Lin28: Linking Organ Development and Tumorigenesis in the Kidney
The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters
Citation Yermalovich, Alena V. 2018. Lin28: Linking Organ Development and Tumorigenesis in the Kidney. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences.
Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41127191
Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA
Lin28: Linking Organ Development and Tumorigenesis in the Kidney
A dissertation presented
by
Alena V. Yermalovich
to
The Committee on Higher Degrees in Biological Sciences in Public Health
in partial fulfillment of the requirements
for the degree of
Doctor of Philosophy
in the subject of
Biological Sciences in Public Health
Harvard University
Cambridge, Massachusetts
March 2018
© 2018 Alena V. Yermalovich
All rights reserved Dissertation Advisor: Professor George Q. Daley Alena V. Yermalovich
Lin28: Linking Organ Development and Tumorigenesis in the Kidney
Abstract
Lin28 is a highly conserved RNA binding protein that modifies gene expression
via direct binding of mRNAs and by blocking the processing of the let-7 family of
microRNAs. In vertebrates, Lin28a and its paralog Lin28b have been implicated in self- renewal of mammalian embryonic stem cells, organismal growth, tissue development and tumorigenesis, however their role in these processes is not fully understood. We discovered that forced expression of Lin28 in developing kidneys in mice results in pathology highly reminiscent of Wilms tumor, the most common pediatric tumor of the kidney. We established that LIN28B is overexpressed in significant percentage of human
Wilms tumor and that the LIN28 gene can be activated through chromosomal translocation, firmly linking LIN28 to the pathogenesis of the disease. Subsequent studies
reveal that Lin28b/let-7 axis controls the timing and duration of kidney development and
manipulation of the pathway represents a therapeutic strategy for enhancing kidney
function. Such a strategy holds promise for children suffering from the complications of
premature birth and/or intrauterine growth restriction and could have profound effects on
long-term health for the individual and the health burden of hypertension and renal
failure of the population as a whole. The work in this thesis reveals novel mechanisms
underling organ development and tumorigenesis in the kidney and paves the way for a
deeper understanding of critical aspects of mammalian development.
iii TABLE OF CONTENTS
DEDICATION ...... V ACKNOWLEDGMENTS...... VI CHAPTER 1: INTRODUCTION ...... 1 Lin28 gene and protein structure ...... 2 Lin28/let-7 is a conserved bistable switch...... 3 Molecular Mechanism of Lin28 Function...... 6 Developmental expression patterns and physiological roles of Lin28 in mammals ...... 9 Lin28 and Wilms Tumor ...... 10 Kidney Development...... 13 CHAPTER 2: LIN28 SUSTAINS EARLY RENAL PROGENITORS AND INDUCES WILMS TUMOR...... 16 INTRODUCTION ...... 16 RESULTS...... 18 Lin28 overexpression during embryonic kidney development leads to Wilms tumor18 Lin28 overexpression sustains the CM cells in the adult kidney...... 21 Lin28 prevents the postnatal wave of differentiation of the CM cells...... 25 Wilms tumor arises when Lin28 is overexpressed in multiple early kidney lineages 27 Lin28 expression is required for the maintenance of CM cells within the tumor...... 28 Lin28-induced Wilms tumor is suppressed by enforced expression of Let-7...... 31 LIN28B expression in human Wilms tumor...... 34 DISCUSSION...... 36 MATERIALS AND METHODS ...... 39 ACKNOWLEDGEMENTS AND COPYRIGHT PERMISSION ...... 42 CONTRIBUTORS TO THE WORK ...... 43 CHAPTER 3: REGULATION OF NEPHROGENESIS BY LIN28/LET-7 ...... 44 INTRODUCTION ...... 44 RESULTS...... 46 Lin28/let-7 expression during normal kidney development ...... 46 Prolonged expression of LIN28B in developing kidney extends nephrogenesis and induces ectopic nephron formation ...... 48 LIN28B mice exhibit enhanced renal function ...... 52 Ectopic LIN28B expression rescues functional impairment in kidneys with low nephron endowment...... 55 Lin28b is required for the normal development of the mammalian kidney...... 56 Lin28b regulates nephrogenesis in a let-7 dependent manner ...... 58 Anti-let-7 antagomirs expand CM cells in ex vivo kidney organ culture...... 62 DISCUSSION...... 64 MATERIALS AND METHODS ...... 67 ACKNOWLEDGEMENTS...... 71 CONTRIBUTORS TO THE WORK ...... 71 CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS...... 72 APPENDIX...... 84 SUPPLEMENTARY FIGURES ...... 84 Chapter 2 Supplementary Figures...... 84 Chapter 3 Supplementary Figures...... 98
REFERENCES ...... 111
iv Dedication
This dissertation is dedicated to my family. To my husband, Pavel, my children,
Victoria and Maxim, and my mom, Valentina. Your unending love and faith fueled me through this scientific journey. Completing my PhD thesis would have been impossible without your help and support. I love you all!
v Acknowledgments
It is with immense gratitude that I acknowledge the support of my PI, Dr. George
Q. Daley over the last several years. George is a true powerhouse and the most brilliant and dedicated scientist I know. It has been a privilege to study in his laboratory and I am immensely honored to call him my mentor for life. Thank you, George, for being a role model, believing in me and teaching to think big! It has been a blast!
The members of my dissertation advisory committee, Dr. Zhi-Min Yuan, Dr. Iain
A. Drummond, and Dr. Benjamin D. Humphreys brought a depth of insight and unique perspective to my work and helped to prioritize the most important experiments. I’d also like to express gratitude to my dissertation examiners, Dr. Benjamin D. Humphreys, Dr.
Brendan Manning, Dr. Gokhan S. Hotamisligil, Dr. Richard Gregory for their time, consideration and service on my defense committee.
I would like to thank my colleague and close friend, Dr. Jihan K. Osborne, who has supported me throughout the Ph.D. process, both personally and professionally.
Jihan’s passion, dedication and commitment to science made many long and difficult experiments possible and certainly more enjoyable with good companionship.
I am grateful to all of the members of the Daley lab – past and present –for their great comradeship and support along this journey. I would like to start by thanking Dr.
Achia Urbach, who was the post-doc I worked with during my rotation and the first two years in Dr. Daley's lab. Dr. Urbach’s excitement over science and cheerful personality helped me settle into the lab. The results of our collaboration on Wilms tumor project were an inspiration for my subsequent work. Also I’d like to give a special shout out to both Sam Ross and Patricia Sousa, two bright, kind, positive and talented individuals,
vi whose technical support with experiments helped me to push the project forward.
Michael Morse, our lab mamager, for putting up with my urgent last minute orders.
Special thanks to Aimee Dixon, Kathryn Entner, Judit Totth, Ho-Chou Tu, Willy Lensch,
Gen Shikoda, Areum Han, Daisy Robinton, Linda Vo, Melissa Kinney, Jess Barragan,
Michael Chen, Dan Pearson, Kaloyan Tsanov, John Powers for a friendly collaborative
environment, scientific discussions and willingness to lend a hand with experiments. All
of these have been essential to my making it through.
To Dr. Brendan Manning, Dr. Marianne Wessling-Resnick, Duckett, Deirdre,
Brazda, Thomas Joseph, thank you for your dedication to making Biology in Public
Health Program feel like a community. The program would not be as welcoming without
you. Your encouragement and advice over the past 6 years were instrumental to my
success.
I am eternally grateful to my family and best friends for keeping my sanity and
providing perspective through ups and down of the graduate school. It was comforting to
know my family and friends believed in me even when I didn’t believe in myself. Thank
you for your continual support and for standing by my side through everything.
vii Chapter 1: Introduction
The RNA-binding protein Lin28 and the let-7 microRNA (miRNA) family were originally discovered in Caenorhabditis elegans (C. elegans) as heterochronic genes regulating developmental timing [1, 2]. In mammals, Lin28a and its paralog Lin28b are highly expressed in stem and progenitor cells, where they function to inhibit biogenesis of the let-7 family of miRNAs. As progenitor cells differentiate, Lin28 expression decreases, allowing formation of mature let-7 miRNAs [3, 4]. Members of the let-7 microRNA family, in turn, bind to the 3′ UTR of Lin28 mRNA, negatively regulating its expression. Thus, Lin28 proteins and let-7 miRNAs mutually suppress each other to form a bistable switch that is conserved throughout evolution from worms to human [5-7].
Lin28 proteins also bind mRNAs and modulate their translation independently of modulation of let-7 [8-12].
Aside from their role as developmental regulators, Lin28a, Lin28b, and let-7 are also implicated in organismal growth, metabolism, tissue development, somatic reprogramming and cancer [13]. With the discovery that Lin28a/b are aberrantly expressed in various human cancers, especially tumors that are highly aggressive and poorly differentiated [14], many questions arose as to how this pathway contributes to progression of cancer and whether the modulation of LIN28 activity is an attractive therapeutic approach to treat intractable malignant disease. While the translational aspects of this work caught immediate attention, it also became apparent that the basic principles of how Lin28/let-7 biology operates remained unclear and understanding the roles of Lin28 and let-7 in both normal development and diseased states has emerged as a new field of research [13].
1 Lin28 gene and protein structure
A single lin-28 gene is found in C. elegans and Drosophila melanogaster [15], while there are two lin28 paralogs in all vertebrates: lin28a and lin28b. All lin28 proteins
have a unique pairing of a cold shock domain (CSD) and a cysteine cysteine histidine
cysteine (CCHC) zinc knuckle domain, both of which can bind RNA (Figure 1.1).
Although, lin28a and lin28b proteins share a high degree of homology in structural
domains, they differ in a few respects. For instance, lin28b contains an extended tail
region at the C-terminus of the protein and a nuclear localization signal (Figure 1.1) [16,
17]. Both Lin28a and Lin28b have been observed to shuttle between the nucleus and cytoplasm. Lin28a is predominantly located in the cytoplasm of cells and has been detected in association with ribosomes, P-bodies, and stress granules [18] while lin28b is found in the nucleus, specifically in the nucleolus [18, 19].
Figure 1.1 | Schematic of Lin28 protein structure.
Lin28 isoforms range in length from 195 to 260 amino acids, with vertebrate versions being among the longest, and lin28b being slightly longer than lin28a. CSD, cold shock domain; CCHC, cysteine cysteine histidine cysteine domain; NLS, nuclear localization signal. This figure adapted from Development (Jennifer Tsialikas and Jennifer Romer-
Seibert, Development 2015 Jul 15;142(14):2397-2404). Doi:10.1242/dev.117580 [20].
2 Lin28/let-7 is a conserved bistable switch
Lin-28 was first characterized in the nematode C. elegans through a mutagenesis
screen aimed at identifying lineage-modifying genes that alter developmental timing, or heterochrony [1, 2]. The studies reveal that loss-of-function mutations in lin-28 accelerate
differentiation of hypodermal and vulval progenitor cells (called seam cells and VPCs
respectively in nematodes) during the L2-L3 larval transition, resulting in precocious
development, where L2 stage-specific events are skipped and later events occur one stage
earlier relative to wild-type worms [1]. In contrast, gain-of-function mutations in lin-28
promote self-renewal and delays differentiation of the hypodermal and vulval progenitor cells, leading to proliferation of seam cells and a cell-cycle delay in VPCs. As a result, continuous expression of lin-28 is sufficient to cause reiteration of L2 cell fates, blocking
the transitions to later stages (Figure 1.2) [2].
Lin-28 is highly expressed throughout embryogenesis and during early post-natal development, but gradually diminishes and disappears by adulthood in the nematode [2].
Studies in C. elegans have shown that suppression of lin-28 during larval development is achieved through regulation by two members of the microRNA class of non-coding
RNAs, lin-4 and let-7, which suppress lin-28 post-transcriptionally via direct binding
sites in its 3’ UTR [2]. Interestingly, lin-4 and let-7 (the first microRNAs to be
discovered) are themselves prominent heterochronic genes in the worm, suggesting that
the interaction between lin-28 and the non-coding RNAs is important for regulating the
timing of development. Although let-7 is expressed in late stages of larval development,
at the L4-adult transition (long after lin-28 is downregulated), there are three let-7
homologs (mir-48, mir-84, and mir-241), which overlap with lin-28 expression during the
3
Figure 1.2 | Mutations in lin-28 during C. elegans development affect developmental timing and execution of stage-specific events in the worm.
The four larval stages (L1-L4) of C. elegans are characterized by stage-specific patterns of cell division and differentiation. At the beginning of each larval stage, seam cells undergo an asymmetric division (indicated by a horizontal line), while the posterior daughter remains an undifferentiated blast cell (represented by long vertical lines that continue to the next stage), and the anterior daughter differentiates and joins the neighboring hypodermal syncytium (represented by short vertical lines). The L2 phase begins with a symmetrical, proliferative division where both cells remain seam cells before undergoing a round of asymmetric division. Lin-28 loss-of-function (lin-28(0)) or gain-of-function (lin-28(gf)) results in the L2 stage being skipped or reiterated, respectively, which causes a change in the total number of seam cells. This figure adapted from Development (Jennifer Tsialikas and Jennifer Romer-Seibert, Development 2015
Jul 15;142(14):2397-2404). Doi:10.1242/dev.117580 [20].
4 L2-L3 transition. Indeed, triply mutant animals lacking mir-48, mir-84, and mir-241 phenocopied the lin-28 gain-of-function mutations, exhibiting repetition of L2-stage events in addition to retarded adult-stage events; and lin-28 was epistatic to the three let-7 homologs [21]. Furthermore, mutation of the let-7 binding site in the lin-28 3’ UTR was shown to increase lin-28 3’ UTR-lacZ reporter expression [22], suggesting that let-7 binding contributes to lin-28 repression and indicating their opposing roles in regulating differentiation and development [13].
Both lin28 and let-7 are highly conserved across evolution [2] and play an important role in mammalian development as well. The first evidence of a connection between lin28 and mammalian biology came from the discovery that mouse embryonic stem cells and human embryonal carcinomal cells express high levels of a mammalian lin28 ortholog, which is downregulated in response to differentiation [15]. Accordingly, it has been shown that human LIN28A, in combination with NANOG, OCT4, and SOX2, can successfully reprogram human somatic fibroblasts into induced pluripotent stem cells
[23]. Subsequent studies showed that LIN28A and its paralog LIN28B directly inhibit the post-transcriptional maturation of let-7 family miRNAs in mammals as well as worms [5-
7, 24, 25]. After discovering that LIN28A and LIN28B suppress the biogenesis of let-7 miRNAs, which, in turn, inhibit LIN28A and LIN28B expression, it became clear that
LIN28/let7 represents a conserved double negative feedback loop (bistable switch) that plays an important role in stem self-renewal and development from worms to mammals
[13].
5 Molecular Mechanism of Lin28 Function
Following the discovery that Lin28a/b represses let-7 biogenesis, a concerted
effort was made to determine the detailed molecular mechanisms underlying this
relationship as a model for understanding miRNA biogenesis. Like other miRNAs, let-7
biogenesis begins with transcription of the primary transcript, pri-let-7, by RNA
polymerase II. In the nucleus, pri-let-7 is processed by the Drosha, in complex with its
RNA-binding cofactor DGCR8, which releases a 60-80 nucleotide precursor, pre-let-7,
which is then exported from the nucleus into the cytoplasm by exportin-5. In the cytoplasm, the pre-miRNA is further cleaved by Dicer into a 22 nucleotide long double- stranded RNA duplex. After that the miRNA strands are separated and one of them bound by Argonaute protein and incorporated into the RNA-induced silencing complex
(RISC). This strand guides RISC to specific mRNAs through base pairing. If the
RNA:RNA match is extensive, Argonaute cleaves the target mRNA, causing its rapid degradation. Less extensive base pairing leads to inhibition of translation, mRNA destabilization, and transfer of the mRNA to P-bodies, where it is eventually degraded
[26]. Lin28a and Lin28bproteins bind to both pri-let-7 and pre-let-7 and block their processing into mature miRNA [5, 7, 24]. In mammals, Lin28a also recruits a cytoplasmic terminal uridyl transferase 4 (TUT4; also known as ZCCHC11) and to a lesser extent, TUT7 (ZCCHC6) to oligo-uridylate pre-let-7 and prevents its processing by
Dicer [27-30]. Uridylated pre-let-7 miRNAs are degraded by DIS3L2 exonuclease [31].
A study suggests that Lin28a is predominantly localized in the cytoplasm, where it recruits TUT4/7 to oligo-uridylate pre-let-7 and prevents Dicer processing, whereas
Lin28b is predominantly localized in the nucleolus where it sequesters pri-let-7 away
6 from Drosha and DGCR8 processing [19]. However, all Lin28 proteins (in mammals as well as in C. elegans) have a putative nucleolar localization signal and are able to enter both the nucleus and cytoplasm Similarly, the proteins can bind to both pri- and pre-let-7 transcripts to block their processing into the mature let-7 form [2, 18, 19, 32, 33]. In the absence of Lin28 proteins, precursors of let-7 can be efficiently processed into mature miRNAs, which then block expression of targets that include pro-mitogenic factors (e.g.,
Ras, c-Myc), factors involved in cell-cycle progression (cyclin D1, cyclin D3, cdk4) and maintenance of the pluripotent or multipotent state (e.g., Blimp-1) (reviewed in [34])
(Figure 1.3).
A number of studies have recently demonstrated that Lin28 proteins bind mRNAs and modulate their translation post-transcriptionally in a let-7-independent manner in worms as well as in mammals [8-12]. To better understand let-7-independent functions of Lin28 proteins researchers have identified thousands of potential mRNA targets of
Lin28a and Lin28b (reviewed in [20]), however, the precise targets that are relevant for the biological function of Lin28 proteins and how they execute specificity when targeting these RNAs is still unclear and remains to be clearly defined. It has been shown that under normal growth conditions, cytoplasmic Lin28a is associated with translation initiation factors eIF3B and eIF4E, elongation factors EF1alpha and EF1alpha2, ribosomal proteins, poly(A)-binding protein, Igf2bps, Musashi1 and RNA helicase A
(RHA) in messenger ribonucleoprotein complexes to regulate mRNA processing [8, 18,
35]. However, under metabolic stress, Lin28a protein is found to localize to cellular processing bodies (P-bodies) and cytoplasmic stress granules, where mRNAs are sequestered and the translation is temporarily stalled [18]. Point-mutations in RNA-
7 binding motifs of Lin28a, the protein localization shifts to the nucleus [18], suggesting that Lin28a regulates its mRNA targets post-transcriptionally by binding them in the nucleus and then, depending on the conditions, shuttling them between ribosomes, P- bodies, or stress granules for translational regulation.
AAAAAA' Target'mRNA'
pri$let$7&
AAAAAA' DROSHA+ Target'mRNA' DGCR8+
pre$let$7&
P"bodies) LIN28A+ AAAAAA' Target'mRNA' Degrada3on' TUT4/7' DICER+ RHA' eIF30' LIN28A/B+ beta' mature+let$7& AAAAAA' U0' Transla3onal'Enhancement' U0'
AGO2+
AAAAAA'
Figure 1.3 | Molecular mechanisms underlying Lin28 function.
Both Lin28a and Lin28b proteins have been observed to shuttle between the nucleus and cytoplasm exerting their influence through (1) repression of let-7 microRNA maturation
(2) enhancing or preventing the translation of mRNA targets. Lin28a recruits RHA, a protein known to facilitate efficient translation of target genes, to regulate mRNA, in tandem with the Igf2bps, poly(A)-binding protein and the eukaryotic translation initiation factors (eIFs). The figure is adopted from Robinton’s doctoral dissertation [36].
8 Developmental expression patterns and physiological roles of Lin28 in mammals
Expression patterns of Lin28 have been studied widely in the whole mouse over
the course of normal development and into adulthood. As is its C. elegans orthologue, the
expression of mouse Lin28 proteins appears to be strictly temporally regulated and is
largely restricted to early development. Expression of Lin28 is observed throughout the embryo at least until embryonic day (E6.5) and as development progresses, the
previously broad expression of Lin28 tapers off and becomes tissue-restricted [3].
Lin28a null mice manifest dwarfism as early as embryonic day 13.5 (E13.5) and 93% of these animals die within one day of birth. Those that survive are 30-50% smaller in weight and 20-30% shorter in length [37]. Lin28b knockout mice are viable and fertile with dwarfism and growth defects solely in males [37]. The double-knockout of both
Lin28a and Lin28b paralogs, leads to synthetic lethality in E10.5–E12.5 embryos, the phenotype that has yet to be understood [37]. Embryonic lethality upon loss of both paralogs suggests these proteins have functional redundancy during development.
From the mouse zygote to the preimplantation blastocyst, Lin28a is exclusively localized in the nucleolus where it is believed to regulate nucleologenesis [33]. After zygotic genome activation, mammalian blastocysts show high levels of Lin28a and
Lin28b transcription in the pluripotent cells of the inner cell mass (ICM) and epiblast, where the proteins act as repressors of let-7 miRNAs to prevent premature differentiation in the pluripotent ICM and epiblast [13].
The expression of Lin28a and Lin28b is not restricted to only pluripotent cells, but also extends to a variety of tissues. Both proteins are highly expressed in the
9 trophoblast [33] and the resultant placental tissues [38], with the LIN28B locus showing
imprinting and paternal monoallelic expression in the human placenta [39].
Lin28 expression is also observed in germline stem cells during mammalian development [40] and in the spermatogonial stem cells of adult male testes. Lin28a is
essential for proper primordial germ cell (PGC) development. It promotes specification of
PGC via Blimp1, a let-7 target and a master regulator of PGC specification [40]. Lin28a
knockout and let-7 overexpression caused a reduction in PGCs during embryogenesis and in proliferating spermatogonia and germ cells before adulthood [37]; while overexpression of Lin28a and Lin28b is associated with the malignancy of multiple human germ cell tumors, including choriocarcinomas, embryonal carcinomas, seminomas, yolk sac tumors, and mixed germ cell tumors [40-44].
Lin28a and Lin28b are also highly expressed in the neural tube and neural crest during mammalian development [3, 45] where they promote differentiation [24, 46].
Lin28a overexpression leads to an abundance of primitive neural tissue in teratomas formed by ESCs [40]. Furthermore, conditional overexpression of Lin28b in neural crest progenitors in mice blockes differentiation of normal neuroblasts and neuroblastoma cells and induces neuroblastoma enhancing Mycn levels via let-7 suppression [47].
