Ichthyological Exploration of Freshwaters an International Journal for Field-Orientated Ichthyology

Verlag Dr. Friedrich Pfeil ISSN 0936-9902 Excerpt from Ichthyological Exploration of Freshwaters An international journal for field-orientated ichthyology

Volume 25 Number 1

This article may be used for research, teaching and private purposes. Exchange with other researchers is allowed on request only. Any substantial or systematic reproduction, re-distribution, re-selling in any form to anyone, in particular deposition in a library, institutional or private website, or ftp-site for public access, is expressly forbidden. Ichthyological Exploration of Freshwaters An international journal for field-orientated ichthyology

Volume 25 • Number 1 • August 2014 pages 1-96, 60 figs., 13 tabs.

Managing Editor Maurice Kottelat, Rue des Rauraques 6 CH-2800 Delémont, Switzerland Tel. + 41 32 4623175 · Fax + 41 32 4622259 · E-mail [email protected]

Editorial board Ralf Britz, Department of Zoology, The Natural History Museum, London, United Kingdom Sven O. Kullander, Naturhistoriska Riksmuseet, Stockholm, Sweden Helen K. Larson, Museum and Art Gallery of the Northern Territory, Darwin, Australia Lukas Rüber, Department of Zoology, The Natural History Museum, London, United Kingdom Ivan Sazima, Museu de Zoologia, Unicamp, Campinas, Brazil Paul H. Skelton, South African Institute for Aquatic Biodiversity, Grahamstown, South Africa Tan Heok Hui, Lee Kong Chian Natural History Museum, National University of Singapore, Singapore

Ichthyological Exploration of Freshwaters is published quarterly

Subscriptions should be addressed to the Publisher: Verlag Dr. Friedrich Pfeil, Wolfratshauser Str. 27, 81379 München, Germany PERSONAL SUBSCRIPTION : EURO 100 per Year/volume - 4 issues (includes surface mail shipping) INSTITUTIONAL SUBSCRIPTION : EURO 180 per Year/volume - 4 issues (includes surface mail shipping)

Manuscripts should be addressed to the Managing Editor: Maurice Kottelat, Rue des Rauraques 6, CH-2800 Delémont, Switzerland

CIP-Titelaufnahme der Deutschen Bibliothek

Ichthyological exploration of freshwaters : an international journal for field-orientated ichthyology. – München : Pfeil. Erscheint jährl. viermal. – Aufnahme nach Vol. 1, No. 1 (1990) ISSN 0936-9902

Vol. 1, No. 1 (1990) –

Copyright © 2014 by Verlag Dr. Friedrich Pfeil, München, Germany All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without the prior permission of the copyright owner. Applications for such permission, with a statement of the purpose and extent of the reproduction, should be addressed to the Publisher, Verlag Dr. Friedrich Pfeil, Wolfratshauser Str. 27, 81379 München, Germany.

Printed by PBtisk a.s., Prˇíbram I – Balonka

ISSN 0936-9902 Printed in the European Union

Verlag Dr. Friedrich Pfeil, Wolfratshauser Str. 27, 81379 München, Germany Phone + 49 89 742827-0 · Fax + 49 89 7242772 · E-mail: [email protected] · www.pfeil-verlag.de Copyright © Verlag Dr. Friedrich Pfeil 11

Review of the crested loaches of the genus Paracobitis from Iran and Iraq with the description of four new species (Teleostei: Nemacheilidae)

Jörg Freyhof*, Hamid Reza Esmaeili**, Golnaz Sayyadzadeh** and Matthias Geiger*

The genus Paracobitis from Iran and Iraq is reviewed, and diagnoses for all nine recognized species are presented. Accordingly, P. longicauda, P. malapterura, P. rhadinaea, P. smithi and P. vignai are considered valid; P. iranica is treated as a synonym of P. malapterura; and four new species are described. Paracobitis basharensis, new species, from the Karoun (Karun) drainage in the Iranian Tigris catchment, is distinguished by having the dorsal-fin origin behind the vertical of the pelvic-fin origin, and a colour pattern comprising of many small irregularly shaped brown blotches. Paracobitis molavii, new species, from the Sirvan and Little Zab drainages in the Iranian and Iraqi Tigris catchment, is distinguished by having a truncate caudal fin, a stout body and the dorsal-fin origin situated in front of the vertical of the pelvic-fin origin. Paracobitis persa, new species, from the Kor drainage in Iran, is distinguished by having a prominent, irregularly shaped midlateral stripe, a shallow adipose crest, and the tube of the anterior nostril not fully overlapping the posterior nostril when folded back. Paracobitis zabgaw raensis, new species, from the Great Zab drainage in the Iraqi Tigris catchment, is distinguished by a very elongate body, a reticulate, often indistinct colour pattern, and the dorsal-fin origin situated below or slightly behind of the vertical of the pelvic-fin origin. All species, except unstudied P. basharensis, P. longicauda, P. rhadinaea, P. smithi and P. vignai are also characterized by fixed, diagnostic nucleotide substitutions in the mtDNA COI barcode region.

