Aspiciliella Pakistanica a New Lichen Species (Megasporaceae, Pertusariales, Ascomycota) from Pakistan

https://doi.org/10.11646/phytotaxa.511.2.5

Aspiciliella pakistanica a new lichen species (Megasporaceae, Pertusariales, Ascomycota) from Pakistan

KAMRAN HABIB1,3,*, QUDSIA FIRDOUS1,4, MOHAMMAD SOHRABI2,5 & ABDUL NASIR KHALID1,6 1 Department of Botany, University of the Punjab, Lahore 54590, Pakistan. 2 The Museum of Iranian Lichens, Iranian Research Organization for Science and Technology, Iran. 3 [email protected]; https://orcid.org/0000-0003-2572-0306 4 [email protected]; https://orcid.org/0000-0002-3096-0198 5 [email protected]; https://orcid.org/0000-0003-4864-3905 6 [email protected]; https://orcid.org/0000-0002-5635-8031 *Corresponding author: [email protected]

Abstract

A new species in Megasporaceae, Aspiciliella pakistanica is described and illustrated from Pakistan. A comparative morpho– anatomical study and ITS–based molecular analysis confirmed its position within the recently resurrected genus Aspiciliella. The taxon is characterized by whitish–grey thalli having large and thick areoles without pale lines on the surface, and a discontinuous algal layer arranged in groups of vertical rows. Its positioning in a separate branch in the phylogenetic tree also makes it distinct from the other known species of the genus.

Keywords: Azad Jammu & Kashmir, lichenized fungi, new species, Pakistan, taxonomy

Introduction

The currently accepted taxonomy of the lichenized family Megasporaceae (Pertusariales) includes eight genera i.e. Aspicilia A. Massal., Circinaria Link (Sohrabi et al. 2013b), Lobothallia (Clauzade & Cl. Roux) Hafellner (Paukov et al. 2019), Megaspora (Clauzade & Cl. Roux) Hafellner & V. Wirth, Sagedia Ach. (Nordin et al. 2010), Teuvoa Sohrabi & S. Leavitt (Sohrabi et al. 2013a), Aspiciliella M. Choisy (Zakeri et al. 2017) and Oxneriaria S.Y. Kondr. & Lőkös (Haji Moniri et al. 2017). The genus Aspiciliella was resurrected recently based on three phylogenetic markers: ITS, mtSSU, and nuLSU (Zakeri et al. 2019a) and is characterized by a crustose thallus that is rimose–areolate and K+ red in part; a green, olive–green to greenish–brown N+ light green epihymenium; 8–spored asci, ellipsoid, colourless, simple ascospores and very short (7–11μm long) conidia. The genus includes three species; Aspiciliella cupreoglauca (B. de Lesd.) Zakeri, Divakar & Otte, A. intermutans (Nyl.) M. Choisy and A. portosantana Sipman & Zakeri (Zakeri et al. 2017, 2019b). In this study, Aspiciliella pakistanica sp. nov. is being described from Pakistan, based on the detailed morphological and anatomical characterization. The ITS–based phylogenetic analysis also supports the identity of this taxon as a novel species. This is the first report of the genus Aspiciliella from the country.

Materials and methods

Specimens were examined macro– and micromorphologically with a stereomicroscope (Meiji Techno, EMZ–5TR, Japan) and a compound microscope (SWIFT M4000–D). The chemistry of Aspiciliella pakistanica was analyzed using spot tests i.e. K, KC, and C (Nylander 1866) as updated in (Orange et al. 2001). Freehand sections of thallus and pycnidia mounted in water were observed at different magnifications for anatomical characterization and measurements. A minimum of twenty measurements were made for each diagnostic feature Specimen preparation and herbarium protocols were followed as outlined by Obermayer (2002). The morphological description and terminology follows that of Owe–Larsson et al. (2008). Herbarium abbreviations follow Thiers (2019). For MycoBank registration protocol see Crous et al. (2004) and Robert et al. (2013).

