ROLE OF BTG2 IN THE ANTIOXIDANT RESPONSE IN HUMAN BREAST EPITHELIAL CELLS
A Dissertation submitted to the Faculty of the Graduate School of Arts and Sciences of Georgetown University in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biochemistry and Cellular and Molecular Biology.
By
Tejaswita M. Karve, M.S.
Washington, D.C. May 24, 2012
Copyright 2012 by Tejaswita M. Karve All Rights Reserved
ii ROLE OF BTG2 IN THE ANTIOXIDANT RESPONSE IN HUMAN BREAST
EPITHELIAL CELLS
Tejaswita M. Karve, M.S.
Thesis Advisor: Eliot M. Rosen, M.D., Ph.D.
ABSTRACT
BTG2, a member of antiproliferative gene family BTG/TOB, has been implicated in cell cycle regulation, normal development and tumor suppression. However, the underlying mechanism(s) by which BTG2 regulates these processes is still unclear.
Previously, it has been shown that BTG2 expression is either completely lost or down- regulated in human breast cancers. Herein, I found that BTG2 protects human mammary epithelial cells from oxidative stress due to hydrogen peroxide (H2O2) and other oxidants, namely, nickel acetate and paraquat. Further, I showed that BTG2- mediated protection against oxidative stress in human breast epithelial cells is BRCA1 independent but requires the antioxidant-response transcription factor NFE2L2. The cytoprotective role of BTG2 is partly mediated by up-regulating the activity of key antioxidant enzymes including catalase, superoxide dismutase (SOD) 1, SOD2, and glutathione peroxidase, which are also NFE2L2-depedent. Additionally, I showed that
BTG2 increases the transcriptional activity of the antioxidant transcriptional factor,
NFE2L2. Furthermore, our immunoprecipitation results indicate that BTG2 is a binding partner of NFE2L2; with this physical interaction being facilitated by Box B, a short highly conserved amino acid motif characteristic of BTG2/TOB family proteins,
iii but not by Box A or Box C of BTG2 protein. I also show that Box B of BTG2 is required for the antioxidant stimulation effects mediated by BTG2 in response to H2O2 induced oxidative stress. Finally, I show that BTG2 is present at the AREs of NFE2L2 responsive genes (i.e., NQO1 and HO-1). These findings suggest a novel role for
BTG2, as a co-activator of NFE2L2, in up-regulating cellular antioxidant defenses in response to oxidative stress in human breast cells.
iv ACKNOWLEDGEMENTS
First and foremost, I am grateful to my thesis advisor Dr. Eliot M. Rosen for his support, encouragement and guidance throughout my tenure at Georgetown University.
I would also like to thank my thesis committee; Dr. Partha Banerjee, Dr. Albert
Fornace, Dr. Vicente Notario and Dr. Rabindra Roy for their valuable time and constructive critique that has helped me to complete and present my final form of this thesis. Finally, I would like to thank my parents as well as my friends for their unconditional love, support and encouragement throughout this process.
v List of abbreviations
CHAPTER I
ATM – ataxia telangiectasia mutated ARE – antioxidant response element BRCA1 – breast cancer susceptibility gene 1 BRCA2 – breast cancer susceptibility gene 2 BTG2 – B-cell translocation gene 2 CAF1 – chromatin assembly factor 1 CDC – centers for disease control and prevention CNC – cap n’collar D3T – 1,2-dithiole-3-thione ER – estrogen receptor GSH – glutathione, reduced form GSSG – glutathione, oxidized form GST – glutathione S-transferase GPx – glutathione peroxidase H2O2 – hydrogen peroxide Keap1 – kelch-like ECH-associated protein 1 KO – knockout LOH – loss of heterozygosity MT477 – thiopyrano[2,3-c]quinoline NCI – national cancer institute NFE2L2 – nuclear factor (erythroid-derived 2)-like 2 NGF – nerve growth factor PC3 – pheochromocytoma cell 3 PEITC – phenethyl isothiocyanate PKC – protein kinase C pRb – retinoblastoma protein, phosphorylated ROS – reactive oxygen species SNP – single nucleotide polymorphism SOD – superoxide dismutase SRC-1 – steroid receptor co-activator 1 TIS21 – tetradecanoyl phorbol acetate-inducible sequence 21 TOB – transducers of ErbB2 TP53 – tumor protein 53 TSG – tumor suppressor gene
CHAPTER II
BrdU – 5-bromo-2'-deoxyuridine ChIP – chromatin immunoprecipitation
vi DMEM – Dulbecco's Modified Eagle medium DMSO – Dimethylsulfoxide DN-NFE2L2 – dominant negative nuclear factor (erythroid-derived 2)-like 2 FCS – fetal calf serum HO-1 – heme oxygenase 1 IgG – immunoglobulin G IP – immunoprecipitation MTT– 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide NQO1 – NAD(P)H dehydrogenase [quinone] 1 RT-PCR – semi-quantitative reverse transcriptase polymerase chain reaction SEM – standard error of the mean siRNA – small interfering RNA wt – wild-type
CHAPTER III
AR – androgen receptor HoxB9 – homeobox protein B9 mRNA – messenger RNA PICK1– protein kinase Calpha (PKCalpha)-binding protein PRMT1 – protein arginine N-methyltransferase 1
CHAPTER IV
BER – base excision repair OGG1 – 8-oxoguanine glycosylase OCT1 – octamer transcription factor 1
CHAPTER V
DMBA – 7,12-dimethylbenzanthracene TMA – tissue microarray analysis
vii TABLE OF CONTENTS
Abstract…………………………………………….…………….………..…...…...... iii
Acknowledgements………………….……………………………...... …………...... v
List of abbreviations…………………..……………………………………...………vi
List of figures…………….………………………………….……...... ……………...xii
List of tables……………………….………………………………………...…...... xv
CHAPTER I: Introduction…………………………………………………………..1
1.A Breast cancer: burden and etiology……………………………………....2
1.B Tumor suppressor genes…………………………………………………..3
1.C BRCA1 as a tumor suppressor gene……………………………………....5
1.D Oxidative stress, NFE2L2-ARE signaling and cancer……………………9
1.D.1 Oxidative stress and cancer………………………………………9
1.D.2 NFE2L2-ARE signaling………………….……………………..11
1.D.3 NFE2L2-ARE signaling in cancer and other diseases…….……15
1.E BTG/TOB gene family………………………………………………...16
1.F BTG2 as a tumor suppressor gene……………………………………...21
1.G Rationale and hypothesis………………………………………………26
1.H Statement of purpose ………………...………….…………………….28
CHAPTER II: Materials and methods…….……………………………………….30
2.A Reagents and chemicals……………………………………………….31
2.B Expression vectors and small interfering (si)RNA……………………31
2.C Cells and cell culture…………………………………………………..33
viii 2.D Cell transfections………………………………………………………34
2.E MTT dye reduction assay……………………………………………...34
2.F Trypan blue dye exclusion assay……………………………………...34
2.G Semi-quantitative reverse transcriptase polymerase chain reaction
analysis (RT-PCR)…………………………………………………….35
2.H Western blot analysis…………………………………………………..37
2.I Antioxidant enzyme activity assays…………………………………….38
2.J Cellular redox state……………………………………………………..38
2.K Transcriptional assays…………………………………………………..38
2.L Immunoprecipitation………….…………...……………….……….….39
2.M Chromatin immunoprecipitation assays………………………………..40
2.N BrdU assay..……………………………………………………………43
2.O Cell cycle analysis……………………………………………………...43
2.P Statistical methods……………………………………………………..43
CHAPTER III: BTG2 serves as a co-activator of the antioxidant transcription
factor NFE2L2 and stimulates cellular antioxidant defenses in human
breast epithelial cells……….……………………………….………………..44
3.A Abstract…………………………………………………………………45
3.B Results…………………………………………………………………..46
3.B.1 BTG2 protects human mammary epithelial cells against oxidative
stress………………………………………………………………46
3.B.2 BTG2 stimulates expression of major antioxidant proteins………47
ix 3.B.3 BTG2 stimulates major antioxidant enzymes………..…………...48
3.B.4 BTG2 mediated protection against H2O2 requires functional
NFE2L2…………………………….……………………………..49
3.B.5 BTG2 mediated antioxidant response is NFE2L2 dependent…….50
3.B.6 BTG2 alters cellular redox state in mammary epithelial cells.…...51
3.B.7 BTG2 regulates NFE2L2-ARE signaling in mammary epithelial
cells ………………………………………………..….………....52
3.B.8 BTG2 physically associates with endogenous NFE2L2 protein…53
3.B.9 Box B of BTG2 is essential for BTG2-NFE2L2 protein
interaction………………………………………………………...54
3.B.10 Box B of BTG2 is required for BTG2 mediated protection against
oxidative stress………………………………………………….55
3.B.11 Box B of BTG2 is required for the BTG2 mediated stimulation of
antioxidant protein expression………………………………….56
3.B.12 BTG2 and NFE2L2 are present at the ARE sites of NFE2L2-
responsive genes………………………………………………..57
3.B.13 NFE2L2 and BTG2 abundance at the AREs increases in response
to oxidative stress………………………………………………..58
3.B.14 BTG2 inhibits cell proliferation in human mammary epithelial
cells……………………………………………………………..59
3.B.15 BTG2 induces cell cycle arrest and blocks apoptosis due to
oxidative stress…………………………………………………60
x 3.C Discussion……………………………………………………………………..62
3.D Figure legends…………………………………………………………………67
3.E Figures………………………………………..…………….….……………...76
CHAPTER IV: BTG2-mediated antioxidant response against oxidative stress in
human mammary epithelial cells is BRCA1-independent…...….……....105
4.A Abstract……………...... 106
4.B Results…………………………...……………….………………...... 107
4.B.1 BTG2-mediated protection against H2O2 is BRCA1
independent……………………………………………………..107
4.B.2 BTG2 stimulated antioxidant response is BRCA1
independent……………………………….……………….……108
4.C Discussion……………………………………………………………110
4.D Acknowledgements…………………………………………………..112
4.E Figure legends…………………………………………….…………..113
4.F Figures……………………………………………………….……….115
CHAPTER V: Conclusions and future directions………………………………..119
CHAPTER VI: Bibliography………………………………………………………124
xi List of figures
CHAPTER I
Figure 1 Effects of BRCA1 mutations on various cellular processes……………7
Figure 2 NFE2L2-ARE signaling pathway...………….………………………..14
Figure 3 Comparative primary protein structure of the members of BTG/ TOB family…..……………………………………………………………..18
Figure 4 Phylogenetic tree describing the relationship among members of BTG/TOB family across the species………………………………….19
Figure 5 Schematics showing functional roles of BTG2/TIS21/PC3 in a mammalian cell……………………………………………………… 23
CHAPTER III
Figure 6A-E BTG2 protects breast cancer cells against oxidative stress…………...76
Figure 6F-H BTG2 protects breast epithelial cells against oxidative stress………...77
Figure 6I-J Western blots confirming the efficacy of cell transfections and siRNA treatments in MCF-10A cells……………………………………….…78
Figure 7A-D BTG2 up-regulates expression of antioxidant enzymes in breast cancer cells…………………………………………………………………....79
Figure 7E-F BTG2 up-regulates expression of antioxidant enzymes in breast epithelial cells…………………………………………………………80
Figure 8A-F Densitometric quantification of RT-PCR and Western blot assays from Figure 6……………………………………………………………81-83
Figure 9A-F BTG2 regulates antioxidant enzyme activity in breast cancer cells….84
Figure 9G-H BTG2 regulates antioxidant enzyme activity in breast epithelial cells…………………..……………………………………………….85
Figure 10A-C BTG2-mediated protection against oxidative stress is NFE2L2 dependent……………………………………………………………..86
xii Figure 11A-E Western blots confirming the efficacy of cell transfections and siRNA treatments in breast cancer cells..…………………………………....87
Figure 12A-B BTG2 mediated antioxidant stimulation needs functional NFE2L2……………………………………………………………....88
Figure 12C-D BTG2 mediated antioxidant stimulation needs functional NFE2L2……………………………………………………………....89
Figure 13A-B NFE2L2 is required for basal and BTG2-stimulated antioxidant enzyme activity……….……………………………………………..90
Figure 14A-B BTG2 regulates cellular redox state...…………………………………91
Figure 15A-B BTG2 regulates NFE2L2-ARE signaling in MCF-7 cells……...……..92
Figure 15C-D BTG2 regulates NFE2L2-ARE signaling in T47D cells...…..………..93
Figure 16A-D BTG2 physically associates with NFE2L2 in vivo...……………...…..94
Figure 17 Schematics showing the primary structure of HA-tagged wtBTG2 as well as three deletion mutants; HA-BTG2 ∆A, HA-BTG2 ∆B and HA- BTG2 ∆C used for the domain mapping studies………………….…..95
Figure 18A-D Box B of BTG2 facilitates physical interaction between BTG2 and NFE2L2……………………………………………………………....96
Figure 19.A Box B of BTG2 is required for BTG2-mediated protection against oxidative stress………………………………………………………..97
Figure 20A-B Box B of BTG2 is necessary for BTG2-mediated stimulation of antioxidant response…………………………………………………..98
Figure 21A-D BTG2 is physically present at the antioxidant response element (ARE) in breast tumor cells……………………………………………….….99
Figure 22A-C Exposure to oxidative stress increases BTG2 recruitment at the antioxidant response element (ARE) in MCF-7 cells………………..100
Figure 22D-F Exposure to oxidative stress increases endogenous BTG2 recruitment at the antioxidant response element (ARE) in MCF-10A cells………...101
Figure 23A-B BTG2 induces growth arrest of H2O2-treated breast cells..………….102
xiii
Figure 24A-B BTG2 is anti-apoptotic in H2O2 treated MCF-7 cells……....…….….103
Figure 24C-D BTG2 is anti-apoptotic in H2O2 treated MCF-7 cells…...……..…….104
CHAPTER IV
Figure 25A-C BTG2-mediated protection against oxidative stress is BRCA1 independent………………………………………………………….115
Figure 26A-D Western blots confirming the efficacy of cell transfections and siRNA treatments in MCF-7 and T47D cells………………………………..116
Figure 27A-D BTG2-mediated antioxidant enzyme activity is unaffected by cellular BRCA1 status………………………………………………………..117
Figure 28A-D BTG2 over-expression stimulates antioxidant protein expression in BRCA1-deficient HCC1937 human breast cancer cells…………….118
xiv List of tables
Table 1 Sequences for the human BTG2-specific, BRCA1-specific and NFE2L2- specific siRNA………………………………………………………………….…...... 32
Table 2 PCR primers, reaction conditions and expected fragment size for the semi- quantitative RT-PCR………………………………………………………………...... 36
Table 3 PCR primers, reaction conditions and expected fragment size for the chromatin immunoprecipitation analysis………………………………………………………....42
xv
CHAPTER I
1 1.A Breast cancer: burden and etiology
Breast cancer is the second leading cancer, after non-melanoma skin cancer, found in American women as per the recent statistics published by the Centers for
Disease Control and Prevention (CDC)[1] . Further, worldwide there were 458,503 reported deaths due to breast cancer for year 2008 [2]. A report by the National Cancer
Institute (NCI) Surveillance Epidemiology and End Results (SEER) registry concludes that the lifetime risk for developing a breast cancer is one in eight women in the United
States and this risk is magnified several times, especially in the minority communities across the nation [3]. Furthermore, a report by the National Business Group on Health
(2008) estimates that the United States spends nearly $7 billion in cost for the breast cancer treatment annually [4]; with the SEER-Medicare study estimating minimum additional cost ranging from $10,000-19,000 per case over a period of 10 yr in incidences of disease recurrence [5] .
Nevertheless, the past few years have shown a slowing down in the number of breast cancers cases reported in the United States probably due to increased awareness
(e.g., genetic screening for predisposition of developing breast cancer), changes in reproductive factors, diet or other unidentified factors [6]. Several underlying risk factors have been identified for developing breast cancer such as increasing age, ethnic background, positive family history, early menarche, late menopause, nulliparity and genetic predisposition [7, 8]. Thus, the biological emphasis remains on identifying and understanding the mutations found in various genes including number of tumor suppressor genes. Evidence has shown that at least two of the tumor suppressor genes,
2 breast cancer susceptibility gene 1 (BRCA1) and breast cancer susceptibility gene 2
(BRCA2), are strongly linked with the predisposition of developing breast cancer in an individual [9, 10]. These genes are now routinely used as clinical predictive markers for assessing the individual risk for developing breast cancer [9, 10]. However, there is an ongoing effort to identify additional markers for better risk assessment of an individual predisposition to developing a breast cancer as well as identifying novel molecular targets for individualized cancer therapy, an emerging concept in cancer medicine.
This thesis aims to define the role of a novel tumor suppressor gene, B-cell translocation gene 2 (BTG2), and at least one of its mechanisms of action in human breast epithelial cells specifically in response to oxidative stress and thus demonstrating the potential of BTG2 as a tumor suppressor gene in human breast cancer.
1.B Tumor suppressor genes (TSGs)
Tumorigenesis is a multi-step process and is most often a consequence of deregulation between two major classes of cellular homeostatic genes, proto- oncogenes and tumor suppressor genes (TSGs) [11, 12]. During malignant transformation, there are a various cellular events involving activation of oncogene(s) and/or inactivation of TSG(s), either simultaneously or sequentially, among other events such as exposure to environmental stresses that result in switching on cell
3 survival pathways and switching off death or apoptotic cascades in transformed cells
[13, 14].
In order to understand the importance of TSGs in cancer suppression, it is necessary to recognize their functional implications in the cellular context as well as their role in the regulation of various cellular processes. One of the important breakthroughs in our understanding about the role of TSGs comes from the Knudson’s two-hit or two-mutation hypothesis, originally developed in the familial retinoblastoma model [15, 16]. According to the two-hit hypothesis, there is sequential inactivation of both alleles of the tumor suppressor gene resulting in a neoplastic transformation. In the case of familial retinoblastoma, the first hit is an inherited germ line mutation, which is present in all the cells of an organism but is insufficient for initiation of tumorigenesis. The second hit in this model may be any somatic mutation that results in loss of heterozygosity (LOH), thus satisfying the conditions for development of a tumor [15, 16]. In cases of non-hereditary forms of human cancer, such as most cases of breast cancer, both hits are somatic mutations that occur during lifetime of an individual [15].
The proteins synthesized by the TSGs are shown to normally function as inhibitors of the malignant transformation; a concept originally studied in the somatic cell hybrid experiments [17-19]. Tumor suppressor proteins play an important role in several critical and highly regulated cellular functions such as cell cycle maintenance, cell proliferation, DNA replication, cell growth and apoptosis [16]. Thus, inactivation of TSGs provides great advantage for tumor cell survival as well as rapid
4 multiplication in the body. Various mechanisms account for the inactivation of TSGs such as accumulation of numerous mutations, large chromosomal deletions/transformations, epigenetic silencing, and unstable protein products due to increased proteolysis [20, 21]. Therefore, understanding TSGs and their regulatory role(s) and specific function(s) in the cellular microenvironment are important steps towards devising treatments against cancer. Finally, a number of TSGs are now routinely used as predictive and/or prognostic markers in various forms of cancers; e.g. screening for the BRCA1 mutations to determine the genetic predisposition for developing breast and/or ovarian cancer. Thus, there are continuous efforts to discover and study more of such TSGs as predictive or prognostic markers as well as molecular targets for developing targeted therapeutics against cancer.
1.C BRCA1 as a tumor suppressor gene
Even though the vast majority of the human breast cancers are sporadic in nature (~90-95%), a small percentage (~5-10%) of cases can be traced back to a genetic predisposition of an individual [22] . In cases of hereditary breast cancers, there are frequent mutations in high penetrance genes such as BRCA1 and BRCA2 as well as other tumor suppressor genes such as TP53, ATM, RAD50, which may show occasional mutation(s) [23].
Breast cancer susceptibility gene 1 (BRCA1), a tumor suppressor gene in breast and ovarian cancer, was first identified by Hall et al. in 1990 and was localized on human chromosome 17q21 followed by a successful cloning by Miki et al. in 1994 [9,
5 24]. The human BRCA1 gene consists of 24 exons and encodes the full-length protein of 1863 amino acids with the approximate molecular weight of 220 kDa [9]. Thus, human BRCA1 gene is an example of a classical tumor suppressor gene since all the
BRCA1 mutation carriers showed LOH as observed by Miki et al. [9]. On the other hand, breast cancer susceptibility gene 2 (BRCA2), another tumor suppressor, was discovered in 1995 by Wooster et al. on chromosome 13q12-13 and mutations in
BRCA2 were also linked with the predisposition for hereditary human breast cancer but not with hereditary ovarian cancer [25].
BRCA1 is shown to participate in an array of cellular functions such as transcription regulation, cell cycle checkpoint control, DNA repair as well as other important cellular homeostatic functions (Fig. 1) [26, 27]. Moreover, BRCA1 plays a key role in DNA damage repair mechanism as evidenced by the studies in the BRCA1 null mice, which are embryonic lethal, further supporting the critical role of BRCA1
[28, 29]. The participation of BRCA1 in DNA repair is of particular interest, given the importance of faithful genetic replication, which is a necessary step to maintain genomic stability [29]. The range of effects observed due to endogenous BRCA1 manipulation in several human tumor cell types such as breast and prostate tumor cells have been crucial in understanding important roles of BRCA1 in breast, prostate and other types of human cancers.
6
Figure 1: Effects of BRCA1 mutations on various cellular processes. Mutations in
BRCA1 are shown to have a range of effects such as genomic instability, predisposition to various cancers and multitude of developmental defects. Figure is reproduced from Deng. CX, 2006 [30].
7
BRCA1 regulates gene expression by acting as a transcriptional co-regulator of several transcriptional factors such as p53, c-myc, and NFE2L2 [31-33]. Using fusion protein assay i.e., GST-BRCA1 fragments Zhang et al. showed that BRCA1 physically interacts with protein p53 [31]. Further, transcriptional assays confirmed that BRCA1 positively regulates p53 signaling as well as acts as a co-operative partner of p53 to induce apoptosis in human colon adenocarcinoma (SW480) cells [31]. These findings suggest the role of BRCA1 as a co-activator of p53 and possibly regulating number of tumor suppressive functions that are associated with p53. The yeast two-hybrid assays by Wang and colleagues showed that BRCA1 not only interacts with a potent oncogene, c-myc, but also acts as a transcriptional co-repressor as suggested by the transcriptional assays [32]. These studies further provided evidence for several of the tumor suppressor activities of BRCA1. Studies from the Rosen laboratory have shown that BRCA1 at least, transcriptionally regulates antioxidant response transcriptional factor, NFE2L2 and thus stimulates antioxidant response in various mammalian cell types upon exposure to oxidative stress [33]. Additionally, BRCA1 acts as a co- repressor of several hormone receptors such as estrogen receptor (ER) and thus suppresses cell proliferation as well as indirectly controls other hormone-regulated signaling cascades [34, 35].