Introduction malapterura. Prokofiev (2009) rediagnosed the genus, and recognized 13 valid species. As of Most nemacheilid loaches with a high dorsal date, four species recognized by Prokofiev (2009) adipose crest, especially those occurring in Cen- are placed in the genus Oxynoemacheilus (Freyhof tral Asia (Bânârescu & Nalbant, 1964), Vietnam et al., 2012), and P. macmahoni is treated as syno- (Nguyen, 2005), the Middle East (Prokofiev, 2009), nym of P. rhadinaea (Bânârescu & Nalbant, 1966; and China (Min et al., 2010) have been placed in Kottelat, 2012). Eight species remain in the genus: the genus Paracobitis. The genus Paracobitis was P. iranica (Lake Namak basin in Iran), P. longi established by Bleeker (1863: 37) for Cobitis cauda (Amu Darya drainage in Central Asia),

* Zoological Research Museum Alexander Koenig, Leibniz Institute for Animal Biodiversity, Adenauerallee 160, 53113 Bonn, Germany. E-mail: [email protected]; [email protected] ** Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran. E-mail: [email protected]; [email protected]

P. malapterura (unknown origin), P. smithi (Tigris the end of the hypural complex. The length of the drainage in Iran), and P. boutanensis, P. rhadinaea, caudal peduncle was measured from behind the P. vignai and P. ghazniensis, all from the Helmand base of the last anal-fin ray to the end of the hyp drainage in Iran and Afghanistan (Bânârescu & ural complex, at mid-height of the caudal-fin base. Nalbant, 1966, 1995; Nalbant & Bianco, 1998). The last two branched rays articulating on a Altogether, Paracobitis remain poorly studied, and single pterygiophore in the dorsal and anal fins 1 a comprehensive taxonomic review is still not were noted as “1 /2”. The holotype is included in available. In part, this is due to security-related the calculation of means and SD. issues in parts of its range; especially the Helmand Abbreviations: SL, standard length; HL, drainage in Afghanistan remains virtually ich- lateral head length; K2P, Kimura 2-parameter. thyologically unexplored. In recent years, indica- Collection codes: CMNFI, Canadian Museum of tions accumulated, and made it plausible that Nature, Ottawa; FSJF, Fischsammlung J. Freyhof, more than the above listed species might exist Berlin; MNHN, Muséum National d’Histoire within the genus Paracobitis. Iranian authors Naturelle, Paris; SMF, Senckenberg Research traditionally identified the species that occur in Institute and Natural History Museum, Frankfurt; the middle and eastern Caspian basin in Iran as ZFMK, Zoological Research Museum Alexander P. malapterurus, while it was rather unlikely that Koenig, Leibniz Institute for Animal Biodiversity, the types could have been collected from this area Bonn; ZM-CBSU, Zoological Museum of Shiraz (see detailed discussion about P. malapterura be- University, Collection of Biology Department, low). This identification dates back to Berg (1949), Shiraz; ZMMU, Zoological Museum, Moscow but Nalbant (pers. comm.) identified these fishes State University, Moscow. as P. longicauda, a species described from Uz- bekistan. Intensive fieldwork in the last 15 years DNA extraction and PCR. Genomic DNA was has made it clear that Paracobitis is more wide- extracted using Macherey & Nagel NucleoSpin® spread in the Middle East. Tissue kits following the manufacturer’s protocol While trying to identify all these fishes from on an Eppendorf EpMotion® pipetting-roboter the Kor and the tributaries of the Tigris, we ex- with vacuum manifold. The standard vertebrate amined material of all known Iranian species DNA barcode region of the COI (cytochrome c including the two syntypes of P. malapterura. In oxidase subunit 1) was amplified using a M13 this study, all populations were analyzed for their tailed primer cocktail including FishF2_t1 (5' TG- morphological characters, as well as for colour TAAAACGACGGCCAGTCGACTAATCATAA- patterns, and sequenced for the COI barcode AGATATCGGCAC), FishR2_t1 (5' CAGGAAA- region where DNA was available. In combination, CAGCTATGACACTTCAGGGTGACCGAAGA- these data supported the view that nine species ATCAGAA), VF2_t1 (5' TGTAAAACGACGGC- of Paracobitis are present in the Middle East, four CAGTCAACCAACCACAAAGACATTGGCAC) of them undescribed. We therefore describe the and FR1d_t1 (5' CAGGAAACAGCTATGACAC- four new Paracobitis species based on combined CTCAGGGTGTCCGAARAAYCARAA) (Ivanova findings from morphology and molecular ge- et al., 2007). Sequencing of the ExoSAP-IT (USB) netic characters. purified PCR product in both directions was conducted at Macrogen Europe Laboratories with forward sequencing primer M13F (5' GTAAAAC- Material and methods GACGGCCAGT) and reverse sequencing primer M13R-pUC (5' CAGGAAACAGCTATGAC). After anaesthesia, fishes were either fixed in 5 % formaldehyde, and stored in 70 % ethanol, or Molecular data analysis. Data processing and directly fixed in 99 % molecular grade ethanol. sequence assembly was done with the software Measurements were made with a dial calliper and Geneious Pro (Biomatters, 2013), and the Muscle recorded to 0.1 mm. All measurements were made algorithm (Edgar, 2004) chosen to create a DNA point to point, and never by projections. Methods sequence alignment. Modeltest (Posada & Cran- for counts and measurements follow Kottelat & dall, 1998), implemented in the MEGA 5 software Freyhof (2007). Terminology of head canals and (Tamura et al., 2011) was used to determine the pores follows Kottelat (1990). Standard length most appropriate sequence evolution model for (SL) was measured from the tip of the snout to the given data, treating gaps and missing data

