Rat Gnrhr Promoter Directs Species-Specific Gene Expression in the Pituitary and Testes of Transgenic Mice

M ISHAQ and others Species speciﬁcity of Gnrhr 50:3 411–426 Research promoter activity

Rat Gnrhr promoter directs species-speciﬁc gene expression in the pituitary and testes of transgenic mice

Muhammad Ishaq, Anne-Laure Schang, Solange Magre, Jean-Noe¨l Laverrie`re, Aure´lien Guillou, Noe¨lline Coudouel, Richard Wargnier, Joe¨lle Cohen-Tannoudji Correspondence and Raymond Counis should be addressed to R Counis Universite´ Paris Diderot Paris 7, Sorbonne Paris Cite´ , Biologie Fonctionnelle et Adaptative, EAC CNRS 4413, Email Physiologie de l’Axe Gonadotrope, Baˆ timent Buffon, case courier 7007, 4, rue MA Lagroua Weill-Halle´ , 75205 Paris raymond.counis@ cedex 13, France univ-paris-diderot.fr

Abstract

The GnRH receptor (GnRHR) is expressed in several non-pituitary tissues, notably in gonads. Key Words However, mechanisms underlying the gonad-specific expression of Gnrhr are not well " GnRH receptor understood. Here, Gnrhr expression was analysed in the developing testes and pituitaries of " testis development rats and transgenic mice bearing the human placental alkaline phosphatase reporter gene " Leydig cells (ALPP) under the control of the rat Gnrhr promoter. We showed that the 3.3 kb, but not the " pituitary gonadotropes pituitary-specific 1.1 kb promoter, directs ALPP expression exclusively to testis Leydig cells " in vivo promoter activity from embryonic day 12 onwards. Real-time PCR analysis revealed that promoter activity " ontogeny displayed the same biphasic profile as marker genes in Leydig cells, i.e. abrupt declines after " castration Journal of Molecular Endocrinology birth followed by progressive rises after a latency phase, in coherence with the differentiation and evolution of foetal and adult Leydig cell lineages. Interestingly, the developmental profile of transgene expression showed high similarity with the endogenous Gnrhr profile in the rat testis, while mouse Gnrhr was only poorly expressed in the mouse testis. In the pituitary, both transgene and Gnrhr were co-expressed at measurable levels with similar ontogenetic profiles, which were markedly distinct from those in the testis. Castration that induced pituitary Gnrhr up-regulation in rats did not affect the mouse Gnrhr. However, it duly up-regulated the transgene. In addition, in LbT2 cells, the rat, but not mouse, Gnrhr promoter was sensitive to GnRH agonist stimulation. Collectively, our data highlight inter-species variations in the expression and regulation of Gnrhr in two different organs and reveal that the rat promoter sequence contains relevant genetic information Journal of Molecular that dictates rat-specific gene expression in the mouse context. Endocrinology (2013) 50, 411–426

Introduction

The interaction of hypothalamic GnRH with a speciﬁc (Stojilkovic et al. 1994, Millar et al. 2004, Counis et al. G protein-coupled receptor (GnRHR) present at the surface 2005). GnRH-binding activity and Gnrhr mRNA expression of pituitary gonadotrope cells is critical to the neuroendo- have also been identiﬁed in a variety of non-pituitary crine regulation of the reproductive axis in all vertebrates tissues and notably in those linked to reproduction.

http://jme.endocrinology-journals.org Ñ 2013 Society for Endocrinology Published by Bioscientiﬁca Ltd. DOI: 10.1530/JME-12-0231 Printed in Great Britain Downloaded from Bioscientifica.com at 09/28/2021 06:48:00AM via free access Research M ISHAQ and others Species speciﬁcity of Gnrhr 50:3 412 promoter activity

These include ovary, placenta, mammary gland and In this study, we examined the developmental pattern endometrium in the female as well as prostate and testis of Gnrhr expression in the rat and mouse testis taking in the male (Ramakrishnappa et al. 2005). In these tissues, advantage of transgenic mice bearing the rat Gnrhr a local production of GnRH supports potential auto- or promoter fused to a highly sensitive reporter gene, the paracrine modulation of cell functions by GnRHR, as human placental alkaline phosphatase gene (ALPP). These illustrated by the archetypal rat gonads (Clayton & Catt transgenic mice were initially generated to improve in vitro 1981, Scott et al. 2009). Little is known about the analyses of the mechanisms involved in promoter activity mechanisms and factors governing the expression of and, most importantly, to explore, in vivo, the develop- Gnrhr in non-pituitary tissues. Most studies have indeed mental pattern of rat Gnrhr promoter activity in the focused on the pituitary gland, mainly in rats, mice and pituitary (Pincas et al. 2001, Granger et al. 2004, 2006, humans. Within the promoters of these species, several Schang et al. 2013a). These transgenic mice also appeared to response elements and related transcription factors be powerful tools to identify novel tissues in which the involved in the gonadotrope-specific and regulated Gnrhr promoter is active (Schang et al. 2011a,b, 2013b). Two expression of pituitary Gnrhr have been identified (Pincas transgenic mouse lines expressing ALPP under the control et al. 1998, 2001, Jorgensen et al. 2004, Hapgood et al. of the 3.3 or 1.1 kb rat Gnrhr promoter (referred to as 2005, Granger et al. 2006, Schang et al. 2013a). Studies of 3.3-Gnrhr and 1.1-Gnrhr respectively) were generated. these promoters in the ovary, placenta and hippocampus Transgene expression was directed to pituitary gonadotrope indicate that Gnrhr expression is driven by the same cells in both mouse lines, thus supporting our in vitro data in promoter with, however, different response elements and gonadotrope cell lines, indicating that the 1.1 kb promoter sets of transcription factors (Kang et al. 2000, Cheng et al. sequence was necessary and sufficient for pituitary-specific 2002, Schang et al. 2011b, 2013b). expression (Granger et al.2004). Recently, we have reported In mammals, Leydig cells originate from at least two transgene expression in the testis (Schang et al.2011a). generations of cells (Lejeune et al.1998, O’Shaughnessy These mouse models were used here to analyse the et al.2005). The first generation, known as ‘foetal’, develops pattern of rat Gnrhr promoter activity during testis during foetal life soon after testis differentiation, at about development and, most specifically, during Leydig cell 12.5 days post-conception (dpc) in mice. These cells are differentiation, from foetal to adult stages. By combining essential for masculinisation of the male urogenital system in situ detection of the transgene, as reported previously and have been described either to regress or to be (Schang et al. 2011a), together with real-time RT-PCR, we maintained in the adult (Habert et al. 2001). The second showed that the 3.3 kb sequence of the rat Gnrhr promoter

Journal of Molecular Endocrinology cell population, termed ‘adult’, appears before puberty is capable of directing reporter gene expression in foetal as and produces testosterone required for the onset of well as in adult Leydig cells. Interestingly, we found that spermatogenesis and the maintenance of reproductive the ontogenetic profile of transgene expression reflected function. To date, based on functional and morphological the evolution of rat Gnrhr rather than endogenous Gnrhr, criteria, it is believed that these two cell populations which was only weakly expressed in the mouse testis. represent two distinct lineages (O’Shaughnessy et al. Furthermore, in the pituitary, in which both transgene 2006). Using RT-PCR approaches in rat foetal gonads, we and endogenous Gnrhr displayed similar ontogenetic have previously identified Gnrh and Gnrhr transcripts as profiles, only the transgene was up-regulated after soon as 14.5 dpc (Botte et al. 1998). Interestingly, the castration. Collectively, our data provide strong argu- foetal expression pattern of Gnrhr in the testis displayed an ments indicating that the relatively short 3.3 kb sequence acuteriseatlategestationstartingat20.5dpcthat of the rat promoter encodes not only tissue-specific corresponds to the onset of testis responsiveness to programmes but also species-specific instructions, which GnRH (Habert et al. 1991, Habert 1992). The precise both predominate over the mouse environment. localisation of Gnrhr expression and whether it was restricted to the Leydig cell population during foetal development was not examined in these studies. More- Materials and methods over, to our knowledge, no data exist so far regarding the Animal housing and experimentation postnatal evolution of testicular Gnrhr expression and correlation with Leydig cell differentiation, as reported for Rats and mice were housed and maintained according the pituitary gonadotrope lineage (Wilson & Handa 1997, to the published European communities guidelines and Zapatero-Caballero et al. 2003, 2004, Granger et al. 2004). with approval from the experimental committee of the

Paris-Rive Gauche University (Agreement A75-1317), digoxigenin-labelled riboprobes as described previously Centre National de la Recherche Scientifique and (Guigon et al. 2003). The mouse Cyp11a1 riboprobe (size University Paris-Diderot Paris 7, Paris, France. Rats were 180 bp) was obtained after RT-PCR on mouse gonads and from the Wistar strain (colony of Janvier, 53680 Le Genest, subcloning in pGEM-T Easy vector. Sense and antisense France). Transgenic mice were from our own colonies primers were 50-GCACTTTGGAGTCAGTTTACATC-30 and generated on site using classical microinjection tech- 50-AGGACGATTCGGTCTTTCTT-30 respectively. To ident- niques as described previously (Granger et al. 2004). To ify gonadal structures, immunodetection of fibronectin time foetal development, males and females were caged was performed on the sections previously analysed or on overnight and the morning day when the vaginal plug was adjacent sections using a rabbit anti-fibronectin antibody observed was designated as day 0 post-conception (dpc). (dilution 1/100, ref F3648; Sigma). The TUNEL assay was The day of birth was designatedas day 0 postnatal (dpn). performed on frozen ovary sections as described pre- Pregnant animals were killed at the same hour of the day viously (Guigon et al. 2003). Briefly, after thawing and from 12 to 20 days post-conception (dpc) and foetuses rehydratation in PBS, the tissue sections were incubated removed for tissue collection. The sex of the foetuses was for 1 h at room temperature with a mix containing determined by gonadal morphological differences and the fluorescein-deoxy-UTP (TUNEL Label; Roche Diagnostics) testes were dissected together with adjacent mesonephros and terminal deoxynucleotidyl transferase (TUNEL in foetuses under 14 dpc, or without mesonephros above enzyme; Roche Diagnostics). Detection of apoptotic cells 14 dpc. In addition, the anterior pituitary was collected. was performed on the sections previously processed for For castration experiments, animals of both sexes were cytochemical detection of ALPP. Images were captured killed at 1000 h and randomly cycling females were used. using a Nikon Eclipse 90i microscope.