In addition to germ cells and ectoderm, Lin28 proteins play an important role in
mesoderm-derived tissues as well. For example, fetal hematopoietic stem and progenitor
cells (HSPCs) express high levels of Lin28b, while adult HSPCs do not [48]. Lin28b
overexpression in adult Lin− bone marrow cells is sufficient to reprogram them into fetal- like lymphoid progenitors [48], which could be related to the oncogenic role Lin28b plays in T cell lymphoma and leukemia [49, 50].
10 Lin28 is also implicated in endodermal tissues. Its expression has been detected by immunohistochemistry in the fetal liver, kidney, intestines, and lung during mouse embryonic development [3]. In addition, a range of cancers involving these tissues express Lin28a and/or Lin28b, among which are hepatocellular carcinoma, Wilms tumor, colorectal cancer and lung cancer, suggesting the proteins play a role in the normal development and malignancy of endodermal tissues [14, 32, 51-54]. Indeed, tissue specific overexpression of Lin28a or Lin28b is sufficient to initiate and drive hepatoblastoma and hepatocellular carcinoma, intestinal adenocarcinoma, and Wilms tumor in the liver, intestine, and kidney, respectively [53-55]. In spite of this wealth of
studies, the function of Lin28a and Lin28b in tissue stem cells and progenitors, especially
those derived from the endoderm is poorly understood due to the limitations of
immunohistochemistry in small cellular compartments and the expectation that Lin28
may only be active in stem or progenitor cells. A more detailed analysis of the expression and function of Lin28a/b in sub-domains of the developing embryo is required to address the role of Lin28a and Lin28b in tissue development throughout embryogenesis.
Lin28 and Wilms Tumor Aside from their role as developmental regulators, LIN28 proteins are implicated in oncogenesis. LIN28A and LIN28B are overexpressed in various human tumors and human cancer cell lines [5, 14, 19]. This overexpression is linked to repression of let-7
family miRNAs and derepression of let-7 targets, among which are oncogenes and pro-
mitogenic factors such as Ras, c-Myc, and HMGA2 [14, 56]. It has been shown that
Lin28 overexpression is sufficient to transform NIH/3T3 cells [14]. Furthermore,
LIN28B depletion in K562 human leukemia cells impairs growth, triggers differentiation,
11 and leads to the decrease of let-7 targets including c-Myc and K-Ras [14]. Genome-wide
mRNA and microRNA profiling on an array of human hepatocellular carcinoma lines
revealed an inverse correlation between the expression of LIN28B and all let-7 family
members, and LIN28B expression was associated with a significantly increased incidence
of early tumor recurrence. LIN28 proteins are specifically activated in the subset of
tumors that are poorly differentiated and more aggressive compared to LIN28-negative
tumors[14].
We discovered that forced expression of Lin28a or LIN28B in developing kidneys
results in pathology highly reminiscent of the most common renal neoplasm of
childhood, Wilms tumor (WT). We have established that 30% of human WT over-
express LIN28B, and that the LIN28 gene can be activated through chromosomal
translocation, firmly linking Lin28 to Wilms pathogenesis [57].
Wilms tumor is the fourth most common type of childhood cancer and the most
common type of pediatric kidney cancer, affecting 1 in 10,000 children in North America
[58]. It usually occurs in children younger than 5 years old, with equal incidence between
sexes. Approximately 90% of the tumors are sporadic and unilateral, while the remainder
are bilateral tumors associated with germline mutations in the WT1, WTX, bcatenin or
other genes [59]. However, the fact that mutations in the Wt1, Wtx and bcatenin genes
account for only 33% of WT [60] suggests that other genetic lesion(s) are responsible in
most cases. Interestingly, resent exome and transcriptome sequencing of 58 human
Wilms’ tumors has identified mutations in Drosha, Dicer and DIS3l2 genes [61], all of which are involved in the biogenesis of miRNAs and are critical components of
Lin28/let-7 pathways, suggesting let-7 biogenesis is a common mechanism of human
12 Wilms’ tumor. However, how does dysregulation of proteins involved in such a general
process lead to Wilms tumor is not known and yet to be explained.
WT is particularly interesting as it arises from multipotent embryonic kidney
precursor cells that fail to differentiate, providing a window into the mechanisms of early
renal development and potentially into the properties of embryonic kidney stem cells
[62]. WT shares histological features with the developing kidney. In many cases the
tumor is associated with persistent areas of embryonic tissue known as nephrogenic rests
that contain blastemal cells with varying degrees of differentiation [58]. Our discovery of
a role for Lin28 in driving Wilms tumor emphasized the importance of studying both tumorigenesis and organogenesis in a combined manner as two sides of the same coin.
Kidney Development
Among its many functions, the mammalian kidney removes nitrogenous waste, regulates blood volume, and maintains bone density. Highly specialized epithelial tubules called nephrons serve as the basic functional units of the kidney [63]. Kidney development, or nephrogenesis, is a complex process that requires reciprocal inductive interactions between two precursor tissues derived from the intermediate mesoderm (IM): the metanephric mesenchyme (MM) and the ureteric bud (UB), which results in proliferation and expansion of the cap mesenchyme (CM) [64-67] (Figure 1.4). The CM represents a pool of multipotent renal stem cells, which self-renew and give rise to mature nephrons via a mesenchymal to epithelial transition (MET) [68, 69]. CM cells are sustained in the outer nephrogenic zone of the kidney until postnatal day 2 in mice [70], and the 36th week of gestation in humans [71], after which time all remaining CM cells
undergo a synchronous wave of differentiation to establish the final number of nephrons
13 – the “nephron endowment” – that will persist lifelong in the adult [70] (Figure 1.4). A human kidney contains anywhere from 200,000 to over 1.8 million nephrons [72].
Although existing nephrons may be repaired in response to renal injury [73], new nephrons cannot be formed during adulthood. Children who are born prematurely or suffer from intrauterine growth restriction (IUGR) as a result of maternal malnutrition have a reduced number of nephrons, which negatively affects the filtration function of the kidney. Because new nephrons do not form in the extra-uterine environment, children
with a compromised nephron endowment are at increased risk of hypertension and
development of cardiovascular and renal diseases, as well as insulin resistance and Type
2 diabetes as adults [74-76]. Therefore, there has been interest in developing novel
approaches to the treatment and prevention of kidney disease.
Figure 1.4 | Outline of kidney development (continued).
14 Figure 1.4 (Continued)
Stages of nephron formation at critical points during mouse embryonic development.
(A) Induction and Condensation. The ureteric bud (gray) extends from the Wolffian duct,
and, upon contact with the metanephric mesenchyme (red), reciprocal signaling induces both bud branching and condensation of the mesenchyme to generate the cap
mesenchyme (Six2+ positive cells). The cells that form the cap mesenchyme are marked
by Six2 and are the nephron progenitor cells. (B) Epithelialization. The condensed
blastemal mesenchyme then undergoes mesenchymal-to-epithelial transformation (MET)
to generate epithelial structures (renal vesicles). (C) Tubulogenesis. More complex
epithelial structures, comma- and S-shaped bodies, are formed. (D) Patterning. S-shaped
bodies form most of the mature nephron (dark orange), including the glomerular
podocytes, and fuse to ureteric-bud derivatives to generate collecting ducts. Endothelial
cells migrate during this process to form the glomerulus, which is surrounded by
glomerular podocytes (Bowman's capsule). As this nephrogenic program is executed, the
ureteric bud will keep on growing and branching. Each time new bud tips are formed, the induction process is repeated, and new nephrons start to form. In the mature nephron, the
blood enters through the capillaries and is filtered by the podocytes. Electrolytes, water,
sugars, and other molecules are transported back into the blood, while the remainder goes
to the bladder for disposal via collecting duct. In humans, kidney development starts
around week 5 of gestation and continues until week 36, while in mice, the ureteric bud
invades the metanephric mesenchyme at E10.5, new nephrons continue to form until day
2 after birth. This figure adapted from Genes & Development (Hohenstein Peter, et al.,
Genes Dev. 2015 March 1;29(5):467-82). Doi:10.1101/gad.256396.114.
15 Chapter 2: Lin28 sustains renal progenitors and induces Wilms tumor
INTRODUCTION
Wilms tumor, a common pediatric kidney cancer affecting 1 in 10,000 children in
North America, arises from the failure of embryonic nephrogenic cells to undergo
terminal differentiation [58]. The development of the kidney is a complex process that
requires reciprocal inductive interactions between the ureteric bud (UB) and metanephric
mesenchyme (MM), which leads to proliferation and expansion of the primitive cap
mesenchyme (CM) [64-67]. The CM cells differentiate into mature nephrons by a mesenchymal to epithelial transition (MET). As they also possess self-renewal capacity,
CM cells represent embryonic kidney stem cells [68, 69]. CM cells proliferate and differentiate in the outer nephrogenic zone of the kidney until the second post-natal day in mice [70] and the 36th week of gestation in humans [71], after which time all remaining
CM cells synchronously differentiate to establish the final number of nephrons in the
adult kidney [70]. Wilms tumor shares histological features with the developing kidney,
and is frequently associated with persistent areas of embryonic tissue known as
nephrogenic rests, which contain blastemal cells with varying degrees of differentiation
[58].
Lin28 is an RNA binding protein that regulates gene expression via two different
mechanisms – one that blocks the processing of the Let-7 family of microRNAs [5-7, 24], and another that involves direct binding to a wide array of mRNA targets (Reviewed in
[77]. The Let-7 dependent mechanism entails binding to the terminal loop of pri/pre Let-7 microRNAs, which prevents their maturation and thus enables the translation of genes that are suppressed by Let-7 miRNAs [7]. Oncogenes such as K-Ras and c-Myc are
16 prominent let-7 targets [34]. In mammals, Lin28A and its closely related paralog Lin28B are highly expressed in pluripotent cells, where they play an important role in the maintenance of self-renewal and proliferation [77]. Both Lin28 proteins are highly expressed in early embryonic development, but become down-regulated over time, while levels of mature Let7 family members rise as stem cells differentiate into specialized tissue types [34]. Over-expression of LIN28 is common in various tumor types and facilitates cellular transformation [14]. Lin28 also promotes reprogramming of somatic cells into induced pluripotent cells [23].
Given that Lin28 is highly active in embryonic tissues and was originally described as a heterochronic gene that regulates developmental timing in C.elegans [1, 2], we hypothesized that Lin28 over-expression might play a role in pediatric tumor formation by altering the timing of tissue differentiation and organogenesis during embryonic development. Indeed LIN28A over-expression has been implicated in type II germ cell tumors [43], which result from a failure of differentiation of primordial germ cells (PGC) [78], while LIN28B has been linked to neuroblastoma [79], a pediatric tumor derived from neural crest tissues that fail to complete their differentiation program [80,
81]. Lastly, we reported previously that in rare cases of human Wilms tumor LIN28B over-expression is caused by translocation at the LIN28B locus [14]. Here we describe a novel murine model of Wilms tumor caused by enforced over-expression of Lin28 during embryonic kidney development, and demonstrate by immunohistochemistry that LIN28B is over-expressed in up to 30% of cases of human Wilms tumor. These data, together with recent insights from whole genome sequencing of Wilms tumor implicate defects in microRNA regulation as a major mechanism of kidney tumorigenesis.
17 RESULTS
Lin28 overexpression during embryonic kidney development leads to Wilms tumor
Previously we and others have shown that LIN28 plays an important role in germ cell development [40, 82] and is associated with human germ cell tumors [43, 83]. Thus, we endeavored to overexpress Lin28 in PGCs by crossing mice containing a Lox-stop-
Lox-Lin28a cassette (LSL-Lin28a) (Figure S2.1A) with mice carrying a Vasa-Cre transgene, which we anticipated would express Cre in PGCs when transmitted paternally, allowing us to test the potential for Lin28 to induce germ cell tumors [84]. Contrary to expectations, the cross between a LSL-Lin28a female and VasaCre male did not yield the predicted germ cell phenotype (0 out of 50) but unexpectedly produced renal tumors in
10% of the offspring (5 out of 50; four bilateral and one unilateral) (Figure 2.1A, top left). Tumors expressed the Lin28a transgene, apparently a consequence of aberrant
“leaky” activation, whereas normal kidneys showed no transgene expression (Figure
2.1B). Crosses of LSL-Lin28a males with Vasa-Cre females resulted in constitutional overexpression in all tissues by virtue of Cre expression in oocytes [84] and perinatal lethality. Interestingly, the kidneys of transgenic embryonic day 18.5 (E18.5) embryos were larger than the kidneys of their littermate controls and contained fewer mature proximal tubules (Figure S2.1B). When we harvested the kidneys from E18.5 transgenic and control embryos and transplanted them under the kidney capsule of immunodeficient mice, tumors developed in a high percentage of recipients (7 out of 10) (Figure 2.1A, top right panel; Figure S2.1C). No tumors formed in transplant recipients of control kidneys
(0 out of 9). Analysis of tumor gene expression and histology (Figures 2.1C and 2.1D) indicated that the Lin28a-derived tumors were highly similar to human Wilms tumor.
18
Figure 2.1 | Lin28 overexpression in embryonic kidneys leads to Wilms tumor.
(A) Kidney tumors as a result of Lin28 overexpression in the kidney. (Top left panel)
Renal tumor in a 17-wk-old kidney from the crossing between a LSL-Lin28a female and a VasaCre male. The smaller kidney is the normal kidney from the opposite side in the same mouse. (Top right panel) Tumor derived by transplantation of a Lin28a- overexpressing kidney (from the crossing between a LSL-Lin28a male and a VasaCre female) under the kidney capsule of an immunodeficient mouse 17 wk post- transplantation. (Bottom panel) LIN28B-derived tumors in 3-wk-old kidneys (Dox induction [1g/L] from E0) (continued).
19 Figure 2.1 (Continued)
(B) Western blot analysis of tumors and age-matched normal kidneys with antibodies
against Lin28a, Flag, and Tubulin. The expression of the Flag tag shows activation of the
transgenic Lin28a in the tumor. (C) Gene set enrichment analysis (GSEA) of microarray
data from Lin28a-derived tumors and control kidneys showing statistically significant up- regulation of “Wilms tumor signature genes” in the tumor compared with the control. (D)
Typical histology of a human Wilms tumor, a Lin28a-derived tumor, and a LIN28B- derived tumor. The tumors are triphasic and contain structures of blastema (B), epithelium (E), and mesenchymal stromal (S) cells. Bar, 100 μm. (E) Schematic representation of the UB and CM cells, which normally exist in the nephrogenic zone of the mouse kidney only until P2. Global Lin28a or LIN28B overexpression in the developing kidney leads to a pathology similar to human Wilms tumor. However, lineage-specific overexpression did not cause renal tumor formation. See also Figure S2.1
Previously, we reported two cases of human Wilms tumor in which LIN28B was overexpressed as a result of chromosomal translocation [14]. To determine whether human LIN28B overexpression would replicate Wilms tumor formation in mice, we engineered a transgenic strain that afforded spatial and temporal control of human
LIN28B (or mouse Lin28a) overexpression by crossing the Rosa26-Lox-stop-Lox-rtTA allele with the Col1A1-TRE-LIN28B allele (Lox-TetOn-LIN28B mice) (Figure S2.1D;
[85]). To achieve global LIN28B overexpression in the developing and/or adult kidney, we crossed Lox-TetOn-LIN28B mice with Wt1Cre mice [86], as Wt1 is expressed in the intermediate mesoderm [60], the origin of the metanephric kidney [67]. All Wt1Cre-
20 LIN28B mice (15 out of 15) developed kidney tumors (Figure 2.1A, bottom panel) within
the first 2 wk of life when exposed to doxycycline (Dox) induction during embryonic
development (E0, E14.5, or even as late as E18.5) (see below). Importantly, the histology
of the LIN28B-derived tumors was similar to Lin28a-derived tumors (Figure 2.1D).
Taken together, these results establish that overexpression of either murine Lin28a or human LIN28B during kidney development in transgenic strains of mice leads to kidney tumor formation that is highly reminiscent of human Wilms tumor (Figure 2.1E).
Lin28 overexpression sustains the CM cells in the adult kidney
During kidney development, the nephronogenic progenitor cells of the CM cells
differentiate into pretubular epithelial aggregates by a MET at around E12.5 [58].
Normally, a balance between differentiation and proliferation of CM cells is sustained in
the nephrogenic zone of the developing kidney until postnatal day 2 (P2), after which
time all CM cells undergo a terminal wave of differentiation [87]. In contrast to normal
kidneys, the Lin28-derived tumors continue to sustain proliferating CM cells, as
evidenced by the expression of CM-specific transcription factors (e.g., Six2, Cited1, and
Eya1) and Ki67 staining (Figures 2.2A and 2.2B; Figure S2.2A). Moreover, H&E (Figure
2.2C) and immunofluorescence (Figure 2.2D; Figures S2.2B and S2.2C) staining of the
tumors demonstrates that the tumor consists of keratin8-positive UB cells surrounded by
Six2-positive CM cells, similar to the structures that normally exist in the nephrogenic
zone of the developing kidney.
21 Figure 2.2 | Lin28-derived tumors harbor proliferating CM cells.
(A) Overexpression of CM-specific transcription factors in the tumor. Microarray data
(tumor, n = 4; control, n = 4). (B) Six2 and Ki67 immunohistochemistry in normal kidneys and LIN28a-derived tumors. Bar, 100 μm. (C) Histology of the E18.5 nephrogenic zone and adult tumors. Note that embryonic structures consisting of a branched UB surrounded by CM cells appears in the adult tumors. Bar, 50 μm. (D) Six2
and Keratin8 coimmunostaining in a normal embryonic kidney, a normal adult kidney,
and an adult tumor. (Note: Keratin 8 is a marker for UB cells during kidney development
and for the collecting duct in the adult kidney). In contrast to normal adult kidneys, in
which Six2 is not expressed and keratin8 expression is restricted to the collecting duct,
the expression pattern of Six2 and Keratin8 in the tumors is similar to the nephrogenic
zone during kidney development. Bar, 100 μm. See also Figure S2.2 (continued).
22 Figure 2.2 (Continued)
23 Taken together, these data indicate that Lin28 overexpression prolongs the timing
of kidney development, sustaining proliferation of the CM cells into adulthood.
Interestingly, the CM cells of the tumor retain their differentiation capacity, as evident by
gene expression for markers of epithelialization, such as Wnt4 and CDH6 (K-cadherin)
(Figure 2.3A; Figure S2.3A); gross histology (Figure 2.3B; Figure S2.3B); and histologic
staining for Lotus tetragonolobus lectin (LTL), a specific marker for mature proximal
tubules (Figure 2.3C).
Figure 2.3 | Differentiation capacity of the CM cells in the tumor.
(A) Overexpression of epithelialization markers Wnt4 and Cdh16 in the tumor.
Microarray data (tumor, n = 4; normal kidney, n = 4). (B) Epithelial structures in a
normal embryonic kidney and a Lin28-derived tumor. (E) Epithelial structures of comma-
shaped/S-shaped bodies differentiated from the CM cells. Bar, 20 μm. (C) Mixture of progenitor cells (Six2-positive) and mature proximal tubule cells (LTL-positive) in the tumor. Bar, 100 μm. See also Figure S2.3.
24 Importantly, the fact that the differentiated epithelial cells are Flag-positive
(Supplemental Fig. S3C) indicates that these cells are indeed derived from the Lin28- overexpressing cells. Furthermore, the Lin28-derived tumors also contain structures resembling differentiated glomeruli (Figures S2.3D and S2.3E). Thus, the CM cells within the tumor retain a differentiation capacity that recapitulates normal kidney development.
Lin28 prevents the postnatal wave of differentiation of the CM cells
We documented that Lin28 overexpression leads to persistent proliferation of CM cells in adult mice. During normal kidney development, Lin28a is expressed in CM cells until E13.5, after which expression wanes, while Lin28b is not expressed at all (Figure
2.4A; Figure S2.4A). Interestingly, however, the nephrogenic zone of E18.5 transgenic embryos appears normal, without aberrant expansion of the CM cells (Figure 2.4B;
Figure S2.4B), suggesting normal proliferation of the CM cells in the nephrogenic zone during embryonic development in the presence of Lin28. Importantly, induction of Lin28
overexpression as late as E18.5 was enough to sustain proliferation of CM cells into
adulthood (Figure S2.4C). To discern whether ectopic Lin28 expression could reactivate
proliferation of nephrogenic cells after the early postnatal period of terminal
differentiation, we induced LIN28B overexpression in renal tissues by virtue of gene
activation via Wt1Cre at P10, when no CM cells exist in the normal kidney. When
LIN28B was overexpressed at P10, tumors failed to develop, and expansion of Six2-
positive cells was not detected (Figure S2.4D). Instead, late LIN28B induction resulted in
a cystic kidney phenotype (Figure S2.4E). Collectively, these data suggest that the CM
cells retain their differentiation capacity in the presence of Lin28 expression but that
25 Lin28 delays the timing of the final postnatal wave of synchronous differentiation, allowing the nephrogenic process to persist, eventually producing Wilms tumor.
Figure 2.4 | Lin28 overexpression prevents the postnatal wave of differentiation of the CM cells.
(A) Analysis of Lin28a expression during mouse embryonic kidney development. Lin28a is expressed in the CM (Six2-positive) cells of the developing kidney until E13.5. All panels are at the same scale. (B, top panel) Six2 expression in E18.5 normal and transgenic kidneys. (Bottom panels) Lin28a expression in normal and transgenic kidneys.
Note that there is no expansion in CM cells of the transgenic kidney compared with the control. Bar, 100 μm. See also Figure S2.4.
26 Wilms tumor arises when Lin28 is overexpressed in multiple early kidney lineages
We then sought to determine in which cells of the developing kidney
overexpression of Lin28 was required to promote Wilms tumor formation. We
overexpressed LIN28B or Lin28a specifically in CM cells by crossing Lox-tetOn-LIN28B
and Lox-TetOn-Lin28a transgenic mice with Six2-Cre mice [69]. Contrary to expectation,
overexpression of Lin28a or LIN28B in the CM cells failed to induce tumor formation
(zero out of 15) but instead produced a cystic kidney phenotype. The cystic phenotype
appeared in the Six2-Cre-Lin28 mice when Lin28 overexpression was induced early in embryonic development (Figures S2.5A and S2.5B) or in adult mice (Figures S2.5C). We
crossed Lox-TetOn-Lin28a/LIN28B mice with mice carrying FoxD1Cre (n = 10) to effect
stromal cell-specific expression [88] and with mice carrying Cdh16Cre (n = 7) to effect
UB cell-specific expression [89], but neither of these crossings reproduced the tumor phenotype. Interestingly, however, overexpression of LIN28B in stromal cells
(FoxD1Cre) led to hydronephrosis in the adult kidney (Fig. S2.5D), while no pathology was seen in the Cdh16Cre mice. Therefore, in the murine model, Lin28 activation is
required in the earliest renal progenitor that gives rise to the multiple cell types of the
developing kidney, implying that Lin28 promotes a coordinated prolongation of
nephrogenesis, which ultimately progresses to Wilms tumor formation (see Figure 2.1E).