P. malapterura Kavir Iran P392F KJ723510 P. malapterura Namak Iran 1992 KJ723499 P. malapterura Namak Iran P1066 KJ723495 P. malapterura Soufi Iran 2419 KJ723508 P. malapterura Namak Iran 2312 KJ723511 P. malapterura Namak Iran 1992 KJ723512 98 84 P. malapterura Namak Iran P1071 KJ723501 95 P. malapterura Namak Iran 1992 KJ723500

99 P. malapterura Kavir Iran P1053F KJ723503 97 93 P. malapterura Namak Iran 1989 KJ723515 P. malapterura Namak Iran SMF33095 KJ723502 100 P. malapterura Namak Iran P738F KJ723493 99 48 98 66 P. malapterura Namak Iran SMF33104 KJ723505 63 P. malapterura Namak Iran P739F KJ723496 P. molavii Sirvan Iraq 2241 KJ723516 100 P. molavii LittleZab Iran M914 KJ723517 66 99 78 94 P. molavii Sirvan Iraq 2241 KJ723506 72 P. molavii Sirvan Iraq 2241 KJ723507 P. molavii Sirvan Iraq 2241 KJ723494 P. persa Kor Iran 1981 KJ723504 98 98 P. persa Kor Iran 1981 KJ723509 97 P. zabgawraensis GreatZab Iraq 2219 KJ723514 100 100 P. zabgawraensis GreatZab Iraq 2219 KJ723497 81 Oxynoemacheilus cyri Kura Turkey 2403 KJ723498

2 % K2P Oxynoemacheilus cyri Kura Turkey 2403 KJ723513 Fig. 1. Neighbour Joining (NJ) estimation of the phylogenetic relationships based on the mitochondrial COI barcode region. Nucleotide positions with less than 95 % site coverage were eliminated before analysis. Numbers of major nodes indicate bootstrap values from the Neighbour Joining, Maximum Parsimony, and Maximum Likelihood method from 500 pseudo-replicates. with the partial deletion option under 95 % site generated neighbor-joining (Saitou & Nei, 1987), coverage cutoff. The model with the lowest BIC maximum parsimony (Swofford, 2002, with scores (Bayesian Information Criterion) is consid- PAUP4b) and maximum likelihood phylogenetic ered to best describe the substitution pattern. We trees with 500 bootstrap replicates to explore

Table 1. List of the diagnostic nucleotide substitutions found in the 652 base pairs long mtDNA COI barcode region.