8
1.D Oxidative stress, NFE2L2-ARE signaling and cancer
1.D.1 Oxidative stress and cancer
The concept of oxidative stress was first proposed by Denham Harman
in 1950s with regards to the deleterious effects of reactive oxidative species
(ROS) or free radicals (e.g., superoxide ion, hydroxyl radical, hydrogen
peroxide and hypochlorite ion) in promoting aging [36]. Several mechanisms
are responsible for formation of free radicals in a cell such as interaction of
ionizing radiation with biological molecules (e.g., proteins), end product of
mitochondrial aerobic respiration, and by-products of enzymatic reactions by
various cell types of immune system (e.g., neutrophils and macrophages). Since
1950s, decades of research have garnered strong evidence that oxidative stress
accelerates aging and is a influential factor in many diseases such as
neurodegenerative diseases and various forms of human cancers [37]. Thus,
oxidative stress is simply defined as an imbalance between ROS and the
corresponding antioxidant defenses in the cell, primarily due to increase in
ROS production and decrease in antioxidant potential of the cell [38].
Excess endogenous production of ROS damages proteins, lipids and
DNA resulting in formation of non-functional proteins, lipid peroxides and
DNA adducts respectively resulting in disruption of cellular homeostasis [39,
40]. The role of oxidative stress as one of the environmental factors in the gene-
environment interaction relating to breast cancer etiology is evident based on
9 the data gathered from several studies linking oxidative stress and breast cancer
[38, 40, 41]. Further, the central role of oxidative stress in estrogen-receptor
(ER) positive breast cancer is based on several studies that suggest that excess
ROS leads to rapid production of endogenous metabolites, which stimulates malignant transformation pathways that in-turn increases vascular permeability and thus drive tumor initiation and rapid metastasis, an event central in breast cancer pathophysiology [42-55].
Recently, at least one cohort-based study has attempted to explore a possible link between dietary antioxidants and oxidative stress in breast cancer patients and healthy women volunteers. Not surprisingly, authors found that breast cancer patients had high levels of circulating oxidative stress markers in their blood plasma compared to their healthy counterparts. However, with an increase in total intake of vitamin A and C in daily diet of breast cancer patients showed a substantial rise in the antioxidant markers when compared with breast cancer patients on normal diet suggesting that vitamin A and C may act as negative regulators of oxidative stress as well as associated inflammation and thus may be helpful in reducing breast cancer risk [56].
Given the role of oxidative stress in tumor initiation and progression,
Ramirez and colleagues have suggested cellular redox regulation using chemopreventive and other anti-cancer strategies as a promising new avenue to treat cancer [57, 58]. One such strategy has been successful in vitro in human melanoma cells and a nude mouse model, where-in researchers expressed
10 cDNA for human superoxide dismutase 2 (SOD2) and found that these
melanoma cells were no longer able to form colonies in soft agar indicating
suppression of their invasive phenotype. Also, these SOD2 overexpressing cells
were unable to generate tumors when transplanted in nude mice [59]. Thus,
these studies highlight the critical role of the antioxidant system as well as
individual proteins involved in the antioxidant system in protecting cells from
malignant transformation.
1.D.2 NFE2L2-ARE signaling
Nuclear factor (erythroid-derived 2)-like 2 (NFE2L2) (also called
NRF2) is a member of a family of transcription factors that are homologous to
the Drosophila "cap 'n' collar" (or CNC) protein [60]. Other closely related
members of this basic leucine-zipper protein family include nuclear factor
(erythroid-derived 2)-like 1 (NFE2L1) (also called NRF1, LCR-F1, TCF11)
and nuclear factor (erythroid-derived 2)-like 3 (NFE2L3) (also called NRF3,
LOC9603, sasky4) [61-63]. All three members of this family have been shown
to form a heterodimeric complex with small proteins such as MAF proteins and
JUN proteins, and to interact with the antioxidant response elements (AREs)
(also called electrophile response elements or EpREs), which are the cis-acting
elements in the promoter and/or enhancer regions of the target genes that
regulate cellular antioxidant responses [64].
NFE2L2 was initially cloned from a cDNA library derived from the
human fetal liver but was found to be ubiquitously expressed across all the
11 human tissues [60]. Although both NFE2L1 and NFE2L2 were shown to stimulate several of the antioxidant proteins, NFE2L2 regulated antioxidant signaling is one of the well-studied cellular response pathways [64, 65]. Under cellular conditions, NFE2L2 is bound to a cytoplasmic inhibitor protein kelch- like ECH-associated protein 1 (Keap1) via its amino terminus and retained in the cell cytoplasm thus suppressing its transcriptional activity [66]. Keap1 acts as a specialized sensor detecting cellular stress and/or damage signals by monitoring the intracellular concentrations of NO, Zn (2+), and alkenals, which are frequently altered under stressful conditions [67]. These chemicals serve as secondary messengers for Keap1 protein, which then perceives environmental stress [67]. It is suggested that these chemicals further covalently modify thiol groups of cysteine present in Keap1 protein, thus initiating the environmental stress response mediated by Keap1-NFE2L2-ARE signaling [68].
Upon exposure to oxidative stress, Keap1 releases NFE2L2 so it can translocate into the nucleus, form a complex with several small proteins such as
MAF proteins, JUN proteins, etc. and then bind to the AREs of different target genes and activate gene expression that includes antioxidant enzymes and cytoprotective proteins (Fig.2) [69, 70]. In addition, Keap1 can release NFE2L2 upon phosphorylation of NFE2L2 by various kinases such as protein kinase C
(PKC) (Fig. 2) [69, 70]. NFE2L2 is recycled in the cell via ubiquitin- proteasome degradation pathway [71, 72].
12 Some of the critical cytoprotective functions of NFE2 family members were confirmed by using knockout (KO) mouse models lacking a particular member [65]. NFE2L1 KO mice died in utero during mid-gestation and thus were not only embryonic lethal but also had a defective erythropoiesis leading to anemia early on in embryonic development [73]. On the other hand, NFE2L2
KO mice showed normal development without any obvious deformities but had decreased antioxidant response when exposed to various chemical oxidants [69,
74]. In addition, these NFE2L2 KO mice developed various systemic autoimmune diseases such as systemic lupus erythematosis as they aged [75].
13 Figure 2: NFE2L2-ARE signaling cascade. Upon exposure to appropriate inducer
(e.g., stress, chemicals), transcription factor NFE2L2 that is anchored in cytoplasm by cytoplasmic inhibitor protein Keap1 is released allowing translocation of NFE2L2 into cell nucleus, where it heterodimerizes with several small proteins (e.g., MAF proteins); this protein-protein complex binds to the AREs of NFE2L2-responsive genes and activates cellular antioxidant response. Figure is taken from Zhang et al. 2004 [76].
14 1.D.3 NFE2L2-ARE signaling in cancer and other diseases
Several studies have implicated oxidative stress as a major contributing
factor to developing cancer as well as number of neurodegenerative diseases
such as Alzheimer’s and Parkinson’s disease in humans [77-79]. In the case of
neurodegenerative diseases, studies show that activation of the NFE2L2-ARE
antioxidant pathway, which involves multiple target genes such as HO-1, NQO1,
etc., can offer a temporary relief as well as slow down disease progression.
These effects are mainly attributed to activation of the antioxidant response that
mitigates inflammation in neural cells [78, 79].
The protective role of NFE2L2 via stimulation of antioxidant response
has also been well documented in various cancers [80-82]. Studies in NFE2L2
KO mouse models have shown that the loss of NFE2L2 is associated with
predisposition for breast and colorectal cancer as well as increased
susceptibility to variety of carcinogens [80, 82]. Sulforaphane, a
chemopreventive agent that is currently in clinical trials for human breast
cancer, is shown to activate antioxidant response via stimulation of NFE2L2-
ARE pathway in various human breast cancer cell lines [83]. Several studies
have demonstrated that chemopreventive agents such as curcumin, phenethyl
isothiocyanate (PEITC) and 3H-1, 2-dithiole-3-thione 9 (D3T) also at least act,
in part, via stimulation of endogenous expression of NFE2L2 [84, 85]. Further,
these studies showed that the induction of NFE2L2 and its subsequent
association with the ARE(s) present on a number of genes such as NQO1 and
15 HO-1 was responsible for increased activity and expression of several
antioxidant and detoxifying proteins. Another novel anti-tumor compound
thiopyrano [2,3-c] quinoline (MT477), which has been shown to inhibit cell
growth in in vitro (various human tumor cell lines) and in vivo (tumor xenograft
mouse model) models, at least partially acts via induction of NFE2L2-ARE
pathway, which activates cellular antioxidant response [86]. Thus, the
cytoprotective effects stimulated by the NFE2L2-ARE signaling have
important therapeutic implications in cancer as well as other debilitating
diseases in humans.
1.E BTG/TOB gene family
A novel TSG family, B-cell translocation gene/transducers of ErbB2
(BTG/TOB), consists of growth-factor inducible immediate early response genes [87].
There are six known BTG/ TOB members in humans; BTG1, BTG2, BTG3, BTG4,
TOB1 and TOB2 [88-90]. All of the BTG/TOB members maintain two short conserved amino acid sequences in their protein structure, Box A and Box B, vital for regulating various cellular functions, including the antiproliferative function shown by all members of this family (Fig.3) [88, 89, 91-94]. Box A and Box B are stretches of 15 to
25 amino acids and also possess a characteristic nuclear receptor motif, LXXLL, found in many other proteins (e.g. SRC-1) that primarily act as co-regulators in receptor activated cell signaling pathways [88, 94-100]. Specifically in the case of BTG/TOB family, a study has shown that the interaction of proteins BTG1 and BTG2 with the
16 chromatin-associated factor-1 (CAF1), a general transcription element and part of
CCR4-CAF1 transcription complex, is facilitated through the LXXLL motif found in
Box A and Box B of these proteins [96, 101, 102].
Most of the BTG/TOB family members have homologs in other vertebrates including murine models (Fig. 4) [88, 89, 103]. This high degree of conservation across species suggests that this gene family may be critical during various developmental stages of organism’s life cycle. Also, it further leads us to speculate that these proteins may be able to compensate and/or supersede, to some extent, the functional role in the absence or defective protein product of another member [104].
All members of this anti-proliferative family are reported to have a short half-life and recycled by the ubiquitin-proteasome system, a common feature found for recycling several oncogenic as well as tumor suppressor proteins [105-107].
17 Figure 3: Comparative primary protein structure of members of the BTG/ TOB family, depicting size and conserved motif arrangements across the members of BTG/TOB memebers. Figure is adapted from Duriez et al. [89].
18 Figure 4: Phylogenetic tree describing the relationship among members of the
BTG/TOB family across species. An evolutionary tree was calculated analyzing the sequences by the nearest neighbor algorithm with the software Align by Feng and
Doolittle [1996]. The evolutionary distance is represented by the total branch lengths
(horizontal lines). Figure is adapted from F.Tirone, 2001[108].
19 One of the early observations during several types of cancers in humans (e.g., breast cancer and prostate cancer) is loss and/or down-regulation of the members of the
BTG/TOB family. For example, loss or down-regulation of BTG2 expression has been frequently observed in breast cancers [109, 110]. As in the case of many other tumor suppressor genes, only a few loss of function analysis based on studies of KO mice are available for members of the BTG/TOB gene family. So far, the KO mouse models have been generated for BTG2 and TOB1 [111-113]. In the case of BTG2 KO animals, apart from a few minor vertebral patterning defects there were no observed morphological anomalies nor any noticeably increased risk of developing any kinds of cancer, possibly due to other member of BTG/TOB family compensating for loss of
BTG2 [111]. Unlike BTG2 KO mouse models, TOB1-deficient or KO mice showed increased predisposition towards developing tumors in various tissues such as lymphomas and lung adenomas, specifically, hemangiosarcomas, lung carcinomas and hepatocellular adenomas and had increased bone density and mass due to hyperproliferation of osteoblasts [112-114]. Importantly, all KO animals (BTG2 and
TOB1) were alive at birth and reached adulthood indicating that absence of a member of this protein family is neither embryonic lethal nor does it induce life-threatening deformities. Nevertheless, additional studies involving other members as well as extending current studies to investigate tumor suppressive possibilities in other mouse models (such as developing KOs lacking multiple members of a family at a time) are necessary to fully understand the overlapping role, if any, of these proteins during the lifespan of animals.
20 1.F BTG2 as a tumor suppressor gene
B-cell translocation gene 2 (BTG2) is a member of the antiproliferative gene family (BTG/TOB). The gene products of this tumor suppressor gene have been shown to play a critical role in cell cycle regulation, cellular differentiation and growth, apoptosis and replicative senescence [88, 89, 96, 108, 115-118]. However, the exact mechanism(s) by which BTG2 regulates such a host of diverse cellular processes remains unclear.
BTG2, a growth factor inducible primary response gene, was first identified and cloned by Rouault and colleagues in 1996 from a human lymphoblastoid cell line cDNA library [119]. However, the rodent homologs of BTG2, PC3 and TIS21, were discovered a few years prior to their human homolog in the early 1990’s. Bradbury et al. cloned the PC3 gene, a rat homolog of BTG2, in 1991 from nerve growth factor
(NGF) exposed PC12 pheochromocytoma cells and found that PC3 is a single peptide secretory protein with an ability to promote neuronal differentiation upon NGF exposure [120]. The mouse homolog of BTG2, TIS21, was cloned by Varnum and colleagues from phorbol ester-induced Swiss 3T3 cells in 1994 [121]. Rouault et al. further found that 158 amino acids long BTG2 protein (MW: ~17 kDa) shows a high degree of homology (~ 90%) to its murine homolog, TIS21 as well as with another member of BTG/TOB family, namely BTG1 (~ 65%) [119]. Further, these authors confirmed the location of the BTG2 gene to chromosome 1, specifically to the q arm of chromosome 1 (1q32) by southern blotting analysis as well as by fluorescence in situ hybridization.
21 The sub-cellular localization of functional BTG2 has been shown to be mainly nuclear [116, 121-124]. However, the presence of the protein at low levels in cytoplasm has also been reported with a short half-life of ~15 min [116, 121-124].
While BTG2 is highly conserved across species, with homologs found in mouse
(TIS21) and rat (PC3), the expression of BTG2 shows a significant differences in the various cell layers of same tissue, as detected by immunohistochemistry technique
[108, 124]. This indicates a tightly regulated temporal and spatial expression pattern of
BTG2, which may be a part of its characteristic functional role in the cell: inhibition of cell proliferation [88]. The levels of anti-proliferative BTG2 are of particular interest in mammary gland growth, specifically, during involution when they are at highest level and remain steady during the differentiation of the mammary epithelium. However, the levels of BTG2 are negligible or completely lost during gestation and lactation, when there is a need of additional cells for milk secretion, and recover rapidly concomitant with cessation of lactation [110].
22 Figure 5: Schematics showing functional roles of BTG2/ TIS21/PC3 in a mammalian cell. Upon stimulation by a phorbol ester (i.e., TPA), BTG2/TIS21/PC3 is induced, resulting in cell cycle arrest at G1/S or G2/M cell cycle boundaries via acting as a binding partner or co-regulator of several proteins such as PRMT1 and CAF1. BTG2 also plays role in vertebral patterning, a developmental process by partnering with
BMP2 protein. Figure is adapted from Lim. IK (2006) [125].
23 BTG2, a p53-inducible gene, is mainly expressed during the G1-S transition stage of a cell cycle [108]. Thus, BTG2/PC3/TIS21, was shown to be responsible for hypo-phosphorylation of the protein retinoblastoma (Rb) leading to G1/S growth arrest
[126] . Conversely, Lim et al. have shown that BTG2/PC3/TIS21 is able to induce
G1/S arrest even in a pRb independent manner [127]. Further, BTG2 was specifically shown to induce G2/M cell cycle arrest in a p53 independent manner [126, 128]. At least one study by Montagnoli et al., found that overexpression of PC3, a rat homologue of BTG2, in NIH/3T3 cells failed to induce apoptosis indicating that the antiproliferative behavior of PC3 may be partly due to cell cycle arrest [129]. F.
Tirone cites similar observations in case of PC12 cells, further suggesting that the anti- apoptotic property of BTG2 may be in part due to the down-regulation of cyclin D1, thereby ensuring active pRb and thus inhibiting cell cycle progression [108].
One of the common observations in several types of human cancers is loss and/or down-regulation BTG2. For example, in several breast and prostate cancer studies, it was observed that there is a loss/down-regulation of BTG2 expression early on during the malignant transformation [109, 110, 130, 131]. Interestingly, there are no known mutations or single nucleotide polymorphisms (SNPs) reported for BTG2 in humans. Given the heterogeneous nature of breast cancer, the nuclear expression of
BTG2 is significantly down-regulated in breast tumor tissues, ranging from 45% to
65% when compared to the surrounding normal breast tissue [110]. In the case of ER- positive breast tumors, loss of BTG2 was further correlated to an increased tumor size and aggressiveness [109]. The loss or down-regulation of BTG2 was shown to promote
24 overexpression of cyclin D1, one of the early events in the process of tumorogenesis
[109]. Even senescence-resistant breast cancer cells showed down-regulation of an anti-apoptotic protein, BTG2, possibly due to its anti-proliferative function in cells
[132].
Moreover, recent studies in the mouse models for various diseases have discovered a link between diseases that induce cellular stress and BTG2 expression, e.g. induction of BTG2 in mouse models with acute pancreatitis [133-135]. The up- regulation of the BTG2 in liver and kidney was seen as a response to the stress induced during acute pancreatitis in mice, possibly as an effort to control apoptosis (as described above) in these tissues [133, 134]. In mouse brain, the expression of BTG2 can also be induced by renal ischemia and reperfusion in addition to acute pancreatitis
[135]. Thus, these studies highlight the up-regulation of BTG2 during various cellular stresses including oxidative stress. Thus, the specific role of BTG2 up-regulation in cells in response to oxidative stress and the underlying cytoprotective mechanism that may be initiated by BTG2 has not yet been completely understood.
25 1.G Rationale and hypothesis
Rationale:
Based on the information discussed in introduction (Chapter 1.F), one of the common early events in several types of human cancers including breast cancer is loss or down- regulation of BTG2 in tumor tissue [109, 130, 136-138]. Further, a recent study showed that loss of BTG2 promotes mammary tumor growth and metastasis in mouse model suggestive of a role of BTG2 in mammary tumor progression [139]. Several studies suggest a link between stressful conditions and induction in BTG2 expression.
BTG2 was found to be up-regulated in murine models with acute pancreatitis and renal ischemia, both conditions are associated with high levels of oxidative stress in pancreatic and hepatic tissue respectively [133-135]. In acute pancreatitis rat model,
BTG2 was strongly over-expressed in the pancreas, liver and kidney tissue [133, 134].
Following ischemic stroke, BTG2 was over-expressed in neurons within peri-infarct and infarct regions of brain but not in contralateral part of human fetal brain [135].
These findings with regards to loss of BTG2 in several human cancers and induction of
BTG2 under stress conditions suggest a possible role of BTG2 in response to stress conditions and human cancers. Furthermore, BTG2 is evolutionarily conversed across various species [108] hinting the importance of this gene in diverse cellular processes across species.
26 Hypothesis:
I hypothesize that BTG2 may function to prevent breast cancer development, in part, through up-regulation of cellular antioxidant response in human mammary epithelial cells. In particular, I propose that the BTG2 protein acts as a co-activator of the antioxidant transcription factor, NFE2L2, and stimulates several antioxidant proteins such as catalase, superoxide dismutase (SOD) 1, SOD2 and glutathione peroxides in response to oxidative stress in human breast epithelial cells.
27 1.H Statement of purpose
Specific aims:
SA1. To identify the mechanism by which BTG2 protects human breast epithelial cells against oxidative stress. To investigate the mechanism by which BTG2 gene protects against oxidative stress due to H2O2 or nickel acetate or paraquat, I will carry out a number of studies to:
a) Test whether BTG2 can stimulate the activity of key enzymes that function in
cellular pathways to detoxify reactive oxygen species (ROS) [i.e., catalase,
superoxide dismutases (SODs), and glutathione peroxidase (GPxs)].
b) Determine the effects of BTG2 on the redox state of the cell (i.e., the ratio of
reduced/oxidized glutathione) under basal conditions and in response to an
oxidant, specifically H2O2.
c) Investigate if the observed BTG2-induced antioxidant response is, at least in
part, mediated via stimulation of NFE2L2-ARE signaling pathway in breast
cells.
SA2. To determine the role of BTG2, if any, in the BRCA1-mediated protection against oxidative stress. Previous work from the Rosen laboratory indicates that
BRCA1 protects various types of human cells against oxidative stress, in part, by stimulating the expression of antioxidant genes (e.g., glutathione-S-transferases and oxidoreductases) and by shifting the cellular redox balance to a higher ratio of reduced/oxidized glutathione. In SA2, I will evaluate the role of BTG2 as an
28 intermediary for BRCA1-mediated protection against oxidative stress in breast cells.
Specifically, I aim to:
a) Determine if the ability of BRCA1 to stimulate these antioxidant gene
expression effects and shift in cellular redox state are dependent upon the
endogenous BTG2 protein.
b) Determine if exogenous wild-type (wt) BTG2 by itself can restore the ability of
BRCA1-deficient mammary epithelial cells to mount an antioxidant response.
c) Investigate the structural basis BRCA1/BTG2 interaction as it relates to
protection against oxidants.
29
CHAPTER II.
30 2.A Reagents and chemicals. Dimethylsulfoxide (DMSO), cholera toxin, 3-(4,5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye, isoproterenol, metaphosphoric acid, nickel acetate, paraquat, transferrin, and trypan blue were all obtained from Sigma (St Louis, MO) while 3% medical grade H2O2 was purchased from local CVS pharmacy (Woonsocket, RI).
2.B Expression vectors and small interfering (si) RNAs. The human wild- type BTG2 (wtBTG2) cDNA in the pcDNA3 vector was a gift from Dr. Saijun Fan
(Georgetown University, Washington, DC) while empty pcDNA3 vector was purchased from Invitrogen (Carlsbad, CA). For immunoprecipitation and chromatin immunoprecipitation experiments, (see below), I utilized human BTG2 cDNA in the pCMV6 vector, which contains an NH2-terminal FLAG epitope tag (FLAG-BTG2), and empty pCMV6 vector that were obtained from the Origene Technologies (Rockville,
MD). For domain mapping studies, immunoprecipitation reaction were performed using a human BTG2 cDNA in the pCMV vector containing a COOH-terminal HA epitope tag
(wt-HA-BTG2), or with a deletion mutant HA-BTG2-∆A lacking conserved Box A of
BTG2 protein in the pCMV vector containing a COOH-terminal HA epitope tag, or a deletion mutant HA-BTG2-∆B lacking conserved Box B of BTG2 protein or a deletion mutant HA-BTG2-∆C lacking conserved Box C of BTG2 protein and pCMV empty vector (Clontech Laboratories, Inc., Mountain View, CA). All of the HA-tagged BTG2 vectors (wild-type and three deletion mutants) were a gift from Dr. Shyamala
Maheswaran (Harvard Medical School and Massachusetts General Hospital, Boston,
MA). The sequences for the control (CON), BRCA1, BTG2 and NFE2L2 siRNA are
31 provided in the Table 1 and were synthesized and purchased from Thermo Scientific, Inc.
