Utah State University DigitalCommons@USU

All Graduate Theses and Dissertations Graduate Studies

5-2016

The Role of GPR84 in Medium-chain Saturated Fatty Acid Taste Transduction

Yan Liu Utah State University

Follow this and additional works at: https://digitalcommons.usu.edu/etd

Part of the Biology Commons

Recommended Citation Liu, Yan, "The Role of GPR84 in Medium-chain Saturated Fatty Acid Taste Transduction" (2016). All Graduate Theses and Dissertations. 4912. https://digitalcommons.usu.edu/etd/4912

This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@USU. It has been accepted for inclusion in All Graduate Theses and Dissertations by an authorized administrator of DigitalCommons@USU. For more information, please contact [email protected]. THE ROLE OF GPR84 IN MEDIUM-CHAIN SATURATED

FATTY ACID TASTE TRANSDUCTION

by

Yan Liu

A dissertation submitted in partial fulfillment of the requirements for the degree

of

DOCTOR OF PHILOSOPHY

in

Biology

Approved:

______Timothy A. Gilbertson, Ph.D. Brett A. Adams, Ph.D. Major Professor Committee Member

______Keith A. Mott, Ph.D. Silvana Martini, Ph.D. Committee Member Committee Member

______Joan M. Hevel, Ph.D. Mark R. McLellan, Ph.D. Committee Member Vice President for Research and Dean of the School of Graduate Studies

UTAH STATE UNIVERSITY Logan, Utah

2016

ii

Copyright © Yan Liu 2016

All Rights Reserved

iii

ABSTRACT

THE ROLE OF GPR84 IN MEDIUM-CHAIN SATURATED

FATTY ACID TASTE TRANSDUCTION

by

Yan Liu, Doctor of Philosophy

Utah State University, 2016

Major Professor: Dr. Timothy A. Gilbertson Department: Biology

Previous research has shown the gustatory recognition of the long-chain

unsaturated fatty acids. In this study, I showed for the first time that medium-chain

saturated fatty acids (MCFAs) are effective taste stimuli at both the cellular and behavioral

levels. The mechanisms of gustatory recognition of MCFAs in mice were also partially

elucidated using pharmaceutical approaches. The inward currents induced by capric acid

in mouse taste cells were significantly inhibited by the antagonists of G-protein signaling,

protein kinase A (PKA), and protein kinase C (PKC), but they were not affected by the

phospholipase C (PLC) and phosphodiesterase (PDE) inhibitors, which suggested that

MCFA taste transduction involves G-protein, PKA, and PKC activation, but does not

involve PLC and PDE. Furthermore, transient receptor potential channel type M5

(TRPM5) knockout mice showed unaffected cellular and behavioral responses, indicating

MCFA taste transduction in mice was TRPM5-independent. The receptor of MCFAs on

taste cells was also investigated in this study. Previous research has shown that GPR84 is iv a novel G protein-coupled receptor (GPCR) activated by MCFAs with 9 to 14 carbons, and the real-time PCR results supported the mRNA expression of GPR84 in mouse taste cells.

Therefore, GPR84 is a good candidate for the MCFA receptor in taste cells. By using a cell line that had an inducible GPR84 + Gqi9 (a chimeric G-protein), ligand specificity experiments showed that the ligands of GPR84 included saturated fatty acids with 6 to 12 carbons and other fatty acids (oleic acid, arachidic acid) previously not known to activate this receptor. Compared to wild type cells, taste cells lacking GPR84 showed significantly lower calcium responses and inward currents to capric acid (C10), and GPR84 knockout mice showed decreased taste sensitivities to both lauric (C12) and capric acids behaviorally, suggesting that GPR84 plays an essential role in MCFA taste transduction process.

(145 pages)

v

PUBLIC ABSTRACT

The Role of GPR84 in Medium-Chain Saturated

Fatty Acid Taste Transduction

Yan Liu

The prevalence of overweight or obese in adults has nearly doubled during the past two decades, and obesity increases the risk of heart disease, diabetes, and even some types of cancer. One of the factors closely linked with the obesity epidemic is overconsumption of dietary fat. Accumulating evidence has supported the existence of the “taste of fat”, and more and more studies have focused on identifying the mechanisms of fatty acid detection by gustatory system. In this study, I showed for the first time that medium-chain saturated fatty acids (MCFAs) were able to activate taste cells isolated from mice, and they could also be tasted by mice behaviorally. These data suggested that MCFAs were effective taste stimuli. The signaling pathways involved in the taste transduction of MCFAs were also studied here. A novel G protein-coupled receptor (GPCR) GPR84 was suggested to be the main receptor of MCFAs in taste cells, because the mice lacking the GPR84 gene had significantly reduced taste responses to MCFAs both cellularly and behaviorally. My study also suggested that downstream of GPR84 signaling involves G-protein, protein kinase A

(PKA), and protein kinase C (PKC) activation, but does not involve phospholipase C (PLC) and phosphodiesterase (PDE). The knowledge on fatty taste may help us reduce fat intake and in turn, prevent obesity in the future.

vi

DEDICATION

To my dear father Deyou Liu, mother Yulan Liu, and husband Xiaoxi Wang for their unconditional love over the years.

vii

ACKNOWLEDGMENTS

Almost six years ago, I arrived the U.S and started my PhD study. For many times,

I thought I was never going to graduate, but I did it and I have so many people to thank.

The first person I want to thank is my major professor Dr. Tim Gilbertson. He is intelligent, knowledgeable, generous, patient, and kind. He gave me countless valuable advices not only in research, but also in career and even life. He has been a mentor and a friend, and his guidance made this journey meaningful and rewarding. I would like to thank

our lab manager Dr. Dane Hansen for teaching me the techniques I needed, helping with

all the trivial matters in lab, and talking to me as a friend when I needed to vent out. In addition, I would like to thank my former lab mate and also my dear friend Dr. Han Xu.

She taught me almost all the techniques I needed to complete my dissertation, and helped solve a lot of tough problems. I also want to thank my committee members, Dr. Brett

Adams, Dr. Keith Mott, Dr. Silvana Martini, and Dr. Joan Hevel for their time and effort on helping me complete my study. And I would like to thank all my lab mates and my friends in Logan for their support in both work and life.

For my whole life, my parents has been giving me a lot of encouragement and they respected my decision all the time. I feel so lucky to be their only daughter. Also, I have a little cute boy to thank, my son, Lex. He exhausted me but at the same time gave me a lot of energy to help me finish my PhD study. I want to thank him for being such a joy in my life.

At last, I would like to thank my husband, Xiaoxi Wang. He is my best friend who has been my cheerleader for the last six years. Without his constant encouragement and viii support, I would not be as happy as I am. Without his willingness to take care of Lex most of the time, it would take me a lot longer to finish my dissertation. I am grateful that he is always on my side and I know I can depend on him no matter how hard life is. ix

CONTENTS

Page

ABSTRACT ...... III

PUBLIC ABSTRACT ...... V

ACKNOWLEDGEMENTS ...... VII

CONTENTS ...... IX

LIST OF TABLES ...... XI

LIST OF FIGURES ...... XII

LIST OF ABBREVIATIONS ...... XIV

CHAPTER I ...... 1 RATIONALE FOR THE PROPOSED RESEARCH...... 1 OVERVIEW OF OBESITY ...... 3 SATURATED FATTY ACIDS AND HEALTH ...... 4 TASTE TRANSDUCTION ...... 5 TASTE OF FAT ...... 9 FATTY ACID TASTE TRANSDUCTION ...... 14 PUTATIVE TRANSDUCTION PATHWAY FOR LONG-CHAIN ...... 21 UNSATURATED FATTY ACIDS IN TASTE CELLS ...... 21 HYPOTHESIZED GPR84-MEDIATED MCFA TASTE TRANSDUCTION PATHWAY ...... 22 REFERENCES ...... 24

CHAPTER II ...... 51 ABSTRACT ...... 51 INTRODUCTION ...... 52 MATERIALS AND METHODS ...... 53 RESULTS ...... 59 DISCUSSION ...... 65 REFERENCES ...... 70

CHAPTER III ...... 84 ABSTRACT ...... 84 INTRODUCTION ...... 85 MATERIALS AND METHODS ...... 86 RESULTS ...... 94 DISCUSSION ...... 97 x

REFERENCES ...... 100

CHAPTER IV ...... 113 ARE MEDIUM-CHAIN FATTY ACIDS EFFECTIVE TASTE STIMULI? ...... 113 IS GPR84 THE RECEPTOR FOR MCFAS? ...... 114 WHAT IS THE DOWNSTREAM TRANSDUCTION PATHWAY FOR MCFAS? ...... 117 REFERENCES ...... ……121

CURRICULUM VITAE ...... 125

xi

LIST OF TABLES

Table Page

3.1 Sequence of PCR primers used to genotype the wild-type and knockout alleles of GPR84...... 103

xii

LIST OF FIGURES

Figure Page

1.1 Prevalence of self-reported obesity among U.S. adults by state and territory .... 45

1.2 Localization of taste papillae on human tongue...... 46

1.3 Ascending gustatory pathway ...... 47

1.4 Schematic representation of a taste bud and four types of taste cells ...... 48

1.5. Putative transduction pathway for long-chain unsaturated fatty acids (LCFAs) in taste cells ...... 49

2.1 Calcium response induced by lauric acid was concentration dependent...... 75

2.2 Taste cell responses induced by capric acid (CA) ...... 76

2.3 Both Type II and Type III taste cells were activated by MCFAs ...... 77

2.4 Wild type mice were able to detect MCFAs ...... 78

2.5 TRPM5 is not essential for MCFAs taste transduction ...... 79

2.6 MCFA taste transduction involves G-protein activation but does not involve PLCß2 ...... 80

2.7 MCFA taste transduction does not involve PDE activation ...... 81

2.8 MCFA taste transduction involves PKA activation...... 82

3.1. Gene targeting strategy to generate GPR84-/- mice ...... 104

3.2 Evaluation of GPR84 knockout mice ...... 105

3.3 GPR84 receptors are expressed in mouse taste cells ...... 106

3.5 Dose-response curves of lauric or capric acid versus calcium responses ...... 109

3.6 The inward currents induced by MCFAs in GPR84-/- taste cells were significantly lower than wild type taste cells ...... 110

3.7 The intracellular calcium rises elicited by MCFAs in GPR84-/- taste cells were significantly lower than wild type taste cells ...... 111 xiii

3.8 GPR84-/- mice showed lower taste sensitivities to MCFAs than wild type mice...... 112

xiv

LIST OF ABBREVIATIONS

5-HT Serotonin

AC Adenylyl cyclase

ATP Adenosine-5'-triphosphate

AUC Area under the curve

BAPTA 1,2-Bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid

BSA Bovine serum albumin

Ca2+ Calcium ions

2+ [Ca ]in Intracellular calcium concentration

CaCl2 Calcium chloride

CALHM1 Calcium homeostasis modulator 1

cAMP Cyclic adenosine monophosphate

CCK Cholecystokinin

CD36 Cluster of differentiation 36 cDNA Complementary deoxyribonucleic acid

CS Conditioned stimulus

CTA Conditioned taste aversion

CT Chorda tympani nerve

DAG Diacylglycerol

DB Denatonium benzoate

DMEM Dulbecco's modified eagle medium

DMSO Dimethyl sulfoxide xv

dNTP 2-deoxynucleotide 5'-triphosphate

DRK Delayed rectifying potassium

EC50 Half maximal effective concentration

EGTA Ethylene glycol tetraacetic acid

ENaC Epithelial sodium channel

ER Endoplasmic reticulum

FAT Fatty acid transporter

FBS Fetal bovine serum

GAD67 Glutamic acid decarboxylase67

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GDP Guanosine-5'-diphosphate

GDP-ß-S Guanosine 5′-[ß-thio]diphosphate trilithium salt

GFP Green fluorescent protein

GL Glossopharyngeal nerve

GLAST Glutamate aspartate transporter

GLP-1 Glucagon-like peptide-1

GPCR G protein-coupled receptor

GPR120 G protein-coupled receptor 120

GPR40 G protein-coupled receptor 40

GPR41 G protein-coupled receptor 41

GPR43 G protein-coupled receptor 43

GPR84 G protein-coupled receptor 84 xvi

GPR84+/+ Wild type

GPR84+/- Heterozygous GPR84 knockout

GPR84+/- GPR84 knockout

GTP Guanosine-5'-triphosphate

HBSS Hank’s buffered salt solution

HCl Hydrogen chloride

HEK293 Human embryonic kidney 293

HEPES 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid

HF High fat

HHP Hanks’ buffered salt solution with HEPES buffer and Na pyruvate

IBMX 3-isobutyl-1-methylxanthine

IP3 Inositol 1,4,5-triphosphate

IP3R3 Inositol 1,4,5-triphosphate receptor type 3

K+ Potassium ions

KCl Potassium chloride

KO Knockout

KOH Potassium hydroxide

LCFA Long-chain unsaturated fatty acids

LiCl Lithium chloride

LPS Lipopolysaccharide

MCFA Medium-chain saturated fatty acid

MgCl2 Magnesium chloride xvii

mRNA Messenger RNA

Na+ Sodium ions

NaCl Sodium chloride

NaOH Sodium hydroxide

NST Nucleus of the solitary tract

NTPDase2 Nucleoside triphosphate diphosphohydrolase 2

O2 Oxygen

PCR Polymerase chain reaction

PDE Phosphodiesterase

PIP2 Phosphatidylinositol 4,5-bisphosphate

PLC Phospholipase C

PLCß2 Phospholipase C ß2 isoform

PKA Protein kinase A

PKC Protein kinase C

PKD2L1 Polycystic kidney disease 2-like 1 protein

PKD1L3 Polycystic kidney disease 1-like 3 protein

PUFA Polyunsaturated fatty acid qPCR Quantitative real-time PCR

RNA Ribonucleic acid

ROMK Renal outer medullary potassium channel

RT-PCR Reverse transcription polymerase chain reaction

S.E.M. Standard error of the mean xviii

SFA Saturated fatty acid

TAE Tris-acetate-ethylenediaminetetraacetic acid

TET Tetracycline

TNFα Tumor necrosis factor alpha

TRC Taste receptor cell

TRP Transient receptor potential

TRPM5 Transient receptor potential melastatin member 5

TRPM5+/+ Wild type

TRPM5-/- TRPM5 knockout

US Unconditioned stimulus

VGCC Voltage-gated calcium channel

WT Wild type

CHAPTER I

INTRODUCTION

Rationale for the Proposed Research

Obesity has become one of the most common health problems worldwide and there

has been a corresponding increase in cardiovascular disease, diabetes, cancer, and other

nutrition-related disorders as a consequence of the obese state. Given that an increase in

dietary fat intake is regarded as one of the factors closely linked with the obesity epidemic

(Bray et al., 2004), it has become increasingly important to identify the mechanisms the

body uses to recognize dietary fat. A review about the detection of fat (Gilbertson, 1998)

stated that, besides the texture of the food, rodents and humans also recognize the presence

of fat in foods by the gustatory mechanisms in the mouth, this suggests that an orosensory

system may be responsible for the detection and preference of fat.

Currently, most of the studies on transduction mechanisms for fat (i.e. fatty acid)

taste have focused on long-chain polyunsaturated fatty acids. Interestingly, in the course of

our work in the laboratory, we have found that a variety of saturated medium-chain fatty

acids (notably, lauric acid) were capable of activating taste cells. There is limited

knowledge concerning the possible transduction mechanisms of medium-chain fatty acids

(MCFAs) in taste cells. Expression data from our laboratory are consistent with taste cells

containing a potential receptor for MCFAs, GPR84. GPR84 is a novel G protein-coupled

receptor (GPCR) activated by MCFAs and is expressed predominantly in hematopoietic

tissues. It has been suggested that GPR84 activation by MCFAs couples primarily to a

pertussis toxin-sensitive Gi/o pathway (Wang et al., 2006). 2

The basic hypothesis that we will test is that taste cells can respond to MCFAs, and GPR84 is the primary receptor for MCFAs in the mammalian taste system. My dissertation research focused on the cellular and behavioral responses to MCFAs in mice, and to determine the role of GPR84 in the detection of medium-chain fatty acid by taste cells, we investigated their expression and function in mouse taste cells and compared the preference to MCFAs in wild-type mice and in mice that lack GPR84 (GPR84 knockout

mice).

3

Overview of Obesity

The worldwide prevalence of obesity has nearly doubled during the past three decades (Finucane et al., 2011). According to the National Health and Nutrition

Examination Survey, in 2011–2014, the rate of obesity was over 36% in adults and 17% in children (Ogden et al., 2015), and more than two-thirds of adults were overweight or obese from 2010 to 2011 (Ogden et al., 2014). According to Centers for Disease Control and

Prevention, all the states had a prevalence of obesity above 20%, and 22 states had a prevalence of obesity over 30% in 2014 (Figure 1.1, (CDC, 2014)). Obesity alone is not a serious disease, however, it can increase the risk of a number of other chronic diseases among adults, including heart disease (Lavie et al., 2009, Logue et al., 2011), diabetes

(Meyer et al., 2011, Sharma and Lau, 2013), high blood pressure (Wang et al., 2010,

Finucane et al., 2011), nonalcoholic fatty liver disease (Tiniakos et al., 2010), osteoarthritis

(Lementowski and Zelicof, 2008), stroke (Kurth et al., 2002), and even some types of cancer, such as breast, colon, endometrial, and kidney cancer (Hursting et al., 2007, Lavie et al., 2009, Crosbie et al., 2010, Nguyen and El-Serag, 2010, McGuire and Fitzpatrick,

2011, Flores et al., 2012, Chan et al., 2014, Kaaks and Kuhn, 2014, Renehan et al., 2015).

Treating obesity and obesity-related diseases is one of the largest costs in the United States.

Currently, an estimate of this cost range from $147 billion to nearly $210 billion per year

(Finkelstein et al., 2009, Cawley and Meyerhoefer, 2012). The fundamental cause of obesity is energy imbalance, and the primary factors that contribute to energy imbalance is excessive food energy intake and inadequate energy expenditure (Keith et al., 2006).

Overconsumption of dietary fat is regarded as one of the factors closely linked with the 4

obesity epidemic (Bray et al., 2004).

Saturated Fatty Acids and Health

Saturated fatty acids (SFAs) are those whose carbon atoms are saturated with hydrogen atoms, and they are very common in the daily food supply. Dairy products, fatty meats, palm oil, and coconut oil are primary sources of saturated fatty acids. In addition, they can also be found in processed foods including sweets and snacks, such as cookies, cakes, pastries, crisps, chocolate, and so on (Funaki, 2009). Overconsumption of saturated

fats poses a greater heath risk than polyunsaturated fats. First, dietary SFAs, such as capric acid, lauric acid, and myristic acid, are capable of causing insulin resistance and inflammatory responses in white adipose tissue (Funaki, 2009, van Dijk et al., 2009), which are closely related to obesity (Pereira-Lancha et al., 2012). Overloading of saturated fat in adipocytes can induce degradation of insulin receptor substrate-1 (Gao et al., 2004), increase reactive oxygen species production (Lin et al., 2005), and activate Toll-like receptor 4 (Song et al., 2006, Wang et al., 2012), all of which are able to impair insulin sensitivity and stimulate adipose tissues to secrete proinflammatory factors. Saturated fat was also able to stimulate more weight gain and hepatic lipid accumulation than unsaturated fat (de Wit et al., 2012). Genetically, several studies showed that SFA intake might also increase the obesity-associated genetic risk in adults (Corella et al., 2011,

Phillips et al., 2012, Casas-Agustench et al., 2014). In addition, the processes of obesity-

related disease were also influenced by saturated fatty acid intake, such as non-alcoholic

fatty liver disease, which could be attenuated by replacing dietary saturated fats with 5 polyunsaturated fats (Enos et al., 2014, Morrison et al., 2015). Besides obesity, human epidemiological studies showed that higher saturated fat intake led to an increased risk of sudden cardiac death (Jouven et al., 2001, Chiuve et al., 2012). Consumption of high levels of SFAs can also increase total cholesterol concentrations as well as low-density lipoprotein cholesterol levels (Grundy and Denke, 1990), which in turn may contribute to cardiovascular disease (Lloyd-Jones et al., 2010). Some previous studies indicated that a switch from SFAs to polyunsaturated fatty acids significantly decreased the risk of cardiovascular disease (Leren, 1970, Turpenien et al., 1979, Siri-Tarino et al., 2010,

Morrison et al., 2015). Therefore, reducing the consumption of saturated fatty acids to a level as low as possible is a European Public Health recommendation to reduce the risk of cardiovascular disease. Taken together, overconsumption of SFA poses a threat to health, and understanding the mechanisms of SFA detection in the oral cavity can help us identify potential strategies to reduce SFA intake, such us designing fat substitutes, and, in turn, help create a healthier diet.

Taste Transduction

How exactly are different taste substances being recognized? To understand these mechanisms, we must first understand a very important mediator – the taste bud. Taste buds are clusters of 50 ~ 100 taste cells distributed throughout the oral cavity. They are onion-shaped structures and primarily located in the three taste papillae on the surface of mammalian tongues, fungiform, foliate, and circumvallate (Figure 1.2, (Calvo and Egan,

2015)). The apical side of the taste buds is exposed to saliva and the basal side is innervated 6

with afferent neuron fibers including chorda tympani (CT) and glossopharyngeal (GL)

nerves (cranial nerves VII and IX, respectively, Figure 1.3, (Purves et al., 2001)). The taste

information is finally delivered to the gustatory cortex through gustatory nucleus of the

solitary tract complex (2001). Based on their respective functions and gene expression profiles, taste cells are normally classified into three cell types, Type I, II, and III cells, and the taste information delivery requires a dialogue among different types of taste cells

(Figure 1.4 (Calvo and Egan, 2015)).

Type I cells are glial-like cells and they are the most numerous cells in taste buds.

Analogous to the function of glial cells in the nervous system, Type I cells provide support to other cells, and they can also regulate the molecular environment of the taste buds, such as neurotransmitter and ion concentrations, to insure the normal function of the taste transduction process. For example, Type I cells express glutamate/aspartate transporters

(GLASTs) (Lawton et al., 2000) and nucleoside triphosphate diphosphohydrolase 2

(NTPDase2) (Bartel et al., 2006), which are able to take up glutamate into the cells and degrade extracellular 5´-triphosphate, respectively. In addition, they also express an inward rectifier channel, renal outer medullary potassium channel (ROMK), which is responsible for removal of accumulating extracellular K+ after action potentials (Dvoryanchikov et al.,

2009). Previous studies also showed that Type I taste cells were involved directly in salty

taste transduction (Vandenbeuch et al., 2008) via the epithelial sodium channels (ENaCs),

which mediated low concentration of NaCl (attractive salt) taste transduction

(Chandrashekar et al., 2010).

Type II cells, which are also called taste receptor cells (TRCs), are the primary 7

sensors for tastants. Type II cells express a variety of receptors in order to recognize

different taste qualities, and all of the taste receptors discovered so far are G protein-

coupled receptors (GPCRs). The T1R family of taste receptors is responsible for sensing

sweet and umami tastants. The heterodimeric combination of T1R2 and T1R3 functions as a sweet receptor, and it can recognize natural sweet substances such as sucrose, fructose,

glucose, and some artificial sweeteners including saccharin and sucralose (Max et al., 2001,

Nelson et al., 2001, Xu et al., 2004). Heterodimeric complex of T1R1 and T1R3 subunits

is an important umami receptor and it can sense L-glutamate and other L-amino acids.

Behavioral and electrophysiological studies showed that mice lacking T1R1 or T1R2 lose

their response to umami or sweet tastants, respectively, and T1R3 knock out mice

diminished responses for both sweet and umami stimuli (Damak et al., 2003, Zhao et al.,

2003). The T2R family functions as sensing bitter tastants, such as quinine, denatonium

benzoate, and caffeine (Chandrashekar et al., 2000, Bufe et al., 2002, Meyerhof et al., 2010).

TRCs also express voltage-gated Na+ and K+ channels in order to fire action potentials and allow release of neurotransmitters. One of the most important neurotransmitters, ATP, is released from Type II taste cells, and interacts with ionotropic ATP receptors (P2X2 and

P2X3) on sensory nerve fibers or neighboring Type III taste cells. The mice lacking P2X2

and P2X3 showed eliminated taste nerve responses and exhibited greatly reduced taste

sensitivities to sweet, umami and bitter tastants (Finger et al., 2005). A voltage-gated ATP

channel, calcium homeostasis modulator 1 (CALHM1), was found recently that is essential

for taste transduction. CALHM1 is expressed exclusively in Type II taste cells, and

knocking out of CALHM1 eliminated ATP release from Type II taste cells. Also, mice 8 lacking CALHM1 have significantly reduced taste sensitivities and gustatory nerve responses to sweet, bitter, and umami tastants (Taruno et al., 2013a, Taruno et al., 2013b).