nucleotide position relative to Oryzias latipes mitochondrial genome (AP004421) 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 5 5 5 5 6 6 6 6 7 7 7 8 8 8 8 8 9 9 9 9 9 9 9 9 0 0 0 0 0 0 1 1 1 5 7 8 8 0 1 6 8 1 4 6 2 6 6 8 8 0 1 1 1 4 5 6 8 0 0 0 3 4 5 0 2 2 n 3 7 0 6 1 0 7 5 2 8 9 0 2 8 7 9 4 0 3 9 9 5 4 5 0 1 3 0 5 8 5 0 6 P. malapterura 14 T A C G T G G A A C T T A C C A A G A G C A C C G C G T A T T C G P. molavii 5 T G C G T G G A A C C T G T C G A G G A C G C C G C G T G C T C G P. persa 2 T A C G T G G A A C T T A C C A A G A G C A C T A C G T A T T T A P. zabgawraensis 2 A A T T C A A G G T T C A C T A T A A G T A T C G T A C A T C C G

Fig. 2. Records of Paracobitis species in the Middle East. ) P. zabgawraensis,  P. molavii, ( P. smithi, % P. mala pterura, @ P. basharensis, & P. persa, P. longicauda, ¯ P. rhadinaea, and P. vignai. phylogenetic affinities. Screening for diagnostic which show 1.4 % minimum K2P sequence di- nucleotide substitutions was performed manu- vergence. Table 1 lists the diagnostic nucleotide ally from the resulting sequence alignment. substitutions found in the 652 base pairs long mtDNA COI barcode region. The other groups correspond to three new species described below. Results A map with all records of the Paracobitis populations considered in this study is shown in Figure 2. No tissue suitable for DNA extraction was available from P. longicauda, P. rhadinaea, P. smithi, P. basharensis and P. vignai. We were able to Key to species of Paracobitis in the Middle East generate COI barcodes for a total of 23 Paracobitis specimens. Oxynoemacheilus cyri was chosen as 1 – Subterranean species, body whitish or pink; appropriate outgroup taxon to elucidate the re- eye absent. lationships between the studied Paracobitis popu- ...... P. smithi lations. It should however be mentioned, that the – Epigean species, body with large brown phylogenetic position of Paracobitis within the blotches, marbled or mottled colour pattern; family Nemacheilidae has not been yet investi- eye fully developed. gated. The Maximum Likelihood estimation of ...... 2 the phylogenetic relationships of the haplotypes found in the mitochondrial COI barcode region, 2 – Body completely scaleless. places the species into four groups (Fig. 1), which ...... P. vignai show between 3.2 % (P. malapterura vs. P. persa) – Body covered by scales, scales present at and 6.6 % (P. molavii vs. P. zabgawraensis) mini- least on caudal peduncle. mum K2P sequence divergence. One of these ...... 3 groups corresponds to P. malapterura and P. iranica,

a b Fig. 3. Paracobitis longicauda, Uzbekistan, Ak-Darya River. a, holotype, 140 mm total length; from Kessler (1872); b, engraving of the holotype of P. longicauda, dorsal adipose crest and colour pattern of a second individual, 173 mm total length, added; from Kessler (1874).

Fig. 4. Paracobitis longicauda, ZMMU P-3790, 94 mm SL and 71 mm SL; Uzbekistan: Ak-Darya River.

3 – Posterior nare slit-shaped. – Flank cream yellowish with large, irregu- ...... 4 larly shaped brown blotches; dorsal-fin – Posterior nare roundish or ovoid. origin situated about one eye diameter ...... 5 behind pelvic-fin origin...... P. basharensis 4 – Flank with many irregularly set small blotches or bars not organized in rows. 7 – Caudal fin truncate...... P. longicauda ...... P. molavii – Flank posteriorly with one or two rows of – Caudal fin emarginate. large irregularly set blotches...... 8 ...... P. rhadinaea 8 – Tube of anterior nostril reaching beyond 5 – Dorsal-fin origin situated above, behind or posterior tip of posterior nostril when very slightly in front of vertical of pelvic-fin folded back; caudal adipose crest deep, its origin. depth at highest point 3.3-3.82 % SL in in- ...... 6 dividuals of 30-50 mm SL. – Dorsal-fin origin situated clearly in front of ...... P. malapterura vertical of pelvic-fin origin. – Tube of anterior nostril not fully overlapping ...... 7 posterior nostril when folded back; caudal adipose crest shallow, its depth at highest 6 – Flank brown with a fine, cream yellowish point 2.1-3.2 % SL in individuals of 30- reticulate or vermiculate pattern; dorsal-fin 50 mm SL. origin situated above or very slightly in ...... P. persa front of vertical of pelvic-fin origin...... P. zabgawraensis