(Lafayette, CO).
Table 1 Sequences for the human BTG2-specific, BRCA1-specific and NFE2L2- specific siRNA.
Target Gene Target sequence(s)
Non-target / Control ON-TARGET plus Non-targeting siRNA # 1 (cat no. D-001810-01-05)
(CON)
BTG2 siRNA1:GAACCGACAUGCUCCCGGA
siRNA2:GCAUUCGCAUCAACCACAA
siRNA3:GGUCAUAGAGCUACCGUAU
siRNA4:AGACAAAGGUUACUAAUUG
BRCA1 siRNA1:CUAGAAAUCUGUUGCUAUG
siRNA2:CAGCUACCCUUCCAUCAUA
NFE2L2 siRNA1:UAAAGUGGCUGCUCAGAAU
siRNA2:GAGUUACAGUGUCUUAAUA
siRNA3:UGGAGUAAGUCGAGAAGUA
siRNA4:CACCUUAUAUCUCGAAGUU
32 2.C Cells and cell culture. Human breast cancer cell lines MCF-7, T47D and HCC1937 as well as a non-tumorigenic, spontaneously immortalized mammary epithelial cell line
MCF-10A were originally obtained from the ATCC (Manassas, VA). Another non- tumorigenic and chemically (exposure to benzo(a)pyrene) immortalized mammary epithelial cell line, 184A1, was a gift from Dr. Martha Stampfer (Lawrence Berkeley
Laboratories, Berkeley, CA). MCF-7 and T47D cells were cultured in Dulbecco’s
Modified Eagle Medium (DMEM) without sodium pyruvate and supplemented with 5 % fetal calf serum (FCS), non-essential amino acids (100 mM), streptomycin (100 µg/ml) and penicillin (100 U/ml) (all from the BioWhittaker, Walkersville, MD). While
HCC1937 cells were cultured in RPMI medium (ATCC) without sodium pyruvate and supplemented with 10 % FCS, non-essential amino acids (100 mM), streptomycin (100
µg/ml) and penicillin (100 U/ml). MCF-10A cells were cultured in F12/DMEM medium
(BioWhittaker) without sodium pyruvate and supplemented with 5% horse serum, hEGF
(20 µg/ml), insulin (100 µg/ml), hydrocortisone (0.5 µg/ml), streptomycin (100 µg/ml) and penicillin (100 U/ml) (all from Lonza Inc., Allendale, NJ), and cholera toxin (0.1
µg/ml). For 184A1 cells, the culture medium used was Mammary Epithelial Basal
Medium (MEBM) plus supplements provided in the Clonetics MEGM Bullet kit: human epidermal growth factor (hEGF) (10 ng/ml), insulin (5 µg/ml), hydrocortisone (0.5
µg/ml), gentamicin sulfate (30 µg/ml), amphotericin B (15 ng/ml), and bovine pituitary extract (70 µg/ml) and L-glutamine (2 mM) (all from Lonza), Transferrin (5 µg/ml) and
Isoproterenol (10-5 M). All cells were maintained in a humidified tissue culture incubator at 37˚C with 5% CO2.
33 2.D Cell transfection. Transient transfections were done using 6 µl of Lipofectamine
(Invitrogen) with 2 µg of wtBTG2 plasmid DNA per 10 cm2 well in a six well dish for 48 h. For immunoprecipitation and chromatin immunoprecipitation assays, cells were transiently transfected overnight with FLAG-BTG2 or pCMV6 (20 µg per 100 mm dish) using 40 µl Lipofectamine. For structural determinants studies, immunoprecipitation reactions were performed using lysates from MCF-7 cells transiently transfected with constructs expressing wt-HA-BTG2, or HA-BTG2-∆A or HA-BTG2-∆B or HA-BTG2-
∆C or pCMV (20 µg per 100 mm dish). All siRNA treatments were carried out for 72 h using gene-specific siRNA (100 nM) or CON siRNA (100 nM) and the transfection reagent used was siPORT amine (Thermo Scientific). None of the siRNAs were toxic to the cells and the CON siRNA had no effect on the basal expression levels of endogenous
BTG2, as detected by the MTT cell viability assay and western blot analysis.
2.E MTT dye reduction assay. Subconfluent, proliferating breast cells were transiently transfected with the indicated vectors or treated with gene-specific siRNA for overnight; then trypsinized and replated in 96-well dishes and allowed to attach for 2-3 h.
Subsequently, the medium was replaced with a fresh serum-free medium containing different concentrations of H2O2 (0-500 nM) or nickel acetate (0-480 nM) or paraquat (0-
125 nM) for 24 h and finally cells were assayed for the MTT dye reduction [140]. Each
H2O2 or nickel acetate or paraquat dose as well as each time-point for an oxidant treatment was performed in triplicate and plotted as the mean values ± SEMs based on three independent experiments.
2.F Trypan blue dye exclusion assay. MCF-7 cells were transiently transfected with wtBTG2 or empty pcDNA3 vector overnight in 24-well dishes. Next day, cells were
34 washed with 1X PBS followed by the treatment with doses of H2O2 in a serum-free medium, as above, for 24 h and assayed for the trypan blue dye exclusion [141]. Briefly, after 24 h H2O2 treatment cells were washed with 1X PBS, trypsinized and suspended in
1X PBS and finally stained with 0.2% trypan blue dye (Invitrogen). Post-staining cells were counted using Countess automated cell counter (Invitrogen), which provides data including total number of cells as well as stained and unstained cell population. Each
H2O2 dose for each time-point was performed in triplicate and plotted as the mean ± SEM from three independent experiments.
2.G Semi-quantitative reverse transcriptase polymerase chain reaction analysis
(RT-PCR). The total cellular RNA was extracted using TRIZOL Reagent (Invitrogen) as per instructions provided by the manufacturer. The first-stranded cDNA template was synthesized from 200 ng of total RNA using SuperScript II reverse transcriptase and oligo (dT) primers (both from Invitrogen) in a final reaction volume of 20 µl [142]. For
PCR, equal volumes of cDNA were used in a total reaction volume of 25 µl. Each PCR consisted of 1X PCR reaction buffer with 1.5 mM MgCl2 (Denville Scientific, Metuchen,
NJ), 2.5 mM dNTPs (Denville), 400 nM of each of custom-designed or previously published forward and reverse primers (IDT, Inc., San Jose, CA) and 1 Unit Hot-Start
Taq DNA polymerase (Denville). The PCR primers used in each reaction, amplification conditions and product size are listed in the Table 2. The PCR amplification conditions as well as the cycle number were adjusted for each set of primers so that it falls under the linear range of product amplification. The PCR products obtained were resolved on a 2
% agarose gel containing ethidium bromide (Sigma) and visualized under ultraviolet
(UV) light using the Quality One 1-D Analysis software (Bio-Rad, Hercules, CA). β-
35 Actin was used as an internal control. Densitometric analysis was performed using software ImageJ (NIH, Bethesda, MD) and mRNA expression values are mean ± SEM based on three independent experiments.
Table 2. PCR Primers, reaction conditions and expected fragment size for the semi- quantitative RT-PCR.
Gene Name Primer Sequence (5’ to 3’) PCR Number PCR reaction product of cycles conditions size (bps) B-cell F:AAGATGGACCCCATCATCAG 209 35 95C 5:00 translocation R:AGCACTTGGTTCTTGCAGGT 95C 0:30 gene 2 (BTG2) 52C 0:30 72C 1:00 72C 10:00 Beta Actin F:GGACTTCGAGCAAGAGATGG 233 32 95C 5:00 (β-Actin) R:AGCACTGTGTTGGCGTACAG 95C 0:30 53C 0:30 72C 1:00 72C 10:00 Breast cancer F:GGTGGTACATGCACAGTTGC 239 32 95C 5:00 susceptibility R:TGACTCTGGGGCTCTGTCTT 95C 0:30 gene1 (BRCA1) 53C 0:30 72C 1:00 72C 10:00 Catalase F:GCCTGGGACCCAATTATC TT 203 33 95C 5:00 R:GAATCTCCGCACTTCTCCAG 95C 0:30 51C 0:30 72C 1:00 72C 10:00 Superoxide F:AGGGCATCATCAATTTCGAG 217 33 95C 5:00 dismutase1 R:ACATTGCCCAAGTCTCCAAC 95C 0:30 (SOD1) 50C 0:30 72C 1:00 72C 10:00 Superoxide F:TTGGCCAAGGGAGAT GTTAC 157 32 95C 5:00 dismutase2 R:AGTCACGTTTGATGGCTTCC 95C 0:30 (SOD2) 51C 0:30 72C 1:00 72C 10:00
36 2.H Western blot analysis. Cell lysates were prepared after indicated treatments or transfections by treating cells with radioimmunoprecipitation assay (RIPA) buffer
(Thermo Scientific) supplemented with protease inhibitor cocktail set II (Calbiochem,
Gibbstown, NJ), followed by at least two freeze-thaw cycles (-20˚C followed by room temperature) in order to achieve complete cell lysis. These cell lysates was spun down at
13000 rpm at 4˚C to separate cell supernatant from cell debris. Next, protein concentration was measured using the BCA protein assay kit (Pierce Biotechnology, Inc.,
Rockford, IL). Equal aliquots of protein (35-50µg of protein per lane) were electrophoresed on 4-12 % Bis-Tris (BT) gradient gels (Invitrogen); transferred to nitrocellulose membrane (Millipore, Bedford, MA) and blotted with primary antibodies against BRCA1 (C20, rabbit polyclonal, 1:200; Santa Cruz Biotechnology, Santa Cruz,
CA), β-actin (rabbit polyclonal, 1:1000; Cell Signaling Technology Inc., Danvers, MA),
BTG2 (rabbit polyclonal, 1:250; Abcam, Cambridge, MA), Catalase (rabbit polyclonal,
1:8000; Calbiochem), Superoxide Dismutase 1 (rabbit polyclonal, 1:1000; Abcam),
Superoxide Dismutase 2 (rabbit polyclonal, 1:1000; Abcam), FLAG (M2, mouse monoclonal, 1:1000; Sigma), HA-probe (F7, mouse monoclonal, 1:200; Santa Cruz) and
NEF2L2 (rabbit polyclonal, 1:200, Santa Cruz) overnight, rocking at 4˚C . Next, the membrane was incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (1:10000) (all from Santa Cruz) for an hour and the resultant immuno complexes were detected with the chemiluminescence detection system (Santa Cruz).
The colored BT specific molecular size marker, SeeBlue 2 (Invitrogen) was used as a protein size standard.
37 2.I Antioxidant enzyme activity assays. Subconfluent cells were either transfected with the indicated vectors or treated with gene-specific siRNA overnight. Next day, cells were washed and incubated with complete medium for 24 h. Post-incubation cells were harvested for antioxidant enzyme assays and reactions were performed using commercial kits for catalase (Catalase Assay Kit, catalog no. 707002, Cayman Chemicals, Ann
Arbor, MI), total SOD activity (SOD Determination Kit, catalog no. 19160, Sigma) and total glutathione peroxides activity (Glutathione Peroxidase Assay Kit, catalog no.
353919, Calbiochem, Gibbstown, NJ) as per instructions provided by the manufacturer.
Each enzyme reaction was performed in triplicate and specific enzyme activity values were calculated and normalized to the control values for each experiment. The final values are indicated in fold changes as mean ± SEM from three independent experiments
2.J Cellular redox state. Subconfluent MCF-7 and T47D cells were transfected with wtBTG2 or empty pcDNA3 vector; treated with doses of H2O2 for 24 h, as above, and then used for assaying reduced (GSH) or oxidized (GSSG) forms of glutathione using a
Glutathione Assay Kit (catalog no. 703002) from Cayman Chemicals as per instructions provided by the manufacturer. Each enzyme reaction was performed in triplicate and specific enzyme activity values were calculated and normalized to the control values for each experiment. The ratio values were calculated as mean ± SEM from three independent experiments.
2.K Transcriptional assays. The wild-type nuclear factor (erythroid-derived 2)-like 2
(wtNFE2L2), dominant negative NFE2L2 (DN-NFE2L2) and NFE2L2-responsive reporter driven by the ARE of the NQO1 promoter (NQO1-ARE-Luc) reporter expression vectors have been described previously [33]. The antioxidant response
38 element (ARE) of NQO1 [NAD(P)H dehydrogenase, quinone 1] used in driving minimal promoter of NQO1-ARE-Luc vector is located upstream of the luciferase gene. For transcriptional assays, cells were plated in 12-well dishes and each transfection was performed in triplicate. Proliferating MCF-7 cells were co-transfected with NQO1-ARE-
Luc (0.2 µg/ well) and indicated expression vectors (total of 2 µg/ well) in presence of pRSV-β-gal (4 ng/ well) using Lipofectamine (4 µl) for an overnight. Total transfected
DNA was kept constant in all reactions by adding empty pcDNA3 vector, wherever necessary. Next day, transfection complex was removed; cells were washed with 1X PBS and replaced with complete medium for 24 hours. Finally, cells were lysed with 1X passive lysis buffer (Promega, Madison, WI) at room temperature for 20 min. The lysate was used to determine luciferase activity using a luciferase assay system kit (catalog no.
E1501, Promega). The activity of β-gal, as determined by the β-galactosidase enzyme assay system (catalog no. E2000, Promega), was used to monitor transfection efficiency.
Each reaction was done in triplicate and the results are represented as mean ± SEM from three independent experiments and were normalized to empty pGL3-Luc values.
2.L Immunoprecipitation (IP). MCF-7 and T47D cells were transiently transfected with
FLAG-BTG2 or pCMV6-FLAG (20 µg) with Lipofectamine per 10 cm dish for overnight. Post-transfections cell lysates were prepared as described under western blotting. These cell lysates were then centrifuged at 4˚C, 13000 rpm for 25 minutes and the resultant cell supernatants were used for immunoprecipitation reactions. The pre- cleared lysate (500 µg) was incubated overnight with 20 µl agarose A/G beads (Santa
Cruz) and 2 µg of anti-FLAG antibody (M2, mouse monoclonal; Sigma) or anti-NFE2L2
(C-20, rabbit polyclonal; Santa Cruz) or normal rabbit or mouse IgG (Santa Cruz). The
39 beads were washed thrice with RIPA buffer supplemented with the protease inhibitors cocktail set II and finally boiled with the Lameali buffer (Invitrogen) containing 2 % SDS at 99˚C for 10 min to separate the immuno complex. The lysate (10-30 µl) was electrophoresed on 4-12 % BT gels, transferred to nitrocellulose membrane and blotted with primary antibodies against FLAG (1:1000) and NFE2L2 (1:200).
Additionally, immunoprecipitation reactions were performed using lysates from
MCF-7 cells transiently transfected with wt-HA-BTG2 or HA-BTG2-∆A or HA-BTG2-
∆B or HA-BTG2-∆C or empty pCMV vector. The pre-cleared lysate (500 µg) was incubated overnight with 20 µl agarose A/G beads (Santa Cruz) and 3 µg of HA-probe
(F7, mouse monoclonal; Santa Cruz) or normal mouse IgG (Santa Cruz). The beads were processed as above and the lysate (30 µl) was electrophoresed on 4-12 % BT gels, transferred to nitrocellulose membrane and blotted with primary antibodies against HA
(1:200) and NFE2L2 (1:200).
2.M Chromatin immunoprecipitation (ChIP) assays. For ChIP assays, I used MCF-7 or T47D cells transiently transfected with indicated expression vectors and/ or treatments and then proceeded with the ChIP analysis using commercial ChIP-IT Express kit (Active
Motif Inc., Carlsbad, CA), according to instructions provided by the manufacturer. After the indicated treatments with H2O2, cells were harvested and cross-linked using 1% formaldehyde. For each reaction, 5 µg of total DNA was incubated with 7 µg of FLAG or
NFE2L2 or normal, non-immune rabbit or mouse IgG antibody at 4˚C overnight. The immunoprecipitated protein-DNA complexes were reverse cross-linked, and the DNA eluted was purified using a QIAquick PCR purification kit (QIAGEN Inc., Valencia,
CA). The purified DNA was used as a template for the PCR amplification of a sequence
40 spanning the ARE(s) within the NQO1 gene promoter and HO-1 gene enhancer regions respectively. Detailed protocol for the PCR setup is described above under RT-PCR. The
PCR primers and conditions used were originally published by Zhang et al.[143] and are described in Table 3. The PCR products were resolved on a 3% agarose gel containing ethidium bromide and viewed under UV light.
Additionally, I performed ChIP assays using MCF-10A cell lysates wherein after the indicated treatments with H2O2, cells were harvested and cross-linked, as above.
Here, each IP reaction consisted of 5 µg of total DNA and 7 µg of BTG2 (Q22, rabbit polyclonal; Santa Cruz) or NFE2L2 or normal, non-immune rabbit or mouse IgG antibody incubated at 4˚C, rocking overnight. The immunoprecipitated protein-DNA complexes were reverse cross-linked, and the DNA eluted was purified using a QIAquick
PCR purification kit. The purified DNA was used as a template for the PCR amplification and the PCR products were resolved on a 3% agarose gel, as above.
41
Table 3. PCR Primers, reaction conditions and expected fragment size for the chromatin immunoprecipitation (ChIP) reaction.
Primer Sequence (5’ to 3’) PCR Numb PCR produ er of reaction Gene Name ct size cycles conditions (bps) Heme F: GCTGCCCAAACCACTTCTGT 200 34 95C 5:00 oxgenase1 R: GCCCTTTCACCTCCCACCTA 95C 0:30 Enhancer E1 55C 0:30 (HO-1 E1) 72C 1:00 72C 10:00 Heme F: TCCTTTCCCGAGCCACGTG 197 36 95C 5:00 oxgenase1 R: TCCGGACTTTGCCCCAGG 95C 0:30 Enhancer E2 56.5C0:30 (HO-1 E2) 72C 1:00 72C 10:00 Heme F: CACCCGCTACCTGGGTGAC 150 35 95C 5:00 oxgenase1 R: GGAGCGGTAGAGCTGCTTGA 95C 0:30 Exon2 56C 0:30 (HO-1 Exon2) 72C 1:00 72C 10:00 NAD(P)H F: AAGTGTGTTGTATGGGCCCC 231 36 95C 5:00 dehydrogenase R: TCGTCCCAAGAGAGTCCAGG 95C 0:30 quinone1 54C 0:30 promoter 72C 1:00 (NQO1 pr) 72C 10:00 NAD(P)H F: 236 36 95C 5:00 dehydrogenase CCTGTAGCTGAAGGTTTGCTGG 95C 0:30 quinone1 R: 54C 0:30 Exon3 CCTACCTGTGATGTCCTTTCTGG 72C 1:00 (NQO1 72C 10:00 Exon3)
42 2.N BrdU assay. Proliferating cells were transiently transfected with wtBTG2 or empty pcDNA3 vector or treated with CON siRNA or BTG2 siRNA for overnight and then treated with doses of H2O2, as above, and used for measuring BrdU-labeled cell proliferation by a BrdU kit (catalog no. QIA58, Calbiochem) as per instructions provided by the manufacturer. Briefly, during final 12 h of H2O2 treatment, cells were incubated with the BrdU label (concentration 1:10000) so that the label is incorporated in the DNA of cells. Next, cells are fixed and denatured, followed by incubation with the anti-BrdU antibody for an hour and finally treated with the HRP-conjugated secondary antibody that detects the colored end product, which is read spectrophotometrically at a dual wavelength of 450-595 nm. The intensity of the color is directly proportional to the incorporation of BrdU label in the cellular DNA. Each reaction was done in triplicate and results shown are mean ± SEM from three independent experiments. Appropriate controls were included for each set of reactions.
2.O Cell cycle analysis. Subconfluent MCF-7 cells were transiently transfected with wtBTG2 or empty pcDNA3 vector for an overnight followed by 500 nM of H2O2 treatment for 24 h, as above. Post-treatment cells were trypsinized; washed with cold 1X
PBS; fixed in 70% cold ethanol and stained with propidium iodide (100 mg/ml) for analysis by the FACSort (Becton Dickinson and Company, Franklin Lakes, NJ). At least
20,000 events were collected for each sample and analyzed by ModFit software (Verity
Software House, Topsham, ME). Results are represented as means ± SEMs from three independent experiments.
2.P Statistical methods. Where appropriate, statistical comparisons were conducted using the two-tailed Student’s t test.
43
CHAPTER III
44 3.A Abstract
A few studies have shown induction in BTG2 expression in mouse models that are exposed to high endogenous oxidative stress, primarily due to genetic dysfunction of antioxidant proteins [144] or various disease conditions such as acute pancreatitis or kidney ischemia. The objective of this effort is to determine if BTG2 protects breast cells from oxidative stress via induction of cellular antioxidant response and if so, delineate the specific role of BTG2 in mediating such an antioxidant response. This work will provide insights into BTG2-mediated protective mechanism, specifically stimulation in expression and activity of major antioxidant enzymes such as catalase, SOD1, SOD2, and glutathione peroxides. It will also provide evidence that exogenous BTG2 has the ability to shift the balance of cellular redox state particularly, in response to H2O2 induced oxidative stress. Finally, I will show involvement of a specific antioxidant pathway,
NFE2L2-ARE response pathway that is activated by BTG2 to initiate the protective mechanism against oxidative stress; further establishing a specific role of BTG2, as a co- activator of transcription factor NFE2L2 in activating this antioxidant response pathway.
The work presented in Chapter III is published as: Karve T. M., and Rosen E. M. 2012.
B-cell translocation gene 2 (BTG2) stimulates cellular antioxidant defenses through the antioxidant transcription factor NFE2L2 in human mammary epithelial cells. Journal of
Biological Chemistry (Accepted for publication).
45 3.B Results
3.B.1 BTG2 protects human mammary epithelial cells against oxidative stress.
To examine the ability of BTG2 to protect against oxidative stress, I transiently transfected MCF-7 and T47D breast carcinoma cells, which have extremely low levels of
BTG2 [110], with wtBTG2 or empty pcDNA3 vector. These cells were then exposed to various doses of H2O2 for 24 h and assayed for cell viability using MTT assay. As shown in Fig. 6A and 6B, MCF-7 and T47D cells transfected with wtBTG2 showed significant
(p<0.05, two-tailed t-test) resistance to H2O2 at all doses when compared to untransfected cells or cells transfected with empty pcDNA3 vector. Similar results were observed in
MCF-7 cells transiently transfected with wtBTG2; followed by H2O2 treatments for 24 h and then assayed for the cell viability using trypan blue dye exclusion assay (Fig. 6C).
