Zeb1 Is a Potential Regulator of Six2 in the Proliferation, Apoptosis and Migration of Metanephric Mesenchyme Cells

International Journal of Molecular Sciences

Article Zeb1 Is a Potential Regulator of Six2 in the Proliferation, Apoptosis and Migration of Metanephric Mesenchyme Cells

Yuping Gu 1,†, Ya Zhao 1,2,†, Yuru Zhou 1,3,†, Yajun Xie 1, Pan Ju 1, Yaoshui Long 1, Jianing Liu 1, Dongsheng Ni 1, Fen Cao 1, Zhongshi Lyu 1, Zhaomin Mao 1, Jin Hao 1, Yiman Li 1, Qianya Wan 1, Quist Kanyomse 1, Yamin Liu 1, Die Ren 1, Yating Ning 1, Xiaofeng Li 1, Qin Zhou 1 and Bing Li 1,4,*

1 Division of Molecular Nephrology and The Creative Training Center for Undergraduates, The Ministry of Education Key Laboratory of Clinical Diagnostics, School of Laboratory Medicine, Chongqing Medical University, Chongqing 400016, China; [email protected] (Y.G.); [email protected] (Y.Z.); [email protected] (Y.Z.); [email protected] (Y.X.); [email protected] (P.J.); [email protected] (Y.L.); [email protected] (J.L.); [email protected] (D.N.); [email protected] (F.C.); [email protected] (Z.L.); [email protected] (Z.M.); [email protected] (J.H.); [email protected] (Y.L.); [email protected] (Q.W.); [email protected] (Q.K.); [email protected] (Y.L.); [email protected] (D.R.); [email protected] (Y.N.); [email protected] (X.L.); [email protected] (Q.Z.) 2 Department of Laboratory Medicine, The First Hospital of Xi’an, Xi’an 710002, China 3 Undergraduates Class of 2012 Entry, The Fifth Clinical College of Medicine, Chongqing Medical University, Chongqing 400016, China 4 The First Afﬁliated Hospital of Chongqing Medical University, Chongqing 400016, China * Correspondence: [email protected]; Tel.: +86-23-6848-5785 † These authors contributed equally to this work.

Academic Editor: Anthony Lemarié Received: 17 April 2016; Accepted: 27 July 2016; Published: 6 August 2016

Abstract: Nephron progenitor cells surround around the ureteric bud tips (UB) and inductively interact with the UB to originate nephrons, the basic units of renal function. This process is determined by the internal balance between self-renewal and consumption of the nephron progenitor cells, which is depending on the complicated regulation networks. It has been reported that Zeb1 regulates the proliferation of mesenchymal cells in mouse embryos. However, the role of Zeb1 in nephrons generation is not clear, especially in metanephric mesenchyme (MM). Here, we detected cell proliferation, apoptosis and migration in MM cells by EdU assay, ﬂow cytometry assay and wound healing assay, respectively. Meanwhile, Western and RT-PCR were used to measure the expression level of Zeb1 and Six2 in MM cells and developing kidney. Besides, the dual-luciferase assay was conducted to study the molecular relationship between Zeb1 and Six2. We found that knock-down of Zeb1 decreased cell proliferation, migration and promoted cell apoptosis in MM cells and Zeb1 overexpression leaded to the opposite data. Western-blot and RT-PCR results showed that knock-down of Zeb1 decreased the expression of Six2 in MM cells and Zeb1 overexpression contributed to the opposite results. Similarly, Zeb1 promoted Six2 promoter reporter activity in luciferase assays. However, double knock-down of Zeb1 and Six2 did not enhance the apoptosis of MM cells compared with control cells. Nevertheless, double silence of Zeb1 and Six2 repressed cell proliferation. In addition, we also found that Zeb1 and Six2 had an identical pattern in distinct developing phases of embryonic kidney. These results indicated that there may exist a complicated regulation network between Six2 and Zeb1. Together, we demonstrate Zeb1 promotes proliferation and apoptosis and inhibits the migration of MM cells, in association with Six2.

Int. J. Mol. Sci. 2016, 17, 1283; doi:10.3390/ijms17081283 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2016, 17, 1283 2 of 16

Keywords: Zeb1; Six2; metanephric mesenchyme cells; cell proliferation; cell apoptosis; cell migration

1. Introduction The kidney is a vital and complex organ that accomplishes multiple physiological functions in the body, such as metabolic waste excretion, water and electrolyte homeostasis control, acid-base balance and blood pressure maintenance. Nephrons is the major functional units for kidney to perform these tasks [1,2]. During kidney development, nephrons’ formation is mainly decided by the interaction of the ureteric bud (UB) and metanephric mesenchyme (MM) cells [3,4]. It begins at embryonic day 10.5 (E10.5) to E11.0 when the UB starts growing and branching under the induction of MM cells [5], and MM cells aggregate around the branched tips of UB. Then, the MM cells and UB form nephrons by two cellular processes: MET and tubule genesis [6]. These reports indicate that MM cells are the original cells of nephron generation and inductively interact with UB in kidney development [7,8]. In addition, self-renewal (proliferation) and consumption of MM cells determine the formation and complement of nephrons [8,9]. Consequently, the proliferation, apoptosis and migration of MM cells become especially important in the study of kidney development. Zeb1, a transcription factor containing 1117 amino acids, is an EMT marker in cancer metastasis of some tissues including kidney [10,11]. Zeb1 promotes EMT through suppression of CDH1 (encoding E-cadherin, an epithelial maker) and the microRNA-200 [10]. This process activates transforming growth factor-β1 (TGF-β1) signaling pathway and trigger cancer cell proliferation, invasiveness and stemness out of control [11,12]. In addition, Zeb1 also plays a critical role in animal organ development [13], cartilage development [14] and regulation of mesenchymal cell proliferation [15]. As an example, loss of Zeb1 results in MET and reduce the proliferation of progenitor cells at the sites of developmental defects in mouse embryos [15]. However, there is little reference about the concrete role of Zeb1 in the cellular regulation of MM cells. Six2, a MET-marker, maintains cap mesenchyme multipotent nephron progenitor cells at an undifferentiated state, promotes MM cell proliferation and restrains cell apoptosis during kidney development [8,9,16]. Deﬁciency of Six2 depletes cap mesenchyme progenitors, ectopic differentiation, and severe kidney hypoplasia and dysplasia [17,18]. However, EMT and MET are two distinct cellular processes that respectively function in cancer metastasis and development. Zeb1 and Six2 are the main markers of these two processes, respectively, but whether there exists a relationship between Zeb1 and Six2 in MM cells remains unknown. Here, we found that Zeb1 promoted cell proliferation and migration, but suppressed cell apoptosis in MM cells, and Zeb1 can bind to Six2 promoter to regulate its transcription by dual-luciferase assay and bioinformatics analysis. Our RT-PCR and Western blot results showed that Zeb1 increased the expression of Six2. Both of Zeb1 and Six2 had a high expression level in embryonic kidney at E13.5 and E18.5. These discoveries provided theoretical evidence for further studying the role of Zeb1—regulated Six2 in kidney development.

2. Results

2.1. Zeb1 Is Highly Conserved and Homologous across Different Mammalians To analyze the conservative of Zeb1 protein, we used CLUSTALW online [19]. The Zeb1 protein is highly conservative and homologous in evolution among mammal species such as Chimpanzee, Human, Rhesus monkey, Dog, Giant panda, Norway rat and House mouse (Figure1A,B). Additionally, we compared the three types of Zeb1 function domains (seven C2H2 zinc ﬁnger, three Zinc ﬁnger double domain and a Homeodomain) in NCBI Protein Database [20]. Then, we found that the structure of Zeb1 protein across those mammal species is also highly conserved (Figure1C). Int. J. Mol. Sci. 2016, 17, 1283 3 of 16 Int. J. Mol. Sci. 2016, 17, 1283 3 of 16

Figure 1. BioinformaticBioinformatic analysis analysis of of Zeb1Zeb1 protein.protein. (A (A) Several) Several tracks tracks of of entire entire amino amino acid acid sequences sequences of ofZeb1Zeb1 acrossacross different different mammal mammal species. species. NCBI NCBI was was us useded to to get get the the sequences sequences that that were were 1117aa in length andand were were highly highly conserved conserved shown shown in grayin gr shadoway shadow representing representing 100% 100% matched matched sequences sequences across differentacross different species; species; (B) Rooted (B) Rooted phylogenetic phylogenetic tree (UPGMA) tree (UPGMA) displayed displayedZeb1 is highlyZeb1 is homologous highly homologous among differentamong different mammalian. mammalian. The identity The identity is shown is shown on the on the right; right; (C) (CZeb1) Zeb1protein protein structure structure contains contains sevenseven C2H2 zinc finger ﬁnger domains, domains, three three zinc zinc finger ﬁnger double double domains domains and and one one homeodomain. homeodomain.