Paracobitis longicauda (Kessler, 1872) this species is fully covered by scales (vs. not, or (Figs. 3-4) only posteriorly covered by scales in a species from the eastern Caspian basin that Berg (1949) Cobitis longicauda Kessler, 1872: 65, pl. 11 figs. identified as P. malapterura). He illustrated two 30-31 specimens, one from the Tedzhen River in Turk- menistan (Fig. 632), and one from upper Amu Material examined. ZMMU P-3790, 3, 68-94 mm SL; Darya in Uzbekistan (Fig. 633). In both drawings, Uzbekistan: Ak-Darya at Sarmakand, Zerafshan River the caudal fin is almost truncate and both agree drainage; F. A. Turdakov, 1937. with the figure by Kessler (1874) in colour pattern and general appearance. We examined topotypi- Diagnosis. Paracobitis longicauda is distinguished cal fishes from Uzbekistan (ZMMU P-3790; Fig. 4), from the other epigean species of Paracobitis in which have a deeply emarginate, almost forked the Middle East by a combination of characters, caudal fin (vs. slightly emarginate in other indi- none of them unique. The body is fully covered viduals mentioned above) and a colour pattern by scales (vs. scales absent or restricted to flank of dark-brown bars on the caudal peduncle (vs. behind dorsal-fin origin in all species discussed widely spaces blotches or marbled pattern). More here except P. rhadinaea), there are irregularly set material should be examined to test if these dif- blotches on the flank behind dorsal-fin base (vs. ferences are due to individual or geographical one or two row of distinct blotches in P. rhadinaea), variation or if two species might be involved. It and the posterior nare opening is slit-shaped (vs. is beyond the possibilities of this study to revise ovoid or roundish in all species except P. rhadinaea the Paracobitis of Central Asia. Berg (1949) men- and P. vignai). tioned that P. longicauda occurs in the Tedzhen and Murgab Rivers in Afghanistan and Turk- Distribution. Paracobitis longicauda was described menistan. Both of these are endorheic rivers from the Ak-Darya, a river in the Amu Darya flowing in to the Karakum desert. Bânârescu & catchment, Uzbekistan. The species and its dis- Nalbant (1964) noted that P. longicauda is re- tribution are poorly known. stricted in distribution to the Amu Darya drainage in Central Asia. Remarks. Kessler (1872: 65) described Cobitis longicauda based on one specimen from the Ak Darya collected by Alexey P. Fedchenko. Kessler Paracobitis malapterura (1872: 65) wrote, that the colour pattern had almost (Valenciennes, in Cuvier & Valenciennes, 1846) completely faded and the few details in colour (Figs. 5-9) pattern he saw were described in the text. He published a figure of the single type specimen Cobitis malapterura Valenciennes, in Cuvier & (Fig. 30, reproduced here as Fig. 3a) almost with- Valenciennes, 1846: 88, pl. 523 out colour pattern on the trunk. After the original Paracobitis iranica Nalbant & Bianco, 1998: 114, description was published, Kessler got one more fig. 13 specimen from Samarkand, collected by Edmund A. F. Russow. This specimen was much better Material examined. MNHN 3962, B.3070, 2 syntypes, preserved and thus, Kessler added details to its 103-126 mm SL; “sent from Syria”; Aucher-Éloy, description and published it again in (1874). He 1837/1838. – FSJF 2203, 3, 50-64 mm SL; Iran: Qom stated that the specimen from Samarkand was prov.: Taghra River between Jafarie and Dolat-Abad, very similar to the holotype of P. longicauda but 34°42.954' N 50°27.286' E. – FSJF 3226, 40, 32-67 mm SL; the dorsal adipose crest was somewhat higher, Iran: Qom prov.: Qom River southwest of Shashme Ali, the pigmentation more intense and the head 34°21'11" N 50°32'53" E. – FSJF 3451, 2, 70-78 mm SL; wider. Nina Bogutskaya (pers. comm.) suspects FSJF 3229, 11, 31-48 mm SL; Iran: Ablorz prov.: Kordan River near Karaj, 35°57'11" N 50°50'15" E. – SMF 33095, that the artist took the same engraving from what 1, 57 mm SL; Iran: Qom prov.: Qom River at Qom, the drawing was printed in 1872 and added the 34°22'37" N 50°36'06" E. – ZM-CBSU J2717-J2724, 8, colour pattern and the dorsal adipose crest of the 65-79 mm SL; Iran: Semnan prov.: Hable River north second specimen (Kessler, 1874: fig. 22; repro- of Garmsar, Kavir basin, 35°18'07" N 52°24'58" E. – ZM- duced here as Fig. 3b). Kessler (1872, 1874) and CBSU J2708-J2716, 9, 56-84 mm SL; Iran: Markazi prov.: Berg (1949: 449-450) mentioned that the body of Emamzadeh spring at Nazi, about 10 km north of