In situ analyses RNA preparation, reverse transcription, RT-PCR and real-time RT-PCR analyses Tissues were ﬁxed 1 h (pituitary and embryonic testes) or 2 h (pre-pubertal and adult testes) in 2% paraformalde- Total RNA from individual organs was extracted with the hyde and then processed according to previously RNeasy Mini RNA extraction kit (Qiagen) and reverse described procedures (Guigon et al. 2003, Granger et al. transcribed using oligo-dT (Qiagen) and Superscript II 2004). Brieﬂy, after washing in PBS–sucrose, tissues were reverse transcriptase (Invitrogen). Quantitative real-time embedded in Tissue-Tek OCT compound (Sakura/CML, RT-PCR was performed using the LightCycler 480 instru-

Journal of Molecular Endocrinology Nemours, France) and 5 mm sections were cut on a ment and the LightCycler 480 SYBR Green I Master mix CM1950 cryostat (Leica, Nussloch, Germany). The sec- (Roche Diagnostics) according to the manufacturer’s tions were mounted onto ten-well TESPA (3-aminopropyl- protocol. PCRs were performed using the primers listed triethoxysilane; Sigma)-coated medical diagnostic slides in Table 1. All primer pairs were tested before use for (Menzel-Glaser/CML, Nemours, France). For the detection specificity and efficacy; only those that displayed an of ALPP activity, slides were heated at 65 8C to denature optimum efficacy (equal or superior to 1.8) were retained. endogenous phosphatases prior to incubation with a The conditions for each real-time PCR were kept as chromogenic enzyme substrate mixture containing nitro follows: 10 min at 95 8C followed by 40 cycles of blue tetrazolium. Detection of HSD3b (3b-hydroxysteroid denaturation (10 s at 95 8C), annealing (10 s at 60 8C) dehydrogenase enzyme) in Leydig cells was performed by and extension (10 s at 72 8C) with single acquisition of using either histochemical staining with a chromogenic fluorescence at the end of each extension step. The enzyme substrate mixture composed of blue tetrazolium, specificity of real-time PCR products was confirmed by etiocholan-3b-ol-17-one and nicotinamide adenosine the analysis of the melting curve and agarose gel diphosphate in phosphate buffer (pH 7.2) (Collenot & electrophoresis. Quantification of gene expression was Collenot 1977), or immunostaining using a rabbit performed using Relative Quantification Software (Roche polyclonal antibody directed against mouse HSD3b Diagnostics), and data were expressed as a ratio of target (kindly provided by Dr P Robel, CHU Biceˆtre, France) at gene to the reference gene Hprt. This reference gene was a 1/1000 dilution and incubation with an Alexa 488- selected after comparison with Ppia (cyclophilin) and conjugated anti-rabbit IgG secondary antibody (Molecular Eif4h (eukaryotic translation initiation factor 4H or Probes, Eugene, OR, USA) used at a 1/1000 dilution. In situ Wbscr1)(O’Shaughnessy et al. 2002), as the same results hybridisation was performed on frozen sections using were observed using Hprt or Eif4h.

Table 1 List of primer couples generated for real-time RT-PCR

Primer sequences (50–30)

Genes NCBI reference Forward Reverse Size (bp)

mr-Hprt NM_013556.2 AGGACCTCTCGAAGTGT ATTCAAATCCCTGAAGTACTCAT 105 NM_012583.2 mr-Ppia (cyclophilin) NM_008907.1 CAAAGTTCCAAAGACAGCAG CTGGCACATGAATCCTGGAA 109 NM_017101.1 m-Eif4h (Wbscr1) NM_033561.1 CTGCAATGTCCACACGAAGTG AAGTGCCCTCAACTTCCCTT 113 h-ALPP NM_001632.3 GGATGTTACCGAGAGCGAGA ATGAAGGTCTGCTCCTGCAC 119 m-Gnrhr NM_010323.1 CAGCTTTCATGATGGTGGTG GGTCACACATTGCGAGAAGA 209 r-Gnrhr NM_031038.3 TCAGCTGCCTGTTCATCATC AACATTTCCGGATCAAACCA 244 m-Thbs2 (Tsp2) NM_011581.3 GTCCGGACTCTATGGCATGAC GAGAAGACAAACAGGCCCAG 194 m-Hsd3b6 NM_013821.3 GGAGGAGATCAGGGTCCTGG CTAGGATGGTCTGCCTGGG 209 mr-Star NM_011485.4 GTCATCAGAGCTGAACACGG TGGCGAACTCTATCTGGGTC 163 NM_031558.2 mr-Cyp17a1 NM_007809.3 CTTTCCTGGTGCACAATCCT TACGCAGCACTTCTCGGATA 141 NM_012753.1 m-Lhcgr NM_013582.2 ACCAAAAGCTGAGGCTGAGA GGAGGCAGATGCTGACTTTC 123 mr-Lhb NM_008497.2 ATCACCTTCACCACCAGCAT GACCCCCACAGTCAGAGCTA 229 NM_012858.2 mr-Cga NM_009889.2 GCTGTCATTCTGGTCATGCT GAAGCAACAGCCCATACACT 159 NM_053918.2

m, mouse; r, rat; mr, compatible rat and mouse.

Adapted RT-PCR for the detection of very low levels of Lipofectamine 2000 (Invitrogen) following a reverse Gnrhr mRNA transfection protocol in 96-well plates as described previously (Schang et al. 2013). After 5 h transfection, Classical RT-PCR was adapted for the identification of very cells were treated for 20 h with or without 10 ng/ml activin low Gnrhr mRNA levels in the mouse testis. Briefly, total A (R&D, Minneapolis, MN, USA) or 150 ng/ml recombinant RNA extracted from the testis of adult mice was reverse mouse follistatin (Biovision, Milpitas, CA, USA) followed Journal of Molecular Endocrinology transcribed using Superscript II with the Gnrhr mRNA- by a 4 h treatment with an increasing concentration of specific primer (RT) 50-TCTAACCTTAAACCCTGCCTTG-30. the GnRH agonist triptorelin (Ipsen Biotech, Paris, PCR amplification was then performed using the forward 0 0 France). Luciferase reporter constructs were based on the (F) 5 -CTACTGCCTTCAATGCTTCCTT-3 and reverse (R) 50-TAGCGAATGCGACTGTCATC-30 primers under con- pGL3 basic vector (Promega Corporation). To facilitate ditions described previously (Moumni et al. 1994). comparison, numbering of Gnrhr promoters was relative to Amplifications were carried out for 40 cycles using the adenine of the translation start codon considered at C programmes optimised for Gnrhr cDNA (20 s at 95 8C, position 1. pLuc0.44 rat Gnrhr containing the proximal K K 30 s at 62 8C and 45 s at 72 8C) with a final 10 min rat Gnrhr promoter ( 475 to 32) as well as the pLuc K C incubation at 72 8C. Two negative controls were system- minimal Prl promoter ( 35/ 35) was described pre- atically added, in which water replaced RNA during the RT viously (Pincas et al. 2001). pLuc 0.45 mouse Gnrhr preparation or cDNA during the PCR preparation. contained the mouse proximal promoter extending from K480 to K11. The promoter fragment was obtained by the amplification of mouse genomic DNA and inserted into Cell culture and transient transfection assays the HindIII and XhoI sites of the modified pGL3 vector as LbT2 cells kindly provided by Dr Pamela Mellon described previously for the rat promoter (Pincas et al. (University of California, San Diego, CA, USA) were 2001). Two independent clones were selected, verified by maintained in monolayer cultures using high-glucose sequencing, and tested in transient transfection assays. DMEM supplemented with 10% foetal bovine serum and The mouse promoter fragment displayed 100% identical

penicillin/streptomycin at 37 8C in humidiﬁed 5% CO2, sequence to the one published by Albarracin et al. (1994) 95% air. They were transiently transfected using and contained GnRH- and activin-response elements.