Type III cells are believed to be presynaptic cells because they can synapse with afferent nerve terminals (Yee et al., 2001) and express many synapse-related proteins, including synaptosomal-associated protein 25, voltage-gated Ca2+ channel, synapsin-II,

γ-aminobutyric acid (GABA), and the neurotransmitter-synthesizing enzymes (DeFazio et al., 2006, Dvoryanchikov et al., 2011). The main function of Type III cells is to integrate the input signals generated by TRCs, and this is also the reason why Type III cells can respond to all taste qualities although they don’t express any taste-specific receptors. In fact, Type III taste cells are not absolutely necessary for taste transduction. Mice lacking

Type III cells can still respond to sweet, bitter, and umami tastes (Huang et al., 2006). An important neurotransmitter produced by Type III taste cells, serotonin (5-HT), is produced when the ATP released from TRCs interact with the ATP receptors on Type III cells

(Huang et al., 2007, Huang et al., 2009). Recent studies have showed that instead of functioning in neurotransmission, 5-HT was crucial for regulating the ATP release from 5-

HT receptor-expressed Type II taste cells (Jaber et al., 2014). In addition, Type III cells can respond to sour taste directly partly because they express polycystic kidney disease

2-like 1 protein (PKD2L1) and polycystic kidney disease 1-like 3 protein (PKD1L3) channels (LopezJimenez et al., 2006, Huang et al., 2008), and mice lacking PKD2L1 showed reduced taste sensitivities to sour tastants (Horio et al., 2011).

Type IV (basal) cells are precursor cells that contribute to taste cell renewal, and they are able to differentiate into the mature Type I-III taste cells (Barlow and Klein, 2015). 9

In general, there is a well-described pathway for the transduction of most taste

stimuli. Initially, taste compounds have to diffuse and interact with their corresponding

receptors on the TRCs. This interaction then leads to a series of downstream signaling

events, which allow Ca2+ release into cytosol of TRCs. Ca2+ can then interact with and

open some Ca2+-dependent ion channels, which in turn depolarizes the taste cell membrane

and leads to the generation of action potentials. Membrane depolarization activates

voltage-gated Ca2+ channels on the cell membrane, and allows extracellular Ca2+ influx

into the cytosol, which then binds to synaptic proteins. Eventually, neurotransmitters are

released from the synaptic vehicles in TRCs and bind to gustatory afferent nerve fibers

directly or indirectly through adjacent Type III cells.

There are two models of peripheral coding of taste: labeled-line model and across

-fiber model. In the labeled-line models, one distinct taste quality is encoded by one

population of taste receptor cell expressing unique taste receptors, and then only one set of

dedicated afferent nerve fibers (Barretto et al., 2015). While in the across-fiber model, taste

receptor cells and gustatory afferent nerves are broadly tuned to respond to more than one

taste quality (Carleton et al., 2010, Liman et al., 2014).

Taste of Fat

Sweet, sour, bitter, salty, and umami are five basic taste qualities that are well

known and have been studied for decades. But how was “fatty” first considered as a candidate taste quality? This was actually based on the function of fat because one of the most important functions of “taste” is that it should be able to detect nutritional or 10

physiological requirements. For example, sweet represents sensing of carbohydrates that

serve as an energy source. Similar with sweet, fat is also a very important energy source

and it can be found abundantly in human diet. Moreover, fat can contribute to the palatability of foods as evidenced by the attraction to foods containing high levels of fat, such as ice cream, donuts, cheese and so on. Therefore, over a decade ago, scientists started to hypothesize that fatty may represent a sixth taste quality.

In order to effectively investigate if the dietary fat can be detected by the gustatory system, we must first identify the substance being recognized within the oral cavity after eating fat. Ingested fat is typically in the form of triglycerides, three fatty acids bound to a glycerol backbone, and it can be degraded into free fatty acids within 1-5 s in the mouth of rat by lingual lipase, which is secreted from von Ebner’s glands around circumvallate and

foliate papillae in the tongue. The role of lingual lipase has been shown by experiments

that have investigated the action of lingual lipase inhibitors, which can inhibit free fatty acid production in mouth. Inhibition of lingual lipase significantly reduced the preference for triglycerides but not for free fatty acids in rat (Kawai and Fushiki, 2003). Similar results were found in humans, but with different types of lipases in human oral cavity (Voigt et al., 2014). A recent study investigated the salivary nonesterified fatty acids after the subjects chewed high fat food for 1 min, and the concentrations of free fatty acids (palmitic, oleic, linoleic, and stearic acids) increased significantly, and these concentrations were sufficient to stimulate taste cell response in mice (Kulkarni and Mattes, 2013). Taken together, free fatty acid appears to be the primary stimulus contributing to the fat taste.

Numerous reports have demonstrated the hedonic preference for fat in humans and 11

rodents. Several studies proved that human preference for foods strongly depended on the

relative proportions of fat in the samples tasted (Drewnowski and Greenwood, 1983, Mela and Sacchetti, 1991, Drewnowski, 1997), and it has been proven that mice and rats showed a robust preference for high-fat foods (Greenberg and Smith, 1996, Imaizumi et al., 2000,

Takeda et al., 2000). Until quite recently, researchers believed postingestive cues (Lucas

et al., 1998), aroma (Ramirez, 1993, Kinney and Antill, 1996), and texture (Rolls et al.,

2003, Kadohisa et al., 2005) rather than taste, were the only factors contributing to sensory

perception of fat. During the last decade, however, accumulating behavioral research has

shown that humans and rodents were still be able to recognize the presence of fat in foods

after eliminating these three factors.

Sham feeding paradigms allow the elimination of postingestive cues, and by using

this method, Mindell et al. found that sham-fed rats showed a strong preference for corn oil over mineral oil in 2-bottle preference tests, which suggests the orosensory effects of

fat detection (Mindell et al., 1990). Postingestive effects can also be excluded by short- term (5 min) preference tests because these occur only after ~13 min following ingestion of fat (Ackroff et al., 1990). Olfactory effects can be removed by intranasal application of zinc sulfate to generate anosmic animals. Takeda and colleague showed that although the threshold for detection of fatty acids was higher, anosmic mice can still recognize and prefer corn oil (Takeda et al., 2001). The texture of fatty acids can also be masked by suspending all the test stimuli in xanthan gum solution. Tsuruta and colleagues showed that rats prefer long-chain fatty acid fluids to vehicles in short-term two-bottle preference test after the texture was masked with xanthan gum solution. Additionally, rats had different 12

preferences for different fatty acids, which suggested that rats can discriminate different

kinds of fatty acids (Tsuruta et al., 1999). Further, the texture of most free fatty acids at their physiologically relevant concentrations is very similar to water. McCormack and colleges measured the viscosity of 88 μM solution of free fatty acids and showed that there was a negligible difference in viscosity between fatty acids and water (1.5% difference)

(McCormack et al., 2006). One of the first studies to prove the role of gustation for fatty acids after minimizing all the effects of olfaction, texture and postingestive was conducted by Fukuwatari and colleagues. They used anosmic rats to eliminate olfaction, suspended all the test substances in 0.3% xanthan gum to mask the texture, and performed 5 min preference tests to eliminate the postingestive influences. The results showed that rats still preferred oleic acid to the control, which showed convincingly the gustatory recognition of fatty acids (Fukuwatari et al., 2003). Besides preference tests, conditioned taste aversion is another method to test the ability of rodents to taste the fatty acids (Garcia et al., 1985).

Several studies showed that both rats and mice could be conditioned to avoid free fatty acids in the low micromolar range (McCormack et al., 2006, Gaillard et al., 2008).

Accumulating evidence from human studies also indicates the gustatory perception of fatty acids. The taste of fatty acids was first identified in humans by Schiffman and

Dackis in 1975, which demonstrated that people could describe the taste of fatty acid solutions (Schiffman and Dackis, 1975). However, in this test, olfaction and texture were not excluded. About 20 years later, human behavioral tests were performed again.

Detection thresholds for fatty acids were typically determined using an 3-alternative, force- choice, ascending (3-AFC), sip and spit method (Mattes, 2009). The participants are asked 13

to discriminate three samples including two control samples and one stimulus sample

starting from the lowest concentration. If a correct identification is made, the same

concentration will be given again, and if an incorrect identification is made, the next higher

concentration will be given. Threshold is the lowest concentration that is correctly

identified for 3 consecutive times. One study using young and elderly subjects with nose

clips showed that there were measurable thresholds for fatty acid detection and young

subjects had lower thresholds (Schiffman et al., 1998), which suggested orosensory system

was responsible for the detection of fat. Nasser and colleagues showed that 6-N-2-

propylthiouracil (PROP) tasters could discriminate linoleic acid added to high-fat ice cream

(Nasser et al., 2001). Similarly, linoleic acid tasters and non-tasters, who were grouped by

correct identification of a 10 µM linoleic acid solution, were used to discriminate fatty

acids with different carbon lengths, and linoleic acid tasters were able to discriminate

between linoleic acid and oleic acid added ice cream (Kamphuis et al., 2003). The

contribution of taste for fatty acids on humans was first isolated by Chale-Rush and

colleagues, where the texture was masked by gum acacia solution and the odor cue was

eliminated by blocking the nares (Chale-Rush et al., 2007a, b). After other sensory systems

were minimized, the detection threshold for linoleic, oleic, and stearic acids were still measurable, suggesting fatty acids can be detected by gustatory system. Recent studies on humans showed further that lauric and caproic acids had detectable oral detection

thresholds (Mattes, 2009), and humans had different oral sensitivities and sensations for

fatty acids with different carbon lengths (Running and Mattes, 2014, Running et al., 2015).

Taken together, the studies mentioned above suggested rodents and humans are 14

capable of detecting free fatty acids independently even when olfaction, texture and

postingestive factors were eliminated, which supports the conclusion that free fatty acids

are effective taste stimuli.

Fatty acid taste transduction

Evidence that “fatty” constitutes a basic taste quality has been supported recently

by cell-based assays, and more and more studies have focused on identifying the

mechanisms of fatty acid taste transduction. Here are the main components proven to be

involved in these mechanisms.

DRK channels

Delayed rectifying K+ (DRK) channels are the first discovered ion channels that are

expressed in taste cells and involved in fat taste transduction. Gilbertson and colleagues were the first to show that extracellular application of cis-polyunsaturated fatty acids was able to activate native taste cells from rats by inhibiting DRK channels, but no significant effect on K+ channels were found when saturated, monounsaturated, and trans-

polyunsaturated fatty acids were applied (Gilbertson et al., 1997). Because DRK channels

are responsible for repolarization during an action potential, inhibiting DRK channels by

fatty acids can prolong depolarization phase of an action potential and, in turn, alter (i.e.

enhance) taste cell activity (Gilbertson et al., 1997). Among the major DRK channels

expressed on taste buds, including Kv1.3, Kv1.5, Kv2.2, Kv3.1, and Kv3.2, Kv1.5 is the

most highly expressed in rat taste cells. It is very sensitive to polyunsaturated fatty acids

and electrophysiological and pharmacological assays have indicated that Kv1.5 is the 15

major DRK channel that contributes to the DRK, and, hence fatty acid-sensitive, current

(Liu et al., 2005).

CD36

Another protein responsible for taste detection of fatty acids is CD36 (cluster of differentiation 36), which is a transmembrane protein that can bind a variety of lipids

including long-chain fatty acids (Baillie et al., 1996). It is able to transport fatty acids across the cell membrane, which is the reason that CD36 is also called fatty acid translocase (FAT)

(Zhang et al., 2003). CD36 is expressed in lingual gustatory papillae in mouse, rat, and human, especially in the circumvallate papillae (Fukuwatari et al., 1997, Laugerette et al.,

2005, Simons et al., 2011). The role of CD36 in fatty acid taste transduction has been actively studied in recent years. Laugerette et al. compared the preference for the diet containing long-chain fatty acids (LCFAs) in wild type and CD36 knockout mice, and the results showed that the CD36 knockout mice lost their spontaneous preference for a LCFA- enriched diet (Laugerette et al., 2005). Similar results were found in some later studies

(Sclafani et al., 2007, Chen et al., 2013), suggesting that CD36 plays an important role in fatty acid taste transduction. However, CD36 is not essential in this process. Previous research showed that although the preference of CD36 knockout mice for high fat (HF) diet was abolished when the HF diet contained low concentrations of fat, but it came back at high concentration of fat (2.5%-20%) (Chen et al., 2013). Also, Ca2+ responses were

eliminated in CD36-null human and mouse taste cells with low concentrations of linoleic

acid, but not with high concentration of the same stimulus (Ozdener et al., 2014). With

more and more studies on the primary LCFA receptor GPR120, there is a theory proposed 16

that CD36 may function as a chaperone protein that facilitates free fatty acids to bind

GPR120, which then activates downstream taste transduction. The data in our laboratory

showed that knocking down of CD36 reduced but not abolished the Ca2+ responses to linoleic acid in human taste cell line, and CD36 knockout mice showed lower but not eliminated taste sensitivities to linoleic acid, suggesting that CD36 is not required but may facilitate the taste transduction of LCFAs.

G Protein-Coupled Receptors

Another type of protein that is involved in fatty acid taste transduction is a subclass

of G protein-coupled receptors (GPCR). Several GPCRs have been suggested to be

activated by free fatty acids, including GPR120, GPR40, GPR41, GPR43, and GPR84. The

ligands for these receptors are fatty acids with different carbon lengths, which are generally

classified as long-, medium-, and short-chain fatty acids (Gilbertson et al., 2010). For long

chain, polyunsaturated fatty acids, the common point for initiation of the fatty acid-induced

receptor potential is transient receptor potential channel type M5 (TRPM5). TRPM5 is

another important ion channel involved in fatty acid taste transduction. In a recent study of

our laboratory, knocking out of TRPM5 reduced the taste cell response to linoleic acid, and

TRPM5 knockout mice showed no preference for and diminished taste sensitivities to

linoleic acid (Liu et al., 2011). Our laboratory and others have already confirmed the

expression of GPR120, GPR40, GPR41/43 and GPR84 in taste cells by real time PCR,

which suggested the possible roles of these receptors in taste transduction of fatty acids.

GPR120

GPR120 is the receptor of saturated and unsaturated long-chain fatty acids 17

(Hirasawa et al., 2005) and it is expressed in a variety of tissues. Hirasawa et al. initially identified GPR120 in the intestinal tract and also mouse intestinal endocrine cell line STC-

1. They suggested that GPR120 could promote unsaturated long-chain fatty acid-induced glucagon-like peptide-1 (GLP-1) secretion (Hirasawa et al., 2005). Later, Tanaka et al.

proved that GPR120 in the intestine could also mediate fatty acid-induced gut peptide

hormone cholecystokinin (CCK) production (Tanaka et al., 2008). Our laboratory

confirmed that GPR120 was involved in CCK release from line STC-1 cells (Shah et al.,

2012), and both of GLP-1 and CCK can elicit satiety and inhibits food intake (Smith and

Gibbs, 1975, Gutzwiller et al., 1999). Besides intestinal cells, GPR120 is also highly

expressed in adipose tissue and proinflammatory macrophages, and Oh et al. suggested that

GPR120 could be activated by omega-3 fatty acids and, in turn, caused anti-inflammatory

effects (Oh et al., 2010). The role of GPR120 in taste transduction has been studied recently.

Matsumura et al. showed that GPR120 was mainly expressed in the Type II taste cells

(Matsumura et al., 2009), which was further confirmed by a later study (Cartoni et al.,

2010). The GPR120 protein was also detected in human gustatory epithelia by

immunohistochemical experiments (Galindo et al., 2012). Two bottle taste preference test

showed that knocking out of GPR120 significantly reduced the preference for linoleic acid

in mice (Cartoni et al., 2010), suggesting a role of GPR120 in the taste transduction of

long-chain fatty acid. The downstream pathway after GPR120 activation in taste system is

still not entirely clear. A recent study showed that a GPR120 agonist induced a significant

rise of GLP-1 in mouse taste cells, which indicated that similar to the intestine, GPR120

activation by LCFA can also induce the release of GLP-1 in gustatory system (Martin et 18

al., 2012).

GPR40

GPR40 belongs to the GPR40 family, which also includes GPR41 and GPR43. By

using a ligand fishing strategy, the ligands for GPR40 were determined to be medium- and

long-chain saturated and unsaturated free fatty acids (Briscoe et al., 2003, Itoh et al., 2003,

Kotarsky et al., 2003). GPR40 is enriched in pancreatic ß-cells as well as some pancreatic

ß-cell lines, and long-chain fatty acids can stimulate and modulate insulin secretion in a

GPR40-dependent manner (Itoh et al., 2003). Additionally, GPR40 is also expressed in

endocrine cells in the gastrointestinal tract where it can modulate incretin secretion and

therefore regulates insulin secretion stimulated by free fatty acids (Edfalk et al., 2008). The

expression of GPR40 in taste cells was also reported recently. It has been suggested that

GPR40 is expressed mainly in Type I taste cells, and knocking out GPR40 decreased the

taste nerve responses to several medium- and long-chain fatty acids. GPR40 knockout (KO)

mice were also used in taste preference test, and it turned out that GPR40 KO mice showed

lower, but not absent, preference for linoleic acid and oleic acid than wild type mice,

indicating that GPR40 contributes to the taste of fatty acids (Cartoni et al., 2010). The

downstream signaling pathway of GPR40 remains to be determined, but it may couple with

Gαq and Gαi family.

GPR41 and GPR43

GPR41 and GPR43 are another two family members in the GPR40 family and they

are closely related to each other. Also by adopting a ligand fishing strategy, GPR41 and

GPR43 are believed to be activated by short-chain fatty acids, although their ligands have 19

different carbon chain lengths (Brown et al., 2003, Le Poul et al., 2003). GPR41 is

expressed mainly in adipose tissue and knocking down of GPR41 significantly reduced the leptin gene expression (Brown et al., 2003, Xiong et al., 2004). GPR41 is also found in enteroendocrine cells in the gut epithelium and ascending colon, and may function as the sensor of short-chain fatty acid and eventually regulates host energy balance (Samuel et al.,

2008, Tazoe et al., 2008, Tazoe et al., 2009). Another function of GPR41 was discovered recently, that is GPR41 mediates regulation of sympathetic nervous system by short-chain fatty acids (Kimura et al., 2011).

GPR43 is highly expressed in leukocytes, and it may play a role in leukocyte differentiation because GPR43 expression was greatly induced in leukemia cells during differentiation to monocytes (Senga et al., 2003). GPR43 is also expressed in intestine and colon and may be involved in intestine and colon function (Karaki et al., 2006, Tazoe et al., 2008, Tazoe et al., 2009). Furthermore, GPR43 knockout mice had lower body fat composition, improved glucose control, and lower plasma lipid under high-fat diet, suggesting that GPR43 play a very important role in energy and lipid metabolism (Bjursell et al., 2011). A recently published article showed that GPR43 could mediate short-chain

fatty acid induced GLP-1 secretion (Tolhurst et al., 2012). The downstream signaling

pathways of both GPR41 and GPR43 remain to be determined. As far as we know, GPR41

coupled with Gi/o, whereas GPR43 coupled through Gq and Gi/o. Their activation can then

increase intracellular Ca2+ concentration and decrease intracellular cyclic adenosine

monophosphate (Brown et al., 2003, Le Poul et al., 2003). The data from my laboratory

showed that GPR41 and GPR43 were both expressed in taste cells (unpublished data). 20

GPR84

GPR84 is a member of the rhodopsin superfamily of GPCRs (Joost and Methner,

2002), and was first discovered by using an expressed sequence tag data mining strategy

in 2001 (Wittenberger et al., 2001). In the same year, GPR84 was also identified from

human peripheral blood neutrophils by a degenerate-primer RT-PCR method and was suggested to be expressed mainly in bone marrow, lung, and peripheral blood leukocytes

(Yousefi et al., 2001). The human and murine gpr84 genes, which have an open reading frame of 1191 bp, both encode GPR84 protein of 396 amino acids and share 85% identity

(Wittenberger et al., 2001)

The nature of the ligands that act on GPR84 was never reported until 2006, when

Wang and his coworkers investigated the potency of various fatty acids at GPR84 using

[35S]GTPγS binding assays and finally demonstrated that GPR84 was activated by

medium-chain saturated fatty acids (MCFAs) of C9 to C14 in length, and the most potent

ligands for GPR84 are capric (C10), undecanoic (C11), and lauric acids (C12) (Wang et al.,

2006). A later study showed that 2- and 3-hydroxy MCFAs were more effective agonists for GPR84 than nonhydroxylated MCFAs (Suzuki et al., 2013). The signaling transduction

pathway following GPR84 activation still remains to be determined. It has been suggested

that GPR84 activation by MCFAs coupled primarily to a pertussis toxin-sensitive Gi/o

pathway, in which MCFAs stimulation led to calcium mobilization, 3´,5´-cyclic AMP

inhibition, and [35S]GTPγS binding (Wang et al., 2006).

The function of GPR84 is not well understood. A previous study showed that in

GPR84 knockout mice, activated T cells expressed higher level of interleukin-4 (IL-4) than 21

wild type mice, suggesting a role for GPR84 in the immune system (Venkataraman and

Kuo, 2005). Additionally, GPR84 activation can induce the secretion of interleukin-12 (IL-

12) p40 in the lipopolysaccharide (LPS)-stimulated monocyte/macrophage cell line, and in the same cell line, the mRNA level of GPR84 was strongly up-regulated under LPS activation, which indicated the possible role of GPR84 in monocyte/macrophage activation

(Wang et al., 2006, Lattin et al., 2008). GPR84 is also a proinflammatory receptor. One recent study showed that GPR84 was up-regulated in adipocytes co-cultured with macrophage cells or TNFα, and MCFAs suppressed adiponectin mRNA expression via

GPR84 in TNFα-primed adipocytes (Nagasaki et al., 2012). Another study showed that

GPR84 activation increased the release of IL-8 from polymorphonuclear leukocytes and

TNFα from macrophages (Suzuki et al., 2013). GPR84 may also play an important role in neuroimmunological processes. In the central nervous system, the expression of GPR84 is up-regulated in microglia during endotoxemia, and also in monocytic cells upon LPS stimulation (Bouchard et al., 2007).

Putative Transduction Pathway for Long-Chain Unsaturated Fatty Acids in Taste Cells

We have elucidated putative the taste transduction pathway for long-chain unsaturated fatty acids (LCFAs) (Figure 1.5), and this pathway remains an important frame of reference for the possible GPR84-mediated MCFA taste transduction pathway. LCFAs are transported by CD36 to its cognate GPCR (e.g. GPR120) or interact with the GPCR directly to initiate the signaling pathway. The G-protein that coupled with the GPCR is then activated, and the ßγ subunits of the activated G-protein dissociate and stimulate 22

phospholipase C ß2 (PLCß2). PLCß2 cleaves phosphatidylinositol 4,5-bisphosphate (PIP2)

into diacyl glycerol (DAG) and inositol 1,4,5-trisphosphate (IP3), both of which are second

messengers. IP3 diffuses and binds to IP3 receptor 3 (IP3R3) located on the endoplasmic

reticulum (ER) membrane. IP3R3 is also an IP3-dependent calcium channel, and IP3R3

activation leads to a release of Ca2+ from the ER calcium store to cytosol. Ca2+ then binds

to a cation channel, TRPM5, on the cell membrane, causing extracellular Na+ influx into the cytosol and, in turn, depolarization of the taste cells. DRK channels are activated and opened by the depolarized membrane potential, but fatty acid-sensitive DRK channels are inhibited by free polyunsaturated fatty acids, which are able to prolong the depolarization phase of an action potential. A large enough depolarization opens voltage-gated Ca2+

channels (VGCCs) on the cell membrane and allows extracellular Ca2+ influx into the

cytosol. The combination of cell depolarization and elevated intracellular Ca2+ level then

triggers the release of neurotransmitters.