27 Lin28 expression is required for the maintenance of CM cells within the tumor
Our data firmly establish a role for Lin28 overexpression in tumor initiation, but
to determine if continued Lin28 expression is necessary for tumor maintenance, we
studied the effect of Lin28 down-regulation by withdrawal of doxycycline commencing
at P7. While significant numbers of Six2/Eya1 positive CM cells persist 2 weeks post
DOX withdrawal (Figure 2.5A; Figure S2.6), at 3 weeks after DOX withdrawal there was
a significant decrease in CM cells in the kidneys of the transgenic mice, no overt tumor,
but a markedly increased number of well differentiated glomerulus-like structures
(Figures 2.5B and 2.5C). Thus, we conclude that expression of Lin28 is sufficient for tumor initiation and necessary for tumor maintenance.
28 Figure 2.5 | Lin28 down-regulation leads to differentiation of the CM cells in the tumor.
(A) qRT–PCR analysis of LIN28B, Six2, and Eya1 (markers form CM cells) in transgenic and control kidneys 1 and 2 wk after Dox withdrawal. (2W) 2-wk-old mice (1 wk without Dox); (3W) 3-wk-old mice (2 wk without Dox). Note that Six2 and Eya1 are still expressed 2 wk after Dox is withdrawn. (B) Average glomerulus number per 10× magnification field in the microscope in transgenic and control kidneys 3 wk after Dox withdrawal (n = 12). (C) Representative H&E staining of transgenic kidneys 3 wk after
Dox withdrawal (transgene 3 wk w/o Dox) compared with a control 4-wk-old kidney and transgenic 1-wk-old and 4-wk-old kidneys maintained on Dox (transgene with Dox). Dox was induced from E0. Note that 3 wk after Dox withdrawal, the transgenic kidneys contain many glumerulus-like structures and do not contain CM cells. Yellow arrows point to glomerulus-like structures. Bar, 100 μm. See also Figure S6 (continued).
29 Figure 2.5 (Continued)
30 Lin28-induced Wilms tumor is suppressed by enforced expression of Let-7
Analysis of miRNA expression in Lin28-induced tumors demonstrated significant
suppression of mature Let-7 species (Figure S2.7A) but no significant change in steady- state levels of pri/pre-Let7 (Figure S2.7B). In accordance with this, Let7 target genes were up-regulated in the tumors compared with control kidneys (Figure S2.7C). To
determine whether Lin28-induced tumorigenesis could be suppressed by enforced restoration of Let-7, we crossed the tumor-prone LIN28B transgenic mice with a strain that expresses a chimeric Let-7g (i7s) species whose processing is not inhibited by Lin28
[17]. We verified by immunohistochemistry staining that the transgenic kidneys
overexpressed LIN28B (Figure S2.7D), that endogenous Let-7 was down-regulated when
the chimeric Let-7g transgene was overexpressed in the LIN28B-i7s kidneys (Figure
2.6A), and that Let-7 targets were down-regulated in the Lin28B;i7s kidneys compared
with Lin28B kidneys (Figure S2.7E). We showed previously that the “i7s” mice are
smaller than their littermate controls [90]. Accordingly, kidneys of compound LIN28B-
i7s mice appeared smaller than normal kidneys (Figure 2.6B). Importantly, however,
there were no evidence of persistent CM cells in the LIN28B-i7s kidneys, as
demonstrated by quantitative RT–PCR (qRT–PCR) (Figure 2.6C) and histology (Figure
2.6D). These results demonstrate that enforced Let-7 expression can counteract the effect
of LIN28B overexpression, suggesting that LIN28B induces Wilms tumor at least in part
by suppressing Let-7 miRNAs.
31 Figure 2.6 | Lin28 acts thorough the Let7 pathway to prevent normal kidney development.
(A) qRT–PCR analysis of mature Let7 levels in LIN28B, LIN28B;i7s, and control kidneys. Dox was provided from E14.5 until the end of the experiment. (B) Morphology of LIN28B, LIN28B;i7s, and control kidneys. (C) qRT–PCR analysis of the CM markers
Six2 and Eya1 in LIN28B, LIN28B;i7s, and control kidneys. (D) H&E staining of
LIN28B, LIN28B;i7s, and control kidneys. Note that the Lin28B;i7s kidneys have a normal histology. Bar, 100 μm. See also Figure S7 (continued).
32 Figure 2.6 (Continued)
33 LIN28B expression in human Wilms tumor
Cancer-initiating cells (CICs) have recently been isolated from human Wilms tumor [91]. We detected overexpression of LIN28B (but not LIN28A) in
NCAM1+ALDH1+ wild-type CICs isolated from early-generation Wilms tumor xenografts (harboring a blastemal predominant phenotype) and to a lesser extent in primary Wilms tumor when compared with developing human kidneys (Figure S2.8A).
To determine whether LIN28 expression is a prominent feature of human Wilms tumor, we analyzed the expression of LIN28A and LIN28B in human Wilms tumor samples from
Boston Children’s Hospital (USA, n = 28) and an independent set from Great Ormond
Street Hospital/University College London Institute of Child Health (UK, n = 77).
Indeed, immunohistochemical staining of these samples revealed overexpression of
LIN28B (Figure 2.7A) in 8 out of 28 and 10 out of 77 samples, respectively, compared with normal kidneys. Conversely, LIN28A expression was not detected in any sample.
This observation was further supported by our analysis of published microarray data that indicated frequent expression of LIN28B but not LIN28A in human Wilms tumor (Figure
2.7B; Figure S2.8B). In our tissue microarray analyses (UK samples), we noted that
LIN28B expression was restricted to blastemal cells, which are the most undifferentiated tumor component. Clinical outcome data were available for 76 out of 77 UK patients who had been uniformly treated with prenephrectomy chemotherapy. Among the 9 LIN28B- positive tumors, 5 patients relapsed, and 3 died. Among the 67 LIN28B-negative tumors,
8 patients relapsed, and 2 died suggesting a significant association of LIN28B expression with relapse and death (P = 0.0059 and P = 0.0105, respectively, two-tailed Fisher’s test).
Detailed histological and statistical analysis of the LIN28B-positive and LIN28B-
34 negative tumors can be found in Supplemental Tables 2.1 and 2.2. These data indicate that expression of LIN28B is a feature of a significant minority of cases of human Wilms tumor, which, together with our prior report of activation of LIN28B by chromosomal translocation in two cases, implicates LIN28 in the pathogenesis of human Wilms tumor.
Figure 2.6 | LIN28B expression in human Wilms tumor.
(A) LIN28B immunohistochemistry in human Wilms tumor. (B) LIN28B and LIN28A expression levels in diverse types of human renal tumors based on published microarray data (GSE11151). See also Figure S2.8.
35 DISCUSSION
It has been argued that pediatric cancer can arise from the failure of embryonic cells to complete their differentiation program [92, 93], indicating that the pathogenesis of pediatric tumors is directly linked to dysregulated embryonic development and organogenesis [94]. Here we demonstrate that overexpression of Lin28, an RNA-binding protein linked to pluripotency, stem cell self-renewal, and delayed larval development in
C. elegans, prolongs kidney development and promotes Wilms tumor formation.
Reminiscent of its association with heterochronic phenotypes in C. elegans, Lin28 overexpression prevents the synchronous wave of differentiation of CM cells in the developing kidney, which, under normal conditions, is complete by P2 in mice [70] and by 36 wk of gestation in humans [71]. In transgenic mice engineered for kidney-specific
Lin28 overexpression, CM cells continue to proliferate into adulthood, resulting in conversion to a tumor highly reminiscent of human Wilms tumor. When activation of
Lin28 was targeted to specific cellular compartments such as UB, stroma, or CM cells, we failed to observe tumor formation; instead, in our model, Cre excision in the intermediate mesoderm, the origin of the entire kidney, was required to induce tumor formation. Theoretically, this observation suggests that Lin28 activation is required in either a stage-specific manner in the earliest kidney progenitor cells or more than one kidney cell lineage. The fact that tumors formed when Lin28 overexpression was induced as late as E18.5, when the earliest progenitors no longer exist, suggests that the second explanation is more likely. Our model implies that aberrant Lin28 expression produces a coordinated expansion of the nephrogenic zone, resulting in proliferating blastema and nephrogenic rests, which are characteristic of human Wilms tumor.
36 Previously, a murine model of Wilms tumor was generated by Wt1 ablation and
Igf2 overexpression [95], which established that Wt1 ablation prevents the MET of CM
cells that is essential for nephrogenesis. In contrast, in our model, the CM cells persist
beyond the period when synchronous differentiation typically occurs and retain their
capacity to undergo MET, resulting in a markedly expanded period of nephrogenesis that
ultimately progresses to frank tumorigenesis. The differences between these two models
demonstrate that pediatric Wilms tumor formation can occur at diverse stages of
development and through different molecular mechanisms.
Lin28 has profound effects on both the proliferative and metabolic machinery of
tumor cells. By virtue of blocking Let-7 biogenesis, Lin28 leads to de-repression of known oncogenic targets of Let-7 like Myc [96], Ras [97], Hmga2 [98, 99], and cyclins
[100, 101]. Moreover, Lin28 has been shown to promote glycolytic metabolism in tissues and cancer cells, and thus is a central regulator of cellular bioenergetics [102]. It appears that Lin28 functions to balance the proliferative and metabolic needs of rapidly growing cells in the early embryo [37], and that this function becomes reactivated in many adult tumors. In cases of pediatric malignancy, Lin28 appears to prolong the embryonic patterns of tissue growth, as we have shown here for Wilms tumor, and which is likely the case for germ cell tumor and neuroblastoma.
Point mutations in WT1, WTX, β-catenin, and abnormalities involving translocations in chromosome 6 have been linked to Wilms tumor [59, 62, 103] and several susceptibility loci for Wilms tumor were recently identified by a genome-wide association study [104]. However, the underlying genetic basis of most cases of Wilms tumor remains unknown [104]. Here we report that up to a third of human Wilms tumors
37 overexpress LIN28B. Moreover, our data suggest an association of LIN28B expression
with a “high-risk” subtype of Wilms tumor called “blastemal type” [105] that is defined by the persistence of a large proportion of blastemal cells in the viable tumor component after prenephrectomy chemotherapy. Therefore, LIN28B expression may be a marker of such therapy-resistant blastemal cells, which currently cannot be identified in chemo- naïve tumors treated according to the North American approach of immediate nephrectomy, but a much larger unselected cohort of tumors would be required to investigate this properly. Prior studies have implicated aberrant expression of the HACE1 locus on chromosome 6 in Wilms tumor [106], but LIN28B is tightly linked to this locus, and our detection of aberrant overexpression of LIN28B in a significant minority of human Wilms tumors suggests the possibility of coordinate dysregulation. Previously, we reported that rare cases of Wilms tumor result from activation of LIN28B by chromosomal translocation and that amplification of the LIN28B locus occurs in only
∼2% of tumors [14]; thus, the mechanism of LIN28B activation remains unexplained in most cases. Based on our demonstration that both murine Lin28a and human LIN28B are competent to induce Wilms tumor in our mouse model, we speculate that the prevalence of LIN28B activation and the absence of aberrant LIN28A expression in human Wilms tumor is likely due to a specific mechanism of LIN28B up-regulation and not differences in the transforming potential of the genes. In support of this hypothesis, it has been shown recently [107] that the promoter of LIN28A in human Wilms tumors is enriched with histone K27me3.
The miRNA pathway is a common target for dysregulation in different types of tumors [108, 109]. Recently, it was demonstrated that DIS3L2, the gene responsible for
38 Perlman syndrome, which entails a predisposition to Wilms tumor, is a nuclease
responsible for degrading Let-7 miRNAs that have become polyuridylated due to Lin28- mediated recruitment of a terminal uridylyl transferase [31]. Taken together with the observation of LIN28B overexpression in up to 30% of human Wilms tumors and our demonstration that enforced expression of Let-7 abrogates Lin28-induced kidney tumorigenesis, these data suggest that a common mechanism of Wilms tumor pathophysiology is dysregulation of LET-7 miRNA biogenesis or function. This hypothesis would be reinforced if indeed Drosha and Dicer1 mutations or other mutation in the miRNA processing machinery are likewise found in Wilms tumor. The
LIN28/LET-7 pathway represents an appealing therapeutic target for Wilms tumor through either inhibition of LIN28 function or delivery of LET-7 to tumor cells.
MATERIALS AND METHODS
Mice. All animal procedures were conducted according to animal care guidelines approved by the Institutional Animal Care and Use Committee at Boston Children’s
Hospital. LSL-Lin28a mice. A Lox-stop (four PGK-polyA and three sv40 polyA) Lox cassette and a Flag-tagged murine Lin28a ORF were cloned into pEF6 plasmid
(Invitrogen, catalog no. V962-20) downstream from a PEF-1α promoter, and targeting was performed into V6.5 embryonic stem cells. Chimeric mice were generated by injection of embryonic stem cells into BALB/c blastocysts and then bred to CD-1 females to generate germline-transmitted pups. Lox-TetOn-Lin28 mice were previously generated in our laboratory as described in [85, 110]. The following Cre mice were obtained from Jackson laboratory: VasaCre (stock no. 006954), Six2Cre (stock no.
39 009606), FoxD1Cre (stock no. 012463), and Cdh16Cre (stock no. 012237). The Wt1Cre
mice were contributed by the laboratory of Dr. William Pu at Boston Children’s Hospital.
Cre mice were crossed to the Lox-TetOn-Lin28 mice, and 1 mg/mL Dox was administered to the drinking water at different time points to induce LIN28B/Lin28a expression. To achieve co-overexpression of Lin28 and Let7, we crossed Wt1Cre mice with TRE-7S21L (“i7s” mice) mice and then crossed the Wt1Cre;i7s mice with Lox-
TetOn-Lin28 mice. For the transplantation experiments, embryos were harvested by cesarean section at E18.5. Kidneys were harvested from transgenic and control embryos, dissected to smaller pieces, and then transplanted under the kidney capsules of NSG mice. qRT-PCR. RNA was isolated by TRIzol and reverse-transcribed using SuperScript III
(Invitrogen, catalog no. 18080-051) or miScript II RT kit (Qiagen, catalog no. 218161). mRNA expression was measured by qPCR using the ΔΔCT method with the following primers: mLin28a: (forward primer, AGGCGGTGGAGTTCACCTTTAAGA; reverse primer, AGCTTGCATTCCTTGGCATGATGG), hLIN28B (forward primer,
GCCCCTTGGATATTCCAGTC; reverse primer, TGACTCAAGGCCTTTGGAAG). mSix2 (forward primer, GCAAGTCAGCAACTGGTTCA; reverse primer,
CTTCTCATCCTCGGAACTGC), mEya1 (forward primer,
TTTCCCTGGGACTACGAATG; reverse primer, GGAAAGCCATCTGTTCCAAA), mGapdh (forward primer, GCAGTGGCAAAGTGGAGATTG; reverse primer,
AATTTGCCGTGAGTGGAGTCATC), mbActin (forward primer,
TACTCCTGCTTGCTGATCCAC; reverse primer,
40 CAGAAGGAGATTACTGCTCTGGCT); For qRT–PCR of mature Let7 miRNA and
pre/pri-Let7, we used Qiagen miScript target as described in the miScript protocol.
Microarray. RNA from four Lin28a-derived Wilms tumor samples and four control
kidneys was harvested and processed using TRIzol. The Illumina Ref-8 microarray
platform was used by the Boston Children’s Hospital Intellectual and Developmental
Disabilities Research Center (IDDRC) Molecular Genetics Core Facility. The microarray
data have been deposited in Gene Expression Omnibus (GEO) and given the series
accession number GSE56323. Gene set enrichment analysis (GSEA) was used to identify
gene sets and pathways associated with a set of up-regulated or down-regulated genes.
Published microarray data from GEO (GSE3822, GSE6890, and GSE12588) were used for the analysis of Lin28a and Lin28b during mouse kidney development. Data from
Oncomine (https://www.oncomine.org) were used for the analysis of LIN28A and
LIN28B expression in human Wilms tumor samples.
Histological Analysis. Tissue samples were fixed in 10% buffered formalin and embedded in paraffin. Immunostaining was performed using the following antibodies:
LIN28A (1:250; Cell Signaling, catalog no. 8641S), LIN28B (1:250; Cell Signaling, catalog no. 4196S), SIX2 (1:400; Proteintech Group, catalog no. 11562-1-AP), LTL
(1:500; Vector Laboratories, catalog no. FL-1321), and Keratin 8 (1:50; Developmental
Studies Hybridoma Bank [DSHB], catalog no. TROMA-I-s [TROMA-I-s]). Slides were dewaxed with xylene and rehydrated through a series of washes with decreasing percentages of ethanol. Antigen retrieval was performed in 10 mM sodium citrate buffer
(pH 6.0) by placement in a decloaking chamber for 30 min on high temperature.
Immunohistochemistry was performed with Elite ABC kit and DAB substrate (Vector
41 Laboratories) according to the manufacturer’s protocol. For immunofluorescence, Alexa
488- or Alexa568-conjugated goat anti-rabbit or goat anti-mouse secondary antibodies
were used. Lin28B immunohistochemistry was scored as positive versus absent staining.
In all cases, positive staining was seen in groups of blastemal cells. To compare the
nephron number between transgenic mice and controls, we count the number of
glomerulus-like structures in 12 random fields (from the kidney cortex) under 10×
magnification.
Statistical Analysis. Data are presented as mean ± SEM, and Student’s t-test (two-tailed distribution, two-sample unequal variance) was used to calculate P-values. Statistical significance is displayed as P < 0.05 (*) or P < 0.01 (**) unless specified otherwise. The tests were performed using Microsoft Excel, with the test type always set to two-sample equal variance.
Gene Nomenclature. Human gene – capital italic (LIN28B), human protein – capital
(LIN28B), mouse gene – first letter capital, italic (Lin28a). Mouse protein – first letter capital (Lin28a).
ACKNOWLEDGEMENTS AND COPYRIGHT PERMISSIONS
This chapter was adapted from the previously published article entitled “Lin28 sustains early renal progenitors and induces Wilms tumor” by Achia Urbach, Alena
Yermalovich, Jin Zhang, Catherine S. Spina, Hao Zhu, Antonio R Perez-Atayde, Rachel
Shukrun, Jocelyn Charlton, Neil Sebire, William Mifsud, Benjamin Dekel, Kathy
Pritchard-Jones, George Q. Daley. The article was published in Genes and Development journal, Volume 28, pages 971-982 in May 2014.
42 We thank all of the clinicians at Boston Children’s Hospital and the UK
Children’s Cancer and Leukaemia Group (CCLG) Centres who managed the care of the
children entered into clinical and biology studies. We especially thank Dr. Richard
Williams and Mr. Tasnim Chagtai (University College London [UCL] Institute of Child
Health) for access to clinical and microarray expression data, and Dr. Sergey Popov
(Institute of Cancer Research, University of London) and Professor Gordan Vujanic
(University of Wales Medical School, Cardiff University) for assistance with
construction of TMAs from patients treated in the SIOP WT 2001 trial in the UK. We
thank the CCLG Tissue Bank for access to samples. G.Q.D. is an investigator of the
Howard Hughes Medical Institute and the Manton Center for Orphan Disease Research
and an affiliate member of the Broad Institute. This work was funded by the Ellison
Medical Foundation and private funds of the Children’s Hospital. K.P.-J. receives support from Cancer Research UK, Great Ormond Street Children’s Charity, Children with
Cancer Charity, and the National Institute for Health Research, Great Ormond Street
Hospital, UCL Biomedical Research Centre award. The CCLG Tissue Bank is funded by
Cancer Research UK and CCLG.
CONTRIBUTORS TO THE WORK
Achia Urbach and Alena Yermalovich designed and performed the experiments. Jin
Zhang, Catherine S. Spina, Hao Zhu, Antonio R Perez-Atayde, Rachel Shukrun, Jocelyn
Charlton, Neil Sebire, William Mifsud, Benjamin Dekel, Kathy Pritchard-Jones helped with various experiments and data analysis. George Q. Daley designed and supervised experiments.
43 Chapter 3: Regulation of Nephrogenesis by Lin28/let-7
INTRODUCTION
Among its many functions, the mammalian kidney removes nitrogenous waste, regulates blood volume, and maintains bone density. Highly specialized epithelial tubules called nephrons serve as the basic functional units of the kidney [63]. Kidney development, or nephrogenesis, is a complex process that requires reciprocal inductive interactions between two precursor tissues derived from the intermediate mesoderm (IM): the metanephric mesenchyme (MM) and the ureteric bud (UB), which results in proliferation and expansion of the cap mesenchyme (CM) [64-67]. The CM represents a pool of multipotent renal stem cells, which self-renew and give rise to mature nephrons via a mesenchymal to epithelial transition (MET) [68, 69]. CM cells are sustained in the outer nephrogenic zone of the kidney until postnatal day 2 in mice [70], and the 36th week of gestation in humans [71], after which time all remaining CM cells undergo a synchronous wave of differentiation to establish the final number of nephrons – the
“nephron endowment” – that will persist lifelong in the adult [70]. A human kidney contains anywhere from 200,000 to over 1.8 million nephrons [72]. Children who are born prematurely or suffer from intrauterine growth restriction (IUGR) as a result of maternal malnutrition have a reduced number of nephrons, which negatively affects the filtration function of the kidney. Because new nephrons do not form in the extra-uterine environment, children with a compromised nephron endowment are at increased risk of hypertension and development of cardiovascular and renal diseases, as well as insulin resistance and Type 2 diabetes as adults [74-76]. Therefore, there has been interest in developing novel approaches to the treatment and prevention of kidney disease.
44 The RNA-binding protein Lin28 and the let-7 microRNA (miRNA) family were
originally discovered in C. elegans as heterochronic genes regulating developmental timing [1, 2]. In mammals, Lin28a and its paralog Lin28b are highly expressed in stem
and progenitor cells, where they function to inhibit biogenesis of the let-7 microRNA
family. As progenitor cells differentiate, Lin28 expression decreases, allowing formation
of mature let-7 miRNAs [3, 4]. Members of the let-7 microRNA family, in turn, bind to
the 3′ UTR of Lin28 mRNA, negatively regulating its expression. Thus, Lin28 proteins
and let-7 miRNAs mutually suppress each other to form a bistable switch that is
conserved throughout evolution from worms to human [5-7]. Lin28 proteins also bind
mRNAs and modulate their translation independently of modulation of let-7 [8-12].