Statistical analysis promoters directed the expression of the transgene in a subpopulation of cells (Fig. 1A and B), previously Real-time RT-PCR results are expressed as the meanGS.E.M. identified as gonadotrope cells using co-immunodetection of at least three animals. Significant differences were with anti-LH beta antibody (Granger et al. 2004). By established by one-way ANOVA using the computer contrast, only the 3.3, as reported previously (Schang et al. program GraphPad Instat version 2.03 (GraphPad soft- 2011a), but not the 1.1 kb promoter was able to direct the ware, Inc., San Diego, CA, USA). When significant expression of the reporter gene in the testis. Staining was variations were found, the Tukey–Kramer multiple observed outside of the seminiferous tubules, in the comparison test was performed. Differences were interstitial tissue, most probably in Leydig cells (Fig. 1C considered significant at P%0.05. and D). Immunodetection of the steroidogenic enzyme HSD3b in the same sections (Fig. 1E and F) confirmed this hypothesis and indicated that transgene expression Results occurred in a subset of the Leydig cell population. In the ovary, surprisingly, both promoters were totally inactive Tissue and cell specificities of transgene expression (illustrated for the 3.3 kb promoter in Fig. 1G, H, and I). in 3.3- and 1.1-Gnrhr mouse lines Because atretic follicles have been reported to express We first examined the cell-specific activity of both the GnRHR (Peng et al. 1994), TUNEL analysis was further 3.3- and 1.1-kb Gnrhr promoters in the testis and ovary of performed to identify these follicles (arrows in Fig. 1G mice as well as in the pituitary using in situ ALPP staining. and I). The results revealed that none of them displayed As expected from our previous work, in the pituitary, both ALPP activity.

3.3 kb 1.1 kb 3.3 kb Pituitary Ovary ABh-ALPP h-ALPP G

Journal of Molecular Endocrinology Fibronectin Testis CDh-ALPP h-ALPPH h-ALPP

EFHSD3b HSD3bI TUNEL

Figure 1 In situ detection of ALPP in the pituitary and testis, but not ovary, of two but not the 1.1 kb (D) promoter is sufficient to drive ALPP expression in transgenic mice lines. Two lines of adult transgenic mice bearing ALPP testicular Leydig cells identified by HSD3b immunohistochemistry (E and F under the control of the 3.3 or 1.1 kb rat Gnrhr promoter were analysed to respectively). The 3.3 kb promoter is inactive in healthy ovarian cells as identify the sites of expression in the testis (C, D, E and F), ovary (G, H and I) demonstrated by the lack of ALPP coloration (H) as well as in atretic follicles as well as in the pituitary (A and B) used as a reference. (A and B) ALPP is (arrow) detected by TUNEL (I). (G) Double labelling with fibronectin expressed in the pituitary of both lines of mice as expected. The 3.3 kb (C) antibody was used to localise the ovarian follicles. Scale bar, 100 mm.

Developmental profile of rat Gnrhr promoter activity in We next compared the testicular expression of the the testis: comparison with endogenous Gnrhr in mouse transgene with Gnrhr endogenously expressed in mice. and rat testes Surprisingly, in mouse testes, Gnrhr mRNA levels were unquantifiable by real-time RT-PCR whatever the develop- The 3.3-Gnrhr mice were used to determine the onto- mental stage. They could only be detected in adapted genetic expression pattern of the transgene in the RT-PCR (see Materials and methods) using Gnrhr-specific testis. To this end, total RNA was extracted from the testes primers in the retrotranscription step (Fig. 2C). This dissected at several stages starting from 17 dpc and ALPP suggested that endogenous Gnrhr is duly expressed in the mRNA levels quantified using real-time RT-PCR. As shown mouse testis, however, at a very low expression level, in Fig. 2A, ALPP mRNA levels decreased sharply, by more estimated to be about 180 times lower than in the adult than 80%, after birth and reached the lowest values by the pituitary. By contrast, similar experiments conducted end of the first postnatal week. Expression of the transgene using RNA from rat testes indicated that levels of Gnrhr then remained at very low levels for more than 2 weeks. mRNA were strikingly higher than those in the mouse and Then,from30to35days,mRNAlevelsincreased easily quantified by real-time RT-PCR (Fig. 2B). Comparing continuously and significantly until adulthood. the developmental expression profiles of ALPP in mice and of endogenous Gnrhr in rats revealed striking similarities (Fig. 2A and B). In both cases, gene expression displayed a A ALPP - mouse 0.2 biphasic profile, with high mRNA levels around birth, b which first declined and then increased at the end 0.16 Hprt ab of the pre-pubertal period. Rat promoter activity, as 0.12 a abc evidenced through ALPP expression in a mouse context, 0.08 abcd thus matched better with rat than mouse endogenous cd Gnrhr expression. cd 0.04

mRNA relative to mRNA relative d d

0 Age 0 dpn3 dpn7 dpn 17 dpc 10 dpn14 dpn 21 dpn24 dpn28 dpn34 dpn 56 dpn Figure 2 Ontogenetic expression of ALPP and Gnrhr mRNA levels in the mouse and B Gnrhr - rat rat testis. Testes were removed from 17 dpc to 56 dpn mice (A) or from

Journal of Molecular Endocrinology 20 dpc to 55 dpn rats (B). Total RNA was extracted and specific mRNAs 3.0 b quantified using real-time RT-PCR, as described in the Materials and methods section, with reference to Hprt for standardisation. Values are the Hprt b meanGS.E.M. of at least three animals in each age group. Groups with 2.0 different letters are significantly different (P!0.05). (C) Detection of very ab ab low levels of Gnrhr mRNA in mouse gonads by adapted RT-PCR (see a Materials and methods). Top: schematic representation of the mouse Gnrhr 1.0 a showing a general intron/exon organisation with 30 and 50-UTR (bold lines)

mRNA relative to mRNA relative a flanking the coding sequence (boxed). Below are positioned the reverse transcription-specific primer (Rev.Transcrip.) and the forward (F) and 0.0 reverse (R) primers used. I1, I2: introns 1 and 2; ATG: start codon of 0 dpn3 dpn7 dpn Age 20 dpc 14 dpn18 dpn21 dpn25 dpn30 dpn35 dpn40 dpn 55 dpn translation; STOP: stop codon of translation. Bottom: gel analysis of RT-PCR products amplified from the pituitary (Pit), testis and ovary RNA. To obtain quantitatively comparable signals, a calibration protocol was developed as C Gnrhr - mouse follows: GnRHR-specific retrotranscription was performed in parallel in the 0 200 400 600 800 1000 presence of either 0.5 mg pituitary RNA, 0.5 mg ovary RNA or 2 mg testis RNA bp in the 20 ml reaction mix and 0.5, 1.5 and 3 ml respectively were used for 11 12 ATG STOP subsequent PCR in a final 50 ml volume. Aliquots of 2, 6 and 15 ml from the pituitary, ovary and testis mixtures were loaded onto the gel. Accordingly, the material visualised on the gel is representative of RT-PCR from F R Rev.Transcrip. 90 ng testis RNA, 4.5 ng ovary RNA and 0.5 ng pituitary RNA. It represents roughly 180 times for the testis, and 9–10 times for the ovary, that from the Pit TestisPit Ovary MW pituitary. The expected size of the PCR product using F-R is 672 bp, whereas the smaller size (455 bp) represents the amplification of the truncated spliced variant naturally occurring through the deletion of the second exon 500 bp (217 nucleotides long). DNA sequencing (Eurofins MWG Operon, Ebersberg, Germany) proved the identity of the material eluted from either band in accordance with mouse data bank sequences.

Similar biphasic profiles were observed when genes expression declined soon after birth to reach undetect- known to be involved in steroidogenic function in Leydig able levels after about 2 weeks of postnatal life, whereas, cells were quantified. Genes encoding Star and the enzyme by contrast, Hsd3b6 expression was induced after 3 weeks steroid 17-alpha-hydroxylase/17,20 lyase (Cyp17a1) ana- of postnatal life. lysed in mice (Fig. 3A and C) and rats (Fig. 3B and D), as well as the LH receptor gene (Lhcgr) in mice (Fig. 3E), were In situ analysis of transgene expression highly expressed at the end of foetal life (17 dpc in mice in the developing mouse testis and 20 dpc in rats). They displayed strong decreases in expression at birth (from 75 to 85% decrease depending To address the tissue localisation of transgene expression on the gene). The expression of these genes remained during development as well as to extend the analysis to low during the pre-pubertal period and thereafter increa- early developmental stages, we performed an in situ sed significantly until the adult life. These expression ontogenetic study of Gnrhr promoter activity in the patterns probably reflected the differentiation and differentiating testis. ALPP activity could be detected as evolution of Leydig cells and specifically the transition early as 12 dpc, i.e. at the very beginning of Leydig cell differentiation (O’Shaughnessy et al. 2006). It is, however, between foetal and adult populations. This was further worth noting that only a subset of Leydig cells identified illustrated using marker genes of both populations, by immunodetection of the steroidogenic enzyme HSD3b i.e. Thbs2 (encoding thrombospondin-2) for foetal was positive for ALPP activity (cf. Figure 4A and C). In all Leydig cells and Hsd3b6 (encoding 3b-hydroxysteroid subsequent stages during the foetal period, ALPP-positive dehydrogenase isomerase type 6) for adult Leydig cells cells became gradually more abundant (Fig. 4B), but (O’Shaughnessy et al. 2002). As illustrated (Fig. 3F), Thbs2 were markedly less than the Leydig cells expressing HSD3b (Fig. 4D).