Hypothesized GPR84-Mediated MCFA Taste Transduction Pathway

As discussed above, in leukocytes, GPR84 activation by MCFAs couples to a

pertussis toxin-sensitive Gi/o pathway, where it caused calcium mobilization and 3´,5´-

cyclic AMP (cAMP) inhibition. Since α-gustducin (McLaughlin et al., 1992), which is abundantly expressed in taste cells, is the α-subunit of a G-protein that belongs to the Gi/o

family (McLaughlin et al., 1992), it’s reasonable to hypothesize that α-gustducin is

responsible for this GPR84-mediated MCFA signaling pathway in taste cells. The function

of α-gustducin in taste transduction is not entirely clear. However, it has been proposed 23

that α-gustducin was coexpressed with T1R and T2R receptors (Kim et al., 2003, Stone et

al., 2007), which are receptors for sweet, umami, and bitter taste. Together with the fact

that knocking out of α-gustducin significantly compromised these three tastes (Ruiz et al.,

2003, Glendinning et al., 2005), it is believed that α-gustducin might play a key role in

sweet, umami, and bitter taste transduction pathway. α-Gustducin is able to activate phosphodiesterase (PDE) and in turn decrease intracellular concentration of cAMP. In taste cells, bitter and umami stimuli were both able to induce a reduction of cAMP level, and for bitter, it was α-gustducin dependent (Yan et al., 2001, Abaffy et al., 2003). The role of the

α-gustducin-induced decrease in cAMP during taste transduction is still not quite clear, and limited research has been done in this field. However, it has been proposed that cAMP was

able to suppress an inward whole-cell current in taste cells, indicating that there is a kind

of cAMP suppressible cation channel in taste cells, and decrease of cAMP level can active these channels and depolarize the taste cells (Kolesnikov and Margolskee, 1995). Another function of cAMP is to activate protein kinase A (PKA) (Meinkoth et al., 1993), which is able to inhibit PLCß2 (Liu and Simon, 1996) and IP3R3 (Soulsby and Wojcikiewicz, 2007).

Therefore, decreased cAMP concentration can cause the decreased activity of PKA, which

will relieve its inhibition to PLCß2 and IP3R3. Then, similar with the polyunsaturated fatty

2+ acids taste transduction pathway, IP3 and DAG can be generated and Ca can be released

from ER store. Ca2+ and DAG together have been shown to activate some isoforms of

protein kinase C (PKC) (Nishizuka, 1995), which is able to phosphorylate and close K+

channels on the membrane (Varkevisser and Kinnamon, 2000), and, in turn, depolarize the taste cells, open VGCCs, and increase intracellular Ca2+ levels (Figure 1.6). The partner of 24

α-gustducin, ß3γ13 (Huang et al., 1999), may function as the ßγ subunit involved in the

LCFAs taste transduction pathway discussed above. Alternatively, it remains possible that

the GPR84 pathway is similar to that seen with LCFAs.

References

Abaffy T, Trubey KR, Chaudhari N (2003) Adenylyl cyclase expression and modulation

of cAMP in rat taste cells. Am J Physiol Cell Physiol 284:C1420-C1428.

Ackroff K, Vigorito M, Sclafani A (1990) Fat appetite in rats: the response of infant and

adult rats to nutritive and non-nutritive oil emulsions. Appetite 15:171-188.

Baillie AG, Coburn CT, Abumrad NA (1996) Reversible binding of long-chain fatty acids

to purified FAT, the adipose CD36 homolog. J Membr Biol 153:75-81.

Barlow LA, Klein OD (2015) Developing and regenerating a sense of taste. Curr Top Dev

Biol 111:401-419.

Barretto RPJ, Gillis-Smith S, Chandrashekar J, Yarmolinsky DA, Schnitzer MJ, Ryba NJP,

Zuker CS (2015) The neural representation of taste quality at the periphery. Nature

517:373-376.

Bartel DL, Sullivan SL, Lavoie EG, Sevigny J, Finger TE (2006) Nucleoside triphosphate

diphosphohydrolase-2 is the ecto-ATPase of type I cells in taste buds. J Comp

Neurol 497:1-12.

Bjursell M, Admyre T, Goransson M, Marley AE, Smith DM, Oscarsson J, Bohlooly YM

(2011) Improved glucose control and reduced body fat mass in free fatty acid

receptor 2-deficient mice fed a high-fat diet. Am J Physiol Endocrinol Metab 25

300:E211-E220.

Bouchard C, Page J, Bedard A, Tremblay P, Vallieres L (2007) G protein-coupled receptor

84, a microglia-associated protein expressed in neuroinflammatory conditions. Glia

55:790-800.

Bray GA, Paeratakul S, Popkin BM (2004) Dietary fat and obesity: a review of animal,

clinical and epidemiological studies. Physiol Behav 83:549-555.

Briscoe CP et al. (2003) The orphan G protein-coupled receptor GPR40 is activated by

medium and long chain fatty acids. J Biol Chem 278:11303-11311.

Brown AJ et al. (2003) The Orphan G protein-coupled receptors GPR41 and GPR43 are

activated by propionate and other short chain carboxylic acids. J Biol Chem

278:11312-11319.

Bufe B, Hofmann T, Krautwurst D, Raguse JD, Meyerhof W (2002) The human TAS2R16

receptor mediates bitter taste in response to beta-glucopyranosides. Nat Genet

32:397-401.

Calvo SS, Egan JM (2015) The endocrinology of taste receptors. Nat Rev Endocrinol

11:213-227.

Carleton A, Accolla R, Simon SA (2010) Coding in the mammalian gustatory system.

Trends Neurosci 33:326-334.

Cartoni C, Yasumatsu K, Ohkuri T, Shigemura N, Yoshida R, Godinot N, le Coutre J,

Ninomiya Y, Damak S (2010) Taste preference for fatty acids is mediated by GPR40

and GPR120. J Neurosci 30:8376-8382.

Casas-Agustench P, Arnett DK, Smith CE, Lai CQ, Parnell LD, Borecki IB, Frazier-Wood 26

AC, Allison M, Chen YD, Taylor KD, Rich SS, Rotter JI, Lee YC, Ordovas JM

(2014) Saturated fat intake modulates the association between an obesity genetic

risk score and body mass index in two US populations. J Acad Nutr Diet 114:1954-

1966.

Cawley J, Meyerhoefer C (2012) The medical care costs of obesity: an instrumental

variables approach. J Health Econ 31:219-230.

CDC (2014) Obesity Prevalence Maps 2014. In: Behavorial Risk Factor Surveillance

System, CDC.

Chale-Rush A, Burgess JR, Mattes RD (2007a) Evidence for human orosensory (taste?)

sensitivity to free fatty acids. Chem Senses 32:423-431.

Chale-Rush A, Burgess JR, Mattes RD (2007b) Multiple routes of chemosensitivity to free

fatty acids in humans. Am J Physiol Gastrointest Liver Physiol 292:G1206-G1212.

Chan DS, Vieira AR, Aune D, Bandera EV, Greenwood DC, McTiernan A, Navarro

Rosenblatt D, Thune I, Vieira R, Norat T (2014) Body mass index and survival in

women with breast cancer-systematic literature review and meta-analysis of 82

follow-up studies. Ann Oncol 25:1901-1914.

Chandrashekar J, Kuhn C, Oka Y, Yarmolinsky DA, Hummler E, Ryba NJ, Zuker CS (2010)

The cells and peripheral representation of sodium taste in mice. Nature 464:297-

301.

Chandrashekar J, Mueller KL, Hoon MA, Adler E, Feng L, Guo W, Zuker CS, Ryba NJ

(2000) T2Rs function as bitter taste receptors. Cell 100:703-711.

Chen CSY, Bench EM, Allerton TD, Schreiber AL, Arceneaux KP, Primeaux SD (2013) 27

Preference for linoleic acid in obesity-prone and obesity-resistant rats is attenuated

by the reduction of CD36 on the tongue. Am J Physiol-Reg I 305:R1346-R1355.

Chiuve SE, Rimm EB, Sandhu RK, Bernstein AM, Rexrode KM, Manson JE, Willett WC,

Albert CM (2012) Dietary fat quality and risk of sudden cardiac death in women.

Am J Clin Nutr 96:498-507.

Corella D, Arnett DK, Tucker KL, Kabagambe EK, Tsai M, Parnell LD, Lai CQ, Lee YC,

Warodomwichit D, Hopkins PN, Ordovas JM (2011) A high intake of saturated fatty

acids strengthens the association between the fat mass and obesity-associated gene

and BMI. J Nutr 141:2219-2225.

Crosbie EJ, Zwahlen M, Kitchener HC, Egger M, Renehan AG (2010) Body mass index,

hormone replacement therapy, and endometrial cancer risk: a meta-analysis. Cancer

Epidemiol Biomarkers Prev 19:3119-3130.

Damak S, Rong M, Yasumatsu K, Kokrashvili Z, Varadarajan V, Zou S, Jiang P, Ninomiya

Y, Margolskee RF (2003) Detection of sweet and umami taste in the absence of

taste receptor T1r3. Science 301:850-853. de Wit N, Derrien M, Bosch-Vermeulen H, Oosterink E, Keshtkar S, Duval C, de Vogel-

van den Bosch J, Kleerebezem M, Muller M, van der Meer R (2012) Saturated fat

stimulates obesity and hepatic steatosis and affects gut microbiota composition by

an enhanced overflow of dietary fat to the distal intestine. Am J Physiol Gastrointest

Liver Physiol 303:G589-G599.

DeFazio RA, Dvoryanchikov G, Maruyama Y, Kim JW, Pereira E, Roper SD, Chaudhari

N (2006) Separate populations of receptor cells and presynaptic cells in mouse taste 28

buds. J Neurosci 26:3971-3980.

Drewnowski A (1997) Why do we like fat? J Am Diet Assoc 97:S58-S62.

Drewnowski A, Greenwood MR (1983) Cream and sugar: human preferences for high-fat

foods. Physiol Behav 30:629-633.

Dvoryanchikov G, Sinclair MS, Perea-Martinez I, Wang T, Chaudhari N (2009) Inward

rectifier channel, ROMK, is localized to the apical tips of glial-like cells in mouse

taste buds. J Comp Neurol 517:1-14.

Dvoryanchikov G, Huang YA, Barro-Soria R, Chaudhari N, Roper SD (2011) GABA, its

receptors, and GABAergic inhibition in mouse taste buds. J Neurosci 31:5782-5791.

Edfalk S, Steneberg P, Edlund H (2008) Gpr40 is expressed in enteroendocrine cells and

mediates free fatty acid stimulation of incretin secretion. Diabetes 57:2280-2287.

Enos RT, Velazquez KT, Murphy EA (2014) Insight into the impact of dietary saturated fat

on tissue-specific cellular processes underlying obesity-related diseases. J Nutr

Biochem 25:600-612.

Finger TE, Danilova V, Barrows J, Bartel DL, Vigers AJ, Stone L, Hellekant G, Kinnamon

SC (2005) ATP signaling is crucial for communication from taste buds to gustatory

nerves. Science 310:1495-1499.

Finkelstein EA, Trogdon JG, Cohen JW, Dietz W (2009) Annual medical spending

attributable to obesity: payer-and service-specific estimates. Health affairs (Project

Hope) 28:w822-w831.

Finucane MM, Stevens GA, Cowan MJ, Danaei G, Lin JK, Paciorek CJ, Singh GM,

Gutierrez HR, Lu Y, Bahalim AN, Farzadfar F, Riley LM, Ezzati M (2011) National, 29

regional, and global trends in body-mass index since 1980: systematic analysis of

health examination surveys and epidemiological studies with 960 country-years

and 9.1 million participants. Lancet 377:557-567.

Flores MB, Rocha GZ, Damas-Souza DM, Osorio-Costa F, Dias MM, Ropelle ER,

Camargo JA, de Carvalho RB, Carvalho HF, Saad MJ, Carvalheira JB (2012)

Obesity-induced increase in tumor necrosis factor-alpha leads to development of

colon cancer in mice. Gastroenterology 143:741-753 e741-e744.

Fukuwatari T, Kawada T, Tsuruta M, Hiraoka T, Iwanaga T, Sugimoto E, Fushiki T (1997)

Expression of the putative membrane fatty acid transporter (FAT) in taste buds of

the circumvallate papillae in rats. FEBS Lett 414:461-464.

Fukuwatari T, Shibata K, Iguchi K, Saeki T, Iwata A, Tani K, Sugimoto E, Fushiki T (2003)

Role of gustation in the recognition of oleate and triolein in anosmic rats. Physiol

Behav 78:579-583.

Funaki M (2009) Saturated fatty acids and insulin resistance. J Med Invest 56:88-92.

Gaillard D, Laugerette F, Darcel N, El-Yassimi A, Passilly-Degrace P, Hichami A, Khan

NA, Montmayeur JP, Besnard P (2008) The gustatory pathway is involved in CD36-

mediated orosensory perception of long-chain fatty acids in the mouse. Faseb J

22:1458-1468.

Galindo MM, Voigt N, Stein J, van Lengerich J, Raguse JD, Hofmann T, Meyerhof W,

Behrens M (2012) G protein-coupled receptors in human fat taste perception. Chem

Senses 37:123-139.

Gao Z, Zhang X, Zuberi A, Hwang D, Quon MJ, Lefevre M, Ye J (2004) Inhibition of 30

insulin sensitivity by free fatty acids requires activation of multiple serine kinases

in 3T3-L1 adipocytes. Mol Endocrinol 18:2024-2034.

Garcia J, Lasiter PS, Bermudezrattoni F, Deems DA (1985) A General-Theory of Aversion

Learning. Ann Ny Acad Sci 443:8-21.

Gilbertson TA (1998) Gustatory mechanisms for the detection of fat. Curr Opin Neurobiol

8:447-452.

Gilbertson TA, Yu T, Shah BP (2010) Gustatory Mechanisms for Fat Detection. In: Fat

Detection: Taste, Texture, and Post Ingestive Effects (Montmayeur JP, le Coutre J,

ed), Boca Raton (FL): CRC Press/Taylor & Francis.

Gilbertson TA, Fontenot DT, Liu L, Zhang H, Monroe WT (1997) Fatty acid modulation

of K+ channels in taste receptor cells: gustatory cues for dietary fat. Am J Physiol

272:C1203-C1210.

Glendinning JI, Bloom LD, Onishi M, Zheng KH, Damak S, Margolskee RF, Spector AC

(2005) Contribution of alpha-gustducin to taste-guided licking responses of mice.

Chem Senses 30:299-316.

Greenberg D, Smith GP (1996) The controls of fat intake. Psychosom Med 58:559-569.

Grundy SM, Denke MA (1990) Dietary influences on serum lipids and lipoproteins. J Lipid

Res 31:1149-1172.

Gutzwiller JP, Goke B, Drewe J, Hildebrand P, Ketterer S, Handschin D, Winterhalder R,

Conen D, Beglinger C (1999) Glucagon-like peptide-1: a potent regulator of food

intake in humans. Gut 44:81-86.

Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto Y, Miyazaki 31

S, Tsujimoto G (2005) Free fatty acids regulate gut incretin glucagon-like peptide-

1 secretion through GPR120. Nat Med 11:90-94.

Horio N, Yoshida R, Yasumatsu K, Yanagawa Y, Ishimaru Y, Matsunami H, Ninomiya Y

(2011) Sour taste responses in mice lacking PKD channels. PLoS One 6:e20007.

Huang AL, Chen X, Hoon MA, Chandrashekar J, Guo W, Trankner D, Ryba NJ, Zuker CS

(2006) The cells and logic for mammalian sour taste detection. Nature 442:934-938.

Huang L, Shanker YG, Dubauskaite J, Zheng JZ, Yan W, Rosenzweig S, Spielman AI, Max

M, Margolskee RF (1999) Ggamma13 colocalizes with gustducin in taste receptor

cells and mediates IP3 responses to bitter denatonium. Nat Neurosci 2:1055-1062.

Huang YA, Dando R, Roper SD (2009) Autocrine and paracrine roles for ATP and serotonin

in mouse taste buds. J Neurosci 29:13909-13918.

Huang YA, Maruyama Y, Stimac R, Roper SD (2008) Presynaptic (Type III) cells in mouse

taste buds sense sour (acid) taste. J Physiol 586:2903-2912.

Huang YJ, Maruyama Y, Dvoryanchikov G, Pereira E, Chaudhari N, Roper SD (2007) The

role of pannexin 1 hemichannels in ATP release and cell-cell communication in

mouse taste buds. Proc Natl Acad Sci U S A 104:6436-6441.

Hursting SD, Nunez NP, Varticovski L, Vinson C (2007) The obesity-cancer link: lessons

learned from a fatless mouse. Cancer Res 67:2391-2393.

Imaizumi M, Sawano S, Takeda M, Fushiki T (2000) Grooming behavior in mice induced

by stimuli of corn oil in oral cavity. Physiol Behav 71:409-414.

Itoh Y et al. (2003) Free fatty acids regulate insulin secretion from pancreatic beta cells

through GPR40. Nature 422:173-176. 32

Jaber L, Zhao FL, Kolli T, Herness S (2014) A physiologic role for serotonergic

transmission in adult rat taste buds. PLoS One 9:e112152.

Joost P, Methner A (2002) Phylogenetic analysis of 277 human G-protein-coupled

receptors as a tool for the prediction of orphan receptor ligands. Genome Biol

3:RESEARCH0063.

Jouven X, Charles MA, Desnos M, Ducimetiere P (2001) Circulating nonesterified fatty

acid level as a predictive risk factor for sudden death in the population. Circulation

104:756-761.

Kaaks R, Kuhn T (2014) Epidemiology: obesity and cancer--the evidence is fattening up.

Nat Rev Endocrinol 10:644-645.

Kadohisa M, Verhagen JV, Rolls ET (2005) The primate amygdala: Neuronal

representations of the viscosity, fat texture, temperature, grittiness and taste of

foods. Neuroscience 132:33-48.

Kamphuis MM, Saris WH, Westerterp-Plantenga MS (2003) The effect of addition of

linoleic acid on food intake regulation in linoleic acid tasters and linoleic acid non-

tasters. Br J Nutr 90:199-206.

Karaki S, Mitsui R, Hayashi H, Kato I, Sugiya H, Iwanaga T, Furness JB, Kuwahara A

(2006) Short-chain fatty acid receptor, GPR43, is expressed by enteroendocrine

cells and mucosal mast cells in rat intestine. Cell Tissue Res 324:353-360.

Kawai T, Fushiki T (2003) Importance of lipolysis in oral cavity for orosensory detection

of fat. Am J Physiol Regul Integr Comp Physiol 285:R447-R454.

Keith SW, Redden DT, Katzmarzyk PT, Boggiano MM, Hanlon EC, Benca RM, Ruden D, 33

Pietrobelli A, Barger JL, Fontaine KR, Wang C, Aronne LJ, Wright SM, Baskin M,

Dhurandhar NV, Lijoi MC, Grilo CM, DeLuca M, Westfall AO, Allison DB (2006)

Putative contributors to the secular increase in obesity: exploring the roads less

traveled. Int J Obes (Lond) 30:1585-1594.

Kim MR, Kusakabe Y, Miura H, Shindo Y, Ninomiya Y, Hino A (2003) Regional

expression patterns of taste receptors and gustducin in the mouse tongue. Biochem

Biophys Res Commun 312:500-506.

Kimura I, Inoue D, Maeda T, Hara T, Ichimura A, Miyauchi S, Kobayashi M, Hirasawa A,

Tsujimoto G (2011) Short-chain fatty acids and ketones directly regulate

sympathetic nervous system via G protein-coupled receptor 41 (GPR41). Proc Natl

Acad Sci U S A 108:8030-8035.

Kinney NE, Antill RW (1996) Role of olfaction in the formation of preference for high-fat

foods in mice. Physiol Behav 59:475-478.

Kolesnikov SS, Margolskee RF (1995) A cyclic-nucleotide-suppressible conductance

activated by transducin in taste cells. Nature 376:85-88.

Kotarsky K, Nilsson NE, Flodgren E, Owman C, Olde B (2003) A human cell surface

receptor activated by free fatty acids and thiazolidinedione drugs. Biochem

Biophys Res Commun 301:406-410.

Kulkarni B, Mattes R (2013) Evidence for Presence of Nonesterified Fatty Acids as

Potential Gustatory Signaling Molecules in Humans. Chem Senses 38:119-127.

Kurth T, Gaziano JM, Berger K, Kase CS, Rexrode KM, Cook NR, Buring JE, Manson JE

(2002) Body mass index and the risk of stroke in men. Arch Intern Med 162:2557- 34

2562.

Lattin JE, Schroder K, Su AI, Walker JR, Zhang J, Wiltshire T, Saijo K, Glass CK, Hume

DA, Kellie S, Sweet MJ (2008) Expression analysis of G Protein-Coupled

Receptors in mouse macrophages. Immunome Res 4:5.

Laugerette F, Passilly-Degrace P, Patris B, Niot I, Febbraio M, Montmayeur JP, Besnard P

(2005) CD36 involvement in orosensory detection of dietary lipids, spontaneous fat

preference, and digestive secretions. J Clin Invest 115:3177-3184.

Lavie CJ, Milani RV, Ventura HO (2009) Obesity and cardiovascular disease: risk factor,

paradox, and impact of weight loss. J Am Coll Cardiol 53:1925-1932.

Lawton DM, Furness DN, Lindemann B, Hackney CM (2000) Localization of the

glutamate-aspartate transporter, GLAST, in rat taste buds. Eur J Neurosci 12:3163-

3171.

Le Poul E, Loison C, Struyf S, Springael JY, Lannoy V, Decobecq ME, Brezillon S,

Dupriez V, Vassart G, Van Damme J, Parmentier M, Detheux M (2003) Functional

characterization of human receptors for short chain fatty acids and their role in

polymorphonuclear cell activation. J Biol Chem 278:25481-25489.

Lementowski PW, Zelicof SB (2008) Obesity and osteoarthritis. Am J Orthop (Belle Mead

NJ) 37:148-151.

Leren P (1970) The Oslo Diet-Heart Study: Eleven-Year Report. Circulation 42:935-942.

Liman ER, Zhang YV, Montell C (2014) Peripheral coding of taste. Neuron 81:984-1000.

Lin Y, Berg AH, Iyengar P, Lam TK, Giacca A, Combs TP, Rajala MW, Du X, Rollman B,

Li W, Hawkins M, Barzilai N, Rhodes CJ, Fantus IG, Brownlee M, Scherer PE 35

(2005) The hyperglycemia-induced inflammatory response in adipocytes: the role

of reactive oxygen species. J Biol Chem 280:4617-4626.

Liu L, Hansen DR, Kim I, Gilbertson TA (2005) Expression and characterization of delayed

rectifying K+ channels in anterior rat taste buds. Am J Physiol Cell Physiol

289:C868-880.

Liu M, Simon MI (1996) Regulation by cAMP-dependent protein kinase of a G-protein-

mediated phospholipase C. Nature 382:83-87.

Liu P, Shah BP, Croasdell S, Gilbertson TA (2011) Transient receptor potential channel

type M5 is essential for fat taste. J Neurosci 31:8634-8642.

Lloyd-Jones D et al. (2010) Heart disease and stroke statistics--2010 update: a report from

the American Heart Association. Circulation 121:e46-e215.

Logue J, Murray HM, Welsh P, Shepherd J, Packard C, Macfarlane P, Cobbe S, Ford I,

Sattar N (2011) Obesity is associated with fatal coronary heart disease

independently of traditional risk factors and deprivation. Heart 97:564-568.

LopezJimenez ND, Cavenagh MM, Sainz E, Cruz-Ithier MA, Battey JF, Sullivan SL (2006)

Two members of the TRPP family of ion channels, Pkd1l3 and Pkd2l1, are co-

expressed in a subset of taste receptor cells. J Neurochem 98:68-77.

Lucas F, Ackroff K, Sclafani A (1998) High-fat diet preference and overeating mediated by

postingestive factors in rats. Am J Physiol 275:R1511-R1522.

Martin C, Passilly-Degrace P, Chevrot M, Ancel D, Sparks SM, Drucker DJ, Besnard P

(2012) Lipid-mediated release of GLP-1 by mouse taste buds from circumvallate

papillae: putative involvement of GPR120 and impact on taste sensitivity. J Lipid 36

Res 53:2256-2265.

Matsumura S, Eguchi A, Mizushige T, Kitabayashi N, Tsuzuki S, Inoue K, Fushiki T (2009)

Colocalization of GPR120 with phospholipase-Cbeta2 and alpha-gustducin in the

taste bud cells in mice. Neurosci Lett 450:186-190.

Mattes RD (2009) Oral detection of short-, medium-, and long-chain free fatty acids in

humans. Chem Senses 34:145-150.

Max M, Shanker YG, Huang L, Rong M, Liu Z, Campagne F, Weinstein H, Damak S,

Margolskee RF (2001) Tas1r3, encoding a new candidate taste receptor, is allelic to

the sweet responsiveness locus Sac. Nat Genet 28:58-63.

McCormack DN, Clyburn VL, Pittman DW (2006) Detection of free fatty acids following

a conditioned taste aversion in rats. Physiol Behav 87:582-594.