Aside from their role as developmental regulators, Lin28a/b and let-7 genes have
been implicated in metabolism [110], wound healing [102] and oncogenesis [5, 14, 19].
We recently discovered that prolonged expression of Lin28 in developing kidneys in mice
markedly expands nephrogenic progenitors, blocks their final wave of differentiation, and
ultimately results in neoplastic transformation resembling the most common renal
neoplasm of childhood, Wilms tumor, via misregulation of let-7 microRNAs [57]. Wilms
tumor shares histological features with the developing kidney, and arises from
inappropriately persisting embryonic renal tissue, providing a window into the
mechanisms of early renal development and into the properties of embryonic kidney stem
cells [62]. Given that Lin28 and let-7 genes were initially identified as heterochronic
genes, and that the dysregulation of the pathway can drive Wilms tumor formation, we
hypothesized that the Lin28/let-7 axis regulates kidney development and that altering its
expression might prolong and enhance nephrogenesis.
45 In this study, we show that Lin28b fulfills crucial roles in kidney development in
mice. A brief period of ectopic LIN28B expression in a kidney-specific and temporally
defined manner extends the period of nephrogenesis, resulting in up to 2 fold increased
endowment of nephrons with increased filtration function of the kidney. In contrast,
kidney-specific loss of Lin28b impairs renal development and function via regulation of
let-7 microRNAs. This study contributes fundamental insights into the molecular
mechanisms underlying organogenesis, and provides a rationale for manipulating the
Lin28/let-7 pathway to prolong nephrogenesis and rescue the effects of low nephron
endowment on kidney function.
RESULTS
Lin28/let-7 expression during normal kidney development
We first explored the expression dynamics of Lin28 during nephrogenesis in the
mouse embryonic kidney. Western blot analysis revealed that while both proteins
expressed at high levels in midgestation, Lin28a expression decreased at embryonic day
E12.5 (E13.5) whereas Lin28b expression was prolonged and exhibited a rapid decline
after E16.5 (Figure 3.1A). This period of Lin28b expression coincides with the time when
the first functional nephrons are formed during mouse kidney development [62]. Next,
we measured absolute expression of Lin28a and Lin28b via quantitative RT-PCR (qRT-
PCR) and found that the amount of Lin28b mRNA is significantly higher relative to
Lin28a at all time points tested (Figure 3.1B). These findings, along with the previously reported data on the prevalence of LIN28B (but not LIN28A) activation in human Wilms tumor [57], strongly suggest that Lin28b plays the predominant role in normal kidney development.
46 A B 200 * Lin28a 180 Lin28b 160 E14.5 Adult E12.5 E13.5 E15.5 E16.5 E17.5 E18.5 P2 NB 140 Lin28a 120 * 100 * Lin28b 80 * 60 * Six2
Molecules/reaction 40 20 * α/β-Tub 0
NB P2 C E12.5E13.5E14.5E15.5E16.5E17.5E18.8 Adult 1.2 let-7a 1.2 let-7f 1.2 let-7d 1.0 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 *" 0.4 *" 0.4 *" 0.2 0.2 0.2 0.0 0.0 0.0
Relative RNA expression Relative RNA NB P2 NB P2 NB P2 E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult D 1.2 pre-let-7a-1 1.2 pre-let-7f-1 1.2 pre-let-7d 1.0 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0.0 0.0 0.0
Relative RNA expression Relative RNA NB P2 NB P2 NB P2 E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult
Figure 3.1 | Profiles of endogenous expression of Lin28 and let-7 in mouse embryonic kidney. (A) Western blot analysis against Lin28a, Lin28b and Six2 proteins in lysates collected from dissected embryonic (E), Newborn (NB), postnatal (P) and adult wild-type kidneys at the indicated developmental time points. (B) Absolute quantitative real-time PCR
(qRT-PCR) analysis measuring the levels of Lin28a and Lin28b mRNAs in wild-type kidneys. Data are mean ± SD; n = 3 from each sample type. (*)=p<0.05 by unpaired, 2- tailed Student’s t-test. (C, D) Relative qRT–PCR analysis measuring the levels of mature and precursor let-7 miRNAs in wild-type kidneys. Data are mean ± SD; n = 3-5 from each sample type. (*)=p<0.05 by unpaired, 2-tailed Student’s t-test. See also Figure S3.1.
47 To understand the role of let-7 microRNAs in the developing kidney, we analyzed
mature and precursor let-7 miRNA levels in wild-type embryonic kidneys by qRT-PCR.
We found that expression of mature let-7 miRNAs negatively correlated with expression of Lin28b during kidney development. All eight mature let-7 family members followed a similar pattern: very low levels of expression up until E14.5, followed by significant two- to three-fold increase in their expression beginning E16.5 (Figure 1C; Figure S3.1A). To determine whether let-7 miRNAs are suppressed during early nephrogenesis due to the presence of Lin28a and/or Lin28b, we measured expression of the let-7 precursor miRNAs. Interestingly, while one group of precursors, pre-let7-a2, pre-let7-b1, pre-let7- c1, pre-let7-d, pre-let7-e, has the same pattern of expression as their mature family members (Figures 3.1C and 3.1D; Figures S3.1A and S3.1B), the second group, pre-let7- a1, pre-let7-c2, pre-let7-f1, pre-let7-f2, pre-let7-g1, pre-let7-i1, is upregulated in early- mid nephrogenesis (E12.5-E16.5) (Figures 3.1C and 3.1D; Figures S3.1A and 3.1B.
These data suggest that Lin28b likely contributes to early kidney development by suppression of the latter group of precursor miRNAs.
Prolonged expression of LIN28B in developing kidney extends nephrogenesis and induces ectopic nephron formation
We have previously shown that continuous induction of LIN28B during embryonic development sustains and expands renal progenitors and blocks the final wave of nephrogenesis, ultimately resulting in oncogenic transformation resembling Wilms tumor. Withdrawal of LIN28B expression reverted tumorigenesis and CM cells eventually underwent terminal differentiation [57]. Taking this into consideration, and knowing that lin-28 was initially identified as a heterochronic gene in C. elegans [1, 2], we hypothesized that Lin28b controls the timing of nephrogenesis in mammals. To test this
48 hypothesis, we utilized our previously generated gain-of-function (GOF) LIN28B
transgenic mouse (TRE-LIN28B; lox-STOP-lox-rtTA) with a Wt1-Cre driver, enabling spatial and temporal control of the human LIN28B protein specifically in early kidney progenitors (henceforth referred to as LIN28BWt1 mice) [57]. In this model system,
LIN28B expression is controlled spatially by the expression of Cre in Wt1-expressing cells and temporally by administration of doxycycline (dox). Wt1 is expressed in the intermediate mesoderm, the earliest precursor of the complete metanephric kidney [57]. It is also expressed in the metanephric mesenchyme within the developing kidney, including both the cortical stroma and the cap mesenchyme, the nephrons formed after induction of this mesenchyme, and ultimately in the podocytes of the glomeruli [111].
We induced LIN28B using a single one-day pulse of dox at E16.5, the time point at which endogenous expression of Lin28b protein declines rapidly during kidney development. Transgene induction led to persistence of LIN28B mRNA and protein levels beyond the normal expression window, with expression maintained until postnatal day 5 (P5) in LIN28BWt1 kidneys (Figures 3.2A and 3.2B), which coincided with
suppression of let-7 miRNAs during this period (Figure 3.2C; Figure S3.2A). This single-
day induction was sufficient to sustain CM expansion through P14, as demonstrated by
the persistent expression of CM-specific transcription factors Six2 and Eya1 (Figures
3.2D and 3.2F; Figure S3.2B). Indeed, blastema was evident even at P21 (Figure S2.3).
Furthermore, immunohistochemistry staining for Lef1, a marker of renal vesicles (RV)
that represent the first epithelial derivatives of the CM, revealed that these cells undergo a
mesenchymal to epithelial transition and subsequently form mature nephrons (Figure
3.2G).
49 A B 1.2 LIN28B P1 P3 P5 P10 P14 P21 Wt1 1.0 LIN28B Wt1 * * Control 0.8 *
0.6 LIN28B 0.4 * 0.2
0.0 Control
P1 P3 P5 P10 P14 P21 Relative mRNA expression Relative mRNA E18.5 C 1.2 1.2 LIN28B let-7a1.2 LIN28B1.2 let-7f1.2 LIN28B1.2 let-7d1.2 LIN28B1.2 let-7c 1.0 Wt1 LIN28B Wt1 LIN28B Wt1 LIN28B Wt1 1.0 LIN28BLIN28B 1.0 1.0 LIN28B 1.0 1.0 LIN28B 1.0 1.0 LIN28B ControlControl ControlControl ControlControl ControlControl 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.6 * * * 0.6 0.6 0.6 0.6 0.6 0.6* * 0.6 * * 0.4 0.4 * 0.4 0.4 * 0.4 0.4 * * * 0.4 0.4 * * * * * * * 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 * * * 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
P1 expression Relative RNA P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 E18.5 D E18.5 E18.5 E E18.5 E18.5 E18.5 E18.5 E18.5 1.4 Six2 P1 P3 P5 P10 P14 P21 LIN28BWt1 1.2
Control Wt1 * 1.0 * * 0.8 * 0.6 * LIN28B 0.4 0.2
0.0 Control
P1 P3 P5 P10 P14 P21 E18.5 Relative mRNA expression Relative mRNA F G Eya1 1.4 P1 P3 P5 P10 P14 P21 LIN28BWt1
1.2 Control Wt1 1.0 * * * 0.8 0.6 LIN28B 0.4 * 0.2
0.0 Control
P1 P3 P5 P10 P14 P21
Relative mRNA expression Relative mRNA E18.5 Figure 3.2 | Transient overexpression of LIN28B in embryonic kidney prolongs the period of nephrogenesis.
(A, C, D, F) Relative qRT–PCR analysis measuring levels of LIN28B, mature let-7, Six2
and Eya1 mRNAs, respectively, in LIN28BWt1 animals and control kidneys from their
littermates E18.5-P21. Data are mean ± SD; n = 3 from each genotype. (*)=p<0.05 by
unpaired, 2-tailed Student’s t-test. (B, E, G) Representative immunohistochemistry
staining against LIN28B, Six2, Lef1 proteins, respectively, in LIN28BWt1 animals and
control kidney from their littermates P1-P21. Scale bar, 200um. See also Figures S3.2-4.
50 The phenotype in the LIN28BWt1 kidneys is unique. There is little clear histological difference with control kidneys at birth, however, within the first few days of postnatal life, there is clear evidence for an expansion and mispositioning of the remaining CM with areas of CM extending deep into the parenchyma (Figure S3.3). As this is not a location for the initial CM, it is likely that the enforced expression of LIN28B under Wt1-
Cre promoter is resulting in induction of this gene in stromal populations other than the
CM, resulting in the formation of ectopic CM domains surrounding and apparently initiating new lateral buds along the collecting ducts (Figure S3.3). This is the first evidence that the postnatal collecting duct can respond to an introduced CM by initiating side branching. Ectopic mesenchyme is still evident as late as P21 although by P14 there is no remaining nephrogenic zone and significant cortical proximal tubular maturation
(Figure S3.3). While Six2 expression falls by P14, with initiation of nephron formation within ectopic CM regions, by P21, dilation of the collecting ducts of the papilla is evident, possibly due to increases in urinary filtrate production from the substantially enhanced nephron number (Figure S3.3).
To discern whether transient ectopic LIN28B expression could affect kidney development outside of its normal expression window (after E16.5), we induced LIN28B at E17.5 and in newborns (NB), time-points at which expression of endogenous Lin28b is almost undetectable in the normal kidney (Figure 3.1A). Six2 and Eya1 positive cells were not detected after P2 in either the E17.5-induced or newborn-induced kidneys
(Figure S3.4). Collectively, these data suggest that Lin28b controls timing of kidney development, and that its expression must be precisely timed to ensure proper nephron
51 mass. Transient over-expression of LIN28B can extend the period of nephrogenesis, but
cannot reactivate it after embryonic day E16.5.
LIN28BWt1 mice exhibit enhanced renal function
Next we examined the effects of prolonged nephrogenesis in LIN28BWt1 mice
(induced at E16.5 for one day) on the function of the postnatal kidney. We first analyzed kidneys of these mice and found that in the period following LIN28B induction through
P1 there was no significant difference between transgenic kidneys and littermate controls
lacking Wt1-Cre. However, with the progression of nephrogenesis, the transgenic kidneys
gradually became dramatically and significantly larger, with a 3-fold increase in weight
at 2-3 months of age (Figures 3.3A and 3.3B). Modest differences in the weights of other
organs (heart and lungs) in 3-month-old LIN28BWt1 mice compared to controls did not
reach statistical significance (Figure S3.5A). The body weight of the transgenic animals
was not affected for the first two weeks after birth. However, from P14 and until 1 month
of age, LIN28BWt1 mice gained significantly less body weight than their littermate controls
(Figure 3.3C). However, once kidney development was completed in LIN28BWt1 mice, there was a 20% increase in body weight relative to controls at 2-3 months of age (Figure
3C). These data indicate that LIN28B induction altered the developmental timing and ultimate organ size of the kidney due to prolonged nephrogenesis. To determine whether prolonged nephrogenesis in LIN28BWt1 mice altered nephron endowment, we calculated
the nephron number by counting glomeruli in LIN28BWt1 kidneys compared to littermate
controls. We found that LIN28BWt1 kidneys had a nearly 2-fold increased number of glomeruli compared to 2 month old controls, indicating increased nephron endowment in
LIN28BWt1 animals (Figures 3.3D and 3.3E).
52 Figure 3.3 | LIN28B transient overexpression enhances renal function. (A) Representative images of LIN28BWt1 and littermate control kidneys from E18.5 to 3
months old animals. Scale bar, 10mm. (B, C) Kidney weight and body weight of
LIN28BWt1 and littermate control mice. Data are mean ± SD; n = 3-8 from each genotype.
(*)=p<0.05 by unpaired, 2-tailed Student’s t-test. (D) Representative H&E image of
1m.o. transgenic and littermate control kidneys. Arrows point to glomerulus-like structures. Scale bar, 200um. (E) Average number of glomeruli per 4x magnification field in the microscope; the slides were coded and counted blindly. (**)=p<0.01 by unpaired, 2-tailed Student’s t-test. (F, G) Glomerular filtration rate (GFR) and creatinine
levels of LIN28BWt1 and littermate control animals (measured blindly). Data are mean ±
SD; n = 14 from each genotype; each group contains mice from three different litters.
(**)=p<0.0001 by unpaired, 2-tailed Student’s t-test. (H, I) GFR and creatinine levels of
LIN28BWt1 and Wt1-Cre lacking control animals on normal diet (NP) vs. low-protein (LP) diet. Animals within each diet are littermates. Measured blindly. Data are mean ± SD; n =
4-8; each group contains mice from three different litters. (**)=p<0.0001 by unpaired, 2- tailed Student’s t-test; (*)=p<0.05 by unpaired Kolmogorov-Smirnov test. See also
Figures S3.5 and S3.6 (continued).
53 Figure 3.3 (Continued)
A E18.5 P1 P3 P5 P7 P10 P14 P21 3m.o. 3mo, Sagittal Control Wt1 LIN28B B C Kidney Weight Body Weight 1024 * 40 Wt1 * * Wt1 512 LIN28B * LIN28B * Control Control 256 * 30 128 64 * * g 20
mg * 32 * 16 * 8 10 * 4 2 0
P1 P3 P5 P7 P1 P3 P5 P7 P10 P14 P21 P10 P14 P21 E18.5 1m.o. E18.5 1m.o. 2-3m.o. 2-3m.o. D E Wt1 LIN28B Control 30 **
20
10 # of glomeruli / field / of# glomeruli 0 LIN28BWt1 Control F G GFR Creatinine 1000 0.15 ** 800 ** 0.10 600 mg/dl ul/min 400 0.05 200
0 0.00 LIN28BWt1 Control LIN28BWt1 Control H I GFR Creatinine 800 NP 0.15 NP ** LP LP 600 ** ** 0.10 mg/dl ul/min 400 *
0.05 200 LIN28BWt1 Control LIN28BWt1 Control
54 To examine whether the increased nephron number in LIN28BWt1 mice impacts kidney function, we measured glomerular filtration rate (GFR) and serum creatinine at 2 months of age. We found that the GFR was significantly higher in transgenic mice, while serum creatinine levels were significantly lower compared to littermate controls, with no sex differences for either test (Figures 3.3F and 3.3G; Figures S3.5B and S3.5C). In
addition, a renal function panel revealed that LIN28BWt1 kidneys exhibited normal levels
of circulating electrolytes and proteins (Figure S3.5D). These data indicate that
LIN28BWt1 kidneys possess enhanced filtration and normal electrolyte handling. However, by 1.5 years of age, the LIN28BWt1 mice showed substantive hydronephrosis with consequential loss of renal parenchyma and evidence of tubular casts (Figure S3.5E).
This suggest either a ureteropelvic obstruction arising from the formation of ectopic nephrons late in development or that the large volumes of urinary filtrate being produced by such an aberrantly large kidney ultimately cause hydronephrotic pathology. Given the activity of the Wt1-Cre promoter in the forming nephrons, and particularly in the podocytes of the glomeruli, it is important to note an absence of apparent pathology in the glomeruli or tubular patterning and segmentation.
Ectopic LIN28B expression rescues functional impairment in kidneys with low nephron endowment
To determine whether transient overexpression of Wt1-driven LIN28B during kidney development can rescue the effects of intrauterine growth restriction (IUGR) on nephron endowment and renal function, we employed a low protein diet-induced IUGR mouse model. Rats and mice fed a low-protein diet during pregnancy give rise to offspring with a 10–30% deficit in nephrons and impaired kidney function, a finding consistent across a range of studies [112, 113]. Accordingly, LIN28BWt1 mice and
55 littermate controls received either a normal (20% wt/wt; NP) or low (9% wt/wt; LP)
protein diet during gestation and postnatal life. Offspring were examined at 2 months of
age. Consistent with the previously published studies, LP mice demonstrated decreased
renal function compared with the animals on NP diet, as shown by a significant reduction
of GFR and an increase in serum creatinine within the uninduced control groups lacking
Wt1-Cre (Figures 3.3H and 3.3I) [112, 113]. However, one-day pulse induction at E16.5
of LIN28B during kidney development rescued this phenotype and resulted in dramatic and significant improvement of glomerular filtration rate in mice prenatally exposed to a maternal LP diet (Figures 3.3H). LIN28BWt1 LP animals exhibited a 30% decrease in creatinine clearance relative to littermate controls; however, this difference did not reach statistical significance as it did in the NP animals (Figures 3.3I). Additionally, the LP diet did not affect renal panel tests in LIN28BWt1 LP animals relative to controls on NP diet
(Figure S3.6). Taken together, these results show that extended expression of LIN28B during kidney development can not only extend the period of nephrogenesis and enhance renal function, but also has the potential to abrogate low nephron endowment.
Lin28b is required for the normal development of the mammalian kidney
To test whether Lin28b is required for kidney development, we next generated
Lin28fl/fl; Wt1-Cre knockout (KO) animals (hereafter referred to as Lin28b KO), in which cells expressing Wt1-Cre lose both endogenous Lin28b alleles (floxed animals previously
described [37]; Figure 3.4A). Using optical projection tomography (OPT) for the CM-
restricted transcription factor Six2, we visualized and quantified distinct CM fields or
“niches” as well as the number of cells in each individual niche, in E18.5 whole kidney
(Figure 3.4B) [114, 115]. A niche is defined as a spatially distinct cluster of CM cells
56 and their adjacent epithelial ureteric tip. As such, niche counts also reflect the number of
branchpoints of the ureteric tree [114, 115].
A B Lin28b Lin28b KO Control 1.2 *" 1.0 0.8 0.6 0.4 0.2 0.1
0.0
Relative mRNA expression Relative mRNA Lin28b KO Control C D E Cell number/niche Niche Count GFR 180 4000 500 *" 160 *" 140 400 3000 120 100 300 80 2000 60 ul/min 200 40 1000
Number of cells 100 20 Number of niches 0 0 0 Lin28b KO Control Lin28b KO Control Lin28b KO Control
Figure 3.4 | Loss of Lin28b leads to impaired kidney development and function.
(A) Relative qRT–PCR analysis measuring levels of Lin28b mRNA in Lin28b KO
(E18.5) and age-matched control kidneys. Data are mean ± SD. n = 3 from each group.
(*)=p<0.05 by unpaired, 2-tailed Student’s t-test. B) Representative Six2 optical projection tomography (OPT) of E18.5 let-7 KO and control kidneys. Scale bar, 500um.
(C, D) The number of progenitors per niche and the number of niches, respectively, at
E18.5. Data are mean ± SD; n=3-5 from each group, and the animals are littermates from at least two different litters. (*)=p<0.05 by unpaired, 2-tailed Student’s t-test. (E) GFR and creatinine levels of Lin28b KO and littermate controls. Measured blindly in 2-3 m.o. animals. Data are mean ± SD; n = 5 from each sample type; each group contains mice from two different litters. (*)=p<0.05 by unpaired, 2-tailed Student’s t-test. See also
Figure S3.7.
57 While the number of cells in each individual niche was unaltered in kidneys of Lin28b
KO animals relative to littermate controls, the niche count in these mice was significantly
reduced, resulting in an overall decreased number of progenitor cells in the kidney
(Figures 3.4C and 3.4D). This reflects a decline in CM-driven ureteric branching. It has been previously established that depletion of the progenitor cell population within the metanephric mesenchyme results in premature cessation of nephrogenesis, small kidneys, low nephron endowment, and reduced renal function [116, 117]. Consistent with these studies, GFR and serum creatinine tests revealed that Lin28b KO mice had significantly impaired kidney function relative to littermate controls (Figure 3.4E; Figure S4.7), indicating that Lin28b activity is required for normal development of the mammalian kidney.
