein production rather than promotion. Thus, potential miRNA targeting of transcription factors that directly or indirectly inhibit the expression of the target proteins described above, could explain the increased protein release. Some transcription factors have both negative and positive effect on gene transcription (Latchman 1996) depending on context.
Members of the activating transcription factor group of proteins are those that bind the CAMP responsive element (CRE) and share a Leucine zipper DNA-
171 binding motif (Hai and Curran 1991). These ATF proteins are majorly associated with stress responses because they are activated by stress related stimuli like cytokines and toxic compounds (Hai et al. 1989, Zhou et al. 2003). However, signals that induce ATF gene expression and their cellular function are not limited to the stress response because they serve as adaptive molecules for alterations in the extracellular and intracellular space (Hai and Hartman 2001).
Thus, ATF proteins are crucial regulators of cellular functions including migration, proliferation and angiogenesis (Hai and Hartman 2001). Some of the proteins increased by PMP treatment have are associated with members of the
ATF protein family, acting through angiogenesis related transcription factors. Of note the activating transcription factor -4 (ATF-4) reduced the transcription of
PIGF in endothelial cells in response to placental endoplasmic reticulum stress
(Mizuuchi et al. 2016), whilst its overexpression in endothelial cells increased
MCP-1 (Huang et al. 2015). Therefore, the potential targeting of ATF-4 or dimer members of the ATF-4 proteins by the miRNAs delivered by the PMP would result in the upregulation of PIGF, MCP-1 and angiogenin expression and release, which could explain their increase in EC following treatment with PMP and reduction after RNAse pre-treatment of the PMP. However, the potential mechanisms involved in such response require investigation.
5.2 PMP increased the transcription of ATF-4 mRNA through Let-7a dependent mechanism
Due to the potential role for ATF-4 described above, we first investigated the transcription of ATF-4 protein in HUVEC treated with PMP, for 24-hours. PMP
172 (100µg/ml) treatment caused a significant increase in ATF-4 mRNA (1.376 fold) in HUVECs. Next, we assessed if PMP delivered Let-7a was responsible for the change in ATF-4 mRNA. Transfection with the let-7a inhibitor prior to PMP treatment reduced the ATF-4 mRNA levels back to basal level. Suggesting potential Let-7a mediated degradation of ATF-4 mRNA. Pre-treatment with a non-targeting inhibitor did not reduce the effect of PMP co-incubation, but non- targeting inhibitor potentiated the effect of PMP on ATF-4 levels (Figure 5.1).
The data also suggest a potential role of endogenous Let-7a in the regulation of
ATF-4 transcription, as transfection with the let-7a inhibitor caused a significant increase in ATF-4 mRNA compared to untreated cells (Figure 5.1). This increase was consistent with the level in PMP treated HUVEC, which showed the extent of the role of Let-7a in ATF-4 maintenance, but also highlighted the important control of ATF-4 transcription factor by PMP-let-7a.
173
Figure 5.1: PMPs increase the transcription of ATF-4 mRNA through a Let- 7a dependent mechanism. Relative quantification of ATF-4 mRNA expression in HUVEC cultured in 1% serum only (EC) or with addition of 100μg/ml PMPs in 1% serum (EC+PMP), or 1% serum after 24hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24hours transfection of non-targeting inhibitor (EC+SC) or 100μg/ml PMPs after 24hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD relative mRNA expression of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
174 5.3 PMP treatment did not regulate ATF-4 protein level in HUVEC
We explored if the altered mRNA level of ATF-4 after PMP treatment translated to altered protein level. HUVEC (3 X105) were cultured in 1% serum overnight before transfection with the Let-7a inhibitor or non-targeting miRNA inhibitor. An additional 24 hours after transfection, cells were treated with PMP or control.
Cells were lysed and lysate used for immunoblotting of ATF-4 protein. The results showed that HUVEC expressed consistent level of ATF-4 protein regardless of PMP treatment or Let-7a inhibition (Figure 5.2). The immunoblot also revealed multiple reactive bands, which could point to extensive post- translational modifications of ATF-4 protein or varying strength of ATF-4 interaction with other proteins (Ameri and Harris 2008). As the observation of multiple bands is consistent with the results by other studies (Watson and
Andley 2010).
175
Figure 5.2: ATF-4 protein is tightly controlled in HUVEC irrespective of PMP treatment. (A) Representative blots (B) Relative quantification of cleaved ATF-4 protein by western blot of whole cell lysate of HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24- hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24- hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of healthy PMPs. *P<0.05 Tukey, SEM relative protein expression of all shown comparisons.
176
5.4 PMP mediate differential enrichment of ATF-4 proteins at promoter regions of pro-angiogenic proteins in HUVEC
Since ATF-4 protein level was unchanged following PMP treatment (section
5.3), we investigated if PMPs induced differential recruitment of ATF-4 to the promoter regions of MCP-1 and PIGF, which are pro-angiogenic modulators shown by our protein array data (Figure 3.18) to be upregulated by PMP treatment. Physiologically, transcription factors act by binding to the promoter region of a gene directly or as a complex with other factors to activate or inhibit its transcription. Therefore, the alterations of these binding events could explain our protein array data showing increased release of pro-angiogenic proteins.
Chromatin immunoprecipitation (CHIP) and subsequent qRT-PCR analysis using primers to the promoter regions of both genes were used to achieve this objective. HUVEC (1 X 106 cells/well) either transfected with Let-7a inhibitor or non-targeting inhibitor were treated with PMPs for 24-hours, then chromatin was crosslinked, fragmented, precipitated with ATF-4 antibody and analysed by qRT-
PCR as discussed in the methods section.
5.4.1 PMPs mediate ATF-4 enrichment at the MCP-1 promoter in HUVEC through a Let-7a dependent mechanism CHIP- qRT-PCR analysis showed that PMP treatment caused a significant
21.3% increase in ATF-4 enrichment at the MCP-1 promoter compared to basal levels. Consistently, PMP treatment of HUVEC transfected with non-targeting inhibitor caused a significant 102% increase in ATF-4 enrichment at MCP-1 promoter compared to untreated HUVEC transfected with non-targeting inhibitor
177 (Figure 5.3). Conversely, PMP treatment of HUVEC transfected with Let-7a inhibitor significantly reduced the ATF-4 enrichment at MCP-1 promoter by 56% compared to untreated HUVEC transfected with Let-7a inhibitor (Figure 5.3).
The comparison of each PMP treatment with the corresponding basal level enabled us to control for the growth condition mediated differences. Moreover, the matched conditions are derived from equal number of cells, thus ideal for comparison and derivation of relative differences.
178
Figure 5.3: PMP mediates ATF-4 enrichment at the MCP-1 promoter through a Let-7a dependent mechanism. Percentage enrichment of ATF-4 protein at MCP-1 promoter in (A) 1% serum (EC) or 100μg/ml PMPs in 1% serum (EC+PMP), (B) 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI) or 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), (C) 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP), and (D) Precipitated with Histone H3 (positive control) antibody or normal IgG (negative control) antibody. Data shown are mean ± standard error of mean, n=9 independent biological samples of PMPs, pooled to in equal n=3. *P<0.05 Tukey SD percentage enrichment between EC+PMP and EC, EC+7aI+PMP and EC+7aI, or EC+SC+PMP and EC+SC.
179 5.4.2 PMPs mediate ATF-4 enrichment at the placental growth factor (PIGF) promoter in HUVEC through a Let-7a dependent mechanism The CHIP- qRT-PCR analysis of the PIGF promoter for ATF-4 enrichment showed that PMP treatment caused a significant 129.4% increase in ATF-4 enrichment at PIGF promoter compared to basal levels (Figure 5.4). PMP treatment of HUVEC transfected with non-targeting inhibitor caused a significant
173% increase in ATF-4 enrichment at PIGF promoter compared to untreated
HUVEC transfected with non-targeting inhibitor (Figure 5.4). Conversely, PMP treatment of HUVEC transfected with Let-7a inhibitor showed no difference in the ATF-4 enrichment at PIGF promoter compared to untreated HUVEC transfected with Let-7a inhibitor (Figure 5.4). The basal ATF-4 enrichment at
PIGF promoter varied between the control.
180
Figure 5.4: PMP mediates ATF-4 enrichment at the PIGF promoter through a Let-7a dependent mechanism. Percentage enrichment of ATF-4 protein at PIGF promoter in (A) 1% serum (EC) or 100μg/ml PMPs in 1% serum (EC+PMP), (B) 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI) or 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), (C) 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP), and (D) Precipitated with Histone H3 (positive control) antibody or normal IgG (negative control) antibody. Data shown are mean ± standard error of mean, n=9 independent biological samples of PMPs, pooled to in equal n=3. *P<0.05 Tukey SD percentage enrichment between EC+PMP and EC, EC+7aI+PMP and EC+7aI, or EC+SC+PMP and EC+SC.
181 5.7 PMPs increases HUVEC mRNA levels of MCP-1 and PIGF in RNA dependent mechanism
ATF-4 recruitment to the promoter regions of MCP-1 and PIGF may inhibit or activate transcription of both genes depending on the interaction with other proteins expressed by HUVEC. We initially investigated if PMP treatment regulated MCP-1 and PIGF transcription in HUVEC using qRT-PCR analysis.
HUVEC were cultured with 1% serum before treatment with 100μg/ml PMPs or
RNAse treated PMP in 1% serum, for 24-hours. Then, total RNA was isolated and mRNA levels of MCP-1 and PIGF analysed by qRT-PCR. Treatment with
100μg/ml PMPs caused a significant increase in MCP-1 mRNA levels (13.812- fold) (Figure 5.5) compared to basal levels. This effect was blocked by RNAse treatment (reduction to 4.56-fold above basal) (Figure 5.5). Similarly, treatment with 100μg/ml PMPs caused a significant increase in PIGF mRNA levels (1.64- fold) compared to basal level, which was significantly decreased by RNAse treatment (0.89-fold compared to basal.) (Figure 5.5). Thus, these data show that PMP-RNA dependent mechanism regulate the transcription of MCP-1 and
PIGF.
182
Figure 5.5: PMPs mediate transcription of MCP-1 and PIGF through an RNA dependent mechanism. Relative mRNA expression of (A) MCP-1 and (B) PIGF in HUVEC cultured in (EC) 1% serum, (EC+PMP) 100μg/ml PMPs, or (EC+PMP+RNAse) in the presence of 100μg/ml PMPs treated with RNAse. Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD individual miRNA expression level between EC and EC+PMP, or between EC+PMP and EC+PMP+RNAse.
5.9 PMPs induce the transcription of MCP-1 and PIGF in HUVEC through
Let-7a dependent mechanism we investigated if PMP-Let-7a increased the transcription of PIGF and MCP-1 to explain the observed protein array results showing that PMP treatment increase
MCP-1 and PIGF release from HUVECS. HUVEC (3 X105) were cultured in 1% serum overnight before transfection of the Let-7a inhibitor (EC+7aI) or non- targeting miRNA inhibitor. 24 hours after incubation, cells were treated with PMP or buffer controls before isolation of total RNA used for qRT-PCR analysis of
MCP-1 and PIGF mRNAs. The result showed that 24-hour treatment with PMPs
183 caused a significant increase in the mRNA level of MCP-1 (3.971-fold) compared to basal (p<0.05). Transfection with non-targeting inhibitor (0.398- fold) or Let-7a inhibitor (0.399-fold) had no significant effect on MCP-1 transcription. Treatment with PMPs in Let-7a transfected HUVEC significantly reduced MCP-1 mRNA levels (0.56-fold compared to control) (Figure 5.6A) showing PMPs induced HUVEC MCP-1 mRNA production in a Let-7a dependent manner.
24-hour treatment with PMPs caused a significant increase in the mRNA level of
PIGF (1.45-fold) compared to basal (p<0.05). Transfection with non-targeting inhibitor (0.953-fold) or Let7a inhibitor (0.99-fold) had no significant effect alone.
Treatment with PMPs in Let-7a transfected HUVEC importantly resulted in significant reduction in PIGF mRNA levels (0.967-fold) compared to control
(Figure 5.6A). These results show that PMPs induced HUVEC PIGF mRNA production in a Let-7a dependent manner. In these experiments, treatment with
PMPs in non-targeting transfected HUVECs increased PIGF mRNA levels above PMP treatment alone (4.681-fold) the reasons for this are unclear (Figure
5.6A).
184
Figure 5.6: PMPs mediates transcription of MCP-1 and PIGF through Let-7a dependent mechanism. Relative quantification of mRNA (A) MCP-1 and (B) PIGF in HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD relative mRNA expression of all shown.
185 5.10 PMP-Let-7a related transcription of MCP-1 correlates with increased
MCP-1 protein expression.
Having shown that PMP treatment, via transferring Let-7a, increased MCP-1 mRNA levels, we then investigated changes in protein level. HUVEC (3 X105) were cultured in 1% serum overnight before transfection of Let-7a inhibitor
(EC+7aI) or non-targeting miRNA inhibitor. 24 hours after incubation, cells were treated with PMP or buffer controls, for 24 hours. Cell culture media was collected and analysed by MCP-1 ELISA.
PMP treatment caused a significant increase in MCP-1 protein release
(1160pg/ml compared to 818.3pg/ml, p<0.05). This was partly reversed by pre- transfection with the Let-7a inhibitor, where MCP-1 levels significantly reduced to 984.5pg/ml compared to PMP treatment (p<0.05) (Figure 5.7). These data suggest that PMPs induce MCP-1 protein expression and release from HUVECs via a Let-7a dependent mechanism, but Let-7a insensitive pathways also exist.
The proteins directly or indirectly targeted by Let-7a to mediate increased recruitment of ATF-4 to MCP-1 promoter requires further investigation.
186
Figure 5.7: PMP-Let-7a related transcription of MCP-1 correlates with increased protein expression. Protein concentration of MCP-1 after 24-hours treatment of HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD protein concentration of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
187 5.11 PMP enhance HUVEC migration is dependent on transferred Let-7a
Following the observation that the increased MCP-1 release is potentially dependent on indirect transcription regulation by Let-7a, as MCP-1 is a known inducer of EC migration (Ma et al. 2007, Weber et al. 1999), we then investigated the functional implications by the in vitro scratch assay. HUVEC (3
X 105) were cultured in 1% serum overnight before transfection of Let-7a inhibitor or non-targeting miRNA inhibitor. Confluent cells were scratch after 24 hours and immediately treated with PMP or left untreated as negative controls.
Migration was assessed at 12-hours and 24-hours post scratching by measuring percentage gap closure (GC). Within 12-hours of treatment, PMPs caused a significant increase in migration (24.6% compared to 15.7% GC). Transfection of
HUVECs with the Let-7a inhibitor fully reversed the migratory effects of PMPs
(16.33% vs.15.7% basal and 24.6% in the presence of PMPs) (Figure 5.8A).
The same pattern was apparent after 24hours, where basal gap closure was
24.91% compared to 34.01% in the presence of PMPs (Figure 5.8B).
Transfection with the Let-7a inhibitor significantly blocked the ability of PMPs to induce migration (16.41% GC) (p<0.05) (Figure 5.8B). The results suggest PMP, through a Let-7a dependent mechanism, has a modest but significant effect on
HUVEC migration. Further experiments are required to determine if this is dependent on the ability of PMPs to modulate MCP-1 levels through an ATF-4 dependent mechanism.
188
Figure 5.8: PMP induction of MCP-1 protein is Let-7a dependent. Percentage gap closure, after 12-hours or 24-hours treatment of HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24- hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD percentage gap closure of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
189 5.12 Discussion miRNA targeting of mRNAs encoding transcription factors can mediate indirect effects on protein release through reduced or increased transcription (Gosline et al. 2016, Lewis et al. 2003). A range of studies have shown that miRNA regulate protein expression by targeting transcription factors (Gosline et al. 2016, Kong et al. 2008). Global inhibition of miRNAs in microvascular EC due to Dicer knockdown increases the expression of high mobility group box transcription factor (HBP1). HBP1 is a suppressor transcription factor that negatively regulates the expression of p47phox (Dinauer and Newburger 1993), a promoter of oxidative stress. Indeed, increased expression of HBP1 by dicer knockdown reduced the expression of p47phox, which in turn inhibited ROS-dependent angiogenic signalling (El-Benna et al. 2009). In an animal model, miR-134 regulated the differentiation of mouse embryonic stem cells by targeting transcription factors Nanog and LRH1 to increase the levels of pro-differentiation proteins like fibroblast growth factor-5 and the tyrosine protein kinase (KDR)
(Tay et al. 2008). KDR is a receptor that interacts with VEGFA, VEGFB and
VEGFC to regulate angiogenesis, proliferation, and vascular permeability (Tay et al. 2008). We show that PMP treatment of HUVEC increased the transcription of MCP-1 and PIGF genes, which could be associated with a pro-inflammatory phenotype and was reversed by transfection of the Let-7a inhibitor. Given that miRNAs bind and inhibit the translation of target mRNA, the increase in the release of MCP-1 and PIGF indicated a secondary regulation by other transcription mechanisms which may have being induced by transfer of Let-7a.
190 The targeting of transcription related proteins through a Let-7a dependent mechanism may be important in PMP mediated angiogenesis. Let-7a can target a wide range of genes, including transcription factors c-Myc (Yongchao Liu et al.
2012) and NF kB (Iliopoulos et al. 2009) that could mediate the observed angiogenic effects. In renal cell carcinoma, Let-7a inhibits proliferation by directly inhibiting c-Myc to block proliferating cell nuclear antigen (PCNA) and cyclin D1 (CCND1) (Yongchao Liu et al. 2012). Conversely, Let-7a has been shown to inhibit the expression of IL-6 through indirect inhibition of NF kB
(Iliopoulos et al. 2009, Persico et al. 1999). Changes in transcription factor activity control the function of many pro-angiogenic proteins including MCP-1
(Miceli et al. 2016) and PIGF (Cao et al. 1996), which we showed are increased by PMP treatment and corresponded to pro-angiogenic phenotype.
There are four key mechanisms by which miRNAs could indirectly regulate transcription of genes.
1. miRNA targeting of transcription factors that physiologically inhibit the expression of MCP-1 and PIGF would allow their transcription to occur and cause increased protein release (Latchman 1996). Indeed, overexpression of the miR-200c in A549 cells inhibits the transcription factor 8 (TCF8), which in turn increases the expression of E-cadherin to promote cell invasion (Hurteau et al. 2007). Because TCF8 negatively regulates the expression of E-cadherin in epithelial cells and plays an important role in epithelial-to mesenchymal transition, miR-200c can indirectly control this process by targeting inhibitory transcription factor TCF8 (Hurteau et al. 2007).
191 2. Alternatively, miRNA targeting of protein kinases that direct a transcription factor to the promoter regions of MCP-1 and PIGF would inhibit the promoter enrichment of such transcription factor and subsequently cause reduced protein release. For instance, Let-7a directly targets the Ras protein kinase leading to the inhibition of the Ras protein kinase signalling that reduces NF kB activity and inhibits IL-6 expression (Iliopoulos et al. 2009).