These results indicate that the BTG2-mediated protective effects observed in breast carcinoma cells are neither limited to one cell line nor artifacts observed by a particular cell survival assay i.e., MTT assay. In addition, as shown in Fig. 6D and 6E MCF-7 cells transfected with wtBTG2 showed significantly (p<0.05) better cell survival when compared to pcDNA3-transfected cells over a range of doses for two other oxidants; nickel acetate (0-480 nM) and paraquat (0-125 nM). These results suggest that BTG2 protects breast carcinoma cells against oxidative stress irrespective of oxidant used to induce the stress.
Alternatively, I also tested the effect of loss of BTG2 on cell survival in response to oxidative stress. Here I used two non-tumorigenic immortalized breast epithelial cell lines; MCF-10A and 184A1, which express moderate (MCF-10A) to moderately-high
(184A1) levels of endogenous BTG2 [110]. Next, cells were treated with BTG2-specific
46 siRNA or CON siRNA followed by exposure to a range of H2O2 doses, as above, and then assayed for cell survivability by MTT assay. As seen in Fig. 6F and 6G, MCF-10A as well as 184A1 cells treated with BTG2 siRNA and then exposed to H2O2 showed significantly (p<0.05) reduced cell viability when compared to untreated cells or CON siRNA treated cells. Conversely, I also manipulated endogenous BTG2 levels in MCF-
10A cells by transfecting these cells with wtBTG2 or empty pcDNA3 vector; then exposure to H2O2 and assayed for cell viability by MTT assay. I found that MCF-10A cells transfected with wtBTG2 showed significantly (p<0.05) improved cell survivability when compared to cells transfected with empty vector or untransfected cells (Fig. 6H).
Western blotting was used to confirm overexpression and knockdown of endogenous
BTG2 in MCF-10A cells (Fig. 6I-J). Thus, these results suggest that the exogenous as well as endogenous BTG2 offers protection against oxidative stress due to various oxidants in human breast cells.
3.B.2 BTG2 stimulates expression of major antioxidant proteins.
In an effort to understand the protective effects induced by BTG2 against oxidative stress, I examined the effect of BTG2 manipulation on expression of major antioxidant proteins i.e., catalase, SOD1, and SOD2. As shown in Fig. 7A and 7B, MCF-
7 transiently transfected with wtBTG2 showed induction in expression of catalase,
SOD1, SOD2 and BRCA1 at transcriptional (mRNA) as well as translational (protein) level when compared to empty vector (pcDNA3) transfected cells or vehicle only cells.
Similar results were observed in T47D cells transiently transfected with wtBTG2 (Fig.
7C-D). Conversely, 184A1 cells with high levels of endogenous BTG2 were treated with
47 BTG2 siRNA showed down-regulation in expression of catalase, SOD1, SOD2 and
BRCA1 at the mRNA as well as protein level when compared to untreated cells or cells treated with CON siRNA (Fig. 7E-F). Furthermore, these BTG2-mediated antioxidant protein stimulation effects were found to be statistically significant (p<0.05) based on densitometric analysis (Fig. 8A-F) performed by utilizing data from three independent sets of experiments in all cell lines used here i.e., MCF-7, T47D and 184A1 cells. These results suggest that exogenous BTG2 can induce expression of several antioxidant proteins in breast cells.
3.B.3 BTG2 stimulates major antioxidant enzymes.
Based on the observation above that BTG2 stimulates expression of catalase,
SOD1 and SOD2, I proceeded to measure the specific enzyme activity of catalase, total superoxide dismutase as well as total glutathione peroxidase in MCF-7 and T47D cells transiently transfected wtBTG2 or empty pcDNA3 vector. Consistent with the protein expression observations, I found that breast carcinoma cells (MCF-7 and T47D) transfected with wtBTG2 showed significant (p<0.05) induction in catalase (~ 2 fold) as well as total superoxide dismutase (~ 2 fold) enzyme activity when compared to pcDNA3-transfected cells (Fig. 9A-B, 9D-E). In addition, I found a small but significant
(p<0.05) increase in total glutathione peroxidase (GPx) enzyme activity (~ 1.5 fold) cells transfected with wtBTG2 compared to pcDNA3-transfected cells (Fig. 9C, 9F). On the contrary, 184A1 cells expressing endogenous BTG2 were treated with BTG2 siRNA showed significant (p<0.05) down-regulation in enzyme activity for catalase and total superoxide dismutase (Fig. 9G-H) in agreement with previously shown protein
48 expression results in Fig. 7E-F. Thus, these results suggest that BTG2 can stimulate activity of major antioxidant enzymes i.e. catalase, SOD1, and SOD2 in accordance to the stimulation of expression of these antioxidant proteins.
3.B.4 BTG2 mediated protection against H2O2 requires functional NFE2L2.
Previous findings from the Rosen laboratory showed that breast cells were protected from oxidative stress by BRCA1; with BRCA1-induced cytoprotective effects being modulated by NFE2L2-ARE signaling [33]. Hence, I tested the effect of antioxidant transcription factor, NEF2L2 in BTG2-mediated protective effects against oxidative stress. Here, I co-transfected MCF-7 and T47D cells with wtBTG2 and dominant negative (DN)-NFE2L2 expression vectors followed by exposure to various doses of H2O2 and finally assaying cell viability by MTT dye reduction assay. As shown in Fig. 10A and 10B, cells transfected with DN-NFE2L2 itself showed significantly
(p<0.05) reduced cell survival; while co-transfection with wtBTG2 and DN-NFE2L2 was unable to rescue these cells. Additionally, I also implemented a siRNA/gene knockdown approach utilizing simultaneous NFE2L2 siRNA treatment and wtBTG2 transfection in
MCF-7 cells in order to rule out any ambiguity with regards to these observed effects. As seen in Fig. 10C, cells treated with NFE2L2 siRNA and then transfected with wtBTG2 showed significant (p<0.05) susceptibility to H2O2 at all doses. The expression pattern
(over and underexpression) of BTG2 and NFE2L2 in both cell lines used in this study was confirmed by western blot (Fig. 11A-E). These results indicate that the transcription factor NFE2L2 is essential for BTG2-mediated protection against oxidative stress in breast cells.
49 3.B.5 BTG2 mediated antioxidant response is NFE2L2 dependent.
MTT results (Fig. 10) confirmed that the BTG2-mediated cytoprotection against oxidative stress requires functional NFE2L2. Here, I examined if BTG2-mediated antioxidant protein expression and enzyme activity requires functional NFE2L2. I used both dominant-negative and siRNA/gene knockdown approach to manipulate endogenous
NFE2L2 levels, in MCF-7 cells to assess this hypothesis. I co-transfected MCF-7 cells with wtBTG2 and DN-NFE2L2 to evaluate the expression of major antioxidant proteins, namely, catalase, SOD1, and SOD2. Western blot in Fig. 12A shows that MCF-7 cells transfected with wtBTG2 have significant (p<0.05) induction in expression of catalase,
SOD1 and SOD2 while cells cotransfected with DN-NEF2L2 and wtBTG2 brings down the expression of catalase, SOD1 and SOD2 proteins at its basal level, comparable to that of empty pcDNA3 vector transfected cells. Also, it is important to note that MCF-7 cells transfected with DN-NFE2L2 transfection itself show significantly (p<0.05) down- regulated expression of catalase, SOD1 and SOD2 when compared to pcDNA3- transfected cells. Densitometric analysis are shown Fig. 12B, based on three independent experiments confirmed that the observed effects are significant (p<0.05).
Additionally, using a gene knockdown approach wherein MCF-7 cells were treated with NFE2L2 siRNA followed by wtBTG2 transfection also showed comparable results as shown in Fig. 12C-D. Densitometric analyses, based on three independent experiments, confirm the effects as statistically significant (p<0.05). Thus, the above- mentioned results demonstrate that the NFE2L2 dependent BTG2-mediated antioxidant effects are not artifacts of a particular technique used to manipulate the levels of
50 endogenous functional NFE2L2. These results further suggest that functional NFE2L2 is necessary for BTG2-mediated antioxidant response in breast cells.
Further, I also tested the lysates of MCF-7 cells that were either transfected with wtBTG2 or DN-NFE2L2 or co-transfected with wtBTG2 and NFE2L2 for catalase and total SOD enzyme activity. Consistent with the antioxidant protein expression pattern, the activity of catalase and total SOD was significantly (p<0.05) induced in cells transfected with wtBTG2 and significantly (p<0.05) down-regulated in cells transfected with DN-
NFE2L2 (Fig. 13A-B). Furthermore, in cells that were cotransfected with wtBTG2 and
NFE2L2, the enzyme activity for catalase and total SOD was significantly (p<0.05) reduced when compared to pcDNA3-transfected cells (Fig. 13A-B). These results suggest that exogenous BTG2-mediated induction in antioxidant enzyme activity requires functional NFE2L2.
3.B.6 BTG2 alters cellular redox state in mammary epithelial cells.
Since I observed stimulatory effects of major antioxidant proteins were modulated by BTG2, I tested the effect of BTG2 on cellular redox state, as indicated by the ratio of reduced to oxidized glutathione (GSH/GSSG). Upon exposure to oxidative stress, cellular redox balance is shifted primarily due to loss of cellular glutathione. The optimal cellular response thus depends on the ability of a cell to maintain its redox balance, i.e., ratio of reduced form of glutathione (GSH) to oxidized form of glutathione (GSSG). MCF-7 and
T47D cells transiently transfected with wtBTG2 followed by treatment with indicated doses of H2O2 for 24 hr showed significantly (p<0.05) better GSH/GSSG ratio than that of vehicle or empty pcDNA3-transfected cells (Fig. 14A-B). However, it is important to
51 note that BTG2 transfection had no significant effect on the basal levels of GSH/GSSG ratio. These results indicate that even though BTG2 may not increase the synthesis of glutathione, but it does attenuate the loss of GSH in response to H2O2 induced oxidative stress.
3.B.7 BTG2 regulates NFE2L2-ARE signaling in mammary epithelial cells.
The transcription factor NFE2L2 stimulates cellular antioxidant defenses by up- regulating transcription of genes containing ARE(s) in their regulatory regions (e.g.
NQO1 gene). The NFE2L2-ARE signaling has been implicated in expression of antioxidant enzymes particularly catalase, SOD1, SOD2, and cellular glutathione synthesis as well as other genes such as NQO1 and HO-1. Since our results indicate that functional NFE2L2 is necessary for BTG2-mediated protection against oxidative stress, I investigated the role of BTG2 in transcriptional regulation of NFE2L2-ARE signaling.
Here, I tested the effect of BTG2 in MCF7 and T47D cells that are transiently transfected with NFE2L2-responsive reporter driven by the ARE of the NQO1 promoter (NQO1-
ARE-Luc) and a combination of other expression vectors, as indicated. As shown in Fig.
15A, MCF-7 cells co-transfected with wtBTG2 and wtNFE2L2 showed at least two fold increase in NQO1-ARE-Luc activity when compared to cells transfected with wtNFE2L2 and empty pcDNA3 vector (p<0.05). Even in the absence of wtNFE2L2, BTG2 was still able to induce NQO1-ARE-Luc activity, albeit to a much smaller level of ~1.6 folds compared to 27 folds, possibly due to the presence of endogenous NFE2L2. However, these NQO1-ARE-Luc stimulatory effects mediated by BTG2 were almost completely abolished upon introduction of DN-NFE2L2 in MCF-7 cells (Fig. 15B). Comparable
52 results were observed in T47D cells with similar combinations of co-transfections (Fig.
15C-D). These results imply that BTG2 transcriptionally regulates NFE2L2-ARE signaling.
3.B.8 BTG2 physically associates with endogenous NFE2L2 protein.
Upon verifying the role of BTG2 in transcriptional regulation of NFE2L2-ARE pathway, I proceeded to determine any physical interaction between two proteins; endogenous NFE2L2 and FLAG-tagged BTG2. The transcriptional activity of NFE2L2 in stimulating cellular antioxidant gene expression is facilitated by a number of co- regulator factors such as small MAF proteins, JUN protein, etc., which physically interact with NFE2L2. Here, I transiently transfected MCF-7 and T47D cells with FLAG-BTG2 or empty pCMV6-FLAG for 48 h. Next, the whole cell lysates were subjected to IP reactions with FLAG or NFE2L2 antibody to precipitate FLAG-BTG2 or NFE2L2 respectively. In FLAG IP reactions, I was able to co-precipitate endogenous NFE2L2
(Fig. 16A-C) and reciprocal results were found in NFE2L2 IP reactions, wherein I was able to enrich FLAG-BTG2 (Fig. 16B-D). Additionally, I included pCMV6-FLAG transfected cell lysates as a negative control along with appropriate host IgG IP reactions, none of which detected any precipitated proteins corresponding to FLAG-BTG2 or
NFE2L2 size. These results indicated that the FLAG-BTG2 protein and endogenous
NFE2L2 protein associate in-vivo.
53 3.B.9 Box B of BTG2 is essential for BTG2-NFE2L2 protein interaction.
Upon establishing the physical interaction between BTG2 and NFE2L2 proteins, I proceeded to locate the critical BTG2 protein domain necessary to facilitate this interaction. Here, I used HA-tagged wtBTG2 along with three deletion mutants, each lacking one of the three conserved domains (Fig. 3) of BTG2 protein; Box A (HA-BTG2-
∆A) or Box B (HA-BTG2-∆B) or Box C (HA-BTG2-∆C) respectively (Fig. 17). Several studies have shown that one or more of these domains is necessary for BTG2 to serve as a co-regulator (co-activator or co-repressor) for various proteins that affect diverse cellular functions such a cell replication, DNA repair etc. [96, 119, 145, 146].
MCF-7 cells were transfected with wt-HA-BTG2 or HA-BTG2-∆A or HA-BTG2-
∆B or HA-BTG2-∆C or empty pCMV vector. The prepared cell lysates were subjected to HA IP reactions. As shown in Fig. 18A, wt-HA-BTG2 was able to co-precipitate endogenous NFE2L2 (similar to FLAG-BTG2) while the pCMV-transfected cells showed no such co-precipitation of NFE2L2. As a negative control, IP using normal, non-immune mouse IgG showed no precipitated proteins for wt-HA-BTG2 or NFE2L2.
Similarly, an HA IP for deletion mutant HA-BTG2-∆A was able to co-precipitate
NFE2L2 (Fig.18B). However, when I performed an HA IP using HA-BTG2-∆B transfected MCF-7 cell lysates, I was unable to co-precipitate any NFE2L2 protein as shown in Fig.18C. An HA IP using HA-BTG2-∆C transfected cell lysates was able to co- precipitate endogenous NFE2L2 as shown in Fig. 18D. An IP performed using normal, non-immune mouse IgG did not show precipitated proteins for any of the three mutants with multiple repetitions yielding similar IP results. Thus, these results suggest that Box
B of BTG2 protein is necessary for the BTG2-NFE2L2 interaction in vivo.
54 3.B.10 Box B of BTG2 is required for BTG2 mediated protection against oxidative stress.
Based on our domain mapping studies (Fig.18), I was able to establish that “Box
B” (but not Box A or Box C) of BTG2 is required for BTG2-NFE2L2 protein interaction in vivo. Since, our MTT results in Fig.10 suggest that BTG2-mediated protection against oxidative stress requires functional NFE2L2, I used deletion mutants to confirm this hypothesis. MCF-7 cells were transfected with either empty pCMV or wt-HA-BTG2 or
HA-BTG2-∆A or HA-BTG2-∆B or HA-BTG2-∆C followed by exposure to various H2O2 doses for 24 h, as indicated, and finally assayed for cell viability by MTT assays. As shown in Fig. 19A, cells transfected with wt-HA-BTG2 showed significantly (p<0.05) higher cell survival when compared to pCMV-transfected cells. Also, cells transfected with HA-BTG2-∆A showed significantly (p<0.05) better survival relative to pCMV- transfected cells. However, in cells transfected with HA-BTG2-∆B, the BTG2-mediated cytoprotective effect was completely lost. While cells transfected with HA-BTG2-∆C showed significantly (p<0.05) better cell survival when compared to pCMV-transfected cells. Interestingly, both HA-BTG2-∆A and HA-BTG2-∆C transfected cells showed reduced cell survival when compared to wt-HA-BTG2 cells although this loss of effect was not statistically significant (p<0.05). These results suggest that “Box B” of BTG2 is necessary for BTG2-mediated protection against oxidative stress, and deletion of BTG2
Box B inhibits interaction with NFE2L2 and thus may have effect on ability of BTG2 to protect breast cells against oxidative stress.
55 3.B.11 Box B of BTG2 is required for the BTG2 mediated stimulation of antioxidant protein expression.
Results from domain mapping studies (Fig. 18) followed by the MTT assay (Fig.
19) using deletion mutants suggest the need of Box B (but not Box A and Box C) of
BTG2 for its cytoprotective function. Here, I tested if Box B is also required for BTG2- mediated antioxidant stimulation in breast cells. Next, MCF-7 cells were transiently transfected with pCMV or wt-HA-BTG2 or HA-BTG2-∆A or HA-BTG2-∆B or HA-
BTG2-∆C expression vectors. Cell lysates were prepared and the expression of major antioxidant proteins; catalase, SOD1 and SOD2 was analyzed using western blot analysis. β–Actin was used a loading and transfer control. As shown in Fig. 20A, wt-HA-
BTG2 was able to stimulate expression of catalase, SOD1 and SOD2 by ~2 fold when compared to pCMV-transfected cells. Similarly, expression of catalase, SOD1 and SOD2 was unaffected in cells transfected HA-BTG2-∆A or HA-BTG2-∆C expression vectors.
However, cells transfected with HA-BTG2-∆B showed complete loss of stimulation in expression of catalase, SOD1 and SOD2. Densitometric analysis shown in Fig. 20B underlines that this loss of antioxidant protein stimulation in HA-BTG2-∆B transfected cells is significant lower (p<0.05) when compared to wt-HA-BTG2 or HA-BTG2-∆A or
HA-BTG2-∆C. These results suggest that Box B of BTG2 is required for BTG2-mediated antioxidant stimulation as this effect is possibly (but may not be solely) an outcome of
BTG2-NFE2L2 interaction wherein Box B of BTG2 facilitates BTG2-NFE2L2 association.
56 3.B.12 BTG2 and NFE2L2 are present at the ARE sites of NFE2L2-responsive genes.
I performed ChIP assays to determine whether BTG2 is present at the AREs in known NFE2L2 target genes, NQO1 and HO-1. Using PCR primers spanning the ARE sites for two gene targets; NQO1 and HO-1, I performed FLAG and NFE2L2 IPs using
FLAG-BTG2 or empty vector pCMV6-FLAG transfected MCF-7 and T47D cells. As a control set of experiments, I used untransfected MCF-7 or T47D cells and performed
NFE2L2 IP (Fig. 21A and 21C), which showed that NFE2L2 was present at the two known ARE sites (E1 and E2) of HO-1 enhancer region as well as at the ARE (pr) site present in the promoter of NQO1 gene. As a negative control, I used HO-1 exon 3 and
NQO1 exon 2, both of which lack any AREs and showed no PCR products confirming absence of NFE2L2 at those sites. Additionally, an IP using non-immune, normal rabbit
IgG showed no PCR products further confirming the specificity of antibody used in IP reactions of ChIP analysis (Fig 21A-B). As shown in Fig. 21B, a FLAG IP using lysates from MCF-7 cells transiently transfected with FLAG-BTG2 showed that BTG2 is present at both HO-1 ARE sites (E1 and E2), as well as at NQO1 ARE (pr), but not at any of the exons for respective genes. No PCR products were detected when I used non-immune, normal mouse IgG for IP or for a FLAG IP using pCMV6-FLAG transfected cell lysates.
The input lane shown represents 10% of the total DNA used for each of the IP reactions.
Similar results were seen in T47D cell lysates transfected with FLAG-BTG2 (Fig. 21D).
These results indicate that exogenous BTG2 is found at the AREs of NFE2L2-responsive genes.
57 3.B.13 NFE2L2 and BTG2 abundance at the AREs increases in response to oxidative stress
Several studies have shown that upon exposure to oxidative stress, there is a time- dependent enrichment of NFE2L2 at the ARE sites of NFE2L2-responsive genes in an effort to activate protective antioxidant gene expression such as catalase, CYP1, UGT1, etc [76, 77]. Since, I was able to detect BTG2 at the AREs of NFE2L2-responsive genes,
I tested if BTG2 may show similar pattern of enrichment at the AREs upon exposure to oxidative stress. The input lane shown in Fig. 22A represent 10% of the total DNA used for each of the IP reactions. As shown in Fig. 22B, I used lysates from MCF-7 cells transfected with FLAG-BTG2 and exposed to 250 nM H2O2 for different time points, as indicated, followed by an NFE2L2 IP. As expected, I observed a time-dependent increase in accumulation of NFE2L2 at the HO-1 AREs as well as at NQO1 ARE with the peak of
NFE2L2 enrichment at 8 h of H2O2 exposure followed by a plateau. When I performed
FLAG IP using same MCF-7 lysates, I found similar kinetics for BTG2 recruitment at the respective ARE (s) as shown in Fig. 22C, with near maximal recruitment at around 8 h of
H2O2 exposure time point. These results suggest that exogenous BTG2 and endogenous
NFE2L2 are not only present at the AREs of NFE2L2-responsive genes but also show similar recruitment kinetics when exposed to oxidative stress.
Additionally, I performed similar ChIP assays utilizing lysates from untreated
MCF-10A cells or MCF-10A cells that were treated with 250 nM H2O2 for varying time points, as above. Input shown in Fig. 22D represents 10% of the total DNA used for the
IP reaction. As shown in Fig. 22E, I was able to detect an enrichment pattern for NFE2L2 at HO-1 and NQO1 ARE sites upon exposure to oxidative stress, similar to MCF-7 in
58 Fig. 22B. Furthermore, I also observed comparable BTG2 recruitment kinetics in MCF-
10A cells treated with H2O2 (Fig. 22F) similar to that of FLAG-BTG2 transfected MCF-7 cells exposed to H2O2. Thus, these results suggest that endogenous as well as exogenous
BTG2 is present at the AREs of NFE2L2-responsive genes, i.e. HO-1 and NQO1 and follow similar ARE recruitment kinetics as that of endogenous NFE2L2 in breast epithelial cells.
3.B.14 BTG2 inhibits cell proliferation in human mammary epithelial cells.
Several studies (see introduction, 1.E) show that BTG2 and other members of the
BTG/TOB family inhibit cell proliferation, a characteristic that contributes to their function as tumor suppressors. Here, I examined the anti-proliferative function of BTG2 in our experimental system; MCF-7 and MCF-10A breast cells. I used BrdU incorporation assay as a measure of cell proliferation. In this assay, MCF-7 cells were transfected with wtBTG2 or empty pcDNA3 vector, followed by exposure to various doses of H2O2 for 24 h with BrdU label present during the final 12 h of H2O2 treatment.