ABStar - mouse Star - rat After birth, during the ﬁrst postnatal week, ALPP- and 10.0 8.0 a a HSD3b-positive cells were in similar proportion (cf. Hprt 8.0 Hprt 6.0 6.0 d Figure 5A and B). These cells were roundish in form and 4.0 4.0 most of them were organised in clusters that are typical of c 2.0 b b 2.0 b b Leydig cells of foetal type (Kerr & Knell 1988, Vergouwen mRNA relative to 0.0 mRNA relative to 0.0 et al. 1991). During the second and third postnatal weeks, 0 dpn3 dpn7 dpn 0 dpn3 dpn7 dpn 17 dpc 10 dpn14 dpn 21 dpn24 dpn 34 dpn 56 dpn 20 dpc 14 dpn18 dpn21 dpn25 dpn30 dpn35 dpn40 dpn 55 dpn

Age Age the number of ALPP-positive cells increased substantially

Journal of Molecular Endocrinology C Cyp17a1 - mouse D Cyp17a1 - rat (Fig. 5C and F) and was higher than the number of Leydig 4.0 12.0 a a cells identiﬁed by HSD3b activity (Fig. 5D and G)or Hprt Hprt 3.0 9.0 f cd Cyp11a1 transcript expression (Fig. 5E and H). At this 2.0 cd 6.0 e bd period, in addition to roundish clustered cells (Fig. 5F, bd bd 3.0 1.0 bd b bc bc b bc mRNA relative to mRNA relative to cd insert 2), a new type of ALPP-positive, but HSD3b- 0.0 0.0 negative, cells had differentiated. These cells were 0 dpn3 dpn7 dpn 0 dpn3 dpn7 dpn 17 dpc 10 dpn14 dpn 21 dpn24 dpn 34 dpn 56 dpn 20 dpc 14 dpn18 dpn21 dpn25 dpn30 dpn35 dpn40 dpn 55 dpn Age Age spindle-shaped (Fig. 5F, insert 1) and not clustered, as

EFLhcgr - mouse Hsd3b6 Thbs2 - mouse were the roundish Leydig cells positive for HSD3b activity 8.0 c' 4.0

ac Hprt (Fig. 5G, insert) and Cyp11a1 expression (Fig. 5H, insert). Hprt a ac 6.0 3.0 a These cells are typical progenitors of the adult lineage c 4.0 2.0 b' b et al 2.0 (Benton . 1995). 1.0 b b c a' mRNA relative to mRNA relative to 0.0 0.0

0 dpn3 dpn7 dpn 0 dpn3 dpn7 dpn 17 dpc 10 dpn14 dpn 21 dpn24 dpn 34 dpn 56 dpn 17 dpc 10 dpn14 dpn 21 dpn24 dpn 34 dpn 56 dpn Age Age Comparison of transgene and Gnrhr expression in the pituitary during postnatal development and following

Figure 3 castration in the adult Ontogenetic expression of Star (A and B), Cyp17a1 (C and D), Lhcgr (E), Hsd3b6 and Thbs2 (F) mRNA levels in the mouse and/or rat testis. Specific Contrasting with the testis, in mouse pituitary, both mRNAs were quantified using real-time RT-PCR as described in the transgene and Gnrhr mRNA were readily detected by real- Materials and methods section with reference to Hprt for standardisation time RT-PCR at all ages investigated, i.e. from the end using the same pool of total RNA as in the Fig. 2A and B legend. Values are the meanGS.E.M. of at least three animals in each age group. Groups with of gestation to adult. Interestingly, the two profiles different letters are significantly different (P!0.05). obtained in this tissue (Fig. 6A) were rather similar and

12 dpc 18 dpc further indicating that the lack of response was not gender A ALPP B ALPP dependent. In contrast, castration led to an increase in the expression of the gonadotropin subunit genes Lhb and Cga not only in rats but also in mice in both sexes (Fig. 6B, C, D, E, and F), validating the protocol and providing evidence for the response of pituitary gonadotrope cells in both species. Most importantly, and contrasting with the endogenous gene, a marked increase in transgene expression was simultaneously observed in the pituitary of C HSD3b D HSD3b activity castrated male and ovariectomised female mice. The same results were obtained with the 1.1-Gnrhr mouse line (Fig. 6E and F). The rat promoter sequences, the long (3.3 kb) as well as the shorter one (1.1 kb), were thus able to direct gene expression in a species-specific manner, mimicking in the mouse environment the castration-induced responsiveness of the rat endogenous Gnrhr. These results not Figure 4 only reveal species specificity in response to the castration In situ detection of ALPP in Leydig cells of 3.3 kb-Gnrhr mouse testes at foetal stages 12 and 18 dpc (A, C and B, D respectively). Leydig cells were of the rat and mouse Gnrhr but also demonstrate that identified by HSD3b immunofluorescence (C) or histochemical detection of the up-regulation of the rat Gnrhr following castration is HSD3b activity (D). The expression of ALPP begins at 12 dpc (A), in maintained in the mouse gonadotrope cell context. agreement with incipient Leydig cell differentiation. At 18 dpc, ALPP expression is heterogeneous among Leydig cells (B). At both ages, the Moreover, comparison of data from the two transgenic number of ALPP-positive cells is notably less than the Leydig cells as models indicates that this regulation is mediated by revealed by HSD3b observed in the same section at 12 dpc (C) or in a serial response element(s) contained within the 1.1 kb sequence section at 18 dpc (D). Scale bar, 100 mm. of the rat Gnrhr promoter.

markedly differed from the profile characterised in the Potential role of the activin/follistatin system in the testis (cf. Fig. 2A). Indeed, in the pituitary, both ALPP differential pituitary response of the rat and mouse and Gnrhr expression increased steadily during the first Gnrhr promoter following castration Journal of Molecular Endocrinology 3 postnatal weeks, and then a sharp drop occurred Among these response elements, the Gnrhr-activating between days 24 and 34 and expression levels remained sequence (GRAS) located at position K391/K380 (Duval at an average value until adulthood. There was, however, et al.1999) and the downstream activin regulatory a phase shift during a sharp period extending from element (DARE) located at position K366/K349 10 to 24 dpn, reflected first by a decline in rat promoter (Cherrington et al. 2005) mediate activin stimulation of activity (ALPP) between 10 and 14 dpn and then by the mouse Gnrhr. These two response elements are not a rebound to 21 and 24 dpn, slightly offset to conserved in the rat promoter, leading to the lack of the endogenous Gnrhr pattern. activin up-regulation of the rat Gnrhr. We thus examined Because an important feature of the rat pituitary Gnrhr whether a differential interaction between GnRH and the is its up-regulation following sex steroid depletion, we activin/follistatin system may account for species-specific investigated whether this property might also be conveyed differences in response to castration. Experiments were by the rat transgenic promoter. To this end, transgenic conducted in vitro using the LbT2 gonadotrope cell line mice and rats were castrated and pituitary levels of ALPP transiently transfected with the rat and mouse promoter and Gnrhr mRNA were measured in parallel. Figure 6B, C, luciferase fusion constructs (Fig. 7). Transfected cells were D, E, and F illustrates the results obtained after 8 days pretreated or not for 20 h with activin A or follistatin and of castration. As expected, castration up-regulated Gnrhr then treated for 4 h with an increasing concentration of expression in the rat pituitary (Fig. 6B). Surprisingly, such the GnRH agonist triptorelin. Regarding the rat gene, regulation was not observed in mice. Up-regulation of GnRHa induced a strong and highly significant (P!0.001) endogenous Gnrhr occurred neither in orchidectomised increase in promoter activity (from 3.5- to 6-fold over male (Fig. 6D), nor in ovariectomised females (Fig. 6C), control) whatever the concentration tested, with a

8 dpn A h-ALPP B HSD3b activity

18 dpn

CDh-ALPP HSD3b activity ECyp11a1

F GH

1 * * 1 *

* 2 2 Journal of Molecular Endocrinology

Figure 5 In situ detection of ALPP in Leydig cells of 3.3 kb-Gnrhr mouse testes at sections; F, G, H are higher magnifications of C, D, E respectively). postnatal days (dpn) 8 (A and B) and 18 (C, D, E, F, G, and H). Leydig cells ALPP-positive cells, negative for HSD3b activity and Cyp11a1 transcript were identified as in Fig. 4. At 8 dpn, the number of ALPP-expressing cells is expression and which are characteristically spindle-shaped (see insert 2 roughly similar to the number of cells displaying HSD3b activity (cf. serial in F), are adult Leydig cells that initiate their differentiation. Clustered sections A and B). They are foetal Leydig cells characterised by their roundish cells (insert 2 in F) stained for HSD3b activity (insert in G) roundish form and their organisation in clusters. At 18 dpn, the number of and Cyp11a1 expression (insert in H) are Leydig cells of foetal type. ALPP-expressing cells has increased (C) and is higher than the Leydig cells Asterisks in G and H identify magnified areas. Scale bar, 100 mm. expressing HSD3b activity (D) or Cyp11a1 transcripts (E) (C, D, E are serial

maximum at 1 nM GnRHa. By contrast, the activity of the Discussion mouse promoter, under the same conditions, was not In the past years, many studies have focused on defining significantly stimulated (PO0.05). Conversely, the rat the molecular mechanisms underlying the cell-specific promoter was unresponsive to activin or follistatin, as expected, while the activity of the mouse promoter and regulated expression of GnRHR in the pituitary. This was strongly stimulated (P!0.001) following activin has led to the identification of specific response elements treatment. The mouse promoter also appeared to be and gonadotrope-specific transcriptional repertoires sensitive to follistatin when cells were co-treated with (Hapgood et al. 2005). These investigations concerned 0.1 and 1 nM GnRHa. Furthermore, GnRHa dose-dependently essentially the mouse, rat and human Gnrhr and were decreased the response to activin stimulation. served by the two gonadotrope cell lines aT3-1 and LbT2,