3. Likewise, miRNA targeting of proteins that form transcription activation or inhibition dimers with a transcription factor that binds to MCP-1 and PIGF promoter regions would allow the formation of alternative dimers, which would reduce or increase their protein expression. For instance, miR-122 was shown to inhibit the transcription of c-Myc by targeting TFDP2 transcription factor and reducing the binding specificity of E2F1 (Wang et al. 2014). The interaction between TFDP2 and E2F1 enhances the transactivation function of the heterodimer in hepatocellular cancer, which allows miR-122 to function as a tumour suppressor (Wang et al. 2014).
4. miRNA targeting of chromatin remodelling proteins associated with changes in the chromatin states of MCP-1 and PIGF genes could modulate their transcription. In breast cancer, miR-22 inhibits the activity of the Ten elven translocation enzymes (TET), thereby remodelling chromatin toward miR-200 silencing and inhibiting its anti-metastatic function (Song et al. 2013). TETs are family of methylcytosine dioxygenases that play an important role in cytosine demethylation and regulation of gene expression through differential chromatin remodelling (Ito et al. 2011).
192 Interestingly, we showed that PMP treatment increased the recruitment of ATF-4 transcription factor to the promoter regions of MCP-1 and PIGF through a Let-7a dependent mechanism. ATF-4 is a member of the activating transcription factors that bind the cAMP responsive element (CRE) and share a Leucine zipper DNA- binding motif with CREBS and CREBs-like proteins (Hai and Curran 1991). ATF-
4 protein can function as either transcriptional activator or inhibitor depending on the interaction with other transcription factors through the Leucine Zipper motif
(Ahn et al. 1998, Lemaigre et al. 1993). ATF-4 protein is implicated in many biological processes, including metabolism and differentiation (Ameri and Harris
2008), and various cancers and vascular diseases, reviewed by Ameri and
Harris (2008). In the vascular system, ATF-4 is induced by injuries and fibroblast growth factor-2, and can serve as conduit for growth factor – growth factor cross talk in atherosclerosis (Malabanan and Khachigian 2010). PMP also increased the transcription of ATF-4 mRNA but did not increase proteins levels in HUVEC suggesting a tight regulation of translation by EC. The tight control of protein levels within HUVEC suggest that the enrichment of ATF-4 protein at the promoter regions of MCP-1 and PIGF is dependent on its interaction with other factors.
miRNA targeting of ATF-4 can regulate gene expression potentially through the mechanism described above. For instance, miR-214 inhibits gluconeogenesis by inhibiting ATF-4 production and ATF-4 – FOXO1 dimer formation (Li et al. 2015).
Moreover, miR-1283 plays a key role in endothelial cells injury through inhibition of ATF-4 by the regulation of the PERK-eIF2α-ATF-4 signalling (He et al. 2016).
193 Let-7a targeting of ATF-4 could modulate other processes through the interaction with other transcription factors like c-Jun, Fos, Fra-1 and CREB, as well as kinases NF kB and P38 (Hai and Curran 1991, Huang et al. 2015), but the implications in angiogenesis, cell migration and proliferation remains poorly described. It is known that the interaction between ATF-4 and these transcription factors described above exhibit variable DNA-binding specificities (CRE or AP-1 consensus), which could facilitate differential regulation of angiogenic genes
(Ameri and Harris 2008). We showed that ATF-4 induces EC migration potentially through increase in MCP-1 release mediated by dimerization with NF kB, P38 or JNK MAP kinases inducing transcription (Huang et al. 2015).
Conversely, ATF-4 inhibits PIGF to regulate placental endoplasmic reticulum through interaction with ATF6a (Mizuuchi et al. 2016). The PMP-Let-7a mediated enrichment of ATF-4 at the promoter regions of MCP-1 and PIGF in
HUVEC correlated with increased migration of ECs treated with PMP. This suggests a potential functional link between ATF-4 enrichment, and increased
MCP-1 and PIGF release by PMP treatment through the effect of delivered Let-
7a on the activity of ATF-4 dimerisation with other transcription factors.
However, the potential interacting factors mediating such pro-angiogenic effects requires further investigation. Such investigation should include inhibition of
ATF-4 and MCP-1 before PMP treatment and assessment of migration.
Potential dimer members involved in this process could be identified by stable isotope labelling in culture before PMP treatment to identify the interacting members through chromatin immuno-precipitation assay.
194 CHAPTER 6: GENERAL DISCUSSION AND FUTURE WORK
6.1 Discussion
The contribution of platelets to the development of CVD is a multifactorial process that heavily depends on cross-talk between platelets and endothelial cells (ECs). Platelets exert influence on ECs through multiple mechanisms, including direct interaction and indirect interactions through soluble proteins and cellular contents. Activated platelets can release large amounts of functional
PMP, which enter the circulation and regulate the function of targets cells by releasing their biomolecules (Hunter et al. 2008). It is known that in response to arterial thrombosis, platelets release significantly more PMP (Mallat et al. 2000).
PMP play important role in the pathogenesis of atherosclerosis and exert angiogenic control through miRNA transfer (Hunter et al. 2008, Janowska-
Wieczorek et al. 2005). Moreover, PMP levels are viewed as a prognostic marker for atherosclerotic vascular disease and inflammation (Pearson et al.
2003, Puddu et al. 2010). Underlying this prognostic potential is the ability of
PMPs to cause angiogenesis. Angiogenesis underlines the progression of cardiovascular diseases (CVD) including arthritis, thrombosis (Armstrong et al.
2011, Glass and Witztum 2001, Järvilehto and Tuohimaa 2009), and cancer
(Folkman 1995). Pathogenic features of angiogenesis such as bleeding, leaky immature blood vessels, infiltration of inflammatory cells and mechanical stress can rupture atherosclerotic plaques. Angiogenesis mediated plaque rupture causes athero-thrombosis and increases CVD morbidity (Folkman 1995). We
195 showed that THBS-1 is a key regulator of this pathological mechanism in-vitro through PMP delivered Let-7a. However, further studies are needed to confirm the in-vivo implication of this signalling pathway in the development of athero- thrombosis. Rodent models of athero-thrombosis that mimic the increased platelet activation seen in human athero-thrombosis have been used extensively
(Furie and Furie 2007, Narayanaswamy et al. 2000, Sachs and Nieswandt
2007). Thus, the athero-thrombotic implications of THBS-1 modulation by PMP delivered Let-7a in those models can easily be studied and should add weight to the evidence of the research in this thesis.
Moreover, the molecular and angiogenic implications of the array of miRNAs in
PMP in this important pathologic control has been unknown until now. We showed that PMPs contains a wide range of miRNAs, potentially contributing to the cumulative pro-angiogenic response of EC. Thus, these miRNAs need further investigations. Such investigations are important because of the evidence that miRNAs can have profound effects when acting within a larger regulatory network that involves other miRNAs, transcription factors and kinases
(Gurtan and Sharp 2013, Schmiedel et al. 2015). The supporting evidence for this can be found in the Let-7 regulation of HMGA2 (Mayr et al. 2007) and the miR-134 regulation of Nanog and LRH1 transcription factors (Tay et al. 2008).
Moreover, there is emerging evidence that miRNAs selectively target transcription factors (Gurtan and Sharp 2013) and are found within network motifs (Gerstein et al. 2012). This evidence suggests that miRNAs act alongside other factors to cause wide spread changes in gene expression associated with
196 a pathogenic phenotype in vascular cells. Thus, initial in-vitro analysis of the miRNAs found in PMP using loss and gain of function analysis will provide much needed evidence of roles in endothelial dysfunction, followed by investigation of the overall effect in-vivo, which will confirm the pathogenic role in atherosclerosis.
Furthermore, angiogenesis is also driven by matrix remodelling/migration, proliferation, and other cytokines. However, we did not fully investigate the mechanisms linking PMP delivered miRNAs to these processes. Cell invasion and migration is an essential process during angiogenesis, both of which are modulated by degradation of the extracellular matrix. We showed increased release of Endoglin, a pro-angiogenic type I integral membrane protein that has been shown to play an important role in TGF-b dependent vascular remodelling during angiogenesis (Guerrero-Esteo et al. 2002, Lebrin and Mummery 2008).
The cytosolic domain of endoglin promotes EC migration and focal adhesion
(Conley et al. 2004, Lebrin and Mummery 2008). Both endoglin and MCP-1 are involved in the pathogenesis of many CVD through their regulation of cell migration and angiogenesis (Ikemoto et al. 2012, Niu and Kolattukudy 2009).
Similarly, cell proliferation is a critical process in maturation of EC’s sprouts and can be regulated by some of the cytokines increased by PMP treatments.
However, PMPs seems to inhibit proliferation in the in-vitro model used in this thesis, thus the actual effects of these proteins in-vivo require investigation. It is important to note that new blood vessels in atherosclerotic plaques are immature and leaky in part due to incomplete EC junctions (Sluimer et al. 2009).
197 While compromised structural integrity will increase leakage, impaired proliferation can also inhibit maturation leading to further leakage and increased risk of rupture (Le Dall et al. 2010).
Let-7a is one of the most investigated miRNAs to date (Roush and Slack 2008), and can target a range of human genes including transcription factor MYC, integrin b3 and THBS-1 (Dogar et al. 2014, Müller and Bosserhoff 2008, Park et al. 2007, Peter 2009, Sampson et al. 2007), hence regulating apoptosis, cell migration and proliferation. Despite the work previously published, it’s effects are not fully explained. The targeting of THBS-1 mRNA in HUVEC by PMP transferred Let-7a chiefly modulate the functional effect of PMP on EC. The inhibition of THBS-1 translation enabled PMP to increase angiogenesis and migration in the presence of functional CD29 and CD47 surface receptors and reduced cleaving of caspase-3, an apoptotic marker. The multi-functional role of
Let-7a was clear in the increased transcription of the key migration mediator
(MCP-1) and potentially key growth factor (PIGF), which is further supported by
Let-7a’s ability to induce angiogenesis independent of other PMP miRNAs
(Summarised in Figure 6.1). These results suggest that Let-7a is a master regulator of PMP induced angiogenesis, which is supported by its ability to induce angiogenesis independent of other biomolecules contained in PMP.
Let-7 miRNA family members are expressed in many cardiovascular systems including the recent evidence that PMP contain significant amounts of this family of miRNAs. Besides cardiovascular pathologies, Let-7 family is important in
198 heart development and embryonic differentiation (Bao et al. 2013), so it has multiple roles. In addition to targeting THBS-1 and MCP-1 (indirectly), Let-7 family members directly target toll-like receptor 4 and cyclin D2 and indirectly target angiopoietin II, reviewed extensively in (Bao et al. 2013), emphasising their importance in health and disease. Let-7 family members are highly expressed in many CVD and contribute in the pathogenesis of heart hypertrophy, atherosclerosis, myocardial infarction and hypertension (Bao et al.
2013). For instance, the levels of circulating Let-7b and Let-7i potentially derived from platelets and PMP are predicted biomarkers of myocardial infarction and dilated cardiomyopathy respectively (Bao et al. 2013). Functionally, reduction of
Let-7f and Let-7b inhibit EC sprouting that is associated with angiogenesis
(Kuehbacher et al. 2007, Otsuka et al. 2008). Though the knockdown of Dicer in
EC inhibited angiogenesis and impaired migration with reduced levels of these miRNAs including Let-7a, the effect of Let-7a on angiogenesis have not been independently investigated (Suarez et al. 2007). However, many published studies validate mRNA targets of Let-7 miRNA members like THBS-1, THBS-2,
TIMP-1, Tie-1 and Tie-2 all of which are important players in angiogenesis (Bao et al. 2013). Therefore, characterisation of the sources and roles of these multi- functional miRNA family members in the development and progression of CVD through angiogenesis require further investigation.
6.2 Conclusion
We show that platelet micro-particles regulate endothelial cell function through a complex biological, cellular, and molecular effects mediated by transferred microRNA (summarised in Figure 6.1).
199 Specifically, we showed that;
1. A unique profile of cytokines stays bound on the surface of platelet
microparticles, including CD40L, ICAM-1, RANTES, C5/C5a, which are
known mediates of inflammatory response, cell-cell adhesion, platelet
activation, migration, and chemotaxis.
2. Platelet microparticles contain more than 500 diverse miRNA species and
a high amount of Let-7a family members.
3. Platelets microparticles have more than 2000 mRNA species, with a high
number of thrombospodin-1 transcript.
4. Platelet microparticles are internalised by endothelial cells in a time
dependent manner.
5. Platelet micro-particles induce angiogenesis and migration, while
inhibiting proliferation.
6. Platelet micro-particles induce the release of novel pro-angiogenic
cytokine subsets specific to platelet micro-particle’s RNA content.
7. The targeting of thrombospondin-1 mRNA by platelet micro-particles’
transferred Let-7a chiefly modulate the angiogenic effect on endothelial
cells.
8. The ability to increase angiogenesis through Let-7a inhibition of
thrombospondin-1 translation needs functional integrin beta-1 and
integrin associated protein.
9. Platelet microparticles reduces the cleaving of caspase-3, a pro-apoptotic
protein and downstream of thrombospodin-1 through integrin associated
protein.
200 10. Platelet micro-particle modulate the transcription of monocyte
chemoattractant protein-1 and placental growth factor in a Let-7a
dependent manner.
11. Platelet micro-particles increases the enrichment of activating
transcription factor-4 at the promoter regions of monocyte
chemoattractant protein-1 and placental growth factor in a Let-7a
dependent manner.
12. Finally, Let-7a induces angiogenesis independent of other platelet micro-
particle’s microRNAs.
201
Figure 6.1: Proposed model for the action of PMP transferred Let-7a on endothelial THBS-1 protein level. PMPs transfer Let-7a that inhibit THBS-1 translation, the resultant reduced THBS-1 concentration reduces the bioavailability of THBS-1 to bind CD47 and CD29, and inhibits the cleaving of caspase-3. The events that reduce the inhibition of migration/ induction of apoptosis and angiogenesis by THBS-1. PMP through Let-7a mechanism increase ATF-4 recruitment to the promoter region of MCP-1 and PIGF, with increased transcription.
202 6.3 Future Work
1. As elaborated in chapter 6, the in-vitro evidence showing that PMP delivered
Let-7a inhibits THBS-1 protein release to induce angiogenesis requires investigation in-vivo in animal models of athero-thrombosis, inflammation and
CVD. The investigations presented in this thesis will help confirm the athero- thrombotic and CVD implications of PMP induced angiogenesis through THBS-
1-Let-7a pathway.
2. There is evidence of pathological development of immature blood vessels in
CVD, which are leaky and promote plaque rupture (Jain et al. 2007). Therefore, the observed reduction in EC proliferation might be playing a pathological role and requires further investigation. The in-vivo confirmation of the role of PMP-
Let-7a in CVD (described in 1) needs to incorporate this aspect.
3. Literature evidence shows that MCP-1 contributes in the pathogenesis of
CVD through increased recruitment of inflammatory cells and induction of vascular permeability (Sprague and Khalil 2009). Therefore, future in-vitro studies and potentially in-vivo studies need to investigate if the Let-7a mediated increase in MCP-1 modulates recruitment of inflammatory cells and increases vascular permeability. The in-vitro investigations should involve siRNA inhibition of ATF-4 before the treatment with PMP in the presence of Let-7a inhibitor to see if MCP-1 protein release is reversed to basal levels.
203 4. Published evidence seems to show that miR-221 is preferentially degraded to enhance angiogenesis, future studies using miRNA inhibitors can investigate the mechanisms underlying this process. Again, the proposed in-vivo investigation
(described in 1 and 2) might need to incorporate this goal.
5. The array of proteins modulated by PMP cannot only be linked to direct targeting by miRNA, or the activity of Let-7a miRNA. As PMPs contain a diverse species of miRNA, the observed angiogenic phenotype following PMP treatment and reversal in RNAse treatment suggest that PMP-miRNA species act in a coordinated manner to regulate angiogenesis. These proteins can regulate EC migration, survival, extracellular matrix remodelling and proliferation in angiogenesis (Ahmed and Bicknell 2009). Experimental validation of the predicated functional targets of the PMP-miRNA content should be conducted to guide the investigation into their effects on cytokine release. Initial approaches should also include the inhibition of individual miRNAs (in addition to Let-7a) to study their mechanisms. Moreover, the findings of such validation and functional analysis should be extended to animal models to confirm any potential role in athero-thrombosis and CVD.
6. Other pathological conditions such as psoriasis, diabetes, renal diseases and neurological diseases directly or indirectly linked to athero-thrombosis should be the target of long-term investigations. This is very important because of the array of signalling pathways like the mitogenic Ras signalling, cytokine-cytokine receptor signalling and growth factor pathways revealed by the computational
204 target prediction analysis. Beyond the involvement in angiogenesis and CVD, potential renal and neurological roles of PMP delivered miRNAs could be explored based on the results of the computational prediction.
205 PRESENTATIONS AND POSTERS
Poster: Platelet Micro-particles induced angiogenesis is dependent on post- transcription regulation of thrombospondin-1 through the transferred microRNA Let-7a. Northern vascular biology forum, University of Hull (8 December 2016).
Presentation: Platelet derived Micro-particles: a novel carrier for genetic information within the vascular system. Center for skin sciences, University of Bradford. (30 October 2016).
Poster: Platelet Micro-particles induced angiogenesis through transferring the microRNA Let-7a. School of Life Sciences, University of Bradford. (27 May 2016).
Presentation: Platelet derived Micro-particles stimulate angiogenesis. School of Life Sciences, University of Bradford. (27 May 2015).
206 REFERENCES
Aatonen, M., Gronholm, M. and Siljander, P. R. (2012) Platelet-derived microvesicles: multitalented participants in intercellular communication. Semin Thromb Hemost, 38(1), pp. 102-13.
Abrams, C. S., Ellison, N., Budzynski, A. and Shattil, S. (1990) Direct detection of activated platelets and platelet-derived microparticles in humans. Blood, 75(1), pp. 128-138.
Adams, J. C. (1997) Thrombospondin-1. The international journal of biochemistry & cell biology, 29(6), pp. 861-865.
Addison, C. L., Daniel, T. O., Burdick, M. D., Liu, H., Ehlert, J. E., Xue, Y. Y., Buechi, L., Walz, A., Richmond, A. and Strieter, R. M. (2000) The CXC chemokine receptor 2, CXCR2, is the putative receptor for ELR+ CXC chemokine-induced angiogenic activity. The Journal of Immunology, 165(9), pp. 5269-5277.
Adrover, J. M. and Hidalgo, A. (2015) Activated Platelets Jam Up the Plaque. Circ Res, 116(4), pp. 557-559.
Ahmed, A., Dunk, C., Ahmad, S. and Khaliq, A. (2000) Regulation of placental vascular endothelial growth factor (VEGF) and placenta growth factor (PlGF) and soluble Flt-1 by oxygen—a review. Placenta, 21, pp. S16- S24.
Ahmed, Z. and Bicknell, R. (2009) Angiogenic signalling pathways. Angiogenesis Protocols: Second Edition, pp. 3-24.