Accepted by Christian Printzen: 28 Jun. 2021; published: 15 Jul. 2021 175 DNA extraction, PCR ampliﬁcation and Sequencing

Genomic DNA was extracted directly from a portion of thallus of each specimen (Holotype, Isotype and Paratype) using a modiﬁed 2% CTAB method (Gardes & Bruns 1993). The ITS–nrDNA region (Internal Transcribed Spacer of the nrDNA) was amplified using the primers pair i.e. ITS1F forward primer (5´ CTTGGTCATTTAGAGGAAGTAA 3´) (Gardes & Bruns 1993) and ITS4 reverse primer (5´ TCCTCCGCTTATTGATATGC 3´) (White & Garrott 1990), following the amplification protocol of Khan et al. (2018). The amplified DNA fragments (PCR products) were visualized with the help of 1% agarose gel using ethidium bromide through a Gel documentation system (Sambrook & Russel, 2006). The amplified products were then sequenced commercially. Phylogenetic Analysis: Three forward and reverse sequences were reassembled by using BioEdit software (Hall 1999). The ITS sequences of other Aspiciliella species were retrieved from GenBank for phylogenetic analysis. Maximum percent identity and query coverage of sequence with related taxa were examined. Multiple sequence alignment was performed using MAFFT with all parameters set to default values. All sequences were trimmed at their conserved sites using BioEdit. The phylogenetic tree was reconstructed using the software MEGA 7.0 (Kumar et al. 2016). Maximum Likelihood tree reconstruction was based on the Kimura 2–parameter model, which was selected as the best substitution model by MEGA 7.0 (Kumar et al. 2016). One thousand rapid bootstrap replicates were run to infer the evolutionary history of the species. Lobothallia radiosa (Hoffm.) Hafellner was selected as an outgroup.

TABLE 1. Voucher specimens and NCBI GenBank accession numbers of the sequences used in the phylogenetic analysis.

ITS Genbank Acession Numbers Species names Origin Voucher name

MH210666 Aspiciliella intermutans Armenia Zakeri 40529 (GLM)

MH210658 Aspiciliella intermutans Armenia Zakeri 39702 (GLM)

KY596010 Aspiciliella intermutans Armenia Zakeri 40501 (GLM)

KY596011 Aspiciliella intermutans Armenia Zakeri 40503 (GLM)

KY596009 Aspiciliella intermutans Armenia Zakeri 40494 (GLM)

MH248855 Aspiciliella intermutans Czech Republic Palice 11394 (PRA)

MH248854 Aspiciliella intermutans Czech Republic Lenzova 255 (PRC)

MH248852 Aspiciliella intermutans Czech Republic Lenzova 25 (PRC)

MH248851 Aspiciliella intermutans Czech Republic Lenzova 254 (PRC)

MH248853 Aspiciliella intermutans Czech Republic Palice 14789 (PRA)

MH210679 Aspiciliella intermutans Iran Zakeri 49961 (GLM)

MH210678 Aspiciliella intermutans Iran Zakeri 49964 (GLM)

MH210681 Aspiciliella intermutans Iran Zakeri 49963 (GLM)

MH248858 Aspiciliella intermutans Armenia Harutyunyan & Mayrhofer (GZU280743)

MH210660 Aspiciliella intermutans Armenia Zakeri 40475 (GLM)

MH210677 Aspiciliella intermutans Iran Zakeri 49966 (GLM)

MH210667 Aspiciliella intermutans Armenia Zakeri 40562 (GLM)

MH210671 Aspiciliella intermutans Armenia Zakeri 40760 (GLM)

...... continued on the next page

ITS Genbank Acession Numbers Species names Origin Voucher name

MH210672 Aspiciliella intermutans Armenia Zakeri 40763 (GLM)

MH210663 Aspiciliella intermutans Armenia Zakeri 40487 (GLM)

MN586924 Aspiciliella portosantana Portugal Sipman 63025

KY618853 Aspiciliella portosantana Portugal Sipman 63025 (B)