McGuire BB, Fitzpatrick JM (2011) BMI and the risk of renal cell carcinoma. Curr Opin

Urol 21:356-361.

McLaughlin SK, McKinnon PJ, Margolskee RF (1992) Gustducin is a taste-cell-specific G

protein closely related to the transducins. Nature 357:563-569.

Meinkoth JL, Alberts AS, Went W, Fantozzi D, Taylor SS, Hagiwara M, Montminy M,

Feramisco JR (1993) Signal transduction through the cAMP-dependent protein

kinase. Mol Cell Biochem 127-128:179-186.

Mela DJ, Sacchetti DA (1991) Sensory preferences for fats: relationships with diet and

body composition. Am J Clin Nutr 53:908-915.

Meyer MR, Clegg DJ, Prossnitz ER, Barton M (2011) Obesity, insulin resistance and

diabetes: sex differences and role of oestrogen receptors. Acta Physiol (Oxf) 37

203(1):259-269.

Meyerhof W, Batram C, Kuhn C, Brockhoff A, Chudoba E, Bufe B, Appendino G, Behrens

M (2010) The molecular receptive ranges of human TAS2R bitter taste receptors.

Chem Senses 35:157-170.

Mindell S, Smith GP, Greenberg D (1990) Corn oil and mineral oil stimulate sham feeding

in rats. Physiol Behav 48:283-287.

Morrison MC, Mulder P, Stavro PM, Suarez M, Arola-Arnal A, van Duyvenvoorde W,

Kooistra T, Wielinga PY, Kleemann R (2015) Replacement of Dietary Saturated Fat

by PUFA-Rich Pumpkin Seed Oil Attenuates Non-Alcoholic Fatty Liver Disease

and Atherosclerosis Development, with Additional Health Effects of Virgin over

Refined Oil. PLoS One 10:e0139196.

Nagasaki H, Kondo T, Fuchigami M, Hashimoto H, Sugimura Y, Ozaki N, Arima H, Ota

A, Oiso Y, Hamada Y (2012) Inflammatory changes in adipose tissue enhance

expression of GPR84, a medium-chain fatty acid receptor: TNFalpha enhances

GPR84 expression in adipocytes. FEBS Lett 586:368-372.

Nasser JA, Kissileff HR, Boozer CN, Chou CJ, Pi-Sunyer FX (2001) PROP taster status

and oral fatty acid perception. Eat Behav 2:237-245.

Nelson G, Hoon MA, Chandrashekar J, Zhang Y, Ryba NJ, Zuker CS (2001) Mammalian

sweet taste receptors. Cell 106:381-390.

Nguyen DM, El-Serag HB (2010) The epidemiology of obesity. Gastroenterol Clin North

Am 39:1-7.

Nishizuka Y (1995) Protein kinase C and lipid signaling for sustained cellular responses. 38

FASEB J 9:484-496.

Ogden CL, Carroll MD, Kit BK, Flegal KM (2014) Prevalence of childhood and adult

obesity in the United States, 2011-2012. JAMA 311:806-814.

Ogden CL, Carroll MD, Fryar CD, Flegal KM (2015) Prevalence of Obesity Among Adults

and Youth: United States, 2011-2014. NCHS data brief:1-8.

Oh DY, Talukdar S, Bae EJ, Imamura T, Morinaga H, Fan W, Li P, Lu WJ, Watkins SM,

Olefsky JM (2010) GPR120 is an omega-3 fatty acid receptor mediating potent

anti-inflammatory and insulin-sensitizing effects. Cell 142:687-698.

Ozdener MH, Subramaniam S, Sundaresan S, Sery O, Hashimoto T, Asakawa Y, Besnard

P, Abumrad NA, Khan NA (2014) CD36-and GPR120-Mediated Ca2+ Signaling in

Human Taste Bud Cells Mediates Differential Responses to Fatty Acids and Is

Altered in Obese Mice. Gastroenterology 146:995-1005.

Pereira-Lancha LO, Campos-Ferraz PL, Lancha AHJ (2012) Obesity: considerations about

etiology, metabolism, and the use of experimental models. Diabetes Metab Syndr

Obes 5:75-87.

Phillips CM, Kesse-Guyot E, McManus R, Hercberg S, Lairon D, Planells R, Roche HM

(2012) High dietary saturated fat intake accentuates obesity risk associated with the

fat mass and obesity-associated gene in adults. J Nutr 142:824-831.

Purves D, Augustine GJ, Fitzpatrick D, et al. (2001) The Organization of the Taste System.

In: Neuroscience, 2nd Edition (Purves D, Augustine GJ, Fitzpatrick D, et al., ed):

Sunderland (MA): Sinauer Associates.

Ramirez I (1993) Role of olfaction in starch and oil preference. American Journal of 39

Physiology - Regulatory, Integrative and Comparative Physiology 265:R1404-

R1409.

Renehan AG, MacKintosh ML, Crosbie EJ (2015) Obesity and endometrial cancer:

unanswered epidemiological questions. BJOG.

Rolls ET, Verhagen JV, Kadohisa M (2003) Representations of the texture of food in the

primate orbitofrontal cortex: neurons responding to viscosity, grittiness, and

capsaicin. J Neurophysiol 90:3711-3724.

Ruiz CJ, Wray K, Delay E, Margolskee RF, Kinnamon SC (2003) Behavioral evidence for

a role of alpha-gustducin in glutamate taste. Chem Senses 28:573-579.

Running CA, Mattes RD (2014) Different oral sensitivities to and sensations of short-,

medium-, and long-chain fatty acids in humans. Am J Physiol-Gastr L 307:G381-

G389.

Running CA, Craig BA, Mattes RD (2015) Oleogustus: The Unique Taste of Fat. Chem

Senses 40:507-516.

Samuel BS, Shaito A, Motoike T, Rey FE, Backhed F, Manchester JK, Hammer RE,

Williams SC, Crowley J, Yanagisawa M, Gordon JI (2008) Effects of the gut

microbiota on host adiposity are modulated by the short-chain fatty-acid binding G

protein-coupled receptor, Gpr41. Proc Natl Acad Sci U S A 105:16767-16772.

Schiffman SS, Dackis C (1975) Taste of nutrients: Amino acids, vitamins, and fatty acids.

Atten Percept Psychophys 17:140-146.

Schiffman SS, Graham BG, Sattely-Miller EA, Warwick ZS (1998) Orosensory Perception

of Dietary Fat. Curr Dir Psychol Sci 7:137-143. 40

Sclafani A, Ackroff K, Abumrad NA (2007) CD36 gene deletion reduces fat preference and

intake but not post-oral fat conditioning in mice. Am J Physiol Regul Integr Comp

Physiol 293:R1823-1832.

Senga T, Iwamoto S, Yoshida T, Yokota T, Adachi K, Azuma E, Hamaguchi M, Iwamoto T

(2003) LSSIG is a novel murine leukocyte-specific GPCR that is induced by the

activation of STAT3. Blood 101:1185-1187.

Shah BP, Liu P, Yu T, Hansen DR, Gilbertson TA (2012) TRPM5 is critical for linoleic

acid-induced CCK secretion from the enteroendocrine cell line, STC-1. Am J

Physiol Cell Physiol 302:C210-C219.

Sharma AM, Lau DC (2013) Obesity and type 2 diabetes mellitus. Can J Diabetes 37:63-

64.

Simons PJ, Kummer JA, Luiken JJ, Boon L (2011) Apical CD36 immunolocalization in

human and porcine taste buds from circumvallate and foliate papillae. Acta

Histochem 113:839-843.

Siri-Tarino PW, Sun Q, Hu FB, Krauss RM (2010) Saturated fat, carbohydrate, and

cardiovascular disease. Am J Clin Nutr 91:502-509.

Smith GP, Gibbs J (1975) Cholecystokinin: a putative satiety signal. Pharmacol Biochem

Behav 3:135-138.

Song MJ, Kim KH, Yoon JM, Kim JB (2006) Activation of Toll-like receptor 4 is associated

with insulin resistance in adipocytes. Biochem Biophys Res Commun 346:739-745.

Soulsby MD, Wojcikiewicz RJ (2007) Calcium mobilization via type III inositol 1,4,5-

trisphosphate receptors is not altered by PKA-mediated phosphorylation of serines 41

916, 934, and 1832. Cell Calcium 42:261-270.

Stone LM, Barrows J, Finger TE, Kinnamon SC (2007) Expression of T1Rs and gustducin

in palatal taste buds of mice. Chem Senses 32:255-262.

Suzuki M, Takaishi S, Nagasaki M, Onozawa Y, Iino I, Maeda H, Komai T, Oda T (2013)

Medium-chain fatty acid-sensing receptor, GPR84, is a proinflammatory receptor.

J Biol Chem 288:10684-10691.

Takeda M, Imaizumi M, Fushiki T (2000) Preference for vegetable oils in the two-bottle

choice test in mice. Life Sci 67:197-204.

Takeda M, Sawano S, Imaizumi M, Fushiki T (2001) Preference for corn oil in olfactory-

blocked mice in the conditioned place preference test and the two-bottle choice test.

Life Sci 69:847-854.

Tanaka T, Katsuma S, Adachi T, Koshimizu TA, Hirasawa A, Tsujimoto G (2008) Free fatty

acids induce cholecystokinin secretion through GPR120. Naunyn Schmiedebergs

Arch Pharmacol 377:523-527.

Taruno A, Matsumoto I, Ma Z, Marambaud P, Foskett JK (2013a) How do taste cells

lacking synapses mediate neurotransmission? CALHM1, a voltage-gated ATP

channel. Bioessays 35:1111-1118.

Taruno A, Vingtdeux V, Ohmoto M, Ma Z, Dvoryanchikov G, Li A, Adrien L, Zhao H,

Leung S, Abernethy M, Koppel J, Davies P, Civan MM, Chaudhari N, Matsumoto

I, Hellekant G, Tordoff MG, Marambaud P, Foskett JK (2013b) CALHM1 ion

channel mediates purinergic neurotransmission of sweet, bitter and umami tastes.

Nature 495:223-226. 42

Tazoe H, Otomo Y, Kaji I, Tanaka R, Karaki SI, Kuwahara A (2008) Roles of short-chain

fatty acids receptors, GPR41 and GPR43 on colonic functions. J Physiol Pharmacol

59 Suppl 2:251-262.

Tazoe H, Otomo Y, Karaki S, Kato I, Fukami Y, Terasaki M, Kuwahara A (2009)

Expression of short-chain fatty acid receptor GPR41 in the human colon. Biomed

Res 30:149-156.

Tiniakos DG, Vos MB, Brunt EM (2010) Nonalcoholic fatty liver disease: pathology and

pathogenesis. Annual review of pathology 5:145-171.

Tolhurst G, Heffron H, Lam YS, Parker HE, Habib AM, Diakogiannaki E, Cameron J,

Grosse J, Reimann F, Gribble FM (2012) Short-chain fatty acids stimulate

glucagon-like peptide-1 secretion via the G-protein-coupled receptor FFAR2.

Diabetes 61:364-371.

Tomchik SM, Berg S, Kim JW, Chaudhari N, Roper SD (2007) Breadth of tuning and taste

coding in mammalian taste buds. J Neurosci 27:10840-10848.

Tsuruta M, Kawada T, Fukuwatari T, Fushiki T (1999) The orosensory recognition of long-

chain fatty acids in rats. Physiol Behav 66:285-288.

Turpenien O, J M, PEKKARINEN M, MIETTINEN M, ELOSUO R, PAAVILAINEN E

(1979) Dietary Prevention of Coronary Heart Disease: The Finnish Mental Hospital

Study. Int J Epidemiol 8:99-118. van Dijk SJ, Feskens EJ, Bos MB, Hoelen DW, Heijligenberg R, Bromhaar MG, de Groot

LC, de Vries JH, Muller M, Afman LA (2009) A saturated fatty acid-rich diet

induces an obesity-linked proinflammatory gene expression profile in adipose 43

tissue of subjects at risk of metabolic syndrome. Am J Clin Nutr 90:1656-1664.

Vandenbeuch A, Clapp TR, Kinnamon SC (2008) Amiloride-sensitive channels in type I

fungiform taste cells in mouse. BMC Neurosci 9:1.

Varkevisser B, Kinnamon SC (2000) Sweet taste transduction in hamster: role of protein

kinases. J Neurophysiol 83:2526-2532.

Venkataraman C, Kuo F (2005) The G-protein coupled receptor, GPR84 regulates IL-4

production by T lymphocytes in response to CD3 crosslinking. Immunol Lett

101:144-153.

Voigt N, Stein J, Galindo MM, Dunkel A, Raguse JD, Meyerhof W, Hofmann T, Behrens

M (2014) The role of lipolysis in human orosensory fat perception. J Lipid Res

55:870-882.

Wang J, Wu X, Simonavicius N, Tian H, Ling L (2006) Medium-chain fatty acids as ligands

for orphan G protein-coupled receptor GPR84. J Biol Chem 281:34457-34464.

Wang L, Manson JE, Forman JP, Gaziano JM, Buring JE, Sesso HD (2010) Dietary fatty

acids and the risk of hypertension in middle-aged and older women. Hypertension

56:598-604.

Wang Z, Liu D, Wang F, Liu S, Zhao S, Ling EA, Hao A (2012) Saturated fatty acids

activate microglia via Toll-like receptor 4/NF-kappaB signalling. Br J Nutr

107:229-241.

Wittenberger T, Schaller HC, Hellebrand S (2001) An expressed sequence tag (EST) data

mining strategy succeeding in the discovery of new G-protein coupled receptors. J

Mol Biol 307:799-813. 44

Xiong Y, Miyamoto N, Shibata K, Valasek MA, Motoike T, Kedzierski RM, Yanagisawa

M (2004) Short-chain fatty acids stimulate leptin production in adipocytes through

the G protein-coupled receptor GPR41. Proc Natl Acad Sci U S A 101:1045-1050.

Xu H, Staszewski L, Tang H, Adler E, Zoller M, Li X (2004) Different functional roles of

T1R subunits in the heteromeric taste receptors. Proc Natl Acad Sci U S A

101:14258-14263.

Yan W, Sunavala G, Rosenzweig S, Dasso M, Brand JG, Spielman AI (2001) Bitter taste

transduced by PLC-beta(2)-dependent rise in IP(3) and alpha-gustducin-dependent

fall in cyclic nucleotides. Am J Physiol Cell Physiol 280:C742-C751.

Yee CL, Yang R, Bottger B, Finger TE, Kinnamon JC (2001) "Type III" cells of rat taste

buds: immunohistochemical and ultrastructural studies of neuron-specific enolase,

protein gene product 9.5, and serotonin. J Comp Neurol 440:97-108.

Yousefi S, Cooper PR, Potter SL, Mueck B, Jarai G (2001) Cloning and expression analysis

of a novel G-protein-coupled receptor selectively expressed on granulocytes. J

Leukoc Biol 69:1045-1052.

Zhang X, Fitzsimmons RL, Cleland LG, Ey PL, Zannettino AC, Farmer EA, Sincock P,

Mayrhofer G (2003) CD36/fatty acid translocase in rats: distribution, isolation from

hepatocytes, and comparison with the scavenger receptor SR-B1. Lab Invest

83:317-332.

Zhao GQ, Zhang Y, Hoon MA, Chandrashekar J, Erlenbach I, Ryba NJ, Zuker CS (2003)

The receptors for mammalian sweet and umami taste. Cell 115:255-266.

45

Figure 1.1. Prevalence of self-reported obesity among U.S. adults by state and territory,

Behavioral Risk Factor Surveillance System, 2014. 46

Figure 1.2. Localization of taste papillae on human tongue. Fungiform are spread on the middle and front of tongue; circumvallate are located on the back of tongue; foliate are on the sides of tongue (Calvo and Egan, 2015). 47

Figure 1.3. Ascending gustatory pathway. Chorda tympani (cranial nerves VII) and glossopharyngeal (cranial nerves IX) nerves innervate the taste buds from fungiform and circumvallate, respectively. They carry the taste signals to the gustatory nucleus of the solitary tract in medulla, the thalamus, and finally to the primary gustatory cortex (Purves et al., 2001). 48

Figure 1.4. Schematic representation of a taste bud and four types of taste cells. Type I cells are glial-like cells providing support to other cells and regulating molecular environment of the taste buds. They were also involved in salty taste transduction. Type II cells are primary sensors for tastants and express a variety of receptors to recognize different taste qualities. Type III cells are presynaptic cells that synapse with gustatory afferent nerves, and they also contribute to sour taste. Taste cell precursors (also known as

Type IV cells) are responsible for taste cell renewal (Calvo and Egan, 2015). 49

Figure 1.5. Putative transduction pathway for long-chain unsaturated fatty acids (LCFAs) in taste cells. LCFAs are transported by CD36 or directly bind to their cognate GPCRs and activated the G-proteins. The ßγ subunits of the activated G-protein dissociate and stimulate PLCß2, which then cleave PIP2 into DAG and IP3. IP3 then interact with IP3R3

on the ER membrane and release Ca2+ from the ER calcium store to cytosol. Ca2+ activate

TRPM5 and allow extracellular Na+ influx into the cytosol, which leads to taste cell

depolarization and followed by opening of DRK channels. The fatty acid-sensitive DRK

channels are inhibited by free LCFAs, which prolongs the depolarization phase of an action potential and opens VGCCs. The combination of cell depolarization and elevated intracellular Ca2+ level then triggers the release of neurotransmitters. 50

Figure 1.6. Hypothesized GPR84-mediated MCFA taste transduction pathway. MCFAs bind to GPR84 and activate gustucin. The ß3γ13 subunits work the same as showen in the

LCFA taste transduction pathway (Figure 1.5), however, the inherent activity of PKA can inhibit PLCß2 and IP3R3. α-gustducin activates PDE and in turn cleaves the cAMP to AMP.

Decreased cAMP then inhibits the activity of PKA, which relieves its inhibition to PLCß2

2+ 2+ and IP3R3, and finally the Ca are released from ER store. Ca and DAG work together to activate PKC, which can phosphorylate and close DRK channels, and, in turn, depolarize the taste cells and trigger neurotransmitter release. Decreased cAMP can also release its inhibition to the cAMP suppressible cation channel and depolarize the taste cells.

51

CHAPTER II

GUSTATORY MECHANISMS FOR MEDIUM-CHAIN FATTY ACID

DETECTION IN MICE

Abstract

It has been almost twenty years since investigators started to study the gustatory recognition of fatty acids, and in the interim most of the studies in this area have focused on the long-chain unsaturated fatty acids. However, medium-chain saturated fatty acids

(MCFA) are also an important form of dietary fatty acids, and there is limited knowledge concerning the gustatory responsiveness to and possible transduction mechanisms of

MCFAs in taste cells. In this study, I showed that MCFAs are effective taste stimuli at both the cellular and behavioral levels. To elucidate the mechanisms of gustatory recognition of

MCFAs in mice, antagonists of several important players that might be involved in this pathway were used in electrophysiological experiments. Capric acid-induced currents were significantly inhibited by GDP-ß-S and the inhibitors of protein kinase A (PKA) and protein kinase C (PKC), which suggested that the currents were activated downstream of

G-protein, PKA and PKC activation. However, these currents were not affected by the phospholipase C (PLC) and phosphodiesterase (PDE) inhibitors, suggesting they were not involved in the MCFA taste transduction pathway. Further, loss of transient receptor potential channel type M5 (TRPM5) did not affect either the lauric acid-induced intracellular Ca2+ change or taste sensitivity to lauric acid, indicating that MCFA

transduction in mouse taste cells is TRPM5-independent. My results indicated that MCFAs 52

are sapid compounds that work through a pathway that is independent of the well- documented pathway for long-chain unsaturated fatty acids (Liu et al., 2011) and suggested increasing complexity to mechanisms underlying the ‘taste of fat’.

Introduction

Obesity has become one of the most common health problems worldwide and there has been a corresponding increase in cardiovascular disease, diabetes, cancer, and other nutrition-related disorders following obesity. Given that an increase in dietary fat intake is regarded as one of the factors closely linked with the obesity epidemic (Bray et al., 2004), it has become increasingly important to identify the mechanisms the body uses to recognize dietary fat. A review about the detection of fat (Gilbertson, 1998) stated that, besides the texture of the food, rodents and humans also recognize the presence of fat in foods by the

gustatory mechanisms in the mouth, this suggests that an orosensory system may be

responsible for the detection and preference of fat.

Currently, most of the research on transduction mechanisms for fat (i.e. fatty acid)

taste has focused on long-chain polyunsaturated fatty acids (LCFAs). The Gilbertson

laboratory completed a series of studies that have elucidated the pathway for the taste

transduction of linoleic acid, which is a typical long-chain fatty acid. Linoleic acid interacts

with a GPCR in a subset of Type II taste cells, which then activates G proteins-PLC

pathway and produces second messengers, which finally activate the taste cells through

TRPM5 channels (Liu et al., 2011). This pathway is similar to the sweet, bitter, and umami

taste transduction pathways. Besides LCFAs, saturated fatty acids are very common in our

food supply, and include items such as dairy products, fatty meats, palm oil, coconut oil, 53

and many processed foods (Funaki, 2009). Compared with LCFAs, saturated fatty acids actually pose a greater heath risk. However, there is limited knowledge concerning their

ability to activate the gustatory system and even less about their possible transduction

mechanisms. In the course of our work in the laboratory, we have found that a variety of

MCFAs were capable of activating taste cells. And some human studies suggested that

MCFAs had detectable oral detection thresholds (Mattes, 2009, Running and Mattes, 2014,

Running et al., 2015).

In this study, I explored the ability of the gustatory system to respond to MCFAs in mice by using both cellular and behavioral assays, and showed for the first time that they were effective taste stimuli. I also identified both Type II and Type III taste cells were able to respond to MCFAs. Moreover, I characterized the transduction pathway by using pharmacological approaches and a knockout mice model. Together, this study greatly expands our knowledge for gustatory detection of dietary fat.

Materials and Methods

Animals

The production of TRPM5 knockout strain has been described in detail previously

(Damak et al., 2006), and the GFP-PLCß2 and GFP-GAD67 strains have also been described in previous studies (Chattopadhyaya et al., 2004, Kim et al., 2006). All

experiments were performed on adult (2-6 months) male C57BL/6J, TRPM5 knockout,

GFP-PLCß2, or GFP-GAD67 mice, and they were raised with water and normal mouse

chow provided ad libitum in a room with 12-h:12-h day/night cycle. All procedures

involving animals were approved by the Institutional Animal Care and Use Committee of 54

Utah State University and were performed in accordance with American Veterinary

Medical Association guidelines.

Solutions

Tyrode’s solution contained (in mM) 140 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10

HEPES, 10 glucose, and 10 Na pyruvate; adjusted pH to 7.40 with NaOH and osmolarity

to 300 ~ 330 mOsm/L with NaCl. Calcium-magnesium free Tyrode’s solution (Ca2+-Mg2+

free Tyrode’s) contained (in mM): 140 NaCl, 5 KCl, 2 BAPTA, 10 HEPES, 10 glucose,

and 10 Na pyruvate; pH was adjusted to 7.40 with NaOH and osmolarity to 300 ~ 330

mOsm/L with NaCl. Hanks’ buffered salt solution (HBSS) with HEPES, Na pyruvate, and fetal bovine serum (HHP with 2% FBS) contained: 98% 1×HBSS, 1% HEPES, 1% Na pyruvate, and 2% heat-inactivated fetal bovine serum (FBS). Intracellular solution used in

whole-cell voltage clamp recording contained (in mM): 140 K gluconate, 1 CaCl2, 2 MgCl2,

10 HEPES, 11 EGTA, 3 ATP, and 0.5 GTP; pH adjusted to 7.20 with KOH and osmolarity

to 305 ~ 315 mOsm/L with K gluconate as necessary. U73122, an inhibitor of PLC,

Guanosine 5′-[β-thio]diphosphate trilithium salt (GDP-ß-S), an inhibitor of G-protein activation, and H-89 dihydrochloride hydrate, an inhibitor of PKA were purchased from

Sigma-Aldrich (St. Louis, MO). U73122 was dissolved in chloroform, aliquoted to 0.6

µmol per tube, and then evaporated to film under a nitrogen stream. Immediately before each experiment, an aliquot was dissolved in ethanol to 0.6 mM, and then diluted in

Tyrode’s solution to a final concentration of 3 µM. GDP-ß-S was dissolved in water to a stock solution of 50 mg/mL, and diluted in the intracellular solution to a final concentration of 1 mM. H-89 was also dissolved in water to a 10 mg/mL stock, and diluted in Tryode’s 55

solution to a final concentration of 3 µM. IBMX (3-isobutyl-1-methylxanthine (Enzo Life

Science, Farmingdale, NY), an inhibitor of PDE, was dissolved in DMSO to a 50 mg/mL

stock solution, and then diluted in Tyrode’s solution to a final concentration of 0.1 mM..