Lin28b regulates nephrogenesis in a let-7 dependent manner
We have shown that transient LIN28B overexpression during kidney development leads to suppression of mature let-7 species (Figure 3.2C; Figure S3.2A). To understand this further, we tested whether let-7 miRNAs are functionally relevant using a genetic loss-of-function (LOF) approach. The mammalian genome encodes twelve let-7 family
members expressed from eight distinct genetic loci [118], which makes LOF studies of
the let-7 miRNA family challenging. Nevertheless, we analyzed a mouse strain harboring viable constitutive combinatorial knockout of select let-7 family members: let-7a1; let-
7d; let-7f1 [119] (hereafter referred to as let-7 KO) (Figure 3.5A; Figure S3.8A). We
found that let-7 KO kidneys exhibit increased transcript levels of Six2 and Eya1, similar
to what was observed in LIN28BWt1 animals and indicating a persistence of the CM population relative to littermate controls (Figures 3.5B, C, and D). Furthermore,
58 immunohistochemistry staining against Six2 and Lef1 revealed that progenitor cells were
sustained in let-7 KO kidneys until postnatal days P3 and P5, respectively, indicating
persistence of this progenitor population one to two days longer than in littermate
controls (Figure 3.5C and 3.5E). While this persistent expression of cap mesenchyme
genes is in line with prolonged nephrogenesis, in contrast to the LIN28BWt1 animals, the location of this persistent zone of nephrogenesis is restricted to the periphery of the kidney and the resulting organs are not overtly enlarged. Hence, the effect here is more subtle and did not result in long term pathology. Although the number of progenitor cells per niche was unaltered in the let-7 KO kidneys relative to littermate controls, there was a significant increase in the niche count as shown by Six2 OPT (Figures 3.5F, G, and H).
This indicates more branching and an overall increase in the number of progenitors in the whole kidney. Interestingly, unlike the LIN28BWt1 animals, no significant difference was observed in body weight between let-7 KO and littermate controls (Figure 3.5J) despite a significant increase in kidney weight in let-7 KO animals for all time points measured
(Figure 3.5I) suggesting at least partial specificity of the Lin28/let-7 axis to kidney development. Finally, let-7 KO mice demonstrated a significant increase in GFR, reduction in serum creatinine, and exhibited normal renal panel tests relative to littermate controls, again phenocopying LIN28BWt1 animals (Figures 3.5K and 3.5L; Figure S3.8B).
Collectively, these data demonstrate that let-7 KO results in prolonged nephrogenesis and enhanced kidney function, phenocopying LIN28B overexpression, but without aberrant pathology noted in LIN28B mice due to the moderate (a day or 2) delay in the cessation.
This suggests Lin28b regulates nephrogenesis via suppression of let-7 miRNA biogenesis and that proper timing of cessation of CM is essential for normal kidney function.
59 Figure 3.5 | Let-7 KO phenocopies effects of LIN28B OE.
(A, B, D) Relative qRT–PCR analysis measuring the levels of mature let-7a,-f,-d; Six2;
Eya1 respectively in KO mice and wild type (WT) littermates at the indicated developmental time points. Data are mean ± SD; n = 2-6 from each genotype. (*)=p<0.05 by unpaired, 2-tailed Student’s t-test. (C, E) Representative immunohistochemistry staining against Six2, Lef1, respectively, in let-7 KO mice and WT littermates. (F)
Representative Six2 OPT of P1 let-7 KO and WT kidneys. Bar, 500um. (G, H) The number of niches and the number of progenitors per niche, respectively, at P1. Data are mean ± SD; n=7 for each genotype; each group contains mice from 3 different litters.
(*)=p<0.05 by unpaired, 2-tailed Student’s t-test. (I, J) Kidney weight and body weight of let-7 KO mice and WT littermates. Data are mean ± SD; n = 2-6 from each genotype.
(*)=p<0.05 by unpaired, 2-tailed Student’s t-test. (K, L) GFR and creatinine levels of the let-7 KO and WT littermate controls. Measured blindly in 2-3 m.o. animals. Data are mean ± SD; n = 6-13 from each genotype; each group contains mice from 2-3 different litters. (*)=p<0.05 by unpaired, 2-tailed Student’s t-test. See also Figure S3.8 (continued).
60 Figure 3.5 (Continued)
A
1.2 let-7a 1.2 let-7f 1.2 let-7d Let-7 KO * Let-7 KO * Let-7 KO * 1.0 Let-7 WT 1.0 Let-7 WT 1.0 Let-7 WT 0.8 0.8 0.8 * * * * * 0.6 * 0.6 0.6 * 0.4 * 0.4 * 0.4 0.2 0.2 0.2 0.0 0.0 0.0 NB P2 P5 P10 NB P2 P5 P10 NB P2 P5 P10 Relative RNA expression Relative RNA B C Six2 1.2 P1 P2 P3 P5 P10 1.0 * Let-7 KO 0.8 Let-7 WT 0.6 Let-7 KO 0.4 0.2 * 0.0 WT Let-7 WT
Relative mRNA expression Relative mRNA NB P2 P3 P5 P10 D E Eya1 1.2 Let-7 KO P1 P2 P3 P5 P10 1.0 WT* 0.8 0.6 Let-7 KO 0.4 * 0.2 0.0 WT Let-7 WT
Relative mRNA expression Relative mRNA NB P2 P3 P5 P10 F G H Let-7 KO Let-7 WT Niche Count Cell number/niche 8000 * 250 200 6000 150 4000 100 2000
Number of cells 50 Number of niches 0 0 Let-7 KO Let-7 WT Let-7 KO Let-7 WT I J K L Kidney Weight Body Weight GFR Creatinine * 32 800 256 Let-7 KO * Let-7 KO * 0.15 128 Let-7 WT 16 Let-7 WT * 600 64 * 8 0.10 g mg 32 400
* mg/dl 4 ul/min 16 * 200 0.05 8 2 4 1 0 0.00 NB P3 P5 P10 1m.o. NB P3 P5 P10 1m.o. Let-7 KO Let-7 WT Let-7 KO Let-7 WT
61 Anti-let-7 antagomirs expand CM cells in ex vivo kidney organ culture
To explore the possibility of therapeutic intervention, we inhibited let-7 in wild-
type mice using antagomirs (or anti-miRs), chemically engineered oligonucleotides that
act as efficient and specific silencers of endogenous miRNAs [120]. We administered
antagomirs against all 8 mature let-7 miRNAs to individual E14.5 embryos by
intrauterine-intraperitoneal injection, including a Cy5-labeled let-7a antagomir to facilitate localization tracing. Evaluating fluorescence of this Cy5-labeled anti-miR demonstrated effective infiltration of this anti-miR into several major organs including the heart, lung, intestines, brain and kidney (Figure S3.9A). Administration of antagomirs for three consecutive days is required to optimally silence miRNAs [120]; however, because antagomir injection requires invasive surgery, our protocol was restricted to one injection per gestation. Subsequently, we did not observe upregulation of let-7 targets or markers of the CM cells in kidneys beyond the normal time points when antagomirs were administered in vivo (Figure S3.9B). However, the uptake of these antagomirs by kidneys indicate it might be feasible to extend nephrogenesis in vivo by means of antagomirs.
Next we exogenously inhibited let-7 in ex vivo organ culture of kidney [121], by treating wild type embryonic day 14.5 kidneys with the same cocktail of antagomirs for 3 days. Antagomirs appeared to be ubiquitously distributed within the kidneys (Figure
3.6A). After 3 days of organ culture, antagomirs suppressed mature let-7 miRNAs relative to negative control reagents as shown by upregulation of one of the let-7 target,
Hmga2 (Figure 3.6B). Importantly, such treatment resulted in a trend towards increased renal progenitors as marked by transcription factors Eya1 and Six2 (Figures 3.6B and
3.6C) indicating that the anti-miRs have the potential to mimic effects of ectopic LIN28B
62 protein expression.
A B C Anti-miR Control Anti-miR Control 1.2 Anti-miR 1.0 Control Six2
BF 0.8
0.6 Tub 0.4 SIX2/TUBULIN Ratio 1.4 0.2 1.2 Cy5 0.0 1.0
Relative RNA expression Relative RNA Hmga2 Six2 Eya1 0.8 Anti-miR Control
Figure 3.6 | Antagomirs against let-7 miRNAs upregulate the CM cells in kidney organ culture.
(A) Representative microscopy images of embryonic kidneys after 3 days of organ culture with Cy5-labeled cocktail of antagomirs (Anti-miR) or miRNA mimic negative
control (Control) taken in bright field (BF) or Cy5 channels. (B) Relative qRT–PCR analysis measuring Hmga2, Six2, and Eya1 mRNA levels in embryonic kidneys after 3 days of organ culture. n=3 for each group. (C) Western blot analysis against Six2 and
Tubulin proteins in lysates collected from kidneys after 3 days of organ culture. See also
Figure S3.9.
63 DISCUSSION
The ability to form anywhere from 3,000 to 5,000 nephrons per kidney in a mouse, or
200,000 to 1.8 million nephrons per kidney in the human relies upon the self-renewal and
survival capacity of renal progenitor cells during prenatal development [122]. By
postnatal day 2 in mice [70] and the 36th week of gestation in humans [71], nephrogenesis
terminates with the exhaustion of all remaining CM. Although existing nephrons may be repaired in response to renal injury [73], new nephrons cannot be formed during adulthood. In mice and humans alike, IUGR correlates strongly with low nephron endowment, which in turn, predisposes to hypertension, renal and cardiovascular diseases in the adult [74-76]. Thus, development of novel regenerative approaches is of particular importance to the treatment and prevention of renal disease. Several studies have attempted to recreate CM populations for in vitro nephron formation using either direct transcriptional reprogramming of somatic cells [123, 124] or directed differentiation of pluripotent stem cells towards a renal progenitor fate [125-127]. However, the in vitro
generation of CM is not likely to help in cases of low nephron endowment, as the
anatomically complicated architecture of the kidney possesses considerable challenges to
the functional integration of a stem cell–derived nephron.
Here we report prolonged nephrogenesis, increased nephron endowment and
improved kidney function due to prolonged in utero expression of Lin28b, a
heterochronic gene that has been linked to pluripotency, stem cell self-renewal, tissue
metabolism, and enhanced wound healing. We show that transient overexpression of
LIN28B in a kidney-specific and temporally defined manner delays cessation of
nephrogenesis, rescuing the effects of low nephron endowment on kidney function.
64 While this increased nephron endowment yields a substantially larger organ, there is a
long-term hydronephrosis evident in these mice that may simply result from excessive
filtrate formation. Hence, any approach to increasing endowment by either prolonging
Lin28 expression or abrogating let-7 expression would need to be carefully controlled
(Figure 3.7). Conversely, kidney specific loss of Lin28b resulted in significantly impaired
kidney development, confirming the crucial role of this gene in proper developmental
timing of nephrogenesis. We have linked the activity of Lin28b in kidney development
to its ability to modulate the production of the let-7 family of microRNAs, and shown that Lin28b regulates the cessation of nephrogenesis in a let-7 dependent manner.
Modulating cessation of nephrogenesis by delaying it by a day or two (similar to our let-7
KO phenotype) would be an ultimate goal in such studies as it would enhance
nephrogenesis and increase the nephron mass without pathological changes (Figure 3. 7).
65
Figure 3.7 | Schematic presentation of enhanced nephrogenesis by Lin28/let-7 pathway.
During normal kidney development Six2+ cap mesenchyme (CM) are sustained in the outer nephrogenic zone of the kidney until postnatal day 2 in mice, after which time all remaining CM cells undergo a synchronous wave of differentiation to establish the final number of nephrons that will persist lifelong in the adult. Lin28b/let-7 axis controls the timing and duration of kidney development such that overexpression of Lin28b or suppression of let-7 miRNAs prolongs the period of nephrogenesis. Nephrogenesis prolonged just for a few days like in let-7 KO results in enhanced renal function and normal physiology, while longer persistence of nephrogenesis akin to LIN28B transient and continuous OE leads to abnormal pathology and complications like hydronephrosis and Wilms tumor in later life.
66 MATERIALS AND METHODS
Animals. All animal work was done in accordance with IACUC guidelines at the ARCH facility in Children’s Hospital Boston. The generation and maintenance of Col1a-TRE-
LIN28B and Lin28bfl/fl animals was previously described[85, 110, 128]. The let-7
knockout strain was a gift from Antony Rodriguez. The Wt1-Cre mice were contributed
by the laboratory of Dr. William Pu at the Boston Children's hospital. For transgene
induction, 1 g/L doxycycline (Sigma) was administered to the drinking water at different
time points to induce LIN28B transgene. Weanling mice were genotyped via ear clippings
processed by Transnetyx. 9% casein diet was ordered from Envigo (TD.150207).
Intrauterine-intraperitoneal injections were performed on E17 mice by anesthetizing a
pregnant female with isoflurane followed by minilaparotomy procedure to expose the
uterine horns. Then antagomirs, a cocktail of Ambion® mirVana™ miRNA Inhibitors or
mirVana™ miRNA Inhibitor Negative Control, were delivered into embryos with a total
dose of 240 mg per kg body weight (diluted in PBS) each in a 25-μL volume by using a
33-gauge Hamilton syringe.
Organ Culture. For the organ culture experiments, wild type embryos were harvested by
cesarean section at E14.5. Kidneys were harvested from the embryos and cultured as
previously described [121]. To inhibit let-7 miRNAs, Ambion® mirVana™ miRNA
Inhibitor and mirVana™ miRNA Inhibitor Negative Control were used as described by
the manufacturer.
qRT-PCR. RNA was isolated by TRIzol from whole kidneys and reverse-transcribed
using a miScriptII RT kit (Qiagen, #218161). Relative mRNA expression was measured
by qPCR using the ΔΔCT method with the following primers:
67 mSix2 (forward primer, GCAAGTCAGCAACTGGTTCA; reverse primer,
CTTCTCATCCTCGGAACTGC), mEya1 (forward primer,
TTTCCCTGGGACTACGAATG; reverse primer, GGAAAGCCATCTGTTCCAAA),
mbActin (forward primer, TACTCCTGCTTGCTGATCCAC; reverse primer,
CAGAAGGAGATTACTGCTCTGGCT); and hLIN28B (forward primer,
GCCCCTTGGATATTCCAGTC; reverse primer, TGACTCAAGGCCTTTGGAAG);
mLin28b (forward primer, TTTGGCTGAGGAGGTAGACTGCAT; reverse primer
ATGGATCAGATGTGGACTGTGCGA); mLin28a (forward primer,
AGCTTGCATTCCTTGGCATGATGG; reverse primer-
AGGCGGTGGAGTTCACCTTTAAGA). Absolute quantification PCR was performed
by using DNA standards ordered from IDT for amplicons of mLin28a and Lin28b
primers. For qRT-PCR of mature and precursor let-7 miRNAs, we used Qiagen miScript
target as described by the manufacturer.
Immunoblot analysis. Whole kidneys (from E12.5 to adulthood) were dissected and
then lysed in RIPA buffer (Pierce) supplemented with protease inhibitor cocktail (Roche)
and phosphatase inhibitor cocktail (Roche). Lysates were loaded and run on the 12%
polyacrylamide gel (Bio-Rad) in 5x Laemmli sample buffer and transferred to a nitrocellulose membrane (GE Healthcare). The membrane was blocked for 1 h in PBST containing 5% milk and subsequently probed with primary antibodies overnight at 4°C.
After 1-h incubation with sheep anti-mouse or donkey anti-rabbit HRP-conjugated secondary antibody (GE Healthcare), the protein level was detected with standard ECL reagents (Thermo Scientific). Antibodies used: anti-α/β-tubulin (Cell Signaling, #2148), anti-Lin28a (Cell Signaling, #3978), anti-Lin28b (mouse preferred) (Cell Signaling,
68 #5422), anti-Six2 (Proteintech Group, #11562-1-AP).
Histological analysis. Whole kidneys were fixed in 10% formalin overnight at room temperature, then placed in 70% ethanol and embedded in paraffin. Slides were dewaxed with xylene and rehydrated through a series of washes with decreasing percentages of ethanol. Antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by placement in decloaking chamber for 45 minutes at 95°C. Slides were treated with 10% hydrogen peroxide to inhibit endogenous peroxidase activity. After blocking with 5% goat or rabbit serum (VECTASTAIN ABC kit #PK-6101), slides were incubated with primary antibody overnight at 4°C and secondary antibody for 30 minutes at room temperature. Detection was performed with the VECTASTAIN Elite ABC Kit and DAB
Substrate (Vector Laboratories, SK-4100). Sections were counterstained with hematoxylin for 20-30 seconds then dehydrated in increasing concentrations of ethanol before a 5-min incubation in xylene followed by mounting. Antibodies used: anti-
LIN28B (Cell Signaling, #4196), anti-Six2 (Proteintech Group, #11562-1-AP), anti-Lef1
(Cell Signaling, #2230).
Immunofluorescence and image analysis. Whole kidneys were fixed in 4% PFA for half an hour at 4C then placed in PBS. Whole mount immunofluorescence, confocal microscopy, and optical projection tomography was carried out according to published protocols [114]. Cell counts per niche (confocal) and niche counts (OPT) were performed as reported [114]. Antibodies used: rabbit anti-Six2 (Proteintech Group, #11562-1-AP), anti-rabbit Alexa Fluor-658 conjugated secondary antibody (Life Technologies).
Blood Analysis. Renal panel tests performed on an Abaxis VetScan VS2 chemistry analyzer. Serum creatinine measured using isotope dilution LC-MS/MS in the O'Brien
69 Core Center for Acute Kidney Injury Research, the University of Alabama at
Birmingham School of Medicine.
Glomeruli number count. To compare the nephron number between transgenic and
control mice we count the number of glomerulus-like structures in 12 random fields from
the kidney cortex under 10X magnification.
Measurement glomerular filtration rate (GFR). GFR was measured using a high-
throughput method described previously [129]. Fluorescein isothiocyanate (FITC)-
sinistrin (Fresenius Kabi, Linz, Austria) was administered to conscious mice under light
anesthesia, isoflurane, via tail vein injections. Blood was collected from a small tail snip
at 3, 7, 10, 15, 35, 55, and 75 min postinjection for the determination of FITC
concentration by fluorescence. GFR was calculated by a two-phase exponential decay
model [129].
Statistical analysis. Data is expressed as mean ±SD. Unpaired t-test with two-tailed
distribution and Welch’s correction was calculated using Prism (GraphPad Prism) to
determine P-values. Statistical significance is displayed as P < 0.05 (*), P < 0.01 (**)
unless specified otherwise.
Gene Nomenclature. Human gene – capital italic (LIN28B), human protein – capital
(LIN28B), mouse gene – first letter capital, italic (Lin28b). Mouse protein – first letter capital (Lin28b).
70 ACKNOWLEDGEMENTS
We are grateful to Antony Rodriguez for the gift of the let-7 knockout animals. We thank
ARCH for their assistance with maintenance of the animal colony. We would also like to thank Rod Bronson from the Rodent Histopathology core at Harvard Medical School for initial mouse tissue pathology. This project was supported by NIH F99 CA212487 predoctoral fellowship.
CONTRIBUTORS TO THE WORK
Alena Yermalovich designed experiments, conducted experimental work and wrote the manuscript. Jihan K. Osborne, Areum Han, Melissa A. Kinney, Daisy Robinton, Dan S.
Pearson contributed to experiments, discussion and analysis of the data. Patricia Sousa assisted with GFR experiments and maintenance of the animal colony. Sean B. Wilson and Alexander N. Combes performed immunofluorescence and image analysis. Michael
J. Chen assisted with dissection of mouse embryonic kidneys. Melissa H. Little and
George Q. Daley contributed to discussion of the data and manuscript preparation.
71 Chapter 4: Conclusions and Future Directions
The initiation, promotion and progression of the most adult cancers result from a gradual accumulation of multiple genetic mutations within several pathways occurring over the course of years. In contrast, pediatric neoplastic tumors arise from one to two genetic mutations that occur over a few months rather than years. These mutations typically involve genes responsible for normal development and result in neoplastic transformation resembling cells and lesions within the developing embryo. In addition, they are often the same genetic events that are implicated in the development of adult cancers as well. Thus, pediatric tumors provide invaluable insights not only into normal development, but also into both adult and childhood neoplasia [130]. The investigation of the role of an oncofetal gene, Lin28, in Wilms tumor is a remarkable illustration of this.
Wilms tumor is the most common pediatric renal cancer and the fourth most common childhood malignancy after leukemia, brain and spinal cord tumors and neuroblastoma. The tumor usually develops in a single kidney before the age of 5 years, with equal incidence between the sexes [62]. Despite being relatively rare in absolute numbers (it affects 1 in 10,000 children accounting for about 6% of pediatric malignant diseases [131]), Wilms tumor is broadly studied for several reasons. First of all, although treatment outcome has improved considerably over recent decades and what used to be a uniformly lethal disease now has a cure rate of over 85%, there still remains a strong clinical need to improve therapies to decrease side effects of current treatments and to find more effective therapies for a substantial minority of patients (∼25%) that respond poorly to current therapies and require high-risk treatment or relapse [132]. Secondly,
Wilms tumor 1 (WT1) was one of the first tumor suppressor genes identified by Knudson
72 during the development of his two-hit hypothesis [59]. Although, many variations in classifications, the genetics and mechanics of tumor suppressor genes have emerged since then, the loss of WT1 in a subset of Wilms tumor cases still serves as an example of a
classic tumor suppressor gene [133]. Finally, it has been argued that Wilms tumor arises
from pluripotent embryonic kidney precursor cells that fail to complete their
differentiation program [92, 93], suggesting the pathogenesis of pediatric tumors is
directly linked to dysregulated embryonic development and organogenesis. As such
Wilms tumor serves as an ideal model to study the link between normal organ
development and tumorigenesis [94]. Understanding normal kidney development will help our understanding and treatment of Wilms tumors and, vise versa, a deep genetic and mechanistic understanding of Wilms tumor will provide insight into normal kidney development and help with treatment of much more common forms of kidney disease
[134].
Histological and transcriptomic analyses of Wilms tumors reveal that it is a heterogeneous group of neoplasms emerging from different developmental stages [130].
In general, there are very few commonly mutated genes in Wilms tumor, and all of them show relatively low mutation frequencies [134]. Among genes identified as being mutated in Wilms tumor are WT1, CTNNB1 (the gene encoding β-catenin), and WTX.
WT1 is a zinc finger DNA-binding transcription factor involved in genitourinary development [135]. A somatic inactivating mutation or deletion of WT1 is found in 12% of Wilms tumors and is linked to early kidney development and regulation of the progenitor cells undergoing the mesenchymal-to-epithelial transformation (MET) [132,
135-137]. The next gene identified to play role in Wilms tumor and renal development
73 was CTNNB1. The gene is mutated somatically in 15% of tumors with activating
mutations of CTNNB1 frequently accompanying loss of WT1 mutations [138, 139].