Ahn, S., Olive, M., Aggarwal, S., Krylov, D., Ginty, D. D. and Vinson, C. (1998) A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol, 18(2), pp. 967- 977.
Albelda, S. and Buck, C. (1990) Integrins and other cell adhesion molecules. FASEB journal: official publication of the Federation of American Societies for Experimental Biology, 4(11), pp. 2868-2880.
Ameri, K. and Harris, A. L. (2008) Activating transcription factor 4. The international journal of biochemistry & cell biology, 40(1), pp. 14-21.
207 Anand, S., Majeti, B. K., Acevedo, L. M., Murphy, E. A., Mukthavaram, R., Scheppke, L., Huang, M., Shields, D. J., Lindquist, J. N. and Lapinski, P. E. (2010) MicroRNA-132-mediated loss of p120RasGAP activates the endothelium to facilitate pathological angiogenesis. Nature medicine, 16(8), pp. 909-914.
Andaloussi, S. E., Mäger, I., Breakefield, X. O. and Wood, M. J. (2013) Extracellular vesicles: biology and emerging therapeutic opportunities. Nature reviews Drug discovery, 12(5), pp. 347-357.
Antwi-Baffour, S., Kholia, S., Aryee, Y. K. D., Ansa-Addo, E. A., Stratton, D., Lange, S. and Inal, J. M. (2010) Human plasma membrane-derived vesicles inhibit the phagocytosis of apoptotic cells – Possible role in SLE. Biochem Biophys Res Commun, 398(2), pp. 278-283.
Armstrong, A. W., Voyles, S. V., Armstrong, E. J., Fuller, E. N. and Rutledge, J. C. (2011) Angiogenesis and oxidative stress: common mechanisms linking psoriasis with atherosclerosis. Journal of dermatological science, 63(1), pp. 1-9.
Armstrong, L. C. and Bornstein, P. (2003) Thrombospondins 1 and 2 function as inhibitors of angiogenesis. Matrix Biology, 22(1), pp. 63-71.
Arrebola-Moreno, A. L., Laclaustra, M. and Kaski, J. C. (2012) Noninvasive assessment of endothelial function in clinical practice. Revista Española de Cardiología (English Edition), 65(1), pp. 80-90.
Asahara, T., Chen, D., Takahashi, T., Fujikawa, K., Kearney, M., Magner, M., Yancopoulos, G. D. and Isner, J. M. (1998) Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization. Circ Res, 83(3), pp. 233-240.
Autiero, M., Waltenberger, J., Communi, D., Kranz, A., Moons, L., Lambrechts, D., Kroll, J., Plaisance, S., De Mol, M. and Bono, F. (2003) Role of PlGF in the intra-and intermolecular cross talk between the VEGF receptors Flt1 and Flk1. Nature medicine, 9(7), pp. 936-943.
Azzam, H. and Zagloul, M. (2009) Elevated platelet microparticle levels in valvular atrial fibrillation. Hematology, 14(6), pp. 357-360.
Bach, T. L., Barsigian, C., Chalupowicz, D. G., Busler, D., Yaen, C. H., Grant, D. S. and Martinez, J. (1998) VE-Cadherin Mediates Endothelial Cell Capillary Tube Formation in Fibrin and Collagen Gels 1. Experimental cell research, 238(2), pp. 324-334.
Baj-Krzyworzeka, M., Szatanek, R., Weglarczyk, K., Baran, J., Urbanowicz, B., Branski, P., Ratajczak, M. Z. and Zembala, M. (2006) Tumour-derived microvesicles carry several surface determinants and mRNA of tumour
208 cells and transfer some of these determinants to monocytes. Cancer Immunol Immunother, 55(7), pp. 808-18.
Bal, L., Ederhy, S., Di Angelantonio, E., Toti, F., Zobairi, F., Dufaitre, G., Meuleman, C., Mallat, Z., Boccara, F. and Tedgui, A. (2010) Circulating procoagulant microparticles in acute pulmonary embolism: A case– control study. International journal of cardiology, 145(2), pp. 321-322.
Bale, M. D., Westrick, L. and Mosher, D. (1985) Incorporation of thrombospondin into fibrin clots. Journal of Biological Chemistry, 260(12), pp. 7502-7508.
Bang, C., Fiedler, J. and Thum, T. (2012) Cardiovascular Importance of the MicroRNA-23/27/24 Family. Microcirculation, 19(3), pp. 208-214.
Bao, M.-H., Feng, X., Zhang, Y.-W., Lou, X.-Y., Cheng, Y. and Zhou, H.-H. (2013) Let-7 in Cardiovascular Diseases, Heart Development and Cardiovascular Differentiation from Stem Cells. International journal of molecular sciences, 14(11), pp. 23086-23102.
Barry, O. P. and FitzGerald, G. A. (1999) Mechanisms of cellular activation by platelet microparticles. Thromb Haemost, 82(2), pp. 794-800.
Barry, O. P., Praticò, D., Lawson, J. A. and FitzGerald, G. A. (1997) Transcellular activation of platelets and endothelial cells by bioactive lipids in platelet microparticles. The Journal of clinical investigation, 99(9), pp. 2118.
Barry, O. P., Praticò, D., Savani, R. C., FitzGerald and GA (1998) Modulation of monocyte-endothelial cell interactions by platelet microparticles. Journal of Clinical Investigation, 102(1), pp. 136.
Bartel, D. P. (2009) MicroRNAs: target recognition and regulatory functions. Cell, 136(2), pp. 215-233.
Bello, L., Francolini, M., Marthyn, P., Zhang, J., Carroll, R. S., Nikas, D. C., Strasser, J. F., Villani, R., Cheresh, D. A. and Black, P. M. (2001) αvβ3 and αvβ5 integrin expression in glioma periphery. Neurosurgery, 49(2), pp. 380-390.
BenEzra, D., Griffin, B. W., Maftzir, G. and Aharonov, O. (1993) Thrombospondin and in vivo angiogenesis induced by basic fibroblast growth factor or lipopolysaccharide. Investigative ophthalmology & visual science, 34(13), pp. 3601-3608.
Berezikov, E. (2011) Evolution of microRNA diversity and regulation in animals. Nature Reviews Genetics, 12(12), pp. 846-860.
209 Bernstein, E., Caudy, A. A., Hammond, S. M. and Hannon, G. J. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409(6818), pp. 363-366.
Bhadada, S. V., Goyal, B. R. and Patel, M. M. (2011) Angiogenic targets for potential disorders. Fundamental & clinical pharmacology, 25(1), pp. 29- 47.
Bhatnagar, P., Wickramasinghe, K., Wilkins, E. and Townsend, N. (2016) Trends in the epidemiology of cardiovascular disease in the UK. Heart, 102(24), pp. 1945-1952.
Bikfalvi, A. (2004) Platelet factor 4: an inhibitor of angiogenesis. in Semin Thromb Hemost: Copyright© 2004 by Thieme Medical Publishers, Inc., 333 Seventh Avenue, New York, NY 10001, USA. pp. 379-385.
Blaszczyk, J., Tropea, J. E., Bubunenko, M., Routzahn, K. M., Waugh, D. S., Court, D. L. and Ji, X. (2001) Crystallographic and modeling studies of RNase III suggest a mechanism for double-stranded RNA cleavage. Structure, 9(12), pp. 1225-1236.
Boerma, M., Burton, G. R., Wang, J., Fink, L. M., McGehee Jr, R. E. and Hauer- Jensen, M. (2006) Comparative expression profiling in primary and immortalized endothelial cells: changes in gene expression in response to hydroxy methylglutaryl-coenzyme A reductase inhibition. Blood coagulation & fibrinolysis, 17(3), pp. 173-180.
Boger, D. L., Goldberg, J., Silletti, S., Kessler, T. and Cheresh, D. A. (2001) Identification of a novel class of small-molecule antiangiogenic agents through the screening of combinatorial libraries which function by inhibiting the binding and localization of proteinase MMP2 to integrin αVβ3. Journal of the American Chemical Society, 123(7), pp. 1280-1288.
Boilard, E., Nigrovic, P. A., Larabee, K., Watts, G. F., Coblyn, J. S., Weinblatt, M. E., Massarotti, E. M., Remold-O’Donnell, E., Farndale, R. W. and Ware, J. (2010a) Platelets amplify inflammation in arthritis via collagen- dependent microparticle production. Science, 327(5965), pp. 580-583.
Boilard, E., Nigrovic, P. A., Larabee, K., Watts, G. F. M., Coblyn, J. S., Weinblatt, M. E., Massarotti, E. M., Remold-O’Donnell, E., Farndale, R. W., Ware, J. and Lee, D. M. (2010b) Platelets Amplify Inflammation in Arthritis via Collagen-Dependent Microparticle Production. Science, 327(5965), pp. 580-583.
Bonauer, A., Carmona, G., Iwasaki, M., Mione, M., Koyanagi, M., Fischer, A., Burchfield, J., Fox, H., Doebele, C. and Ohtani, K. (2009) MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science, 324(5935), pp. 1710-1713.
210
Bornstein, P. (1995) Diversity of function is inherent in matricellular proteins: an appraisal of thrombospondin 1. J Cell Biol, 130(3), pp. 503-506.
Bornstein, P. (2001) Thrombospondins as matricellular modulators of cell function. The Journal of clinical investigation, 107(8), pp. 929-934.
Brass, L. F. (2003) Thrombin and platelet activation. CHEST Journal, 124(3_suppl), pp. 18S-25S.
Brill, A., Dashevsky, O., Rivo, J., Gozal, Y. and Varon, D. (2005) Platelet-derived microparticles induce angiogenesis and stimulate post-ischemic revascularization. Cardiovascular research, 67(1), pp. 30-38.
Brooks, P. C., Clark, R. and Cheresh, D. A. (1994) Requirement of vascular integrin alpha v beta 3 for angiogenesis. Science, 264(5158), pp. 569- 571.
Brooks, P. C., Strömblad, S., Sanders, L. C., von Schalscha, T. L., Aimes, R. T., Stetler-Stevenson, W. G., Quigley, J. P. and Cheresh, D. A. (1996) Localization of matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin αvβ3. Cell, 85(5), pp. 683-693.
Büssing, I., Slack, F. J. and Großhans, H. (2008) let-7 microRNAs in development, stem cells and cancer. Trends in molecular medicine, 14(9), pp. 400-409.
Cao, Y., Linden, P., Shima, D., Browne, F. and Folkman, J. (1996) In vivo angiogenic activity and hypoxia induction of heterodimers of placenta growth factor/vascular endothelial growth factor. Journal of Clinical Investigation, 98(11), pp. 2507.
Caporali, A. and Emanueli, C. (2011) MicroRNA regulation in angiogenesis. Vascular pharmacology, 55(4), pp. 79-86.
Caporali, A., Meloni, M., Völlenkle, C., Bonci, D., Sala-Newby, G. B., Addis, R., Spinetti, G., Losa, S., Masson, R. and Baker, A. H. (2011) Deregulation of microRNA-503 contributes to diabetes mellitus–induced impairment of endothelial function and reparative angiogenesis after limb ischemia. Circulation, 123(3), pp. 282-291.
Carmeliet, P. (2000) Mechanisms of angiogenesis and arteriogenesis. Nature medicine, 6(4), pp. 389.
Carmeliet, P. (2003) Angiogenesis in health and disease. Nature medicine, 9(6), pp. 653-660.
211 Carmeliet, P. and Jain, R. K. (2000) Angiogenesis in cancer and other diseases. Nature, 407(6801), pp. 249-257.
Casey, R., Joyce, M., Roche-Nagle, G., Cox, D. and Bouchier-Hayes, D. (2004) Young male smokers have altered platelets and endothelium that precedes atherosclerosis. Journal of surgical research, 116(2), pp. 227- 233.
Chandrasekaran, S., Guo, N.-h., Rodrigues, R. G., Kaiser, J. and Roberts, D. D. (1999) Pro-adhesive and chemotactic activities of thrombospondin-1 for breast carcinoma cells are mediated by α3β1 integrin and regulated by insulin-like growth factor-1 and CD98. Journal of Biological Chemistry, 274(16), pp. 11408-11416.
Chang, T.-C., Yu, D., Lee, Y.-S., Wentzel, E. A., Arking, D. E., West, K. M., Dang, C. V., Thomas-Tikhonenko, A. and Mendell, J. T. (2008) Widespread microRNA repression by Myc contributes to tumorigenesis. Nature genetics, 40(1), pp. 43-50.
Chen, Y. and Gorski, D. H. (2008) Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5. Blood, 111(3), pp. 1217-1226.
Chiang, H. R., Schoenfeld, L. W., Ruby, J. G., Auyeung, V. C., Spies, N., Baek, D., Johnston, W. K., Russ, C., Luo, S. and Babiarz, J. E. (2010) Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Genes & Development, 24(10), pp. 992-1009.
Cloutier, N., Pare, A., Farndale, R. W., Schumacher, H. R., Nigrovic, P. A., Lacroix, S. and Boilard, E. (2012) Platelets can enhance vascular permeability. Blood, 120(6), pp. 1334-43.
Cloutier, N., Tan, S., Boudreau, L. H., Cramb, C., Subbaiah, R., Lahey, L., Albert, A., Shnayder, R., Gobezie, R., Nigrovic, P. A., Farndale, R. W., Robinson, W. H., Brisson, A., Lee, D. M. and Boilard, E. (2013) The exposure of autoantigens by microparticles underlies the formation of potent inflammatory components: the microparticle-associated immune complexes. EMBO Mol Med, 5(2), pp. 235-49.
Coleman, M. L., Sahai, E. A., Yeo, M., Bosch, M., Dewar, A. and Olson, M. F. (2001) Membrane blebbing during apoptosis results from caspase- mediated activation of ROCK I. Nature cell biology, 3(4), pp. 339-345.
Conley, B. A., Koleva, R., Smith, J. D., Kacer, D., Zhang, D., Bernabeu, C. and Vary, C. P. (2004) Endoglin controls cell migration and composition o focal adhesions: Function of the cytosolic doamin. Journal of Biological Chemistry.
212 Coughlin, S. R. (2000) Thrombin signalling and protease-activated receptors. Nature, 407(6801), pp. 258-264.
Crawford, T. N., Alfaro, I., Kerrison, J. B. and Jablon, E. P. (2009) Diabetic retinopathy and angiogenesis. Current diabetes reviews, 5(1), pp. 8-13.
Creager, M. A., Lüscher, T. F., Cosentino, F. and Beckman, J. A. (2003) Diabetes and vascular disease pathophysiology, clinical consequences, and medical therapy: part I. Circulation, 108(12), pp. 1527-1532.
Crisby, M., Nordin-Fredriksson, G., Shah, P. K., Yano, J., Zhu, J. and Nilsson, J. (2001) Pravastatin treatment increases collagen content and decreases lipid content, inflammation, metalloproteinases, and cell death in human carotid plaques implications for plaque stabilization. Circulation, 103(7), pp. 926-933.
Crouch, S., Kozlowski, R., Slater, K. and Fletcher, J. (1993) The use of ATP bioluminescence as a measure of cell proliferation and cytotoxicity. Journal of immunological methods, 160(1), pp. 81-88.
Cui, W., Zhou, J., Dehne, N. and Brüne, B. (2015) Hypoxia induces calpain activity and degrades SMAD2 to attenuate TGFβ signaling in macrophages. Cell & bioscience, 5(1), pp. 36.
Daleke, D. L. (2003) Regulation of transbilayer plasma membrane phospholipid asymmetry. Journal of lipid research, 44(2), pp. 233-242.
Davis-Dusenbery, B. N. and Hata, A. (2010) Mechanisms of control of microRNA biogenesis. Journal of biochemistry, 148(4), pp. 381-392.
Dawson, D. W., Pearce, S. F. A., Zhong, R., Silverstein, R. L., Frazier, W. A. and Bouck, N. P. (1997) CD36 mediates the in vitro inhibitory effects of thrombospondin-1 on endothelial cells. J Cell Biol, 138(3), pp. 707-717.
Dawson, D. W., Volpert, O. V., Pearce, S. F. A., Schneider, A. J., Silverstein, R. L., Henkin, J. and Bouck, N. P. (1999) Three distinct D-amino acid substitutions confer potent antiangiogenic activity on an inactive peptide derived from a thrombospondin-1 type 1 repeat. Molecular Pharmacology, 55(2), pp. 332-338.
Deanfield, J. E., Halcox, J. P. and Rabelink, T. J. (2007) Endothelial function and dysfunction. Circulation, 115(10), pp. 1285-1295.
Dejana, E. (1996) Endothelial adherens junctions: implications in the control of vascular permeability and angiogenesis. Journal of Clinical Investigation, 98(9), pp. 1949.
213 Dejana, E., Orsenigo, F., Molendini, C., Baluk, P. and McDonald, D. M. (2009) Organization and signaling of endothelial cell-to-cell junctions in various regions of the blood and lymphatic vascular trees. Cell and tissue research, 335(1), pp. 17-25.
Delamater, A. M., Marchante, A. and Hernandez, J. (2015) Psychological problems and management of patients with diabetes mellitus. International Textbook of Diabetes Mellitus, Fourth Edition, Fourth Edition, pp. 846-852.
Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F. and Hannon, G. J. (2004) Processing of primary microRNAs by the Microprocessor complex. Nature, 432(7014), pp. 231-235.
Deshmane, S. L., Kremlev, S., Amini, S. and Sawaya, B. E. (2009) Monocyte chemoattractant protein-1 (MCP-1): an overview. Journal of interferon & cytokine research, 29(6), pp. 313-326.
Dews, M., Homayouni, A., Yu, D., Murphy, D., Sevignani, C., Wentzel, E., Furth, E. E., Lee, W. M., Enders, G. H. and Mendell, J. T. (2006) Augmentation of tumor angiogenesis by a Myc-activated microRNA cluster. Nature genetics, 38(9), pp. 1060-1065.
Diamant, M., Tushuizen, M. E., Sturk, A. and Nieuwland, R. (2004) Cellular microparticles: new players in the field of vascular disease? European journal of clinical investigation, 34(6), pp. 392-401.
Diehl, P., Fricke, A., Sander, L., Stamm, J., Bassler, N., Htun, N., Ziemann, M., Helbing, T., El-Osta, A. and Jowett, J. B. (2012a) Microparticles: major transport vehicles for distinct microRNAs in circulation. Cardiovascular research, pp. cvs007.
Diehl, P., Fricke, A., Sander, L., Stamm, J., Bassler, N., Htun, N., Ziemann, M., Helbing, T., El-Osta, A. and Jowett, J. B. (2012b) Microparticles: major transport vehicles for distinct microRNAs in circulation. Cardiovascular research, 93(4), pp. 633-644.
Diehl, P., Fricke, A., Sander, L., Stamm, J., Bassler, N., Htun, N., Ziemann, M., Helbing, T., El-Osta, A., Jowett, J. B. M. and Peter, K. (2012c) Microparticles: major transport vehicles for distinct microRNAs in circulation. Cardiovascular research.