Bisindolylmaleimide II, an inhibitor of PKC was purchased from VWR Scientific (Radnor,

PA). It was dissolved in DMSO to a stock solution of 100 mM, and then diluted in Tyrode’s solution to a final concentration of 0.2 µM. All the stock solutions was stored in -20 °C,

and diluted right before experiments. The sodium salt forms of all the fatty acids were bought from Sigma-Aldrich (St. Louis, MO), and the fatty acid solutions were prepared fresh by dissolving in Tyrode’s solution (cellular assays) or water (behavioral assay). Fatty acid perfusion in calcium imaging was followed by 0.1% fatty acid free bovine serum albumin (BSA, Sigma) in Tyrode’s solution.

Taste Cell Isolation

Tongues were removed, then rinsed and immediately immersed in ice-cold

Tyrode’s solution. A mixed enzyme solution of collagenase I (1 mg/ml), dispase II (2.45 mg/ml), and trypsin inhibitor (1 mg/ml) was injected between the muscle layer and the lingual epithelium of the tongues. The injected tongue was incubated in a Ca2+-Mg2+ free

Tyrode’s solution and bubbled with O2 for 45 min at room temperature. Following

incubation, the lingual epithelium was removed from the underlying muscle layer with

forceps, pinned out in a Sylgard-lined petri dish and incubated in the same enzyme solution

for appropriately 7 minutes. Then the epithelium was incubated in the Ca2+-Mg2+ free

Tyrode’s solution for another 10 minutes. Taste buds were moved from the epithelium under low magnification microscope by gentle suction from a fire-polished pipette and 56 plated immediately onto a coverslip coated with Corning® Cell-Tak™ Cell and Tissue

Adhesive (Corning, NY) for calcium imaging and patch clamp recording.

Calcium Imaging

The procedure of calcium imaging has been described in detail in previous studies

(Liu et al., 2011). Single taste cells were loaded with intracellular calcium indicator Fura-

2, AM (5 µM, Invitrogen) in HHP buffer with 2% FBS for 1 hour at room temperature in a dark room. The coverslip was then mounted onto an imaging chamber (RC-25F or RC-

26Z, Warner Instruments), placed on the stage of an inverted microscope (Nikon TE-100), and perfused continuously with Tyrode’s or tastant solutions dissolved in Tyrode’s. A monochromator (Bentham FSM150, Intracellular Imaging Inc.) was used to deliver excitation wavelengths (340 and 380 nm) with a 100-watt xenon lamp to illuminate the

Fura-2 AM loaded taste cells. The cell fluorescence was recorded through a CCD camera linked to the inverted microscope, and controlled by an imaging software (Incyt Im2™).

The monochromator was calibrated beforehand to construct a standard calibration curve of the ratio of fluorescence at 340 and 380 nm vs. calcium concentration using the Calcium

Calibration Buffer Kit (Life Technologies, CA) with pentapotassium salt of Fura-2 as the indicator. During the calcium imaging experiment, fluorescence ratio of 340 nm/380 nm was directly converted to calcium concentration using this calibration curve. Different

MCFA solutions were applied extracellularly with a bath perfusion system at a flow rate of 4 ml/min for 2.5 min, following with 1 min of 0.1% fatty acid free BSA solution, and then the solution was switched to regular Tyrode’s until the calcium signal returned to near baseline level. Data analyses were based on the area under the curve (AUC) of each calcium 57

response calculated with Gaussian multi-peak function by the analytical software Origin 7

(OriginLab, Northampton MA). The AUC between the taste cells from wild type and

TRPM5 knockout mice were compared by an unpaired two-tailed Student’s t-test and

significance was set at α = 0.05.

Whole Cell Voltage Clamp Recording

Capric acid-induced currents were recorded in voltage clamp mode with an

Axopatch-200B amplifier (Molecular Devices, Sunnyvale, CA). Borosilicate patch

pipettes were pulled on a Sutter P-97 puller (Sutter Instruments, Novato CA) and then fire

polished on a microforge (model MF-9; Narishige, East Meadow NY) to a resistance of 4-

11 MΩ. Series resistance and cell capacitance were compensated optimally before recording. pCLAMP software (version 10, Molecular Devices, Sunnyvale, CA), which

interfaced to the amplifier with a Digidata 1322 A A/D board (Axon Instruments, Union

City, CA), was used to deliver commands and collect data. Data were collected at 2-5 kHz and filtered on-line at 1 kHz. A patch pipette was sealed onto the cell membrane to obtain resistance of at least 1 GΩ, and then more suction was applied to rupture the membrane

patch (whole cell mode). Typical input resistance of cells recorded in this fashion was 1

to several GΩ. Capric acid-induced currents were recorded at a holding potential of -100

mV. Our prototypical MCFA, capric acid (200 µM), was applied focally from a pipette positioned near the cell and delivered for a period of 10 s by a PicoSpritzer III (Parker

Hannifin Corp, Cleveland, OH) controlled by pCLAMP software. Different inhibitors except GDP-ß-S, which was dissolved in the intracellular solution, were diluted in

Tyrode’s buffer and applied in bath 30 secs before and during capric acid application. The 58 magnitude of the currents induced by capric acid before and after inhibitor application were compared by a paired, two-tailed Student’s t-test. Significance was set at α = 0.05 for all the analysis.

Conditioned Taste Aversion Assay

Details of the conditioned taste aversion (CTA) assay have been described previously (Pittman et al., 2008, Liu et al., 2011). Before the tests, mice were given ad libitum access to water until 24 hours prior to water training when the mice were placed on a 23.5-hour water restriction schedule for the duration of the CTA assay. Right after the training/conditioning/testing on each of the water restriction days, all mice were given 30 minutes access to water. Mice were first water trained in a MS-160 Davis Rig gustatory behavioral apparatus for 3 ~ 4 days until they have similar lick numbers for each of 24 presentations of water. Then taste aversions were conditioned through 3 consecutive days of pairing the conditioned stimulus (CS) and the unconditioned stimulus (US). During conditioning, mice were given 5 minutes access to 600 µM of lauric or capric acid as the

CS. Once the mice stopped licking, they were given the same fatty acid orally with syringes.

The US was immediately administered through intraperitoneal injections (20 ml/kg body weight dosage) of 150 mM of LiCl to induce gastric distress or 150 mM of NaCl as a control condition. Signs of gastric malaise include lying in an extended prone position, immobility, and a lack of rearing or cage exploration compared with the controls. 11 test taste stimuli were used on testing days besides water, including 10, 30, 100, 300, and 600

μM of lauric or capric acid (depending on the CS used), 100 μM of linoleic acid, 300 μM of undecanoic acid, 300 μM of capric or lauric acid (depending on the CS used), 100 mM 59

sucrose, 2 mM denatonium benzoate, and 100 mM NaCl. All testing was conducted in the

same MS-160 Davis Rig as water training. In order to reduce olfactory cues for the fatty

acids, a fan was placed near the animal chamber to provide constant airflow along the

longitudinal axis of the stimulus delivery tray. The test session included 2 blocks of 12

presentations with shutter opening for 5 s, and the wait times for the first lick were 150 s.

The sequences of the 12 stimuli were arranged randomly. In order to compensate individual

variances in the water-restricted motivation across the mice, the total number of licks per

stimulus was summarized between the 2 trials and normalized by a ratio of licks to test stimulus/licks to water. Trials with zero lick number were excluded from the subsequent

analysis. The unpaired, two-tailed Student’s t-test were used to analyze the differences

between LiCl and NaCl-injected groups within each tastant and significance was set at α =

0.05.

Results

MCFAs Activated Mouse Taste Cells.

To explore the ability of mice taste cells to respond to MCFAs, I used two different

kinds of cellular assays with capric acid (C10:0) and lauric acid (C12:0) as representative

MCFAs stimuli since they were suggested to be the most potent ligands for the receptor of

MCFAs based on my preliminary data and that from a previous study (Wang et al., 2006).

Intracellular calcium concentration change is a good indicator for cell activity, so

functional calcium imaging was conducted on single taste cells stimulated with capric acid

or lauric acid from wild type mice. Taste cells were isolated using our established methods

(Liu et al., 2011). In functional calcium imaging, the taste cells were loaded with Fura-2 60

AM and stimulated with a series of concentrations (10 µM, 30 µM, 100 µM, and 300 µM) of lauric acid in Tyrode’s solution for 2.5 min. Bath application of lauric acid at concentrations greater than 30 µM induced a robust intracellular Ca2+ rise in single taste

cells, and the responses were concentration dependent (Figure 2.1). I also used 100 µM of

capric acid as a stimulus in the same calcium imaging procedure, and about 8% of the taste cells showed capric acid-induced calcium responses (AUC = 16777 ± 2728, n = 26, Figure

2.2A).

To verify the results, I also performed whole-cell voltage clamp recording on mouse taste cells. 200 µM capric acid was applied by rapid perfusion with a stimulus pipette positioned near the isolated taste cells, and induced a quick inward current (-68.6 ± 5.2 pA, n = 46, Figure 2.2B) on a slightly higher percentage of taste cells than the proportion that responded using calcium imaging. The inward current reached a sharp peak about 1 s after applying the capric acid, and then gradually decreased during the rest of the stimulus. The taste cells also received repetitive stimulations of capric acid on different time intervals.

The results showed that the response to capric acid adapted very quickly, and one second was already enough for the taste cells to recover from the previous stimulation. Both calcium imaging and patch clamp recording experiments suggested that MCFAs were able to activate native mouse taste cells.

Both Type II and Type III Taste Cells Were Activated by MCFAs.

After confirming that taste cells were able to respond to MCFAs, I conducted additional experiments to determine the subtypes of taste cells that respond to MCFAs. We have in the laboratory transgenic mice expressing enhanced green fluorescent protein (GFP) 61

under control of the PLCß2 (GFP-PLCß2) (Kim et al., 2006) or GAD67 (GFP-GAD67)

(Chattopadhyaya et al., 2004, Tomchik et al., 2007) promoter. PLCß2 is the beta-2 isoform of PLC, which is a key player in Ca2+ release after taste receptors are stimulated. Many taste cells express PLCß2 and it is considered to be a marker for Type II tastes cells because it is essential for the taste transduction of sweet, bitter, and umami (Zhang et al., 2003,

Dotson et al., 2005). GAD67 is an isoform of glutamic acid decarboxylase (GAD), which is an enzyme that responsible for GABA synthesis, and it is suggested to be the marker for

Type III taste cells (Dvoryanchikov et al., 2011). I performed both functional calcium imaging and patch clamp recording using the isolated taste cells from GFP-PLCß2 and

GFP-GAD67 mice. In calcium imaging, the criterion for calcium responses is its

reversibility and having a peak amplitude that was at least ten times the standard deviation

of baseline fluctuation. 62 out of 166 (37.3%) GFP positive taste cells from GFP-PLCß2

mice had calcium responses to MCFAs (100 µM of lauric and capric acids mixture, Figure

2.3 A), and 29 out of 52 (55.8% ) GFP positive taste cells from GFP-GAD67 mice were activated by MCFAs in calcium imaging (Figure 2.3 B), which suggested that MCFAs could activate both Type II and Type III taste cells in mice.

In order to verify the calcium imaging data, I performed the patch clamp recording on the taste cells from both GPF labeled strains. Consistent with the calcium imaging data, capric acid induced robust inward currents on the GPF labeled taste cells from both strains of mice (Figure 2.3 E, F), including 66% (8 out of 12) Type II taste cells and 75% (6 out of 8) type III taste cells. The time course of the currents induced in both type of taste cells were similar with each other, they all reached a sharp peak about 1s after capric acid 62

application, and then decreased slowly. All the results indicated that both Type II and Type

III taste cells are MCFA sensitive.

Wild Type Mice Were Able to Detect MCFAs Behaviorally.

To determine the ability of MCFAs to be detected in vivo, I performed CTA

paradigm on wild type mice (Liu et al., 2011), where the mice were conditioned to avoid

lauric acid by using 600 µM of lauric acid as the conditioned stimulus. The results of the

CTA assays showed that LiCl-injected wild type mice significantly avoided lauric acid at

concentrations higher than 30 µM (Figure 2.4 A), which suggested that lauric acid was an

effective taste stimulus in vivo. Control mice (injected with NaCl) showed no such aversion.

And the taste aversion to lauric acid had generalized to both capric and undecanoic acid

(Figure 2.4 B), as expected since they all belong to the same MCFA category and were

reported as ligands for GPR84 (Wang et al., 2006). There was no generalization with other

GPCR-mediated taste stimuli, such as sweet, bitter, or linoleic acid (Figure 2.4 B). Overall,

the results were consistent with the cellular assays mentioned above.

TRPM5 Is Not Essential for MCFAs Taste Transduction

Previous studies in our laboratory concluded that transient receptor potential

channel type M5 (TRPM5) was essential in long-chain fatty acid transduction in mouse

taste cells (Liu et al., 2011). Cellular responses to linoleic acid in Type II taste cells, for

example, occurred in a qualitatively similar fashion to sweet, bitter and umami stimuli.

Therefore, I wanted to test if TRPM5 was also essential for MCFA transduction pathway,

and a transgenic mouse model lacking TRPM5 (TRPM5-/-) was used in cell-based and

behavioral assays to do so. MCFA-induced changes in intracellular calcium in the taste 63

cells isolated from TRPM5-/- mice were measured using functional calcium imaging as described above. Lauric acid (100 µM) elicited qualitatively similar changes in intracellular

Ca2+ rise in taste cells from TRPM5-/- mice (AUC = 26130 ± 10560, n = 7, Figure 2.5 A)

compared to taste cells from wild type mice (AUC = 28710 ± 6388, n = 11, Figure 2.5 B).

The responses of the taste cells were calculated by area under the calcium response curves,

and there was no significant difference between wild type and TRPM5-/- groups (p = 0.8267,

Figure 2.5 C), consistent with the interpretation that TRPM5 channels are not an essential component in MCFA transduction signaling pathway.

CTA assays were also conducted to verify the role of TRPM5 in MCFA taste transduction. In a manner similar to that already described (see above), mice (TRPM5-/- or wild type) were injected with either LiCl or NaCl (controls) immediately following a single exposure to 600 µM of lauric acid. Similar to wild type mice, LiCl-injected TRPM5-/- mice

showed significant avoidance to lauric acid in the same low micromolar range (Figure 2.5

D)，suggesting TRPM5-/- mice have similar taste sensitivity to lauric acid as wild type mice. These results further confirmed that TRPM5 channel is not required in MCFA

transduction in the mouse taste system.

Downstream Signaling Pathway for MCFA Taste Transduction

In order to begin to elucidate the transduction pathway for MCFAs, I used pharmacological approaches to determine the involvement of potential second messenger pathways, where I inhibited suspected second messengers that might be involved in the downstream signaling as hypothesized earlier (Chapter I).

The Gilbertson laboratory has elucidated the taste transduction pathway for LCFAs, 64

which couples to G-protein and PLCß2 (Liu et al., 2011), and this pathway remains an

important frame of reference for the possible MCFA taste transduction pathway (see Figure

1.5 in Chapter I). Therefore, I first investigated the involvement of G-proteins and PLCß2.

GDP-ß-S (1 mM) was used to block the activation of G-proteins by mixing into the intracellular solution during whole cell voltage clamp recording, and the inward currents induced by capric acid were recorded both with and without GDP-ß-S. The results showed that the inward currents produced by capric acid (Figure 2.6 A) stimulation were almost completely abolished when the activation of G-proteins was blocked (n = 14, Figure 2.6

B), suggesting that G-protein was required in the taste transduction of capric acid.

The blocker of PLCß2, U73122 (3 µM), was also used during voltage clamp recording as stated above. But instead of being applied intracellularly, U73122 was mixed in the extracellular solution and applied 30 seconds before and during the focal release of capric acid. The results showed that U73122 had no significant effect on the capric acid- induced inward current (control: -55.3 ± 14.0 pA; U73122: -59.8 ± 20.0 pA; p = 0.7241, n

= 5, Figure 2.6 C, D), which indicated that in contrast to the long-chain fatty acid taste transduction pathway, taste cells activation by MCFAs does not depend on PLCß2.

Previous studies showed that cell activation by MCFAs caused cAMP inhibition

(Wang et al., 2006), therefore, the next component under investigation was phosphodiesterase (PDE), because it catalyzes the breakdown of cAMP into AMP. The inhibitor of PDE, IBMX (0.1 mM), was used in the same manner as U73122 described above (Figure 2.7). The current induced by capric acid (-57.2 ± 9.8 pA, n = 10) was not significantly reduced by IBMX (-58.8 ± 9.4 pA, n = 10, p = 0.8062), which indicated that 65

PDE was not activated downstream after taste cells were activated by MCFAs.

The involvement of PKA and PKC was also investigated based on my initial hypothesis (see Figure 1.6 in Chapter I). The antagonists of PKA, H-89 (3 µM), was applied extracellularly during voltage clamp recording (Figure 2.8), and it significantly inhibited the capric acid-induced current (control: -72.9 ± 19.0 pA; H89: -32.4 ± 5.6 pA, n = 6, p <

0.05), suggesting PKA played an important role in MCFA transduction. By using the same method, the inhibitor of PKC, bisindolylmaleimide II (0.2 µM), was also applied on taste cells. Similar with the PKA inhibitor, the inward current produced by capric acid (-66.2 ±

10.7 pA, n = 8) was also significantly reduced by PKC inhibitor (-53.1 ± 9.6 pA, n = 8, p

< 0.05). However, the inhibition effect of PKC inhibitor was smaller compared with the

PKA inhibitor (Figure 2.9), suggesting that although PKC was involved in MCFA taste transduction, it likely plays a less important role in this process.

Discussion

In the current study, I have shown that MCFAs are able to elicit calcium response and inward current in native taste cells of mice, including both Type II and Type III taste cells. MCFAs are also effective taste stimuli in vivo, proved by the conditioned taste aversion assays. In addition, capric acid-induced currents were significantly inhibited by

GDP-ß-S and inhibitors of PKA and PKC, which suggested that the currents were activated downstream of G-protein, PKA, and PKC activation. However, these currents were not affected by the PLCß2 and PDE inhibitors, suggesting PLCß2 and PDE were not involved in the MCFA taste transduction pathway.

It has been almost twenty years since we started to study the gustatory recognition 66

of fatty acids, and most of the studies focused on the long-chain unsaturated fatty acids,

especially linoleic acid, since it is a qualitatively more effective fatty acid taste stimulus.

However, dietary fatty acids also include other forms of fatty acids, such as MCFAs, and

there is limited knowledge concerning the possible transduction mechanisms of MCFAs in

taste cells. So far, only one group showed that MCFAs were detectable in humans (Mattes,

2009, Running and Mattes, 2014), no other studies have reported the taste of MCFAs or on the ability of MCFA to activate taste cells. This study is the first that supported the notion that MCFAs are effective taste stimuli at both the cellular and behavioral levels.

Intracellular calcium concentration change is a good indicator for cell activity, so

functional calcium imaging was conducted on single taste cells from wild type mice while

stimulated with MCFAs. The calcium responses induced by MCFAs were similar with

those produced by linoleic acid in respect to amplitude and time course (Liu et al., 2011).

The inward current elicited by MCFAs, however, were generally smaller than those

attributed to linoleic acid (Liu et al., 2011). This may reflect the fact that LCFAs activate

TRPM5 downstream, while MCFAs, like lauric or caproic acid, do not. The nature of the

channel carrying the MCFA-induced current has not been identified in the present study.

Despite best efforts to provide a more complete characterization of the MCFA-induced

current, ion substitution experiments produced equivocal results due to the relatively small

amplitude of these currents and their adapting nature. This difficulty may be exacerbated

by our finding that both Type II and Type III cells respond to MCFAs and these different

cell types may not necessarily be utilizing a common transduction pathway. Future

experiments performed on identifiable cell types will be required to determine the 67

molecular nature of this channel in the same way the involvement of TRPM5 was assessed in LCFA transduction.

Different types of taste cells express unique receptors and channels and they have different functions, the taste recognition requires cross talk among Type I, II, and III taste cells (Besnard et al., 2016). Therefore, the knowledge of which type of taste cells respond to a certain taste stimulus can help us predict the possible signaling pathway being activated.

Previous studies in our lab showed that long-chain unsaturated fatty acids activated primarily Type II cells but also a small fraction of Type III taste cells. Similar to this,

MCFAs could also elicit responses in a similar fraction of both Type II and Type III taste cells. This finding provided the first clue to investigate if a similar signaling pathway was involved both in MCFA and LCFA transduction.

To date, GPCRs, like GPR120, are believed to be the cognate receptors for fatty acids on taste cells (Matsumura et al., 2007, Cartoni et al., 2010). I hypothesized that

GPR84 is the primary receptor of MCFAs in taste transduction based on the current knowledge on MCFAs signaling pathways (Wang et al., 2006) and their expression in the taste system, which will be more fully described in the next chapter. Previous studies concluded that MCFAs activated GPR84, and then coupled to a pertussis toxin-sensitive pathway (Wang et al., 2006). In addition, research in our lab showed that the linoleic acid induced responses coupled with activation of G-proteins (Liu et al., 2011). Consistent with previous studies, the capric acid-induced inward current was virtually eliminated by GDP-

ß-S, suggesting that MCFAs-induced responses couple to G-proteins. This result further confirmed the possible involvement of GPCRs in initiating the MCFA-activated signaling 68

pathway in the peripheral taste system.

Previous studies concluded that TRPM5 played a critical role in long-chain fatty acid transduction in mouse taste cells. The taste cells from TRPM5 knockout mice showed significantly decreased responses to linoleic acid, and behaviorally, mice lacking TRPM5 showed no preference and reduced sensitivity to linoleic acid (Liu et al., 2011). Similar experiments were done on TRMP5 knockout mice, but instead of using linoleic acid as the tastant, I used lauric acid. However, knocking out of TRPM5 didn’t have significant effects on either taste cell responses in vitro nor taste sensitivity in vivo, suggesting that TRPM5 was not involved in the MCFA signaling pathway in mouse taste cells. Another important

component involves in long-chain fatty acid taste transduction is PLC (Liu et al., 2011),

but applying the antagonist of PLCß2 did not reduce the taste cell responses to capric acid.

The differences in the involvement of TRPM5 and PLC indicated that MCFA transduction

pathway in mouse taste cells is significantly different with for the long-chain unsaturated

fatty acids.

In leukocytes, GPR84 activation by MCFAs couples to a pertussis toxin-sensitive

Gi/o pathway, where it caused calcium mobilization and 3´,5´-cyclic AMP (cAMP) inhibition (Wang et al., 2006). α-gustducin, which belongs to the Gi/o family, is abundantly

expressed in taste cells (McLaughlin et al., 1992) and might play a key role in sweet, umami, and bitter taste transduction pathway (Ruiz et al., 2003, Glendinning et al., 2005).

Therefore, I hypothesized that α-gustducin is the G-protein that responsible for MCFA signaling pathway in taste cells, and α-gustducin is able to activate phosphodiesterase (PDE) and, in turn, decrease intracellular cAMP in taste cells (Kolesnikov and Margolskee, 1995, 69

Kinnamon, 2009). I didn’t have an α-gustducin knockout model to test its involvement

directly, but I found that by applying the antagonist of PDE during the whole cell voltage

clamp recording, the inward current induced by capric acid was not reduced significantly,

which suggested that PDE was not involved in the MCFA signaling pathway. Therefore, the MCFA activated G-protein might not be α-gustducin. My data showed that the antagonist of PKA significantly reduced the inward current induced by capric acid, suggesting MCFA signaling pathway involves the activation of PKA, which is also an indirect evidence of the cAMP involvement because PKA activation requires cAMP

(Meinkoth et al., 1993). How exactly cAMP was produced is still under investigation, but one known signaling pathway for sugar transduction can provide some insight into this process. Sucrose and other sugars activate Gs by interacting with GPCRs, and the activated

Gαs then activate adenylyl cyclase (AC) to produce cAMP. cAMP is able to activate PKA,

which in turn close the basolateral K+ channels by phosphorylation (Avenet et al., 1988a,

b, Naim et al., 1991, Margolskee, 2002, Abaffy et al., 2003). Similar with this sugar

transduction pathway, MCFA taste transduction also involves G-protein and PKA

activation, and my next step will be testing the involvement of AC in this process by using

AC blockers.