CTNNB1 encodes β-catenin, a key protein involved in the Wnt signaling pathway, which is critical for epithelialization step after MET during nephrogenesis [139]. Another gene
fount to be inactivated by mutation or deletion in ∼18% of tumors, regardless of their
WT1 mutation status, is WTX (Wilms’ tumor on chromosome X) [140, 141]. WTX, further
links both the WT1 and CTNNB1 genes together, as the protein negatively regulates Wnt
signaling by contributing to β-catenin degradation and by being associated with WT1
transcriptional control [142, 143]. While activation of Wnt signaling pathway most likely
occur subsequent to WT1 mutation [144, 145], it is not clear whether Wnt activating
mutation is required for tumor initiation, development and progression after WT1
mutation. Also the role of Wnt activation in Wilms tumors lacking WT1 mutation has yet
to be discovered as germline WTX mutations do not predispose to Wilms’ tumor [146].
Studies have shown that mutations in cancer-associated genes like TP53 and
MYCN are also implicated in Wilms tumor [145, 147-149]. Missense or loss of function
mutations in TP53 or high expression and copy number gain of MYCN have been
associated with a low proportion of Wilms tumor. However, these mutations are largely
implicated in cases that show anaplasia and carry a poor prognosis [150-152].
Interestingly, but perhaps not surprisingly, genetic aberrations discovered in TP53 and
MYCN overlap with CTNNB1/WT1/WTX pathway in the context of Wilms tumor. For
example, it has been shown that WTX can mediate TP53 inactivation via enhancing TP53 acetylation in vitro [153]. Several studies have also revealed that MYCN is regulated by
WT1 in Wilms tumor. MYCN is coexpressed with WT1 in the developing kidney, and
74 mutations in WT1 DNA-binding domain leads to overexpression of MYCN [154, 155].
Both TP53 and MYCN have been implicated in kidney development as well. TP53- deficient mice display genetic and congenital abnormalities in the kidneys [156, 157], while MYCN-deficient embryos die at E10.5–E12.5, with a reduction in the number of mesonephric tubules [158]. However, the exact role of TP53 and MYCN in nephrogenesis and Wilms tumor is not fully understood and requires further investigations.
Overall, only one-third of tumors have mutations in one or more of Wnt signaling pathway associated genes listed above [141]. Additionally, loss of heterozygosity (LOH) or loss of imprinting (LOI) on chromosome 11p15, which harbors a cluster of imprinted genes, is documented in approximately 70% of tumors, resulting in biallelic expression of insulin-like growth factor II (IGF2) [159, 160]. However, the mechanism by which one or a combination of these genetic alterations results in tumorigenesis has remained challenging to determine, due to the lack of an appropriate Wilms tumor mouse model.
The work in this dissertation deciphers the role of Lin28, an RNA-binding protein linked to development [14, 40], metabolism [110], wound healing [102] and oncogenesis
[5, 14, 19] in normal kidney development and Wilms tumor. Using doxycycline-inducible mouse models for overexpression of murine Lin28a and human LIN28B we have shown that activation of either gene leads to neoplastic transformation resembling Wilms tumor through either leaky expression of Lin28a in a Vasa-Cre-driven system or the directed expression of LIN28B in the renal Wt1 lineage, respectively. Continuous overexpression of Lin28 in developing kidneys markedly expands Six2+ nephrogenic progenitor cells that form the cap mesenchyme blocking their final, synchronized differentiation, which
75 under normal conditions is complete in the mouse by post-natal day 2 [70] and by 36
weeks of gestation in humans [71]. Our model implies that aberrant Lin28 expression
produces a coordinated expansion of the nephrogenic zone, resulting in proliferating
blastema and nephrogenic rests, which are characteristic of human Wilms tumor.
Previously, a murine model of Wilms tumor was generated by Wt1 ablation and
Igf2 upregulation [95], which established that Wt1 ablation prevents the MET of CM
cells, the step that is essential for nephrogenesis. In contrast, in our Wilms tumor mouse
model, the CM cells do persist beyond the period when synchronous differentiation
typically occurs and maintain their capacity to undergo MET, resulting in a markedly
expanded period of nephrogenesis as marked by Six2+ nephrogenic progenitor cells that
ultimately progresses to tumorigenesis. The differences between these two models
demonstrate that pediatric Wilms tumor formation can occur at diverse stages of
development and by means of different molecular mechanisms consistent with the
observation that different subgroups of Wilms tumor have a different developmental stage of origin [130].
Although, both murine Lin28a and human LIN28B are sufficient to induce Wilms tumor in our mouse model, only overexpression of LIN28B (but not LIN28A) is prevalent in a significant percentage (up to 30%) of human Wilms tumor patient samples. The expression of LIN28B paralog is restricted to blastemal cells, which are the most undifferentiated tumor component, and correlates strongly with tumor relapse and mortality. As such, LIN28B expression may serve as a marker for high-risk subtype of
Wilms tumor and relapsed patients.
The prevalence of LIN28B activation and the absence of aberrant LIN28A
76 expression in human Wilms tumor could be explained through an unknown mechanism that drives the specific activation of the LIN28B locus rather than via differences in the transforming potential of the genes since both of them are competent to induce Wilms tumor in the murine model. Previously, we reported that rare cases of Wilms tumor result from activation of LIN28B by chromosomal translocation and that amplification of the
LIN28B locus occurs in only ∼2% of tumors [14]; therefore, the underlying genetic or epigenetic basis of LIN28B activation remains unexplained in most cases.
While the importance of LIN28 paralogs in tumorigenesis is broadly appreciated, the mechanisms that underlie LIN28 overexpression in human cancers remain obscure.
Transcriptional activation of LIN28A and LIN28B by upstream targets could explain aberrant expression of the proteins in some cases. For instance, c-Myc binds to both
LIN28A and LIN28B loci and activates expression of these genes [161, 162]. LIN28B is also increased by SRC oncoprotein in an inducible breast cancer model. Transient induction of SRC activates NF-kB, which triggers an inflammatory response and directly activates Lin28B transcription and rapidly reduces let-7 microRNA levels [163].
Besides transcriptional factors, other mechanisms may explain LIN28A and
LIN28B overexpression in tumors. For example, amplification of regions containing the
LIN28A and LIN28B loci has been reported in several studies of human cancers.
Nevertheless, analysis of SNP array data from 3,131 primary tumors and cell lines showed no appreciable copy number changes at the LIN28A locus and only a small number of cancers (1.7%) showed an increased focal copy number at the LIN28B locus
[14]. Most of these amplification events were rare and broad, involving both LIN28B and numerous neighboring genes. Therefore, although genomic amplification could explain
77 LIN28B expression in a small subset of tumors, it is unlikely to be a dominant
mechanism of activation [14]. The same study investigated methylation status at a CpG
island located within the LIN28B locus and documented relative hypomethylation in
LIN28B-expressing cell lines, suggesting that aberrant hypomethylation may poise the
LIN28B locus for transcriptional activation in some tumors [14].
Prior studies have implicated aberrant expression of the HACE1 locus on
chromosome 6 in Wilms tumor [106]. LIN28B is tightly linked to this locus, and our
detection of aberrant overexpression of LIN28B in a significant minority of human Wilms
tumors suggests the possibility of coordinate dysregulation.
LIN28 has profound effects on both the proliferative and metabolic machinery of
tumor cells. Both LIN28 paralogs exert their influence through 2 different mechanisms:
1) they bind a wide variety of mRNAs enhancing or preventing their translation [8-12], 2) they also regulate let-7 microRNAs by binding to the terminal loops of the precursors of let-7 and blocking their processing into mature miRNAs [3, 4]. In addition, to inhibit the maturation of let-7 miRNAs, LIN28 recruits terminal uridylyl transferases (TUT4/7) to uridylate pre-let-7, which cannot be processed by DICER into a mature miRNA and is therefore broken down by DIS3L2 exonuclease [27-31]. Inhibition of let-7 biogenesis leads to de-repression of let-7 targets among which are known oncogenic targets like Myc
[96], Ras [97], Hmga2 [98, 99], and cyclins [100, 101]. To elucidate the mechanism by which LIN28 leads to tumorigenesis, we crossed our Wilms tumor mouse model with the mice expressing a LIN28-independent form of let-7 and found a complete rescue of the phenotype. Although this does not rule out a role for the mRNA-binding activity of
LIN28, it is clear LIN28 induces Wilms tumor at least in part by suppressing Let-7
78 microRNAs.
The miRNA pathway is a common target for dysregulation in different types of
tumors [108, 109]. In particular, resent exome and transcriptome sequencing of Wilms’ tumors has identified mutations in DROSHA, DICER, DIS3l2, DGCR8, XPO5 and
TARBP2, all of which are involved in the biogenesis of miRNAs and are critical components of Lin28/let-7 pathways [61, 164]. Overall, 33% of Wilms’ tumors (22 out
of 66) studies had mutations or deletions in these miRNA processor genes, and they
frequently occurred in combination, resulting in multiple hits to the same pathway within
the same tumor [164]. Moreover, recently it was demonstrated that mutations in DIS3L2
RNA exonuclease cause the Perlman syndrome, which is characterized by fetal
overgrowth and a predisposition to Wilms tumors [165]. Thus, common hits to let-7
miRNAs processing (by LIN28 overexpression or inactivation of DIS3L2) result in
aberrant mature let-7 expression and are associated with Wilms tumor, strongly
suggesting that disruptions of let-7 miRNA biogenesis or function is an important player in Wilms tumorigenesis.
Overall, the mutations discovered to date in Wilms tumor seem to overlap either with the Wnt signaling pathway (CTNNB1/WT1/WTX etc.) or the miRNA processor pathway (DROSHA, DICER, DIS3l2 etc.). Also, epigenetic abnormalities play a clear role in a subset of Wilms tumors in which IGF2 is dysregulated (though it is not clear whether they play an in initiating role in tumor formation). It is astonishing, but perhaps not surprising, that LIN28 appears to be a common denominator for all these key pathways involved in Wilms tumor biology. In addition to its role in miRNA biogenesis described above, LIN28 has been shown to cooperate with WNT signaling to drive invasive
79 intestinal and colorectal adenocarcinoma in mice and humans [53]. Furthermore, LIN28B
overexpression is tightly associated with upregulation of Igf2bp1 and Igf2bp3, well- established let-7 targets, in mouse and human liver cancers [55]. Also, LIN28 paralogs are known to regulate expression of IGF2 in let-7-independent manner by directly binding IGF2 and IGF2BP1-3 mRNAs in a variety of contexts both endogenous and pathological [8, 55, 166]. Thus, LIN28 brings most of the genetic aberrations identified in
Wilms tumor together and underlines the importance of studying normal kidney
development for the better understanding of Wilms tumor biology.
Indeed, in recent years, both LIN28 paralogs have emerged as factors that play an
important role in stemness and oncogenesis [13]. Lin28 is highly expressed in mouse embryonic stem cells and, together with Oct4, Sox2, and Nanog, promotes reprogramming of somatic cells into induced pluripotent cells reprogram somatic cells into induced pluripotent stem cells (iPSCs) [23]. We detected overexpression of LIN28B in Wilms tumor cancer stem cells (CSCs) identified as NCAM1+ ALDH1+ cells and characterized by NCAM1 expression and ALDH1 activity [91]. During normal kidney development, NCAM1 and ALDH1 are not found in the same types. It was proposed that
NCAM1 acts as a marker for the developmental stage of origin, while ALDH1 is associated with stem cell activity, similarly to other cancers, rather than being a specific renal lineage blastema marker [91]. However, both of these markers have to be expressed in CSCs and LIN28B may be involved in regulating this transformation. Indeed, a study shows that LIN28/let-7 pathway plays a critical role and has a stimulating effect on in the maintenance of ALDH1+ tumor cells [167]. Furthermore, a recent report demonstrated that the NCAM1+/ALDH1+ CSCs dedifferentiate to a more mesenchymal state from
80 which the bulk of the tumor forms [168]. Other groups have shown that reprogramming of iPSC, a process in which Lin28a is known to be involved as well, in situ in the kidney can induce Wilms tumor [169, 170]. This suggests LIN28 plays a role in regulating initiation and progression of Wilms tumor cancer stem cells and it would be interesting to
analyze whether NCAM1+ ALDH1+ cells appear in our Wilms tumor mouse models.
While our discovery of the role of Lin28 in Wilms tumor offers promise for treating kids with particularly aggressive, Lin28+, so-called blastemal disease, of even greater interest is the role of Lin28 in mediating prolonged nephrogenesis as a means to treat the much more common forms of kidney disease. Kidney disease represents a major public health issue in large part because nephrons, which are responsible for the filtration function of the kidney, form only during development in utero, and reaches completion at approximately 34-36 weeks of gestation. Children who are born prematurely or suffer
from malnutrition, disease, trauma, or surgical ablation have a reduced number of
nephrons, or “low nephron endowment.” Because new nephrons never form in the
extrauterine environment, children with a compromised nephron endowment are at
increased risk of hypertension and development of cardiovascular and renal diseases as
well as insulin resistance and Type 2 diabetes in later life. Several studies have attempted
to emulate nephron formation in vitro by the directed differentiation of pluripotent stem
cells towards renal progenitor fate [125, 126, 171]. However, anatomically complicated
organs like the kidney are particularly challenging for stem cell-based therapies[172].
Therefore, there has been interest in developing novel approaches to the treatment and
prevention of kidney disease [74-76].
Our studies of normal kidney development in mice reveal expression of Lin28b
81 around the middle of gestation when new nephrons are forming, after which Lin28b is
silenced. If we provide a brief additional pulse of LIN28B expression in a kidney-specific
and temporally defined manner in our transgenic mouse, we prolong the period of
nephrogenesis, resulting in up to 2 fold increased endowment of nephrons with increased filtration function of the kidney. We have linked the activity of Lin28b to its ability to modulate let-7 miRNAs during kidney development and shown that Lin28b regulates the cessation of nephrogenesis in a let-7 dependent manner. This interaction is potentially
druggable by small molecule or anti-miR (a nucleic acid that blocks let-7), which might
suffice to act like the endogenous Lin28b protein. Indeed, inhibition of let-7 in ex vivo
organ culture of kidney resulted in proliferation of the CM cells, revealing potential for
translational applications and therapeutic interventions. To take the therapeutics to the
next level we also administered fluorescently labeled antagomirs in utero and found
several major organs such as heart, lung, intestines, brain and kidney are able to uptake
the antagomirs. However, further optimizations are required to achieve significant
upregulation and expansion of progenitor cells in the kidney and possibly other organs, in
development of which Lin28/let-7 pathway plays a role.
In summary, the work in this dissertation represents an analysis of the role of the
heterochronic Lin28/let-7 pathway in organ development and tumorigenesis in the
kidney. Prior to the studies described in this thesis, the role of the pathway in mammalian
organogenesis and tumor initiation and progression had not been definitively addressed
nor understood. We have shown that overexpression of Lin28 during embryonic kidney development in mice results in pathology highly reminiscent of human Wilms tumor. We have established that LIN28B is overexpressed in significant percentage of particularly
82 aggressive subtype of Wilms tumor, and that and that the LIN28 gene can be activated through chromosomal translocation, firmly linking LIN28 to Wilms pathogenesis. Wilms tumor biology provided insight into mechanisms of early renal development and into the properties of kidney progenitor cells. As a result, we have discovered that Lin28 proteins
(particularly lin28b) and let-7 miRNAs regulate timing of kidney development in mice reminiscent of their association with heterochronic phenotypes in C. elegans. We demonstrated that precise and tightly controlled manipulation of expression of the genes represents a therapeutic strategy for enhancing kidney function. Such a strategy holds promise for children suffering from the complications of premature birth and/or intrauterine growth restriction and could have profound effects on long-term health for the individual and the health burden of hypertension and renal failure of the population as a whole. Our work gives important insights into the biology of Wilms tumor and reveals novel mechanisms regulating nephrogenesis.
83
APPENDIX
SUPPLEMENTARY FIGURES
Chapter 2 Supplementary Figures
Figure S2.1, related to Figure 2.1 | General and tissue specific Lin28 over-expression
(A) Schema for the design of the Lox-stop-Lox-mLin28a mice and the strategies to obtain general or specific Lin28a over-expression. Cells that underwent Cre Excision of the Lox-Stop-Lox cassette, will over-express Lin28a (labeled with FLAG tag) even when the Cre allele is not expressed any more. (B) E18.5 kidneys from control and transgenic mice. Note that the transgenic kidney has fewer mature proximal tubule structures
(yellow arrows) and that there is no expansion in the nephrogenic zone of the transgenic kidneys compared to the control (See also in main text, Fig 4B) (C) Lin28a derived tumor, 4M post transplantation of transgenic kidney under the kidney capsule of immunodeficient mice. (D) Schema to explain the system of the rosa26-Lox-stop-Lox- rtTA;Col1A1-TRE-LIN28B mice. Cells in which the Lox-Stop-Lox cassette underwent
Cre excision and all the cells that derived from them, will have Rosa26-rtTA allele and will over-express Lin28B upon Dox induction even when the Cre allele is not expressed any more (continued).
84
Figure S2.1 (Continued)
85
Figure S2.2, related to Figure 2.2 | Li28B derived tumors harbor proliferating cap- mesenchyme cells
(A) Overexpression of CM specific transcription factors in the Lin28B derived tumor. qRT-PCR analysis. (Control n=4, Transgene n=3). (B) Six2 and Ki67 immunostaining in
Lin28a derived tumor. Note that the epithelial cells (Six2 negative, yellow arrow) are still positive for Ki67. (C) Embryonic structures of cap mesenchyme cells (Six2 positive) and ureteric bud cells (Keratin8 positive) in the Lin28B derived tumor. LTL is a marker for mature proximal tubules (continued).
86
Figure S2.2 (Continued)
87 Figure S2.3, related to Figure 2.3 | Differentiation capacity of the CM cells in the tumor.
(A, B) Epithelial differentiation in a Lin28 derived tumor (A) Cdh6 immunostaining. (B)
H&E staining. Yellow arrow – epithelial structures (Cdh6 positive) differentiated from
CM cells. Red arrows – undifferentiated CM cells (Cdh6 negative). Scale bar – 200mM.
(C) Anti flag staining of the Lin28 derived tumor. Note that both the undifferentiated CM cells (red arrow) and the differentiated epithelial structures (yellow arrows) are flag positive. (D) Glomeruli-like structures in a Lin28 derived tumor. (E) Anti flag staining of the Lin28 derived tumor. Note that the glomeruli-like structures are flag positive
(continued).
88 Figure S2.3 (Continued)
89 Figure S2.4, related to Figure 2.4 | Lin28 over-expression sustain exits CM cell population but can't reprogram adult kidney cells into CM cells.
(A) Lin28a and Lin28b expression levels in the cap mesenchyme (CM) cells at E11.5 and
E15.5. Data obtained from published microarray GSE3822, GSE6290 for E11.5 and from
GSE12588 for E15.5. (E11.5 n=20 E15.5 n=3). (B) Six2 immunostaining in the nephrogenic zone of E18.5 Lin28a over-expressing kidney. Scale = 100mM. (C) H&E staining of P11.5 transgenic kidney in which Lin28 over-expression was induced only from E18.5. Note the presence of CM-UB structures in the kidney. Scale = 100 mM. (D) qRT-PCR analysis of LIN28B and Six2 expression in kidneys of transgenic mice in which LIN28B overexpression was induced at postnatal day 10 or at E0 as a positive control. (E) H&E staining of 6 weeks old transgenic kidneys after induction of LIN28B over-expression from E0 (left panel) or from P10 (right panel) (continued).
90 Figure S2.4 (Continued)
91
Figure S2.5 | Tissue specific over-expression of Lin28a/LIN28B didn't result in Wilms tumor formation.
Morphology (A) and H&E staining (B) of 12w old kidneys from Six2Cre-Lin28a and control mice. Lin28a over-expression was induced from E0. (C) H&E staining of kidneys from 18w old Six2Cre-Lin28a and control mice. Lin28a over-expression was induced when mice were 11w old. (D) Kidneys from 5M old FoxD1Cre-LIN28B and control mice. LIN28B over-expression was induced from E0.
92
Figure S2.6, related to Figure 2.5 | Transgenic kidney 2 weeks post Dox withdrawal.
Note that CM cells (yellow arrows) persist in the transgenic kidney 2 weeks post Dox withdrawal.
93 Figure S2.7, related to Figure 2.6 | Let-7 levels in Lin28 derived tumors and control.
(A) qRT-PCR analysis of mature Let-7 species in Lin28a/LIN28B derived tumors and
control. (n=3). (B) qRT-PCR analysis of Pre/pri Let-7 species in Lin28a/LIN28B derived tumors and control. (n=3). (C) Gene set enrichment analysis (GSEA) of microarray data from Lin28 derived tumors and control kidneys showing statistically significant up regulation of Let7 target genes in the tumor compare to the control. (D) Immunostaining against LIN28B in control kidney, LIN28B over-expressing kidney and LIN28B;i7s overexpressing kidney. Scale = 100mM. (E) Let-7 targets with lower expression in the
Lin28B;i7s samples compared to the Lin28B tumors (Microarray data) (continued).
94 Figure S2.7 (Continued)
95
Figure S2.8, related to Figure 2.7 | LIN28A and LIN28B expression in human Wilms tumor.
(A) LIN28B and LIN28A expression levels (qRT-PCR) in human fetal kidney, primary
Wilms tumor xenograft and Wilms tumor cancer initiating cells (CIC) (n=3). (B) LIN28B and LIN28A expression levels in diverse types of human pediatric tumors. Data obtained from Oncomine (www.oncomine.org) to demonstrate the expression of LIN28B in neuroblastoma).
96 Table S2.1 Statistical data regarding % of relapse and death in LIN28B + and LIN28- human Wilms tumor. Follow up is more than 6 years in all cases.
Total number of cases Relapsed Died (after relapse) Total number 77* 13 5 LIN28B positive 10/77 5/9 (56%) 3/9 (33%) LIN28B negative 67/77 8/67 (12%) 2/67 (3%) Odd ratio 9.21875 16.25
Table S2.2 Histological subtype classification of the UK Wilms tumor cohort (n=77)
Histological Lin28B subtype Total positive
Blastemal 4 1 Diffuse AH 3 1 Epithelial 3 0 Focal AH 1 0 Mixed 23 2 Non-AH primary 6 2 Regressive 23 2 Stromal 13 1 No clinical information 1 1
Total 77 10 AH = anaplastic histology. All tumors were treated according to the International Society
of Paediatric Oncology protocol (Vujanic et al. Med and Pediatric Oncology 2002). For 6
cases (termed Non-AH primary) immediate nephrectomy was performed with no pre-
operative chemotherapy.