As shown in Fig 23A, MCF-7 cells transfected with wtBTG2 showed significant
(p<0.05) cell growth inhibition compared to untransfected cells or cells transfected with empty pcDNA3 vector. Further, exposure to H2O2 itself showed dose-dependent growth inhibition in empty pcDNA3-transfected as well as untransfected cells consistent with an earlier study detecting similar effects in vascular muscle cells [147]. However, the degree of growth inhibition was consistently and significantly (p<0.05) higher in wtBTG2 transfected MCF-7 cells relative to vehicle only or pcDNA3-transfected MCF-7 cells.
59 Based on the above observations, I verified the effect of BTG2 loss on cell growth in MCF-10A cells. Here, I treated MCF-10A cells with BTG2 siRNA or CON siRNA.
MCF-10A cells treated with BTG2 siRNA showed no significant (p<0.05) difference in cell growth inhibition when compared to CON siRNA treated or untreated cells (Fig.
23B), suggesting that the loss of BTG2 subsided the inhibitory effects on cell proliferation. However, I detected the dose-dependent growth inhibitory effects in all test groups of MCF-10A cells treated with H2O2 similar to MCF-7 cells; with these effects significantly (p<0.05) reduced in MCF-10A cells treated BTG2 siRNA compared to
CON siRNA treated or vehicle only cells. Thus, these results suggest that endogenous as well as exogenous BTG2 can inhibit cell proliferation in human breast cells.
3.B.15 BTG2 induces cell cycle arrest and blocks apoptosis due to oxidative stress.
Apart from effects on cell proliferation, I examined the effects of BTG2 on cell cycle as well as cell death by apoptosis. Previously, several studies provided evidence that BTG2 arrest cells in G1/S as well as G2/M phases of cell cycle (see introduction). As shown in Fig. 24A-B and cell cycle histograms (Fig. 24C-D) of MCF-7, cells transfected with wtBTG2 showed that there were significantly (p<0.05) less cells in S-phase when compared to pcDNA3-transfected cells. Although not significant, there was a greater number of cells in G1 phase of cell cycle when wtBTG2 was transfected in MCF-7 cells compared to pcDNA3-transfected cells. Further, the effect of cell cycle arrest in G2 phase was significant (p<0.05) in wtBTG2 transfected MCF-7 cells exposed to H2O2 relative to pcDNA3-transfected cells exposed to H2O2. Also, wtBTG2 transfected MCF-7cells showed a significant reduction (p<0.05) in pre-G1 or apoptotic cells when compared to
60 pcDNA3-transfected cells (Fig. 24A-B). These results suggest that BTG2 is anti- apoptotic and induces cell cycle arrest in breast cells.
61 3.C Discussion.
In this study, I present evidence that BTG2 protects human breast epithelial cells from oxidative stress partly by induction of several antioxidant proteins such as catalase,
SOD1, SOD2 and GPx. Another major finding of this study is that BTG2-mediated antioxidant defense requires functional NFE2L2, an antioxidant response regulating transcription factor. Furthermore, my results identify a potential mechanism for the
BTG2-mediated antioxidant defense response that is regulated via NEF2L2-ARE signaling wherein BTG2 serves as a co-regulator, specifically as a co-activator, of transcription factor NFE2L2.
When wtBTG2 was expressed in human breast epithelial cells, followed by an exposure to an oxidant, these cells showed significantly (p<0.05) better cell survival compared to cells transfected with empty pcDNA3 vector, suggesting that BTG2 offers protection against oxidative stress. This observation may partly explain the induction of
BTG2 detected in mouse models during high oxidative stress conditions such as acute pancreatitis and kidney ischemia [133-135]. My results show that BTG2 also induces expression of several of major antioxidant proteins such as catalase, SOD1 and SOD2, which was consistent with the increase in specific enzyme activity of these proteins as well. These antioxidant effects were directly related to the status of functional NFE2L2 in our experimental system; inhibiting NFE2L2 by introduction of dominant negative
NFE2L2 expression vector or by treatment with NFE2L2 siRNA abolished the exogenous BTG2-mediated antioxidant stimulation effects. Further, I was able to detect the physical association between exogenous BTG2 and endogenous NFE2L2 via immunoprecipitation reactions. I also found that endogenous as well as ectopic BTG2
62 was found at the AREs of NFE2L2-responsive genes suggesting that BTG2 may serve as a co-regulator of NFE2L2.
Previously, BTG2 was shown to act as a co-regulator and/or a binding partner for several transcription factors and regulatory proteins respectively [96, 145, 148-150].
BTG2 acts as a co-activator of transcription factor HoxB9, plays a critical role in normal developmental processes including development and differentiation of mammary gland
[151]. BTG2 also binds to a regulatory protein, PRMT1, a predominant member of protein arginine metyltransferases in mammalian cell, and thus may be indirectly involved in regulating a variety of cellular functions such as DNA repair, RNA processing, and modulation of various signal transduction pathways [148]. And BTG2 binds to transcriptional co-regulators CCR4-associated factor 1 (CAF1) and suppresses its deadenylase activity and thus regulates mammalian mRNA deadenylation [152].
Additionally, BTG2 acts as a co-repressor of the transcription factor ER∝ and is shown to inhibit cell proliferation [145]. Murine homolog of BTG2, TIS21, was shown to bind a protein kinase Calpha (PKCalpha)-binding protein (PICK1) via GST-tagged protein binding assays and thus is speculated to be involved in PKC-mediated extracellular signal pathways [150]. My study defines another functional role of BTG2, as a co-activator of transcription factor NFE2L2. In addition, our data also suggests that BTG2-mediated activation of cellular antioxidant response is NFE2L2-dependent event, even though I do not exclude possibility of another NFE2L2-independent BTG2-mediated antioxidant stimulation mechanism.
Further, I performed several immunoprecipitation reactions using deletion mutants, each lacking one of the conserved amino acid sequences of BTG2; either Box A
63 or Box B or Box C domains to narrow the specific BTG2 domain required for the BTG2-
NFE2L2 protein association. My results suggest that Box B of BTG2 is necessary for
BTG2-NFE2L2 interaction (but not Box A or Box C) and in turn required for the
NFE2L2-dependent BTG2-mediated antioxidant response. BTG2, like other members of the BTG/TOB family, maintains 2 conserved protein domains; Box A and Box B, each spanning a stretch of 15-25 amino acids as well as third minor domain “Box C”, also found in another BTG/TOB member such as BTG1 [89]. Studies have shown that both or at least one of the conserved boxes (A and B) is necessary for the members of the
BTG/TOB family, including BTG2, for executing their anti-proliferative as well as co- regulatory functional roles in cellular milieu. Deletion studies showed that intact “Box A” is required for the Rb-mediated antiproliferative function of BTG2, and the interaction between BTG2 and CAF1 is facilitated via intact “Box B”; while “Box C” in its entirety is required for PRMT1-BTG2 association [95, 153, 154]. Another recent study found that
BTG2 binds to androgen receptor (AR) via Box B, specifically through the LXXLL motif of Box B but not via Box A [149]. Additionally, the interaction between BTG2 and
HoxB9 is also speculated to be facilitated by one of these two conserved boxes [108].
Several studies implicated oxidative stress as a contributing factor to cancer and neurodegenerative diseases such as Alzheimer’s and Parkinson’s disease. Specifically in neurodegenerative disease, activation of the NFE2L2-ARE pathway by drugs such as
Deprenyl (Selegiline) has shown to offer temporary relief and slow down disease progression by mitigating neural cell inflammation [155]. Cellular exposure to oxidative stress activates NEF2L2-ARE signaling, which then results in stimulating activity and expression of several antioxidant and detoxifying proteins [77]. The heterodimerization
64 of several small proteins (e.g MAF proteins, JUN proteins, etc.) with NFE2L2 and the subsequent association of this complex with the ARE(s) of the NFE2L2-responsive genes mediates activation of NFE2L2-ARE signaling.
The cytoprotective role of NFE2L2 via stimulation of antioxidant response has also been well documented in various cancers [80-82]. Studies in knockout NFE2L2 mouse models have shown that the loss of NEFE2L2 is associated with increased susceptibility to carcinogens and thus higher predisposition for developing breast and colorectal cancer [80, 82]. Thus, NFE2L2 has been also shown to be a molecular target for a number of cancer chemopreventive agents like sulforaphane, phenethyl isothiocyanate and diindolylmethane (DIM) [83, 84, 156-159]. Hence, the biological consequences of the physical association, between BTG2 and NFE2L2, may have important implications in cancer as well as other chronic non-cancer diseases. The association between BTG2 and NFE2L2 may be useful in further evaluating the potential of BTG2 as a chemopreventive target for agents such as sulforaphane, DIM etc. and if so, its role in stimulating NFE2L2-ARE pathway.
Furthermore, few studies have attempted to explore the potential of BTG2 as a marker in various types of cancer including breast cancer [160, 161]. In a recent breast tumor tissue microarray study, authors found a strong correlation between high levels of
BTG2 expression and positive prognosis in patients, emphasizing the potential of BTG2 as a marker in breast cancer [160]. Similar studies may also be helpful in defining BTG2 as a marker in other types of cancers such as prostate cancer, where BTG2 is frequently lost similar to that of breast cancer.
65 Thus, the findings in this aim contribute to our understanding role of BTG2 as a tumor suppressor in human breast cancer and discovering at least one such tumor suppressive mechanism i.e., antioxidant stimulation via NFE2L2-ARE pathway, and its potential as a putative molecular target for various chemopreventive drugs that may be able to induce an endogenous NFE2L2-ARE pathway.
66 3D. Figure legends
Figure 6A-E. BTG2 protects breast cancer cells against oxidative stress.
A. MCF-7 cells were transfected overnight with wtBTG2 or empty pcDNA3 vector; harvested using trypsin; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using MTT assays. B. T47D cells were transfected overnight with wtBTG2 or empty pcDNA3 vector; trypsinized; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using MTT assay. C.
MCF-7 cells were transfected overnight with wtBTG2 or empty pcDNA3 vector; trypsinized; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using trypan blue dye exclusion assay. D,E. MCF-7 cells were transfected with wtBTG2 or empty pcDNA3 vector; trypsinized; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of paraquat (D) or nickel acetate (E) for 24 h; and assayed for cell viability using MTT assays. Cell viability values are shown as mean ± SEM based on three independent experiments. “*” represents statistically significant differences relative to empty vector transfected cells (p<0.05, two-tailed t-test).
Figure 6F-H. BTG2 protects breast epithelial cells against oxidative stress.
F. 184A1 cells were treated with BTG2 siRNA or CON siRNA; trypsinized; seeded into
96-well dishes; exposed to different concentrations of H2O2 for 24 h; and assayed for sensitivity to H2O2 using MTT assays. G. MCF-10A cells were treated with BTG2 siRNA or CON siRNA; trypsinized; seeded into 96-well dishes; exposed to different concentrations of H2O2 for 24 h; and assayed for sensitivity to H2O2 using MTT assays.
H. MCF-10A cells were transfected overnight with wtBTG2 or empty pcDNA3 vector; trypsinized; seeded into 96-well dishes; exposed to different concentrations of H2O2 for
24 h; and assayed for cell viability using MTT assays. Cell viability values are shown as
67 mean ± SEM based on three independent experiments. “*” represents statistically significant differences relative to empty vector/control siRNA transfected cells (p<0.05).
Figure 6I-J. Western blots confirming the efficacy of cell transfections and siRNA treatments in MCF-10A cells. MCF-10A cells were transfected with the indicated expression vector or treated with the indicated siRNA and harvested for Western blotting to detect BTG2 or β-actin (internal control for loading and transfer).
Figure 7A-D. BTG2 up-regulates expression of antioxidant enzymes in breast cancer cells. A,B. MCF-7 cells were transiently transfected overnight with wtBTG2 or empty pcDNA3 vector; post-incubated for 24 h to allow gene expression; harvested and subjected to semi-quantitative RT-PCR (A) or western blot (B) analysis. C,D. T47D cells were transiently transfected overnight with wtBTG2 or empty pcDNA3 vector; post- incubated for 24 h to allow gene expression; harvested and subjected to semi-quantitative
RT-PCR (C) or western blot (D) analysis. Data shown are representative of at least three independent experiments.
Figure 7E-F. BTG2 up-regulates expression of antioxidant enzymes in breast epithelial cells. E,F. 184A1 cells were treated with BTG2 siRNA or CON siRNA and harvested for semi-quantitative RT-PCR (E) or western blotting (F) analysis. Data shown are representative of three independent experiments.
Figure 8A-F. Densitometric quantification of RT-PCR and Western blot assays from Figure 7. Panels A and B show quantification of RT-PCR (A) and western blots
(B) of MCF-7 cells transfected with wtBTG2 versus empty pcDNA3 vector. Panels C and D show quantification of RT-PCR (C) and western blots (D) of T47D cells transfected with wtBTG2 versus empty pcDNA3 vector. Panels E and F show quantification of RT-PCR (C) and western blots (D) of 184A1 cells treated with BTG2-
68 siRNA or CON siRNA. Values plotted are mean ± SEM of three independent experiments and are further normalized to β-actin and expressed as fold changes relative to the control value. “*” represents statistically significant differences relative to empty vector/control siRNA transfected cells (p<0.05).
Figure 9A-F. BTG2 regulates antioxidant enzyme activity in breast cancer cells. A-
C. MCF-7 cells were transfected overnight wtBTG2 or pcDNA3 vector; post-incubated for 24 h to allow gene expression; harvested and assayed to determine catalase (A) or total SOD (B) or total GPx (C) activity. D-F. T47D cells were transfected overnight wtBTG2 or pcDNA3 vector; post-incubated for 24 h to allow gene expression; harvested and assayed to determine catalase (D) or total SOD (E) or total GPx (F) activity. Values, expressed as fold changes and are mean ± SEM of three independent experiments.
*p<0.05.
Figure 9G-H. BTG2 regulates antioxidant enzyme activity in breast epithelial cells.
G-H184A1 cells were treated with BTG2 siRNA or CON siRNA and assayed to determine catalase (G) or SOD (H) activity. Values shown are expressed as fold changes and are mean ± SEM of three independent experiments. *p<0.05.
Figure 10A-C. BTG2-mediated protection against oxidative stress is NFE2L2 dependent. MCF-7 cells were transiently transfected with the indicated combination expression vectors (A) overnight; trypsinized next day; seeded into 96-well dishes; exposed to different concentrations of H2O2 for 24 h; and assayed for sensitivity to H2O2 using MTT assays. T47D cells were similarly transfected with the indicated combination expression vectors (B) overnight; trypsinized next day; seeded into 96-well dishes; exposed to different concentrations of H2O2 for 24 h; and assayed for sensitivity to H2O2
69 using MTT assays. MCF-7 cells were transiently transfected with the combination of siRNA and indicated expression vectors (C) overnight; trypsinized; seeded into 96-well dishes; exposed to different concentrations of H2O2 for 24 h; and assayed for sensitivity to H2O2 using MTT assays. Cell viability values are shown as mean ± SEM based on three independent experiments. “*” represents statistically significant differences relative to empty vector/control siRNA transfected cells (p<0.05).
Figure 11A-E. Western blots confirming the efficacy of cell transfections and siRNA treatments in breast cancer cells. A,B MCF-7 cells were transfected with the indicated expression vector and harvested for western blotting to detect BTG2 or NFE2L2 or β- actin (as a control). C,D T47D cells were transfected with the indicated expression vector and harvested for western blotting to detect BTG2 or NFE2L2 or β-actin (as a control). E
MCF-7 cells were treated with the NFE2L2 siRNA and harvested for Western blotting to detect NFE2L2 or β-actin (as a control).
Figure 12A-B. BTG2 mediated antioxidant stimulation needs functional NFE2L2.
MCF-7 cells were co-transfected overnight with the indicated expression vectors; post- incubated for 24 h to allow gene expression; and harvested for western blotting. Panel
(A) shows the western blot for major antioxidant proteins; catalase, SOD1 and SOD2 as well as NEF2L2 and BTG2. β-actin was used as a loading control. Panel (B) shows densitometric quantification of Western blot assay for panel A. Data shown are representative of at least three independent experiments. Values plotted are normalized to
β-actin and expressed as fold changes relative to the control value as mean ± SEM of three independent experiments. *p<0.05.
70 Figure 12C-D. BTG2 mediated antioxidant stimulation needs functional NFE2L2.
MCF-7 cells were treated with the indicated siRNA and transfected with the indicated expression vectors for an overnight; post-incubated for 24 h to allow gene expression; and harvested for western blotting. Panel (C) shows the western blot for major antioxidant proteins; catalase, SOD1 and SOD2 as well as NEF2L2 and BTG2. β-actin was used as a loading control. Panel (D) shows densitometric quantification of western blot assay for panel C. Data shown are representative of at least three independent experiments. Values plotted are normalized to β-actin and expressed as fold changes relative to the control value as mean ± SEM of three independent experiments. *p<0.05.
Figure 13A-B. NFE2L2 is required for basal and BTG2-stimulated antioxidant enzyme activity. MCF-7 cells were transfected with the indicated vector(s) and assayed for catalase (A) or SOD (B) enzymatic activity. The total transfected DNA content was maintained constant by transfection of empty pcDNA3 vector. Values are plotted as fold changes relative to the vehicle-treated controls and are mean ± SEM based on three independent experiments. *p<0.05.
Figure 14A-B. BTG2 regulates cellular redox state. A. MCF-7 cells were transfected as indicated; exposed to different concentrations of H2O2, as indicated, for 24 h; and assayed for reduced (GSH) and oxidized (GSSG) glutathione. B. T47D cells were transfected as indicated; exposed to different concentrations of H2O2, as indicated, for 24 h; and assayed for reduced (GSH) and oxidized (GSSG) glutathione. Values are plotted as fold changes relative to the vehicle-treated controls and are mean ± SEM of three independent experiments. *p< 0.05.
71 Figure 15A-D. BTG2 regulates NFE2L2-ARE signaling in breast cells. A,B MCF-7 cells were co-transfected with NQO1-ARE-Luc reporter and the indicated expression vector(s); post-incubated for 24 h for gene expression; and harvested for luciferase assays. C,D T47D cells were co-transfected with NQO1-ARE-Luc reporter and the indicated expression vector(s); post-incubated for 24 h; and harvested for luciferase assays. The total transfected DNA content was kept constant by transfecting additional empty pcDNA3 vector. Luciferase values were expressed as fold changes relative to cells transfected with reporter only, as mean ± SEM of three independent experiments. As a negative control, a control reporter (pGL3-Luc) was transfected. *p<0.05. β-galactosidase was included in each reaction to monitor transfection efficiency.
Figure 16A-D. BTG2 physically associates with NFE2L2 in vivo. Subconfluent proliferating MCF-7 cells were transfected with FLAG-BTG2 or empty pCMV6-FLAG vector (as indicated); post-incubated for 24 h to allow gene expression; and subjected to anti-FLAG IP (A) or anti-NFE2L2 IP (B). T47D cells were transfected with FLAG-
BTG2 or empty pCMV6-FLAG vector; post-incubated for 24 h; and subjected to anti-
FLAG (C) or anti-NFE2L2 (D) IP. Precipitated proteins were western blotted using anti-
FLAG or anti-NFE2L2 antibody. As a negative control, IPs were performed using the appropriate non-immune IgG. The input lanes correspond to 10% of the protein utilized for IP. The data shown are representative of three independent experiments.
Figure 17. Schematics showing the primary structure of HA-tagged wtBTG2 as well as three deletion mutants; HA-BTG2 ∆A, HA-BTG2 ∆B and HA-BTG2 ∆C used for the domain mapping studies.
72 Figure 18A-D. Box B of BTG2 facilitates physical interaction between BTG2 and
NFE2L2. MCF-7 cells were transfected overnight with wt-HA-BTG2 or HA-BTG2 ∆A or HA-BTG2 ∆B or HA-BTG2 ∆C or empty pCMV vector; post-incubated for 24 h; harvested and subjected to anti-HA (A-D) IP. Precipitated proteins were western blotted using anti-HA or anti-NFE2L2 antibody. As a negative control, IPs were performed using the appropriate non-immune IgG. Input lanes correspond to 10% of the total protein used for IP. Blots shown here are representative of three independent experiments.
Figure 19A. Box B of BTG2 is required for BTG2-mediated protection against oxidative stress. MCF-7 cells were transiently transfected with empty pCMV vector or wt-HA-BTG2 or HA-BTG2 ∆A or HA-BTG2 ∆B or HA-BTG2 ∆C; trypsinized and then seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using MTT (A). Values plotted are mean ± SEM of three experiments. *p<0.05.
Figure 20A-B. Box B of BTG2 is necessary for BTG2-mediated stimulation of antioxidant response. MCF-7 cells were transfected overnight with an empty pCMV vector or wt-HA-BTG2 or HA-BTG2 ∆A or HA-BTG2 ∆B or HA-BTG2 ∆C; post- incubated for 24 h to allow gene expression; and harvested for western blotting. Panel
(A) shows the western blot for major antioxidant proteins; catalase, SOD1 and SOD2 as well as BTG2. β-actin was used as a loading control. Panel (B) shows densitometric quantification of western blot assay for panel A. Values plotted are normalized to β-actin and expressed as fold changes relative to the empty vector-transfected value as mean ±
SEM of three independent experiments. *p<0.05.
73 Figure 21A-D. BTG2 is physically present at the antioxidant response element
(ARE) in breast tumor cells. A. Untransfected MCF-7 cells were subjected to ChIP assays using anti-NFE2L2 antibody or non-immune rabbit IgG (negative control). The
PCR primers correspond to two different AREs (E1 and E2) of the HO-1 gene, HO-1 exon 3 (negative control), an ARE from the NQO1 gene promoter (NQO1 pr), and NQO1 exon 2 (negative control). B. MCF-7 cells were transfected with FLAG-BTG2 or empty pCMV6-FLAG vector; post incubated for 24 h to allow gene expression; harvested for
ChIP assays using anti-FLAG or non-immune mouse IgG (negative control). C.
Untransfected T47D cells were subjected to chromatin immunoprecipitation (ChIP) assays using anti-NFE2L2 antibody or non-immune rabbit IgG (negative control). D.
T47D cells were transfected with FLAG-BTG2 or empty pCMV6-FLAG vector (as indicated); post incubated for 24 h to allow gene expression; harvested for and ChIP assays performed using anti-FLAG or non immune mouse IgG (negative control). The data shown are representative of three independent experiments.