I also used PKC inhibitor during whole cell voltage clamp and the results showed

that the inward current produced by capric acid was slightly but significantly decreased by

PKC inhibitor, which indicated that PKC activation was followed with taste recognition of

capric acid, although it may be not as important as the role of PKA. The involvement of

PKC in taste transduction is not a new concept. It has been demonstrated that the 70

transduction of synthetic sweeteners required the activation of PKC (Varkevisser and

Kinnamon, 2000). How exactly PKC was activated is unclear. A well-known PKC activation pathway is PLC dependent, where PLC hydrolyses phosphatidylinositol 4,5 bisphosphate and releases inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG), IP3

and DAG can be generated and Ca2+ can be released from ER store. Ca2+ and DAG together

then work together to activate protein kinase C (PKC) (Nishizuka, 1995). However, PLC

is not involved in MCFA transduction based on my studies, so it likely relies on a PLC-

independent PKC activation pathway, which is poorly understood but has been studied in

several studies (Villalba et al., 2002, Yang et al., 2006, Hao et al., 2015).

References

Abaffy T, Trubey KR, Chaudhari N (2003) Adenylyl cyclase expression and modulation of

cAMP in rat taste cells. Am J Physiol Cell Physiol 284:C1420-C1428.

Avenet P, Hofmann F, Lindemann B (1988a) Signalling in taste receptor cells: cAMP-

dependent protein kinase causes depolarization by closure of 44 pS K-channels.

Comp Biochem Physiol A Comp Physiol 90:681-685.

Avenet P, Hofmann F, Lindemann B (1988b) Transduction in taste receptor cells requires

cAMP-dependent protein kinase. Nature 331:351-354.

Besnard P, Passilly-Degrace P, Khan NA (2016) Taste of Fat: A Sixth Taste Modality?

Physiol Rev 96:151-176.

Bray GA, Paeratakul S, Popkin BM (2004) Dietary fat and obesity: a review of animal,

clinical and epidemiological studies. Physiol Behav 83:549-555.

Cartoni C, Yasumatsu K, Ohkuri T, Shigemura N, Yoshida R, Godinot N, le Coutre J, 71

Ninomiya Y, Damak S (2010) Taste Preference for Fatty Acids Is Mediated by

GPR40 and GPR120. J Neurosci 30:8376-8382.

Chattopadhyaya B, Di Cristo G, Higashiyama H, Knott GW, Kuhlman SJ, Welker E, Huang

ZJ (2004) Experience and activity-dependent maturation of perisomatic

GABAergic innervation in primary visual cortex during a postnatal critical period.

J Neurosci 24:9598-9611.

Damak S, Rong M, Yasumatsu K, Kokrashvili Z, Perez CA, Shigemura N, Yoshida R,

Mosinger B, Jr., Glendinning JI, Ninomiya Y, Margolskee RF (2006) Trpm5 null

mice respond to bitter, sweet, and umami compounds. Chem Senses 31:253-264.

Dotson CD, Roper SD, Spector AC (2005) PLCbeta2-independent behavioral avoidance of

prototypical bitter-tasting ligands. Chem Senses 30:593-600.

Dvoryanchikov G, Huang YA, Barro-Soria R, Chaudhari N, Roper SD (2011) GABA, its

receptors, and GABAergic inhibition in mouse taste buds. J Neurosci 31:5782-5791.

Funaki M (2009) Saturated fatty acids and insulin resistance. J Med Invest 56:88-92.

Gilbertson TA (1998) Gustatory mechanisms for the detection of fat. Curr Opin Neurobiol

8:447-452.

Glendinning JI, Bloom LD, Onishi M, Zheng KH, Damak S, Margolskee RF, Spector AC

(2005) Contribution of alpha-gustducin to taste-guided licking responses of mice.

Chem Senses 30:299-316.

Hao S, Meng Y, Li W, Hu SY, Yang DH (2015) Activation of phospholipase C-independent

protein kinase C signaling pathway of parathyroid hormone enhances CITED1

expression in mouse osteoblasts. Nan Fang Yi Ke Da Xue Xue Bao 35:486-491. 72

Kim JW, Roberts C, Maruyama Y, Berg S, Roper S, Chaudhari N (2006) Faithful

expression of GFP from the PLCbeta2 promoter in a functional class of taste

receptor cells. Chem Senses 31:213-219.

Kinnamon SC (2009) Umami taste transduction mechanisms. Am J Clin Nutr 90:753S-

755S.

Kolesnikov SS, Margolskee RF (1995) A cyclic-nucleotide-suppressible conductance

activated by transducin in taste cells. Nature 376:85-88.

Liu P, Shah BP, Croasdell S, Gilbertson TA (2011) Transient receptor potential channel

type M5 is essential for fat taste. J Neurosci 31:8634-8642.

Margolskee RF (2002) Molecular mechanisms of bitter and sweet taste transduction. J Biol

Chem 277:1-4.

Matsumura S, Mizushige T, Yoneda T, Iwanaga T, Tsuzuki S, Inoue K, Fushiki T (2007)

GPR expression in the rat taste bud relating to fatty acid sensing. Biomed Res

28:49-55.

Mattes RD (2009) Oral detection of short-, medium-, and long-chain free fatty acids in

humans. Chem Senses 34:145-150.

McLaughlin SK, McKinnon PJ, Margolskee RF (1992) Gustducin is a taste-cell-specific G

protein closely related to the transducins. Nature 357:563-569.

Meinkoth JL, Alberts AS, Went W, Fantozzi D, Taylor SS, Hagiwara M, Montminy M,

Feramisco JR (1993) Signal transduction through the cAMP-dependent protein

kinase. Mol Cell Biochem 127-128:179-186.

Naim M, Ronen T, Striem BJ, Levinson M, Zehavi U (1991) Adenylate cyclase responses 73

to sucrose stimulation in membranes of pig circumvallate taste papillae. Comp

Biochem Physiol B 100:455-458.

Nishizuka Y (1995) Protein kinase C and lipid signaling for sustained cellular responses.

FASEB J 9:484-496.

Pittman DW, Smith KR, Crawley ME, Corbin CH, Hansen DR, Watson KJ, Gilbertson TA

(2008) Orosensory detection of fatty acids by obesity-prone and obesity-resistant

rats: Strain and sex differences. Chem Senses 33:449-460.

Ruiz CJ, Wray K, Delay E, Margolskee RF, Kinnamon SC (2003) Behavioral evidence for

a role of alpha-gustducin in glutamate taste. Chem Senses 28:573-579.

Running CA, Craig BA, Mattes RD (2015) Oleogustus: The Unique Taste of Fat. Chem

Senses 40:507-516.

Running CA, Mattes RD (2014) Different oral sensitivities to and sensations of short-,

medium-, and long-chain fatty acids in humans. Am J Physiol-Gastr L 307:G381-

G389.

Tomchik SM, Berg S, Kim JW, Chaudhari N, Roper SD (2007) Breadth of tuning and taste

coding in mammalian taste buds. J Neurosci 27:10840-10848.

Varkevisser B, Kinnamon SC (2000) Sweet taste transduction in hamster: role of protein

kinases. J Neurophysiol 83:2526-2532.

Villalba M, Bi K, Hu J, Altman Y, Bushway P, Reits E, Neefjes J, Baier G, Abraham RT,

Altman A (2002) Translocation of PKCθ in T cells is mediated by a

nonconventional, PI3-K– and Vav-dependent pathway, but does not absolutely

require phospholipase C. J Cell Biol 157:253-263. 74

Wang J, Wu X, Simonavicius N, Tian H, Ling L (2006) Medium-chain fatty acids as ligands

for orphan G protein-coupled receptor GPR84. J Biol Chem 281:34457-34464.

Yang D, Guo J, Divieti P, Bringhurst FR (2006) Parathyroid hormone activates PKC-delta

and regulates osteoblastic differentiation via a PLC-independent pathway. Bone

38:485-496.

Zhang Y, Hoon MA, Chandrashekar J, Mueller KL, Cook B, Wu D, Zuker CS, Ryba NJ

(2003) Coding of sweet, bitter, and umami tastes: different receptor cells sharing

similar signaling pathways. Cell 112:293-301.

75

[Lauric acid] 10 µM 30 µM 100 µM 300 µM

Time (200 s) [Ca2+] (50 nM)

Figure 2.1. Calcium response induced by lauric acid was concentration dependent.

Intracellular calcium changes in taste cells were measured using functional calcium imaging when applying a series of concentrations of lauric acid in Tyrode’s solution for

2.5 min. Then the cells were perfused with 1 mg/ml BSA in Tyrode’s solution to wash out lauric acid. Bath application of lauric acid that is higher than 30 µM induced a robust intracellular Ca2+ rise in taste cells, and the response was concentration dependent.

76

A B CA CA

2 s 20 pA Time (100 s)

Ca2+] (20 nM)

C 2

1 (relative to control) to (relative Response current amplitude Response current

0 0 2 4 6 8 Time interval (s)

Figure 2.2. Taste cell responses induced by capric acid (CA). (A). Bath application of capric acid (100 µM) elicited an intracellular calcium rise in mouse taste cell. (B). Focal application of capric acid (200 µM) induced a rapid inward current in mouse taste cell. (C).

Capric acid (200 µM) was applied on mouse taste cells (n=6) repetitively on different time

intervals, and 1 s interval was already enough for the cells to recover and generate similar

current response again. 77

A B LA + CA CA

2 s

20 pA

Time (50 s)

[Ca2+] (20 nM)

C D LA + CA CA

2 s

20 pA Time (50 s)

[Ca2+] (20 nM)

Figure 2.3. Both Type II and Type III taste cells were activated by MCFAs. In calcium imaging, lauric (LA) and capric (CA) acids mixture (100 μM) induced robust calcium increases in GFP positive taste cell from both GFP-PLCß2 (A) and GFP-GAD67 mice (C).

And among all the cells collected, 37.3% (62 out of 166) of GFP-PLCß2 and 55.8% (29 out of 52) of GFP-GAD67 taste cells responded to MCFAs. Voltage clamp recording data showed that capric acid (200 μM) elicited rapid inward currents in both GFP-PLCß2 (B) and GFP-GAD67 (D) taste cells. 78

A

1.5

* * * *

1.0 LiCl NaCl

0.5 Relative lick ratio (test/water) ratio lick Relative

0.0 0 200 400 600 800 Lauric acid (µ M)

B 1.5 LiC l * NaCl

* 1.0

0.5 Relative lick ratio (test/water) ratio lick Relative 0.0

M) M) M) µ µ µ

DB (3 mM)

NaCl (100 mM)

Sucrose (100 mM) Capric acid (200 Linoleic acid (200 Undecanic acid (200

Figure 2.4. Wild type mice were able to detect MCFAs. (A) Relative lick ratios (mean ±

SEM) for different concentrations of lauric acid (10, 30, 100, 300, 600 μM) in wild type mice on day two after CTA. n = 7 for LiCl group, and n = 5 for NaCl group. Asterisks indicate significant differences between two groups (p < 0.05). (B) Relative lick ratios

(mean ± SEM) for other MCFAs and GPCR-mediated taste stimuli. 79

A B LA LA

Time (50 s) Time (50 s) [Ca2+] (20 nM) [Ca2+] (20 nM)

C D 1.5 * 40000 * * *

30000 * 1.0 LiC l 20000 NaCl

0.5 10000 Area Under Curve

0 Relative lick ratio (test/water) ratio lick Relative

WT TRPM5 KO 0.0 0 200 400 600 800 Lauric acid (µ M)

Figure 2.5. TRPM5 is not essential for MCFAs taste transduction. Lauric acid (LA, 100

µM) induced similar intracellular calcium rise in both TRPM5+/+ (A) and TRPM5-/- taste cells (B). The area under the curve (mean ± SEM) to of these two groups were compared using an unpaired two-tailed Student’s t-test (α = 0.05) with the sample size as n = 7 for

TRPM5+/+ taste cells and n = 9 for TRPM5-/- taste cells (C). (D) On day two after CTA test on TRPM5-/- mice, relative lick ratios (mean ± SEM) were recorded and calculated for different concentrations of lauric acid (10, 30, 100, 300, 600 μM). n = 4 for LiCl group, and n = 6 for NaCl group. Asterisks indicate significant differences two groups (p < 0.05). 80

A CA B CA 5 s 20 pA 5 s 20 pA

C D CA CA

5 s 5 s 10 pA 10 pA

E

Control U73122 0

-50 (pA)

-100 Capric acid Capric induced current induced

-150

Figure 2.6. MCFA taste transduction involves G-protein activation but does not involve

PLCß2. Focal application of capric acid (CA, 200 µM) induced an inward current in wild type taste cells (A), and this current was almost completely abolished by GDP-ß-S (B).

However, capric acid (200 µM) induced similar inward currents with (C) and without (D)

U73122 (PLCß2 inhibitor). The amplitudes of the currents (mean ± SEM) in both groups were not significantly different (E, n = 5, p = 0.7241). Data were analyzed by a paired two- tailed Student’s t-test and significance was set at α = 0.05. 81

A B

CA CA

5 s 5 s

10 pA 10 pA

C Control IB M X 0

-20

-40 (pA)

Capric acid Capric -60 induced current induced

-80

Figure 2.7. MCFA taste transduction does not involve PDE activation. Capric acid (CA,

200 µM) induced an inward current in the wild type taste cell (A), and this current was not

reduced significantly by the PDE inhibition, IBMX (B, p = 0.8062). (C) Mean response ±

SEM to capric acid with (n = 10) or without IBMX (n = 10) inhibition. Data were analyzed by a paired two-tailed Student’s t-test and significance was set at α = 0.05.

82

A B

CA CA

5 s 5 s 20 pA 20 pA

C

Control H89 0

-20

-40

(pA) -60 Capric acid Capric -80 induced current induced

-100

Figure 2.8. MCFA taste transduction involves PKA activation. The rapid inward current

(A) induced by capric acid (CA, 200 µM) was significantly inhibited by the antagonist of

PKA (H89, n = 6, p < 0.05, B, C). The amplitudes of the currents were expressed as mean

± SEM. Data were analyzed by a paired two-tailed Student’s t-test and significance was set at α = 0.05.

83

A B CA CA

5 s 5 s

20 pA 20 pA

C

Control B isindolylm aleim ide II 0

-20

-40 (pA)

Capric acid Capric -60 induced current induced

-80

Figure 2.9. MCFA taste transduction involves PKC activation. Capric acid (CA, 200 µM) induced a fast inward current in mouse taste cells (A), and this current was slightly but significantly reduced by the antagonist of PKC (Bisindolylmaleimide II, n = 8, p < 0.05, B,

C). The amplitudes of the currents were expressed as mean ± SEM. Data were analyzed by a paired two-tailed Student’s t-test and significance was set at α = 0.05.

84

CHAPTER III

GPR84 IS ESSENTIAL FOR THE TASTE OF MEDIUM-CHAIN

SATURATED FATTY ACIDS

Abstract

Previous research has shown that GPR84 is a novel G protein-coupled receptor

(GPCR) activated by medium-chain saturated fatty acids (MCFAs) of C9 to C14 in length

(Venkataraman and Kuo, 2005, Wang et al., 2006), and the real-time PCR results showed

that the mRNA of GPR84 was expressed in taste cells. Fura-2 based ratiometric calcium

imaging was used to characterize GPR84 in a cell line that had an inducible GPR84 + Gqi9

(a chimeric G-protein; (Wang et al., 2006)). I found that GPR84 functioned as a receptor

for saturated fatty acids from C6 to C12 and other fatty acids (oleic acid, arachidic acid) previously not thought to activate this receptor. Using whole cell patch clamp recording, I have shown that capric acid (C10) induced a quick inward current in wild type taste cells at resting potentials, and this current was significantly reduced in taste cells from GPR84 knockout mice. The calcium response to capric acid in GPR84 knockout taste cells was also significantly reduced compared to the wild type taste cells. In behavioral studies, the mice lacking GPR84 showed reduced taste sensitivities to both lauric (C12) and capric acid

(C10). All the data above supported the idea that GPR84 plays a very important role in

MCFA taste transduction process. 85

Introduction

The prevalence of individuals who are overweight or obese has nearly doubled

during the past two decades, and obesity increases the risk of heart disease, diabetes, and

even some types of cancer (Hursting et al., 2007, Wang et al., 2010, Logue et al., 2011,

Meyer et al., 2011). Overconsumption of dietary fat is regarded as one of the factors closely

linked with the obesity epidemic (Bray et al., 2004). Therefore, understanding the

mechanisms of fatty acid detection in the oral cavity can help the identification of potential

strategies to reduce fat intake, such as designing fat substitutes, and, in turn, help create a

healthier diet.

Accumulating evidence has established the existence of the “taste of fat”, and more

and more studies have focused on identifying the mechanisms of fatty acid taste

transduction. Gilbertson and colleagues were the first to show that extracellular application

of cis-polyunsaturated fatty acids was able to activate native taste cells from rats by

inhibiting delayed rectifying potassium channels (Gilbertson et al., 1997). Subsequently, it

became clear that there were additional receptors upstream of delayed rectifying potassium

channel, and support for both cluster of differentiation 36 (CD36) and fatty acid-activated

GPCRs emerged (Gilbertson and Khan, 2014). Support for the involvement of fatty acid

receptors in taste system, two bottle taste preference tests showed that knocking out of

GPR120 or GPR40 significantly reduced the preference for linoleic acid in mice (Cartoni

et al., 2010b). Furthermore, downstream of these receptors, G-protein, phopholipase beta-

2 (PLCß2), and transient receptor potential channel type M5 (TRPM5) are important second massagers involved in fatty acid taste transduction based on recent studies in our 86

lab (Liu et al., 2011).

All the studies above, however, were focusing on the gustatory mechanism of long-

chain unsaturated fatty acids, little research has been done on unveiling the taste

transduction of saturated fatty acids, although they pose greater threats to human health.

We have found that a variety of medium-chain saturated fatty acids (MCFAs) were capable

of activating taste cells, and some studies in humans suggested that MCFAs had detectable

oral detection thresholds (Mattes, 2009, Running and Mattes, 2014, Running et al., 2015).

GPR84 is a novel G protein-coupled receptor (GPCR) expressed predominantly in hematopoietic tissues, and can be activated by MCFAs of C9 to C14 in length (Wang et al.,

2006). It has been suggested that GPR84 activation by MCFAs couples primarily to a

pertussis toxin-sensitive Gi/o pathway, in which MCFAs caused calcium mobilization,

3´,5´-cyclic AMP inhibition, and [35S]GTPγS binding (Wang et al., 2006).

In this study, I investigated the expression of GPR84 in native taste cells, and the

ligand specificity of GPR84 on a cell line expressing inducible GPR84 receptors. GPR84

knockout mice model was used to study the involvement of GPR84 receptor in MCFA taste

transduction in both cellular and behavioral assays.

Materials and Methods

GPR84-Expressing Cell Line

The special HEK293 cell line was designed to express GPR84 in an inducible

fashion under control by the tetracycline (TET) promoter. It was constructed by and a

generous gift of International Flavor and Fragrances Inc. (International Flavors &

Fragrances, Inc.). The specific constructs I utilized was an inducible GPR84 + Gqi9 (a 87

chimeric G-protein; (Wang et al., 2006)). This cell line has been cloned, validated by

PCR/qPCR and verified for function in FLIPR®-based calcium assays. All cells were

cultured in the cell culture medium DMEM with GlutaMax (Invitrogen) supplemented with

10% tetracycline-free fetal bovine serum (FBS, Fisher). 10 μg/ml Blasticidin S HCl

(Invitrogen) and 100 μg/ml Hygromycin B (Invitrogen) were added to the medium to select

the antibiotic-resistant cells. To induce the expression of transfected GPR84 receptor genes,

0.5 μg/ml doxycycline were added to the culture medium 24 hours before experiments.

Non-induced cells served as controls.

Animals

The GPR84 knockout model (GPR84-/-) was created by Taconic (Hudson, NY) on

a pure C57BL/6N background. It was made by incorporating a knockout gene, in which

the single exon was replaced by a LacZ/Neo cassette by homologous recombination

(Figure 3.1). GPR84 knockout mice were bred with two heterozygote (GPR84+/-) parents,

and GPR84+/-and GPR84-/- mice were identified by genotyping. I checked their general health condition by measuring their body weight and body composition every week for 20 weeks. All experiments were performed on adult (2-5 months) male C57BL/6J or GPR84

knockout mice, and they were raised with water and normal mouse chow provided ad

libitum in a room with 12-h:12-h day/night cycle. All procedures involving animals were approved by the Institutional Animal Care and Use Committee of Utah State University and were performed in accordance with American Veterinary Medical Association guidelines.

88

Genotyping

DNAs were extracted from ear tissues by DirectPCR lysis Reagent (Viagen Biotech,

CA) according to manufacturer’s protocol. Then GPR84 genotyping was carried out by

two separate polymerase chain reaction (PCR) to specifically amplify either the wild type

or the knockout allele. The primers used are shown in Table 3.1. Final reaction cocktail

(20 μL) contains 1× GoTaq® Reaction Buffer (Promega, WI), 1.75 mM Mg2+, 0.2 mM

dNTPs, 0.3 µM forward and reverse primers, 1 µL template DNA extracted

by DirectPCR® Lysis Reagent, and 0.025 U/μl GoTaq® DNA Polymerase (Promega,

WI). The PCR was performed in Eppendorf® Mastercycler (Sigma-Aldrich, MO) with the

programming as follows: 10 cycles of 94 °C for 15 s, 65 °C for 30 s (decrease 1 °C per

cycle), and 72 °C for 40 s. Then 30 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for

40 s. After PCR, the samples were electrophoresed in 2% agarose in 1×TAE (Tris-Acetate-

EDTA) buffer (Fisher BioReagents, NJ) with 1×SYBR® Safe DNA Gel Stain (Invitrogen,

CA). Then the gel was imaged in a Gel Doc XR+ system (Bio-Rad, CA).

Solutions

Tyrode’s buffer contained (in mM) 140 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 HEPES,

10 glucose, and 10 Na pyruvate; pH was adjusted to 7.40 with NaOH and osmolarity to

300 ~ 330 mOsm/L with NaCl, if necessary. Calcium-magnesium free Tyrode’s (Ca2+-

Mg2+ free Tyrode’s) solution contained (in mM): 140 NaCl, 5 KCl, 2 BAPTA, 10 HEPES,

10 glucose, and 10 Na pyruvate; adjusted pH to 7.40 with NaOH and, as needed, osmolarity to 300 ~ 330 mOsm/L with NaCl. Solution used to dilute Fura-2 AM for calcium imaging

on taste cells (HHP with 2% FBS) contained: 98% 1× Hanks' Balanced Salt Solution, 1% 89

HEPES, 1% Na pyruvate, and 2% heat-inactivated fetal bovine serum (FBS). Intracellular

solution used in whole-cell voltage clamp recording contained (in mM): 140 K gluconate,

1 CaCl2, 2 MgCl2, 10 HEPES, 11 EGTA, 3 ATP, and 0.5 GTP; pH was adjusted to 7.20

with KOH and osmolarity was adjusted to 305 ~ 315 mOsm/L with K gluconate. All the

fatty acids (sodium salt) were bought from Sigma-Aldrich (St. Louis, MO), and they were dissolved in Tyrode’s solution (cellular assays) or water (behavioral assay) to make fatty acid solutions.

Taste Cell Isolation

Details of taste cell isolation procedure were described before (Liu et al., 2011).

Briefly, tongues of the mice were removed, rinsed, and then immersed immediately in the

ice-cold Tyrode’s solution. An enzyme mixture including collagenase I (1 mg/ml), dispase

II (2.45 mg/ml), and trypsin inhibitor (1 mg/ml) was injected under the lingual epithelium

of the tongue, which was then incubated at room temperature in Ca2+-Mg2+ free Tyrode’s

solution with O2 bubbled for 45 minutes. The lingual epithelium was separated from the

underlying muscle layer and pinned out in a Sylgard-lined petri dish, followed by

incubation in the same enzyme mixture for 7 minutes, and subsequently in the Ca2+-Mg2+

free Tyrode’s solution for another 10 minutes. Taste bud isolation was performed under

low magnification microscope with a fire-polished pipette, and the isolated taste buds were

placed on a coverslip coated with Corning® Cell-Tak™ Cell and Tissue Adhesive

(Corning, NJ) for calcium imaging and patch clamp recording.