ABOntogenetic profile Male rat data on GnRHR and Gnrhr mRNA in rats (Hapgood et al. 1.4 2.5 *** h-ALPP Intact (5) *** 2005). This speciﬁcity is further emphasised by the fact Hprt 1.2 Hprt Gnrhr 2.0 Orchidectomised (5) 1.0 1.5 that neither the 1.1 kb nor the 3.3 kb promoter is active in 0.8 *** 1.0 0.6 the ovary, suggesting the existence of additional regulat- 0.4 0.5 mRNA relative to 0.2 mRNA relative to 0.0 ory sequences such as an alternative promoter in this Age Gnrhr Lhb Cga 3 dpn7 dpn 17 dpc 10 dpn14 dpn21 dpn24 dpn28 dpn34 dpn 71 dpn tissue. Data obtained by two other groups using similar

CDFemale mouse 3.3 Male mouse 3.3 transgenesis approaches clearly support our results. 2.5 Intact (4) 2.5 Intact (4) Orchidectomised (3) Accordingly, McCue et al. (1997) and Duval et al. (2000) Hprt Hprt 2.0 Ovariectomised (4) 2.0 ** *** *** ** 1.5 *** NS * 1.5 NS observed that the 2.7 kb ovine Gnrhr promoter or the 1.0 1.0 1.9 kb murine promoter directs gene expression in the 0.5 0.5 mRNA relative to mRNA relative to 0 0 pituitary and testis of transgenic mice but not in the ovary. Gnrhr h-ALPP Lhb Cga Gnrhr h-ALPP Lhb Cga Further, Albarracin et al. (1999) reported that the shorter EFFemale mouse 1.1 Male mouse 1.1 1.2 kb murine promoter is active in the pituitary but not in 2.5 2.5 Intact (4) Ovariectomised (4) Intact (5) Orchidectomised (4) the testis. Together, these data indicate that the region Hprt Hprt 2.0 2.0 * *** 1.5 1.5 between K1.2 and K1.9 kb of the mouse promoter is *** NS * *** NS ** 1.0 1.0 crucial for testis-specific expression. Consistently, 0.5 0.5 mRNA relative to mRNA relative to 0 0 comparison by dot matrix pairwise alignments of the Gnrhr h-ALPP Lhb Cga Gnrhr h-ALPP Lhb Cga 3kb 50 upstream sequences of rat and mouse Gnrhr (Fig. 8A) indicated that sequence identity was abruptly Figure 6 lost beyond base positions K2085 and K2094 respect- Ontogeny of ALPP and Gnrhr mRNAs in the mouse pituitary during peri- /postnatal development (A), and (B, C, D, E, and F) effects of castration on ively, suggesting that genomic sequence escaped from the expression of pituitary ALPP, Gnrhr, Lhb and Cga mRNA in the male and functional constraints beyond 2.1 kb in both rats and female adult mice of 3.3-Gnrhr (C and D) and 1.1-Gnrhr (E and F) lines, mice. We may therefore suggest that the promoter domain keeping male rats as the reference (B). (A) Ontogenetic expression of ALPP K and endogenous Gnrhr mRNA was determined using real-time RT-PCR on located between the ATG codon and 1.1 kb accounts for total RNA from pituitaries of 17 dpc, and 3, 7, 10, 14, 21, 24, 28, 34, and pituitary-specific expression and that the region located 71 dpn male mice. (B, C, D, E, and F) Pituitary mRNA levels were quantified between K1.1 and K2.1 is needed for testis specification by real-time RT-PCR in parallel in intact and orchidectomised male rats (B) and mice (D and F) and ovariectomised female mice (C and E) killed 8 days and accounts for species-specific differences in gene post-operative. Values are the meanGS.E.M. of four to five animals in each expression levels in the gonads. However, this upstream experimental group and are expressed relative to Hprt.NS,PO0.05; domain does not appear to be conserved in other *P%0.05; **P%0.01; ***P%0.001 when compared with control Journal of Molecular Endocrinology intact animals. mammalian species, namely in the human promoter. Indeed, sequence identities between human and rat (or mouse) promoters are lost beyond 1200 bp from the ATG generated by targeted oncogenesis in P Mellon’s group codon (Schang et al. 2011a). Further inspection of the (Windle et al. 1990, Alarid et al. 1996, Thomas et al. 1996). Gnrhr loci indicates that several conserved non-coding By comparison, only a few studies have characterised the sequences are present in the first intron. These constrained Gnrhr mechanisms underlying promoter activity in extra- elements constitute additional candidates that may confer pituitary tissues because of the lack of appropriate host cell tissue-specific gene expression in testis, ovary or other lines. An alternative approach based on the generation of extrapituitary tissues. mouse models by additive transgenesis has been The expression profiles of ALPP driven by the rat developed to complement these in vitro studies. In the promoter in the mouse testis and of Gnrhr in the rat testis present work, we took advantage of such transgenic mice are strikingly correlated. Profiles of rat mRNA are to initiate the characterisation of rat Gnrhr promoter consistent with initial studies co-authored by Huhtaniemi activity in the developing testis. In adulthood, we et al. (1985) identifying in the rat testis the highest provided evidence that the 3.3 kb sequence of the rat concentration of GnRH-binding sites at day 1 of life, Gnrhr promoter is able to direct testis-specific expression of followed by a decline reaching a nadir at 15 dpn, and then the ALPP reporter gene. By contrast, the 1.1 kb promoter, a gradual increase until adulthood. Furthermore, the although known to confer maximal pituitary activity testis-specific patterns of rat Gnrhr expression and the (Granger et al. 2004), was ineffective. In addition, we transgene are in close concordance with the develop- demonstrated that 3.3 kb promoter activity is restricted to mental pattern of several Leydig cell marker genes such as Leydig cells, a cell specificity in agreement with previous Lhgcr, Star and Cyp17a1. All these genes are known to be

Rat Gnrhr promoter increase occurs around 20 dpn and correlates with the

Control Activin Follistatin onset of Hsd3b6 expression that follows the initial

60 *** differentiation of the adult Leydig cell population. This differentiation starts around day 10 and is associated with 50 min the proliferation of progenitors distinct from foetal Leydig Prl 40 cells. Studies on the Dhh-null mouse have now supported 3.68× 3.54× 3.85× /pLuc 30 the hypothesis that foetal Leydig cells remain in the testis

Gnrhr but are concealed by the development of a much greater 20 adult population (Clark et al. 2000). Alternatively, 10 proliferation of other cell types, notably Sertoli cells, Relative luciferase activity pLuc0.44 after birth may contribute to the change in the proportion 0 Control GnRHa 0.1nM GnRHa 1nM GnRHa 10nM of foetal Leydig cells (Baker & O’Shaughnessy 2001). At these stages, Leydig cells in clusters and of round shape Mouse Gnrhr promoter corresponding to the foetal population strongly co-express Control Activin Follistatin ALPP and HSD3b; the others, mostly of spindle shape, 120 correspond obviously to differentiating adult Leydig cells, 1.07× min 100 *** *** expressing Gnrhr but not yet HSD3b. This differs from Prl 80 *** foetal cells where the activity of the promoter appears /pLuc *** concomitantly or posteriorly to the expression of HSD3b

60 1.34×

Gnrhr when the majority of cells are HSD3b positive/ALPP 1.32× 40 *** ** negative at 12 dpc. These data support the idea that