Figure 22A-C. Exposure to oxidative stress increases exogenous BTG2 recruitment at the antioxidant response element (ARE) in MCF-7 cells. MCF-7 cells were transfected with FLAG-BTG2; post incubated for 24 h to allow gene expression; exposed to H2O2 (250 nM) for the indicated time points; and harvested for ChIP assays. Panel A shows 10 % of total input DNA; while panels B and C show ChIP assays using anti-
FLAG (B) or anti-NFE2L2 (C) antibody. The data are representative of three independent experiments.
Figure 22D-F. Exposure to oxidative stress increases endogenous BTG2 recruitment at the antioxidant response element (ARE) in MCF-10A cells. Untransfected MCF-
10A cells were either exposed to H2O2 (250 nM) for the indicated time points; and harvested for ChIP assays. Panel A shows 10 % of input DNA used in the reaction; while
74 panels B and C show ChIP assays using anti-BTG2 (B) or anti-NFE2L2 (C) antibody.
These data are representative of three independent experiments.
Figure 23A-B. BTG2 induces growth arrest of H2O2-treated breast cells. A. MCF-7 cells were transfected with wtBTG2 or empty pcDNA3 vector and treated with different concentrations of H2O2 for 24 h, with exposure to BrdU during the final 12 h of H2O2 treatment. The percent of growth inhibition was plotted as means ± SEM of three independent experiments. B. MCF-10A cells were treated with BTG2 siRNA or CON- siRNA and then exposed to different concentrations of H2O2 for 24 h, with exposure to
BrdU during the final 12 h of H2O2 treatment. The percent of growth inhibition was plotted as mean ± SEM of three independent experiments. “*” represents statistically significant (p<0.05) differences relative to empty vector/control siRNA transfected cells.
Figure 24A-D. BTG2 is anti-apoptotic in H2O2-treated MCF-7 cells. A,B. MCF-7 cells were transfected with wtBTG2 or pcDNA3 vector; treated without (A) or with (B)
H2O2 (500 nM) for 24 h; harvested, fixed in 70% ethanol followed by staining of cell nuclei with propidium iodide for cell cycle analysis by flow cytometry. The values plotted represent mean ± SEM based of three independent experiments. C,D.
Representative flow cytometry histograms for MCF-7 cells corresponding to A-B.
75 3.E. Figures
Figure 6A-E: BTG2 protects breast cancer cells against oxidative stress.
76 Figure 6F-H: BTG2 protects breast epithelial cells against oxidative stress.
77 Figure 6I-J: Western blots confirming the efficacy of cell transfections and siRNA treatments in MCF-10A cells.
78 Figure 7A-D: BTG2 up-regulates expression of antioxidant enzymes in breast cancer cells.
79 Figure 7E-F: BTG2 up-regulates expression of antioxidant enzymes in breast epithelial cells.
80 Figure 8A-F: Densitometric quantification of RT-PCR and Western blot assays from Figure 6.
81 Figure 8A-F: Densitometric quantification of RT-PCR and Western blot assays from Figure 6.
82 Figure 8A-F: Densitometric quantification of RT-PCR and Western blot assays from Figure 6.
83 Figure 9A-F: BTG2 regulates antioxidant enzyme activity in breast cancer cells.
84 Figure 9G-H: BTG2 regulates antioxidant enzyme activity in breast epithelial cells.
85 Figure 10A-C: BTG2-mediated protection against oxidative stress is NFE2L2 dependent.
86 Figure 11A-E: Western blots confirming the efficacy of cell transfections and siRNA treatments in breast cancer cells.
87 Figure 12A-B: BTG2 mediated antioxidant stimulation needs functional NFE2L2.
88 Figure 12C-D: BTG2 mediated antioxidant stimulation needs functional NFE2L2.
89 Figure 13A-B: NFE2L2 is required for basal and BTG2-stimulated antioxidant enzyme activity.
90 Figure 14A-B: BTG2 regulates cellular redox state.
91 Figure 15A-B BTG2 regulates NFE2L2-ARE signaling in MCF-7 cells.
92 Figure 15C-D BTG2 regulates NFE2L2-ARE signaling in T47D cells.
93 Figure 16A-D BTG2 physically associates with NFE2L2 in vivo.
94 Figure 17: Schematics showing the primary structure of HA-tagged wtBTG2 as well as three deletion mutants; HA-BTG2 ∆A, HA-BTG2 ∆B and HA-BTG2 ∆C used for the domain mapping studies.
95 Figure 18A-D: Box B of BTG2 facilitates physical interaction between BTG2 and NFE2L2.
96 Figure 19: Box B of BTG2 is required for BTG2-mediated protection against oxidative stress.
97 Figure 20A-B: Box B of BTG2 is necessary for BTG2-mediated stimulation of antioxidant response.
98 Figure 21A-D: BTG2 is physically present at the antioxidant response element (ARE) in breast tumor cells.
99 Figure 22A-C: Exposure to oxidative stress increases BTG2 recruitment at the antioxidant response element (ARE) in MCF-7 cells.
100 Figure 22D-F: Exposure to oxidative stress increases endogenous BTG2 recruitment at the antioxidant response element (ARE) in MCF-10A cells.
101 Figure 23A-B: BTG2 induces growth arrest of H2O2 treated breast cells.
102 Figure 24A-B: BTG2 is anti-apoptotic in H2O2 treated MCF-7 cells.
103 Figure 24C-D: BTG2 is anti-apoptotic in H2O2-treated MCF-7 cells.
104
Chapter IV
105 4.A Abstract
In the previous aim, I showed that BTG2 mediates a protective antioxidant response against oxidative stress in human breast cells by serving as a co-activator of antioxidant transcription factor, NFE2L2. The Rosen lab previously showed that endogenous as well as exogenous BRCA1 are capable of achieving similar antioxidant stimulatory effects by a transcriptionally regulating NFE2L2-ARE pathway. The objective of this work was to determine if the BRCA1 acts as an intermediary in BTG2-mediated antioxidant response, specifically in activating the NFE2L2-ARE pathway. Here, I will test the ability of
BRCA1 to stimulate antioxidant gene expression is dependent on endogenous BTG2 and vice versa. If my results indicate BRCA1 depends on BTG2 for activating antioxidant response or vice versa, I will further investigate the physical association, if any, that may exist between these two proteins followed by mapping of the interacting domains. These studies will further our knowledge of how two tumor suppressor proteins may work in cooperation to protect breast cells from harmful effects of oxidative stress.
The work presented in Chapter IV is published as: Karve T. M., and Rosen E. M. 2012.
B-cell translocation gene 2 (BTG2) stimulates cellular antioxidant defenses through the antioxidant transcription factor NFE2L2 in human mammary epithelial cells. Journal of
Biological Chemistry (Accepted for publication).
106 4.B. Results
4.B.1 BTG2 mediated protection against H2O2 is BRCA1-independent.
Rosen lab previously showed that BRCA1 mediates protective effects in response to oxidative stress in various cell types, including breast cells [33]. Hence, I tested if the effects mediated by BTG2 may be attributable to endogenous BRCA1 intervention. As shown earlier, MCF-7 and T47D cells treated with BRCA1 siRNA alone significantly
(p<0.05) reduced cell survival when compared to CON siRNA treated cells or untreated cells. The cell survivability of BRCA-siRNA treated cells was further reduced upon exposure to range of H2O2 doses, also shown previously [162]. However, upon the introduction of wtBTG2 in these BRCA1 siRNA treated MCF-7 or T47D cells, there was a significant (p<0.05) increase in cell survival at all tested doses of H2O2 (Fig. 25A-B).
Western blots shown in Fig.26A-D confirm BRCA1 knockdown and BTG2 overexpression in MCF-7 and T47D cells. These results demonstrate that BRCA1 siRNA treated MCF-7 cells or T47D cells can be rescued from the detrimental effects due to down-regulation of BRCA1 even upon exposure to various doses of H2O2.
In addition, wtBTG2 showed similar protective effect in HCC1937 cells, a breast cancer cell line with a point mutation (5382insC) in a single BRCA1 allele [163], when treated with various doses of H2O2 (Fig 25C). These results suggest the BTG2–mediated cytoprotection against H2O2 induced oxidative stress is BRCA1-independent in breast cancer cells.
107 4.B.2. BTG2 stimulated antioxidant response is BRCA1 independent.
Since I detected that BTG2-mediated protection against oxidative stress is independent of cellular BRCA1 status, I further tested if BTG2 may be able to stimulate antioxidant response in the absence of BRCA1. As shown in Fig. 27A-B, I used MCF-7 cell lysates that were treated with BRCA1 siRNA and then simultaneously transiently transfected with wtBTG2 to assay for catalase activity as well as total SOD activity. My results show that BTG2 was able to significantly (p<0.05) stimulate the enzyme activity of catalase and total SOD, as shown before, and the activity levels were unchanged even in cells that were simultaneously treated with BRCA1 siRNA and transiently transfected with BTG2. Similar results were observed in T47D cells that were simultaneously treated with BRCA1 siRNA and transfected with wtBTG2 (Fig. 27C-D). These results suggest that BTG2 stimulates antioxidant response irrespective of endogenous BRCA1 status in these cells.
Similarly, I also checked the expression for catalase and SOD1 and SOD2 in
HCC1937 that were transfected with wtBTG2. As shown in Fig. 28A, HCC1937 cells transfected with BTG2 showed stimulation in expression of catalase, SOD1 and SOD2 when compared to cells transfected with empty pcDNA3 vector transfected or untreated cells. Densitometry results shown in Fig. 28B indicate that this stimulation in expression of catalase, SOD1 and SOD2 was significant (p<0.05) based on three independent experiments. β-actin was used as a transfer and loading control. Furthermore, I determined the enzyme activity of catalase and total SOD using cell lysates of HCC1937 cells transiently transfected with wtBTG2 (Fig. 28C-D). Consistent with the antioxidant protein expression pattern, HCC1937 cells transfected with wtBTG2 showed significant
108 (p<0.05) increase in catalase (Fig. 27C) activity as well as total SOD (Fig. 28D) activity when compared to cells that were treated with pcDNA3 or untreated cells. These results suggest exogenous BTG2 can stimulate antioxidant response in breast cancer cells lacking functional BRCA1.
109 4.C. Discussion
In this aim, I explored the possibility that BRCA1, a known tumor suppressor gene in breast cancer, might act as an intermediary in BTG2-mediated antioxidant response in human breast cells. Here I used various breast tumor cell lines to test this hypothesis. I used two breast cancer cell lines; MCF-7 and T47D, which express abundant functional BRCA1 but do not express detectable levels of BTG2 [110]. In addition, I also used a BRCA1 mutant cell line HCC1937, which has a point mutation
(5382insC) in a single BRCA1 allele and thus synthesizes a non-functional endogenous
BRCA1 [163]. Also, HCC1937 lacks any detectable endogenous BTG2 expression (Fig.
28A). Furthermore, our laboratory has previously shown that upon exposure to oxidative stress MCF-7 and T47D are able to activate NFE2L2-ARE signaling via BRCA1- modulated transcriptional regulation [33].
A recently published study from the Rosen lab utilizing MCF-7 and T47D cell lines, both of the cell lines that lack BTG2, showed that BRCA1 can activate several antioxidant proteins such as catalase, SOD1 and SOD2 upon exposure to H2O2 induced oxidative stress along with other DNA damage repair proteins such as OGG1, NTH1, etc
[162]. These results suggest that BRCA1 stimulates the expression and activity of several antioxidant and DNA repair proteins as a cytoprotective response against oxidative stress.
Further, this study suggested that the activation of these proteins by BRCA1 is dependent on the presence of octamer-binding transcription factor 1, OCT1. Previous studies found that BRCA1 interacts with OCT1 [164], and thus the ability of BRCA1 to stimulate the base excision repair (BER) enzymes for DNA repair in this study [162] is suggestive of
110 the role of BRCA1 as a co-activator of transcription factor OCT1, thereby activating
OCT1 gene expression.
In the present study, I overexpressed BTG2 to test the effects on cellular antioxidant response. As shown in the previous chapter, overexpression of BTG2 in
MCF-7 and T47D cells stimulated expression of catalase, SOD1 and SOD2. To rule out that this induction may have been due to BRCA1 mediated pathways, I treated these cells with BRCA1 siRNA and simultaneously expressed wtBTG2 in these cells. I found similar antioxidant protein induction effects in cells treated with BRCA1 siRNA and transfected with wtBTG2. In addition, I used a cell line, HCC1937, that does not have a detectable level of BTG2 and has a non-functional BRCA1 to rule out any artifact that may be attributable to a cell line or gene expression manipulation technique. I found similar results; stimulation of antioxidant protein expression upon introduction of wtBTG2 in HCC1937 cells. Thus, even though BRCA1 is shown to interact with other tumor suppressor proteins such as p53 and act as a co-factor to mediate growth inhibition, a tumor suppressive function, I was unable to detect such a role for BRCA1 in BTG2- mediated antioxidant response [31].
Since results from my current study as well as previously published findings from the Rosen laboratory [162] were unable to identify any role for BRCA1 in BTG2- mediated antioxidant response, I did not pursue the interaction or domain mapping studies with regards to BRCA1 and BTG2 at this point. Thus, the findings in this aim confirm the role of BRCA1 as well as BTG2 as antioxidant stimulators in response to oxidative stress; these two tumor suppressors mediate such a response through independent mechanisms.
111 4.D Acknowledgements: The work presented in Chapter III and IV was supported, in part, by USPHS grants RO1-CA80000, RO1-CA104546 and RO1-CA150646 (to EMR)
112 4.E. Figure legends
Figure 25A-C. BTG2-mediated protection against oxidative stress is BRCA1 independent. A. MCF-7 cells were transfected with the indicated combination of siRNA plus expression vector for an overnight; trypsinized; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using MTT assays. B. T47D cells were transfected with the indicated combination of siRNA plus expression vector for an overnight; trypsinized; seeded into
96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using MTT assays. C. HCC1937 cells were transfected with wtBTG2 or empty pcDNA3 vector for overnight; trypsinized; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H2O2 for 24 h; and assayed for cell viability using MTT assays. Cell viability values are shown as mean ± SEM based on three independent experiments. “*” represents statistically significant differences relative to empty vector/ CON siRNA transfected cells (p<0.05).
Figure 26A-D. Western blots confirming the efficacy of cell transfections and siRNA treatments in MCF-7 and T47D cells. MCF-7 (A,B) or T47D (C,D) cells were transfected with the indicated expression vector or treated with the indicated siRNA and harvested for western blotting to detect BTG2, BRCA1 or β-actin (internal control for loading and transfer).
Figure 27A-D. BTG2-mediated antioxidant enzyme activity is unaffected by cellular
BRCA1 status. Subconfluent proliferating MCF-7 (A,B) or T47D (C,D) cells were treated with BRCA1 siRNA or CON siRNA; then transfected with wtBTG2 or empty pcDNA3 vector; post-incubated for 24 h to allow gene expression; and assayed for
113 catalase (A,C) or total SOD (B,D) activity. Values plotted as fold changes relative ot control value and are mean ± SEM of three independent experiments. * p<0.05.
Figure 28A-D. BTG2 over-expression stimulates antioxidant protein expression in
BRCA1-deficient HCC1937 human breast cancer cells. HCC1937 cells were transient transfected overnight with wtBTG2 or empty pcDNA3 vector; post-incubated for 24 h to allow gene expression; and subjected to western blotting. Panel A shows a western blots for BTG2, catalase, SOD1, SOD2, BRCA1 and β-Actin. Panel B shows densitometric quantification of western blots from three independent experiments. Values plotted are normalized to β-actin and expressed as fold changes relative to the control value as mean
± SEM. Panel C and D shows assays of catalase (C) and total SOD (D) enzyme activity.
Values are expressed as the fold changes relative to the vehicle control and plotted as mean ± SEM of three independent experiments. *p<0.05.
114 4.F Figures
Figure 25A-C: BTG2-mediated protection against oxidative stress is BRCA1 independent.
115 Figure 26A-D: Western blots confirming the efficacy of cell transfections and siRNA treatments in MCF-7 and T47D cells.
116 Figure 27A-D: BTG2-mediated antioxidant enzyme activity is unaffected by cellular BRCA1 status.
117 Figure 28A-B: BTG2 over-expression stimulates antioxidant protein expression in BRCA1-deficient HCC1937 human breast cancer cells.
118
CHAPTER V
119 5.A Conclusions and future directions
The findings presented in this thesis further enhance our understanding of the role of BTG2 in human breast epithelial cells, tumor as well as normal breast cells, and defines a mechanism of action that explains the cytoprotective effects mediated by
BTG2, highlighting the tumor suppressive properties of this protein in human breast cancer [165]. The data presented in chapter III and IV provide insights into the tumor suppressive role of BTG2 in the context of oxidative stress in breast cancer, and further strengthens the possibility of using BTG2 as a prognostic marker for breast cancer.
The first specific aim demonstrated that BTG2 protects against oxidative stress and improves cell survival in various types of human breast epithelial cells irrespective of the oxidant used to induce the stress. Further, I showed that this protective effect is partly mediated by induction in expression as well as activity of several major antioxidant proteins such as catalase, SOD1 and SOD2. Finally, I was able to show that these protective effects are a result of BTG2-NFE2L2 interaction, wherein BTG2 acts as a co- activator of antioxidant transcription factor, NFE2L2 modulating antioxidant gene expression upon exposure to oxidative stress. This antioxidant stimulatory role of BTG2 was confirmed by using ectopic BTG2 expression vectors as well as endogenous BTG2 in human breast epithelial cells.
Considering the detailed in vitro BTG2-NFE2L2 relationship and the protective antioxidant effects mediated by this interaction mapped out in this thesis, it would be interesting to test the correlation of BTG2 expression (loss or down-regulation) and its effects on antioxidant protein expression in a human breast tissue microarray analysis
(TMA), an immediate potential clinical application supporting a possibility that BTG2
120 may serve as a marker in human breast cancer. TMA is a simple laboratory technique discovered in 1998 by Kononen and colleagues is now routinely for biomarker discovery for various types of human cancers [166]. TMA is capable of rapid, standardized, quality- assured and high-throughput profiling of several tumor samples simultaneously with a side-by-side comparison [166-168]. Such an approach facilitates multiple analyses on multiple patients from a single paraffin block, which is made out of core samples from the paraffin-embedded specimens of multiple patients are taken and then transferred to a single multicore paraffin block.
Using human breast TMA, I would specifically detect the expression pattern of
BTG2 (in nucleus and cytoplasm) and correlate it with the expression of antioxidant defenses as manifested by protein nitrosylation (a routinely used marker for oxidative stress) and other NFE2L2 target gene products such as SOD, catalase and NQO1.
Together, if the correlation is established between loss of BTG2 (as shown by several studies, see introduction) and decrease in antioxidant protein expression (as in this thesis) using TMA, these observations may further strengthen the potential of BTG2 as a prognostic marker in human breast cancer.
Given that few studies have implicated potential involvement of BTG2 in DNA damage repair [119] it would be interesting to test the role of BTG2 in DNA repair mechanism(s), especially in base excision repair (BER) pathway, a common pathway for repairing oxidative stress induced DNA adducts [169]. 8-Oxoguanine (also called 8- hydroxyguanine) is one of the most common oxidative stress induced DNA lesion found in the genome [170] and is primarily repaired by the DNA glycosylase OGG1 (8- oxoguanine glycosylase 1) via BER pathway in humans [171]. Further, hOGG1 gene
121 encoding the human OGG1 enzyme was shown to have a single ARE in its promoter region (-47 to -44), which allows inducible regulation of OGG1 by antioxidant transcription factor, NFE2L2 [172, 173]. The data presented in the SA1 of my thesis shows that BTG2 serves as a co-activator of NFE2L2 and stimulates antioxidant response upon exposure to oxidative stress, it may even induce the OGG1 expression, which is shown to increase enzyme activity of OGG1 and promote rapid repair of 8-oxoguanine removal and DNA repair [174]. Such an investigation would further add a novel role of
BTG2 explaining its tumor suppressive functions in mammalian cells.
Since data presented in this thesis shows that the ability of BTG2 to stimulate antioxidant response and protective effects against oxidative stress in human breast epithelial cells are dependent on functional NFE2L2 in these cells; NFE2L2 is a known target for several chemopreventive agents (see introduction), it would be interesting to test the role of BTG2 as a target for these chemopreventive agents. It remains to be seen if these chemopreventive agents (e.g., DIM) may be able to stimulate BTG2 expression as a potential mechanism to stimulate NFE2L2 activity, which raises the possibility that
BTG2 may be a promising molecular target with therapeutic implications in breast as well as several other human cancers.
Apart from the above-mentioned studies, utilizing BTG2 KO mouse model to understand the stimulation of antioxidant response and DNA damage repair studies may be able to provide crucial information about physiological role of BTG2 in vivo. BTG2
KO mice showed minor defects in vertebral patterning, however did not show any life threatening physical deformities or increased predisposition towards developing any type of cancer under normal conditions (see introduction). However, there has been no study
122 to date examining the effects of exposure to oxidative stress in these animals and if such a stress may increase their predisposition towards developing tumors or promote other debilitating disorders. It would be interesting to test the effects of loss of BTG2 and physiological response of these animals to chemically induced (e.g., using nickel acetate,
DMBA etc.) oxidative stress.
Finally, it would be interesting to test the role of BTG1, another closely related member of the BTG/TOB family exhibiting ~ 70% homology with BTG2, in human breast cancer. It would be interesting to examine if BTG1, which is not completely lost in breast cancer, may be able to compensate for the loss of BTG2 in human breast tissue and
BTG2 KO mouse models and protect these cells/ animals from oxidative stress and stimulate antioxidant response.
In the second part of this thesis, I provide evidence that the BTG2-mediated antioxidant response is independent of cellular BRCA1 status but requires functional antioxidant transcription factor, NFE2L2. This observation is noteworthy since previous studies from the Rosen laboratory showed that BRCA1 stimulates similar antioxidant responses upon exposure to oxidative stress. Nevertheless, I do not rule out other possible NFE2L2-independent mechanism(s) for BTG2-mediated antioxidant response in breast epithelial cells.
In conclusion, the information provided in this comprehensive research report contributes to a better understanding of tumor suppressive properties of BTG2 in breast cancer and quite possibly may be significant in developing targeted treatments for breast cancer.