Real-Time PCR

RNA was extracted from taste cells isolated from mouse by RNeasy Plus Micro Kit 90

(Qiagen, Valencia, CA) and analyzed with ExperionTM RNA HighSens Analysis Kit

(BIO-RAD, Hercules, California). Then cDNA was synthesized by the iScript cDNA

Synthesis Kit (BIO-RAD, Hercules, California). All the procedures above were performed according to the manufacturers’ protocols. Commercially available TaqMan® Gene

Expression Assays (Thermo Fisher Scientific, Waltham, MA) were then used to detect the expression of GPR84. Final reaction cocktail (20 μL) contains: 1× reaction buffer, 0.2 mM

dNTPs, 2.5 mM Mg2+, 0.06 μM forward and reverse primers for GAPDH, 0.2 µM GAPDH

probe, TaqMan® gene expression mix for GPR84 (1.25 μL in 25 μL reaction, Thermo

Fisher Scientific, MA), 2 μL template cDNA, and 0.05 U/μl HotMaster Taq (5 Prime, MD).

The GAPDH probe was Texas Red-labeled and the GPR84 probe was FAM-labeled. The expression levels of GPR84 from different types of papillae was normalized to the expression level of the housekeeping gene GAPDH within the same sample by the equation:

ΔCtGPR84 = CtGPR84 - CtGAPDH. Ct is the number of cycles required for the fluorescence signal to cross the threshold. Then GPR84 expression was compared to GPR120 in circumvallate

(calibrator) by the equation ΔΔCt = ΔCtGPR84 - ΔCtGPR120. At last, the ∆ΔCt was

exponentially transformed to represent the relative expression (R) to the calibrator: =

2 . 𝑅𝑅 ∆ΔCt

Calcium Imaging

The procedure of calcium imaging has been described in detail in a previous study

(Liu et al., 2011). For cell lines, suspended cells in culture medium were plated onto 12 mm coverslips with cell medium and incubated in the incubator for about 2 hours until most of the cells attached stably to the coverslips. Then the plated cells were rinsed with 91

Tyrode’s solution, loaded with 4 μM of the ratiometric intracellular calcium indicator Fura-

2, AM (Invitrogen) in Tyrode’s with 0.25% pluronic acid solution, and incubated at 37°C

for 45 min in the cell incubator. For taste cells, single taste cells on coverslips were loaded

with the Fura-2, AM in HHP buffer with 2% FBS for 1 hour at room temperature in dark.

The coverslips were then mounted onto an imaging chamber (RC-25F or RC-26Z, Warner

Instruments) and imaged under an inverted microscope (Nikon TE-100). The excitation

wavelengths of 340 and 380 nm were generated by a monochromator (Bentham FSM150,

Intracellular Imaging Inc.) to excite Fura-2. Each cell was outlined and the fluorescence in

the outlined area was recorded by an imaging software coupled to the monochromator

(Incyt Im2™) through a CCD camera linked to the microscope. A standard curve of the ratio of fluorescence (340 nm/380 nm) vs. calcium concentration was calibrated beforehand using Calcium Calibration Buffer Kit (Life Technologies, CA) with pentapotassium salt of Fura-2 as the indicator. During calcium imaging, the calcium concentration was directly calculated by the calibration curve from the ratio of fluorescence.

MCFA solutions were applied by a bath perfusion system at a flow rate of 4 ml/min for 2.5 minutes, followed by 1 min of 0.1% fatty acid free bovine serum albumin (BSA) in

Tyrode’s solution and then regular Tyrode’s solution to wash away the fatty acids until the calcium signal returned to the baseline. The calcium response was quantified by the area under the curve (AUC), which was calculated with Gaussian multi-peak function by Origin

7 (OriginLab, Northampton MA). The calcium response between the taste cells from wild type and GPR84-/- mice were compared by an unpaired two-tailed Student’s t test and

significance was set at α = 0.05. To generate the does-response curves for lauric and capric 92

acids on GPR84-HEK cells, a series of lauric or capric acid at concentrations of 1, 3, 10,

30, and 100 μM were applied to the cells, and AUC was calculated as the calcium response.

Does-response curves were fitted using GraphPad software (Graphpad Software Inc., CA)

to the following equation:

Y=Min + (Max-Min)/(1+10^((LogEC50-X)))

Where Max and Min are plateaus in the units of the Y axis.

Whole Cell Voltage Clamp Recording

Voltage clamp mode with an Axopatch-200B amplifier (Molecular Devices,

Sunnyvale, CA) was used to record the capric acid-induced currents in taste cells.

Borosilicate patching pipettes were pulled by a Sutter P-97 puller (Sutter Instruments,

Novato CA) and fire polished by a microforge (model MF-9; Narishige, East Meadow NY).

The resistances of the patching pipettes were 4-11 MΩ. pCLAMP software (version 10,

Molecular Devices, Sunnyvale, CA) was used to deliver commands and collect data, and it was interfaced to the amplifier with a Digidata 1322 A A/D board (Axon Instruments,

Union City, CA). Data were collected at 2-5 kHz and filtered on-line at 1 kHz. In order to record a whole cell current, a seal with the resistance higher than 1 GΩ was needed between the patching pipette and the cell membrane, and then more suction was applied to rupture the membrane patch to reach a whole cell mode. Series resistance and cell capacitance were compensated optimally before recording, and the whole cell currents were recorded with a holding potential of -100 mV. Focal application of capric acid was delivered by a pipette positioned near the cell and controlled by a PicoSpritzer III (Parker Hannifin Corp,

Cleveland, OH). The currents recorded in wild type and GPR84 knockout taste cells were 93

compared by an unpaired, two-tailed Student’s t-test, and significance was set at α = 0.05.

Conditioned Taste Aversion assay

Details of the conditioned taste aversion (CTA) assay have been described

previously (Pittman et al., 2008, Liu et al., 2011). Mice were placed on a 23.5-hour water

restriction schedule for the duration of the CTA assay starting at 24 hours before water

training, where they were given 30 min access to water right after

training/conditioning/testing experiment on each day. Water training and testing were both

performed in a MS-160 Davis Rig gustatory behavioral apparatus. Firstly, mice were trained with water for 3 ~ 4 days until they have stable numbers of licks for each of at least

20 presentations. The next 3 consecutive days, taste aversions were constructed by pairing

the conditioned stimulus (CS) and the unconditioned stimulus (US). Mice were given 5

minute access to 600 µM of lauric or capric acid as the CS, and then the same CS orally

with syringes right before injecting the US. 150 mM of LiCl was injected intraperitoneally

(20 ml/kg body weight dosage) as the US to induce gastric distress, the signs of which

included moving slowly, lying in an extended prone position, and stopping exploration in

the cage. 150 mM of NaCl was injected to the control group. On testing days, a fan was

placed near the animal chamber to provide constant airflow along the longitudinal axis of

the stimulus delivery tray to reduce olfactory effect of the fatty acids. Besides water, the

test solutionsincluded 10, 30, 100, 300, and 600 μM of lauric or capric acid, 100 μM of

linoleic acid, 300 μM of undecenoic acid, 300 μM of capric or lauric acid, 100 mM sucrose,

2 mM denatonium benzoate, and 100 mM NaCl. The sequences of the tastants were

arranged randomly, and the test session included 2 blocks of 12 presentations with shutter 94

opening for 5 s, and the wait times for the first lick were 150 s. The total number of licks

per stimulus was averaged between the 2 trials and normalized relative to the licks to water

presentations. Trials with zero licks were removed from the analysis. The differences

between LiCl and saline-injected groups within each tastant were compared by an unpaired, two-tailed Student’s t-test and significance was set at α = 0.05.

Results

Evaluation of GPR84 Knockout Mice.

Weights of GPR84+/+, GPR84+/-, and GPR84-/- mice were monitored every week

from age 4 to 20 weeks (Figure 3.2 A). The results showed that mice with different

genotypes all grew steadily, and GPR84+/- and GPR84-/- mice had significantly higher body weights than GPR84+/+ mice for every testing week (p < 0.05, n = 4~10). Body fat

compositions were also measured every 4 weeks from age 8 to 20 week (Figure 3.2 B).

GPR84+/- mice showed higher body fat composition than GPR84+/+ and GPR84-/- mice for

all the testing ages. At 20 week, GPR84+/+ mice showed significantly lower body fat

composition than both GPR84+/- and GPR84-/- mice (p < 0.05, n = 4~10). Although the deletion of GPR84 caused the differences among three genotype group on growth and body fat composition, GPR84-/- mice were in a healthy state by all indices within the age of my

experiments.

GPR84 Receptor mRNA Is Expressed in Taste Cells.

To determine if GPR84 receptors present in native taste cells, I examined the

expression of its mRNA in taste buds from wild type mice by quantitative real-time PCR 95

(qPCR). Taste buds from fungiform, foliate, and circumvallate papillae were isolated and

analyzed separately. The mRNAs from the taste buds were exacted and then the cDNAs

were synthesized and used in qPCR for quantitative evaluation. The mRNA expression of

GPR120 was used to compare the GPR84 expression levels. The qPCR results showed that

the mRNA of GPR84 expressed in the taste cells from fungiform (ΔCt = 10.2 ± 0.9, n = 4),

foliate (ΔCt = 7.8 ± 1.2, n = 9), and circumvallate papillae (ΔCt = 7.2 ± 0.9, n = 9), and the

expression in circumvallate was the highest. The expression level of GPR84 is 30% ~ 40%

of GPR120 within each papillae (Figure 3.3). Previous studies have shown that GPR120

was highly expressed in taste cells (Cartoni et al., 2010a, Montmayeur et al., 2011),

although the GPR84 expression level was not as high as GPR120, it was still significant.

Ligand Specificity of GPR84.

The ligand specificity of GPR84 was tested on a heterologous expression cell line which was designed to express GPR84 in an inducible fashion under control by the tetracycline promoter, and the gene expression of this cell line was validated by qPCR. By using functional calcium imaging, we recorded the intracellular calcium rise stimulated by

a variety of fatty acids in HEK293 cells with induced GPR84 receptors and Gqi9. The

results showed that caproic (C6:0), caprylic (C8:0), capric (C10:0), undecanoic (C11:0), lauric

(C12:0), oleic (C18:1), and arachidic acids (C20:2) all elicited a robust and reversible calcium

increase in the cells induced to express GPR84 receptors, while in the non-induced control cells, they could not induce any calcium responses (Figure 3.4).

To characterize the ligand sensitivity of GPR84, the concentration-response functions for activation of GPR84 by lauric and capric acids were investigated using 96

ratiomeric calcium imaging. Figure 3.5 shows the concentration-response plots measured

from the cells with induced GPR84 receptors in response to a series of lauric or capric acids

at concentrations ranging from 1 to100 µM. The EC50 value for lauric acid and capric acid

were 27.4 ± 1.1 µM (n = 53 ~ 81) and 4.4 ± 1.3 µM (n = 17 ~ 55), respectively.

Cellular Responses to MCFAs in GPR84-/- Mice

To study the functional role of GPR84 in MCFA taste transduction, we utilized a

transgenic mouse model that is GPR84 deficient (GPR84-/-). Taste cells were isolated from

GPR84-/- mice, and both functional calcium imaging and voltage clamp recording were

used to characterize the taste cell responses to capric acid. In voltage clamp recording

experiments, capric acid was applied near the recorded cells and it induced a rapid inward

current in wild type taste cells (Figure 3.6 A, -78.77 ± 9.104 pA, n = 17). This current was

significantly reduced in GPR84 knockout taste cells (-15.98 ± 4.985 pA, n = 11, p < 0.01).

Consistent with the electrophysiology data, calcium imaging experiments showed that the

calcium increases to capric acid in GPR84-/- taste cells (Figure 3.7, AUC: 2542 ± 604.5, n

= 5) were much smaller compared to the responses in wild type taste cells (AUC: 16777 ±

2728, n = 26, p < 0.05).

Behavioral Assays on GPR84-/- Mice.

To determine the role of GPR84 in MCFA taste transduction in vivo, I performed

CTA assays on GPR84-/- mice, and then compared the taste sensitivity between wild type and GPR84 knockout mice. Mice were injected with either LiCl or NaCl (controls)

immediately following a single exposure to 600 µM of lauric or capric acid. When lauric

acid was used as the conditioned stimulus, GPR84 knockout mice did not show any 97

significant aversions for lauric acid with concentrations up to 600 μM, suggesting the lack

of GPR84 receptors significantly reduced the taste sensitivity of mice to lauric acid (Figure

3.8 A). However, when capric acid was served as conditioned stimulus in another set of

CTA assays, the GPR84 knockout mice showed significant aversion to capric acid with

concentration higher than 300 μM ((Figure 3.8 B), suggesting that knocking out of GPR84 reduced but not totally abolished the taste sensitivity of mice to capric acid. The underlying nature of the differences between using lauric acid and capric acid as the conditioned stimulus was not clear.

Discussion

In the current study, I have shown that the mRNA of GPR84 is expressed on taste cells from mice, and GPR84 functioned as a receptor for saturated fatty acids from C6 to

C12, and, surprisingly, oleic acid and arachidic acids. A GPR84 knockout mice model was

used to investigate the role of GPR84 in MCFA taste transduction, and both cellular and

behavioral assays proved that GPR84 was critical in gustatory recognition of MCFAs.

Several GPCRs have been suggested to be activated by free fatty acids, including

GPR120, GPR40, GPR41, GPR43, and GPR84.The ligands for these receptors are fatty acids with different lengths, which are generally classified as long-, medium-, and short- chain fatty acids. GPR120 and GPR40 were the only GPCRs that have been studied in the gustatory systems so far, and past research showed that mice lacking GPR120 or GPR40 had reduced preferences for long chain unsaturated fatty acids, which suggested that

GPR120 and GPR40 mediated taste transduction of long-chain unsaturated fatty acids 98

(LCFAs). We have found that taste cells responded not only to LCFAs, but also to MCFAs,

which suggested the existence of a MCFA receptor(s) on taste cells. The real-time PCR data from our laboratory was consistent with taste cells containing a potential receptor for

MCFAs, GPR84. GPR84 is a novel GPCR activated by MCFAs which is expressed predominantly in hematopoietic tissues, it has been proven that GPR84 was activated by saturated fatty acid with carbon chain lengths of 9-14 in CHO (Chinese Hamster Ovary)

cells transfected with human GPR84. For the first time, I did a careful and systematic

analysis of the ligand specificity of this receptor using ratiometric calcium imaging. In

contrast with previous studies, I found that the ligands of GPR84 included not only the

MCFAs from C6 to C12, but also oleic acid and arachidic acid, which were previously not thought to activate this receptor. The EC50 value for lauric acid and capric acid were also

in the same molar order of magnitude range seen in earlier work (Wang et al., 2006).

To determine directly the involvement of GPR84 in the initial recognition of

MCFAs by taste cells, the changes in intracellular calcium and induced current responses

to capric acid were recorded from the taste cells isolated from GPR84 knockout mice. As

expected, knocking out of GPR84 significantly diminished the taste cell responses

activated by capric acid. However, there were still small residual responses in both calcium

rise and inward current, which suggested that there might be another receptor(s)

responsible for MCFA taste transduction. Besides GPR84, GPR40 is another GPCR that

has been shown to be activated by some MCFAs (Briscoe et al., 2003), however, it has

never been studied extensively in taste cells. It is very possible that GPR40 can also

contribute to MCFA responses in the gustatory system. 99

In the CTA assay with lauric acid as the conditioned stimulus, GPR84 knockout mice showed no avoidance to lauric acid with concentrations up to 600 µM. However, in the CTA test with capric acid as the conditioned stimulus, mice lacking GPR84 could not taste capric acid at concentrations up to 100 µM, but still avoided the capric acid with the concentration higher than 300 µM. The study in Chapter II of my dissertation showed that wild type mice could taste the lauric acid with the concentration as low as 30 µM (Figure

2.4). Compared to wild type mice, GPR84 deficient mice showed much lower taste sensitivity to MCFAs, which further confirmed the important role of GPR84 in MCFA taste transduction. The reason that GPR84 knockout mice could still taste high concentrations of capric acid may be because of the same aforementioned reason, which may be due to expression of GPR40 receptors. Different results in CTA assays between lauric and capric acid also suggested differences among various MCFAs. While the reason for this remains unclear at present, they may have different binding kinetics with multiple MCFA receptors.

It has been suggested that the signaling pathways downstream of GPR84 involved activation of a pertussis toxin-sensitive Gi/o, inhibition of cAMP production, and mobilization of calcium in CHO cells with transfected GPR84 receptors (Wang et al., 2006).

The taste transduction signaling pathway after GPR84 activation has been investigated and discussed in Chapter II. The mechanism of MCFA taste transduction appears to be different from long-chain unsaturated fatty acid taste, where the downstream pathway involves

TRPM5 and PLCß2 activation. Blocking the activation of G-protein, protein kinase A, and protein kinase C significantly reduced the taste cell responses to MCFAs, which suggested their important roles in the downstream pathway of MCFA taste transduction (data shown 100 in Chapter II, Figures 2.6-2.8).

In conclusion, I have shown that GPR84 was expressed in taste cells from three taste papillae, and I identified MCFAs with carbon length from 6 to 12 and two long-chain unsaturated fatty acids (oleic acid and arachidic acid) as the ligands for GPR84 receptors.

Based on the results of calcium imaging, patch clamp recording, and CTA assays, I found that GPR84 is an important receptor that mediates to a large degree the taste transduction of MCFAs. This new knowledge on the "fatty" taste receptors provided more information concerning how different types of fatty acids are detected in the gustatory system, and it makes us closer to solving the problems of overconsumption of fat, which is one of the main causes to dietary-induced obesity.

References

Bray GA, Paeratakul S, Popkin BM (2004) Dietary fat and obesity: a review of animal,

clinical and epidemiological studies. Physiol Behav 83:549-555.

Briscoe CP, Tadayyon M, Andrews JL, Benson WG, Chambers JK, Eilert MM, Ellis C,

Elshourbagy NA, Goetz AS, Minnick DT, Murdock PR, Sauls HR, Shabon U,

Spinage LD, Strum JC, Szekeres PG, Tan KB, Way JM, Ignar DM, Wilson S, Muir

AI (2003) The orphan G protein-coupled receptor GPR40 is activated by medium

and long chain fatty acids. J Biol Chem 278:11303-11311.

Cartoni C, Yasumatsu K, Ohkuri T, Shigemura N, Yoshida R, Godinot N, le Coutre J,

Ninomiya Y, Damak S (2010b) Taste preference for fatty acids is mediated by

GPR40 and GPR120. J Neurosci 30:8376-8382.

Gilbertson TA, Fontenot DT, Liu L, Zhang H, Monroe WT (1997) Fatty acid modulation 101

of K+ channels in taste receptor cells: gustatory cues for dietary fat. Am J Physiol

272:C1203-C1210.

Gilbertson TA, Khan NA (2014) Cell signaling mechanisms of oro-gustatory detection of

dietary fat: advances and challenges. Prog Lipid Res 53:82-92.

Hursting SD, Nunez NP, Varticovski L, Vinson C (2007) The obesity-cancer link: lessons

learned from a fatless mouse. Cancer Res 67:2391-2393.

Liu P, Shah BP, Croasdell S, Gilbertson TA (2011) Transient receptor potential channel

type M5 is essential for fat taste. J Neurosci 31:8634-8642.

Logue J, Murray HM, Welsh P, Shepherd J, Packard C, Macfarlane P, Cobbe S, Ford I,

Sattar N (2011) Obesity is associated with fatal coronary heart disease

independently of traditional risk factors and deprivation. Heart 97:564-568.

Mattes RD (2009) Oral detection of short-, medium-, and long-chain free fatty acids in

humans. Chem Senses 34:145-150.

Meyer MR, Clegg DJ, Prossnitz ER, Barton M (2011) Obesity, insulin resistance and

diabetes: sex differences and role of oestrogen receptors. Acta Physiol (Oxf)

203:259-269

Montmayeur JP, Fenech C, Kusumakshi S, Laugerette F, Liu ZH, Wiencis A, Boehm U

(2011) Screening for G-protein-coupled receptors expressed in mouse taste papillae.

Flavour Frag J 26:223-230.

Pittman DW, Smith KR, Crawley ME, Corbin CH, Hansen DR, Watson KJ, Gilbertson TA

(2008) Orosensory detection of fatty acids by obesity-prone and obesity-resistant

rats: Strain and sex differences. Chem Senses 33:449-460. 102

Running CA, Craig BA, Mattes RD (2015) Oleogustus: The Unique Taste of Fat. Chem

Senses 40:507-516.

Running CA, Mattes RD (2014) Different oral sensitivities to and sensations of short-,

medium-, and long-chain fatty acids in humans. Am J Physiol-Gastr L 307:G381-

G389.

Venkataraman C, Kuo F (2005) The G-protein coupled receptor, GPR84 regulates IL-4

production by T lymphocytes in response to CD3 crosslinking. Immunol Lett

101:144-153.

Wang J, Wu X, Simonavicius N, Tian H, Ling L (2006) Medium-chain fatty acids as ligands

for orphan G protein-coupled receptor GPR84. J Biol Chem 281:34457-34464.

Wang L, Manson JE, Forman JP, Gaziano JM, Buring JE, Sesso HD (2010) Dietary fatty

acids and the risk of hypertension in middle-aged and older women. Hypertension

56:598-604.

103

Table 3.1. Sequence of PCR primers used to genotype the wild-type and knockout alleles of GPR84.

Allele Sense Sequence (5’-3’)

WT Forward ATTAGAAAGGCAGCTCAACAGATCG

Reverse CCTCTATACCACTGAGGTTG

KO Forward GCAGCGCATCGCCTTCTATC

Reverse CCTCTATACCACTGAGGTTG

104

Figure 3.1. Gene targeting strategy to generate GPR84-/- mice.

105

A

+/+ 40 GPR84 +/- GPR84 -/- GPR84

30

20 W eight (g)

10

0 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Age (week)

B

+/+ GPR84 20 +/- GPR84 * -/- GPR84 *

* 15 * *

10

5 Body fat composition (%) composition Body fat

0 8 week 12 week 16 week 20 week

Figure 3.2. Evaluation of GPR84 knockout mice. GPR84+/+, GPR84+/-, and GPR84-/- mice

were evaluated by their growth curves (A) and body fat composition (B). Data points were

represented by mean ± SEM (n = 4-10). Asterisks indicate significant differences between two groups (p < 0.05). 106

1.5

1.0

0.5

Relative GPR84 expression to calibritor GPR84 to expression Relative 0.0

GPR84 GPR84 GPR84 GPR120 GPR120 GPR120

Fungiform Foliate Circumvallate

Figure 3.3. GPR84 receptors are expressed in mouse taste cells. The mRNA expression of

GPR84 and GPR120 in the taste cells from fungiform, foliate, and circumvallate papillae.

Data are expressed relative to the expression of GPR120 in the circumvallate papilla

(calibrator).

107

Induced cells Non-induced cells Induced cells Non-induced cells Caproic acid Caproic acid Caprylic acid Caprylic acid

Time (25 s) [Ca2+] (25 nM)

Capric acid Capric acid Undecanoic acid Undecanoic acid

Lauric acid Lauric acid Arachidic acid Arachidic acid

Oleic acid Oleic acid

108

Figure 3.4. Ligand specificity of GPR84 receptor. Ligand specificity was investigated by functional calcium imaging in HEK293 cell line with inducible GPR84 receptors. Bath application of caproic (C6:0), caprylic acid (C8:0), capric acid (C10:0), undecanoic acid (C11:0), lauric acid (C12:0), oleic acid (C18:1), and arachidic acid (C20:2) all elicited a robust and reversible calcium in the cells with induced GPR84 receptors, while they did not induce any calcium increase in the non-induced control cells.

109

A Capric acid

15000

10000

5000 AreaUnder Curve

0 0.0 0.5 1.0 1.5 2.0 2.5 Log[Capric] (µ M)

B Lauric acid

15000

10000

5000 AreaUnder Curve

0 0.0 0.5 1.0 1.5 2.0 2.5 Log[Lauric acid] (µ M)

Figure 3.5. Dose-response curves of lauric or capric acid versus calcium responses.

Intracellular calcium increases in the cells with induced GPR84 receptor were measured using functional calcium imaging when applying a series of concentrations of lauric and capric acids. The area under response curve was calculated and fitted with a dose-response equation. The EC50 value for lauric and capric acids were 27.4 ± 1.1 µM (n = 53 ~ 81) and

4.4 ± 1.3 µM (n = 17 ~ 55), respectively. 110

A B CA CA

2 s

2 s 20 pA 20 pA

C

50

WT GPR84 KO 0

-50 (pA)

Capric acid Capric -100 induced current induced

-150

Figure 3.6. The inward currents induced by MCFAs in GPR84-/- taste cells were

significantly lower than wild type taste cells. Focal application of capric acid (CA, 200

µM) induced an inward current in wild type taste cells (A), and this current was significantly reduced in GPR84-/- taste cells (p < 0.01). (C) Mean response ± SEM to capric acid for wild type taste cells (n = 17) and GPR84 knockout taste cells (n = 11).