2.2. Zeb1 Promotes the Proliferation and MigrationMigration butbut Inhibits thethe ApoptosisApoptosis ofof MMMM CellsCells As noted above, the function of Zeb1 in metanephric mesenchymal cells remains unclear during kidney development, so we wonder whether Zeb1 plays a crucial role inin thethe regulationregulation ofof thesethese cells.cells. To investigate whether whether Zeb1Zeb1 affectsaffects the the proliferation, proliferation, apoptosis apoptosis andand migration migration of MM of cells, MM cells,mK3 mK3cells were cells used were as used a cell as model. a cell mK3 model. cells mK3 were cellstransfected were transfected with Zeb1 overexpression with Zeb1 overexpression or knock-down or knock-down(Zeb1-shRNA) (Zeb1 vector-shRNA) followed vector by followedEdU assay. by As EdU illustra assay.ted As in illustrated Figure 2A,B in Figure and A1,2A,B the and ratio Figure of EdU A1, thepositive ratio cells of EdU to the positive whole cells cells was to the promoted whole cellsin mK was3 cells promoted transfected in mK3 with cellsthe overexpression transfected with vector the overexpressioncompared with vectorthe control. compared However, with the the ratio control. was However,reduced while the ratio Zeb1 was was reduced knocked while downZeb1 in mK3was knockedcells. Meanwhile, down in mK3to find cells. out Meanwhile, the effect of to findZeb1 out on thecell effect apoptosis of Zeb1 ofon the cell mK3 apoptosis cells, we of the detected mK3 cells, the weapoptosis detected of themK3 apoptosis cells transfected of mK3 cells with transfected Zeb1 overexpression with Zeb1 overexpressionvector, overexpression vector, overexpressioncontrol vector, controlZeb1-shRNA vector, orZeb1 control-shRNA shRNA or control (pLKO.1). shRNA (pLKO.1).Then, mK3 Then, cells mK3 transfected cells transfected with withZeb1Zeb1-shRNA-shRNA or orcontrol control shRNA shRNA (pLKO.1) (pLKO.1) were were treated treated with with 0.1 0.1 μµMM dexamethasone dexamethasone before before cell cell apoptosis analysis. Overexpression of Zeb1 decreased the rate of mK3 cellcell apoptosisapoptosis compared with the controlcontrol cellscells (Figure(Figure3 3A,B).A,B).Besides, Besides, Zeb1 silence and dexamethasone treatment increased the apoptosis rate of mK3 cells and knockdown of Zeb1 increasedincreased cellcell apoptosisapoptosis inducedinduced byby dexamethasonedexamethasone compared with thethe respective control cells (Figure 33C,DC,D).). These results demonstrate that Zeb1Zeb1 inhibitsinhibits MM MM cell cell apoptosis. apoptosis. In addition,addition, we we treated treated mK3 mK3 cells cells with with the same the methodssame methods used in theused proliferation in the proliferation assay. Contrarily, assay. weContrarily, performed we Woundperformed Healing Wound Assay Healing and found Assay that and deficiency found that of deficiencyZeb1 resulted of Zeb1 in the resulted reduction in the of woundreduction healing of wound percentage healing compared percentage with compared the control wi (Figureth the 4controlA,B). In (Figure contrast, 4A,B). mK3 In cells contrast, transfected mK3 withcells thetransfected overexpression with the vectors overexpression shows promotion vector ofs shows cell healing promotion percentage of cell (Figure healing4A,C). percentage To some degree,(Figure these4A,C). data To concludessome degree, that these the migration data conclude of mK3s that cells the is advanced migration by ofZeb1 mK3. cells is advanced by Zeb1Moreover,. to determine the efficiency of Zeb1 overexpression or knock-down, we conducted the RTMoreover, PCR and to Western-blot. determine the As efficiency expected, ofZeb1 Zeb1 wasoverexpression overexpressed or knock-down, and knocked we down conducted efficiently the (FigureRT PCR2C,D). and AllWestern-blot. these findings As indicatesexpected, that Zeb1Zeb1 wascan overexpressed promotes the and proliferation knocked ofdown mK3 efficiently cells. (Figure 2C,D). All these findings indicates that Zeb1 can promotes the proliferation of mK3 cells.

Int. J. Mol. Sci. 2016, 17, 1283 4 of 16 Int. J. Mol. Sci. 2016, 17, 1283 4 of 16 Int. J. Mol. Sci. 2016, 17, 1283 4 of 16

FigureFigure 2. Knock-down2. Knock-down of ofZeb1 Zeb1inhibits inhibits mK3 mK3 cell cell proliferation proliferation while while overexpression overexpression ofof Zeb1Zeb1 promotes it. Figureit. (A) Proliferating2. Knock-down mK3 of Zeb1cells inhibitswere labeled mK3 cell with proliferation EdU (red) whileand nucleuses overexpression of the ofwhole Zeb1 cellspromotes were (A) Proliferating mK3 cells were labeled with EdU (red) and nucleuses of the whole cells were stained it.stained (A) Proliferating with DAPI or mK3 hoechst cells (blue).were labeled The cells with were EdU 48 h(red) post-treated and nucleuses with vectors of the ofwhole overexpression cells were with DAPI or hoechst (blue). The cells were 48 h post-treated with vectors of overexpression or target stainedor target with shRNA DAPI or or the hoechst respective (blue). control The cells vector weres. 48The h post-treatedimages present with were vectors taken of overexpressionby fluorescent shRNA or the respective control vectors. The images present were taken by fluorescent microscopy ormicroscopy target shRNA (200×) or with the a respective scale bar of control 50 μm vectorand thes. Thered andimages blue present images were mergedtaken by to fluorescent the purple (200ˆ) with a scale bar of 50 µm and the red and blue images were merged to the purple ones; microscopyones; (B) EdU (200×) positive with percentagea scale bar of(EdU 50 μ %)m andwere the quantified. red and blue Results images were were displayed merged as to meanthe purple ± SD (B) EdU positive percentage (EdU %) were quantified. Results were displayed as mean ˘ SD (n = 3). ones;(n = 3). (B *) p EdU < 0.05, positive ** p < 0.01, percentage *** p < 0.001 (EdU negative %) were control quantified. vectors; Results (C,D) wereThe RT-PCR displayed and as western-blot mean ± SD * p < 0.05, ** p < 0.01, *** p < 0.001 negative control vectors; (C,D) The RT-PCR and western-blot showed (showedn = 3). * pthe < 0.05, significant ** p < 0.01, efficiency *** p < 0.001 of Zeb1 negative overexpression control vectors; and ( Cknock-,D) Thedown. RT-PCR The and expression western-blot was the significant efficiency of Zeb1 overexpression and knock-down. The expression was calculated by showedcalculated the by significant scanning grayefficiency in Image of Zeb1J software overexpression normalized and to the knock- internaldown. mRNA The controlexpression GAPDH was scanningcalculatedor protein gray bycontrol in scanning Image β-tubulin. J softwaregray inThe Image normalized result J softwarewas toshown the normalized internal with error mRNA to barsthe controlinternalrepresenting GAPDHmRNA mean control or protein± SD GAPDH (n control= 3). β -tubulin.or* p protein< 0.05, The ** control p result < 0.01, β was-tubulin. *** shownp < 0.001. The with result error was bars shown representing with error mean bars˘ representingSD (n = 3). mean * p <0.05, ± SD ** (np =< 3). 0.01, *** *p p< < 0.001.0.05, ** p < 0.01, *** p < 0.001.

Figure 3. Knock-down of Zeb1 promotes mK3 cell apoptosis while overexpression of Zeb1 inhibits it. FigureFigure(A) mK3 3. Knock-down3. Knock-downcell apoptosis of ofZeb1 wasZeb1 promotes detectedpromotes by mK3mK3 flow cellcell cy apoptosistometry withwhile while Annexin overexpression overexpression V-FITC/PI ofof Zeb1 Zeb1staining. inhibitsinhibits The it. it. (A)(numberA mK3) mK3 cell of cell apoptosis positive apoptosis cells was was detecteddouble detected stained by flow by by cytometryflow AnnexinV-FITC/PI cytometry with Annexinwith in Annexin mK3 V-FITC/PI cells V-FITC/PI transfected staining. staining. Thewith number Zeb1The of positivenumberoverexpression cellsof positive double vector cells stained was double bydramatically AnnexinV-FITC/PI stained by smalleAnnexinV-FITC/PIr inthan mK3 the cells control in transfected mK3 vector. cells with transfected TheZeb1 detectionoverexpression with Zeb1was vectoroverexpressionperformed was dramatically 48 h vectortransfection smaller was dramaticallylater; than the(C) controlmK3 smalle cells vector.r werethan The transfectedthe detection control waswith vector. performedZeb1 -shRNAThe detection48 hortransfection negative was later;performedcontrol (C) shRNA mK3 48 h cells for transfection 20 were h. Then transfected later;one well (C) cellsmK3 with of cellsZeb1 the twowere-shRNA transfected transfected or negative with with the Zeb1 control same-shRNA vector shRNA orwas negative fortreated 20 h. Thencontrolwith one 0.1 wellshRNA μM cells dexamethasone for of 20 the h. two Then transfected one for well 30 cellsh, with following of the the same two byvector transfected cell wasapoptosis treated with thedetection. with same 0.1 vectorµ MThe dexamethasone wasnumber treated of forwithAnnexinV-FITC/PI-positive 30 h,0.1 following μM dexamethasone by cell apoptosis cells for in 30Zeb1 detection. h, knock-downfollowing The by numbermK3 cell cellsapoptosis of was AnnexinV-FITC/PI-positive significantlydetection. The larger number than the cellsof in AnnexinV-FITC/PI-positiveZeb1negativeknock-down control cells. mK3 And cells cellsthe was dexamethasonein Zeb1 significantly knock-down at larger0.1 mK3μM than concentrationcells the was negative significantly increased control largerthe cells. number than And the of the dexamethasonenegativeAnnexinV-FITC/PI-positive control at 0.1 cells.µM And concentration mK3the dexamethasone cells; increased (B,D) Apoptosis theat number0.1 μ Mrates concentration of AnnexinV-FITC/PI-positive(Q2% + Q4%) increased of mK3 the cells number detected mK3 cells;of AnnexinV-FITC/PI-positive mK3 cells; (B,D) Apoptosis rates (Q2% + Q4%) of mK3 cells detected (B,Din) Figure Apoptosis 3A,B rateswere (Q2%respectively + Q4%) quantifi of mK3ed. cells Results detected were indisplayed Figure3A,B as mean were ± respectively SD (n = 3). ** quantified. p < 0.01, in Figure 3A,B were respectively quantified. Results were displayed as mean ± SD (n = 3). ** p < 0.01, Results*** p < were 0.001 displayed negative control as mean vector.˘ SD (n = 3). ** p < 0.01, *** p < 0.001 negative control vector. *** p < 0.001 negative control vector.