97 CHAPTER 3 SUPPLEMENTARY FIGURES
Figure S3.1, related to Figure 3.1 | Profile of endogenous expression of mature and precursor let-7 miRNAs in mouse embryonic kidney.
(A, B) Relative qRT–PCR analysis measuring the levels of mature and precursor let-7 miRNAs in wild-type kidneys at the indicated developmental time points. Data are mean
± SD; n = 3-5 from each sample type (continued).
98 Figure S3.1 (Continued)
A 1.2 1.2 let-7b 1.2 let-7c let-7e 1.0 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0.0 0.0 0.0
Relative RNA expression Relative RNA P2 NB NB P2 NB P2 E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult
1.2 let-7g 1.2 let-7i 1.0 1.0 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0
Relative RNA expression Relative RNA NB P2 NB P2 E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult B E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult 1.2 1.2 pre-let-7a-2 1.2 pre-let-7b pre-let-7c-1 1.0 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0.0 0.0 0.0
Relative RNA expression Relative RNA NB P2 P2 NB P2 NB E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult 1.2 pre-let-7c-2 1.2 pre-let-7f-2 1.2 pre-let-7g 1.0 1.0 1.0 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0.0 0.0 0.0
Relative RNA expression Relative RNA NB P2 NB P2 NB P2 E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult 1.2 pre-let-7i 1.2 pre-let-7e 1.0 1.0 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0
Relative RNA expression Relative RNA NB P2 NB P2 E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult E12.5E13.5E14.5E15.5E16.5E17.5E18.5 Adult Supplemental Fig.S1. Profiles of endogenous expression of mature and precursor let-7 miRNAs in mouse embryonic kidney.
99 A
LIN28B1.2 let-7b LIN28B1.2 let-7e LIN28B1.2 let-7g LIN28B1.2 let-7i 1.2 1.2 1.2 1.2 * LIN28B Wt1 LIN28B Wt1 LIN28B Wt1 LIN28B Wt1 1.0 1.0 LIN28B 1.0 * 1.0 LIN28B 1.0 1.0 LIN28B 1.0 1.0 LIN28B ControlControl ControlControl ControlControl ControlControl 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 * * * * 0.6 0.6 0.6 0.6 0.6 0.6 0.6* * 0.6 * * * * 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 * * * * * * 0.2 * * 0.2 * 0.2 * 0.2 0.2 * * 0.2 0.2 0.2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 P1 P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5
P1 expression Relative RNA P3 P5 P1 P3 P5 P1 P3 P5 P1 P3 P5 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 P10 P14 P21 E18.5 E18.5 E18.5 E18.5 E18.5 E18.5 E18.5 E18.5 B NB P2 P3 P5 P8 P11 4x
10x Six2 20x
LIN28BWt1
Supplemental Fig.S2. Transient overexpression of LIN28B in embryonic kidney prolongs the period Figureof nephrogenesis. S3.2, related to Figure 3.2 | Transient overexpression of LIN28B in embryonic kidney prolongs the period of nephrogenesis.
Relative qRT–PCR analysis measuring the levels of mature let-7 miRNAs in LIN28BWt1
and control kidneys of littermate animals at the indicated developmental time points.
Data are mean ± SD; n = 3 from each genotype. (*)=p<0.05 by unpaired, 2-tailed
Student’s t-test. (B) Representative immunohistochemistry staining against Six2 proteins,
respectively, in LIN28BWt1 animals under 4x, 10x and 20x magnification.
100 Figure S3.3, related to Figure 3.2 | Persistence of nephrogenic blastema leads to ectopic and extended nephron formation in LIN28B overexpressing neonatal kidneys.
Haematoxylin and eosin stained paraffin-fixed histological sections of kidneys from wildtype and LIN28BWt1 overexpressing kidneys from postnatal (P) day 1 to 90. P1:
Equivalent sections of wildtype and LIN28BWt1 overexpressing kidneys show a similar
nephrogenic zone with evidence of residual cap mesenchyme (dotted white line) around
ureteric tips (yellow line). P3: Cessation of nephrogenesis in wildtype kidneys is seen as
an absence of cap mesenchyme adjacent to ureteric tips. At this age, LIN28BWt1 transgenic
mice show clear peripheral and ectopic cap mesenchyme regions (dotted white line)
associated with open ureteric epithelium (yellow line). P5 to P14: Maturation of all
nephrons evident in wildtype kidneys with no remaining nephrogenic zone. LIN28BWt1
transgenic kidneys continued to show regions of ectopic cap mesenchyme associated with
forming nephrons throughout the cortex. This is associated with a substantial expansion
in renal parenchymal volume and extensive neonephrogenesis. Frequently, collecting
duct epithelium adjacent to these blastemal regions show dilation. P21: By this timepoint,
newly formed nephrons are maturing but there remain residual pockets of persistent
nephrogenic blastema within the cortex of the LIN28BWt1 transgenic kidneys similar to nephroblastomatosis in the human. This is accompanied by substantial dilation of the collecting duct epithelium within cortex and papilla (arrowheads). P90: By this time, there is no apparent remaining blastema and most nephrons have completed maturation.
However, there are pocket of densely packed nephrons with more basophilic staining. At this timepoint, the LIN28BWt1 kidneys are >5x the size of the wildtype kidneys but no papillary collecting duct dilation was observed. Scale bar = 50uM (continued).
101 Figure S3.3 (Continued)
102 P1 P7 P14 1m.o. LIN28BWt1 Six2 Lef1
Figure S3.4, related to Figure 3.2 | Transient overexpression of LIN28B in embryonic kidney after E16.5. Supplemental Fig.S4. Transient overexpression of LIN28B in embryonic kidney after E16.5. Representative immunohistochemistry staining against Six2 and Lef1 proteins, respectively, in LIN28BWt1 kidneys. LIN28B induced in Wt1-expressing cells by dox administration from Newborns to P7. Scale bar, 200um.
103 Figure S3.5, related to Figure 3.3 | LIN28B transient overexpression enhances renal function.
(A) Organ weights in LIN28BWt1 and littermate control for 3 m.o. animals. Data are mean
± SD. n = 5 or 6 from each genotype. Each group contains mice from two different litters.
(B,C) Glomerular filtration rate (GFR) and creatinine levels of LIN28BWt1 and littermate control animals according to gender, and measured blindly. Data are mean ± SD; n = 7 or
8 from each genotype; each group contains mice from three different litters. (**)=p<0.01 by unpaired, 2-tailed Student’s t-test. (D) Renal function panel tests for LIN28BWt1 and
littermate control animals on normal diet. Albumin (ALB), alanine aminotransferase
(ALT), amylase (AMY), total bilirubin (TBIL), urea nitrogen (BUN), phosphorus
(PHOS), sodium (Na+), potassium (K+), glucose (GLU), total protein (TP), globulin
(GLOB). Data are mean ± SD. n = 14 or 15 from each genotype for NP; each group
contains mice from two or three different litters. (E) Onset of hydronephrotic injury in
LIN28B transgenic kidneys. Haematoxylin and eosin stained paraffin-fixed histological sections of kidneys from wildtype and LIN28B overexpressing kidneys at 1.5 years of age. Arrowheads: dilated tubules showing evidence of protein casts. nr: nephrogenic rest,
Scale bar = 50uM (continued).
104 Figure S3.5 (Continued)
A B C Heart Lung Creatinine Levels 300 450 GFR 0.15 800 *" 1.2 LIN28B*" 1.2 LIN28B 400 LIN28BWt1 LIN28BWt1 1.0 LIN28B 1.0 LIN28B 600 ControlControl *" *" ControlControl 200 0.10 350 0.8 0.8
mg mg 400 300 0.6 0.6 mg/dl 100 ul/min 0.05 250 200 0.4 0.4 0.2 0.2 0 200 0 Lin28BWt1 Control Lin28BWt1 Control 0.00 Male0.0 Female Male 0.0 Female P1 P3 P5 P1 P3 P5 D P10 P14 P21 P10 P14 P21 E18.5 E18.5 66 ALB 1006 ALBALT 10006 AMYALB 0.356 TBILALB 80 800 0.30 44 4 4 4 60 600 U/L U/L 0.25 G/DL G/DL G/DL G/DL G/DL
40 400 MG/DL 22 2 2 2 20 200 0.20
00 0 0 0.150 LIN28BLIN28BWt1Wt1 ControlControl LIN28BLIN28BWt1 Control LIN28BLIN28BWt1 Control LIN28BLIN28BWt1 Control 60 10 PHOS 6 6 BUNALB 6 ALB 2006 ALBNA+ 15 ALBK+ 8 180 404 4 4 4 6 10
160 G/DL G/DL G/DL G/DL MG/DL MG/DL
4 MMOL/L 202 2 MMOL/L 2 25 2 140
00 00 1200 00 LIN28BLIN28BWt1 Control LIN28BLIN28BWt1 ControlControl LIN28BLIN28BWt1 Control LIN28BLIN28BWt1 Control
3006 ALB 67 ALB 6 ALB GLU TP 2.5 GLOB 6 2.0 2004 4 4 1.5 5 G/DL G/DL G/DL G/DL G/DL MG/DL 1002 2 21.0 4 0.5
00 03 00.0 LIN28BLIN28BWt1 ControlControl LIN28BLIN28BWt1 ControlControl LIN28BLIN28BWt1 Control E
Supplemental Fig.S5. LIN28B transient overexpression enhances renal function.
105 5.06 ALBALB 1506 ALTALB 11006 AMYALB 0.356 TBILALB 1000 4.5 0.30 4 1004 9004 4 U/L 4.0 U/L 800 0.25 G/DL G/DL G/DL G/DL G/DL MG/DL 2 502 7002 2 3.5 0.20 600 3.00 00 5000 0.150 LIN28BWt1 ControlControl LIN28BWt1 ControlControl LIN28BLIN28BWt1 Control LIN28BLIN28BWt1 ControlControl 6 6 6 6 80 BUNALB 10 PHOSALB 200 ALBNA+ 14 ALBK+
60 8 190 12 4 4 4 4 6 180 40 10 G/DL G/DL G/DL G/DL MG/DL MMOL/L MG/DL 2 42 MMOL/L 1702 2 20 8 2 160
0 0 1500 0 6 LIN28B Control LIN28BLIN28BWt1 Control LIN28BLIN28BWt1 ControlControl LIN28BLIN28BWt1 ControlControl LIN28BWt1 Control 3006 GLUALB 5.56 ALBTP 1.56 ALBGLOB
250 4 5.04 1.04 200 G/DL G/DL G/DL G/DL G/DL MG/DL 2 4.52 0.52 150
1000 4.00 0.00 LIN28BLIN28BWt1 ControlControl LIN28BLIN28BWt1 ControlControl LIN28BLIN28BWt1 ControlControl
Figure S3.6, related to Figure 3.3 | LIN28B transient overexpression rescues functional impairment in kidneys with low nephron endowment.
Renal function panel tests for LIN28BWt1 and littermate control animals on low protein diet (9% casein). Albumin (ALB), alanine aminotransferase (ALT), amylase (AMY), total bilirubin (TBIL), urea nitrogen (BUN), phosphorus (PHOS), sodium (Na+), potassium (K+), glucose (GLU), total protein (TP), globulin (GLOB). Data are mean ±
SD. n=6 or 7; each group contains mice from two or three different litters.
106 Creatinine 0.20
0.15
0.10 mg/dl 0.05
0.00 Lin28b KO Control
Figure S3.7, related to Figure 3.4 | Loss of Lin28b leads to impaired kidney development and function.
Serum creatinine levels of Lin28b KO and littermate control animals. Measured in 2-3 m.o. animals. Data are mean ± SD; n = 5 from each sample type; each group contains mice from two different litters.
107 A
1.2 let-7b 1.2 let-7c 1.2 let-7e Let-7 KO Let-7 KO Let-7 KO 1.0 1.0 Let-7 WT Let-7 WT 1.0 Let-7 WT 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0.0 0.0 0.0
Relative RNA expression Relative RNA P2 P5 P2 P5 NB P2 P5 NB P10 NB P10 P10 B
4.5 ALB 60 ALT 1500 AMY 0.45 TBIL
0.40 4.0 40 1000
U/L 0.35 U/L G/DL MG/DL 3.5 20 500 0.30
3.0 0 0 0.25 Let-7 KO Let-7 WT Let-7 KO Let-7 WT Let-7 KO Let-7 WT Let-7 KO Let-7 WT
40 BUN 8 PHOS 180 NA+ 10 K+ 7 175 30 9 6 170 20 8 MG/DL MG/DL MMOL/L 5 165 MMOL/L 10 7 4 160
0 3 155 6 Let-7 KO Let-7 WT Let-7 KO Let-7 WT Let-7 KO Let-7 WT Let-7 KO Let-7 WT
300 GLU 5.5 TP 2.0 GLOB
1.5 200 5.0 1.0 G/DL G/DL MG/DL 100 4.5 0.5
0 4.0 0.0 Let-7 KO Let-7 WT Let-7 KO Let-7 WT Let-7 KO Let-7 WT
Supplemental Fig.S8. Let-7 KO phenocopies effects of LIN28B OE.
Figure S3.8, related to Figure 3.5 | Let-7 KO phenocopies effects of LIN28B OE.
(A) Relative qRT–PCR analysis measuring the levels of mature let-7b,-c,-e in let-7 KO mice and WT littermates at the indicated developmental time points. Data are mean ±
SD; n = 2-4 from each genotype. (B) Renal function panel of the let-7 KO and WT littermates. Albumin (ALB), alanine aminotransferase (ALT), amylase (AMY), total bilirubin (TBIL), urea nitrogen (BUN), phosphorus (PHOS), sodium (Na+), potassium
(K+), glucose (GLU), total protein (TP), globulin (GLOB). Data are mean ± SD; n = 6-9 from each genotype; each group contains mice from two different litters.
108 Figure S3.9, related to Figure 3.6 | Application of antagomirs against let-7 miRNA in in vivo
(A) Representative images of different organs 24 hrs post intrauterine-intraperitoneal
injections with Cy5-labeled cocktail of antagomirs (Anti-miR) or miRNA mimic negative control (Control) taken in bright field (BF) or Cy5 channels. (B) Relative qRT–PCR analysis measuring Hmga2, Six2, and Eya1 mRNA levels in embryonic kidneys 24 hrs post intrauterine-intraperitoneal injections with antagomirs. n=3 for each group.
109 A Kidney Lung Anti-miR Control Anti-miR Control BF BF Cy5 Cy5
Liver Heart Anti-miR Control Anti-miR Control BF BF Cy5 Cy5
Intestine Brain Anti-miR Control Anti-miR Control BF BF Cy5 Cy5
B In vivo
1.2 Anti-miR 1.0 Control 0.8 0.6 0.4 0.2 0.0 Relative mRNA expression Relative mRNA Hmga2 Six2 Eya1
110 REFERENCES 1. Ambros, V. and H.R. Horvitz, Heterochronic mutants of the nematode Caenorhabditis elegans. Science, 1984. 226(4673): p. 409-16.
2. Moss, E.G., R.C. Lee, and V. Ambros, The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell, 1997. 88(5): p. 637-46.
3. Yang, D.H. and E.G. Moss, Temporally regulated expression of Lin-28 in diverse tissues of the developing mouse. Gene Expr Patterns, 2003. 3(6): p. 719-26.
4. Yokoyama, S., et al., Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken. Gene Expr Patterns, 2008. 8(3): p. 155-60.
5. Heo, I., et al., Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. Mol Cell, 2008. 32(2): p. 276-84.
6. Newman, M.A., J.M. Thomson, and S.M. Hammond, Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. RNA, 2008. 14(8): p. 1539-49.
7. Viswanathan, S.R., G.Q. Daley, and R.I. Gregory, Selective blockade of microRNA processing by Lin28. Science, 2008. 320(5872): p. 97-100.
8. Polesskaya, A., et al., Lin-28 binds IGF-2 mRNA and participates in skeletal myogenesis by increasing translation efficiency. Genes Dev, 2007. 21(9): p. 1125- 38.
9. Xu, B. and Y. Huang, Histone H2a mRNA interacts with Lin28 and contains a Lin28-dependent posttranscriptional regulatory element. Nucleic Acids Res, 2009. 37(13): p. 4256-63.
10. Qiu, C., et al., Lin28-mediated post-transcriptional regulation of Oct4 expression in human embryonic stem cells. Nucleic Acids Res, 2010. 38(4): p. 1240-8.
11. Peng, S., et al., Genome-wide studies reveal that Lin28 enhances the translation of genes important for growth and survival of human embryonic stem cells. Stem Cells, 2011. 29(3): p. 496-504.
12. Wilbert, M.L., et al., LIN28 binds messenger RNAs at GGAGA motifs and regulates splicing factor abundance. Mol Cell, 2012. 48(2): p. 195-206.
13. Shyh-Chang, N. and G.Q. Daley, Lin28: primal regulator of growth and metabolism in stem cells. Cell Stem Cell, 2013. 12(4): p. 395-406.
111 14. Viswanathan, S.R., et al., Lin28 promotes transformation and is associated with advanced human malignancies. Nat Genet, 2009. 41(7): p. 843-8.
15. Moss, E.G. and L. Tang, Conservation of the heterochronic regulator Lin-28, its developmental expression and microRNA complementary sites. Dev Biol, 2003. 258(2): p. 432-42.
16. Lee, S.H., et al., The ubiquitin ligase human TRIM71 regulates let-7 microRNA biogenesis via modulation of Lin28B protein. Biochim Biophys Acta, 2014. 1839(5): p. 374-86.
17. Piskounova, E., et al., Determinants of microRNA processing inhibition by the developmentally regulated RNA-binding protein Lin28. J Biol Chem, 2008. 283(31): p. 21310-4.
18. Balzer, E. and E.G. Moss, Localization of the developmental timing regulator Lin28 to mRNP complexes, P-bodies and stress granules. RNA Biol, 2007. 4(1): p. 16-25.
19. Piskounova, E., et al., Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell, 2011. 147(5): p. 1066-79.
20. Tsialikas, J. and J. Romer-Seibert, LIN28: roles and regulation in development and beyond. Development, 2015. 142(14): p. 2397-404.
21. Abbott, A.L., et al., The let-7 MicroRNA family members mir-48, mir-84, and mir- 241 function together to regulate developmental timing in Caenorhabditis elegans. Dev Cell, 2005. 9(3): p. 403-14.
22. Morita, K. and M. Han, Multiple mechanisms are involved in regulating the expression of the developmental timing regulator lin-28 in Caenorhabditis elegans. EMBO J, 2006. 25(24): p. 5794-804.
23. Yu, J., et al., Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p. 1917-20.
24. Rybak, A., et al., A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nat Cell Biol, 2008. 10(8): p. 987-93.
25. Lehrbach, N.J., et al., LIN-28 and the poly(U) polymerase PUP-2 regulate let-7 microRNA processing in Caenorhabditis elegans. Nat Struct Mol Biol, 2009. 16(10): p. 1016-20.
26. Siomi, H. and M.C. Siomi, Posttranscriptional regulation of microRNA biogenesis in animals. Mol Cell, 2010. 38(3): p. 323-32.
112 27. Hagan, J.P., E. Piskounova, and R.I. Gregory, Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells. Nat Struct Mol Biol, 2009. 16(10): p. 1021-5.
28. Heo, I., et al., TUT4 in concert with Lin28 suppresses microRNA biogenesis through pre-microRNA uridylation. Cell, 2009. 138(4): p. 696-708.
29. Thornton, J.E., et al., Lin28-mediated control of let-7 microRNA expression by alternative TUTases Zcchc11 (TUT4) and Zcchc6 (TUT7). RNA, 2012. 18(10): p. 1875-85.
30. Heo, I., et al., Mono-uridylation of pre-microRNA as a key step in the biogenesis of group II let-7 microRNAs. Cell, 2012. 151(3): p. 521-32.
31. Chang, H.M., et al., A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway. Nature, 2013. 497(7448): p. 244-8.
32. Guo, Y., et al., Identification and characterization of lin-28 homolog B (LIN28B) in human hepatocellular carcinoma. Gene, 2006. 384: p. 51-61.
33. Vogt, E.J., et al., Importance of the pluripotency factor LIN28 in the mammalian nucleolus during early embryonic development. Development, 2012. 139(24): p. 4514-23.
34. Viswanathan, S.R. and G.Q. Daley, Lin28: A microRNA regulator with a macro role. Cell, 2010. 140(4): p. 445-9.
35. Jin, J., et al., Evidence that Lin28 stimulates translation by recruiting RNA helicase A to polysomes. Nucleic Acids Res, 2011. 39(9): p. 3724-34.
36. Robinton, D.A., Lin28a/b in the regulation of developmental timing and tumorigenesis, 2016, Harvard University.: Harvard University's DASH p. 183.
37. Shinoda, G., et al., Fetal deficiency of lin28 programs life-long aberrations in growth and glucose metabolism. Stem Cells, 2013. 31(8): p. 1563-73.
38. Sangiao-Alvarellos, S., et al., Changes in hypothalamic expression of the Lin28/let-7 system and related microRNAs during postnatal maturation and after experimental manipulations of puberty. Endocrinology, 2013. 154(2): p. 942-55.
39. Barbaux, S., et al., A genome-wide approach reveals novel imprinted genes expressed in the human placenta. Epigenetics, 2012. 7(9): p. 1079-90.
40. West, J.A., et al., A role for Lin28 in primordial germ-cell development and germ- cell malignancy. Nature, 2009. 460(7257): p. 909-13.
113 41. Cao, D., et al., RNA-binding protein LIN28 is a marker for primary extragonadal germ cell tumors: an immunohistochemical study of 131 cases. Mod Pathol, 2011. 24(2): p. 288-96.
42. Cao, D., et al., RNA-binding protein LIN28 is a marker for testicular germ cell tumors. Hum Pathol, 2011. 42(5): p. 710-8.
43. Gillis, A.J., et al., Expression and interdependencies of pluripotency factors LIN28, OCT3/4, NANOG and SOX2 in human testicular germ cells and tumours of the testis. Int J Androl, 2011. 34(4 Pt 2): p. e160-74.
44. Xue, D., et al., RNA-binding protein LIN28 is a sensitive marker of ovarian primitive germ cell tumours. Histopathology, 2011. 59(3): p. 452-9.