MN586923 Aspiciliella portosantana Portugal Sipman 63019

KY618852 Aspiciliella portosantana Portugal Sipman 63019 (B)

NR153581 Aspiciliella portosantana Portugal B:Sipman 63019

MN586922 Aspiciliella portosantana Portugal Sipman 62854

KY618851 Aspiciliella portosantana Portugal Sipman 62854 (B)

KY618843 Aspiciliella cupreoglauca Greece Sipman & Raus 61847 (B)

KY618846 Aspiciliella cupreoglauca Greece Sipman & Raus 62682 (B)

KY618844 Aspiciliella cupreoglauca Greece Sipman & Raus 62345 (B)

MH248842 Aspiciliella cupreoglauca Greece Sipman 59898 (B)

KY618847 Aspiciliella cupreoglauca Greece Sipman & Raus 62704 (B)

KY618845 Aspiciliella cupreoglauca Greece Sipman & Raus 62440 (B)

MZ161191 Aspiciliella pakistanica Pakistan LAH36684

MZ161194 Aspiciliella pakistanica Pakistan LAH36685

MZ161199 Aspiciliella pakistanica Pakistan LAH36686

KY249607 Aspicilia subepiglypta South Korea 00857 KoLRI

MN989285 Lobothallia radiosa Greece Sipman & Raus 63710 (B 60 0203223)

MN989284 Lobothallia radiosa Greece Sipman & Raus 63591 (B 60 0203104)

Results

Three new complete ITS-nrDNA sequences nested within the phylogenetic branch of the genus Aspiciliella have been obtained; representing the new species Aspiciliella pakistanica (for details see under Taxonomy). A total of 39 sequences were analyzed, including 36 obtained from the GenBank. The data matrix had 541 unambiguously aligned nucleotide positions among which, 348 were constant, 187 variable and 164 were parsimony–informative. In our phylogram (Fig. 1), the sequences of Aspiciliella pakistanica formed a well-supported (BS 100) separate clade outside a group comprised of A. cupreoglauca, A. intermutans and A. portosantana, demonstrating its status as an independent species.

ASPICILIELLA PAKISTANICA A NEW LICHEN SPECIES Phytotaxa 511 (2) © 2021 Magnolia Press • 177 FIGURE 1. Molecular phylogenetic analysis of Aspiciliella pakistanica sp. nov.by the Maximum Likelihood method based on rDNA sequences, including ITS1, 5.8S and ITS2. Numbers below branch node represent ML bootstrap (>50%) based on 1000 replicates. Sequences generated from Pakistani collections are marked with

178 • Phytotaxa 511 (2) © 2021 Magnolia Press HABIB ET AL. PLATE 1 Morpho–anatomy of Aspiciliella pakistanica sp. nov. A: LAH36684 (Holotype; Pir Chinasi; PC15) B: LAH36686 (Paratype; Kaghan; K 15) C: LAH Herbarium specimen (colour changed; areoles) D: Section of thallus.

Taxonomic description

Aspiciliella pakistanica K. Habib, Q. Firdous, Sohrabi & Khalid MycoBank No: 838033