Int. J. Mol. Sci. 2016, 17, 1283 5 of 16 Int. J. Mol. Sci. 2016, 17, 1283 5 of 16

FigureFigure 4. Knock-down ofof Zeb1Zeb1 inhibitsinhibits mK3 mK3 cell cell migration migration while while overexpression overexpression of Zeb1of Zeb1promotes promotes cell cellmigration migration only only after after 24 h. 24 ( Ah.) Cell(A) Cell migration migration of mK3 of mK3 cells cells was measuredwas measured via wound via wound healing healing assay. assay.The width The width of wound of wound area was area calculated was calculated at three at timethree pointstime points (0, 12, (0, 24 12, h) 24 starting h) starting from thefrom point the pointwhen when mK3 cellsmK3 werecells transfectedwere transfected 48 h later. 48 h Thelater. transfection The transfection way was way same was withsame Figure with Figure2. Zeb1 2.knock Zeb1 knockdown down led to lowerled to apoptosislower apoptosis rate but rateZeb1 butoverexpression Zeb1 overexpression resulted resulted in higher inrate, higher compared rate, compared with the withcontrols; the controls; (B,C) The (B quantiﬁcation,C) The quantification of wound of healing wound percentagehealing percentage (100%) was (100%) exhibited was exhibited with the with error thebars error representing bars representing mean ˘ SDmean (n =± 3).SD **(np =< 3). 0.01, ** p negative < 0.01, negative control vector.control vector.

2.3.2.3. Zeb1 Zeb1 Binds Binds to to Six2 Six2 Promoter Promoter and and Up-Reg Up-Regulatesulates Six2 Six2 in in Metane Metanephricphric Mesenchymal Mesenchymal Cell Cell ToTo find find out the mechanism of the cellular regula regulationtion in addition to metanephric mesenchymal cells,cells, we we performed performed bioi bioinformaticsnformatics prediction prediction of of the the interaction interaction between between Zeb1Zeb1 andand Six2Six2.. As As exhibited exhibited inin Figure Figure 55A,A, Zeb1Zeb1 bindingbinding motifs motifs towards towards the the potential potential promoter promoter of of Six2Six2 werewere conserved among among mammalmammal species species such such as as Human, Chimpanzee, Mous Mouse,e, Norway Norway rat, rat, Dog and Rhesus. This This result result showsshows it it is possible that Zeb1Zeb1 cancan regulateregulate thethe expression expression of ofSix2 Six2 gene geneby by mediating mediating the the transcription transcription of ofSix2 Six2. Therefore,. Therefore, we we carried carried out dual-luciferaseout dual-luciferase assay, assay, RT-PCR RT-PCR and Western and Western blot to blot verify toZeb1 verifyaffected Zeb1 affectedthe expression the expression of Six2. Weof Six2 found. We that found overexpression that overexpression of Zeb1 significantly of Zeb1 significantly promotes promotesSix2 promoter Six2 promoterreporter activity reporter (Figure activity5B). Additionally,(Figure 5B). theAdditionally, deficiency oftheZeb1 deficiencyup-regulated of Zeb1 both up-regulated mRNA and protein both mRNAexpression and ofproteinSix2 compared expression with of theSix2 control compared (Figure with5C). the In control contrast, (FigureZeb1 overexpression5C). In contrast, caused Zeb1 overexpressionthe up-regulation caused of Six2 theat up-regulation both mRNA andof Six2 protein at both level mRNA (Figure and5D). protein It has level been (Figure reported 5D). that It Six2has beensuppression reported inhibits that Six2 cell suppression proliferation, inhibits but promotes cell proliferation, cell apoptosis but inprom MMotes cells cell and apoptosis up-regulation in MM of cellsSix2 andpromotes up-regulation cell migration of Six2 [8 promotes,17]. These cell previous migratio studiesn [8,17]. can These explain previous the phenotype studies can of Zeb1explain. the phenotype of Zeb1. 2.4. Zeb1 Regulates Cell Proliferation and Apoptosis of MM Cells by Working with Six2 2.4. Zeb1 Regulates Cell Proliferation and Apoptosis of MM Cells by Working with Six2 To clarify the interaction between Zeb1 and Six2 in metanephric mesenchymal cells’ regulation, mK3To cells clarify were the transfected interaction with between negative Zeb1 control and Six2 shRNA in metanephric (pLKO.1), Zeb1 mesenchymal-shRNA, Six2 cells’-shRNA regulation, or both mK3Zeb1 -shRNAcells were & Six2 transfected-shRNA followedwith negative by EdU control assay andshRNA apoptosis (pLKO.1), detection. Zeb1-shRNA, As shown Six2 in Figure-shRNA6A,B, or bothmK3 Zeb1 cells-shRNA introduced & Six2 with-shRNA either Zeb1followed-shRNA by orEdUSix2 assay-shRNA andmade apoptosis cell proliferation detection. As significantly shown in Figurereduced, 6A,B, compared mK3 cells with introduced the negative with control either Zeb1 cells.-shRNA Moreover, or Six2 mK3-shRNA cells transfected made cell proliferation with both of significantlyZeb1-shRNA reduced, and Six2 -shRNAcompared presented with the anegative smaller ratiocontrol compared cells. Moreover, with the mK3 mK3 cells cells transfected transfected withwith both one ofof theZeb1 two-shRNA shRNA. and These Six2-shRNA results declarepresented that a smaller down-regulation ratio compared of Six2 withrestrains the mK3 MM cells cell transfectedproliferation with indeed one of and the this two suppression shRNA. Thes wase results enhanced declare when thatZeb1 down-regulationwas knocked of down Six2 withrestrainsSix2 MMdown-regulated cell proliferation (Figure indeed5C). and this suppression was enhanced when Zeb1 was knocked down with Six2 down-regulated (Figure 5C).

Int. J. Mol. Sci. 2016, 17, 1283 6 of 16 Int. J. Mol. Sci. 2016, 17, 1283 6 of 16

Int. J. Mol. Sci. 2016, 17, 1283 6 of 16

FigureFigure 5. Zeb1 5.binds Zeb1 binds to Six2 to Six2promoter promoter and and up-regulates up-regulatesSix2 Six2in in mK3mK3 cells. (A (A) )The The predicted predicted binding binding motifsmotifs of Zeb1 ofto Zeb1Six2 to promoter,Six2 promoter, which which was was acquired acquired from from the the JASPARJASPAR Database. The The binding binding motifs motifs Figure 5. Zeb1 binds to Six2 promoter and up-regulates Six2 in mK3 cells. (A) The predicted binding across mammalacross mammal species species are conservatively are conservatively shown show in grayn in shadow gray shadow representing representing the matched the matched sequence motifs of Zeb1 to Six2 promoter, which was acquired from the JASPAR Database. The binding motifs amongsequence several mammalamong several species, mammal for instance, species, seven for instance, base pairs seven in eightbase werepairs matchedin eight were between matched mouse acrossbetween mammal mouse speciesand human; are conservatively (B) G401 cells show weren co-transfectedin gray shadow with representing pGL-SV40 (renilla the matched control), and human; (B) G401 cells were co-transfected with pGL-SV40 (renilla control), ﬁreﬂy luciferase reporter sequencefirefly luciferase among several reporter mammal pcDNA3.1- species,Six2 forpromoter-luciferase, instance, seven base and pairs either in theeight m. Zeb1were expressionmatched pcDNA3.1-Six2 promoter-luciferase, and either the m.Zeb1 expression plasmid pCDH-copGFP-m.Zeb1 betweenplasmid mouse pCDH-copGFP-m. and human;Zeb1 (B) G401or the cells respective were co-transfected control vector. with Luciferase pGL-SV40 activity (renilla was control), assayed or the respective control vector. Luciferase activity was assayed using dual luciferase reporter assay fireflyusing luciferase dual luciferase reporter reporter pcDNA3.1- assay 48Six2 h afterpromoter-luciferase, transfection, normalized and either to renillathe m. control.Zeb1 expression The result 48 h afterplasmidwas transfection, analyzed pCDH-copGFP-m. by normalizedstudent’sZeb1 t test or to renillaandthe respectivedisplayed control. controlwith The error result vector. bars was Luciferaserepresenting analyzed activity bymean student’s was ± SD assayed (nt test= 3), and displayedusing** p with

Figure 6. Zeb1 is required for the proliferation of mK3 cells associated to Six2. (A) mK3 cells were 48 h post-introduced with control shRNA, Zeb1-shRNA, Six2-shRNA or both of the two target shRNA. FigureFigureThen 6. Zeb1EdU6. Zeb1 assayis is required required was performed for for the the proliferation refering proliferation to Figure of mK3 of 2 cellsand mK3 theassociated cells red and associated to blue Six2 images. (A to) mK3 Six2were cells.( merged Awere) mK3 48to theh cells werepost-introduced 48purple h post-introduced ones; the with length control with of scale shRNA, control bar was Zeb1 shRNA, 50-shRNA, μm.Zeb1 Cell Six2 -shRNA,proliferation-shRNASix2 or was -shRNAboth decreased of the or two bothin mK3 target of cells the shRNA. twotreated target Then EdU assay was performed refering to Figure 2 and the red and blue images were merged to the shRNA.with Then either EdU single assay shRNA was performed or double referingshRNA toof FigureZeb1 and2 and Six2 the compared red and with blue respective images were controls; merged purple ones; the length of scale bar was 50 μm. Cell proliferation was decreased in mK3 cells treated to the purple(B) The ones;data of the proliferation length of scalepercentage bar was (EdU 50 %)µm. were Cell presented proliferation as mean was ± decreasedSD (n = 3). in* p mK3< 0.05, cells with either single shRNA or double shRNA of Zeb1 and Six2 compared with respective controls; treated** with p < either0.01, respective single shRNA controls; or double (C) The shRNA significant of Zeb1 knock-downand Six2 comparedefficiency of with Zeb1 respective and Six2 controls; was (Bmeasured) The data by of the proliferation RT-PCR with percentage the internal (EdU control %) were 18S equal.presented as mean ± SD (n = 3). * p < 0.05, (B) The data of proliferation percentage (EdU %) were presented as mean ˘ SD (n = 3). * p < 0.05, ** p < 0.01, respective controls; (C) The significant knock-down efficiency of Zeb1 and Six2 was ** p

What is more, we performed cell apoptosis detection in mK3 cells treated the same as in FigureWhat 6. isFor more, cell we apoptosis, performed when cell apoptosis mK3 cells detection were inintroduced mK3 cells treatedwith either the same Zeb1 as-shRNA in Figure 6or. ForSix2 cell-shRNA, apoptosis, the rate when of mK3cell apoptosis cells were was introduced higher than with eitherthe controlZeb1-shRNA cells. However, or Six2-shRNA, it is found the ratethat ofmK3 cell cells apoptosis introduced was higherwith both than of the the control two shRNAs cells. However,had a lower it isapoptosis found that rate, mK3 compared cells introduced with that withtransfected both of by the only two one shRNAs shRNA had (Figure a lower 7A,B). apoptosis From rate, these compared data, it is with implied that transfectedthat there is by interaction only one shRNAbetween (Figure Zeb1 and7A,B). Six2 From in the these apoptosis data, it isregulation implied thatof MM there cells. is interaction The complicated between relationshipZeb1 and Six2 leadsin theto the apoptosis different regulation apoptosis of trends MM cells.between The single-knock-down complicated relationship of Zeb1 leads, Six2 to and the double-knock-down different apoptosis trendsof both. between single-knock-down of Zeb1, Six2 and double-knock-down of both.