111

A B CA CA

Time (25 s) [Ca2+] (25 nM)

C

25000

20000

15000

10000

5000 Area Under Curve

0 WT GPR84 KO

Figure 3.7. The intracellular calcium rises elicited by MCFAs in GPR84-/- taste cells were significantly lower than wild type taste cells. Capric acid (100 µM) induced an intracellular calcium increase in wild type (A) and GPR84-/- taste cells (B).The area under the curve

(mean ± SEM) of these two groups were calculated and compared via an unpaired two- tailed Student’s t-test, and the calcium responses in GPR84-/- taste cells (n = 5) were significantly reduced compared to the responses in wild type taste cells (n = 26, p < 0.05).

112

A

1.5 LiC l NaCl

1.0

0.5 Relative lick ratio (test/water) ratio lick Relative

0.0 0 200 400 600 800 Lauric acid (µ M) B

1.5 LiC l NaCl

* * 1.0

0.5 Relative lick ratio (test/water) ratio lick Relative

0.0 0 200 400 600 800 Capric acid (µ M)

Figure 3.8. GPR84-/- mice showed lower taste sensitivities to MCFAs than wild type mice.

Relative lick ratios (mean ± SEM) for different concentrations of lauric or capric acid when using lauric acid (A, n = 7 for LiCl group, and n = 3 for NaCl group) or capric acid (B, n =

10 for LiCl group, and n = 9 for NaCl group) as the conditioned stimulus in GPR84 knockout male mice on day two after CTA. Asterisks indicate significant differences between two groups (p < 0.05). 113

CHAPTER IV

RESEARCH SUMMARY AND FUTURE DIRECTIONS

Are Medium-Chain Fatty Acids Effective Taste Stimuli?

Rodents and humans have a hedonic preference for foods rich in fatty acids. Over

the last twenty years, it has been proven in numerous behavioral studies that rodents and

humans are capable of detecting fatty acids independently even when olfaction, texture,

and postingestive factors were eliminated, and moreover, free fatty acids are capable of eliciting cellular responses in native taste cells isolated from rodents. However, most of the studies have been focusing on the long-chain unsaturated fatty acids (LCFAs), and limited research has been done on the taste of saturated fatty acids, even though they exist in dietary food and pose more serious threats to human health. There is only one published paper that studied the gustatory response for medium-chain saturated fatty acids (MCFAs),

which showed that human had a detectable oral taste threshold for one MCFA (lauric acid,

C12) (Mattes, 2009). My research is the first study ever that used both cellular and

behavioral assays to determine if one class of fatty acids, MCFAs, was an effective

gustatory stimulus.

In Chapter II of my dissertation, I have shown that MCFAs induced both an

intracellular free calcium rise and inward currents in the taste cells isolated from wild type

mice. Increase of intracellular calcium concentration is a good indicator for cell activation,

and calcium is a key ion involved in the neurotransmitter release. Inward currents can lead 114

to cell membrane depolarization, which is another hallmark for increased cell activity.

Moreover, wild type mice showed aversion to MCFAs with low concentrations during

conditioned taste aversion (CTA) test, which further confirmed that MCFAs were effective stimuli for rodents. In order to link between the cellular/molecular and behavioral events

and provide a whole picture for the gustatory response to MCFAs, whole nerve recording

on the gustatory afferent nerves (chorda tympani or glossopharyngeal nerves) while

applying MCFAs over the tongue would be a nice complementary experiment. Chorda

tympani (CT) and glossopharyngeal (GL) innervate the fungiform and circumvallate

papillae, respectively, and the neurotransmitters release from the taste cells could activate

both of these nerves. Since the taste cells from circumvallate express more GPR84 than

fungiform, I expect that the GL nerve would elicit a more robust response.

Different types of taste cells have unique signaling pathways and functions during

taste transduction. Therefore, the studies on which type of taste cells responds to MCFAs

could provide clues for the MCFA taste transduction pathways. Somewhat surprisingly, I

identified that both Type II and Type III taste cells could be activated by MCFAs, which

suggested complicated signaling pathways might be involved in gustatory recognition of

MCFAs.

Is GPR84 the Receptor for MCFAs?

During the past couple of decades, several fatty acid activated G protein-coupled

receptors (GPCRs) have been deorphanized and they are able to bind fatty acids with

different carbon lengths (Briscoe et al., 2003, Brown et al., 2003, Hirasawa et al., 2005,

Wang et al., 2006). Among all the fatty acid activated GPCRs, GPR120 and GPR40 were 115

the only ones that had been studied in taste system and it has been showed that they played

important roles in taste perception of LCFAs (Cartoni et al., 2010a). The reason that we started to study GPR84 in taste is because we wanted to investigate how saturated fatty acids were detected through taste pathways, and GPR84 has been proven to be activated by saturated fatty acids, although the ligands of GPR84 only include MCFAs (Wang et al.,

2006). Another reason is that we found the mRNA of GPR84 was expressed in taste cells, which indicated that GPR84 is very possibly the main receptor that mediates the taste of

MCFAs.

In Chapter III of my dissertation, I provided evidence regarding the expression of

GPR84 mRNA in taste cells, however, I didn’t show the expression of GPR84 protein, which would be an additional support of GPR84’s involvement in taste. I tried immunohistochemical assays on the frozen tongue tissue sections from the wild type mice, but didn’t find specific binding of the anti-GPR84 antibody on the taste papillae. There are several reasons that may have contributed to this result. First, the antibodies I tried were anti-human GPR84 antibodies because there was no commercially available anti-mouse

GPR84 antibody. The lack of a specific mouse antibody could reduce the binding ability of the antibody to the GPR84 receptors on mice, despite the fact the human and the murine

GPR84 proteins are 85% identical in amino acid residues (Wittenberger et al., 2001).

Another reason might be the expression of GPR84 protein on taste cells is not high enough to be detected in immunohistochemical assays. Based on the data from our lab, the mRNA expression of GPR84 is about 30% to 40% the expression of GPR120 on each papillae.

Previous research validated the protein expression of GPR120 in taste cells (Cartoni et al., 116

2010a, Montmayeur et al., 2011), so GPR84 protein is very likely expressed in taste cells,

too. Moreover, my experiments on GPR84 knockout model proved its functional

expression.

Which type of taste cells expresses GPR84? This can be elucidated by real-time

PCR on GFP positive taste cells isolated from GFP-PLCß2 or GFP-GAD67 mice. I hypothesize that GPR84 is expressed in both Type II and Type III taste cells because both types responded to MCFAs in calcium imaging and patch clamp recording assays.

A GPR84 knockout mouse model was utilized to investigate its involvement in

MCFA taste transduction at both cellular and behavioral levels, and loss of GPR84 significantly decreased taste cell responses and taste sensitivities to MCFAs. All the results supported my hypothesis that GPR84 plays an essential role in MCFA transduction. Again,

whole nerve recording on the gustatory afferent nerves of GPR84 knockout mice would be

additional supporting evidence to provide the link between the taste cell and ultimate

behavior.

In previous studies from our laboratory, RNA interference has been used to knock

down GPR120 expression on STC-1 cell line, which is a mouse enteroendocrine cell line

that expresses many taste signaling elements (Dyer et al., 2005). And the cellular response

induced by linoleic acid was significantly inhibited when the expression of GPR120 was

reduced (Shah et al., 2012). The same strategy can be used to directly measure the

involvement of GPR84 receptors in MCFA transduction, but STC-1 cell line cannot be

used as the study model because it does not express GPR84 receptors according to the data

of our laboratory. Instead, the taste cell line derived from p53 deficient mice (Sako et al., 117

2011) can be utilized in this fashion, and it is a better model to mimic the native taste cells.

Although GPR84 knockout model showed significantly decreased cellular and

behavioral responses, there were still residual signals left in calcium rise, inward current,

and taste sensitivity to capric acid. Therefore, it is possible that there are other GPCRs or

other signaling pathways that are involved in MCFA transduction. GPR40 can be activated

by medium- and long-chain fatty acid, and it is expressed in taste cells. A previous study

suggested that GPR40 can mediate the taste of long-chain fatty acids (Cartoni et al., 2010b).

Therefore, GPR40 would be a good candidate as a potential additional MCFA receptor in

the taste system. The involvement of GPR40 in MCFA transduction could be investigated

using similar methods as used in my studies of GPR84.

What Is the Downstream Transduction Pathway for MCFAs?

The taste transduction pathways for LCFAs have been elucidated during the past

decades. It is initiated by the interaction between LCFAs and their corresponding GPCRs.

The G-proteins that coupled with the GPCRs are then activated, and the ßγ subunits are released and stimulate the PLCß2 activity, which cleaves phosphatidylinositol 4,5- bisphosphate (PIP2) into diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3). Then

IP3 stimulates the release of intracellular calcium, which eventually activates the transient

receptor potential cation channel 5 (TRPM5) (Liu et al., 2011). This pathway is an important reference for the possible GPR84-mediated MCFA taste transduction pathway.

Therefore, I first investigated the involvement of the important components in this pathway.

However, by using TRPM5 knockout model in both cellular and behavioral assays, I demonstrated that taste activation by MCFAs was not affected by knocking out of TRPM5. 118

Moreover, applying the antagonist of PLCß2 did not inhibit the inward current induced by

capric acid. All the data suggested that the MCFA taste transduction pathway is different

than that for LCFA, and it may involve (a) more complicated signaling pathway(s).

So far, only a few published papers attempted to elucidate the signaling pathways following GPR84 activation. In leukocytes, GPR84 activation by MCFAs coupled with a pertussis toxin-sensitive Gi/o pathway, and followed by calcium mobilization and cAMP

inhibition. α-Gustducin is a well-known G-protein highly expressed in taste cells, and it

belongs to the Gi/o family (McLaughlin et al., 1992). It plays a key role in sweet, umami,

and bitter taste transduction pathway. So I hypothesized that GPR84 coupled to α-

gustducin during MCFA transduction. My studies showed that blocking G-protein

activation using GDP-ß-S abolished the inward current induced by capric acid, which

suggested G-protein activation was coupled with MCFA transduction. However, it could

not prove directly the involvement of α-gustducin in this process, unless we use a α- gustducin knockout model. So I studied a second messenger activated downstream of α-

gustducin, phosphodiesterase (PDE), to investigate the role of α-gustducin indirectly. My

results showed that inhibiting PDE did not affect the inward current induced by capric acid,

suggesting that PDE was not involved in MCFA taste transduction, and in turn indicating

that α-gustducin may not be involved, either.

My study also showed that inhibiting the activity of protein kinase A (PKA) significantly reduced the response of taste cell to MCFAs. Previous studies have shown that in taste cells, sucrose and other sugars activated Gs and released the Gαs subunit, which

then stimulated adenylyl cyclase (AC) to produce cAMP and eventually activated PKA. 119

PKA could phosphorylate and close the basolateral potassium channels to elongate the depolarization phase of taste cells (Avenet et al., 1988a, b, Naim et al., 1991, Margolskee,

2002, Abaffy et al., 2003). It is possible that the GPR84-mediated MCFA taste transduction pathway is similar with sugar. To prove this hypothesis, AC inhibitor can be used the same way as other antagonists in my study. The cAMP levels in the epithelial sheets from taste papillae can be measured with or without MCFA stimulation by using methods described before (Abaffy et al., 2003).

Blocking protein kinase C (PKC) slightly but significantly reduced the inward current produced by capric acid, which means a portion of the MCFA transduction depends on PKC activation, and it probably acts in a separate pathway from the one involving PKA.

It has been suggested that PKC was required in the taste transduction of synthetic sweeteners (Varkevisser and Kinnamon, 2000), but no published research has ever studied how PKC was activated in taste cells. A well-known PKC activation pathway is as follows:

PLC hydrolyses phosphatidylinositol 4,5 bisphosphate to produce IP3 and DAG, and then

Ca2+ is released from ER store. Ca2+ and DAG together then work together to activate PKC

(Nishizuka, 1995). However, my study showed that PLC was not involved in MCFA transduction, so it likely relies on a PLC-independent PKC activation pathway that remains to be elucidated.

Capric acid induced a rapidly activating inward current in wild type taste cells, but what is the nature of the ion channel that mediates this current? To characterize this current, a series of ion substitution experiments were performed to determine which ions this channel could conduct. Changing the extracellular concentration of sodium by ion 120

substitution did not shift the reversal potential to a predictable level (data not show),

suggesting this channel was not exclusively sodium permeable, like TRPM5. Therefore, I

suspected that this channel may be a calcium channel. Many transient receptor potential

(TRP) channels are expressed in sensory organs, including taste, and most of them are

calcium permeable (Gees et al., 2010). In order to check if this channel is calcium channel,

the sodium, potassium, and chloride ions in the extracellular solution can be substituted

with cesium during patch clamp recording, and using current ramps in the absence and

presence of the MCFAs. The nature of the MCFA current was difficult to identify during

the course of my experiments because I got equivocal results. One possible cause of this

may lie in the fact that MCFAs induce different currents in Type II and Type III taste cells,

and my patch clamp studies were not conducted on identifiable (i.e. GFP-labeled) cell types.

In the future, one could perform ion substitution experiments during voltage clamp

recording as stated above only on GFP positive taste cells from GFP-PLCß2 or GFP-GAD

mice to elucidate the currents from Type II and Type III taste cells.

Cluster of differentiation 36 (CD36) is a protein that has been actively studied on the taste of fat. It is a transmembrane protein that is able to transport or LCFAs (Baillie et al., 1996, Zhang et al., 2003). The exact role of CD36 on taste transduction remains to be elucidated, however, a theory proposed that CD36 might work as a chaperone protein to facilitate free fatty acids binding their receptors, which then activated downstream taste transduction. The data in our laboratory showed that reduced expression of CD36 inhibited but not abolished the Ca2+ response to linoleic acid in human taste cell line. Moreover,

CD36 knockout mice showed lower but not eliminated taste sensitivity to linoleic acid, 121

suggesting that CD36 is not essential but might facilitate the LCFA taste transduction. It

would be interesting to check the involvement of CD36 in MCFA transduction by using

CD36 deficient mice. Since CD36 is generally believed to only transport or bind LCFAs

(Degrace-Passilly and Besnard, 2012), I anticipate the result that knocking out of CD36

will not affect the taste responsiveness to MCFAs.

In conclusion, my dissertation has shown that MCFAs are effective taste stimuli

and at least part of the MCFA transduction pathway has been elucidated. So far, the

research on fat taste has been limited to the LCFAs, and my research of the taste of MCFAs

has added significantly to the understanding of fat taste transduction. These findings will

help us identify potential strategies to reduce fatty acid intake, such as designing fat

substitutes, and in turn, possibly helping to prevent dietary-induced obesity.

References

Abaffy T, Trubey KR, Chaudhari N (2003) Adenylyl cyclase expression and modulation of

cAMP in rat taste cells. Am J Physiol Cell Physiol 284:C1420-1428.

Avenet P, Hofmann F, Lindemann B (1988a) Signalling in taste receptor cells: cAMP-

dependent protein kinase causes depolarization by closure of 44 pS K-channels.

Comp Biochem Physiol A Comp Physiol 90:681-685.

Avenet P, Hofmann F, Lindemann B (1988b) Transduction in taste receptor cells requires

cAMP-dependent protein kinase. Nature 331:351-354.

Baillie AG, Coburn CT, Abumrad NA (1996) Reversible binding of long-chain fatty acids

to purified FAT, the adipose CD36 homolog. J Membr Biol 153:75-81.

Briscoe CP, Tadayyon M, Andrews JL, Benson WG, Chambers JK, Eilert MM, Ellis C, 122

Elshourbagy NA, Goetz AS, Minnick DT, Murdock PR, Sauls HR, Shabon U,

Spinage LD, Strum JC, Szekeres PG, Tan KB, Way JM, Ignar DM, Wilson S, Muir

AI (2003) The orphan G protein-coupled receptor GPR40 is activated by medium

and long chain fatty acids. Journal of Biological Chemistry 278:11303-11311.

Brown AJ, Goldsworthy SM, Barnes AA, Eilert MM, Tcheang L, Daniels D, Muir AI,

Wigglesworth MJ, Kinghorn I, Fraser NJ, Pike NB, Strum JC, Steplewski KM,

Murdock PR, Holder JC, Marshall FH, Szekeres PG, Wilson S, Ignar DM, Foord

SM, Wise A, Dowell SJ (2003) The orphan G protein-coupled receptors GPR41 and

GPR43 are activated by propionate and other short chain carboxylic acids. Journal

of Biological Chemistry 278:11312-11319.

Cartoni C, Yasumatsu K, Ohkuri T, Shigemura N, Yoshida R, Godinot N, le Coutre J,

Ninomiya Y, Damak S (2010a) Taste Preference for Fatty Acids Is Mediated by

GPR40 and GPR120. Journal of Neuroscience 30:8376-8382.

Cartoni C, Yasumatsu K, Ohkuri T, Shigemura N, Yoshida R, Godinot N, le Coutre J,

Ninomiya Y, Damak S (2010b) Taste preference for fatty acids is mediated by

GPR40 and GPR120. J Neurosci 30:8376-8382.

Degrace-Passilly P, Besnard P (2012) CD36 and taste of fat. Curr Opin Clin Nutr 15:107-

111.

Dyer J, Salmon KSH, Zibrik L, Shirazi-Beechey SP (2005) Expression of sweet taste

receptors of the T1R family in the intestinal tract and enteroendocrine cells.

Biochem Soc T 33:302-305.

Gees M, Colsoul B, Nilius B (2010) The role of transient receptor potential cation channels 123

in Ca2+ signaling. Cold Spring Harb Perspect Biol 2:a003962.

Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto Y, Miyazaki

S, Tsujimoto G (2005) Free fatty acids regulate gut incretin glucagon-like peptide-

1 secretion through GPR120. Nat Med 11:90-94.

Liu P, Shah BP, Croasdell S, Gilbertson TA (2011) Transient receptor potential channel

type M5 is essential for fat taste. J Neurosci 31:8634-8642.

Margolskee RF (2002) Molecular mechanisms of bitter and sweet taste transduction. J Biol

Chem 277:1-4.

Mattes RD (2009) Oral detection of short-, medium-, and long-chain free fatty acids in

humans. Chem Senses 34:145-150.

McLaughlin SK, McKinnon PJ, Margolskee RF (1992) Gustducin is a taste-cell-specific G

protein closely related to the transducins. Nature 357:563-569.

Montmayeur JP, Fenech C, Kusumakshi S, Laugerette F, Liu ZH, Wiencis A, Boehm U

(2011) Screening for G-protein-coupled receptors expressed in mouse taste papillae.

Flavour Frag J 26:223-230.

Naim M, Ronen T, Striem BJ, Levinson M, Zehavi U (1991) Adenylate cyclase responses

to sucrose stimulation in membranes of pig circumvallate taste papillae. Comp

Biochem Physiol B 100:455-458.

Nishizuka Y (1995) Protein kinase C and lipid signaling for sustained cellular responses.

FASEB J 9:484-496.

Sako H, Hori M, Masuho I, Saitoh O, Okada A, Tomooka Y (2011) Establishment of clonal

cell lines of taste buds from a p53 (-/-) mouse tongue. In Vitro Cell Dev-An 47:333- 124

340.

Shah BP, Liu P, Yu T, Hansen DR, Gilbertson TA (2012) TRPM5 is critical for linoleic

acid-induced CCK secretion from the enteroendocrine cell line, STC-1. Am J

Physiol-Cell Ph 302:C210-C219.

Varkevisser B, Kinnamon SC (2000) Sweet taste transduction in hamster: role of protein

kinases. J Neurophysiol 83:2526-2532.

Wang J, Wu X, Simonavicius N, Tian H, Ling L (2006) Medium-chain fatty acids as ligands

for orphan G protein-coupled receptor GPR84. J Biol Chem 281:34457-34464.

Wittenberger T, Schaller HC, Hellebrand S (2001) An expressed sequence tag (EST) data

mining strategy succeeding in the discovery of new G-protein coupled receptors. J

Mol Biol 307:799-813.

Zhang X, Fitzsimmons RL, Cleland LG, Ey PL, Zannettino AC, Farmer EA, Sincock P,

Mayrhofer G (2003) CD36/fatty acid translocase in rats: distribution, isolation from

hepatocytes, and comparison with the scavenger receptor SR-B1. Lab Invest

83:317-332.

125

CURRICULUM VITAE

Yan Liu

Ph.D.

Department of Biology, Utah State University

5305 Old Main Hill

Logan, UT 84322-5305

Phone: (435)932-5763

Email: [email protected]

EDUCATION

Jilin University, China B.Sc. 2003-2007 Biotechnology

Peking University, China M.Sc 2007-2010 Radiation Medicine

Utah State University PhD Candidate 2010-present Neuroscience

WORKING EXPERENCES

Jan.2011 – 2014, spring and fall semester

Teaching assistant of Human Physiology BIOL2420, Department of Biology, USU Responsibilities: Prepare and monitor laboratories; Grade laboratory assignments as required; Present pre-laboratory talks.

Sep.2010 – Present

Research assistant in Gilbertson Lab, Department of Biology, USU Responsibilities: Work on the project “The role of GPR84 in Medium-Chain Saturated Fatty Acid Taste Transduction”

PROJECTS

Presently working on the project “The role of GPR84 in Medium-Chain Saturated Fatty Acid Taste 126

Transduction”.

Worked on the project “Epidermal Growth Factor Receptor–Targeted Radioimmunotherapy of Human

Head and Neck Cancer Xenografts Using 90Y-Labeled Fully Human Antibody Panitumumab” as my

graduation thesis from Dec 2007 to Dec 2009.

PUBLICATIONS

1. Jin C, Liu Z, Yu Z, Zhang J, Liu Y, Zhao H, Jia B, Wang F

Radioimmunotherapy of Human Colon Cancer Xenografts with 131I-labeled Anti-CEA Monoclonal

Antibody.

Bioconjug Chem. 2010; 21(2):314-8.

2. Jin C, Shi J, Liu Y, Jin X, Huang J, Zhao H, Li F, Wang F

Comparison of in vitro and in vivo Characteristics of 99mTc-labeled Cyclic RGD Dimers with

PEG4/2PEG4 linkers

Journal of Nuclear and Radiochemistry. 2010.32(5):

3. Liu Y, Jin C, Yang S, Yang Y, Jia B, Wang F

125I/111In Labeled Anti-EGFR Monoclonal Antibody Panitumumab: Preparation and Biodistribution

Evaluation in Normal Mice

Journal of Nuclear and Radiochemistry.2010 32 (6): 362-368.

4. Liu Z*, Liu Y*, Jia B, Zhao H, Jin X, Li F, Chen X, Wang F

Epidermal Growth Factor Receptor–Targeted Radioimmunotherapy of Human Head and Neck Cancer

Xenografts Using 90Y-Labeled Fully Human Antibody Panitumumab (Co-first author)

Mol Cancer Ther 2010 Aug;9(8):2297-308. Epub 2010 Aug 3

CONFERENCE ABSTRACTS

1. Liu Y, Jia B, Liu Z, Zhao H, Chen X, Wang F

Radioimmunotherapy of EGFR-positive tumors with 90Y-labeled Panitumumab 127

56th Annual Meeting of Society of Nuclear Medicine, Toronto, Canada, June, 2009

J Nucl Med. 2009; 50 (Supplement 2):1641

2. Liu Y, Gilbertson TA

Medium-chain fatty acid transduction in mouse taste cells is TRPM5-independent

AChemS 34th Annual Meeting, CA, 2012

3. Liu Y, Gilbertson TA

Ligand specificity of orphan G protein-coupled receptor 84

AChemS 35th Annual Meeting, CA, 2013

4. Liu Y, Gilbertson TA

Taste cell responses to medium chain saturated fatty acids are mediated by GPR84

AChemS 38th Annual Meeting, FL, 2016

SCHOLARSHIPS AND HONORS

Entrance Scholarship, Jilin University, 2003

Third-grade Scholarship (awarded to top 15% students), Jilin University, 2004

Second-grade Scholarship (awarded to top 10% students), Jilin University, 2005-2006

First-grade Scholarship (awarded to top 5% students), Jilin University, 2007

Second Prize Fellowship, Peking University, 2007-2009

Individual Prize, Peking University, 2010

Lawrence H. Piette Graduate Scholarship, 2011

AChemS Travel and Housing Award, 2012-2014, 2016

PROFESSIONAL AFFILIATIONS

Association for Chemoreception Sciences, since 2011.