Diagnosis: The taxon is characterized by a whitish–grey thallus, 0.8–1.5 mm thick, with areoles 1–4.2 mm wide without pale lines on the surface and a discontinuous algal layer arranged in groups of vertical rows. Etymology: The specific epithet pakistanica (Latin) refers to the country of origin of this species Typus: PAKISTAN. Azad Jammu & Kashmir: Muzaffarabad, Pir Chinasi, 34° 23′ 20.76″ N, 73° 32′ 59.64″ E, 2,900 m a.s.l.; on rocks; August 3, 2018, T. S. Ullah & K. Habib PC–15 (LAH36686– Holotype) and Isotype ( ICH– Isotype). Thallus: crustose, areolate to rimose areolate, 5 to 8 cm wide, epruinose. Areoles: 1–4.2 mm wide and 0.8–1.5 mm thick, thicker centrally but thinner toward the periphery, broadly attached to stipitate, separated by distinct cracks, discrete to rarely contiguous, smooth to thinly wrinkled, angular or irregular, replicating by division, flat to weakly convex. Upper surface whitish–grey in the field, becoming pale yellow-brown to brown in the herbarium. Lower surface dark brown to black. Prothallus: not apparent. Upper Cortex: 10–20 μm thick, smooth, upper layer dark gray–brown, hyaline adjacent to the algal layer, paraplectenchymtous, textura globularis, cells 5–10 μm in diam. Algal layer: discontinuous, clustered in groups, arranged in vertical rows; rows 30–50 μm wide and 65–120 μm high, hyaline between the gaps. Photobiont chlorococcoid, cells ± spherical, 10–15 μm in diam. Medulla: 300–570 μm thick, corresponding with size of the areole, hyphae prosoplectenchymatous, 3–5 μm wide. Pycnidia: immersed, rare, colorless, indistinct, 300–380 μm high × 140–230 μm wide. Conidiospores: 15–25 × 1–2.5 μm. Conidia: acrogenous, filiform, straight, hyaline, 8–12 × 0.5–1 μm. Spot tests: Cortex; K+ (yellowish–red), C–, KC–. Medulla; K–, C–, KC–. Ecology: Saxicolous in a temperate climate at an altitude of 2900 m a.s.l., rain and sun exposed, with surrounding trees Abies pindrow (Royle ex D.Don) Royle, Cedrus deodara (Roxb.) G.Don, Pinus roxburghii Sarg., Pinus wallichiana

ASPICILIELLA PAKISTANICA A NEW LICHEN SPECIES Phytotaxa 511 (2) © 2021 Magnolia Press • 179 Jacks and Picea smithiana, (Wall.) Boiss dominant and hilly topography, having a maximum and minimum temperature of 34 oC and –3 oC, respectively and annual rainfall varying from 1400–1800 mm. The second collection was found at an elevation of 3000 m a.s.l in the partially forested Kaghan valley, with mean maximum and minimum temperature of 32°C and –2°C, respectively, and temperate climate. It is a biologically, geo–physically, and hydrologically dynamic area. Additional Specimen Examined (Paratype): PAKISTAN. Khyber Pakhtunkhwa: Kaghan; 34.5417° N, 73.3500° E; 3000 m a.s.l; on rocks; July 19, 2019, A. N. Khalid & K. Habib; K–23 (LAH36686).

Disccusion

Three collections of this taxon were made from Kaghan Valley (KP) and Peer Chanasi, Muzaffarabad (Azad Jammu & Kashmir). The two sites vary significantly in terms of elevation, vegetation and climatic conditions. However, phylogenetic analysis confirmed that the three collections of Aspiciliella pakistanica sp. nov. form a monophyletic clade with good support (Fig.1). The areoles of A. pakistanica are up to 4.2 mm in diameter when fully developed and are the largest in the genus. No apothecia were found in present collections. The other species of Aspiciliella have areoles less than 2 mm in diameter and apothecia are common. In the field, A. pakistanica has whitish–grey thalli but on storage in the herbarium these become pale brown with some rusty brown areoles. By contrast, the thalli of A. cupreoglauca are pale to dark brown, that of A. intermutans are grey to pale yellowish or brownish–grey and grey to dark grey and those of A. portosantana yellowish to greenish–grey. The phylogenetic analysis showed that A. cupreoglauca forms a strongly supported sister group relationship with A. pakistanica (Fig. 1). Morphologically, A. pakistanica is quite distinct from A. cupreoglauca, A. intermutans and A. portosantana in having a thick whitish grey thallus with large areoles without pale lines on the surface. Furthermore, specimens of A. pakistanica have a discontinuous algal layer which is arranged in vertical rows, a feature not observed in any other Aspiciliella spp. These differences and phylogenetic analysis confirm the novelty of this new species.