FigureFigure 7.7.Zeb1 Zeb1is requiredis required for mK3for mK3 cells tocells survival to survival associated associated with Six2 with.(A) Six2 mK3. cells(A) weremK3 transfectedcells were sametransfected with Figure same 6with and Figure cell apoptosis 6 and cell was apoptosis detected wa bys reference detected toby Figure reference3. The to rateFigure of apoptosis3. The rate in of mK3apoptosis cells treatedin mK3 with cells single treated target with shRNA single istarget higher shRNA than the is higher negative than control the negative shRNA, whilecontrol mK3 shRNA, cells treatedwhile mK3 double cells shRNAs treated had double a lower shRNAs rate than had the singlea lowe targetedr rate than mK3 cells;the single (B) Cell targeted apoptosis mK3 rate cells; was quantified(B) Cell apoptosis and presented rate was as meanquantifi˘ SDed (andn = 3).presented * p < 0.05, as **meanp < 0.01, ± SD respective (n = 3). * controls. p < 0.05, ** p < 0.01, respective controls. Meanwhile, to confirm Zeb1 mediates cell phenotypes above by affecting the expression of Six2, we quantifiedMeanwhile, the to mRNA confirm expression Zeb1 mediates of Six2 cellby phenotypes RT-PCR. As above illustrated by affecting in Figure the6C, expression the knock-down of Six2, ofweZeb1 quantifiedor Six2 thewas mRNA all efficient expression and Zeb1 of Six2knock-down by RT-PCR. significantly As illustrated down-regulated in Figure 6C,Six2 theexpression knock-down at theof Zeb1 mRNA or Six2 level. was all efficient and Zeb1 knock-down significantly down-regulated Six2 expression at the mRNA level. 2.5. The Expression Profile of Zeb1 and Six2 in Kidney Development 2.5. The Expression Profile of Zeb1 and Six2 in Kidney Development As mentioned above, we found Zeb1 mediated cell proliferation, apoptosis and migration in MM cells associatedAs mentioned with Six2above,, which we found was fundamental Zeb1 mediated for kidney cell proliferation, development. apoptosis Thus, we and wonder migration whether in Zeb1MM orcellsSix2 associatedwas expressed with Six2 differently, which was in variant fundamental stages for during kidney kidney development. development. Thus, Accordingly, we wonder wewhether conducted Zeb1 RT-PCRor Six2 usingwas expressed cDNAs of differently embryonic in mouse variant kidney stages at during different kidney times development. (E11.5, E12.5, E13.5,Accordingly, E14.5, E16.5,we conducted E18.5). As RT-PCR diagramed using in cDNAs Figure 8ofA,B, embryonic the mRNA mouse expression kidney ofat differentZeb1 and timesSix2 changed(E11.5, E12.5, with E13.5, the kidney E14.5, development E16.5, E18.5). stage, As diagramed and the variant in Figure tendency 8A,B, oftheZeb1 mRNAand expressionSix2 was identical of Zeb1 exceptand Six2 for changed E16.5. This with finding the kidney suggests development that Zeb1 quitestage, possibly and the playsvariant an tendency important ofrole Zeb1 during and Six2 kidney was developmentidentical except in relation for E16.5. to Six2 This. Furthermore, finding suggests we conducted that Zeb1 the quite expression possibly prediction plays an of importantZeb1 and Six2role byduring GUDMAP kidney online development to analyze inZeb1 relationand Six2 tomRNA Six2. expressionFurthermore, at differentwe conducted times, which the expression presented variantprediction mRNA of Zeb1 levels and (Figure Six28 byC). GUDMAP online to analyze Zeb1 and Six2 mRNA expression at different times, which presented variant mRNA levels (Figure 8C). 2.6. c-Myc Is Up-Regulated by Zeb1 in MM Cells To verify the mechanism that Zeb1 mediates MM cells by regulating Six2, we checked the protein expression of c-Myc, a transcription factor that has been reported to have interaction with Six2 during nephrogenesis [21]. The Western-blot data showed that the deficiency of Zeb1 down-regulated c-Myc (Figure9A,B) and Zeb1 overexpression led to the up-regulation of c-Myc (Figure9C,D).

Int. J. Mol. Sci. 2016, 17, 1283 8 of 16

Int. J. Mol. Sci. 2016, 17, 1283 8 of 16 Int. J. Mol. Sci. 2016, 17, 1283 8 of 16

Figure 8. Zeb1 and Six2 have a similar expression profile in mouse kidney development. (A) RT-PCR was performed using the cDNA library obtained from the embryonic mouse kidney at different embryonic days (E11.5, E12.5, E13.5, E14.5, E16.5, E18.5). The mRNA expression of both genes showed identical variation trends except for E16.5; (B) The quantification was analyzed by Gray Scan normalized to the internal control GAPDH and the results were acted as mean ± SD (n = 3); (C) Bioinformatics analysis of Zeb1 and Six2 mRNA expression was performed in GUDMAP Expression Database. It is the microarray data in different cells of developing renal, in which blue represents the median of each row, black means the expression value is smaller than median, while red represents a larger value. FigureFigure 8.8. Zeb1 and Six2 have a similar expression proﬁleprofile inin mousemouse kidneykidney development.development. (A) RT-PCR 2.6. c-Mycwaswas performedperformed Is Up-Regulated usingusing thetheby Zeb1 cDNAcDNA in librarylibraryMM Cells obtainedobtained fromfrom thethe embryonicembryonic mousemouse kidneykidney atat differentdifferent embryonicembryonic daysdays (E11.5, (E11.5, E12.5, E12.5, E13.5, E13.5, E14.5, E14.5, E16.5, E16. E18.5).5, E18.5). The mRNAThe mRNA expression expression of both of genes both showed genes Toidenticalshowed verify identical variation the mechanism variation trends except trends that for except E16.5;Zeb1 (forBmediates) TheE16.5; quantiﬁcation (B MM) The cellsquantification was by analyzed regulating was by analyzed Gray Six2 Scan, bywe normalized Gray checked Scan the proteintonormalized theexpression internal to control theof c-Myc,internal GAPDH a controltranscription and theGAPDH results factor an wered thethat acted results has as meanbeen were ˘reported actedSD (n as= to 3);mean have (C) Bioinformatics± interactionSD (n = 3); with Six2 analysis(duringC) Bioinformatics ofnephrogenesisZeb1 and analysisSix2 mRNA[21]. of Zeb1The expression andWestern-blo Six2 was mRNA performedt data expression showed in GUDMAP was that performed Expressionthe deficiency in GUDMAP Database. of Zeb1 down-regulatedItExpression is the microarray Database. c-Myc data (Figure It inis differentthe 9A,B)microarray cells and of dataZeb1 developing in overexpression different renal, cells in which of led developing blueto the represents up-regulation renal, thein which median ofblue ofc-Myc (Figureeachrepresents 9C,D). row, black the median means the of expressioneach row, black value means is smaller the thanexpression median, value while is red sm representsaller than median, a larger value.while red represents a larger value.

2.6. c-Myc Is Up-Regulated by Zeb1 in MM Cells To verify the mechanism that Zeb1 mediates MM cells by regulating Six2, we checked the protein expression of c-Myc, a transcription factor that has been reported to have interaction with Six2 during nephrogenesis [21]. The Western-blot data showed that the deficiency of Zeb1 down-regulated c-Myc (Figure 9A,B) and Zeb1 overexpression led to the up-regulation of c-Myc (Figure 9C,D). Figure 9. The expression of c-Myc in mK3 cells is regulated by Zeb1..( (AA)) Western Western visualization shows that mK3 cells introduced with Zeb1-shRNA for 48 h expressed c-Myc less than cells treated with control shRNAshRNA at at protein protein level; level; (B )( TheB) The expression expression was calculatedwas calculated by scanning by scanning gray in gray Image in J softwareImage J softwarenormalized normalized to the internal to the control internal GAPDH. control The GA resultPDH. wasThe displayedresult was with displayed error bars with representing error bars representingmean ˘ SD (nmean= 3). ± **SDp <(n 0.01,= 3). ***** p<0.001; < 0.01, (***C) p The<0.001; protein (C) expressionThe protein of expression c-Myc was of increased c-Myc was in increasedmK3 cells in treated mK3 withcells Zeb1treatedoverexpression with Zeb1 overexpression for 48 h compared for 48 with h compared the control with cells the (blank control vector); cells ((blankD) The vector); expression (D) The was expression quantiﬁed was the same quantified way as the in same (B). way as in (B).