Dinauer, M. C. and Newburger, P. (1993) The respiratory burst oxidase and the molecular genetics of chronic granulomatous disease. Critical reviews in clinical laboratory sciences, 30(4), pp. 329-369.
214 Distler, J., Hirth, A., Kurowska-Stolarska, M. and Gay, R. (2003) Angiogenic and angiostatic factors in the molecular control of angiogenesis. The Quarterly Journal of Nuclear Medicine and Molecular Imaging, 47(3), pp. 149.
Dogar, A. M., Semplicio, G., Guennewig, B. and Hall, J. (2014) Multiple microRNAs derived from chemically synthesized precursors regulate thrombospondin 1 expression. nucleic acid therapeutics, 24(2), pp. 149- 159.
Dzau, V. and Gibbons, G. (1991) Endothelium and growth factors in vascular remodeling of hypertension. Hypertension, 18(5 Suppl), pp. III115.
El-Benna, J., Dang, P. M.-C., Gougerot-Pocidalo, M.-A., Marie, J.-C. and Braut- Boucher, F. (2009) p47phox, the phagocyte NADPH oxidase/NOX2 organizer: structure, phosphorylation and implication in diseases. Experimental & molecular medicine, 41(4), pp. 217-225.
Eliceiri, B. P. and Cheresh, D. A. (2001) Adhesion events in angiogenesis. Current opinion in cell biology, 13(5), pp. 563-568.
Esemuede, N., Lee, T., Pierre-Paul, D., Sumpio, B. E. and Gahtan, V. (2004) The role of thrombospondin-1 in human disease 1. Journal of surgical research, 122(1), pp. 135-142.
Fasanaro, P., D'Alessandra, Y., Di Stefano, V., Melchionna, R., Romani, S., Pompilio, G., Capogrossi, M. C. and Martelli, F. (2008) MicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3. Journal of Biological Chemistry, 283(23), pp. 15878-15883.
Fath, K. R. and Burgess, D. R. (1993) Golgi-derived vesicles from developing epithelial cells bind actin filaments and possess myosin-I as a cytoplasmically oriented peripheral membrane protein. J Cell Biol, 120(1), pp. 117-127.
Feng, J., Liu, Y., Sabe, A. A., Sadek, A. A., Singh, A. K., Sodha, N. R. and Sellke, F. W. (2015) Differential impairment of adherens-junction expression/phosphorylation after cardioplegia in diabetic versus non- diabetic patients. European Journal of Cardio-Thoracic Surgery, pp. ezv202.
Fish, J. E., Santoro, M. M., Morton, S. U., Yu, S., Yeh, R.-F., Wythe, J. D., Ivey, K. N., Bruneau, B. G., Stainier, D. Y. and Srivastava, D. (2008) miR-126 regulates angiogenic signaling and vascular integrity. Developmental cell, 15(2), pp. 272-284.
Flaumenhaft, R., Dilks, J. R., Richardson, J., Alden, E., Patel-Hett, S. R., Battinelli, E., Klement, G. L., Sola-Visner, M. and Italiano, J. E. (2009)
215 Megakaryocyte-derived microparticles: direct visualization and distinction from platelet-derived microparticles. Blood, 113(5), pp. 1112-1121.
Folkman, J. (1995) Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature medicine, 1(1), pp. 27-30.
Folkman, J. (2002) Role of angiogenesis in tumor growth and metastasis. in Seminars in oncology: Elsevier. pp. 15-18.
Forlow, S. B., McEver, R. P. and Nollert, M. U. (2000) Leukocyte-leukocyte interactions mediated by platelet microparticles under flow. Blood, 95(4), pp. 1317-1323.
Freedman, J. E., Larson, M. G., Tanriverdi, K., O'Donnell, C. J., Morin, K., Hakanson, A. S., Vasan, R. S., Johnson, A. D., Iafrati, M. D. and Benjamin, E. J. (2010) Relation of platelet and leukocyte inflammatory transcripts to body mass index in the Framingham heart study. Circulation, 122(2), pp. 119-29.
Friedman, R. C., Farh, K. K.-H., Burge, C. B. and Bartel, D. P. (2009) Most mammalian mRNAs are conserved targets of microRNAs. Genome Res, 19(1), pp. 92-105.
Friedman, S. L. (2000) Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. Journal of Biological Chemistry, 275(4), pp. 2247-2250.
Furie, B. and Furie, B. (2007) In vivo thrombus formation. Journal of Thrombosis and Haemostasis, 5(s1), pp. 12-17.
Furman, M. I., Barnard, M. R., Krueger, L. A., Fox, M. L., Shilale, E. A., Lessard, D. M., Marchese, P., Frelinger, A. L., 3rd, Goldberg, R. J. and Michelson, A. D. (2001) Circulating monocyte-platelet aggregates are an early marker of acute myocardial infarction. J Am Coll Cardiol, 38(4), pp. 1002- 6.
Gale, N. W. and Yancopoulos, G. D. (1999) Growth factors acting via endothelial cell-specific receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development. Genes & Development, 13(9), pp. 1055-1066.
Gambim, M. H., Do Carmo, A. D. O., Marti, L., Veríssimo-Filho, S., Lopes, L. R. and Janiszewski, M. (2007) Platelet-derived exosomes induce endothelial cell apoptosis through peroxynitrite generation: experimental evidence for a novel mechanism of septic vascular dysfunction. Critical Care, 11(5), pp. R107.
George, J. N., Pickett, E., Saucerman, S., McEver, R., Kunicki, T., Kieffer, N. and Newman, P. (1986a) Platelet surface glycoproteins. Studies on
216 resting and activated platelets and platelet membrane microparticles in normal subjects, and observations in patients during adult respiratory distress syndrome and cardiac surgery. Journal of Clinical Investigation, 78(2), pp. 340.
George, J. N., Pickett, E. B., Saucerman, S., McEver, R. P., Kunicki, T. J., Kieffer, N. and Newman, P. (1986b) Platelet surface glycoproteins. Studies on resting and activated platelets and platelet membrane microparticles in normal subjects, and observations in patients during adult respiratory distress syndrome and cardiac surgery. Journal of Clinical Investigation, 78(2), pp. 340.
Gerhardt, H., Golding, M., Fruttiger, M., Ruhrberg, C., Lundkvist, A., Abramsson, A., Jeltsch, M., Mitchell, C., Alitalo, K. and Shima, D. (2003) VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia. J Cell Biol, 161(6), pp. 1163-1177.
Gerstein, M. B., Kundaje, A., Hariharan, M., Landt, S. G., Yan, K.-K., Cheng, C., Mu, X. J., Khurana, E., Rozowsky, J. and Alexander, R. (2012) Architecture of the human regulatory network derived from ENCODE data. Nature, 489(7414), pp. 91-100.
Ghosh, G., Subramanian, I. V., Adhikari, N., Zhang, X., Joshi, H. P., Basi, D., Chandrashekhar, Y., Hall, J. L., Roy, S. and Zeng, Y. (2010) Hypoxia- induced microRNA-424 expression in human endothelial cells regulates HIF-α isoforms and promotes angiogenesis. The Journal of clinical investigation, 120(11), pp. 4141.
Giancotti, F. G. and Ruoslahti, E. (1999) Integrin signaling. Science, 285(5430), pp. 1028-1033.
Giannotta, M., Trani, M. and Dejana, E. (2013) VE-cadherin and endothelial adherens junctions: active guardians of vascular integrity. Developmental cell, 26(5), pp. 441-454.
Gidlof, O., van der Brug, M., Ohman, J., Gilje, P., Olde, B., Wahlestedt, C. and Erlinge, D. (2013) Platelets activated during myocardial infarction release functional miRNA, which can be taken up by endothelial cells and regulate ICAM1 expression. Blood, 121(19), pp. 3908-17, s1-26.
Glass, C. K. and Witztum, J. L. (2001) Atherosclerosis: the road ahead. Cell, 104(4), pp. 503-516.
Goichot, B., Grunebaum, L., Desprez, D., Vinzio, S., Meyer, L., Schlienger, J., Lessard, M. and Simon, C. (2006) Circulating procoagulant microparticles in obesity. Diabetes & metabolism, 32(1), pp. 82-85.
217 Gomez, D., Alonso, D., Yoshiji, H. and Thorgeirsson, U. (1997) Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. European journal of cell biology, 74(2), pp. 111-122.
Goodwin, A. M. (2007) In vitro assays of angiogenesis for assessment of angiogenic and anti-angiogenic agents. Microvascular research, 74(2-3), pp. 172-183.
Gosline, S. J., Gurtan, A. M., JnBaptiste, C. K., Bosson, A., Milani, P., Dalin, S., Matthews, B. J., Yap, Y. S., Sharp, P. A. and Fraenkel, E. (2016) Elucidating MicroRNA regulatory networks using transcriptional, post- transcriptional, and histone modification measurements. Cell reports, 14(2), pp. 310-319.
Gregory, R. I., Yan, K.-p., Amuthan, G., Chendrimada, T., Doratotaj, B., Cooch, N. and Shiekhattar, R. (2004) The Microprocessor complex mediates the genesis of microRNAs. Nature, 432(7014), pp. 235-240.
Griffiths-Jones, S., Saini, H. K., van Dongen, S. and Enright, A. J. (2008) miRBase: tools for microRNA genomics. Nucleic Acids Res, 36(suppl 1), pp. D154-D158.
Grishok, A., Pasquinelli, A. E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D. L., Fire, A., Ruvkun, G. and Mello, C. C. (2001) Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell, 106(1), pp. 23- 34.
Guerrero-Esteo, M., Sánchez-Elsner, T., Letamendia, A. and Bernabéu, C. (2002) Extracellular and cytoplasmic domains of endoglin interact with the transforming growth factor-β receptors I and II. Journal of Biological Chemistry, 277(32), pp. 29197-29209.
Gupta, S. K., Piccoli, M. T. and Thum, T. (2014) Non-coding RNAs in cardiovascular ageing. Ageing research reviews, 17, pp. 79-85.
Gupta, S. K. and Singh, J. P. (1994) Inhibition of endothelial cell proliferation by platelet factor-4 involves a unique action on S phase progression. J Cell Biol, 127(4), pp. 1121-1127.
Gurtan, A. M. and Sharp, P. A. (2013) The role of miRNAs in regulating gene expression networks. Journal of molecular biology, 425(19), pp. 3582- 3600.
Hai, T. and Curran, T. (1991) Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proceedings of the National Academy of Sciences, 88(9), pp. 3720-3724.
218 Hai, T. and Hartman, M. G. (2001) The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene, 273(1), pp. 1-11.
Hai, T., Liu, F., Coukos, W. J. and Green, M. R. (1989) Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes & Development, 3(12b), pp. 2083-2090.
Hamon, Y., Broccardo, C., Chambenoit, O., Luciani, M.-F., Toti, F., Chaslin, S., Freyssinet, J.-M., Devaux, P. F., McNeish, J. and Marguet, D. (2000) ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nature cell biology, 2(7), pp. 399- 406.
Han, J., Lee, Y., Yeom, K.-H., Kim, Y.-K., Jin, H. and Kim, V. N. (2004) The Drosha-DGCR8 complex in primary microRNA processing. Genes & Development, 18(24), pp. 3016-3027.
Han, J., Lee, Y., Yeom, K.-H., Nam, J.-W., Heo, I., Rhee, J.-K., Sohn, S. Y., Cho, Y., Zhang, B.-T. and Kim, V. N. (2006) Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell, 125(5), pp. 887-901.
Harrison, P. (2005) Platelet function analysis. Blood Reviews, 19(2), pp. 111- 123.
He, L. and Hannon, G. J. (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nature Reviews Genetics, 5(7), pp. 522-531.
He, L., Yuan, J., Xu, Q., Chen, R., Chen, L. and Fang, M. (2016) miRNA-1283 Regulates the PERK/ATF4 Pathway in Vascular Injury by Targeting ATF4. PLoS One, 11(8), pp. e0159171.
Hemker, H. C., Al Dieri, R., De Smedt, E. and Béguin, S. (2006) Thrombin generation, a function test of the haemostatic-thrombotic system. Thromb Haemost, 96(5), pp. 553-61.
Herbert, S. P. and Stainier, D. Y. (2011) Molecular control of endothelial cell behaviour during blood vessel morphogenesis. Nature reviews Molecular cell biology, 12(9), pp. 551-564.
Herrmann, J., Lerman, L. O., Mukhopadhyay, D., Napoli, C. and Lerman, A. (2006) Angiogenesis in atherogenesis. Arteriosclerosis, Thrombosis, and Vascular Biology, 26(9), pp. 1948-1957.
219 Herrmann, J., Lerman, L. O., Rodriguez-Porcel, M., Holmes, D. R., Richardson, D. M., Ritman, E. L. and Lerman, A. (2001) Coronary vasa vasorum neovascularization precedes epicardial endothelial dysfunction in experimental hypercholesterolemia. Cardiovascular research, 51(4), pp. 762-766.
Higashida, T., Kanno, H., Nakano, M., Funakoshi, K. and Yamamoto, I. (2008) Expression of hypoxia-inducible angiogenic proteins (hypoxia-inducible factor–1α, vascular endothelial growth factor, and E26 transformation- specific–1) and plaque hemorrhage in human carotid atherosclerosis.
Ho, M.-R., Tsai, K.-W., Chen, C.-h. and Lin, W.-c. (2011) dbDNV: a resource of duplicated gene nucleotide variants in human genome. Nucleic Acids Res, 39(suppl 1), pp. D920-D925.
Hogg, N. (1997) Leukocyte typing VI; white cell differentiation antigens. in CD18 workshop panel report. pp. 347-348.
Horenstein, A., Stockinger, H., Imhof, B. and Malavasi, F. (1998) CD38 binding to human myeloid cells is mediated by mouse and human CD31. Biochem. J, 330, pp. 1129-1135.
Hori, K., Wampler, J., Matthews, J. and Cormier, M. (1973) Identification of the product excited states during the chemiluminescent and bioluminescent oxidation of Renilla (sea pansy) luciferin and certain of its analogs. Biochemistry, 12(22), pp. 4463.
Hua, Z., Lv, Q., Ye, W., Wong, C., Cai, G., Gu, D., Ji, Y., Zhao, C., Wang, J. and Yang, B. B. (2006) MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia. PLoS One, 1(1), pp. e116.
Huang, H., Jing, G., Wang, J. J., Sheibani, N. and Zhang, S. X. (2015) ATF4 is a novel regulator of MCP-1 in microvascular endothelial cells. Journal of Inflammation, 12(1), pp. 1.
Huh, D., Gu, W., Kamotani, Y., Grotberg, J. B. and Takayama, S. (2005) Microfluidics for flow cytometric analysis of cells and particles. Physiological measurement, 26(3), pp. R73.
Humphries, M. (1999) Integrin structure. Biochemical Society Transactions, 28(4), pp. 311-339.
Hunter, M. P., Ismail, N., Zhang, X., Aguda, B. D., Lee, E. J., Yu, L., Xiao, T., Schafer, J., Lee, M. and Schmittgen, T. D. (2008) Detection of microRNA expression in human peripheral blood microvesicles. PLoS One, 3(11), pp. e3694.
220 Hurteau, G. J., Carlson, J. A., Spivack, S. D. and Brock, G. J. (2007) Overexpression of the microRNA hsa-miR-200c leads to reduced expression of transcription factor 8 and increased expression of E- cadherin. Cancer research, 67(17), pp. 7972-7976.
Hutvágner, G., McLachlan, J., Pasquinelli, A. E., Bálint, É., Tuschl, T. and Zamore, P. D. (2001) A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science, 293(5531), pp. 834-838.
Hynes, R. O. (1999) Cell adhesion: old and new questions. Trends in Biochemical Sciences, 24(12), pp. M33-M37.
Hynes, R. O. (2002) A reevaluation of integrins as regulators of angiogenesis. Nature medicine, 8(9), pp. 918-921.
Ikemoto, T., Hojo, Y., Kondo, H., Takahashi, N., Hirose, M., Nishimura, Y., Katsuki, T., Shimada, K. and Kario, K. (2012) Plasma endoglin as a marker to predict cardiovascular events in patients with chronic coronary artery diseases. Heart and vessels, 27(4), pp. 344-351.
Iliopoulos, D., Hirsch, H. A. and Struhl, K. (2009) An Epigenetic Switch Involving NF-κB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell Transformation. Cell, 139(4), pp. 693-706.
Iruela-Arispe, M. L., Lombardo, M., Krutzsch, H. C., Lawler, J. and Roberts, D. D. (1999) Inhibition of angiogenesis by thrombospondin-1 is mediated by 2 independent regions within the type 1 repeats. Circulation, 100(13), pp. 1423-1431.
Isenberg, J. S., Martin-Manso, G., Maxhimer, J. B. and Roberts, D. D. (2009) Regulation of nitric oxide signalling by thrombospondin 1: implications for anti-angiogenic therapies. Nature Reviews Cancer, 9(3), pp. 182-194.
Isenberg, J. S., Ridnour, L. A., Perruccio, E. M., Espey, M. G., Wink, D. A. and Roberts, D. D. (2005) Thrombospondin-1 inhibits endothelial cell responses to nitric oxide in a cGMP-dependent manner. Proceedings of the National Academy of Sciences of the United States of America, 102(37), pp. 13141-13146.
Italiano, J. E., Richardson, J. L., Patel-Hett, S., Battinelli, E., Zaslavsky, A., Short, S., Ryeom, S., Folkman, J. and Klement, G. L. (2008) Angiogenesis is regulated by a novel mechanism: pro-and antiangiogenic proteins are organized into separate platelet α granules and differentially released. Blood, 111(3), pp. 1227-1233.
Ito, S., Shen, L., Dai, Q., Wu, S. C., Collins, L. B., Swenberg, J. A., He, C. and Zhang, Y. (2011) Tet proteins can convert 5-methylcytosine to 5-
221 formylcytosine and 5-carboxylcytosine. Science, 333(6047), pp. 1300- 1303.
Jain, R. K., Finn, A. V., Kolodgie, F. D., Gold, H. K. and Virmani, R. (2007) Antiangiogenic therapy for normalization of atherosclerotic plaque vasculature: a potential strategy for plaque stabilization. Nature clinical practice Cardiovascular medicine, 4(9), pp. 491-502.
Janowska-Wieczorek, A., Wysoczynski, M., Kijowski, J., Marquez-Curtis, L., Machalinski, B., Ratajczak, J. and Ratajczak, M. Z. (2005) Microvesicles derived from activated platelets induce metastasis and angiogenesis in lung cancer. International journal of cancer, 113(5), pp. 752-760.
Järvilehto, M. and Tuohimaa, P. (2009) Vasa vasorum hypoxia: initiation of atherosclerosis. Medical hypotheses, 73(1), pp. 40-41.
Jay Widmer, R. and Lerman, A. (2014) Endothelial dysfunction and cardiovascular disease. Global Cardiology Science and Practice, pp. 43.