45. Balzer, E., et al., LIN28 alters cell fate succession and acts independently of the let-7 microRNA during neurogliogenesis in vitro. Development, 2010. 137(6): p. 891-900.
46. Wulczyn, F.G., et al., Post-transcriptional regulation of the let-7 microRNA during neural cell specification. FASEB J, 2007. 21(2): p. 415-26.
47. Molenaar, J.J., et al., LIN28B induces neuroblastoma and enhances MYCN levels via let-7 suppression. Nat Genet, 2012. 44(11): p. 1199-206.
48. Yuan, J., et al., Lin28b reprograms adult bone marrow hematopoietic progenitors to mediate fetal-like lymphopoiesis. Science, 2012. 335(6073): p. 1195-200.
49. Beachy, S.H., et al., Enforced expression of Lin28b leads to impaired T-cell development, release of inflammatory cytokines, and peripheral T-cell lymphoma. Blood, 2012. 120(5): p. 1048-59.
50. Rao, S., et al., Inactivation of ribosomal protein L22 promotes transformation by induction of the stemness factor, Lin28B. Blood, 2012. 120(18): p. 3764-73.
51. King, C.E., et al., LIN28B promotes colon cancer progression and metastasis. Cancer Res, 2011. 71(12): p. 4260-8.
52. Zhang, W.C., et al., Glycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesis. Cell, 2012. 148(1-2): p. 259-72.
53. Tu, H.C., et al., LIN28 cooperates with WNT signaling to drive invasive intestinal and colorectal adenocarcinoma in mice and humans. Genes Dev, 2015. 29(10): p. 1074-86.
54. Urbach, A., et al., Lin28 sustains early renal progenitors and induces Wilms tumor. Genes Dev, 2014. 28(9): p. 971-82.
114 55. Nguyen, L.H., et al., Lin28b is sufficient to drive liver cancer and necessary for its maintenance in murine models. Cancer Cell, 2014. 26(2): p. 248-61.
56. Bussing, I., F.J. Slack, and H. Grosshans, let-7 microRNAs in development, stem cells and cancer. Trends Mol Med, 2008. 14(9): p. 400-9.
57. Urbach, A., et al., Lin28 sustains early renal progenitors and induces Wilms tumor. Genes & development, 2014. 28(9): p. 971-82.
58. Rivera, M. and D. Haber, Wilms' tumour: connecting tumorigenesis and organ development in the kidney. Nature reviews. Cancer, 2005. 5(9): p. 699-1411.
59. Knudson, A.G., Jr. and L.C. Strong, Mutation and cancer: a model for Wilms' tumor of the kidney. J Natl Cancer Inst, 1972. 48(2): p. 313-24.
60. Huff, V., Wilms' tumours: about tumour suppressor genes, an oncogene and a chameleon gene. Nature reviews. Cancer, 2011. 11(2): p. 111-132.
61. Wegert, J., et al., Mutations in the SIX1/2 Pathway and the DROSHA/DGCR8 miRNA Microprocessor Complex Underlie High-Risk Blastemal Type Wilms Tumors. Cancer Cell, 2015. 27(2): p. 298-311.
62. Rivera, M.N. and D.A. Haber, Wilms' tumour: connecting tumorigenesis and organ development in the kidney. Nat Rev Cancer, 2005. 5(9): p. 699-712.
63. Little, M.H. and A.P. McMahon, Mammalian kidney development: principles, progress, and projections. Cold Spring Harb Perspect Biol, 2012. 4(5).
64. Grobstein, C., Inductive interaction in the development of the mouse metanephros. Journal of Experimental Zoology, 1955. 130(2): p. 319-339.
65. Grobstein, C., Trans-filter induction of tubules in mouse metanephrogenic mesenchyme. Exp Cell Res, 1956. 10(2): p. 424-40.
66. Hatini, V., et al., Essential role of stromal mesenchyme in kidney morphogenesis revealed by targeted disruption of Winged Helix transcription factor BF-2. Genes Dev, 1996. 10(12): p. 1467-78.
67. Davidson, A.J., Mouse kidney development. StemBook, ed. The Stem Cell Research Community, StemBook, , 2009.
68. Pleniceanu, O., O. Harari-Steinberg, and B. Dekel, Concise review: Kidney stem/progenitor cells: differentiate, sort out, or reprogram? Stem cells (Dayton, Ohio), 2010. 28(9): p. 1649-1709.
115 69. Kobayashi, A., et al., Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development. Cell stem cell, 2008. 3(2): p. 169-250.
70. Hartman, H.A., H.L. Lai, and L.T. Patterson, Cessation of renal morphogenesis in mice. Dev Biol, 2007. 310(2): p. 379-87.
71. Hinchliffe, S.A., et al., Human intrauterine renal growth expressed in absolute number of glomeruli assessed by the disector method and Cavalieri principle. Lab Invest, 1991. 64(6): p. 777-84.
72. Hughson, M., et al., Glomerular number and size in autopsy kidneys: the relationship to birth weight. Kidney Int, 2003. 63(6): p. 2113-22.
73. Humphreys, B.D., et al., Repair of injured proximal tubule does not involve specialized progenitors. Proc Natl Acad Sci U S A, 2011. 108(22): p. 9226-31.
74. Keller, G., et al., Nephron number in patients with primary hypertension. N Engl J Med, 2003. 348(2): p. 101-8.
75. Hoy, W.E., et al., Nephron number, hypertension, renal disease, and renal failure. J Am Soc Nephrol, 2005. 16(9): p. 2557-64.
76. Abitbol, C.L., et al., Obesity and preterm birth: additive risks in the progression of kidney disease in children. Pediatr Nephrol, 2009. 24(7): p. 1363-70.
77. Shyh-Chang, N. and G. Daley, Lin28: primal regulator of growth and metabolism in stem cells. Cell stem cell, 2013. 12(4): p. 395-406.
78. Oosterhuis, J.W. and L.H. Looijenga, Testicular germ-cell tumours in a broader perspective. Nat Rev Cancer, 2005. 5(3): p. 210-22.
79. Diskin, S., et al., Common variation at 6q16 within HACE1 and LIN28B influences susceptibility to neuroblastoma. Nat Genet, 2012.
80. Maris, J.M., Recent advances in neuroblastoma. N Engl J Med, 2010. 362(23): p. 2202-11.
81. Molenaar, J., et al., LIN28B induces neuroblastoma and enhances MYCN levels via let-7 suppression. Nat Genet, 2012.
82. Shinoda, G., et al., Lin28a regulates germ cell pool size and fertility. Stem Cells, 2013. 31(5): p. 1001-9.
116 83. Murray, M.J., et al., LIN28 Expression in malignant germ cell tumors downregulates let-7 and increases oncogene levels. Cancer Res, 2013. 73(15): p. 4872-84.
84. Gallardo, T., et al., Generation of a germ cell-specific mouse transgenic Cre line, Vasa-Cre. Genesis, 2007. 45(6): p. 413-7.
85. Zhu, H., et al., Lin28a transgenic mice manifest size and puberty phenotypes identified in human genetic association studies. Nat Genet, 2010. 42(7): p. 626- 30.
86. Zhou, B., et al., Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature, 2008. 454(7200): p. 109-13.
87. Rumballe, B., et al., Nephron formation adopts a novel spatial topology at cessation of nephrogenesis. Developmental biology, 2011.
88. Humphreys, B.D., et al., Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. Am J Pathol, 2010. 176(1): p. 85-97.
89. Shao, X., S. Somlo, and P. Igarashi, Epithelial-specific Cre/lox recombination in the developing kidney and genitourinary tract. J Am Soc Nephrol, 2002. 13(7): p. 1837-46.
90. Zhu, H., et al., The Lin28/let-7 axis regulates glucose metabolism. Cell, 2011. 147(1): p. 81-94.
91. Pode-Shakked, N., et al., The isolation and characterization of renal cancer initiating cells from human Wilms' tumour xenografts unveils new therapeutic targets. EMBO Mol Med, 2013. 5(1): p. 18-37.
92. Messahel, B., et al., Clinical features of molecular pathology of solid tumours in childhood. Lancet Oncol, 2005. 6(6): p. 421-30.
93. Maris, J.M. and C.T. Denny, Focus on embryonal malignancies. Cancer Cell, 2002. 2(6): p. 447-50.
94. Scotting, P., D. Walker, and G. Perilongo, Childhood solid tumours: a developmental disorder. Nature reviews. Cancer, 2005. 5(6): p. 481-488.
95. Hu, Q., et al., Wt1 ablation and Igf2 upregulation in mice result in Wilms tumors with elevated ERK1/2 phosphorylation. The Journal of clinical investigation, 2011. 121(1): p. 174-257.
96. Sampson, V.B., et al., MicroRNA let-7a down-regulates MYC and reverts MYC- induced growth in Burkitt lymphoma cells. Cancer Res, 2007. 67(20): p. 9762-70.
117 97. Johnson, S.M., et al., RAS is regulated by the let-7 microRNA family. Cell, 2005. 120(5): p. 635-47.
98. Lee, Y.S. and A. Dutta, The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev, 2007. 21(9): p. 1025-30.
99. Mayr, C., M.T. Hemann, and D.P. Bartel, Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science, 2007. 315(5818): p. 1576-9.
100. Chang, H.M., et al., Trim71 cooperates with microRNAs to repress Cdkn1a expression and promote embryonic stem cell proliferation. Nat Commun, 2012. 3: p. 923.
101. Legesse-Miller, A., et al., let-7 Overexpression leads to an increased fraction of cells in G2/M, direct down-regulation of Cdc34, and stabilization of Wee1 kinase in primary fibroblasts. J Biol Chem, 2009. 284(11): p. 6605-9.
102. Shyh-Chang, N., et al., Lin28 enhances tissue repair by reprogramming cellular metabolism. Cell, 2013. 155(4): p. 778-92.
103. Hu, Q., et al., Wt1 ablation and Igf2 upregulation in mice result in Wilms tumors with elevated ERK1/2 phosphorylation. J Clin Invest, 2011. 121(1): p. 174-83.
104. Turnbull, C., et al., A genome-wide association study identifies susceptibility loci for Wilms tumor. Nat Genet, 2012. 44(6): p. 681-4.
105. Vujanic, G.M., et al., Revised International Society of Paediatric Oncology (SIOP) working classification of renal tumors of childhood. Med Pediatr Oncol, 2002. 38(2): p. 79-82.
106. Slade, I., et al., Constitutional translocation breakpoint mapping by genome-wide paired-end sequencing identifies HACE1 as a putative Wilms tumour susceptibility gene. J Med Genet, 2010. 47(5): p. 342-7.
107. Aiden, A.P., et al., Wilms tumor chromatin profiles highlight stem cell properties and a renal developmental network. Cell Stem Cell, 2010. 6(6): p. 591-602.
108. Merritt, W.M., et al., Dicer, Drosha, and outcomes in patients with ovarian cancer. N Engl J Med, 2008. 359(25): p. 2641-50.
109. Bahubeshi, A., M. Tischkowitz, and W.D. Foulkes, miRNA processing and human cancer: DICER1 cuts the mustard. Sci Transl Med, 2011. 3(111): p. 111ps46.
110. Zhu, H., et al., The Lin28/let-7 axis regulates glucose metabolism. Cell, 2011. 147(1): p. 81-94.
118 111. Armstrong, J.F., et al., The expression of the Wilms' tumour gene, WT1, in the developing mammalian embryo. Mech Dev, 1993. 40(1-2): p. 85-97.
112. Hoppe, C.C., et al., Effects of dietary protein restriction on nephron number in the mouse. Am J Physiol Regul Integr Comp Physiol, 2007. 292(5): p. R1768-74.
113. Boubred, F., et al., The magnitude of nephron number reduction mediates intrauterine growth-restriction-induced long term chronic renal disease in the rat. A comparative study in two experimental models. J Transl Med, 2016. 14(1): p. 331.
114. Combes, A.N., et al., An integrated pipeline for the multidimensional analysis of branching morphogenesis. Nat Protoc, 2014. 9(12): p. 2859-79.
115. Short, K.M., et al., Global quantification of tissue dynamics in the developing mouse kidney. Dev Cell, 2014. 29(2): p. 188-202.
116. Self, M., et al., Six2 is required for suppression of nephrogenesis and progenitor renewal in the developing kidney. EMBO J, 2006. 25(21): p. 5214-28.
117. Fogelgren, B., et al., Deficiency in Six2 during prenatal development is associated with reduced nephron number, chronic renal failure, and hypertension in Br/+ adult mice. Am J Physiol Renal Physiol, 2009. 296(5): p. F1166-78.
118. Thornton, J.E. and R.I. Gregory, How does Lin28 let-7 control development and disease? Trends Cell Biol, 2012. 22(9): p. 474-82.
119. Rowe, R.G., et al., Developmental regulation of myeloerythroid progenitor function by the Lin28b-let-7-Hmga2 axis. J Exp Med, 2016. 213(8): p. 1497-512. 120. Krutzfeldt, J., et al., Silencing of microRNAs in vivo with 'antagomirs'. Nature, 2005. 438(7068): p. 685-9.
121. Barak, H. and S.C. Boyle, Organ culture and immunostaining of mouse embryonic kidneys. Cold Spring Harb Protoc, 2011. 2011(1): p. pdb prot5558.
122. Hendry, C., et al., Defining and redefining the nephron progenitor population. Pediatr Nephrol, 2011. 26(9): p. 1395-406.
123. Kaminski, M.M., et al., Direct reprogramming of fibroblasts into renal tubular epithelial cells by defined transcription factors. Nat Cell Biol, 2016. 18(12): p. 1269-1280.
124. Hendry, C.E., et al., Direct transcriptional reprogramming of adult cells to embryonic nephron progenitors. J Am Soc Nephrol, 2013. 24(9): p. 1424-34.
119 125. Lam, A.Q., et al., Rapid and efficient differentiation of human pluripotent stem cells into intermediate mesoderm that forms tubules expressing kidney proximal tubular markers. J Am Soc Nephrol, 2014. 25(6): p. 1211-25.
126. Taguchi, A., et al., Redefining the in vivo origin of metanephric nephron progenitors enables generation of complex kidney structures from pluripotent stem cells. Cell Stem Cell, 2014. 14(1): p. 53-67.
127. Takasato, M., et al., Kidney organoids from human iPS cells contain multiple lineages and model human nephrogenesis. Nature, 2015. 526(7574): p. 564-8.
128. Zhou, W. and C.R. Freed, Adenoviral gene delivery can reprogram human fibroblasts to induced pluripotent stem cells. Stem cells, 2009. 27(11): p. 2667-74.
129. Rieg, T., A High-throughput method for measurement of glomerular filtration rate in conscious mice. J Vis Exp, 2013(75): p. e50330.
130. Gadd, S., et al., Clinically relevant subsets identified by gene expression patterns support a revised ontogenic model of Wilms tumor: a Children's Oncology Group Study. Neoplasia, 2012. 14(8): p. 742-56.
131. Kim, S. and D.H. Chung, Pediatric solid malignancies: neuroblastoma and Wilms' tumor. Surg Clin North Am, 2006. 86(2): p. 469-87, xi.
132. Perotti, D., et al., Is Wilms tumor a candidate neoplasia for treatment with WNT/beta-catenin pathway modulators?--A report from the renal tumors biology- driven drug development workshop. Mol Cancer Ther, 2013. 12(12): p. 2619-27.
133. Berger, A.H., A.G. Knudson, and P.P. Pandolfi, A continuum model for tumour suppression. Nature, 2011. 476(7359): p. 163-9.
134. Hohenstein, P., K. Pritchard-Jones, and J. Charlton, The yin and yang of kidney development and Wilms' tumors. Genes Dev, 2015. 29(5): p. 467-82.
135. Pritchard-Jones, K., et al., The candidate Wilms' tumour gene is involved in genitourinary development. Nature, 1990. 346(6280): p. 194-7.
136. Park, S., et al., Inactivation of WT1 in nephrogenic rests, genetic precursors to Wilms' tumour. Nat Genet, 1993. 5(4): p. 363-7.
137. Essafi, A., et al., A wt1-controlled chromatin switching mechanism underpins tissue-specific wnt4 activation and repression. Dev Cell, 2011. 21(3): p. 559-74.
138. Maiti, S., et al., Frequent association of beta-catenin and WT1 mutations in Wilms tumors. Cancer Res, 2000. 60(22): p. 6288-92.
120 139. Koesters, R., et al., Mutational activation of the beta-catenin proto-oncogene is a common event in the development of Wilms' tumors. Cancer Res, 1999. 59(16): p. 3880-2.
140. Rivera, M.N., et al., An X chromosome gene, WTX, is commonly inactivated in Wilms tumor. Science, 2007. 315(5812): p. 642-5.
141. Ruteshouser, E.C., S.M. Robinson, and V. Huff, Wilms tumor genetics: mutations in WT1, WTX, and CTNNB1 account for only about one-third of tumors. Genes Chromosomes Cancer, 2008. 47(6): p. 461-70.
142. Rivera, M.N., et al., The tumor suppressor WTX shuttles to the nucleus and modulates WT1 activity. Proc Natl Acad Sci U S A, 2009. 106(20): p. 8338-43.
143. Major, M.B., et al., Wilms tumor suppressor WTX negatively regulates WNT/beta- catenin signaling. Science, 2007. 316(5827): p. 1043-6.
144. Fukuzawa, R., et al., Sequential WT1 and CTNNB1 mutations and alterations of beta-catenin localisation in intralobar nephrogenic rests and associated Wilms tumours: two case studies. J Clin Pathol, 2007. 60(9): p. 1013-6.
145. Uschkereit, C., et al., Different CTNNB1 mutations as molecular genetic proof for the independent origin of four Wilms tumours in a patient with a novel germ line WT1 mutation. J Med Genet, 2007. 44(6): p. 393-6.
146. Jenkins, Z.A., et al., Germline mutations in WTX cause a sclerosing skeletal dysplasia but do not predispose to tumorigenesis. Nat Genet, 2009. 41(1): p. 95- 100.
147. Nisen, P.D., et al., Enhanced expression of the N-myc gene in Wilms' tumors. Cancer Res, 1986. 46(12 Pt 1): p. 6217-22.
148. Norris, M.D., et al., N-myc amplification in Wilms' tumor. Cancer Genet Cytogenet, 1988. 30(1): p. 187-9.
149. Williams, R.D., et al., Subtype-specific FBXW7 mutation and MYCN copy number gain in Wilms' tumor. Clin Cancer Res, 2010. 16(7): p. 2036-45.
150. Bardeesy, N., et al., Anaplastic Wilms' tumour, a subtype displaying poor prognosis, harbours p53 gene mutations. Nat Genet, 1994. 7(1): p. 91-7.
151. Williams, R.D., et al., Molecular profiling reveals frequent gain of MYCN and anaplasia-specific loss of 4q and 14q in Wilms tumor. Genes Chromosomes Cancer, 2011. 50(12): p. 982-95.
121 152. Maschietto, M., et al., TP53 mutational status is a potential marker for risk stratification in Wilms tumour with diffuse anaplasia. PLoS One, 2014. 9(10): p. e109924.
153. Kim, W.J., et al., The WTX tumor suppressor enhances p53 acetylation by CBP/p300. Mol Cell, 2012. 45(5): p. 587-97.
154. Zhang, X., G. Xing, and G.F. Saunders, Proto-oncogene N-myc promoter is down regulated by the Wilms' tumor suppressor gene WT1. Anticancer Res, 1999. 19(3A): p. 1641-8.
155. Udtha, M., et al., Upregulation of c-MYC in WT1-mutant tumors: assessment of WT1 putative transcriptional targets using cDNA microarray expression profiling of genetically defined Wilms' tumors. Oncogene, 2003. 22(24): p. 3821-6.
156. Saifudeen, Z., et al., p53 regulates metanephric development. J Am Soc Nephrol, 2009. 20(11): p. 2328-37.
157. Saifudeen, Z., et al., A p53-Pax2 pathway in kidney development: implications for nephrogenesis. PLoS One, 2012. 7(9): p. e44869.
158. Charron, J., et al., Embryonic lethality in mice homozygous for a targeted disruption of the N-myc gene. Genes Dev, 1992. 6(12A): p. 2248-57.
159. Ogawa, O., et al., Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour. Nature, 1993. 362(6422): p. 749-51.
160. Steenman, M.J., et al., Loss of imprinting of IGF2 is linked to reduced expression and abnormal methylation of H19 in Wilms' tumour. Nat Genet, 1994. 7(3): p. 433-9.
161. Chang, T.C., et al., Lin-28B transactivation is necessary for Myc-mediated let-7 repression and proliferation. Proc Natl Acad Sci U S A, 2009. 106(9): p. 3384-9.
162. Dangi-Garimella, S., et al., Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J, 2009. 28(4): p. 347-58.
163. Iliopoulos, D., H.A. Hirsch, and K. Struhl, An epigenetic switch involving NF- kappaB, Lin28, Let-7 MicroRNA, and IL6 links inflammation to cell transformation. Cell, 2009. 139(4): p. 693-706.
164. Torrezan, G.T., et al., Recurrent somatic mutation in DROSHA induces microRNA profile changes in Wilms tumour. Nat Commun, 2014. 5: p. 4039.
165. Astuti, D., et al., Germline mutations in DIS3L2 cause the Perlman syndrome of overgrowth and Wilms tumor susceptibility. Nat Genet, 2012. 44(3): p. 277-84.
122 166. Hafner, M., et al., Identification of mRNAs bound and regulated by human LIN28 proteins and molecular requirements for RNA recognition. RNA, 2013. 19(5): p. 613-26.
167. Yang, X., et al., Double-negative feedback loop between reprogramming factor LIN28 and microRNA let-7 regulates aldehyde dehydrogenase 1-positive cancer stem cells. Cancer Res, 2010. 70(22): p. 9463-72.
168. Shukrun, R., et al., Wilms' tumor blastemal stem cells dedifferentiate to propagate the tumor bulk. Stem Cell Reports, 2014. 3(1): p. 24-33.
169. Ohnishi, K., et al., Premature termination of reprogramming in vivo leads to cancer development through altered epigenetic regulation. Cell, 2014. 156(4): p. 663-77.
170. Abad, M., et al., Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature, 2013. 502(7471): p. 340-5.
171. Takasato, M., et al., Directing human embryonic stem cell differentiation towards a renal lineage generates a self-organizing kidney. Nat Cell Biol, 2014. 16(1): p. 118-26.
172. Yokoo, T., A. Fukui, and E. Kobayashi, Application of regenerative medicine for kidney diseases. Organogenesis, 2007. 3(1): p. 34-43.
123