TABLE 2. Distinguishing characters of the species of Aspiciliella.

Taxa A. pakistanica A. intermutans A. cupreoglauca A. portosantana

Surface pale lines absent pale lines present pale lines present pale lines usually present

Thallus thickness 0.8–1.5 mm <0.4 mm 0.3-0.5 mm 0.3–0.4 mm

Areole width 1–4.2 mm 0.3–2mm 0.3–1 mm 0.5–1.5 mm

Color of thallus whitish–grey grey–brown to light brown brown dark grey to greenish–grey

Algal layer discontinuous continuous continuous continuous

Apothecia absent present present present

References reported here (Zakeri et al. 2019a) (Zakeri et al. 2017) (Zakeri et al. 2017)

An updated key to the species of Aspiciliella

1 Thallus whitish–grey; areoles 1–4.2 mm wide; algal layer arranged in groups of vertical rows ...... A. pakistanica 1* Thallus brown or yellow-grey or green-grey; areoles 0.3–2.5 mm wide; algal layer arranged horizontally ...... 2 2 Thallus pale brown to dark brown; areoles 0.3–1 mm wide, with pale lines on the surface and along the margins ...... A. cupreoglauca 2* Thallus grey to dark grey or yellowish– or greenish–grey; areoles 1–2.5 mm wide, with or without pale lines along the margins ...... 3 3 Thallus grey, dark grey to greenish–grey; pale marginal lines usually absent ...... A. portosantana 3* Thallus grey to pale yellowish– or brownish grey; pale marginal lines present ...... A. intermutans

We sincerely thank Dr. Memoona Khan for her comments for improving the manuscript and Mr. Tariq Saifullah for accompanying us to collecting sites in Azad Jammu & Kashmir, Pakistan.