Jiménez, B., Volpert, O. V., Crawford, S. E., Febbraio, M., Silverstein, R. L. and Bouck, N. (2000) Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1. Nature medicine, 6(1), pp. 41- 48.
Jimenez, B., Volpert, O. V., Reiher, F., Chang, L., Munoz, A., Karin, M. and Bouck, N. (2001) c-Jun N-terminal kinase activation is required for the inhibition of neovascularization by thrombospondin-1. Oncogene, 20(26), pp. 3443-3448.
Jinek, M. and Doudna, J. A. (2009) A three-dimensional view of the molecular machinery of RNA interference. Nature, 457(7228), pp. 405-412.
Johnson, C. D., Esquela-Kerscher, A., Stefani, G., Byrom, M., Kelnar, K., Ovcharenko, D., Wilson, M., Wang, X., Shelton, J. and Shingara, J. (2007) The let-7 microRNA represses cell proliferation pathways in human cells. Cancer research, 67(16), pp. 7713-7722.
Johnson, M. D., Kim, H. R. C., Chesler, L., Tsao-Wu, G., Polverini, P. J. and Bouck, N. (1994) Inhibition of angiogenesis by tissue inhibitor of metalloproteinase. Journal of cellular physiology, 160(1), pp. 194-202.
Juhan-Vague, I., Renucci, J., Grimaux, M., Morange, P., Gouvernet, J., Gourmelin, Y. and Alessi, M. (2000) Thrombin-activatable fibrinolysis inhibitor antigen levels and cardiovascular risk factors. Arteriosclerosis, Thrombosis, and Vascular Biology, 20(9), pp. 2156-2161.
222 Jung, H. J., Kim, Y., Lee, H. B. and Kwon, H. J. (2015) Antiangiogenic Activity of the Lipophilic Antimicrobial Peptides from an Endophytic Bacterial Strain Isolated from Red Pepper Leaf. Molecules and Cells, 38(3), pp. 273-278.
Jy, W., Mao, W.-W., Horstman, L. L., Tao, J. and Ahn, Y. S. (1995) Platelet microparticles bind, activate and aggregate neutrophils in vitro. Blood Cells, Molecules, and Diseases, 21(3), pp. 217-231.
Kahn, M. L., Zheng, Y.-W., Huang, W., Bigornia, V., Zeng, D., Moff, S., Farese, R. V., Tam, C. and Coughlin, S. R. (1998) A dual thrombin receptor system for platelet activation. Nature, 394(6694), pp. 690-694.
Kanda, S., Landgren, E., Ljungström, M. and Claesson-Welsh, L. (1996) Fibroblast growth factor receptor 1-induced differentiation of endothelial cell line established from tsA58 large T transgenic mice. Cell growth & differentiation: the molecular biology journal of the American Association for Cancer Research, 7(3), pp. 383-395.
Kane, N. M., Meloni, M., Spencer, H. L., Craig, M. A., Strehl, R., Milligan, G., Houslay, M. D., Mountford, J. C., Emanueli, C. and Baker, A. H. (2010) Derivation of endothelial cells from human embryonic stem cells by directed differentiation analysis of microRNA and angiogenesis in vitro and in vivo. Arteriosclerosis, Thrombosis, and Vascular Biology, 30(7), pp. 1389-1397.
Kane, N. M., Thrasher, A. J., Angelini, G. D. and Emanueli, C. (2014) Concise review: MicroRNAs as modulators of stem cells and angiogenesis. Stem Cells, 32(5), pp. 1059-1066.
Kapuscinski, J. (1995) DAPI: a DNA-specific fluorescent probe. Biotechnic & Histochemistry, 70(5), pp. 220-233.
Kazerounian, S., Yee, K. and Lawler, J. (2008) Thrombospondins: from structure to therapeutics. Cellular and molecular life sciences, 65(5), pp. 700-712.
Kent, K. C., Mii, S., Harrington, E. O., Chang, J. D., Mallette, S. and Ware, J. A. (1995) Requirement for protein kinase C activation in basic fibroblast growth factor–induced human endothelial cell proliferation. Circ Res, 77(2), pp. 231-238.
Khurana, R., Simons, M., Martin, J. F. and Zachary, I. C. (2005) Role of angiogenesis in cardiovascular disease a critical appraisal. Circulation, 112(12), pp. 1813-1824.
Kim, H., Song, K., Park, Y., Kang, Y., Lee, Y., Lee, K., Ryu, K., Bae, J. and Kim, S. (2003) Elevated levels of circulating platelet microparticles, VEGF, IL-6 and RANTES in patients with gastric cancer: possible role of a metastasis predictor. European journal of cancer, 39(2), pp. 184-191.
223
Kim, H. K., Song, K. S., Chung, J. H., Lee, K. R. and Lee, S. N. (2004) Platelet microparticles induce angiogenesis in vitro. British journal of haematology, 124(3), pp. 376-384.
Kim, V. N., Han, J. and Siomi, M. C. (2009) Biogenesis of small RNAs in animals. Nature reviews Molecular cell biology, 10(2), pp. 126-139.
Koch, S., Tugues, S., Li, X., Gualandi, L. and Claesson-Welsh, L. (2011) Signal transduction by vascular endothelial growth factor receptors. Biochemical Journal, 437(2), pp. 169-183.
Koganti, S., Eleftheriou, D., Brogan, P. A., Kotecha, T., Hong, Y. and Rakhit, R. D. (2016) Microparticles and their role in coronary artery disease. International journal of cardiology.
Kong, W., Yang, H., He, L., Zhao, J.-j., Coppola, D., Dalton, W. S. and Cheng, J. Q. (2008) MicroRNA-155 is regulated by the transforming growth factor β/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol, 28(22), pp. 6773-6784.
Kozomara, A. and Griffiths-Jones, S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res, 42(D1), pp. D68-D73.
Krol, J., Loedige, I. and Filipowicz, W. (2010) The widespread regulation of microRNA biogenesis, function and decay. Nature Reviews Genetics, 11(9), pp. 597-610.
Kuehbacher, A., Urbich, C., Zeiher, A. M. and Dimmeler, S. (2007) Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis. Circ Res, 101(1), pp. 59-68.
Kuijper, S., Turner, C. J. and Adams, R. H. (2007) Regulation of angiogenesis by Eph-ephrin interactions. Trends Cardiovasc Med, 17(5), pp. 145-51.
Kuzemczak, M., Białek-Ławniczak, P., Torzyńska, K., Janowska-Kulińska, A., Miechowicz, I., Kramer, L., Moczko, J. and Siminiak, T. (2016) Comparison of Baseline Heart Rate Variability in Stable Ischemic Heart Disease Patients with and without Stroke in Long-Term Observation. Journal of Stroke and Cerebrovascular Diseases, 25(10), pp. 2526-2534.
Laffont, B., Corduan, A., Plé, H., Duchez, A.-C., Cloutier, N., Boilard, E. and Provost, P. (2013) Activated platelets can deliver mRNA regulatory Ago2• microRNA complexes to endothelial cells via microparticles. Blood, 122(2), pp. 253-261.
224 Lagarde, M., Bryon, P., Guichardant, M. and Dechavanne, M. (1980) A simple and efficient method for platelet isolation from their plasma. Thrombosis research, 17(3), pp. 581-588.
Lamalice, L., Le Boeuf, F. and Huot, J. (2007) Endothelial cell migration during angiogenesis. Circ Res, 100(6), pp. 782-794.
Lambert, M. P., Wang, Y., Bdeir, K. H., Nguyen, Y., Kowalska, M. A. and Poncz, M. (2009) Platelet factor 4 regulates megakaryopoiesis through low- density lipoprotein receptor–related protein 1 (LRP1) on megakaryocytes. Blood, 114(11), pp. 2290-2298.
Landry, P., Plante, I., Ouellet, D. L., Perron, M. P., Rousseau, G. and Provost, P. (2009) Existence of a microRNA pathway in anucleate platelets. Nat Struct Mol Biol, 16(9), pp. 961-6.
Landthaler, M., Yalcin, A. and Tuschl, T. (2004) The human DiGeorge syndrome critical region gene 8 and its D. melanogaster homolog are required for miRNA biogenesis. Current Biology, 14(23), pp. 2162-2167.
Languino, L. R., Gehlsen, K. R., Wayner, E., Carter, W. G., Engvall, E. and Ruoslahti, E. (1989) Endothelial cells use alpha 2 beta 1 integrin as a laminin receptor. J Cell Biol, 109(5), pp. 2455-2462.
Latchman, D. S. (1996) Inhibitory transcription factors. The international journal of biochemistry & cell biology, 28(9), pp. 965-974.
Lawler, J. (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. Journal of cellular and molecular medicine, 6(1), pp. 1-12.
Layne, K., Ferro, A. and Passacquale, G. (2015) Netrin-1 as a novel therapeutic target in cardiovascular disease: to activate or inhibit? Cardiovascular research, 107(4), pp. 410-419.
Le Dall, J., Ho-Tin-Noé, B., Louedec, L., Meilhac, O., Roncal, C., Carmeliet, P., Germain, S., Michel, J.-B. and Houard, X. (2010) Immaturity of microvessels in haemorrhagic plaques is associated with proteolytic degradation of angiogenic factors. Cardiovascular research, 85(1), pp. 184-193.
Leavesley, D., Schwartz, M., Rosenfeld, M. and Cheresh, D. (1993) Integrin beta 1-and beta 3-mediated endothelial cell migration is triggered through distinct signaling mechanisms. J Cell Biol, 121(1), pp. 163-170.
Lebrin, F. and Mummery, C. L. (2008) Endoglin-mediated vascular remodeling: mechanisms underlying hereditary hemorrhagic telangiectasia. Trends in cardiovascular medicine, 18(1), pp. 25-32.
225
Lee, D. Y., Deng, Z., Wang, C.-H. and Yang, B. B. (2007) MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proceedings of the National Academy of Sciences, 104(51), pp. 20350-20355.
Lee, J. S., Shukla, S., Kim, J.-A. and Kim, M. (2015) Anti-Angiogenic Effect of Nelumbo nucifera Leaf Extracts in Human Umbilical Vein Endothelial Cells with Antioxidant Potential. PLoS One, 10(2), pp. e0118552.
Lee, Y., Jeon, K., Lee, J. T., Kim, S. and Kim, V. N. (2002) MicroRNA maturation: stepwise processing and subcellular localization. Embo j, 21(17), pp. 4663-4670.
Lemaigre, F. P., Ace, C. I. and Green, M. R. (1993) The cAMP response element binding protein, CREB, is a potent inhibitor of diverse transcriptional activators. Nucleic Acids Res, 21(12), pp. 2907-2911.
Leppanen, A., Mehta, P., Ouyang, Y. B., Ju, T., Helin, J., Moore, K. L., van Die, I., Canfield, W. M., McEver, R. P. and Cummings, R. D. (1999) A novel glycosulfopeptide binds to P-selectin and inhibits leukocyte adhesion to P-selectin. J Biol Chem, 274(35), pp. 24838-48.
Leroyer, A. S., Rautou, P.-E., Silvestre, J.-S., Castier, Y., Lesèche, G., Devue, C., Duriez, M., Brandes, R. P., Lutgens, E. and Tedgui, A. (2008) CD40 Ligand+ microparticles from human atherosclerotic plaques stimulate endothelial proliferation and angiogenesis. J Am Coll Cardiol, 52(16), pp. 1302-1311.
Levine, M. and Tjian, R. (2003) Transcription regulation and animal diversity. Nature, 424(6945), pp. 147-151.
Lewis, B. P., Shih, I.-h., Jones-Rhoades, M. W., Bartel, D. P. and Burge, C. B. (2003) Prediction of mammalian microRNA targets. Cell, 115(7), pp. 787- 798.
Li, A., Dubey, S., Varney, M. L., Dave, B. J. and Singh, R. K. (2003) IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. The Journal of Immunology, 170(6), pp. 3369-3376.
Li, K., Zhang, J., Yu, J., Liu, B., Guo, Y., Deng, J., Chen, S., Wang, C. and Guo, F. (2015) MicroRNA-214 suppresses gluconeogenesis by targeting activating transcriptional factor 4. Journal of Biological Chemistry, pp. jbc. M114. 633990.
226 Li, X. and Cong, H. (2009) Platelet-derived microparticles and the potential of glycoprotein IIb/IIIa antagonists in treating acute coronary syndrome. Texas Heart Institute Journal, 36(2), pp. 134.
Li, Y., Song, Y. H., Li, F., Yang, T., Lu, Y. W. and Geng, Y. J. (2009) MicroRNA- 221 regulates high glucose-induced endothelial dysfunction. Biochem Biophys Res Commun, 381(1), pp. 81-3.
Li, Y. X., Liu, D. Q., Zheng, C., Zheng, S. Q., Liu, M., Li, X. and Tang, H. (2011) miR-200a modulate HUVECs viability and migration. IUBMB life, 63(7), pp. 553-559.
Li, Z. and Rana, T. M. (2014) Therapeutic targeting of microRNAs: current status and future challenges. Nat Rev Drug Discov, 13(8), pp. 622-638.
Lidington, E., Moyes, D., McCormack, A. and Rose, M. (1999) A comparison of primary endothelial cells and endothelial cell lines for studies of immune interactions. Transplant immunology, 7(4), pp. 239-246.
Liu, J., Carmell, M. A., Rivas, F. V., Marsden, C. G., Thomson, J. M., Song, J.- J., Hammond, S. M., Joshua-Tor, L. and Hannon, G. J. (2004) Argonaute2 is the catalytic engine of mammalian RNAi. Science, 305(5689), pp. 1437-1441.
Liu, X., Cheng, Y., Yang, J., Xu, L. and Zhang, C. (2012) Cell-specific effects of miR-221/222 in vessels: molecular mechanism and therapeutic application. Journal of molecular and cellular cardiology, 52(1), pp. 245- 255.
Liu, Y., Yin, B., Zhang, C., Zhou, L. and Fan, J. (2012) Hsa-let-7a functions as a tumor suppressor in renal cell carcinoma cell lines by targeting c-myc. Biochem Biophys Res Commun, 417(1), pp. 371-375.
Lodish, H. F., Zhou, B., Liu, G. and Chen, C.-Z. (2008) Micromanagement of the immune system by microRNAs. Nature Reviews Immunology, 8(2), pp. 120-130.
Losy, J., Niezgoda, A. and Wender, M. (1999) Increased serum levels of soluble PECAM-1 in multiple sclerosis patients with brain gadolinium-enhancing lesions. Journal of neuroimmunology, 99(2), pp. 169-172.
Lu, K., Ye, W., Zhou, L., Collins, L. B., Chen, X., Gold, A., Ball, L. M. and Swenberg, J. A. (2010) Structural characterization of formaldehyde- induced cross-links between amino acids and deoxynucleosides and their oligomers. Journal of the American Chemical Society, 132(10), pp. 3388- 3399.
227 Lu, P., Takai, K., Weaver, V. M. and Werb, Z. (2011) Extracellular matrix degradation and remodeling in development and disease. Cold Spring Harbor perspectives in biology, 3(12), pp. a005058.
Luttun, A., Tjwa, M., Moons, L., Wu, Y., Angelillo-Scherrer, A., Liao, F., Nagy, J. A., Hooper, A., Priller, J. and De Klerck, B. (2002) Revascularization of ischemic tissues by PlGF treatment, and inhibition of tumor angiogenesis, arthritis and atherosclerosis by anti-Flt1. Nature medicine, 8(8), pp. 831- 840.
Ma, J., Wang, Q., Fei, T., Han, J.-D. J. and Chen, Y.-G. (2007) MCP-1 mediates TGF-β–induced angiogenesis by stimulating vascular smooth muscle cell migration. Blood, 109(3), pp. 987-994.
Maione, T. E., Gray, G. S., Petro, J., Hunt, A. J., Donner, A. L., Bauer, S. I., Carson, H. F. and Sharpe, R. J. (1990) Inhibition of angiogenesis by recombinant human platelet factor-4 and related peptides. Science, 247(4938), pp. 77-80.
Maisonpierre, P. C., Suri, C., Jones, P. F., Bartunkova, S., Wiegand, S. J., Radziejewski, C., Compton, D., McClain, J., Aldrich, T. H. and Papadopoulos, N. (1997) Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science, 277(5322), pp. 55-60.
Makino, K., Jinnin, M., Hirano, A., Yamane, K., Eto, M., Kusano, T., Honda, N., Kajihara, I., Makino, T. and Sakai, K. (2013) The downregulation of microRNA let-7a contributes to the excessive expression of type I collagen in systemic and localized scleroderma. The Journal of Immunology, 190(8), pp. 3905-3915.
Malabanan, K. P. and Khachigian, L. M. (2010) Activation transcription factor-4 and the acute vascular response to injury. Journal of Molecular Medicine, 88(6), pp. 545-552.
Malerba, M., Olivini, A., Radaeli, A., Ricciardolo, F. L. M. and Clini, E. (2016) Platelet activation and cardiovascular comorbidities in patients with chronic obstructive pulmonary disease. Current medical research and opinion, 32(5), pp. 885-891.
Mallat, Z., Benamer, H., Hugel, B., Benessiano, J., Steg, P. G., Freyssinet, J.-M. and Tedgui, A. (2000) Elevated levels of shed membrane microparticles with procoagulant potential in the peripheral circulating blood of patients with acute coronary syndromes. Circulation, 101(8), pp. 841-843.
Marguet, D., Luciani, M.-F., Moynault, A., Williamson, P. and Chimini, G. (1999) Engulfment of apoptotic cells involves the redistribution of membrane phosphatidylserine on phagocyte and prey. Nat Cell Biol, 1(7), pp. 454- 456.
228
Mause, S. F. and Weber, C. (2010) Microparticles: protagonists of a novel communication network for intercellular information exchange. Circ Res, 107(9), pp. 1047-57.
Mayr, C., Hemann, M. T. and Bartel, D. P. (2007) Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science, 315(5818), pp. 1576-1579.
Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G. and Tuschl, T. (2004) Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol Cell, 15(2), pp. 185-197.
Merten, M., Pakala, R., Thiagarajan, P. and Benedict, C. R. (1999) Platelet microparticles promote platelet interaction with subendothelial matrix in a glycoprotein IIb/IIIa–dependent mechanism. Circulation, 99(19), pp. 2577- 2582.
Mettouchi, A. and Meneguzzi, G. (2006) Distinct roles of β1 integrins during angiogenesis. European journal of cell biology, 85(3), pp. 243-247.
Miceli, M., Dell'Aversana, C., Russo, R., Rega, C., Cupelli, L., Ruvo, M., Altucci, L. and Chambery, A. (2016) Secretome profiling of cytokines and growth factors reveals that neuro-glial differentiation is associated with the down- regulation of Chemokine Ligand 2 (MCP-1/CCL2) in amniotic fluid derived-mesenchymal progenitor cells. Proteomics, 16(4), pp. 674-688.
Minuz, P., Patrignani, P., Gaino, S., Degan, M., Menapace, L., Tommasoli, R., Seta, F., Capone, M. L., Tacconelli, S. and Palatresi, S. (2002) Increased oxidative stress and platelet activation in patients with hypertension and renovascular disease. Circulation, 106(22), pp. 2800-2805.