Khomein, Namak basin, 33°42'57" N 50°04'22" E. – ZM- Remarks. The type locality of P. malapterura is CBSU J2706-J2707, 2, 85-90 mm SL; Iran: Qom prov.: not known. Iranian authors usually identify the Qom River, 34°22'47" N 50°36'08" E. Paracobitis species from the Caspian basin as Material for molecular genetic analysis: FSJF DNA- P. malapterura (Abdoli, 2000; Esmaeili et al., 2010), 2312; Iran: Ablorz prov.: Kordan river near Karaj city, 35°57'11" N 50°50'15" E, GenBank accession number: but there is little reason for this assumption. KJ723511. – FSJF DNA-1989; Iran: Qom prov.: Qom Paracobitis malapterura was described by Cuvier River southwest of Shashme Ali, 34°21'11" N 50°32'53" E, & Valenciennes (1846) based on two individuals GenBank accession number: KJ723515. – FSJF DNA-1992; (MNHN 3962 and B-3070) received in 1840 by the Iran: Ablorz prov.: Kordan River near Karaj, 35°57'11" N Muséum National d’Histoire Naturelle in Paris. 50°50'15" E, GenBank accession numbers: KJ723499, The two syntypes were sent to Paris by Rémi KJ723500, KJ723508, KJ723512. – FSJF DNA-2419; Iran: Aucher-Éloy, a French botanist who moved to Eastern Azerbaijan prov.: Soufi-Chai River at Maraaghe, Constantinople (now Istanbul) to collect plants 37°27'29.50" N 46°16'11.84" E, GenBank accession number: KJ723508. – SMF 33095; Iran: Qom prov.: Qom in the Middle East. Between 1830 and 1838, he River at Qom, 34°22'37" N 50°36'06" E, GenBank acces- travelled widely in the Middle East (see Aucher- sion number: KJ723502. – SMF 33104; Iran: Qom prov.: Éloy, 1843, for the description of his voyage). The Qom River at Qom, 34°22'37" N 50°36'06" E, GenBank two specimens are labelled as coming from Syria accession number: KJ723505. – ZM-CBSU M1053; Iran: but Cuvier & Valenciennes (1846) mentions that Semnan prov.: Hable River north of Garmsar, Kavir “Mr Aucher-Éloy (1792-1838) has sent, from basin, 35°18'07" N 52°24'58" E, GenBank accession num- Syria, a loach”. The two fishes were most likely ber: KJ723503. – ZM-CBSU M1066; Iran: Karaj prov.: sent through an agent from ‘Syria’ (which in- Kordan River, 35°56'51.30" N, 50°49'46.76" E; GenBank accession number: KJ723495. – ZM-CBSU M1071; Iran: cluded today’s Lebanon) to Paris, as it was a Karaj prov.: Kurdan River, 35°56'51.30" N, 50°49'46.76" E; common practice then to have agents receiving GenBank accession number: KJ723501. – ZM-CBSU material and selling it to museums and collections. M738; Iran: Qom prov.: Emamzadeh Abdollah River, The fishes were received in 1840 by MNHN, after 34°22'46.6" N, 50°36'08.0" E; GenBank accession number: the death of Aucher-Éloy in 1838 in Esfahan, in- KJ723493. – ZM-CBSU M739; Iran: Qom prov.: Emamz- dicating that they were collected in the last years adeh Abdollah River, 34°22'46.6" N, 50°36'08.0" E; Gen- of Aucher-Éloy’s travels. In March 1836, large Bank accession number: KJ723496. parts of the collections of Aucher-Éloy were lost by a fire in Constantinople, so the fishes might Diagnosis. Paracobitis malapterura is distin- also have been collected after the fire. guished from the other epigean species of Para In 1836, Aucher-Éloy made several excursions cobitis in the Middle East by a combination of to Greece and Western Anatolia (where no Para characters, none of them unique. The flank behind cobitis occur), and in 1837 he travelled with the the dorsal-fin origin or slightly anterior to the French zoologist M. Dufaud through the north of dorsal-fin base is covered by scales, while the Anatolia along the northern part of Lake Orumi- anterior flank is naked (vs. scales completely yeh to the Caspian Sea in Iran. They surveyed the absent in P. vignai or the body fully covered by western Alborz mountain range in August 1837, scales in P. longicauda and P. rhadinaea). Paracobi and left the mountains on September 2nd travelling tis malapterura has a moderately to slightly emar- along lower Sefid River, through Qazvin and ginate caudal fin (vs. deeply emarginate or forked Karaj to Tehran, where they arrived on September in P. vignai) and a roundish posterior nare open- 5th. From Tehran, they made an extensive excur- ing (vs. slit-shaped in P. longicauda, P. rhadinaea sion to Mount Damávand, and returned on the and P. vignai). 18th September. Dufaud died of fever in Tehran on the 21st October. On the 22nd December 1837, Distribution. Paracobitis malapterura is known Aucher-Éloy continued his travels south, and from the Lake Namak basin and the Hable River reached Qom on the 24th December, where he in the western Kavir basin. We examined two noted “Koum, qui doit son existence a une petit specimens reportedly from Urmia basin (FSJF rivière don’t l’eau est toujours bonne et ne tarit DNA-2419). The locality data, however, require jamais . . . [Qom, which bases its existence on a confirmation before accepting that the species is small river having always good water and never effectively present in Urmia basin. dries out . . .] (Aucher-Éloy, 1843: 464)”. From Qom, he subsequently travelled to Esfahan, and