3. Discussion Discussion Figure 9. The expression of c-Myc in mK3 cells is regulated by Zeb1. (A) Western visualization shows Zeb1that mK3, a transcription cells introduced factor, with isis Zeb1 highlyhighly-shRNA conservedconserved for 48 h andand expressed homologoushomologous c-Myc less in evolutionevolution than cells amongtreated differentwith speciescontrol at at thethe shRNA protein protein at level.protein level. Here, level; Here, we (B )first weThe ﬁrst reportedexpression reported the was role the calculated of role Zeb1 of byinZeb1 kidneyscanningin kidneydevelopment gray in development Image and J its andcellular itssoftware function cellular normalized functionin MM cells.to inthe MM Knock-downinternal cells. control Knock-down of GAZeb1PDH. decreased The of resultZeb1 cell decreasedwas proliferation displayed cell andwith proliferation migration,error bars andbut migration, representing but increased mean ± SD cell (n apoptosis= 3). ** p < in0.01, MM *** cellsp<0.001; (Figures (C) The2– protein4 and Figureexpression A1 ).of Deﬁciencyc-Myc was of Zeb1 increaseddown-regulated in mK3 cells the expressiontreated with ofZeb1Six2 overexpressionand c-Myc (Figurefor 48 h5 C,Dcompared andFigure with the9A,B). control Moreover, cells overexpression(blank vector); of (Zeb1D) Thepromotes expressionSix2 was promoterquantified the reporter same way activity as in ( inB). luciferase assay (Figure5B). On the contrary, overexpression of Zeb1 leads to the opposite results (Figures2–4, Figure5C,D and Figure3. Discussion9C,D). However, double knock down of Zeb1 and Six2 decreased cell proliferation more seriously Zeb1, a transcription factor, is highly conserved and homologous in evolution among different species at the protein level. Here, we first reported the role of Zeb1 in kidney development and its cellular function in MM cells. Knock-down of Zeb1 decreased cell proliferation and migration, but

Int. J. Mol. Sci. 2016, 17, 1283 9 of 16

(Figure6A,B), but did not enhance cell apoptosis in MM cells compared with Six2 or Zeb1 knockdown alone (Figure7A,B). Metanephric mesenchyme (MM) cells include the nephron progenitor cells marked by Six2 and form nephrons by balancing self-renewal and consumption [7,9]. Numerous transcription factors are involved in this process, such as c-Myc and Six2 [8,17]. In this study, we focused on a transcription factor Zeb1, which is widely expressed in development and cancer and acts as an inducer of EMT and a regulator of cell migration in cancer cells [10]. In addition, mutation of Zeb1 can induce MET and reduce the proliferation of progenitor cells at defects sites of developing mouse embryos [22]. Besides, knock-down of Zeb1 inhibits cell growth via activating the apoptosis pathway [23], and TXNIP/miR-200/Zeb1/E-cadherin signaling pathway is reported to function in beta cell apoptosis [24], which suggests that Zeb1 plays a crucial role in cell apoptosis. Meanwhile, our results suggested that the resistant of Zeb1-depleted mK3 cells to dexamethasone are decreased in comparison to control cells, which implied that Zeb1 is involved in the apoptosis process that is induced by agent dexamethasone (Figure3C,D). So, we speculate that Zeb1 may be a regulator of MET and had an association with MET marker-Six2 in MM cells. Interestingly, knock-down of Zeb1 decreased cell proliferation and migration but increased cell apoptosis in MM cells as reported in other cells [10,22]. Furthermore, the expression of Six2 was down-regulated when Zeb1 was knocked down. Down-regulation of Six2 represses MM cell proliferation and migration [16,18] but enhances cell apoptosis [8], and overexpression of Zeb1 leads to the opposite results, reasonably. These suggested that Six2 is involved in the process that Zeb1 mediated cell proliferation, migration and apoptosis in MM cells. As is known to us, Six2 is an essential gene in kidney development and its expression is variant during renal development [25]. We further measured the mRNA expression of Six2 and Zeb1 in embryonic mouse kidney in vitro (Figure8A,B). Although their expression pattern is not completely the same, both of Six2 and Zeb1 had high expression at the E11.5 to E13.5 stage, which is a key period in the mouse kidney development process. It has been reported that, in the process of mammalian cell apoptosis, caspases mediate 500–1000 proteins’ cleavage and generate many protein fragments, which can increase the probability of cell apoptosis [26–28]. Nevertheless, there is some reversible reports that N-terminal truncated Lyn∆N that is generated by caspase cleavage has been demonstrated with anti-apoptotic roles [29]. Whatever the concrete role of this fragment in cell apoptosis is, these reports provide a direction for our subsequent study about Zeb1, Six2 and cell apoptosis in embryonic mouse kidney development. Here, our results demonstrated that Zeb1 depletion decreased Six2 expression and enhanced cell apoptosis in mk3 cells, but the connection between Six2 down-regulation and cell apoptosis promotion remains unknown. Because of the limit of time and materials, we did not test the protein expression of Zeb1 and Six2 in embryonic mouse kidney in the present study, but we will detect their protein level and further study the connection between Six2 down-regulation and cell apoptosis promotion during embryonic mouse kidney development. Interestingly, the recent study shows that Zeb1 can positively regulate the mTOR pathway and maintain its threshold level in wild-type MEFs that is required for Akt-S473 generation [30], and mTOR pathway can rescue many developmental defects of embryos due to the ESCO2 mutant [31], which indicates that the mTOR pathway is essential in development. All these studies indicate that mTOR pathway may be involved in Zeb1-regulated renal development. To ﬁnd out the regulatory mode between Zeb1 and Six2, we combined the bioinformatics analysis with the dual-luciferase assay results and found that Zeb1 could bind to Six2 promoter to enhance the luciferase activity. Therefore, these may prove that Zeb1 binds to Six2 promoter to promote Six2 gene transcription and further promotes gene expression, which is identical to the up-regulation of Six2 in Zeb1 overexpressed cells. All these indicated that Zeb1 might up-regulate Six2 by transcriptional regulation. Perhaps post-translational modiﬁcation is another regulation mode, which provides us valuable insight for further research on the regulation mechanism between Zeb1 and Six2. Int. J. Mol. Sci. 2016, 17, 1283 10 of 16 Int. J. Mol. Sci. 2016, 17, 1283 10 of 16

Tomode, make which the provides mechanism us valuable clear, we insight detected for furt theher expression research on of the c-Myc, regulation a member mechanism of the between Myc family of proto-oncogenesZeb1 and Six2. expressed in the MM progenitors and which are essential for progenitor cell proliferationTo make and the kidney mechanism growth clear, [32 ,we33]. detected Then, wethe expression found that of ac-Myc, deﬁciency a member of Zeb1 of thedown-regulated Myc family of proto-oncogenes expressed in the MM progenitors and which are essential for progenitor cell c-Myc and overexpression of Zeb1 up-regulated c-Myc in MM cells (Figure9A–D). Zeb1 represses proliferation and kidney growth [32,33]. Then, we found that a deficiency of Zeb1 down-regulated the expression of miR-34a and miR-34b/c, and miR-34a conversely down-regulated Zeb1 and c-Myc c-Myc and overexpression of Zeb1 up-regulated c-Myc in MM cells (Figure 9A–D). Zeb1 represses the to decreaseexpression the of migration miR-34a and and miR-34b/c, invasion ofand cancer miR-34a cells conversely [34]. Furthermore, down-regulatedSix2 Zeb1mediates and c-Myc the nuclearto translocationdecrease the of Eya1,migration then and Eya1 invasion switches of cancer Myc betweencells [34]. phosphorylationFurthermore, Six2 mediates and dephosphorylation the nuclear statestranslocation to regulate of MM Eya1, cell then multipotency, Eya1 switches proliferation,Myc between phosphorylation apoptosis, and and so dephosphorylation on [21]. Deletion states of c-Myc can reduceto regulateSix2 -positiveMM cell multipotency, stem/progenitor proliferation, populations apoptosis, and decreaseand so on cell [21]. proliferation Deletion of [c-Myc33]. Therefore, can thesereduce evidences Six2-positive demonstrated stem/progenitorSix2 and populations c-Myc may and be decrea new targetsse cell proliferation of Zeb1. However, [33]. Therefore, the role these of c-Myc needsevidences to be clariﬁed demonstrated in further Six2 and study, c-Myc and may elucidating be new targets the of regulation Zeb1. However, network the role among of c-Myc them needs appears especiallyto be clarified important in further in kidney study, development. and elucidating the regulation network among them appears especially important in kidney development. Based on our results and the reported data, we formed a work model to illustrate the regulation Based on our results and the reported data, we formed a work model to illustrate the regulation between Zeb1 and Six2 during embryonic renal development (Figure 10). Zeb1 promotes MM between Zeb1 and Six2 during embryonic renal development (Figure 10). Zeb1 promotes MM cell cell proliferationproliferation (cell renewal) renewal) and and cell cell migration migration but but inhibits inhibits cell cell apoptosis apoptosis (cell (cell consumption) consumption) in in associationassociation with withSix2 Six2up-regulation up-regulation and and c-Myc c-Myc down-regulation.down-regulation. The The MM MM cell cell renewal, renewal, consumption consumption and migrationand migration are essentialare essential for for the the induced induced interaction interaction between between MM cells and and UB. UB. These These contribute contribute to UB branchingto UB branching morphogenesis morphogenesis and MET and andMET elongation and elongation for nephrons’ for nephrons’ formation formation in embryonicin embryonic kidney development.kidney development. Besides, Zeb1 Besides,and Six2 Zeb1have and Six2 similar have expression similar expression patterns patterns at different at different stages ofstages developing of kidneydeveloping (Figure8 kidneyA,B). These(Figure results 8A,B). Th furtherese results suggested further suggested that Zeb1 thatis a Zeb1 potential is a potential regulator regulator of Six2 of and c-MycSix2 in theand proliferation,c-Myc in the proliferation, migration andmigration apoptosis and apoptosis of MM cells. of MM cells.

FigureFigure 10. 10.The The work work model model of ofZeb1 Zeb1in in developingdeveloping embryonic kidney. kidney. Zeb1Zeb1 promotespromotes MM MMcell cell proliferationproliferation (cell renewal),(cell renewal), cell migrationcell migration but inhibits but inhibits cell apoptosis cell apoptosis (cell consumption) (cell consumption) in association in with Six2associationup-regulation with Six2 andup-regulation c-Myc down-regulation. and c-Myc down-regulation. As the green As cyclesthe green show, cycles MM show, cells MM migrate cells and aggregatemigrate at and UB aggregate branches at with UB thebranch inductiones with the of UB,induction then of interact UB, then with interact UB. Sowith the UB. MM So cellthe MM renewal, consumptioncell renewal, and consumption migration and are migration essential are for essential the induced for the interactioninduced interaction between between MM cellsMM cells and UB. and UB. These contributes to UB branching morphogenesis and MET and elongation for nephrons These contributes to UB branching morphogenesis and MET and elongation for nephrons formation formation during embryonic kidney development. during embryonic kidney development.