Mizuuchi, M., Cindrova-Davies, T., Olovsson, M., Charnock-Jones, D. S., Burton, G. J. and Yung, H. W. (2016) Placental endoplasmic reticulum stress negatively regulates transcription of placental growth factor via ATF4 and ATF6β: implications for the pathophysiology of human pregnancy complications. The Journal of pathology.
Mombouli, J.-V. (1997) Endothelium-derived hyperpolarizing factor (s): updating the unknown. Trends in Pharmacological Sciences, 18(4), pp. 252-256.
Monagle, P. (2015) Developmental hemostasis I. Pediatric Thrombotic Disorders, pp. 107.
Moncada, S., Herman, A., HIGGs, E. A. and Vane, J. (1977) Differential formation of prostacyclin (PGX or PGI 2) by layers of the arterial wall. An
229 explanation for the anti-thrombotic properties of vascular endothelium. Thrombosis research, 11(3), pp. 323-344.
Moncada, S., Radomski, M. W. and Palmer, R. M. (1988) Endothelium-derived relaxing factor: identification as nitric oxide and role in the control of vascular tone and platelet function. Biochemical pharmacology, 37(13), pp. 2495-2501.
Montecalvo, A., Larregina, A. T., Shufesky, W. J., Stolz, D. B., Sullivan, M. L., Karlsson, J. M., Baty, C. J., Gibson, G. A., Erdos, G., Wang, Z., Milosevic, J., Tkacheva, O. A., Divito, S. J., Jordan, R., Lyons-Weiler, J., Watkins, S. C. and Morelli, A. E. (2012) Mechanism of transfer of functional microRNAs between mouse dendritic cells via exosomes. Blood, 119(3), pp. 756-66.
Monteys, A. M., Spengler, R. M., Wan, J., Tecedor, L., Lennox, K. A., Xing, Y. and Davidson, B. L. (2010) Structure and activity of putative intronic miRNA promoters. Rna, 16(3), pp. 495-505.
Morel, O., Jesel, L., Freyssinet, J.-M. and Toti, F. (2011) Cellular mechanisms underlying the formation of circulating microparticles. Arteriosclerosis, Thrombosis, and Vascular Biology, 31(1), pp. 15-26.
Morel, O., Toti, F., Hugel, B., Bakouboula, B., Camoin-Jau, L., Dignat-George, F. and Freyssinet, J.-M. (2006) Procoagulant microparticles. Arteriosclerosis, Thrombosis, and Vascular Biology, 26(12), pp. 2594- 2604.
Müller, D. and Bosserhoff, A. (2008) Integrin β3 expression is regulated by let- 7a miRNA in malignant melanoma. Oncogene, 27(52), pp. 6698-6706.
Muller, W., Berman, M., Newman, P., DeLisser, H. and Albelda, S. (1992) A heterophilic adhesion mechanism for platelet/endothelial cell adhesion molecule 1 (CD31). J Exp Med, 175(5), pp. 1401-1404.
Murphy-Ullrich, J. E. and Poczatek, M. (2000) Activation of latent TGF-β by thrombospondin-1: mechanisms and physiology. Cytokine & growth factor reviews, 11(1), pp. 59-69.
Nagalla, S., Shaw, C., Kong, X., Kondkar, A. A., Edelstein, L. C., Ma, L., Chen, J., McKnight, G. S., López, J. A. and Yang, L. (2011) Platelet microRNA- mRNA coexpression profiles correlate with platelet reactivity. Blood, 117(19), pp. 5189-5197.
Narayanaswamy, M., Wright, K. C. and Kandarpa, K. (2000) Animal models for atherosclerosis, restenosis, and endovascular graft research. Journal of Vascular and Interventional Radiology, 11(1), pp. 5-17.
230 Nemetski, S. M. and Gardner, L. B. (2007) Hypoxic regulation of Id-1 and activation of the unfolded protein response are aberrant in neuroblastoma. Journal of Biological Chemistry, 282(1), pp. 240-248.
Newman, M. A., Thomson, J. M. and Hammond, S. M. (2008) Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. Rna, 14(8), pp. 1539-1549.
Newman, P. J., Berndt, M. C., Gorski, J., White, G. C., Lyman, S., Paddock, C. and Muller, W. A. (1990) PECAM-1 (CD31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily. Science, 247(4947), pp. 1219-1222.
Newton, J. P., Buckley, C. D., Jones, E. Y. and Simmons, D. L. (1997) Residues on both faces of the first immunoglobulin fold contribute to homophilic binding sites of PECAM-1/CD31. Journal of Biological Chemistry, 272(33), pp. 20555-20563.
Nicosia, R. F. and Tuszynski, G. P. (1994) Matrix-bound thrombospondin promotes angiogenesis in vitro. J Cell Biol, 124(1), pp. 183-193.
Niswander, L. M., Palis, J. and McGrath, K. E. (2016) Imaging Flow Cytometric Analysis of Primary Bone Marrow Megakaryocytes. Imaging Flow Cytometry: Methods and Protocols, pp. 265-277.
Niu, J. and Kolattukudy, P. E. (2009) Role of MCP-1 in cardiovascular disease: molecular mechanisms and clinical implications. Clinical science, 117(3), pp. 95-109.
Nomura, S., Imamura, A., Okuno, M., Kamiyama, Y., Fujimura, Y., Ikeda, Y. and Fukuhara, S. (2000) Platelet-Derived Microparticles in Patients with Arteriosclerosis Obliterans: Enhancement of High Shear-Induced Microparticle Generation by Cytokines. Thrombosis research, 98(4), pp. 257-268.
Nomura, S., Inami, N., Shouzu, A., Urase, F. and Maeda, Y. (2009) Correlation and association between plasma platelet-, monocyte-and endothelial cell- derived microparticles in hypertensive patients with type 2 diabetes mellitus. Platelets, 20(6), pp. 406-414.
Nomura, S., Miyazaki, Y., Miyake, T., Suzuki, M., Kawakatsu, T., Kido, H., Yamaguchi, K., Fukuroi, T., Kagawa, H. and Yanabu, M. (1993) Detection of platelet-derived microparticles in patients with diabetes. American journal of hematology, 44(3), pp. 213-213.
Nomura, S., Suzuki, M., Katsura, K., Xie, G. L., Miyazaki, Y., Miyake, T., Kido, H., Kagawa, H. and Fukuhara, S. (1995) Platelet-derived microparticles
231 may influence the development of atherosclerosis in diabetes mellitus. Atherosclerosis, 116(2), pp. 235-240.
Nomura, S., Tandon, N. N., Nakamura, T., Cone, J., Fukuhara, S. and Kambayashi, J. (2001) High-shear-stress-induced activation of platelets and microparticles enhances expression of cell adhesion molecules in THP-1 and endothelial cells. Atherosclerosis, 158(2), pp. 277-287.
Nör, J., Mitra, R. S., Sutorik, M. M., Mooney, D. J., Castle, V. P. and Polverini, P. J. (2000) Thrombospondin-1 induces endothelial cell apoptosis and inhibits angiogenesis by activating the caspase death pathway. Journal of vascular research, 37(3), pp. 209-218.
O'Brien, E. R., Garvin, M. R., Dev, R., Stewart, D. K., Hinohara, T., Simpson, J. B. and Schwartz, S. M. (1994) Angiogenesis in human coronary atherosclerotic plaques. The American journal of pathology, 145(4), pp. 883.
Otsuka, M., Zheng, M., Hayashi, M., Lee, J.-D., Yoshino, O., Lin, S. and Han, J. (2008) Impaired microRNA processing causes corpus luteum insufficiency and infertility in mice. The Journal of clinical investigation, 118(5), pp. 1944.
Ouviña, S. M., La Greca, R. D., Zanaro, N. L., Palmer, L. and Sassetti, B. (2001) Endothelial dysfunction, nitric oxide and platelet activation in hypertensive and diabetic type II patients. Thrombosis research, 102(2), pp. 107-114.
Owens, A. P. and Mackman, N. (2011) Microparticles in Hemostasis and Thrombosis. Circ Res, 108(10), pp. 1284-1297.
Ozsolak, F., Poling, L. L., Wang, Z., Liu, H., Liu, X. S., Roeder, R. G., Zhang, X., Song, J. S. and Fisher, D. E. (2008) Chromatin structure analyses identify miRNA promoters. Genes & Development, 22(22), pp. 3172-3183.
Pan, Y., Liang, H., Liu, H., Li, D., Chen, X., Li, L., Zhang, C.-Y. and Zen, K. (2014) Platelet-secreted microRNA-223 promotes endothelial cell apoptosis induced by advanced glycation end products via targeting the insulin-like growth factor 1 receptor. The Journal of Immunology, 192(1), pp. 437-446.
Paneni, F., Beckman, J. A., Creager, M. A. and Cosentino, F. (2013) Diabetes and vascular disease: pathophysiology, clinical consequences, and medical therapy: part I. European heart journal, pp. eht149.
Park, S.-M., Shell, S., Radjabi, A. R., Schickel, R., Feig, C., Boyerinas, B., Dinulescu, D. M., Lengyel, E. and Peter, M. E. (2007) Let-7 prevents early cancer progression by suppressing expression of the embryonic gene HMGA2. Cell cycle, 6(21), pp. 2585-2590.
232
Pasquinelli, A. E., Reinhart, B. J., Slack, F., Martindale, M. Q., Kuroda, M. I., Maller, B., Hayward, D. C., Ball, E. E., Degnan, B. and Müller, P. (2000) Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature, 408(6808), pp. 86-89.
Pearson, T. A., Mensah, G. A., Alexander, R. W., Anderson, J. L., Cannon, R. O., Criqui, M., Fadl, Y. Y., Fortmann, S. P., Hong, Y. and Myers, G. L. (2003) Markers of inflammation and cardiovascular disease. Circulation, 107(3), pp. 499-511.
Persico, M., Vincenti, V. and DiPalma, T. (1999) Structure, expression and receptor-binding properties of placenta growth factor (PlGF). in Vascular growth factors and angiogenesis: Springer. pp. 31-40.
Peter, M. E. (2009) Let-7 and miR-200 microRNAs: guardians against pluripotency and cancer progression. Cell cycle, 8(6), pp. 843-852.
Phillips, D. R., Charo, I. F., Parise, L. V. and Fitzgerald, L. (1988) The platelet membrane glycoprotein lib-Ilia complex. Blood, 71(4), pp. 831-843.
Piali, L., Hammel, P., Uherek, C., Bachmann, F., Gisler, R. H., Dunon, D. and Imhof, B. A. (1995) CD31/PECAM-1 is a ligand for alpha v beta 3 integrin involved in adhesion of leukocytes to endothelium. J Cell Biol, 130(2), pp. 451-460.
Piccin, A., Murphy, W. G. and Smith, O. P. (2007) Circulating microparticles: pathophysiology and clinical implications. Blood Reviews, 21(3), pp. 157- 171.
Pichiule, P. and LaManna, J. C. (2002) Angiopoietin-2 and rat brain capillary remodeling during adaptation and deadaptation to prolonged mild hypoxia. Journal of applied physiology, 93(3), pp. 1131-1139.
Pober, J. S. and Sessa, W. C. (2007) Evolving functions of endothelial cells in inflammation. Nature Reviews Immunology, 7(10), pp. 803-815.
Poliseno, L., Tuccoli, A., Mariani, L., Evangelista, M., Citti, L., Woods, K., Mercatanti, A., Hammond, S. and Rainaldi, G. (2006) MicroRNAs modulate the angiogenic properties of HUVECs. Blood, 108(9), pp. 3068- 3071.
Preston, R. A., Jy, W., Jimenez, J. J., Mauro, L. M., Horstman, L. L., Valle, M., Aime, G. and Ahn, Y. S. (2003) Effects of severe hypertension on endothelial and platelet microparticles. Hypertension, 41(2), pp. 211-217.
Probst, J., Weide, B., Scheel, B., Pichler, B., Hoerr, I., Rammensee, H. and Pascolo, S. (2007) Spontaneous cellular uptake of exogenous messenger
233 RNA in vivo is nucleic acid-specific, saturable and ion dependent. Gene therapy, 14(15), pp. 1175-1180.
Puddu, P., Puddu, G. M., Cravero, E., Muscari, S. and Muscari, A. (2010) The involvement of circulating microparticles in inflammation, coagulation and cardiovascular diseases. Canadian Journal of Cardiology, 26(4), pp. e140-e145.
Rajendran, P., Rengarajan, T., Thangavel, J., Nishigaki, Y., Sakthisekaran, D., Sethi, G. and Nishigaki, I. (2013) The vascular endothelium and human diseases. International journal of biological sciences, 9(10), pp. 1057.
Ramacciotti, E., Hawley, A. E., Farris, D. M., Ballard, N. E., Wrobleski, S. K., Myers Jr, D. D., Henke, P. K. and Wakefield, T. W. (2009) Leukocyte-and platelet-derived microparticles correlate with thrombus weight and tissue factor activity in an experimental mouse model of venous thrombosis. Thromb Haemost, 101(4), pp. 748.
Ratajczak, J., Wysoczynski, M., Hayek, F., Janowska-Wieczorek, A. and Ratajczak, M. (2006) Membrane-derived microvesicles: important and underappreciated mediators of cell-to-cell communication. Leukemia, 20(9), pp. 1487-1495.
Rautou, P.-E., Vion, A.-C., Amabile, N., Chironi, G., Simon, A., Tedgui, A. and Boulanger, C. M. (2011) Microparticles, Vascular Function, and Atherothrombosis. Circ Res, 109(5), pp. 593-606.
Ray, P. S., Estrada-Hernandez, T., Sasaki, H., Zhu, L. and Maulik, N. (2000) Early effects of hypoxia/reoxygenation on VEGF, ang-1, ang-2 and their receptors in the rat myocardium: implications for myocardial angiogenesis. Molecular and cellular biochemistry, 213(1-2), pp. 145-153.
Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R. and Ruvkun, G. (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature, 403(6772), pp. 901-906.
Rendu, F. and Brohard-Bohn, B. (2001) The platelet release reaction: granules' constituents, secretion and functions. Platelets, 12(5), pp. 261-273.
Ribatti, D., Levi-Schaffer, F. and Kovanen, P. T. (2008) Inflammatory angiogenesis in atherogenesis—a double-edged sword. Ann Med, 40(8), pp. 606-621.
Risau, W. (1997) Mechanisms of angiogenesis. Nature, 386(6626), pp. 671-674.
234 Risitano, A., Beaulieu, L. M., Vitseva, O. and Freedman, J. E. (2012) Platelets and platelet-like particles mediate intercellular RNA transfer. Blood, 119(26), pp. 6288-95.
Roberts, D. D., Isenberg, J. S., Ridnour, L. A. and Wink, D. A. (2007) Nitric oxide and its gatekeeper thrombospondin-1 in tumor angiogenesis. Clinical Cancer Research, 13(3), pp. 795-798.
Rodrigo, M. C., Martin, D. S., Redetzke, R. A. and Eyster, K. M. (2002) A method for the extraction of high-quality RNA and protein from single small samples of arteries and veins preserved in RNAlater. Journal of pharmacological and toxicological methods, 47(2), pp. 87-92.
Roush, S. and Slack, F. J. (2008) The let-7 family of microRNAs. Trends in cell biology, 18(10), pp. 505-516.
Roy, H., Bhardwaj, S., Babu, M., Jauhiainen, S., Herzig, K.-H., Bellu, A. R., Haisma, H. J., Carmeliet, P., Alitalo, K. and Ylä-Herttuala, S. (2005) Adenovirus-mediated gene transfer of placental growth factor to perivascular tissue induces angiogenesis via upregulation of the expression of endogenous vascular endothelial growth factor-A. Human gene therapy, 16(12), pp. 1422-1428.
Rubanyi, G. M. (1993) The role of endothelium in cardiovascular homeostasis and diseases. Journal of cardiovascular pharmacology, 22, pp. S1&hyhen.
Rückerl, R., Phipps, R. P., Schneider, A., Frampton, M., Cyrys, J., Oberdörster, G., Wichmann, H. E. and Peters, A. (2007) Ultrafine particles and platelet activation in patients with coronary heart disease–results from a prospective panel study. Particle and fibre toxicology, 4(1), pp. 1.
Rundhaug, J. E. (2005) Matrix metalloproteinases and angiogenesis. Journal of cellular and molecular medicine, 9(2), pp. 267.
Sa, G., Murugesan, G., Jaye, M., Ivashchenko, Y. and Fox, P. L. (1995) Activation of Cytosolic Phospholipase A by Basic Fibroblast Growth Factor via a p42 Mitogen-activated Protein Kinase-dependent Phosphorylation Pathway in Endothelial Cells. Journal of Biological Chemistry, 270(5), pp. 2360-2366.
Saba, H. I. and Saba, S. R. (2014) Vascular Endothelium, Influence on Hemostasis: Past and Present. Hemostasis and Thrombosis, pp. 14-29.
Saboor, M., Ayub, Q. and Samina Ilyas, M. (2013) Platelet receptors; an instrumental of platelet physiology. Pakistan journal of medical sciences, 29(3), pp. 891.
235 Sachs, U. J. and Nieswandt, B. (2007) In vivo thrombus formation in murine models. Circ Res, 100(7), pp. 979-991.
Sahni, A. and Francis, C. W. (2000) Vascular endothelial growth factor binds to fibrinogen and fibrin and stimulates endothelial cell proliferation. Blood, 96(12), pp. 3772-3778.
Salcedo, R., Ponce, M. L., Young, H. A., Wasserman, K., Ward, J. M., Kleinman, H. K., Oppenheim, J. J. and Murphy, W. J. (2000) Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood, 96(1), pp. 34-40.
Sampson, V. B., Rong, N. H., Han, J., Yang, Q., Aris, V., Soteropoulos, P., Petrelli, N. J., Dunn, S. P. and Krueger, L. J. (2007) MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer research, 67(20), pp. 9762-9770.
Sang, Q. X. A. (1998) Complex role of matrix metalloproteinases in angiogenesis. Cell research, 8(3), pp. 171-177.
Santhekadur, P. K., Gredler, R., Chen, D., Siddiq, A., Shen, X.-N., Das, S. K., Emdad, L., Fisher, P. B. and Sarkar, D. (2012) Late SV40 Factor (LSF) Enhances Angiogenesis by Transcriptionally Up-regulating Matrix Metalloproteinase-9 (MMP-9). J Biol Chem, 287(5), pp. 3425-3432.
Sanz, J. and Fayad, Z. A. (2008) Imaging of atherosclerotic cardiovascular disease. Nature, 451(7181), pp. 953-957.
Scatena, M., Almeida, M., Chaisson, M. L., Fausto, N., Nicosia, R. F. and Giachelli, C. M. (1998) NF-κB mediates αvβ3 integrin-induced endothelial cell survival. J Cell Biol, 141(4), pp. 1083-1093.