Fig. 5. Paracobitis malapterura, FSJF 2203, 64 mm SL; Iran: Taghra River.

Fig. 6. Paracobitis malapterura, MNHN 3962, B.3070, syntypes, 126 and 103 mm SL; “sent from Syria”.

Fig. 7. Paracobitis malapterura; Iran: Kordan River; a, FSJF 3451, 69.4 mm SL; b, FSJF 2134, 58.3 mm SL; c, FSJF 3229, 47.2 mm SL; and d, 35.4 mm SL.

Fig. 8. Paracobitis malapterura, FSJF 3226; Iran: Qom River; a, 69.7 mm SL; b, 61.2, mm SL; c, 50.9 mm SL; d, 39.4 mm SL; and e, 35.2 mm SL.

Fig. 9. Paracobitis malapterura, ZM-CBSU J2707, 86 mm SL, Iran: Qom River. from there southwards to Shiraz, Bandar Abbas the two loaches were the only fishes sent for and later taking a boat to Oman and even to Aucher-Éloy to Paris, M. Dufaud might have Baluchistan, before returning to Esfahan where collected them before he died in Tehran, as he he died in 1838. had an interest in zoological materials. Aucher- Aucher-Éloy (1843) did not mention anything Éloy and Dufaud entered the distribution range on his collection of fishes, but he rarely mentioned of Paracobitis when they visited Lake Namak about the collection of specific plants as well. As basin after turning east from the Sefid River to