References

Crous, P.W., Gams, W., Stalpers, J.A., Robert, V. & Stegehuis, G. (2004) MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology 50: 19–22. Gardes, M. & Bruns, T.D. (1993) ITS primers with enhanced specificity for basidiomycetes––application to the identification of mycorrhizae and rusts. Molecular ecology 2: 113–8. https://doi.org/10.1111/j.1365-294X.1993.tb00005.x Haji Moniri, M., Gromakova, A.B., Lőkös, L. & Kondratyuk, S.Y. (2017) New members of the Megasporaceae (Pertusariales, lichen– forming Ascomycota): Megaspora iranica spec. nova and Oxneriaria gen. nova. Acta Botanica Hungarica 59: 343–370. https://doi.org/10.1556/034.59.2017.3-4.5 Hall, T.A. (1999) BioEdit: A User–Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium 41: 95–98. Khan, M., Khalid, A.N. & Lumbsch, H.T. (2018) A new species of Lecidea (Lecanorales, Ascomycota) from Pakistan. MycoKeys 38: 25–34. https://doi.org/10.3897/mycokeys.38.26960 Kumar, P., Skouloudis, A.N., Bell, M., Viana, M., Carotta, M.C., Biskos, G. and Morawska, L. (2016) Real–time sensors for indoor air monitoring and challenges ahead in deploying them to urban buildings. Science of the Total Environment 560: 150–159. https://doi.org/10.1016/j.scitotenv.2016.04.032 Nordin, A., Savić, S. & Tibell, L. (2010) Phylogeny and taxonomy of Aspicilia and Megasporaceae. Mycologia 102: 1339–1349. https://doi.org/10.3852/09-266 Nylander, W. (1866) Circa novum in studio lichenum criterium chemicum. Flora (Regensburg) 49: 198–201. Obermayer, W. (2002) Management of a Lichen Herbarium. Protocols in Lichenology. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 507–523. https://doi.org/10.1007/978-3-642-56359-1_29 Orange, A., James, P. & White, F.J. (2001) Microchemical Methods for the Identification of Lichens. First Edit. British Lichen Society, London, 101 pp. Owe–Larsson, B., Nordin, A. & Tibell, L. (2008) Aspicilia. In: Nash, T.H., Gries, C. & Bungartz, F. (Eds.) Lichen Flora of the Greater Sonoran Desert Region. Lichens Unlimited, Tempe, Tempe, Arizona, pp. 61–108. Paukov, A., Davydov, E.A., Nordin, A., Roux, C., Şenkardeşler, A., Sohrabi, M., Vondrák, J., Frolov, I.V, Teptina, A.Y. & Shiryaeva, A.S. (2019) Three new species, new combinations and a key to known species of Lobothallia ( Megasporaceae ). The Lichenologist 51: 301–322. https://doi.org/10.1017/S0024282919000264 Robert, V., Vu, D., Amor, A.B.H., Van de Wiele, N., Brouwer, C., Jabas, B., Szoke, S., Dridi, A., Triki, M., Daoud, S. B, Chouchen, O., Vaas, L., De Cock, A., Stalpers, J.A., Stalpers, D., Verkley, G.J.M., Groenewald, M., dos Santos, F.B., Stegehuis, G., Li, W., Wu, L., Zhang, R., Ma, J., Zhou, M., Gorjón, S.P., Eurwilaichitr, L., Ingsriswang, S., Hansen, K., Schoch, C., Robbertse, B., Irinyi, L., Meyer, W., Cardinali, G., Hawksworth, D.L., Taylor, J.W. & Crous, P.W. (2013) MycoBank gearing up for new horizons. IMA Fungus 4: 371–379. https://doi.org/10.5598/imafungus.2013.04.02.16 Sambrook, J. & Russell, D.W. (2006) Purification of nucleic acids by extraction with phenol: chloroform. Cold Spring Harbor Protocols, 2006(1), pp.pdb–prot4455. https://doi.org/10.1101/pdb.prot4455 Sohrabi, M., Rico, S.D.L.V.J., Halici, M.G., Shrestha, G. & Stenroos, S. (2013a) Teuvoa, a new lichen genus in Megasporaceae (Ascomycota: Pertusariales), including Teuvoa junipericola sp. nov. The Lichenologist 45: 347–360. https://doi.org/10.1017/S0024282913000108 Sohrabi, M., Stenroos, S., Myllys, L., Søchting, U., Ahti, T. & Hyvönen, J. (2013b) Phylogeny and taxonomy of the “manna lichens.” Mycological Progress. https://doi.org/10.1007/s11557-012-0830-1

ASPICILIELLA PAKISTANICA A NEW LICHEN SPECIES Phytotaxa 511 (2) © 2021 Magnolia Press • 181 Thiers, B. (2019) Index Herbariorum: A global directory of public herbaria and associated staff. Continuously updated. [http://sweetgum. nybg.org/science/ih/] White, T.J. & Garrott, R.A. (1990) PCR protocols: a guide to methods and applications. Academic Press Inc, San Diego, pp.315–322. Zakeri, Z., Divakar, P.K. & Otte, V. (2017) Taxonomy and phylogeny of Aspiciliella, a resurrected genus of Megasporaceae, including the new species A. portosantana. Herzogia 30: 166–176. https://doi.org/10.13158/heia.30.1.2017.166 Zakeri, Z., Otte, V., Sipman, H., Malíček, J., Cubas, P., Rico, V.J., Lenzová, V., Svoboda, D. & Divakar, P.K. (2019a) Discovering cryptic species in the Aspiciliella intermutans complex (Megasporaceae, Ascomycota) – First results using gene concatenation and coalescent–based species tree approaches. PLOS ONE 14: e0216675. https://doi.org/10.1371/journal.pone.0216675 Zakeri, Z., Sipman, H., Paukov, A. & Otte, V. (2019b) Neotypification of Aspiciliella cupreoglauca and lectotypification and synonymization of Aspicilia reticulata ( Megasporaceae, Ascomycota). The Lichenologist 51: 97–99. https://doi.org/10.1017/S0024282918000476