20 Gnrhr, or its surrogate ALPP, could be a marker of adult Relative luciferase activity

pLuc0.45mo Leydig cell progenitors. 0 Control GnRHa 0.1nM GnRHa 1nM GnRHa 10nM These testis-specific expression patterns appear clearly distinct from those previously observed in the foetal pituitary (Granger et al. 2004, 2006). In the pituitary, we Figure 7 Comparative effects of activin A, follistatin and GnRH on rat and mouse further show here that both ALPP and endogenous Gnrhr Gnrhr promoter activities in LbT2 gonadotrope cells. LbT2 cells were are co-expressed in a remarkably similar manner, notably co-transfected for 5 h with pRL-SV (internal control of transfection during postnatal development. In their whole, pituitary efficiency) together with the pLuc0.44 Gnrhr (K475/K32 rat promoter), Journal of Molecular Endocrinology pLuc0.45mo Gnrhr (K480/K11 mouse promoter) or pLucPrlmin (K35/C35) profiles displayed a gradual increase of expression in the construct, incubated for 20 h in DMEM supplemented with 2% foetal period before puberty to return later at a stable inter- bovine serum in the absence (black bars) or presence (light grey bars) of mediate level. Such profiles are compatible with activin A (10 ng/ml) or follistatin (150 ng/ml, dark grey bars) and finally post-incubated for 4 h with a control medium or medium supplemented progressive differentiation and development of the gona- with activin or follistatin and containing or not (control) increasing dotrope cell lineage with the influence of hormonal concentrations of the GnRH agonist triptorelin (GnRHa) as indicated. Cells regulation, especially at puberty (Wilson & Handa 1997, were then lysed and firefly and Renilla luciferase activities were determined. The highest concentrations of GnRH (10 nM) as well as activin Zapatero-Caballero et al. 2003, 2004). treatment induced small but consistent increases in the activity of the Importantly, we report here species-specific diver- minimal Prl promoter and of the empty pGL3 vector (not illustrated). These gences between rat and mouse Gnrhr expression that are variations were considered as non-specific and results were therefore expressed as fold stimulation over minimal Prl promoter activities for each further underlined by the behaviour of the transgene in its treatment. Values are the meanGS.D. of three to four independent mouse context. Contrasting with the Gnrhr gene in the rat experiments performed in triplicate. Indicated statistical comparisons for testis and with the rat promoter ALPP fusion transgene the rat Gnrhr promoter are those between the GnRH-treated vs untreated cells (control). The ones reported for the mouse promoter are those in the mouse testis, the endogenous mouse Gnrhr is between the control or GnRH-treated cells vs activin or follistatin-treated expressed at very low levels in the gonads. These data are ! ! or co-treated cells: ***P 0.001; **P 0.01. consistent with previous works illustrating the lack of detection of GnRH-binding sites in the foetal (Pointis & expressed in both foetal and adult Leydig cell populations, Latreille 1986) as well as adult (Wang et al. 1983) mouse recapitulating different phases of their differentiation testis, the absence of functional consequences after Gnrhr (O’Shaughnessy et al. 2002). Indeed, the first increase in disruption (Wu et al. 2010) and the low activity of the the expression of these genes correlates well with Thbs2 1.9 kb mouse Gnrhr promoter in the testis of transgenic expression, which typifies foetal Leydig cells. The second mice. Indeed, the latter was estimated to be about 1:100

A Mouse Gnrhr promoter (–3255/+3 - ATG) –3000 –2500 –2000 –1500 –1000 –500 +3 +3 –2094 –1200 80.5% id.

–500

–1000

GATA repeat in rat Gnrhr –1200 AC repeat in mouse Gnrhr –1500 69.7% id.

–2000 –2085

–2500 Rat Gnrhr promoter (–3255/+3 - ATG)

–3000

No identity Testis specificity Pituitary specificity

B –2100 –1200 Journal of Molecular Endocrinology

Figure 8 Sequence comparison between the rat and mouse Gnrhr promoters. the testis-speciﬁc domains of rat and mouse Gnrhr promoters. In addition (A) Dot matrix representation of the pairwise alignment of rat vs mouse to some small sequence blocks that are lacking in one or the other DNA sequences. Strong sequence conservation between the mouse and rat promoter, the most important divergence is the presence of an AC/TG 50 upstream ﬂanking regions extends over 2 kb upstream of the ATG codon. repeat (1477/1377) in the mouse sequence that is lacking in the rat Sequence identity between the two promoters is abruptly lost beyond sequence and partially replaced by a GATA repeat (1446/1393). K2085 and K2094 in rats and mice respectively. (B) Pairwise alignment of

that in the pituitary (McCue et al. 1997), a value in the genetically engineered mice that either selectively ablated range found in the present study. The low expression of Gnrhr-expressing cells or expressed the yellow ﬂuorescent Gnrhr mRNA in the mouse testis is supported by the very protein under the endogenous Gnrhr promoter established faint labelling of Gnrhr mRNA subspecies identiﬁed by that the mouse Gnrhr is not expressed in Leydig cells (Wen northern blot (Bull et al. 2000). Interestingly, recent use of et al. 2010). Some faint expression could, however, be

detected in germ cells postnatally, supporting data from 1984a,b) reported, using radio-receptor assays, the absence Bull et al. on purified germ cells. The recent work of Anjum of an increase in the number of GnRHR in both male and et al. (2012) reporting strong immunoreactivity in both female mice for at least 2 months after castration. Our Leydig and germ cell populations may reflect a peculiar in vitro experiments using the LbT2 gonadotrope cells trait of the strain used, i.e. the Parkes mice. Alternatively, transiently transfected with the rat and mouse promoter the immunoreactive material detected may not be luciferase fusion constructs likewise illustrate the differ- representative of functional GnRHR. Thus, the majority ential responsiveness of the mouse and rat pituitary of the evidence implies that rats and mice display clear-cut Gnrhr to GnRH stimulation. Indeed, rat but not mouse differences in GnRHR expression notably in Leydig cells, Gnrhr promoter activity was significantly increased by suggesting potentially important functional differences in GnRH stimulation. This might be explained by activin/ the rat vs mouse genomic sequence. In this regard, it is follistatin-dependent mechanisms. Indeed, in normal

worth noting that an AC/GT repeat ((AC)14 AT (AC)15)is pituitary gonadotrope cells as well as in LbT2 cells, exclusively present in the mouse sequence at position GnRH stimulates follistatin gene (Fst) expression (Winters K1477/K1377 (Fig. 8). In at least two other promoters, et al. 2007) and Fst expression is increased in rat pituitaries those of the haem oxygenase I gene and of the von following gonadectomy (Kaiser & Chin 1993, Dalkin et al. Willebrand factor gene, variations in the length of these 1998). Follistatin has been shown to down-regulate mouse AC/GT repeats are correlated with various human diseases Gnrhr transcription, most probably by counteracting the that are thought to be linked to variations in promoter action of endogenous activin (Duval et al. 1999, Pernasetti activities (Daidone et al. 2010, Bean et al. 2012). This et al. 2001). Accordingly, GnRH dose-dependently repeat may therefore contribute to severe attenuation of decreased mouse promoter responsiveness to activin mouse promoter activity. Similarly, some blocks of the stimulation probably through follistatin-mediated activin sequence are lacking in one or the other promoters that neutralisation (Fig. 7). By contrast, the rat Gnrhr promoter, might have an impact on gene expression levels, the larger which is not sensitive to activin due to the lack of activin- one being located at positions K1900/K1881 in the rat response elements, was not inﬂuenced by follistatin sequence (Fig. 8B). This marked difference in mouse and treatment (Fig. 7; Cherrington et al. 2005). Altogether rat promoter activities in the testis is reminiscent of our these data suggest that divergent responses to castration in previous observations in the hippocampus where similar the rat and mouse species occur via follistatin that might divergence between those two promoter activities was counterbalance GnRH up-regulation of Gnrhr mRNA in identiﬁed (Schang et al. 2011b). In both cases, the rat the mouse but not in rat pituitary. The positive response

Journal of Molecular Endocrinology transgenic promoter displays the same behaviour during elicited by the rat transgenic promoter in the mouse embryonic and postnatal development as the rat endogen- context is instructive and suggests that, as in the gonads, ous Gnrhr, despite the mouse context. Together, these data the species-specific characteristics are encoded into the are consistent with a predominant role of genetic promoter sequences rather than being dictated by the information over cell context in species-specific variations physiological or cellular environment. Altogether our of Gnrhr expression. studies in transgenic mice using two distinct conditions This is further highlighted by castration experiments. and distinct tissues demonstrate that the activity of Castration is a widely used model known to induce the endogenous Gnrhr, on the one hand, and of a transgene up-regulation of Gnrhr and other genes such as Lhb and driven by a foreign Gnrhr promoter, on the other hand, Cga (Gharib et al. 1990, Counis 1999). Such regulation is may vary in a divergent, independent manner. In this mainly due to the removal of the negative feedback case, the transgene behaves with respect to the species mediated by gonadal steroids on GnRH secretion, leading origin and properties of the driving promoter. ultimately to enhanced stimulation of pituitary gonado- In conclusion, this study shows that the rat promoter trope cells (Herbison 1998). In adult mice, in contrast with is activated in foetal as well as adult Leydig cell progenitors rats, the castration-induced rise in GnRH secretion duly and strongly suggests that the rat Gnrhr is a marker of up-regulates gonadotropin subunit genes but not Gnrhr Leydig cell differentiation. Secondly, the tissue-specific expression. This is illustrated here 8 days after castration, elements required for directing Gnrhr expression in but was also observed after 15 days (not illustrated). Gnrhr these progenitor cells as well as in differentiated expression was not evaluated over a longer period of time, Leydig cells are most probably circumscribed to the and it remains possible that some changes may occur later. 2 kb promoter region 50 upstream of the ATG codon. However, studies from Clayton’s group (Naik et al. Third, and most importantly, our study points out the