123
Chapter VI
124 References Cited:
1. Center for Disease Control and Prevention. United States Cancer Statistics (USCS) : Cancer among women. 2008 16 April 2012 [cited 2012 26 April]; Available from: http://www.cdc.gov/cancer/breast/statistics/. 2. World Health Organization. The Globocan Project: Cancer Incidence, Mortality and Prevalence Worldwide 2008. 2008 2010 [cited 2012 26 April ]; Available from: http://globocan.iarc.fr/factsheets/populations/factsheet.asp?uno=900. 3. Centers for Disease Control and Prevention and National Cancer Institute. United States Cancer Statistics: 1999–2007 Incidence and Mortality Web-based Report. 2010 2010 [cited 2012 26 April ]; Available from: www.cdc.gov/uscs. 4. National Committee for Quality Assurance. Breast cancer screening. In: The State of Health Care Quality 2007. Washington: NCQA; 2007. 2008 [cited 2012 26 April]; Available from: http://www.businessgrouphealth.org/healthtopics/breast_cancer.cfm. 5. Stokes, M.E., D. Thompson, E.L. Montoya, M.C. Weinstein, E.P. Winer, and C.C. Earle, Ten-year survival and cost following breast cancer recurrence: estimates from SEER-medicare data. Value Health, 2008. 11(2): p. 213-20. 6. Ravdin, P.M., K.A. Cronin, N. Howlader, C.D. Berg, R.T. Chlebowski, E.J. Feuer, B.K. Edwards, and D.A. Berry, The decrease in breast-cancer incidence in 2003 in the United States. N Engl J Med, 2007. 356(16): p. 1670-4. 7. Hulka, B.S. and P.G. Moorman, Breast cancer: hormones and other risk factors. Maturitas, 2008. 61(1-2): p. 203-13; discussion 213. 8. American Cancer Society. What causes cancer? 2012 2012 [cited 2012 26 April]; Available from: www.cancer.org. 9. Miki, Y., J. Swensen, D. Shattuck-Eidens, P.A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L.M. Bennett, W. Ding, and et al., A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 1994. 266(5182): p. 66-71. 10. Wooster, R., G. Bignell, J. Lancaster, S. Swift, S. Seal, J. Mangion, N. Collins, S. Gregory, C. Gumbs, and G. Micklem, Identification of the breast cancer susceptibility gene BRCA2. Nature, 1995. 378(6559): p. 789-92. 11. Kaelin, W.G., Jr., D.C. Pallas, J.A. DeCaprio, F.J. Kaye, and D.M. Livingston, Identification of cellular proteins that can interact specifically with the T/E1A- binding region of the retinoblastoma gene product. Cell, 1991. 64(3): p. 521-32. 12. Foulds, L., The natural history of cancer. J Chronic Dis, 1958. 8(1): p. 2-37. 13. Land, H., L.F. Parada, and R.A. Weinberg, Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature, 1983. 304(5927): p. 596-602. 14. Newbold, R.F. and R.W. Overell, Fibroblast immortality is a prerequisite for transformation by EJ c-Ha-ras oncogene. Nature, 1983. 304(5927): p. 648-51. 15. Knudson, A.G., Jr., Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A, 1971. 68(4): p. 820-3. 16. R., F.E., The Metabolic & Molecular Bases of Inherited Diseases. 8th ed, ed. B. Scriver, Valle, Sly, Childs, Kinzler-Vogeltein. Vol. 1. 2001.
125 17. Ephrussi, B., R.L. Davidson, M.C. Weiss, H. Harris, and G. Klein, Malignancy of somatic cell hybrids. Nature, 1969. 224(5226): p. 1314-6. 18. Harris, H., The analysis of malignancy by cell fusion: the position in 1988. Cancer Res, 1988. 48(12): p. 3302-6. 19. Stanbridge, E.J., C.J. Der, C.J. Doersen, R.Y. Nishimi, D.M. Peehl, B.E. Weissman, and J.E. Wilkinson, Human cell hybrids: analysis of transformation and tumorigenicity. Science, 1982. 215(4530): p. 252-9. 20. Saxon, P.J., E.S. Srivatsan, and E.J. Stanbridge, Introduction of human chromosome 11 via microcell transfer controls tumorigenic expression of HeLa cells. EMBO J, 1986. 5(13): p. 3461-6. 21. Weissman, B.E., P.J. Saxon, S.R. Pasquale, G.R. Jones, A.G. Geiser, and E.J. Stanbridge, Introduction of a normal human chromosome 11 into a Wilms' tumor cell line controls its tumorigenic expression. Science, 1987. 236(4798): p. 175-80. 22. National Institutes of Health. 27 Feburary 2012 [cited 2012 26 April]; Available from: http://www.genome.gov/10000507. 23. van der Groep, P., E. van der Wall, and P.J. van Diest, Pathology of hereditary breast cancer. Cell Oncol (Dordr), 2011. 34(2): p. 71-88. 24. Hall, J.M., M.K. Lee, B. Newman, J.E. Morrow, L.A. Anderson, B. Huey, and M.C. King, Linkage of early-onset familial breast cancer to chromosome 17q21. Science, 1990. 250(4988): p. 1684-9. 25. Wooster, R., S.L. Neuhausen, J. Mangion, Y. Quirk, D. Ford, N. Collins, K. Nguyen, S. Seal, T. Tran, D. Averill, and et al., Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science, 1994. 265(5181): p. 2088-90. 26. Starita, L.M. and J.D. Parvin, The multiple nuclear functions of BRCA1: transcription, ubiquitination and DNA repair. Curr Opin Cell Biol, 2003. 15(3): p. 345-50. 27. Rosen, E.M., S. Fan, and Y. Ma, BRCA1 regulation of transcription. Cancer Lett, 2006. 236(2): p. 175-85. 28. Deng, C.X., Tumor formation in Brca1 conditional mutant mice. Environ Mol Mutagen, 2002. 39(2-3): p. 171-7. 29. Weaver, Z., C. Montagna, X. Xu, T. Howard, M. Gadina, S.G. Brodie, C.X. Deng, and T. Ried, Mammary tumors in mice conditionally mutant for Brca1 exhibit gross genomic instability and centrosome amplification yet display a recurring distribution of genomic imbalances that is similar to human breast cancer. Oncogene, 2002. 21(33): p. 5097-107. 30. Deng, C.X., BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Res, 2006. 34(5): p. 1416-26. 31. Zhang, H., K. Somasundaram, Y. Peng, H. Tian, D. Bi, B.L. Weber, and W.S. El- Deiry, BRCA1 physically associates with p53 and stimulates its transcriptional activity. Oncogene, 1998. 16(13): p. 1713-21. 32. Wang, Q., H. Zhang, K. Kajino, and M.I. Greene, BRCA1 binds c-Myc and inhibits its transcriptional and transforming activity in cells. Oncogene, 1998. 17(15): p. 1939-48.
126 33. Bae, I., S. Fan, Q. Meng, J.K. Rih, H.J. Kim, H.J. Kang, J. Xu, I.D. Goldberg, A.K. Jaiswal, and E.M. Rosen, BRCA1 induces antioxidant gene expression and resistance to oxidative stress. Cancer Res, 2004. 64(21): p. 7893-909. 34. Fan, S., J. Wang, R. Yuan, Y. Ma, Q. Meng, M.R. Erdos, R.G. Pestell, F. Yuan, K.J. Auborn, I.D. Goldberg, and E.M. Rosen, BRCA1 inhibition of estrogen receptor signaling in transfected cells. Science, 1999. 284(5418): p. 1354-6. 35. Zheng, L., L.A. Annab, C.A. Afshari, W.H. Lee, and T.G. Boyer, BRCA1 mediates ligand-independent transcriptional repression of the estrogen receptor. Proc Natl Acad Sci U S A, 2001. 98(17): p. 9587-92. 36. Harman, D., Aging: a theory based on free radical and radiation chemistry. J Gerontol, 1956. 11(3): p. 298-300. 37. Raha, S. and B.H. Robinson, Mitochondria, oxygen free radicals, disease and ageing. Trends Biochem Sci, 2000. 25(10): p. 502-8. 38. Kang, D.H., Oxidative stress, DNA damage, and breast cancer. AACN Clin Issues, 2002. 13(4): p. 540-9. 39. Muller, F.L., M.S. Lustgarten, Y. Jang, A. Richardson, and H. Van Remmen, Trends in oxidative aging theories. Free Radic Biol Med, 2007. 43(4): p. 477-503. 40. Gago-Dominguez, M., X. Jiang, and J.E. Castelao, Lipid peroxidation, oxidative stress genes and dietary factors in breast cancer protection: a hypothesis. Breast Cancer Res, 2007. 9(1): p. 201. 41. Ambrosone, C.B., Oxidants and antioxidants in breast cancer. Antioxid Redox Signal, 2000. 2(4): p. 903-17. 42. Lander, H.M., An essential role for free radicals and derived species in signal transduction. FASEB J, 1997. 11(2): p. 118-24. 43. Felty, Q., K.P. Singh, and D. Roy, Estrogen-induced G1/S transition of G0- arrested estrogen-dependent breast cancer cells is regulated by mitochondrial oxidant signaling. Oncogene, 2005. 24(31): p. 4883-93. 44. Oberley, T.D., R.G. Allen, J.L. Schultz, and L.J. Lauchner, Antioxidant enzymes and steroid-induced proliferation of kidney tubular cells. Free Radic Biol Med, 1991. 10(1): p. 79-83. 45. Patel, M.M. and H.K. Bhat, Differential oxidant potential of carcinogenic and weakly carcinogenic estrogens: Involvement of metabolic activation and cytochrome P450. J Biochem Mol Toxicol, 2004. 18(1): p. 37-42. 46. Bhat, H.K., G. Calaf, T.K. Hei, T. Loya, and J.V. Vadgama, Critical role of oxidative stress in estrogen-induced carcinogenesis. Proc Natl Acad Sci U S A, 2003. 100(7): p. 3913-8. 47. Dairkee, S.H., M. Nicolau, A. Sayeed, S. Champion, Y. Ji, D.H. Moore, B. Yong, Z. Meng, and S.S. Jeffrey, Oxidative stress pathways highlighted in tumor cell immortalization: association with breast cancer outcome. Oncogene, 2007. 26(43): p. 6269-79. 48. Beckman, K.B. and B.N. Ames, The free radical theory of aging matures. Physiol Rev, 1998. 78(2): p. 547-81. 49. Moghaddam, A., H.T. Zhang, T.P. Fan, D.E. Hu, V.C. Lees, H. Turley, S.B. Fox, K.C. Gatter, A.L. Harris, and R. Bicknell, Thymidine phosphorylase is angiogenic and promotes tumor growth. Proc Natl Acad Sci U S A, 1995. 92(4): p. 998-1002.
127 50. Blackburn, R.V., D.R. Spitz, X. Liu, S.S. Galoforo, J.E. Sim, L.A. Ridnour, J.C. Chen, B.H. Davis, P.M. Corry, and Y.J. Lee, Metabolic oxidative stress activates signal transduction and gene expression during glucose deprivation in human tumor cells. Free Radic Biol Med, 1999. 26(3-4): p. 419-30. 51. Li, C. and R.M. Jackson, Reactive species mechanisms of cellular hypoxia- reoxygenation injury. Am J Physiol Cell Physiol, 2002. 282(2): p. C227-41. 52. Grimshaw, M.J., S. Naylor, and F.R. Balkwill, Endothelin-2 is a hypoxia-induced autocrine survival factor for breast tumor cells. Mol Cancer Ther, 2002. 1(14): p. 1273-81. 53. Grimshaw, M.J., J.L. Wilson, and F.R. Balkwill, Endothelin-2 is a macrophage chemoattractant: implications for macrophage distribution in tumors. Eur J Immunol, 2002. 32(9): p. 2393-400. 54. Echiburu-Chau, C., D. Roy, and G.M. Calaf, Metastatic suppressor CD44 is related with oxidative stress in breast cancer cell lines. Int J Oncol, 2011. 39(6): p. 1481-9. 55. Sotgia, F., U.E. Martinez-Outschoorn, and M.P. Lisanti, Mitochondrial oxidative stress drives tumor progression and metastasis: should we use antioxidants as a key component of cancer treatment and prevention? BMC Med, 2011. 9: p. 62. 56. Yeon, J.Y., Y.J. Suh, S.W. Kim, H.W. Baik, C.J. Sung, H.S. Kim, and M.K. Sung, Evaluation of dietary factors in relation to the biomarkers of oxidative stress and inflammation in breast cancer risk. Nutrition, 2011. 27(9): p. 912-8. 57. Vera-Ramirez, L., P. Sanchez-Rovira, M.C. Ramirez-Tortosa, C.L. Ramirez- Tortosa, S. Granados-Principal, J.A. Lorente, and J.L. Quiles, Free radicals in breast carcinogenesis, breast cancer progression and cancer stem cells. Biological bases to develop oxidative-based therapies. Crit Rev Oncol Hematol, 2011. 80(3): p. 347-68. 58. Brown, N.S. and R. Bicknell, Hypoxia and oxidative stress in breast cancer. Oxidative stress: its effects on the growth, metastatic potential and response to therapy of breast cancer. Breast Cancer Res, 2001. 3(5): p. 323-7. 59. Church, S.L., J.W. Grant, L.A. Ridnour, L.W. Oberley, P.E. Swanson, P.S. Meltzer, and J.M. Trent, Increased manganese superoxide dismutase expression suppresses the malignant phenotype of human melanoma cells. Proc Natl Acad Sci U S A, 1993. 90(7): p. 3113-7. 60. Moi, P., K. Chan, I. Asunis, A. Cao, and Y.W. Kan, Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc Natl Acad Sci U S A, 1994. 91(21): p. 9926-30. 61. Chan, J.Y., X.L. Han, and Y.W. Kan, Cloning of Nrf1, an NF-E2-related transcription factor, by genetic selection in yeast. Proc Natl Acad Sci U S A, 1993. 90(23): p. 11371-5. 62. Chan, J.Y., X.L. Han, and Y.W. Kan, Isolation of cDNA encoding the human NF- E2 protein. Proc Natl Acad Sci U S A, 1993. 90(23): p. 11366-70. 63. Kobayashi, A., E. Ito, T. Toki, K. Kogame, S. Takahashi, K. Igarashi, N. Hayashi, and M. Yamamoto, Molecular cloning and functional characterization of a new Cap'n' collar family transcription factor Nrf3. J Biol Chem, 1999. 274(10): p. 6443-52.
128 64. Nguyen, T., P.J. Sherratt, and C.B. Pickett, Regulatory mechanisms controlling gene expression mediated by the antioxidant response element. Annu Rev Pharmacol Toxicol, 2003. 43: p. 233-60. 65. Leung, L., M. Kwong, S. Hou, C. Lee, and J.Y. Chan, Deficiency of the Nrf1 and Nrf2 transcription factors results in early embryonic lethality and severe oxidative stress. J Biol Chem, 2003. 278(48): p. 48021-9. 66. Itoh, K., N. Wakabayashi, Y. Katoh, T. Ishii, K. Igarashi, J.D. Engel, and M. Yamamoto, Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev, 1999. 13(1): p. 76-86. 67. McMahon, M., D.J. Lamont, K.A. Beattie, and J.D. Hayes, Keap1 perceives stress via three sensors for the endogenous signaling molecules nitric oxide, zinc, and alkenals. Proc Natl Acad Sci U S A, 2010. 107(44): p. 18838-43. 68. Kensler, T.W., N. Wakabayashi, and S. Biswal, Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol, 2007. 47: p. 89-116. 69. Itoh, K., K.I. Tong, and M. Yamamoto, Molecular mechanism activating Nrf2- Keap1 pathway in regulation of adaptive response to electrophiles. Free Radic Biol Med, 2004. 36(10): p. 1208-13. 70. Nguyen, T., C.S. Yang, and C.B. Pickett, The pathways and molecular mechanisms regulating Nrf2 activation in response to chemical stress. Free Radic Biol Med, 2004. 37(4): p. 433-41. 71. Cullinan, S.B., J.D. Gordan, J. Jin, J.W. Harper, and J.A. Diehl, The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol Cell Biol, 2004. 24(19): p. 8477-86. 72. Kobayashi, A., M.I. Kang, H. Okawa, M. Ohtsuji, Y. Zenke, T. Chiba, K. Igarashi, and M. Yamamoto, Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol, 2004. 24(16): p. 7130-9. 73. Chan, J.Y., M. Kwong, R. Lu, J. Chang, B. Wang, T.S. Yen, and Y.W. Kan, Targeted disruption of the ubiquitous CNC-bZIP transcription factor, Nrf-1, results in anemia and embryonic lethality in mice. EMBO J, 1998. 17(6): p. 1779- 87. 74. Chan, K., R. Lu, J.C. Chang, and Y.W. Kan, NRF2, a member of the NFE2 family of transcription factors, is not essential for murine erythropoiesis, growth, and development. Proc Natl Acad Sci U S A, 1996. 93(24): p. 13943-8. 75. Li, J., T.D. Stein, and J.A. Johnson, Genetic dissection of systemic autoimmune disease in Nrf2-deficient mice. Physiol Genomics, 2004. 18(3): p. 261-72. 76. Zhang, Y. and G.B. Gordon, A strategy for cancer prevention: stimulation of the Nrf2-ARE signaling pathway. Mol Cancer Ther, 2004. 3(7): p. 885-93. 77. Giudice, A. and M. Montella, Activation of the Nrf2-ARE signaling pathway: a promising strategy in cancer prevention. Bioessays, 2006. 28(2): p. 169-81. 78. Lee, J.M. and J.A. Johnson, An important role of Nrf2-ARE pathway in the cellular defense mechanism. J Biochem Mol Biol, 2004. 37(2): p. 139-43.
129 79. Cuadrado, A. and A.I. Rojo, Heme oxygenase-1 as a therapeutic target in neurodegenerative diseases and brain infections. Curr Pharm Des, 2008. 14(5): p. 429-42. 80. Khor, T.O., M.T. Huang, A. Prawan, Y. Liu, X. Hao, S. Yu, W.K. Cheung, J.Y. Chan, B.S. Reddy, C.S. Yang, and A.N. Kong, Increased susceptibility of Nrf2 knockout mice to colitis-associated colorectal cancer. Cancer Prev Res (Phila), 2008. 1(3): p. 187-91. 81. Cho, H.Y., S.P. Reddy, and S.R. Kleeberger, Nrf2 defends the lung from oxidative stress. Antioxid Redox Signal, 2006. 8(1-2): p. 76-87. 82. Becks, L., M. Prince, H. Burson, C. Christophe, M. Broadway, K. Itoh, M. Yamamoto, M. Mathis, E. Orchard, R. Shi, J. McLarty, K. Pruitt, S. Zhang, and H.E. Kleiner-Hancock, Aggressive mammary carcinoma progression in Nrf2 knockout mice treated with 7,12-dimethylbenz[a]anthracene. BMC Cancer, 2010. 10: p. 540. 83. Pledgie-Tracy, A., M.D. Sobolewski, and N.E. Davidson, Sulforaphane induces cell type-specific apoptosis in human breast cancer cell lines. Mol Cancer Ther, 2007. 6(3): p. 1013-21. 84. Xu, C., X. Yuan, Z. Pan, G. Shen, J.H. Kim, S. Yu, T.O. Khor, W. Li, J. Ma, and A.N. Kong, Mechanism of action of isothiocyanates: the induction of ARE- regulated genes is associated with activation of ERK and JNK and the phosphorylation and nuclear translocation of Nrf2. Mol Cancer Ther, 2006. 5(8): p. 1918-26. 85. Thangapazham, R.L., A. Sharma, and R.K. Maheshwari, Multiple molecular targets in cancer chemoprevention by curcumin. AAPS J, 2006. 8(3): p. E443-9. 86. Jasinski, P., P. Zwolak, K. Terai, R.I. Vogel, D. Borja-Cacho, and A.Z. Dudek, MT477 acts in tumor cells as an AURKA inhibitor and strongly induces NRF-2 signaling. Anticancer Res, 2011. 31(4): p. 1181-7. 87. Herschman, H.R., Primary response genes induced by growth factors and tumor promoters. Annu Rev Biochem, 1991. 60: p. 281-319. 88. Matsuda, S., J. Rouault, J. Magaud, and C. Berthet, In search of a function for the TIS21/PC3/BTG1/TOB family. FEBS Lett, 2001. 497(2-3): p. 67-72. 89. Duriez, C., C. Moyret-Lalle, N. Falette, F. El-Ghissassi, and A. Puisieux, BTG2, its family and its tutor. Bull Cancer, 2004. 91(7-8): p. E242-53. 90. Buanne, P., G. Corrente, L. Micheli, A. Palena, P. Lavia, C. Spadafora, M.K. Lakshmana, A. Rinaldi, S. Banfi, M. Quarto, A. Bulfone, and F. Tirone, Cloning of PC3B, a novel member of the PC3/BTG/TOB family of growth inhibitory genes, highly expressed in the olfactory epithelium. Genomics, 2000. 68(3): p. 253-63. 91. Rouault, J.P., R. Rimokh, C. Tessa, G. Paranhos, M. Ffrench, L. Duret, M. Garoccio, D. Germain, J. Samarut, and J.P. Magaud, BTG1, a member of a new family of antiproliferative genes. EMBO J, 1992. 11(4): p. 1663-70. 92. Guehenneux, F., L. Duret, M.B. Callanan, R. Bouhas, S. Hayette, C. Berthet, C. Samarut, R. Rimokh, A.M. Birot, Q. Wang, J.P. Magaud, and J.P. Rouault, Cloning of the mouse BTG3 gene and definition of a new gene family (the BTG family) involved in the negative control of the cell cycle. Leukemia, 1997. 11(3): p. 370-5.