4. Materials and Methods

4.1. Bioinformatic Analysis The species and evolutionary conservation of Zeb1 proteins was analyzed using Multiple Sequence Alignment by CLUSTALW online [19] and edited in BioEdit software. The amino acid sequences used Int. J. Mol. Sci. 2016, 17, 1283 11 of 16 for analysis were acquired from the NCBI GenPept Database [20]. Moreover, gene expression pattern (Developing Kidney MOE430 Microarray Analysis) of Zeb1 and Six2 was obtained from the GUDMAP Expression Database [35]. Additionally, the motifs where Zeb1 may bind to Six2 potential promoter (2000bp upstream of transcription start site) was predicted on the JASPAR Database [36], the six promoter sequence (NCBI reference sequence NC_000083.6) was retrieved from the Genbank Database.

4.2. Plasmids Construction The m.Zeb1 CDS was amplified from the cDNA of C57BL/6 embryonic mouse kidney by PCR using the forward primer: 51-tagcgtttaaactta GATCATGGCGGATGGCCCCAGG TGTAAGC-31, the reverse primer: 51-tggactagtggatcc CTAAGCTTCATTTGTCTTCTCTTCA-31. The amplification was inserted into the HindIII/BamHI site of pCDNA3.1 (+) (Invitrogen, Carlsbad, CA, USA) using the ligation-independent cloning (LIC) [37,38]. Then the m.Zeb1 CDS fragment was cut by the NheI/BamHI restriction enzyme and was cloned to the pCDH-CMV-MCS-EF1-copGFP vector (a lentivirus overexpression vector) at the same restriction site using T4 ligation cloning. The m.Zeb1 shRNA and m.Six2 shRNA sequences were acquired from the SIGMA ALORICH [39] with m.Zeb1 target: 51-CCGGGTCAGTAAACATACCTA-31; m.Six2 target: 51-CCTCCACAAGAATGAAAGCGT-31. Then anneal the shRNA oligo containing gene target and clone the annealed fragment to pLKO.1 vector at AgeI/EcoRI site according to the protocols [40] pGL3-basic vector (Promega, Madison, WI, USA) and pRL-SV40 was purchased from Promega. The promoter of murine Six2 was amplified from C57BL/6 mouse genomic DNA by PCR using the forward primer: CGTGCTAGCCCGGGCTATTTCCCAGGTCCCCTGGAATCCT and the reverse primer: CCGGAATGCCAAGCTCTTGCAGCTTTTTTAATAATATTAT. Then the fragment was inserted into the XhoI/HindIII site (upstream of fly luciferase gene) of the pGL3-luciferase vector to create pGL3-Six2 promoter-luciferase using LIC. All of these recombined vectors were sequenced and aligned in the NCBI Nucleotide Blast Database.

4.3. Cell Culture and Transfection The 293T cell and mK3 cell (a cell line cloned from mouse and representing the un-induced differentiation stage of metanephric mesenchyme [41,42]) were cultured in DMEM medium (Gibico, Carlsbad, CA, USA) with 10% FBS (Gibico, Carlsbad, CA, USA), 1000 units/mL of penicillin ˝ and 1000 µg/mL of streptomycin in 37 C, 100% humidity and 10% CO2. The G401 cell were cultured in the same condition except the different base medium ATCC-formulated McCoy’s 5a Medium Modiﬁed (Cat. No.30-2007, ATCC). When the mK3 cell grew to 60% conﬂuent in 6-well plates, lentivirus mediated cell transfection was performed, with the assist of polybrene (8 µg/mL). The lentivirus was packed in HEK293T cell line with 10 µg recombined vector in 10 cm dish, then it was harvested to infect mK3 cells after 48 h. The pCDH-CMV-MCS-EF1-copGFP-m.Zeb1 CDS, pLKO.1-m.Zeb1 shRNA, pLKO.1-m.Six2 shRNA and the corresponding control vectors were transfected alone while the m.Zeb1 shRNA was co-transfected with the m.Six2 shRNA in another well.

4.4. RNA Extraction and RT-PCR The total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) from 48 h post-transfected mK3 cells and the kidneys of C57BL/6 embryonic mice at different developmental stage. The cDNA was synthesized using the Invitrogen RT kit according to the manufacturer’s protocol (Invitrogen). The mRNA expression level of Zeb1, Six2 was detected by RT-PCR at 60 ˝C annealing temperature with Zeb1 real time PCR sense primer: 51-CGAGTCAGATGCAGAAAATGAGCAA-31 and the anti-sense primer: 51-ACCCAGACTGCGTCACATGTCTT-31; Six2 sense primer: 51-GCCTGCG AGCACCTCCACAAGAAT-31 and the anti-sense primer: 51-CACCGACTTGCCACTGCCATTGAG-31. The expression were normalized to the internal control (18s or GAPDH) and were quantiﬁed by Gray Scan using Image J software. Int. J. Mol. Sci. 2016, 17, 1283 12 of 16

4.5. Western Blotting mK3 cells that were transfected for 48 h in 6-well plates were washed with PBS, pH 7.4 three times. Then, the cells were lysed with 300 µL of 1% SDS lysis buffer. The lysed complex were collected and boiled at 95 ˝C in a water bath for 10 min followed by centrifuging at 12,000 rpm for 10 min to gather the proteins in supernatant. The concentration of proteins was measured using the Pierce BCA Protein Assay Kit (Thermo Scientiﬁc, Waltham, MA, USA) based on the manufacturer instructions. 30 µg of each sample was used to conduct western in reference to the previous studies [8,43]. The primary antibodies respectively against Six2, Zeb1, c-Myc, β-tubulin were efﬁcient with proper dilution (1:700; 1:800; 1:1000; 1:4000; Proteintech, Chicago, IL, USA).

4.6. 5-Ethynyl-21-deoxyuridine (EdU) Assay mK3 cells were transfected with Zeb1 overexpression vectors or Zeb1-shRNA vectors or co-transfected with Zeb1-shRNA and Six2-shRNA vectors by lentivirus. Forty-eight hours later, the treated mK3 cells were seeded onto 96-well plates (10 thousand cells each well) and grew for about 8 h so that the cells were well adherent. Then the proliferation of mK3 cells was detected using the EdU DNA Proliferation in Detection kit (RiboBio, Guangzhou, China) according to the manufacturer instructions.

4.7. MTT Assay The MTT assay was carried out to test the changes of cellular viability. About 2000 mK3 cells transfected with Zeb1-shRNA or NC-shRNA were seeded in 96-well plates with ﬁve replicates. 12 h and 24 h later, the medium was aspirated, the cells were incubated with 100 µL fresh medium containing 0.5 mg/mL MTT for 4 h. Then, the medium was discarded and 100 µL of dimethyl sulfoxide was added into the well to dissolve the resulting formazan crystals. The absorbance was detected using a microplate reader (MULTISKAN GO, Thermo Scientiﬁc, Waltham, MA, USA) at a test wavelength of 590 nm. The average intensity of absorbance in relation to the formazan product indicated the number of cultured living cells with the equal cells at 0 h.

4.8. Flow Cytometry Assay and Reagent The apoptosis of mK3 cells was determined via the Annexin V-fluorescein isothiocyanate (FITC) Apoptosis Detection Kit (KeyGEN BioTECH, Nanjing, China). mK3 cells were transfected when the cells grew to about 60% confluence and 0.1 µM dexamethasone was selected as an inducing agent in mK3 cells transfected with Zeb1-shRNA or negative control shRNA for 20 h [44–46]. Then, the cells were harvested 48 h later with EDTA-free trypsin. The cells were numbered by cell counting board and pipetted about 1 million for the later treatment according to the manufacturer instructions. The flow cytometry apoptosis detection was operated by the Institute of Pediatrics in Children’s Hospital of Chongqing Medical University.

4.9. Wound Healing Assay mK3 cells were plated in 6-well plates in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS. When cells confluence reached about 60%, pCDH-copGFP-Zeb1 CDS, pLKO.1-Zeb1-shRNA, or blank vector (pCDH-copGFP or pLKO.1) were introduced into mK3 cells. The monolayer cells were generated scratch wounds using a pipette tip when cells grew to 95%–100%, then washed twice with PBS, pH 7.4 to wipe off cell debris. Cells were incubated in completed DMEM ˝ in 37 C, 100% humidity and 5% CO2. The images of wound width were taken at different time points (12 and 24 h) using a fluorescence microscope (ECLIPSE Ti-s, Nikon, Tokyo, Japan). Four images were collected from independent selected fields of each sample, and the width of wound areas were calculated by 2014 Microsoft PowerPoint. Int. J. Mol. Sci. 2016, 17, 1283 13 of 16

4.10. Dual-Luciferase Assay The G401 cell (a human tumor epithelial cell of Caucasian male, aging 3 months) were cultured in 24-well plate (0.1 million each well) for 24 h and then transiently co-transfected with pCDH-m.Zeb1, pGL3-Six2 promoter-luciferase (500 ng/well) and plasmid pRL-SV40 (10 ng/well) utilizing Polyetherimide (PEI) (23966-2, polysciences, Warrington, PA, USA). 48 h later, luciferase activity was assayed using Dual-Luciferase Reporter assay kit (Promega). Levels of ﬁreﬂy luciferase were standardized to those of Renilla.

4.11. Embryonic Mouse Kidney Isolation Embryonic kidneys were isolated from the C57BL/6 mouse embryos at different developmental stage (E11.5, E12.5, E13.5, E14.5, E16.5, E18.5) as described [47]. The process was performed in PBS, pH 7.4 under a microscope and the kidneys were stored at ´80 ˝C or put in Trizol solution for total RNA extraction.

4.12. Statistical Analysis All experiments were performed independently three times and the results were presented as the mean ˘ standard error of the mean (SEM) or SD. Data were assessed for the statistical signiﬁcance using student’s t test. The GraphPad Prism 5 software (GraphPad, San Diego, CA, USA) was used to evaluate the statistical results. Statistical differences were considered signiﬁcant with * p < 0.05, ** p < 0.01, *** p < 0.001.