Scharf, R., Tomer, A., Marzec, U., Teirstein, P., Ruggeri, Z. and Harker, L. (1992) Activation of platelets in blood perfusing angioplasty-damaged coronary arteries. Flow cytometric detection. Arteriosclerosis, Thrombosis, and Vascular Biology, 12(12), pp. 1475-1487.
Scharpfenecker, M., Fiedler, U., Reiss, Y. and Augustin, H. G. (2005) The Tie-2 ligand angiopoietin-2 destabilizes quiescent endothelium through an internal autocrine loop mechanism. Journal of cell science, 118(4), pp. 771-780.
Schmiedel, J. M., Klemm, S. L., Zheng, Y., Sahay, A., Blüthgen, N., Marks, D. S. and van Oudenaarden, A. (2015) MicroRNA control of protein expression noise. Science, 348(6230), pp. 128-132.
Schober, M. and Fuchs, E. (2011) Tumor-initiating stem cells of squamous cell carcinomas and their control by TGF-β and integrin/focal adhesion kinase
236 (FAK) signaling. Proceedings of the National Academy of Sciences, 108(26), pp. 10544-10549.
Schraufstatter, I. U., Chung, J. and Burger, M. (2001) IL-8 activates endothelial cell CXCR1 and CXCR2 through Rho and Rac signaling pathways. American Journal of Physiology-Lung Cellular and Molecular Physiology, 280(6), pp. L1094-L1103.
Schultz-Cherry, S., Chen, H., Mosher, D. F., Misenheimer, T. M., Krutzsch, H. C., Roberts, D. D. and Murphy-Ullrich, J. E. (1995) Regulation of transforming growth factor-β activation by discrete sequences of thrombospondin 1. Journal of Biological Chemistry, 270(13), pp. 7304- 7310.
Schwartz, M. A. and DeSimone, D. W. (2008) Cell adhesion receptors in mechanotransduction. Current opinion in cell biology, 20(5), pp. 551-556.
Schwarz, M., Katagiri, Y., Kotani, M., Bassler, N., Loeffler, C., Bode, C. and Peter, K. (2004) Reversibility versus persistence of GPIIb/IIIa blocker- induced conformational change of GPIIb/IIIa (αIIbβ3, CD41/CD61). Journal of Pharmacology and Experimental Therapeutics, 308(3), pp. 1002-1011.
Seghezzi, G., Patel, S., Ren, C. J., Gualandris, A., Pintucci, G., Robbins, E. S., Shapiro, R. L., Galloway, A. C., Rifkin, D. B. and Mignatti, P. (1998) Fibroblast growth factor-2 (FGF-2) induces vascular endothelial growth factor (VEGF) expression in the endothelial cells of forming capillaries: an autocrine mechanism contributing to angiogenesis. J Cell Biol, 141(7), pp. 1659-1673.
Senger, D. R. (1996) Molecular framework for angiogenesis: a complex web of interactions between extravasated plasma proteins and endothelial cell proteins induced by angiogenic cytokines. The American journal of pathology, 149(1), pp. 1.
Shaw, G., Morse, S., Ararat, M. and Graham, F. L. (2002) Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells. The FASEB Journal, 16(8), pp. 869-871.
Short, S. M., Derrien, A., Narsimhan, R. P., Lawler, J., Ingber, D. E. and Zetter, B. R. (2005) Inhibition of endothelial cell migration by thrombospondin-1 type-1 repeats is mediated by β(1) integrins. J Cell Biol, 168(4), pp. 643- 653.
Siljander, P., Carpen, O. and Lassila, R. (1996) Platelet-derived microparticles associate with fibrin during thrombosis. Blood, 87(11), pp. 4651-4663.
237 Silletti, S., Kessler, T., Goldberg, J., Boger, D. L. and Cheresh, D. A. (2001) Disruption of matrix metalloproteinase 2 binding to integrin αvβ3 by an organic molecule inhibits angiogenesis and tumor growth in vivo. Proceedings of the National Academy of Sciences, 98(1), pp. 119-124.
Sinauridze, E. I., Kireev, D. A., Popenko, N. Y., Pichugin, A. V., Panteleev, M. A., Krymskaya, O. V. and Ataullakhanov, F. I. (2007) Platelet microparticle membranes have 50-to 100-fold higher specific procoagulant activity than activated platelets. THROMBOSIS AND HAEMOSTASIS-STUTTGART-, 97(3), pp. 425.
Slevin, M., Kumar, P., Wang, Q., Kumar, S., Gaffney, J., Grau-Olivares, M. and Krupinski, J. (2008) New VEGF antagonists as possible therapeutic agents in vascular disease. Expert opinion on investigational drugs, 17(9), pp. 1301-1314.
Sluimer, J. C., Kolodgie, F. D., Bijnens, A. P., Maxfield, K., Pacheco, E., Kutys, B., Duimel, H., Frederik, P. M., van Hinsbergh, V. W. and Virmani, R. (2009) Thin-walled microvessels in human coronary atherosclerotic plaques show incomplete endothelial junctions: relevance of compromised structural integrity for intraplaque microvascular leakage. J Am Coll Cardiol, 53(17), pp. 1517-1527.
Soldi, R., Mitola, S., Strasly, M., Defilippi, P., Tarone, G. and Bussolino, F. (1999) Role of αvβ3 integrin in the activation of vascular endothelial growth factor receptor-2. Embo j, 18(4), pp. 882-892.
Song, S. J., Poliseno, L., Song, M. S., Ala, U., Webster, K., Ng, C., Beringer, G., Brikbak, N. J., Yuan, X. and Cantley, L. C. (2013) MicroRNA-antagonism regulates breast cancer stemness and metastasis via TET-family- dependent chromatin remodeling. Cell, 154(2), pp. 311-324.
Sprague, A. H. and Khalil, R. A. (2009) Inflammatory cytokines in vascular dysfunction and vascular disease. Biochemical pharmacology, 78(6), pp. 539-552.
Stern, D., Kaiser, E. and Nawroth, P. (1988) Regulation of the coagulation system by vascular endothelial cells. Pathophysiology of Haemostasis and Thrombosis, 18(4-6), pp. 202-214.
Strieter, R. M., Polverini, P. J. and Kunkel, S. L. (1999) CXC chemokines as regulators of angiogenesis. in: Google Patents.
Strömblad, S., Becker, J. C., Yebra, M., Brooks, P. C. and Cheresh, D. A. (1996) Suppression of p53 activity and p21WAF1/CIP1 expression by vascular cell integrin alphaVbeta3 during angiogenesis. Journal of Clinical Investigation, 98(2), pp. 426.
238 Suarez, Y., Fernandez-Hernando, C., Pober, J. S. and Sessa, W. C. (2007) Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells. Circ Res, 100(8), pp. 1164-73.
Suárez, Y., Fernández-Hernando, C., Pober, J. S. and Sessa, W. C. (2007) Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells. Circ Res, 100(8), pp. 1164-1173.
Suárez, Y., Fernández-Hernando, C., Yu, J., Gerber, S. A., Harrison, K. D., Pober, J. S., Iruela-Arispe, L. M., Merkenschlager, M. and Sessa, W. C. (2008) Dicer-dependent endothelial microRNAs are necessary for postnatal angiogenesis. Proceedings of the National Academy of Sciences, 105(37), pp. 14082-14087.
Sulston, J. E. and Horvitz, H. R. (1977) Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Developmental biology, 56(1), pp. 110-156.
Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C., Davis, S., Sato, T. N. and Yancopoulos, G. D. (1996) Requisite role of angiopoietin- 1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell, 87(7), pp. 1171-1180.
Suzuki, H., Katsura, A., Matsuyama, H. and Miyazono, K. (2015) MicroRNA regulons in tumor microenvironment. Oncogene, 34(24), pp. 3085-3094.
Szekanecz, Z. and Koch, A. E. (2004) Vascular endothelium and immune responses: implications for inflammation and angiogenesis. Rheumatic Disease Clinics of North America, 30(1), pp. 97-114.
Takahashi, H. and Shibuya, M. (2005) The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions. Clinical science, 109(3), pp. 227-241.
Tan, K. T. and Lip, G. Y. (2005) The potential role of platelet microparticles in atherosclerosis. Thromb Haemost, 94(3), pp. 488-492.
Tanjore, H., Zeisberg, E. M., Gerami-Naini, B. and Kalluri, R. (2008) β1 integrin expression on endothelial cells is required for angiogenesis but not for vasculogenesis. Developmental dynamics, 237(1), pp. 75-82.
Tans, G., Rosing, J., Thomassen, M., Heeb, M. J., Zwaal, R. and Griffin, J. H. (1991) Comparison of anticoagulant and procoagulant activities of stimulated platelets and platelet-derived microparticles. Blood, 77(12), pp. 2641-2648.
239 Taverna, D. and Hynes, R. O. (2001) Reduced blood vessel formation and tumor growth in α5-integrin-negative teratocarcinomas and embryoid bodies. Cancer research, 61(13), pp. 5255-5261.
Tay, Y., Zhang, J., Thomson, A. M., Lim, B. and Rigoutsos, I. (2008) MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature, 455(7216), pp. 1124-1128.
Théry, C., Ostrowski, M. and Segura, E. (2009) Membrane vesicles as conveyors of immune responses. Nature Reviews Immunology, 9(8), pp. 581-593.
Théry, C., Zitvogel, L. and Amigorena, S. (2002) Exosomes: composition, biogenesis and function. Nature Reviews Immunology, 2(8), pp. 569-579.
Thiagarajan, P. and Tait, J. (1990) Binding of annexin V/placental anticoagulant protein I to platelets. Evidence for phosphatidylserine exposure in the procoagulant response of activated platelets. Journal of Biological Chemistry, 265(29), pp. 17420-17423.
Thompson, E. A. and Salem, H. H. (1986) Inhibition by human thrombomodulin of factor Xa-mediated cleavage of prothrombin. Journal of Clinical Investigation, 78(1), pp. 13.
Thoreen, C. C., Kang, S. A., Chang, J. W., Liu, Q., Zhang, J., Gao, Y., Reichling, L. J., Sim, T., Sabatini, D. M. and Gray, N. S. (2009) An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. Journal of Biological Chemistry, 284(12), pp. 8023-8032.
Tolsma, S. S., Volpert, O. V., Good, D. J., Frazier, W. A., Polverini, P. J. and Bouck, N. (1993) Peptides derived from two separate domains of the matrix protein thrombospondin-1 have anti-angiogenic activity. J Cell Biol, 122(2), pp. 497-511.
Townsend, N., Williams, J., Bhatnagar, P., Wickramasinghe, K. and Rayner, M. (2014) Cardiovascular disease statistics 2014. London: British Heart Foundation.
Tregouet, D., Schnabel, R., Alessi, M., Godefroy, T., Declerck, P., Nicaud, V., Munzel, T., Bickel, C., Rupprecht, H. and Lubos, E. (2009) Activated thrombin activatable fibrinolysis inhibitor levels are associated with the risk of cardiovascular death in patients with coronary artery disease: the AtheroGene study. Journal of Thrombosis and Haemostasis, 7(1), pp. 49- 57.
Turitto, V. T. and Hall, C. L. (1998) Mechanical factors affecting hemostasis and thrombosis. Thrombosis research, 92(6), pp. S25-S31.
240
Tushuizen, M. E., Diamant, M., Sturk, A. and Nieuwland, R. (2011) Cell-derived microparticles in the pathogenesis of cardiovascular disease friend or foe? Arteriosclerosis, Thrombosis, and Vascular Biology, 31(1), pp. 4-9.
Undas, A., Stepien, E., Branicka, A., Wolkow, P., Zmudka, K. and Tracz, W. (2009) Thrombin formation and platelet activation at the site of vascular injury in patients with coronary artery disease treated with clopidogrel combined with aspirin. Kardiol Pol, 67(6), pp. 591-8.
Urbich, C., Kuehbacher, A. and Dimmeler, S. (2008) Role of microRNAs in vascular diseases, inflammation and angiogenesis. Cardiovascular research.
Valadi, H., Ekstrom, K., Bossios, A., Sjostrand, M., Lee, J. J. and Lotvall, J. O. (2007) Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol, 9(6), pp. 654-9.
Van Creveld, S., Paulssen, M. and Vonk, R. (1951) SIGNIFICANCE OF CLOTTING FACTORS IN BLOOD-PLATELETS, IN NORMAL AND PATHOLOGIGAL CONDITIONS. The Lancet, 258(6676), pp. 242-244.
Van der Veken, B., De Meyer, G. R. and Martinet, W. (2016) Intraplaque neovascularization as a novel therapeutic target in advanced atherosclerosis. Expert opinion on therapeutic targets, (just-accepted).
Vandekeere, S., Dewerchin, M. and Carmeliet, P. (2015) Angiogenesis revisited: an overlooked role of endothelial cell metabolism in vessel sprouting. Microcirculation.
Vanhoutte, P. and Boulanger, C. (1999) Endothelial function and dysfunction. in Biology of the arterial wall: Springer. pp. 49-70.
VanWijk, M. J., VanBavel, E., Sturk, A. and Nieuwland, R. (2003) Microparticles in cardiovascular diseases. Cardiovascular research, 59(2), pp. 277-287.
Verma, S. and Anderson, T. J. (2002) Fundamentals of endothelial function for the clinical cardiologist. Circulation, 105(5), pp. 546-549.
Versteeg, H. H., Heemskerk, J. W., Levi, M. and Reitsma, P. H. (2013) New fundamentals in hemostasis. Physiological reviews, 93(1), pp. 327-358.
Virmani, R., Kolodgie, F. D., Burke, A. P., Finn, A. V., Gold, H. K., Tulenko, T. N., Wrenn, S. P. and Narula, J. (2005) Atherosclerotic plaque progression and vulnerability to rupture angiogenesis as a source of intraplaque hemorrhage. Arteriosclerosis, Thrombosis, and Vascular Biology, 25(10), pp. 2054-2061.
241
Vital, S. A., Becker, F., Holloway, P. M., Russell, J., Perretti, M., Granger, D. N. and Gavins, F. N. (2016) Formyl-Peptide Receptor 2/3/Lipoxin A4 Receptor Regulates Neutrophil-Platelet Aggregation and Attenuates Cerebral Inflammation Impact for Therapy in Cardiovascular Disease. Circulation, 133(22), pp. 2169-2179.
Voellenkle, C., van Rooij, J., Guffanti, A., Brini, E., Fasanaro, P., Isaia, E., Croft, L., David, M., Capogrossi, M. C. and Moles, A. (2012) Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. Rna, 18(3), pp. 472-484.
Volpert, O. (2000) Modulation of endothelial cell survival by an inhibitor of angiogenesis thrombospondin-1: a dynamic balance. Cancer and Metastasis Reviews, 19(1-2), pp. 87-92.
Von dem Borne, A., Modderman, P., Admiraal, L., Nieuwenhuis, H., Knapp, W., Dörken, B. and Gilks, W. (1989) Platelet antibodies, the overall results. Leukocyte Typing IV.
Wahlgren, J., De, L. K. T., Brisslert, M., Vaziri Sani, F., Telemo, E., Sunnerhagen, P. and Valadi, H. (2012) Plasma exosomes can deliver exogenous short interfering RNA to monocytes and lymphocytes. Nucleic Acids Res, 40(17), pp. e130.
Wang, B., Hsu, S. h., Wang, X., Kutay, H., Bid, H. K., Yu, J., Ganju, R. K., Jacob, S. T., Yuneva, M. and Ghoshal, K. (2014) Reciprocal regulation of microRNA-122 and c-Myc in hepatocellular cancer: Role of E2F1 and transcription factor dimerization partner 2. Hepatology, 59(2), pp. 555- 566.
Wang, L., Xiao, H., Zhang, X., Liao, W., Fu, S. and Huang, H. (2015) Restoration of CCAAT enhancer binding protein α P42 induces myeloid differentiation and overcomes all-trans retinoic acid resistance in human acute promyelocytic leukemia NB4-R1 cells. International Journal of Oncology, 47(5), pp. 1685-1695.
Wang, Q., Downey, G. P. and McCulloch, C. A. (2011) Focal adhesions and Ras are functionally and spatially integrated to mediate IL-1 activation of ERK. The FASEB Journal, 25(10), pp. 3448-3464.
Wang, S., Aurora, A. B., Johnson, B. A., Qi, X., McAnally, J., Hill, J. A., Richardson, J. A., Bassel-Duby, R. and Olson, E. N. (2008) The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Developmental cell, 15(2), pp. 261-271.
Wang, S. and Olson, E. N. (2009) AngiomiRs—key regulators of angiogenesis. Curr Opin Genet Dev, 19(3), pp. 205-211.
242
Wang, X.-Q. and Frazier, W. A. (1998) The thrombospondin receptor CD47 (IAP) modulates and associates with α2β1 integrin in vascular smooth muscle cells. Molecular Biology of the Cell, 9(4), pp. 865-874.
Wang, Z., Lin, S., Li, J. J., Xu, Z., Yao, H., Zhu, X., Xie, D., Shen, Z., Sze, J. and Li, K. (2011) MYC protein inhibits transcription of the microRNA cluster MC-let-7a-1 let-7d via noncanonical E-box. Journal of Biological Chemistry, 286(46), pp. 39703-39714.
Watson, G. W. and Andley, U. P. (2010) Activation of the unfolded protein response by a cataract-associated αA-crystallin mutation. Biochem Biophys Res Commun, 401(2), pp. 192-196.
Weber, K. S., Nelson, P. J., Grone, H. J. and Weber, C. (1999) Expression of CCR2 by endothelial cells : implications for MCP-1 mediated wound injury repair and In vivo inflammatory activation of endothelium. Arterioscler Thromb Vasc Biol, 19(9), pp. 2085-93.
Weiss, H. J. (1975) Platelet physiology and abnormalities of platelet function. New England Journal of Medicine, 293(11), pp. 531-541.
Weitz, S. H., Gong, M., Barr, I., Weiss, S. and Guo, F. (2014) Processing of microRNA primary transcripts requires heme in mammalian cells. Proceedings of the National Academy of Sciences, 111(5), pp. 1861- 1866.
Wencel-Drake, J. D., Dieter, M. G. and Lam, S. (1993) Immunolocalization of beta 1 integrins in platelets and platelet-derived microvesicles. Blood, 82(4), pp. 1197-1203.
Wheeler, B. M., Heimberg, A. M., Moy, V. N., Sperling, E. A., Holstein, T. W., Heber, S. and Peterson, K. J. (2009) The deep evolution of metazoan microRNAs. Evolution & development, 11(1), pp. 50-68.
Willis, G. R. (2015) Characterisation of Microparticles and Nitro-Oxidative Stress in Cardiometabolic Disease. Unpublished, Cardiff University.
Wilson, L. A., McKeown, L., Tumova, S., Li, J. and Beech, D. J. (2015) Expression of a long variant of CRACR2A that belongs to the Rab GTPase protein family in endothelial cells. Biochem Biophys Res Commun, 456(1), pp. 398-402.