inter-species variations in the level of Gnrhr activity in the luteal cells. Molecular Endocrinology 16 1552–1564. (doi:10.1210/ testis and its regulation in the pituitary, and thus under- me.16.7.1552) Cherrington BD, Farmerie TA, Lents CA, Cantlon JD, Roberson MS & lines the predominant influence of intrinsic information Clay CM 2005 Activin responsiveness of the murine gonadotropin- encoded into the promoter sequence. In this regard, releasing hormone receptor gene is mediated by a composite enhancer this study supports the recent concept developed by containing spatially distinct regulatory elements. Molecular Endocrinology 19 898–912. (doi:10.1210/me.2004-0214) Wilson et al. (2008) that in homologous tissues, the Clark AM, Garland KK & Russell LD 2000 Desert hedgehog (Dhh) gene is genetic sequence is mainly responsible for directing required in the mouse testis for formation of adult-type Leydig cells transcriptional programmes. and normal development of peritubular cells and seminiferous tubules. Biology of Reproduction 63 1825–1838. (doi:10.1095/biolreprod63.6.1825) Clayton RN & Catt KJ 1981 Gonadotropin-releasing hormone receptors: characterization, physiological regulation, and relationship to reproductive function. Endocrine Reviews 2 186–209. (doi:10.1210/edrv-2-2-186) Declaration of interest Collenot G & Collenot A 1977 L’activite 3b-hydroxysteroide deshydro- The authors declare that there is no conflict of interest that could be genasique dans les gonades en differentiation de Pleurodeles waltlii perceived as prejudicing the impartiality of the research reported. (Amphibien, Urodele); visualisation sur coupes seriees a l’aide d’une nouvelle technique histochimique. Journal of Embryology and Experimental Morphology 42 29–42. Encyclopedia of Reproduction Funding Counis R 1999 Gonadotropin biosynthesis. In , This work was supported by grants from the Paris Diderot Paris 7 University vol 2, pp 507– 520. Eds JD Neill & E Knobil. New York: Academic Press. ` and from the Centre National de la Recherche Scientifique (CNRS). M I was Counis R, Laverriere J-N, Garrel G, Bleux C, Cohen-Tannoudji J, Lerrant Y, a recipient of doctoral scholarship from Higher Education Commission, Kottler M-L & Magre S 2005 Gonadotropin-releasing hormone and the Reproduction, Nutrition, Development Islamabad, Pakistan. A L S was a recipient of a fellowship from the control of gonadotrope function. Ministe` re de la Recherche et de l’Education Nationale. 45 243–254. (doi:10.1051/rnd:2005017) Daidone V, Pontara E, Romualdi C, Cattini MG, Scaroni C, Albiger N, Pagnan A & Casonato A 2010 Microsatellite (GT)(n) is part of the von Willebrand factor (VWF) promoter region that influences the gluco- References corticoid-induced increase in VWF in Cushing’s syndrome. Thrombosis Research 125 e275–e280. (doi:10.1016/j.thromres.2010.01.031) Alarid ET, Windle JJ, Whyte DB & Mellon PL 1996 Immortalization of Dalkin AC, Haisenleder DJ, Gilrain JT, Aylor K, Yasin M & Marshall JC 1998 pituitary cells at discrete stages of development by directed oncogenesis Regulation of pituitary follistatin and inhibin/activin subunit messen- in transgenic mice. Development 122 3319–3329. ger ribonucleic acids (mRNAs) in male and female rats: evidence for Albarracin CT, Kaiser UB & Chin WW 1994 Isolation and characterization inhibin regulation of follistatin mRNA in females. Endocrinology of the 50-flanking region of the mouse gonadotropin-releasing 139 2818–2823. (doi:10.1210/en.139.6.2818) hormone receptor gene. Molecular Endocrinology 135 2300–2306. Duval DL, Ellsworth BS & Clay CM 1999 Is gonadotrope expression of Albarracin CT, Frosch MP & Chin WW 1999 The gonadotropin-releasing the gonadotropin releasing hormone receptor gene mediated by hormone receptor gene promoter directs pituitary-specific oncogene autocrine/paracrine stimulation of an activin response element? expression in transgenic mice. Endocrinology 140 2415–2421. Endocrinology 140 1949–1952. (doi:10.1210/en.140.4.1949) Journal of Molecular Endocrinology (doi:10.1210/en.140.5.2415) Duval DL, Farris AR, Quirk CC, Nett TM, Hamernik DL & Clay CM 2000 Anjum S, Krishna A, Sridaran R & Tsutsui K 2012 Localization of Responsiveness of the ovine gonadotropin-releasing hormone gonadotropin-releasing hormone (GnRH), gonadotropin-inhibitory receptor gene to estradiol and gonadotropin-releasing hormone is hormone (GnIH), kisspeptin and GnRH receptor and their possible not detectable in vitro but is revealed in transgenic mice. Endocrinology roles in testicular activities from birth to senescence in mice. 141 1001–1010. (doi:10.1210/en.141.3.1001) Journal of Experimental Zoology. Part A, Ecological Genetics and Physiology Gharib SD, Wierman ME, Shupnik MA & Chin WW 1990 Molecular biology 317 630–644. (doi:10.1002/jez.1765) of the pituitary gonadotropins. Endocrine Reviews 11 177–199. Baker PJ & O’Shaughnessy PJ 2001 Role of gonadotrophins in regulating (doi:10.1210/edrv-11-1-177) numbers of Leydig and Sertoli cells during foetal and postnatal Granger A, Ngo-Muller V, Bleux C, Guigon C, Pincas H, Magre S, development in mice. Reproduction 122 227–234. (doi:10.1530/ Daegelen D, Tixier-Vidal A, Counis R & Laverriere JN 2004 The rep.0.1220227) promoter of the rat gonadotropin-releasing hormone receptor gene Bean CJ, Boulet SL, Ellingsen D, Pyle ME, Barron-Casella EA, Casella JF, directs the expression of the human placental alkaline phosphatase Payne AB, Driggers J, Trau HA, Yang G et al. 2012 Heme oxygenase-1 reporter gene in gonadotrope cells in the anterior pituitary gland as gene promoter polymorphism is associated with reduced incidence of well as in multiple extrapituitary tissues. Endocrinology 145 983–993. acute chest syndrome among children with sickle cell disease. Blood (doi:10.1210/en.2003-0881) 120 3822–3828. (doi:10.1182/blood-2011-06-361642) Granger A, Bleux C, Kottler ML, Rhodes SJ, Counis R & Laverriere JN 2006 Benton L, Shan LX & Hardy MP 1995 Differentiation of adult Leydig cells. The LIM-homeodomain proteins Isl-1 and Lhx3 act with steroidogenic Journal of Steroid Biochemistry and Molecular Biology 53 61–68. factor 1 to enhance gonadotrope-specific activity of the gonadotropin- (doi:10.1016/0960-0760(95)00022-R) releasing hormone receptor gene promoter. Molecular Endocrinology 20 Botte MC, Chamagne AM, Carre MC, Counis R & Kottler ML 1998 Foetal 2093–2108. (doi:10.1210/me.2005-0184) expression of GnRH and GnRH receptor genes in rat testis and ovary. Guigon CJ, Mazaud S, Forest MG, Brailly-Tabard S, Coudouel N & Magre S Journal of Endocrinology 159 179–189. (doi:10.1677/joe.0.1590179) 2003 Unaltered development of the initial follicular waves and Bull P, Morales P, Huyser C, Socıás T & Castelloń EA 2000 Expression of normal pubertal onset in female rats after neonatal deletion of the GnRH receptor in mouse and rat testicular germ cells. Molecular Human follicular reserve. Endocrinology 144 3651–3662. (doi:10.1210/en. Reproduction 6 582–586. (doi:10.1093/molehr/6.7.582) 2003-0072) Cheng CK, Yeung CM, Chow BK & Leung PC 2002 Characterization of a Habert R 1992 Effect of decapitation and chronic in vivo treatment with a new upstream GnRH receptor promoter in human ovarian granulosa- gonadotrophin-releasing hormone agonist on testicular