5. Conclusions The results shown in this study indicate that Zeb1 up-regulates Six2 and promotes proliferation and apoptosis and inhibits the migration in MM cells.

Acknowledgments: We sincerely thank for the support of the National Natural Science Foundation of China (Grant No. 31271563 and Grant 81572076) to Qin Zhou and the National Basic Research Program of China (No. 2011CB944002) to Qin Zhou. We also acknowledge the materials support of the Students Innovation Laboratory of Chongqing Medical University. And we thank for the ScienLab team, an entrepreneur team of undergraduate students, for their help of lentivirus packing. Author Contributions: Yuping Gu, Ya Zhao, Yuru Zhou, Yajun Xie Qin Zhou and Bing Li conceived and designed the experiments; Yuping Gu, Pan Ju, Yaoshui Long, Dongsheng Ni, Jianing Liu and Fen Cao performed the experiments, Zhongshi Lyu, Zhaomin Mao analyzed the data; Jin Hao, Yiman Li, Quist Kanyomse, Qianya Wan, Yamin Liu, Die Ren, Yating Ning and Xiaofeng Li contributed reagents/materials/analysis tools; Yuping Gu, Ya Zhao, Yuru Zhou, Yajun Xie, Qin Zhou and Bing Li wrote the paper. Conﬂicts of Interest: The authors declare no conﬂict of interest.

Abbreviations

Zeb1 Zinc finger E-box-binding homeobox 1 MM Metanephric mesenchymal UB Ureteric bud PA Pre-tubular aggregate UT Ureteric tree RV Renal vesicles CM Condensed/cap mesenchyme TGF-β Transforming growth factor-β FITC Fluorescein isothiocyanate fitc HEK Human embryonic kidney MET Mesenchymal-epithelial-transition EMT Epithelial- mesenchymal-transition DMEM Dulbecco’s modified Eagle’s medium Int. J. Mol. Sci. 2016, 17, 1283 14 of 16 Int. J. Mol. Sci. 2016, 17, 1283 14 of 16 DMEM Dulbecco’s modified Eagle’s medium

AppendixAppendix A A

FigureFigure A1.A1.Knock-down Knock-down of ofZeb1 Zeb1inhibits inhibits mK3 mK3 cell cell proliferation. proliferation. mK3 mK3 cells cells were were 48 h post-treated48 h post-treated with vectorswith vectors of target of target shRNA shRNA or the respectiveor the respective control co vector,ntrol thenvector, the then equal the 2000 equal cells 2000 were cells seeded were into seeded the 96-well.into the Proliferating96-well. Proliferating mK3 cells mK3 were cells tested were in livingtested cellsin living using cells MTT using at 12 MTT and 24at h.12 Theand formazan24 h. The productformazan was product detected was by detected the intensity by the ofintensity absorbance of absorbance at 590 nm at wavelength 590 nm wavelength to indicate to indicate cell vitality. cell Thevitality. absorbance The absorbance intensity ofintensityZeb1 knocked of Zeb1 down knocked cells down was smaller cells was than smaller the negative than the control negative cells atcontrol both 12cells and at 24 both h.The 12 and absorbance 24 h. The present absorbance were examined present were by a examined microplate by reader a microplate and results reader were and displayed results aswere mean displayed˘ SD (n as= 3).mean ** p ±< SD 0.01, (n = *** 3).p **< p 0.001 < 0.01, negative *** p < control0.001 negative vectors. control vectors.

References References 1. McCampbell, K.K.; Springer, K.N.; Wingert, R.A. Analysis of nephron composition and function in the 1. McCampbell, K.K.; Springer, K.N.; Wingert, R.A. Analysis of nephron composition and function in the adult adult zebrafish kidney. J. Vis. Exp. 2014, 9, e51644. zebraﬁsh kidney. J. Vis. Exp. 2014, 9, e51644. [CrossRef][PubMed] 2. Vainio, S. How the developing mammalian kidney assembles its thousands of nephrons: Fgfs as stemness 2. Vainio, S. How the developing mammalian kidney assembles its thousands of nephrons: Fgfs as stemness signals. Dev. Cell 2012, 22, 1125–1126. signals. Dev. Cell 2012, 22, 1125–1126. [CrossRef][PubMed] 3. Saxen, L.; Sariola, H. Early organogenesis of the kidney. Pediatr. Nephrol. 1987, 1, 385–392. 3. Saxen, L.; Sariola, H. Early organogenesis of the kidney. Pediatr. Nephrol. 1987, 1, 385–392. [CrossRef] 4. Nishita, M.; Qiao, S.; Miyamoto, M.; Okinaka, Y.; Yamada, M.; Hashimoto, R.; Iijima, K.; Otani, H.; [PubMed] Hartmann, C.; Nishinakamura, R.; et al. Role of Wnt5a-Ror2 signaling in morphogenesis of the 4. Nishita, M.; Qiao, S.; Miyamoto, M.; Okinaka, Y.; Yamada, M.; Hashimoto, R.; Iijima, K.; Otani, H.; metanephric mesenchyme during ureteric budding. Mol. Cell. Biol. 2014, 34, 3096–3105. Hartmann, C.; Nishinakamura, R.; et al. Role of Wnt5a-Ror2 signaling in morphogenesis of the metanephric 5. Pope, J.C.T.; Brock, J.W., 3rd.; Adams, M.C.; Stephens, F.D.; Ichikawa, I. How they begin and how they mesenchyme during ureteric budding. Mol. Cell. Biol. 2014, 34, 3096–3105. [CrossRef][PubMed] 5. Pope,end: Classic J.C.T.; Brock,and new J.W., theories 3rd.; Adams, for the development M.C.; Stephens, and F.D.; deterioration Ichikawa, I.of Howcongenital they begin anomalies and how of the they kidney end: Classicand urinary and new tract, theories CAKUT. for J. the Am. development Soc. Nephrol. and 1999 deterioration, 10, 2018–2028. of congenital anomalies of the kidney and

6. urinaryTanigawa, tract, S.; CAKUT. Sharma,J. N.; Am. Hall, Soc. Nephrol.M.D.; Nishinakamura,1999, 10, 2018–2028. R.; Perantoni, [PubMed ]A.O. Preferential propagation of 2+ 6. Tanigawa,competent S.;Six Sharma, nephronic N.; Hall,progenitors M.D.; Nishinakamura,by LIF/ROCKi R.;trea Perantoni,tment of the A.O. metanephric Preferential mesenchyme. propagation ofStem competent Cell Rep. 2015 Six2+, 5nephronic, 435–447. progenitors by LIF/ROCKi treatment of the metanephric mesenchyme.

7. StemKobayashi, Cell Rep. A.;2015 Valerius,, 5, 435–447. M.T.; Mugford, [CrossRef ][J.W.;PubMed Carroll,] T.J.; Self, M.; Oliver, G.; McMahon, A.P. Six2 defines 7. Kobayashi,and regulates A.; a Valerius, multipotent M.T.; self-renewing Mugford, J.W.; nephron Carroll, pr T.J.;ogenitor Self, M.;population Oliver, G.;throughout McMahon, mammalian A.P. Six2 deﬁneskidney anddevelopment. regulates aCell multipotent Stem Cell self-renewing2008, 3, 169–181. nephron progenitor population throughout mammalian kidney 8. development.lyu, Z.; Mao, CellZ.; Wang, Stem Cell H.;2008 Fang,, 3, 169–181.Y.; Chen, [ CrossRefT.; Wan,][ Q.;PubMed Wang,] M.; Wang, N.; Xiao, J.; Wei, H.; et al. 8. lyu,MiR-181b Z.; Mao, targets Z.; Wang, Six2 H.; and Fang, inhibits Y.; Chen, the T.; proliferatio Wan, Q.; Wang,n of M.;metanephric Wang, N.; Xiao,mesenchymal J.; Wei, H.; etcells al. MiR-181bin vitro. targetsBiochem. Six2 Biophys. and inhibitsRes. Commun. the proliferation 2013, 440, 495–501. of metanephric mesenchymal cells in vitro. Biochem. Biophys. 9. Res.Self, Commun.M.; Lagutin,2013 ,O.V.;440, 495–501.Bowling, [ CrossRefB.; Hendrix,][PubMed J.; Cai,] Y.; Dressler, G.R.; Oliver, G. Six2 is required for 9. Self,suppression M.; Lagutin, of nephrogenesi O.V.; Bowling,s and B.; progenitor Hendrix, J.;renewal Cai, Y.; in Dressler, the developing G.R.; Oliver, kidney. G. Six2EMBO is requiredJ. 2006, for25, suppression5214–5428. of nephrogenesis and progenitor renewal in the developing kidney. EMBO J. 2006, 25, 5214–5428. 10. [Vannier,CrossRef ][C.;PubMed Mock, ]K.; Brabletz, T.; Driever, W. Zeb1 regulates E-cadherin and Epcam (epithelial cell 10. Vannier,adhesion C.; molecule) Mock, K.; expression Brabletz, T.; to Driever, control W.cell Zeb1 behavior regulates in early E-cadherin zebrafish and development. Epcam (epithelial J. Biol. cell Chem. adhesion 2013, molecule)288, 18643–18659. expression to control cell behavior in early zebraﬁsh development. J. Biol. Chem. 2013, 288, 11. 18643–18659.Eggers, J.C.; [Martino,CrossRef ][V.;PubMed Reinbold,] R.; Schafer, S.D.; Kiesel, L.; Starzinski-Powitz, A.; Schuring, A.N.; Kemper, B.; Greve, B.; Gotte, M. microRNA miR-200b affects proliferation, invasiveness and stemness of endometriotic cells by targeting ZEB1, ZEB2 and KLF4. Reprod. Biomed. Online 2016, 32, 434–445.