Woolard, J., Wang, W.-Y., Bevan, H. S., Qiu, Y., Morbidelli, L., Pritchard-Jones, R. O., Cui, T.-G., Sugiono, M., Waine, E. and Perrin, R. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant. Cancer research, 64(21), pp. 7822-7835.
243
Würdinger, T., Tannous, B. A., Saydam, O., Skog, J., Grau, S., Soutschek, J., Weissleder, R., Breakefield, X. O. and Krichevsky, A. M. (2008) miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells. Cancer cell, 14(5), pp. 382-393.
Xu, X., Qi, X., Shao, Y., Li, Y., Fu, X., Feng, S. and Wu, Y. (2016) Blockade of TGF-β-activated kinase 1 prevents advanced glycation end products- induced inflammatory response in macrophages. Cytokine, 78, pp. 62-68.
Yan, L.-X., Huang, X.-F., Shao, Q., Huang, M.-Y., Deng, L., Wu, Q.-L., Zeng, Y.- X. and Shao, J.-Y. (2008) MicroRNA miR-21 overexpression in human breast cancer is associated with advanced clinical stage, lymph node metastasis and patient poor prognosis. Rna, 14(11), pp. 2348-2360.
Yancopoulos, G. D., Davis, S., Gale, N. W., Rudge, J. S., Wiegand, S. J. and Holash, J. (2000) Vascular-specific growth factors and blood vessel formation. Nature, 407(6801), pp. 242-248.
Yang, W. J., Yang, D. D., Na, S., Sandusky, G. E., Zhang, Q. and Zhao, G. (2005) Dicer is required for embryonic angiogenesis during mouse development. Journal of Biological Chemistry, 280(10), pp. 9330-9335.
Yano, K., Brown, L. F. and Detmar, M. (2001) Control of hair growth and follicle size by VEGF-mediated angiogenesis. The Journal of clinical investigation, 107(4), pp. 409-417.
Yao, Y.-y., Fu, C., Ma, G.-s., Feng, Y., Shen, C.-x., Wu, G.-q., Zhang, X.-g., Ding, J.-d., Tang, C.-c. and Chen, Z. (2013) Tissue kallikrein is related to the severity of coronary artery disease. Clinica Chimica Acta, 423, pp. 90- 98.
Yi, R., Qin, Y., Macara, I. G. and Cullen, B. R. (2003) Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes & Development, 17(24), pp. 3011-3016.
Ylä-Herttuala, S. and Alitalo, K. (2003) Gene transfer as a tool to induce therapeutic vascular growth. Nature medicine, 9(6), pp. 694-701.
Yoon, S. O., Chun, S.-M., Han, E. H., Choi, J., Jang, S. J., Koh, S. A., Hwang, S. and Yu, E. (2011) Deregulated expression of microRNA-221 with the potential for prognostic biomarkers in surgically resected hepatocellular carcinoma. Human pathology, 42(10), pp. 1391-1400.
Yusuf, S., Reddy, S., Ôunpuu, S. and Anand, S. (2001) Global burden of cardiovascular diseases. Circulation, 104(23), pp. 2855-2864.
244 Zampetaki, A., Kirton, J. P. and Xu, Q. (2008) Vascular repair by endothelial progenitor cells. Cardiovascular research.
Zeller, J., Lenz, A., Eschenfelder, C., Zunker, P. and Deuschl, G. (2005) Platelet-leukocyte interaction and platelet activation in acute stroke with and without preceding infection. Arteriosclerosis, Thrombosis, and Vascular Biology, 25(7), pp. 1519-1523.
Zhang, H., Kolb, F. A., Jaskiewicz, L., Westhof, E. and Filipowicz, W. (2004) Single processing center models for human Dicer and bacterial RNase III. Cell, 118(1), pp. 57-68.
Zhang, L., Zhou, M., Qin, G., Weintraub, N. L. and Tang, Y. (2014) MiR-92a regulates viability and angiogenesis of endothelial cells under oxidative stress. Biochem Biophys Res Commun, 446(4), pp. 952-958.
Zhang, X., McGeoch, S. C., Johnstone, A. M., Holtrop, G., Sneddon, A. A., MacRury, S. M., Megson, I. L., Pearson, D. W., Abraham, P., De Roos, B., Lobley, G. E. and O'Kennedy, N. (2014) Platelet-derived microparticle count and surface molecule expression differ between subjects with and without type 2 diabetes, independently of obesity status. J Thromb Thrombolysis, 37(4), pp. 455-63.
Zhou, H.-R., Islam, Z. and Pestka, J. J. (2003) Rapid, sequential activation of mitogen-activated protein kinases and transcription factors precedes proinflammatory cytokine mRNA expression in spleens of mice exposed to the trichothecene vomitoxin. Toxicological Sciences, 72(1), pp. 130- 142.
Zhou, Q., Gallagher, R., Ufret-Vincenty, R., Li, X., Olson, E. N. and Wang, S. (2011) Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23 27 24 clusters. Proceedings of the National Academy of Sciences, 108(20), pp. 8287-8292.
Zimmerman, G. A. and Weyrich, A. S. (2008) Signal-dependent protein synthesis by activated platelets: new pathways to altered phenotype and function. Arterioscler Thromb Vasc Biol, 28(3), pp. s17-24.
Zipper, H., Brunner, H., Bernhagen, J. and Vitzthum, F. (2004) Investigations on DNA intercalation and surface binding by SYBR Green I, its structure determination and methodological implications. Nucleic Acids Res, 32(12), pp. e103-e103.
Zwaal, R. F. and Schroit, A. J. (1997) Pathophysiologic implications of membrane phospholipid asymmetry in blood cells. Blood, 89(4), pp. 1121-1132.
245
246 APPENDIX
Appendix 1 Table 3.4: Relative group biological process association of predicted mRNA targets of top 25 highly expressed miRNAs in PMP. Term Genes Fold Enrichment MAPK cascade FGF18, FGF7, IL18, FGF16, 1.879519151 FGF10, TGFB1, CAMKK2, MEN1 Positive regulation of HMGN3, THRA, IL18, ARNT2, 1.346956793 transcription from RNA EDN1, ATP1B4, FGF10, FOXO1, polymerase II promoter FOXO4 Angiogenesis FGF18, ATP5B, IL18, FGF10, 1.803383174 CXCR3, TNFSF12, MMP2, TSPAN12, SERPINE1 Aging LITAF, TACR3, NPY2R, SNCA, 1.890150775 MMP7, PAX5, ITGB2, Negative regulation of JDP2, EDN1, SNCA, FOXO1, 1.367872271 transcription from RNA AURKB, CBX7, TGFB1, CBX6 polymerase II promoter Positive regulation of natural CCL3, CXCL14, CCL4L1, CCL5, 7.03477168 killer cell chemotaxis XCL1, CCL7 Positive regulation of release F2RL3, PDPK1, BAX, SNCA, 3.343687774 of sequestered calcium ion CXCL9, IL13, CXCR3, CXCL11, into cytosol XCL1, CXCL10, F2R Cell-cell adhesion RTN4, ABCF3, RANGAP1, 1.574819736 LARP1, PAK6, BZW2, EFHD2, BZW1 Cell proliferation COPS2, RETNLB, PPARD, 1.457568813 CDC14A, ELF5, NR6A1, CLK1 Phosphatidylinositol-mediated FGF18, FGF7, ERBB4, ERBB2, 1.935668308 signalling FGF16, NCS1, KITLG, FGF10 Negative regulation of neuron SNCA, CNTFR, BCL2L1, PDPK1, 1.803104357 apoptotic process BDNF, CLCF1, BCL2, PIK3CA, POU4F1 Neural crest cell development EDNRA, ALDH1A2, TAPT1, 4.419279645 EDN1, FOXC2, NRG1, SOX9 Protein autophosphorylation ERBB4, STK10, ERBB2, MKNK2, 1.67007661 KIT, AURKB, MAPKAPK2, CLK1 Anterior/posterior pattern ARC, RARG, HOXA11, YY1, 2.051808407 specification EMX2, VANGL2, ZBTB16, GLI2, HOXD10
247
Appendix 2
Table 3.6: Relative group molecular functions associated with the predicted mRNA targets of top 25 highly expressed miRNAs in PMP.
Term Genes Fold Enrichment Calcium-dependent PRKCA, CCL3, PRKCG 6.128146176 protein kinase C activity BH3 domain binding BAX, BCL2, BCL2L1 6.128146176 Sequence-specific mRNA SRSF3, FMR1, LIN28A 6.128146176 binding ATPase inhibitor activity PLN, ATPIF1, FNIP2 6.128146176 Aldehyde dehydrogenase ALDH1A3, ALDH3B2, ALDH3A2 5.447241045 [NAD(P)+] activity 3-chloroallyl aldehyde FAR1, ALDH1A2, ALDH3B2, 5.10678848 dehydrogenase activity ALDH3A2 CCR5 chemokine CCL3, CCL4L1, CCL5, STAT1, 5.10678848 receptor binding STAT3 MAP kinase activity MAPK6, MAPK13, MAPK4, NLK, 4.669063753 MAPK3 CCR1 chemokine CCL3, CCL4L1, CCL5, CCL7 4.669063753 receptor binding Phosphate ion binding MTHFD2, G6PC, RELA, GNG12, 4.085430784 RPH3A, SLC34A2 Receptor signalling TYRO3, ERBB4, ERBB2, KIT, KDR 4.085430784 protein tyrosine kinase activity RNA stem-loop binding CPEB3, FMR1, ZC3H12A, DAZAP1 4.085430784 Peptide alpha-N- NAA20, NAA11, NAA10, NAA60, 3.714027986 acetyltransferase activity NAA16 pre-mRNA binding SRSF2, TARBP2, SRSF6, TRA2B 3.63149403 Retinoic acid receptor PRMT2, LRIF1, SNW1, HMGA1, 3.404525653 binding NSD1 Glycine binding GSS, GRIN2B, GLRA3, GLRA2, 3.268344627 GRIN1 MAP kinase DUSP5, DUSP2, DUSP10, DUSP8, 3.142639065 tyrosine/serine/threonine DUSP6 phosphatase activity miRNA binding TARBP2, POU5F1, FMR1, AGO1, 3.064073088 ZC3H12A, LIN28A
248
249 Appendix 3: THBS-1 3’ UTR
TTGAAAGCCTTTGGAAAGCATAATATATGTTCTGGAAGGTTCACGCTGTGTC GGTCTCCTAGCATCAATGTCAGCTAATAAAATTAAATGCTAATGTGCTTGAA CAACCTTAAAATTAGGCTTTTGTCATTAGAAAAGTAGAGCTATTCCTATGTG GTTAACTTATTAACTAAGATGTCTATGCTTTTATGAATTAGTTTTCATTTGTAT ATTTATTTATATTTGTTTATTTAACAGATCCCTAATCATCAAATTGTTGATTGA AAGACTGATCATAAACCAATGCTGGTATTGCACCTTCTGGAACTATGGGCT TGAGAAAACCCCCAGGATCACTTCTCCTTGGCTTCCTTCTTTTCTGTGCTTG CATCAGTGTGGACTCCTAGAACGTGCGACCTGCCTCAAGAAAATGCAGTTT TCAAAAACAGACTCAGCATTCAGCCTCCAATGAATAAGACATCTTCCAAGCA TATAAACAATTGCTTTGGTTTCCTTTTGAAAAAGCATCTACTTGCTTCAGTTG GGAAGGTGCCCATTCCACTCTGCCTTTGTCACAGAGCAGGGTGCTATTGTG AGGCCATCTCTGAGCAGTGGACTCAAAAGCATTTTCAGGCATGTCAGAGAA GGGAGGACTCACTAGAATTAGCAAACAAAACCACC CTGACATCCTCCTTCAGGAACACGGGGAGCAGAGGCCAAAGCACTAAGGG GAGGGCGCATACCCGAGACGATTGTATGAAGAAAATATGGAGGAACTGTTA CATGTTCGGTACTAAGTCATTTTCAGGGGATTGAAAGACTATTGCTGGATTT CATGATGCTGACTGGCGTTAGCTGATTAACCCATGTAAATAGGCACTTAAAT AGAAGCAGGAAAGGGAGACAAAGACTGGCTTCTGGACTTCCTCCCTGATC CCCACCCTTACTCATCACCTGCAGTGGCCAGAATTAGGGAATCAGAATCAA ACCAGTGTAAGGCAGTGCTGGCTGCCATTGCCTGGTCACATTGAAATTGGT GGCTTCATTCTAGATGTAGCTTGTGCAGATGTAGCAGGAAAATAGGAAAAC CTACCATCTCAGTGAGCACCAGCTGCCTCCCAAAGGAGGGGCAGCCGTGC TTATATTTTTATGGTTACAATGGCACAAAATTATTATCAACCTAACTAAAACA TTCCTTTTCTCTTTTTTCCTGAATTATCATGGAGTTTTCTAATTCTCTCTTTTG GAATGTAGATTTTTTTTAAATGCTTTACGATGTAA AATATTTATTTTTTACTTATTCTGGAAGATCTGGCTGAAGGATTATTCATGGA ACAGGAAGAAGCGTAAAGACTATCCATGTCATCTTTGTTGAGAGTCTTCGT GACTGTAAGATTGTAAATACAGATTATTTATTAACTCTGTTCTGCCTGGAAAT TTAGGCTTCATACGGAAAGTGTTTGAGAGCAAGTAGTTGACATTTATCAGCA AATCTCTTGCAAGAACAGCACAAGGAAAATCAGTCTAATAAGCTGCTCTGC CCCTTGTGCTCAGAGTGGATGTTATGGGATTCTTTTTTTCTCTGTTTTATCTT TTCAAGTGGAATTAGTTGGTTATCCATTTGCAAATGTTTTAAATTGCAAAGAA AGCCATGAGGTCTTCAATACTGTTTTACCCCATCCCTTGTGCATATTTCCAG GGAGAAGGAAAGCATATACACTTTTTTCTTTCATTTTTCCAAAAGAGAAAAA AATGACAAAAGGTGAAACTTACATACAAATATTACCTCATTTGTTGTGTGAC TGAGTAAAGAATTTTTGGATCAAGCGGAAAGAGTTTAAGTGTCTAACAAACT TAAAGCTACTGTAGTACCTAAAAAGTCAGTGTTGTACATAGCATAAAAACTC TGCAGAGAAGTATTCCCAATAAGGAAATAGCATT GAAATGTTAAATACAATTTCTGAAAGTTATGTTTTTTTTCTATCATCTGGTAT ACCATTGCTTTATTTTTATAAATTATTTTCTCATTGCCATTGGAATAGATATCT CAGATTGTGTAGATATGCTATTTAAATAATTTATCAGGAAATACTGCCTGTA GAGTTAGTATTTCTATTTTTATATAATGTTTGCACACTGAATTGAAGAATTGT TGGTTTTTTCTTTTTTTTGTTTTGTTTTTTTTTTTTTTTTTTTTTGCTTTTGACC TCCCATTTTTACTATTTGCCAATACCTTTTTCTAGGAATGTGCTTTTTTTTGT ACACATTTTTATCCATTTTACATTCTAAAGCAGTGTAAGTTGTATATTACTGT
250 TTCTTATGTACAAGGAACAACAATAAATCATATGGAAATTTATATTTATACTT ACTGTATCCATGCTTATTTGTTCTCTACTGGC
251 Appendix 4: Further Results
PMP mediates ATF-4 enrichment at ET-1 promoter
PMP mediates ATF-4 enrichment at ET-1 promoter. Percentage enrichment of ATF-4 protein at ET-1 promoter in (A) 1% serum (EC) or 100μg/ml PMPs in 1% serum (EC+PMP), (B) 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI) or 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), (C) 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP), and (D) Precipitated with Histone H3 (positive control) antibody or normal IgG (negative control) antibody. (E) Relative enrichment to corresponding basal levels of ATF-4 protein at ET-1 in EC+PMP, EC+SC+PMP, EC+7aI+PMP or Histone H3 precipitation. Data shown are mean ± standard error of mean, n=9 independent biological samples of PMPs, pooled to in equal n=3. *P<0.05 Tukey SD percentage enrichment between EC+PMP and EC, EC+7aI+PMP and EC+7aI, or EC+SC+PMP and EC+SC.
252 PMP mediates ATF-4 enrichment at ANG promoter
PMP mediates ATF-4 enrichment at ANG promoter. Percentage enrichment of ATF-4 protein at ANG promoter in (A) 1% serum (EC) or 100μg/ml PMPs in 1% serum (EC+PMP), (B) 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI) or 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), (C) 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP), and (D) Precipitated with Histone H3 (positive control) antibody or normal IgG (negative control) antibody. (E) Relative enrichment to corresponding basal levels of ATF-4 protein at ANG in EC+PMP, EC+SC+PMP, EC+7aI+PMP or Histone H3 precipitation. Data shown are mean ± standard error of mean, n=9 independent biological samples of PMPs, pooled to in equal n=3. *P<0.05 Tukey SD percentage enrichment between EC+PMP and EC, EC+7aI+PMP and EC+7aI, or EC+SC+PMP and EC+SC.
253 PMP mediated changes in ET-1 is independent of transcription activity
PMPs elicit early transcription of ET-1. Relative mRNA expression of ET-1 in HUVEC cultured in (EC) 1% serum, (EC+PMP) 100μg/ml PMPs, or (EC+PMP+RNAse) in the presence of 100μg/ml PMPs treated with RNAse for either (A) 12-hours or (B) 24-hours. Data shown are mean ± standard error of mean, n=3 independent biological samples of PMPs. *P<0.05 Tukey SD individual miRNA expression level between EC and EC+PMP, or between EC+PMP and EC+PMP+RNAse.
254 Transfection reagent effects the expression of MCP-1 protein
Transfection reagent increased MCP-1 release by HUVEC. MCP-1 protein concentration released in the growth medium of HUVEC cultured in 1% serum (EC), transfected with Let-7a inhibitor for 24-hours (EC+7aI) or transfected with scrambled inhibitor for 24-hours (EC+SC). Data shown are mean ± standard error of mean, n=15 pooled experimental samples. *P<0.05 Tukey SD protein concentration comparisons between EC, EC+7aI and EC+SC.
255 PMP induce slow cell death through a late Let-7a dependent mechanism
PMP induce slow cell death through a late Let-7a dependent mechanism. Luminescence values from HUVEC cultured in 1% serum (EC), 100μg/ml PMPs in 1% serum (EC+PMP), 1% serum after 24-hours transfection of Let-7a inhibitor (EC+7aI), 100μg/ml PMPs after 24-hours transfection of Let-7a inhibitor in 1% serum (EC+7aI+PMP), 1% serum after 24-hours transfection of scrambled inhibitor (EC+SC) or 100μg/ml PMPs after 24-hours transfection of scrambled inhibitor in 1% serum (EC+SC+PMP). Data shown are mean luminescence ± standard error of mean, n=3 independent biological samples of healthy PMPs. *P<0.05 Tukey SD relative mRNA expression of all shown comparisons between EC+PMP, EC+7aI, EC+7aI+PMP, EC+SC and EC+SC+PMP.
256