130 93. Matsuda, S., J. Kawamura-Tsuzuku, M. Ohsugi, M. Yoshida, M. Emi, Y. Nakamura, M. Onda, Y. Yoshida, A. Nishiyama, and T. Yamamoto, Tob, a novel protein that interacts with p185erbB2, is associated with anti-proliferative activity. Oncogene, 1996. 12(4): p. 705-13. 94. Ikematsu, N., Y. Yoshida, J. Kawamura-Tsuzuku, M. Ohsugi, M. Onda, M. Hirai, J. Fujimoto, and T. Yamamoto, Tob2, a novel anti-proliferative Tob/BTG1 family member, associates with a component of the CCR4 transcriptional regulatory complex capable of binding cyclin-dependent kinases. Oncogene, 1999. 18(52): p. 7432-41. 95. Rodier, A., P. Rochard, C. Berthet, J.P. Rouault, F. Casas, L. Daury, M. Busson, J.P. Magaud, C. Wrutniak-Cabello, and G. Cabello, Identification of functional domains involved in BTG1 cell localization. Oncogene, 2001. 20(21): p. 2691- 703. 96. Prevot, D., A.P. Morel, T. Voeltzel, M.C. Rostan, R. Rimokh, J.P. Magaud, and L. Corbo, Relationships of the antiproliferative proteins BTG1 and BTG2 with CAF1, the human homolog of a component of the yeast CCR4 transcriptional complex: involvement in estrogen receptor alpha signaling pathway. J Biol Chem, 2001. 276(13): p. 9640-8. 97. Yoshida, Y., S. Matsuda, N. Ikematsu, J. Kawamura-Tsuzuku, J. Inazawa, H. Umemori, and T. Yamamoto, ANA, a novel member of Tob/BTG1 family, is expressed in the ventricular zone of the developing central nervous system. Oncogene, 1998. 16(20): p. 2687-93. 98. Jia, S. and A. Meng, Tob genes in development and homeostasis. Dev Dyn, 2007. 236(4): p. 913-21. 99. Kawate, H., Y. Wu, K. Ohnaka, H. Nawata, and R. Takayanagi, Tob proteins suppress steroid hormone receptor-mediated transcriptional activation. Mol Cell Endocrinol, 2005. 230(1-2): p. 77-86. 100. Maekawa, M., T. Yamamoto, and E. Nishida, Regulation of subcellular localization of the antiproliferative protein Tob by its nuclear export signal and bipartite nuclear localization signal sequences. Exp Cell Res, 2004. 295(1): p. 59-65. 101. Bogdan, J.A., C. Adams-Burton, D.L. Pedicord, D.A. Sukovich, P.A. Benfield, M.H. Corjay, J.K. Stoltenborg, and I.B. Dicker, Human carbon catabolite repressor protein (CCR4)-associative factor 1: cloning, expression and characterization of its interaction with the B-cell translocation protein BTG1. Biochem J, 1998. 336 ( Pt 2): p. 471-81. 102. Morel, A.P., S. Sentis, C. Bianchin, M. Le Romancer, L. Jonard, M.C. Rostan, R. Rimokh, and L. Corbo, BTG2 antiproliferative protein interacts with the human CCR4 complex existing in vivo in three cell-cycle-regulated forms. J Cell Sci, 2003. 116(Pt 14): p. 2929-36. 103. Rouault, J.P., C. Samarut, L. Duret, C. Tessa, J. Samarut, and J.P. Magaud, Sequence analysis reveals that the BTG1 anti-proliferative gene is conserved throughout evolution in its coding and 3' non-coding regions. Gene, 1993. 129(2): p. 303-6. 104. Kohno, T., M. Kawanishi, S. Matsuda, H. Ichikawa, M. Takada, M. Ohki, T. Yamamoto, and J. Yokota, Homozygous deletion and frequent allelic loss of the
131 21q11.1-q21.1 region including the ANA gene in human lung carcinoma. Genes Chromosomes Cancer, 1998. 21(3): p. 236-43. 105. Sasajima, H., K. Nakagawa, and H. Yokosawa, Antiproliferative proteins of the BTG/Tob family are degraded by the ubiquitin-proteasome system. Eur J Biochem, 2002. 269(14): p. 3596-604. 106. Hochstrasser, M., Ubiquitin-dependent protein degradation. Annu Rev Genet, 1996. 30: p. 405-39. 107. Mani, A. and E.P. Gelmann, The ubiquitin-proteasome pathway and its role in cancer. J Clin Oncol, 2005. 23(21): p. 4776-89. 108. Tirone, F., The gene PC3(TIS21/BTG2), prototype member of the PC3/BTG/TOB family: regulator in control of cell growth, differentiation, and DNA repair? J Cell Physiol, 2001. 187(2): p. 155-65. 109. Kawakubo, H., E. Brachtel, T. Hayashida, G. Yeo, J. Kish, A. Muzikansky, P.D. Walden, and S. Maheswaran, Loss of B-cell translocation gene-2 in estrogen receptor-positive breast carcinoma is associated with tumor grade and overexpression of cyclin d1 protein. Cancer Res, 2006. 66(14): p. 7075-82. 110. Kawakubo, H., J.L. Carey, E. Brachtel, V. Gupta, J.E. Green, P.D. Walden, and S. Maheswaran, Expression of the NF-kappaB-responsive gene BTG2 is aberrantly regulated in breast cancer. Oncogene, 2004. 23(50): p. 8310-9. 111. Park, S., Y.J. Lee, H.J. Lee, T. Seki, K.H. Hong, J. Park, H. Beppu, I.K. Lim, J.W. Yoon, E. Li, S.J. Kim, and S.P. Oh, B-cell translocation gene 2 (Btg2) regulates vertebral patterning by modulating bone morphogenetic protein/smad signaling. Mol Cell Biol, 2004. 24(23): p. 10256-62. 112. Yoshida, Y., S. Tanaka, H. Umemori, O. Minowa, M. Usui, N. Ikematsu, E. Hosoda, T. Imamura, J. Kuno, T. Yamashita, K. Miyazono, M. Noda, T. Noda, and T. Yamamoto, Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell, 2000. 103(7): p. 1085-97. 113. Yoshida, Y., T. Nakamura, M. Komoda, H. Satoh, T. Suzuki, J.K. Tsuzuku, T. Miyasaka, E.H. Yoshida, H. Umemori, R.K. Kunisaki, K. Tani, S. Ishii, S. Mori, M. Suganuma, T. Noda, and T. Yamamoto, Mice lacking a transcriptional corepressor Tob are predisposed to cancer. Genes Dev, 2003. 17(10): p. 1201-6. 114. Suzuki, T., K.T. J, R. Ajima, T. Nakamura, Y. Yoshida, and T. Yamamoto, Phosphorylation of three regulatory serines of Tob by Erk1 and Erk2 is required for Ras-mediated cell proliferation and transformation. Genes Dev, 2002. 16(11): p. 1356-70. 115. Hayashida, M., R. Minoda, Y. Shinmyo, K. Ohta, H. Tanaka, and E. Yumoto, PC3 is involved in the shift from proliferation to differentiation and maturation in spiral ganglion neurons. Neuroreport, 2010. 21(2): p. 90-3. 116. Arenander, A.T., R.W. Lim, B.C. Varnum, R. Cole, J. de Vellis, and H.R. Herschman, TIS gene expression in cultured rat astrocytes: multiple pathways of induction by mitogens. J Neurosci Res, 1989. 23(3): p. 257-65. 117. Fletcher, B.S., R.W. Lim, B.C. Varnum, D.A. Kujubu, R.A. Koski, and H.R. Herschman, Structure and expression of TIS21, a primary response gene induced by growth factors and tumor promoters. J Biol Chem, 1991. 266(22): p. 14511-8.
132 118. Wheaton, K., J. Muir, W. Ma, and S. Benchimol, BTG2 antagonizes Pin1 in response to mitogens and telomere disruption during replicative senescence. Aging Cell, 2010. 9(5): p. 747-60. 119. Rouault, J.P., N. Falette, F. Guehenneux, C. Guillot, R. Rimokh, Q. Wang, C. Berthet, C. Moyret-Lalle, P. Savatier, B. Pain, P. Shaw, R. Berger, J. Samarut, J.P. Magaud, M. Ozturk, C. Samarut, and A. Puisieux, Identification of BTG2, an antiproliferative p53-dependent component of the DNA damage cellular response pathway. Nat Genet, 1996. 14(4): p. 482-6. 120. Bradbury, A., R. Possenti, E.M. Shooter, and F. Tirone, Molecular cloning of PC3, a putatively secreted protein whose mRNA is induced by nerve growth factor and depolarization. Proc Natl Acad Sci U S A, 1991. 88(8): p. 3353-7. 121. Varnum, B.C., S.T. Reddy, R.A. Koski, and H.R. Herschman, Synthesis, degradation, and subcellular localization of proteins encoded by the primary response genes TIS7/PC4 and TIS21/PC3. J Cell Physiol, 1994. 158(1): p. 205- 13. 122. Terra, R., H. Luo, X. Qiao, and J. Wu, Tissue-specific expression of B-cell translocation gene 2 (BTG2) and its function in T-cell immune responses in a transgenic mouse model. Int Immunol, 2008. 20(3): p. 317-26. 123. Kawamura-Tsuzuku, J., T. Suzuki, Y. Yoshida, and T. Yamamoto, Nuclear localization of Tob is important for regulation of its antiproliferative activity. Oncogene, 2004. 23(39): p. 6630-8. 124. Melamed, J., S. Kernizan, and P.D. Walden, Expression of B-cell translocation gene 2 protein in normal human tissues. Tissue Cell, 2002. 34(1): p. 28-32. 125. Lim, I.K., TIS21 (/BTG2/PC3) as a link between ageing and cancer: cell cycle regulator and endogenous cell death molecule. J Cancer Res Clin Oncol, 2006. 132(7): p. 417-26. 126. Guardavaccaro, D., G. Corrente, F. Covone, L. Micheli, I. D'Agnano, G. Starace, M. Caruso, and F. Tirone, Arrest of G(1)-S progression by the p53-inducible gene PC3 is Rb dependent and relies on the inhibition of cyclin D1 transcription. Mol Cell Biol, 2000. 20(5): p. 1797-815. 127. Lim, I.K., M.S. Lee, M.S. Ryu, T.J. Park, H. Fujiki, H. Eguchi, and W.K. Paik, Induction of growth inhibition of 293 cells by downregulation of the cyclin E and cyclin-dependent kinase 4 proteins due to overexpression of TIS21. Mol Carcinog, 1998. 23(1): p. 25-35. 128. Ryu, M.S., M.S. Lee, J.W. Hong, T.R. Hahn, E. Moon, and I.K. Lim, TIS21/BTG2/PC3 is expressed through PKC-delta pathway and inhibits binding of cyclin B1-Cdc2 and its activity, independent of p53 expression. Exp Cell Res, 2004. 299(1): p. 159-70. 129. Montagnoli, A., D. Guardavaccaro, G. Starace, and F. Tirone, Overexpression of the nerve growth factor-inducible PC3 immediate early gene is associated with growth inhibition. Cell Growth Differ, 1996. 7(10): p. 1327-36. 130. Ficazzola, M.A., M. Fraiman, J. Gitlin, K. Woo, J. Melamed, M.A. Rubin, and P.D. Walden, Antiproliferative B cell translocation gene 2 protein is down- regulated post-transcriptionally as an early event in prostate carcinogenesis. Carcinogenesis, 2001. 22(8): p. 1271-9.
133 131. Jalava, S.E., A. Urbanucci, L. Latonen, K.K. Waltering, B. Sahu, O.A. Janne, J. Seppala, H. Lahdesmaki, T.L. Tammela, and T. Visakorpi, Androgen-regulated miR-32 targets BTG2 and is overexpressed in castration-resistant prostate cancer. Oncogene, 2012. 132. Elmore, L.W., X. Di, C. Dumur, S.E. Holt, and D.A. Gewirtz, Evasion of a single- step, chemotherapy-induced senescence in breast cancer cells: implications for treatment response. Clin Cancer Res, 2005. 11(7): p. 2637-43. 133. Fiedler, F., G.V. Mallo, H. Bodeker, V. Keim, J.C. Dagorn, and J.L. Iovanna, Overexpression of the PC3/TIS21/BTG2 mRNA is part of the stress response induced by acute pancreatitis in rats. Biochem Biophys Res Commun, 1998. 249(2): p. 562-5. 134. Savkovic, V., S. Gaiser, J.L. Iovanna, and H. Bodeker, The stress response of the exocrine pancreas. Dig Dis, 2004. 22(3): p. 239-46. 135. Slevin, M., C. Sanfeliu, M.M. Turu, M. Grau-Olivares, I. Ferrer, S. Boluda, J. Marti-Fabregas, S. Kumar, P. Kumar, and J. Krupinski, B-cell translocation gene 2 is over-expressed in peri-infarct neurons after ischaemic stroke. Pathobiology, 2009. 76(3): p. 129-35. 136. Struckmann, K., P. Schraml, R. Simon, K. Elmenhorst, M. Mirlacher, J. Kononen, and H. Moch, Impaired expression of the cell cycle regulator BTG2 is common in clear cell renal cell carcinoma. Cancer Res, 2004. 64(5): p. 1632-8. 137. Farioli-Vecchioli, S., M. Tanori, L. Micheli, M. Mancuso, L. Leonardi, A. Saran, M.T. Ciotti, E. Ferretti, A. Gulino, S. Pazzaglia, and F. Tirone, Inhibition of medulloblastoma tumorigenesis by the antiproliferative and pro-differentiative gene PC3. FASEB J, 2007. 21(9): p. 2215-25. 138. Zhang, Z., C. Chen, G. Wang, Z. Yang, J. San, J. Zheng, Q. Li, X. Luo, Q. Hu, Z. Li, and D. Wang, Aberrant expression of the p53-inducible antiproliferative gene BTG2 in hepatocellular carcinoma is associated with overexpression of the cell cycle-related proteins. Cell Biochem Biophys, 2011. 61(1): p. 83-91. 139. Takahashi, F., N. Chiba, K. Tajima, T. Hayashida, T. Shimada, M. Takahashi, H. Moriyama, E. Brachtel, E.J. Edelman, S. Ramaswamy, and S. Maheswaran, Breast tumor progression induced by loss of BTG2 expression is inhibited by targeted therapy with the ErbB/HER inhibitor lapatinib. Oncogene, 2011. 30(27): p. 3084-95. 140. Levitz, S.M. and R.D. Diamond, A rapid colorimetric assay of fungal viability with the tetrazolium salt MTT. J Infect Dis, 1985. 152(5): p. 938-45. 141. Whur, P., R.T. Robson, and N.E. Payne, Effect of a protease inhibitor on the adhesion of Ehrlich ascites cells to host cells in vivo. Br J Cancer, 1973. 28(5): p. 417-28. 142. Battula, N. and L.A. Loeb, On the fidelity of DNA replication. Characterization of polynucleotides with errors in base-pairing synthesized by avian myeloblastosis virus deoxyribonucleic acid polymerase. J Biol Chem, 1975. 250(12): p. 4405-9. 143. Zhang, J., T. Ohta, A. Maruyama, T. Hosoya, K. Nishikawa, J.M. Maher, S. Shibahara, K. Itoh, and M. Yamamoto, BRG1 interacts with Nrf2 to selectively mediate HO-1 induction in response to oxidative stress. Mol Cell Biol, 2006. 26(21): p. 7942-52.
134 144. Han, E.S., F.L. Muller, V.I. Perez, W. Qi, H. Liang, L. Xi, C. Fu, E. Doyle, M. Hickey, J. Cornell, C.J. Epstein, L.J. Roberts, H. Van Remmen, and A. Richardson, The in vivo gene expression signature of oxidative stress. Physiol Genomics, 2008. 34(1): p. 112-26. 145. Karmakar, S., E.A. Foster, and C.L. Smith, Estradiol downregulation of the tumor suppressor gene BTG2 requires estrogen receptor-alpha and the REA corepressor. Int J Cancer, 2009. 124(8): p. 1841-51. 146. Prevot, D., T. Voeltzel, A.M. Birot, A.P. Morel, M.C. Rostan, J.P. Magaud, and L. Corbo, The leukemia-associated protein Btg1 and the p53-regulated protein Btg2 interact with the homeoprotein Hoxb9 and enhance its transcriptional activation. J Biol Chem, 2000. 275(1): p. 147-53. 147. Deshpande, N.N., D. Sorescu, P. Seshiah, M. Ushio-Fukai, M. Akers, Q. Yin, and K.K. Griendling, Mechanism of hydrogen peroxide-induced cell cycle arrest in vascular smooth muscle. Antioxid Redox Signal, 2002. 4(5): p. 845-54. 148. Lin, W.J., J.D. Gary, M.C. Yang, S. Clarke, and H.R. Herschman, The mammalian immediate-early TIS21 protein and the leukemia-associated BTG1 protein interact with a protein-arginine N-methyltransferase. J Biol Chem, 1996. 271(25): p. 15034-44. 149. Hu, X.D., Q.H. Meng, J.Y. Xu, Y. Jiao, C.M. Ge, A. Jacob, P. Wang, E.M. Rosen, and S. Fan, BTG2 is an LXXLL-dependent co-repressor for androgen receptor transcriptional activity. Biochem Biophys Res Commun, 2011. 404(4): p. 903-9. 150. Lin, W.J., Y.F. Chang, W.L. Wang, and C.Y. Huang, Mitogen-stimulated TIS21 protein interacts with a protein-kinase-Calpha-binding protein rPICK1. Biochem J, 2001. 354(Pt 3): p. 635-43. 151. Chen, F. and M.R. Capecchi, Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control development of the mammary gland in response to pregnancy. Proc Natl Acad Sci U S A, 1999. 96(2): p. 541-6. 152. Yang, X., M. Morita, H. Wang, T. Suzuki, W. Yang, Y. Luo, C. Zhao, Y. Yu, M. Bartlam, T. Yamamoto, and Z. Rao, Crystal structures of human BTG2 and mouse TIS21 involved in suppression of CAF1 deadenylase activity. Nucleic Acids Res, 2008. 36(21): p. 6872-81. 153. Berthet, C., F. Guehenneux, V. Revol, C. Samarut, A. Lukaszewicz, C. Dehay, C. Dumontet, J.P. Magaud, and J.P. Rouault, Interaction of PRMT1 with BTG/TOB proteins in cell signalling: molecular analysis and functional aspects. Genes Cells, 2002. 7(1): p. 29-39. 154. Rouault, J.P., D. Prevot, C. Berthet, A.M. Birot, M. Billaud, J.P. Magaud, and L. Corbo, Interaction of BTG1 and p53-regulated BTG2 gene products with mCaf1, the murine homolog of a component of the yeast CCR4 transcriptional regulatory complex. J Biol Chem, 1998. 273(35): p. 22563-9. 155. Nakaso, K., C. Nakamura, H. Sato, K. Imamura, T. Takeshima, and K. Nakashima, Novel cytoprotective mechanism of anti-parkinsonian drug deprenyl: PI3K and Nrf2-derived induction of antioxidative proteins. Biochem Biophys Res Commun, 2006. 339(3): p. 915-22. 156. Saw, C.L., M. Cintron, T.Y. Wu, Y. Guo, Y. Huang, W.S. Jeong, and A.N. Kong, Pharmacodynamics of dietary phytochemical indoles I3C and DIM: Induction of
135 Nrf2-mediated phase II drug metabolizing and antioxidant genes and synergism with isothiocyanates. Biopharm Drug Dispos, 2011. 32(5): p. 289-300. 157. Ernst, I.M., C. Schuemann, A.E. Wagner, and G. Rimbach, 3,3'-Diindolylmethane but not indole-3-carbinol activates Nrf2 and induces Nrf2 target gene expression in cultured murine fibroblasts. Free Radic Res, 2011. 45(8): p. 941-9. 158. Fan, S., Q. Meng, T. Saha, F.H. Sarkar, and E.M. Rosen, Low concentrations of diindolylmethane, a metabolite of indole-3-carbinol, protect against oxidative stress in a BRCA1-dependent manner. Cancer Res, 2009. 69(15): p. 6083-91. 159. Hu, R., N. Chen, J. Yao, Q. Zhao, F. Zhang, Z.Y. Li, Q.D. You, and Q.L. Guo, The role of Nrf2 and apoptotic signaling pathways in oroxylin A-mediated responses in HCT-116 colorectal adenocarcinoma cells and xenograft tumors. Anticancer Drugs, 2012. 160. Mollerstrom, E., A. Kovacs, K. Lovgren, S. Nemes, U. Delle, A. Danielsson, T. Parris, D.J. Brennan, K. Jirstrom, P. Karlsson, and K. Helou, Up-regulation of cell cycle arrest protein BTG2 correlates with increased overall survival in breast cancer, as detected by immunohistochemistry using tissue microarray. BMC Cancer, 2010. 10: p. 296. 161. Mollerstrom, E., U. Delle, A. Danielsson, T. Parris, B. Olsson, P. Karlsson, and K. Helou, High-resolution genomic profiling to predict 10-year overall survival in node-negative breast cancer. Cancer Genet Cytogenet, 2010. 198(2): p. 79-89. 162. Saha, T., J.K. Rih, R. Roy, R. Ballal, and E.M. Rosen, Transcriptional regulation of the base excision repair pathway by BRCA1. J Biol Chem, 2010. 285(25): p. 19092-105. 163. Tomlinson, G.E., T.T. Chen, V.A. Stastny, A.K. Virmani, M.A. Spillman, V. Tonk, J.L. Blum, N.R. Schneider, Wistuba, II, J.W. Shay, J.D. Minna, and A.F. Gazdar, Characterization of a breast cancer cell line derived from a germ-line BRCA1 mutation carrier. Cancer Res, 1998. 58(15): p. 3237-42. 164. Fan, W., S. Jin, T. Tong, H. Zhao, F. Fan, M.J. Antinore, B. Rajasekaran, M. Wu, and Q. Zhan, BRCA1 regulates GADD45 through its interactions with the OCT-1 and CAAT motifs. J Biol Chem, 2002. 277(10): p. 8061-7. 165. Karve, T.M. and E.M. Rosen, B-cell translocation gene 2 (BTG2) stimulates cellular antioxidant defenses through the antioxidant transcription factor NFE2L2 in human mammary epithelial cells. J Biol Chem, 2012. 166. Kononen, J., L. Bubendorf, A. Kallioniemi, M. Barlund, P. Schraml, S. Leighton, J. Torhorst, M.J. Mihatsch, G. Sauter, and O.P. Kallioniemi, Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med, 1998. 4(7): p. 844-7. 167. Schraml, P., J. Kononen, L. Bubendorf, H. Moch, H. Bissig, A. Nocito, M.J. Mihatsch, O.P. Kallioniemi, and G. Sauter, Tissue microarrays for gene amplification surveys in many different tumor types. Clin Cancer Res, 1999. 5(8): p. 1966-75. 168. Moch, H., T. Kononen, O.P. Kallioniemi, and G. Sauter, Tissue microarrays: what will they bring to molecular and anatomic pathology? Adv Anat Pathol, 2001. 8(1): p. 14-20.
136 169. Kryston, T.B., A.B. Georgiev, P. Pissis, and A.G. Georgakilas, Role of oxidative stress and DNA damage in human carcinogenesis. Mutat Res, 2011. 711(1-2): p. 193-201. 170. Kasai, H., P.F. Crain, Y. Kuchino, S. Nishimura, A. Ootsuyama, and H. Tanooka, Formation of 8-hydroxyguanine moiety in cellular DNA by agents producing oxygen radicals and evidence for its repair. Carcinogenesis, 1986. 7(11): p. 1849- 51. 171. Boiteux, S. and J.P. Radicella, The human OGG1 gene: structure, functions, and its implication in the process of carcinogenesis. Arch Biochem Biophys, 2000. 377(1): p. 1-8. 172. Piao, M.J., K.C. Kim, J.Y. Choi, J. Choi, and J.W. Hyun, Silver nanoparticles down-regulate Nrf2-mediated 8-oxoguanine DNA glycosylase 1 through inactivation of extracellular regulated kinase and protein kinase B in human Chang liver cells. Toxicol Lett, 2011. 207(2): p. 143-8. 173. Cox, D.P., Disruption of 8-hydroxy-2'-deoxyguanosine DNA Glycosylase (OGG1) Antioxidant Response Capacity by Sodium Arsenite, in Department of biomedical pharm sciences. 2008, The University of Montana. 174. Riis, B., L. Risom, S. Loft, and H.E. Poulsen, OGG1 mRNA expression and incision activity in rats are higher in foetal tissue than in adult liver tissue while 8-oxo-2'-deoxyguanosine levels are unchanged. DNA Repair (Amst), 2002. 1(9): p. 709-17.
137