Int. J. Mol. Sci. 2016, 17, 1283 15 of 16

11. Eggers, J.C.; Martino, V.; Reinbold, R.; Schafer, S.D.; Kiesel, L.; Starzinski-Powitz, A.; Schuring, A.N.; Kemper, B.; Greve, B.; Gotte, M. microRNA miR-200b affects proliferation, invasiveness and stemness of endometriotic cells by targeting ZEB1, ZEB2 and KLF4. Reprod. Biomed. Online 2016, 32, 434–445. [CrossRef] [PubMed] 12. Tang, O.; Chen, X.M.; Shen, S.; Hahn, M.; Pollock, C.A. MiRNA-200b represses transforming growth factor-beta1-induced EMT and fibronectin expression in kidney proximal tubular cells. Am. J. Physiol. Ren. Physiol. 2013, 304, F1266–F1273. [CrossRef][PubMed] 13. Gong, S.G.; Eulenberg, R.L. Palatal development in Twirler mice. Cleft Palate Craniofac. J. 2001, 38, 622–628. [CrossRef] 14. Nishimura, G.; Manabe, I.; Tsushima, K.; Fujiu, K.; Oishi, Y.; Imai, Y.; Maemura, K.; Miyagishi, M.; Higashi, Y.; Kondoh, H.; et al. DeltaEF1 mediates TGF-β signaling in vascular smooth muscle cell differentiation. Dev. Cell 2006, 11, 93–104. [CrossRef][PubMed] 15. Liu, Y.; El-Naggar, S.; Darling, D.S.; Higashi, Y.; Dean, D.C. Zeb1 links epithelial-mesenchymal transition and cellular senescence. Development 2008, 135, 579–588. [CrossRef][PubMed] 16. Senanayake, U.; Koller, K.; Pichler, M.; Leuschner, I.; Strohmaier, H.; Hadler, U.; Das, S.; Hoefler, G.; Guertl, B. The pluripotent renal stem cell regulator Six2 is activated in renal neoplasms and influences cellular proliferation and migration. Hum. Pathol. 2013, 44, 336–345. [CrossRef][PubMed] 17. Zhou, P.; Chen, T.; Fang, Y.; Wang, H.; Li, M.; Ma, P.; He, L.; Li, Q.; Liu, T.; Yang, X.; et al. Down-regulated Six2 by knockdown of neurofibromin results in apoptosis of metanephric mesenchyme cells in vitro. Mol. Cell. Biochem. 2014, 390, 205–213. [CrossRef][PubMed] 18. Reidy, K.J.; Rosenblum, N.D. Cell and molecular biology of kidney development. Semin. Nephrol. 2009, 29, 321–337. [CrossRef][PubMed] 19. Multiple Sequence Aligment by CLUSTALW. Available online: http://www.genome.jp/tools/clustalw/ (accessed on 24 September 2015). 20. The Protein Database of National Center for Biotechnology Information. Available online: http://www.ncbi. nlm.nih.gov/protein. (accessed on 14 August 2015). 21. Xu, J.; Wong, E.Y.; Cheng, C.; Li, J.; Sharkar, M.T.; Xu, C.Y.; Chen, B.; Sun, J.; Jing, D.; Xu, P.X. Eya1 interacts with Six2 and Myc to regulate expansion of the nephron progenitor pool during nephrogenesis. Dev. Cell 2014, 31, 434–447. [CrossRef][PubMed] 22. Yu, J.; Carroll, T.J.; McMahon, A.P. Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney. Development 2002, 129, 5301–5312. [PubMed] 23. Takeyama, Y.; Sato, M.; Horio, M.; Hase, T.; Yoshida, K.; Yokoyama, T.; Nakashima, H.; Hashimoto, N.; Sekido, Y.; Gazdar, A.F.; et al. Knockdown of ZEB1, a master epithelial-to-mesenchymal transition (EMT) gene, suppresses anchorage-independent cell growth of lung cancer cells. Cancer Lett. 2010, 296, 216–224. [CrossRef][PubMed] 24. Filios, S.R.; Xu, G.; Chen, J.; Hong, K.; Jing, G.; Shalev, A. MicroRNA-200 is induced by thioredoxin-interacting protein and regulates Zeb1 protein signaling and beta cell apoptosis. J. Biol. Chem. 2014, 289, 36275–36283. [CrossRef][PubMed] 25. Xu, J.; Liu, H.; Park, J.S.; Lan, Y.; Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development 2014, 141, 1442–1452. [CrossRef][PubMed] 26. Crawford, E.D.; Wells, J.A. Caspase substrates and cellular remodeling. Annu. Rev. Biochem. 2011, 80, 1055–1087. [CrossRef][PubMed] 27. Pop, C.; Salvesen, G.S. Human caspases: Activation, specificity, and regulation. J. Biol. Chem. 2009, 284, 21777–21781. [CrossRef][PubMed] 28. Piatkov, K.I.; Brower, C.S.; Varshavsky, A. The N-end rule pathway counteracts cell death by destroying proapoptotic protein fragments. Proc. Natl. Acad. Sci. USA 2012, 109, E1839–E1847. [CrossRef][PubMed] 29. Eldeeb, M.A.; Fahlman, R.P. The anti-apoptotic form of tyrosine kinase Lyn that is generated by proteolysis is degraded by the N-end rule pathway. Oncotarget 2014, 5, 2714–2722. [CrossRef][PubMed] 30. Liu, Y.; Sanchez-Tillo, E.; Lu, X.; Clem, B.; Telang, S.; Jenson, A.B.; Cuatrecasas, M.; Chesney, J.; Postigo, A.; Dean, D.C. Rb1 family mutation is sufficient for sarcoma initiation. Nat. Commun. 2013.[CrossRef][PubMed] 31. Xu, B.; Lee, K.K.; Zhang, L.; Gerton, J.L. Stimulation of mTORC1 with L-leucine rescues defects associated with Roberts syndrome. PLoS Genet. 2013, 9, e1003857. [CrossRef][PubMed] Int. J. Mol. Sci. 2016, 17, 1283 16 of 16

32. Bates, C.M. Kidney development: Regulatory molecules crucial to both mice and men. Mol. Genet. Metab. 2000, 71, 391–396. [CrossRef][PubMed] 33. Couillard, M.; Trudel, M. C-myc as a modulator of renal stem/progenitor cell population. Dev. Dyn. 2009, 238, 405–414. [CrossRef][PubMed] 34. Siemens, H.; Jackstadt, R.; Hunten, S.; Kaller, M.; Menssen, A.; Gotz, U.; Hermeking, H. miR-34 and SNAIL form a double-negative feedback loop to regulate epithelial-mesenchymal transitions. Cell Cycle 2011, 10, 4256–4271. [CrossRef][PubMed] 35. The GenitoUrinary Development Molecular Anatomy Project Database. Available online: http://www. gudmap.org/gudmap/pages/mastertablebrowse.html (accessed on 10 September 2015). 36. The JASPAR Database. Available online: http://jaspar.genereg.net/cgi-bin/jaspar_db.pl. (accessed on 16 October 2015). 37. Sun, H.; Li, Q.W.; Lv, X.Y.; Ai, J.Z.; Yang, Q.T.; Duan, J.J.; Bian, G.H.; Xiao, Y.; Wang, Y.D.; Zhang, Z.; et al. MicroRNA-17 post-transcriptionally regulates polycystic kidney disease-2 gene and promotes cell proliferation. Mol. Biol. Rep. 2010, 37, 2951–2958. [CrossRef][PubMed] 38. Balhana, R.; Stoker, N.G.; Sikder, M.H.; Chauviac, F.X.; Kendall, S.L. Rapid construction of mycobacterial mutagenesis vectors using ligation-independent cloning. J. Microbiol. Methods 2010, 83, 34–41. [CrossRef] [PubMed] 39. MISSION shRNA Clones for individual genes. Available online: http://www.Sigmaaldrich.com/china- mainland/zh/life-science/functional-genomics-and-rnai/shrna.html (accessed on 3 December 2015). 40. pLKO.1-ShRNA Construction. Available online: http://www.addgene.org/tools/protocols/plko/ (accessed on 12 December 2015). 41. Valerius, M.T.; Patterson, L.T.; Witte, D.P.; Potter, S.S. Microarray analysis of novel cell lines representing two stages of metanephric mesenchyme differentiation. Mech. Dev. 2002, 112, 219–232. [CrossRef] 42. McLaughlin, N.; Yao, X.; Li, Y.; Saifudeen, Z.; El-Dahr, S.S. Histone signature of metanephric mesenchyme cell lines. Epigenetics 2013, 8, 970–978. [CrossRef][PubMed] 43. Tanigawa, S.; Wang, H.; Yang, Y.; Sharma, N.; Tarasova, N.; Ajima, R.; Yamaguchi, T.P.; Rodriguez, L.G.; Perantoni, A.O. Wnt4 induces nephronic tubules in metanephric mesenchyme by a non-canonical mechanism. Dev. Biol. 2011, 352, 58–69. [CrossRef][PubMed] 44. Suwanjang, W.; Abramov, A.Y.; Charngkaew, K.; Govitrapong, P.; Chetsawang, B. Melatonin prevents cytosolic calcium overload, mitochondrial damage and cell death due to toxically high doses of dexamethasone-induced oxidative stress in human neuroblastoma SH-SY5Y cells. Neurochem. Int. 2016, 97, 34–41. [CrossRef][PubMed] 45. Zhang, C.; Li, L.; Zhao, B.; Jiao, A.; Li, X.; Sun, N.; Zhang, J. Ghrelin protects against dexamethasone-induced INS-1 cell apoptosis via ERK and p38MAPK signaling. Int. J. Endocrinol. 2016.[CrossRef][PubMed] 46. Guo, S.; Mao, L.; Ji, F.; Wang, S.; Xie, Y.; Fei, H.; Wang, X.D. Activating AMP-activated protein kinase by an alpha1 selective activator compound 13 attenuates dexamethasone-induced osteoblast cell death. Biochem. Biophys. Res. Commun. 2016, 471, 545–552. [CrossRef][PubMed] 47. Brown, A.C.; Blank, U.; Adams, D.C.; Karolak, M.J.; Fetting, J.L.; Hill, B.L.; Oxburgh, L. Isolation and culture of cells from the nephrogenic zone of the embryonic mouse kidney. J. Vis. Exp. 2011.[CrossRef][PubMed]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).