steroidogenesis in the rat fetus. Journal of Endocrinology 133 245–251. Peng C, Fan NC, Ligier M, Vaananen J & Leung PC 1994 Expression and (doi:10.1677/joe.0.1330245) regulation of gonadotropin-releasing hormone (GnRH) and GnRH Habert R, Devif I, Gangnerau MN & Lecerf L 1991 Ontogenesis of the in vitro receptor messenger ribonucleic acids in human granulosa-luteal cells. response of rat testis to gonadotropin-releasing hormone. Molecular and Endocrinology 135 1740–1746. (doi:10.1210/en.135.5.1740) Cellular Endocrinology 82 199–206. (doi:10.1016/0303-7207(91)90032-N) Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang HJ, Miller WL & Habert R, Lejeune H & Saez JM 2001 Origin, differentiation and regulation Mellon PL 2001 Cell-specific transcriptional regulation of follicle- of foetal and adult Leydig cells. Molecular and Cellular Endocrinology stimulating hormone-b by activin and gonadotropin-releasing 179 47–74. (doi:10.1016/S0303-7207(01)00461-0) hormone in the LbT2 pituitary gonadotrope cell model. Endocrinology Hapgood JP, Sadie H, van Biljon W & Ronacher K 2005 Regulation of 142 2284–2295. (doi:10.1210/en.142.6.2284) expression of mammalian gonadotrophin-releasing hormone receptor Pincas H, Forrai Z, Chauvin S, Laverriere JN & Counis R 1998 Multiple genes. Journal of Neuroendocrinology 17 619–638. (doi:10.1111/ elements in the distal part of the 1.2 kb 50-flanking region of the rat j.1365-2826.2005.01353.x) GnRH receptor gene regulate gonadotrope-specific expression Herbison AE 1998 Multimodal influence of estrogen upon gonadotropin- conferred by proximal domain. Molecular and Cellular Endocrinology releasing hormone neurons. Endocrine Reviews 19 302–330. 144 95–108. (doi:10.1016/S0303-7207(98)00149-X) (doi:10.1210/er.19.3.302) Pincas H, Amoyel K, Counis R & Laverriere JN 2001 Proximal cis-acting Huhtaniemi IT, Catt KJ & Clayton RN 1985 Newborn and immature rat elements, including steroidogenic factor 1, mediate the efficiency of testes contain gonadotropin-releasing hormone (GnRH) receptors, and a distal enhancer in the promoter of the rat gonadotropin-releasing their testosterone production is stimulated by a GnRH agonist in vitro. hormone receptor gene. Molecular Endocrinology 15 319–337. Molecular and Cellular Endocrinology 40 41–44. (doi:10.1016/0303-7207 (doi:10.1210/me.15.2.319) (85)90156-X) Pointis G & Latreille MT 1986 Absence of LHRH effect on testosterone Jorgensen JS, Quirk CC & Nilson JH 2004 Multiple and overlapping production by Leydig cells from foetal mouse testis. Journal of Steroid combinatorial codes orchestrate hormonal responsiveness and dictate Biochemistry 24 307–310. (doi:10.1016/0022-4731(86)90070-1) cell-specific expression of the genes encoding luteinizing hormone. Ramakrishnappa N, Rajamahendran R, Lin YM & Leung PC 2005 GnRH Endocrine Reviews 25 521–542. (doi:10.1210/er.2003-0029) in non-hypothalamic reproductive tissues. Animal Reproduction Science Kaiser UB & Chin WW 1993 Regulation of follistatin messenger ribonucleic 88 95–113. (doi:10.1016/j.anireprosci.2005.05.009) acid levels in the rat pituitary. Journal of Clinical Investigation Schang A-L, Counis R, Magre S, Bleux C, Granger A, Ngoˆ-Muller V, 91 2523–2531. (doi:10.1172/JCI116488) Chenut M-C, Ishaq M, Cohen-Tannoudji J & Laverrie`re J-N 2011a Kang SK, Cheng KW, Ngan ES, Chow BK, Choi KC & Leung PC 2000 Reporter transgenic mouse models highlight the dual endocrine and Differential expression of human gonadotropin-releasing hormone neural facet of GnRH receptor function. Annals of the New York Academy receptor gene in pituitary and ovarian cells. Molecular and Cellular of Sciences 1220 16–22. (doi:10.1111/j.1749-6632.2010.05886.x) Endocrinology 162 157–166. (doi:10.1016/S0303-7207(00)00196-9) Schang A-L, Ngoˆ-Muller V, Bleux C, Granger A, Chenut M-C, Loudes C, Kerr JB & Knell CM 1988 The fate of foetal Leydig cells during the Magre S, Counis R, Cohen-Tannoudj J & Laverrie`re J-N 2011b GnRH development of the foetal and postnatal rat testis. Development receptor gene expression in the developing rat hippocampus: 103 535–544. transcriptional regulation and potential roles in neuronal plasticity. Lejeune H, Habert R & Saez JM 1998 Origin, proliferation and Endocrinology 152 568–580. (doi:10.1210/en.2010-0840) differentiation of Leydig cells. Journal of Molecular Endocrinology Schang A-L, Bleux C, Chenut M-C, Ngoˆ-Muller V, Que´rat B, Jeanny J-C, 20 1–25. (doi:10.1677/jme.0.0200001) Counis R, Cohen-Tannoudji J & Laverrie`re J-N 2013b Identification McCue JM, Quirk CC, Nelson SE, Bowen RA & Clay CM 1997 Expression of and analysis of two novel sites of rat GnRH receptor gene promoter a murine gonadotropin-releasing hormone receptor-luciferase fusion activity: the pineal gland and retina. Neuroendocrinology 97 115–131. Journal of Molecular Endocrinology gene in transgenic mice is diminished by immunoneutralization of (doi:10.1159/000337661) gonadotropin-releasing hormone. Endocrinology 138 3154–3160. Schang A-L, Granger A, Que´rat B, Bleux C, Cohen-Tannoudji J & (doi:10.1210/en.138.8.3154) Laverrie`re J-N 2013a A bi-functional promoter element in the rat Millar RP, Lu ZL, Pawson AJ, Flanagan CA, Morgan K & Maudsley SR 2004 gonadotropin-releasing hormone receptor gene conveys both Gonadotropin-releasing hormone receptors. Endocrine Reviews GATA2-induced silencer and LIM-Homeodomain protein-dependent 25 235–275. (doi:10.1210/er.2003-0002) enhancer properties. Molecular Endocrinology 27 74–91. (doi:10.1210/ Moumni M, Kottler ML & Counis R 1994 Nucleotide sequence analysis me.2012-1182) of mRNAs predicts that rat pituitary and gonadal gonadotropin- Scott HM, Mason JI & Sharpe RM 2009 Steroidogenesis in the fetal testis releasing hormone receptor proteins have identical primary structure. and its susceptibility to disruption by exogenous compounds. Endocrine Biochemical and Biophysical Research Communications 200 1359–1366. Reviews 30 883–925. (doi:10.1210/er.2009-0016) (doi:10.1006/bbrc.1994.1601) Stojilkovic SS, Reinhart J & Catt KJ 1994 Gonadotropin-releasing hormone Naik SI, Young LS, Charlton HM & Clayton RN 1984a Pituitary receptors: structure and signal transduction pathways. Endocrine gonadotropin-releasing hormone receptor regulation in mice. I: Males. Reviews 15 462–499. Endocrinology 115 106–113. (doi:10.1210/endo-115-1-106) Thomas P, Mellon PL, Turgeon J & Waring DW 1996 The LbT2 clonal Naik SI, Young LS, Charlton HM & Clayton RN 1984b Pituitary gonadotrope: a model for single cell studies of endocrine cell secretion. gonadotropin-releasing hormone receptor regulation in mice. II: Endocrinology 137 2979–2989. (doi:10.1210/en.137.7.2979) Females. Endocrinology 115 114–120. (doi:10.1210/endo-115-1-114) Vergouwen RP, Jacobs SG, Huiskamp R, Davids JA & de Rooij DG 1991 O’Shaughnessy PJ, Willerton L & Baker PJ 2002 Changes in Leydig cell gene Proliferative activity of gonocytes, Sertoli cells and interstitial cells expression during development in the mouse. Biology of Reproduction during testicular development in mice. Journal of Reproduction and 66 966–975. (doi:10.1095/biolreprod66.4.966) Fertility 93 233–243. (doi:10.1530/jrf.0.0930233) O’Shaughnessy PJ, Baker PJ & Johnston H 2005 Neuroendocrine regulation Wang NG, Sundaram K, Pavlou S, Rivier J, Vale W & Bardin CW 1983 of Leydig cell development. Annals of the New York Academy of Sciences Mice are insensitive to the antitesticular effects of luteinizing hormone- 1061 109–119. (doi:10.1196/annals.1336.013) releasing hormone agonists. Endocrinology 112 331–335. (doi:10.1210/ O’Shaughnessy PJ, Baker PJ & Johnston H 2006 The foetal Leydig cell – endo-112-1-331) differentiation, function and regulation. International Journal of Wen S, Ai W, Alim Z & Boehm U 2010 Embryonic gonadotropin-releasing Andrology 29 90–95 (discussion 105–108). (doi:10.1111/j.1365-2605. hormone signaling is necessary for maturation of the male reproductive 2005.00555.x) axis. PNAS 107 16372–16377. (doi:10.1073/pnas.1000423107)

Wilson ME & Handa RJ 1997 Ontogeny of gene expression in the Wu S, Wilson MD, Busby ER, Isaac ER & Sherwood NM 2010 Disruption gonadotroph of the developing female rat. Biology of Reproduction of the single copy gonadotropin-releasing hormone receptor in mice 56 563–568. (doi:10.1095/biolreprod56.2.563) by gene trap: severe reduction of reproductive organs and functions Wilson MD, Barbosa-Morais NL, Schmidt D, Conboy CM, Vanes L, in developing and adult mice. Endocrinology 151 1142–1152. Tybulewicz VL, Fisher EM, Tavare S & Odom DT 2008 Species-speciﬁc (doi:10.1210/en.2009-0598) transcription in mice carrying human chromosome 21. Science Zapatero-Caballero H, Sanchez-Franco F, Guerra-Perez N, 322 434–438. (doi:10.1126/science.1160930) Fernandez-Mendez C & Fernandez-Vazquez G 2003 Gonadotropin- Windle JJ, Weiner RI & Mellon PL 1990 Cell lines of the pituitary releasing hormone receptor gene expression during pubertal develop- gonadotrope lineage derived by targeted oncogenesis in transgenic ment of male rats. Biology of Reproduction 68 1764–1770. (doi:10.1095/ mice. Molecular Endocrinology 4 597–603. (doi:10.1210/mend-4-4-597) biolreprod.102.008821) Winters SJ, Ghooray D, Fujii Y, Moore JP Jr, Nevitt JR & Kakar SS 2007 Zapatero-Caballero H, Sanchez-Franco F, Fernandez-Mendez C, Transcriptional regulation of follistatin expression by GnRH in Garcia-San Frutos M, Botella-Cubells LM & Fernandez-Vazquez G 2004 mouse gonadotroph cell lines: evidence for a role for cAMP signaling. Gonadotropin-releasing hormone receptor gene expression during Molecular and Cellular Endocrinology 271 45–54. (doi:10.1016/j.mce. pubertal development of female rats. Biology of Reproduction 70 348– 2007.03.006) 355. (doi:10.1095/biolreprod.103.020818)

Received in ﬁnal form 15 March 2013 Accepted 27 March 2013 Accepted Preprint published online 27 March 2013 Journal of Molecular Endocrinology