Tehran; Aucher-Éloy crossed rivers potentially Srivathsan & Meier, 2012), and 1.4 % K2P distance inhabited by Paracobitis until he left Qom. Abdo- between two populations might be indicative for li (2000) reported Paracobitis also from the Oru- the presence of two species. On the other hand, miyeh (Urmia) basin and the Sefid, but the genus this distance might also be found within one spe- Paracobitis has never been observed in these ar- cies (Herbert et al., 2003). We would recognize eas or in the Caspian Rivers west of the Sefid. It both populations as two separate species if there is very likely, that Aucher-Éloy and Dufaud col- were clear morphological differences between lected their Paracobitis in the Namak basin, and them, and would interpret the low detected mo- most likely in the northern tributaries of the lecular differentiation as a sign for a recent evo- Namak basin in the present day Alborz province, lutionary divergence. To clarify the situation, we as Dufaud died before they reached Qom, the examined standard measurements of body shape, next occasion where they might have collected counted fin rays, examined the scales, head and Paracobitis. The two syntypes are indistinguish- lateral line pores and compared the shape of the able from Paracobitis found in Lake Namak basin lips, mouth and fins, the depth and length of the examined from that study. We therefore conclude, adipose crest as well as the colour pattern in all that the two syntypes of P. malapterura have been details between both populations, but found no collected from the Lake Namak basin, most consistent differences. In Paracobitis, juveniles likely from the Karaj River, which flows close to have usually a marbled colour pattern on the Tehran to the south. flank along and above lateral midline and behind Our molecular data place P. malapterura very the dorsal-fin base. Anterior to the dorsal-fin base close to P. iranica, a species described from the and below the lateral midline, the colour pattern Qom River in the Namak basin. Paracobitis irani consists of fine mottling. The complete flank is ca was described by Nalbant & Bianco (1998) covered by a fine mottled or marbled colour pat- based on not-specified differences in colour pattern in some individuals while others show a very ters. Nalbant & Bianco (1998) believed that the clear marbled colour pattern on the entire flank. types of P. malapterura originated from Syria (from Most individuals in both populations possess a where the genus has never been recorded), and marbled colour pattern with a midlateral row of that it is highly unlikely that this species could blotches fused to a lateral stripe in some indi- be conspecific with the Lake Namak populations viduals. The dorsal and caudal fins have elon- (T. Nalbant, pers. comm.). Nalbant & Bianco (1998) gated black blotches on the rays, organized in 1-5 follow Bânârescu & Nalbant (1964) who give the rows, usually 2-3 distinct rows in juveniles, and Tigris-Euphrates basin, which extends through 3-5 fuzzy and indistinct rows in adults. In other Syria, as the distribution range of P. malapterura. individuals, the colour pattern of the dorsal and This might be the reason, why no specific differ- caudal fins might be very irregular and not organ- ences between P. iranica and P. malapterura were ized in rows, but in the form of black blotches mentioned by Nalbant & Bianco (1998). We se- and spots. Generally, there is a trend that small- quenced the COI barcode region of individuals er fishes have more distinct rows of elongated from the Qom drainage (where the type locality black blotches on fins compared to larger adults of P. iranica is located), and of P. malapterura from that show a fuzzier pattern on the fins. the Kordan River, which is a tributary to the Karaj Nalbant & Bianco (1998) distinguished P. irani River. Today, Lake Namak is an endorheic, fish- ca and P. malapterura by their colour pattern. They less saltlake, but it is expected, that it might have gave no further details, but only showed figures. been inhabited by fish in the past (probably at Indeed, on the figure of Nalbant & Bianco (1998: late quaternary), especially when it had a more fig. 13), the holotype of P. iranica has a coarse humid climate (Kehl, 2009; Kehl et al., 2009). marmorate pattern (similar to the individual Judging from our analyzed materials, there is no shown here on Fig. 5), and the syntypes of more gene flow between both the Lake Namak P. malapterura (Fig. 6) have a very fine mottled Paracobitis populations, and no shared haplotypes pattern. While these differences are real between were detected. Both populations show 1.4 % K2P the relatively small holotype of P. iranica (80 SL) sequence divergence in their COI barcode region. and the large types of P. malapterura (103-126 mm There is an ongoing discussion about a priori SL), the colour pattern is highly variable and we genetic thresholds and their use for species de- found no consistent difference between fishes of limitation and recognition (Meier et al., 2006; the same size groups (see Figs. 7-8). We even

Freyhof et al.: Review of Paracobitis Copyright © Verlag Dr. Friedrich Pfeil 21 found an individual from the Qom River (ZM- Diagnosis. Paracobitis smithi is a subterranean, CBSU J2707, 86 mm SL; Fig. 9) with a colour troglomorphic species distinguished from all pattern very similar to the types of P. malapterura. other species of Paracobitis by its whitish or pink As we find no morphological differences between body without any colour pattern (vs. marbled or P. malapterura and P. iranica, and the molecular mottled colour pattern) and the absence of eyes difference between both is small, P. iranica is (vs. present). synonymized here with P. malapterura. Unfortu- nately we could not examine the holotype of Distribution. Paracobitis smithi is only found in P. iranica. a natural well at Kaaje-Ru, near Baq-e-Loveh Oasis in Iranian Zagros Mountains. This is the only known opening of an underground water Paracobitis rhadinaea (Regan, 1906) of unknown extent. (Fig. 10) Remarks. Noemacheilus smithi has been placed in Nemachilus rhadinaeus Regan, 1906a: 8 Paracobitis by Nalbant & Bianco (1998) as the spe- Nemachilus macmahoni Chaudhuri, 1910b: 341 cies has a distinct adipose crest and a slender body. Paracobitis smithi is endemic to the Karoun Material examined. ZM-CBSU N100-N102, 3, 204- drainage in the wider Tigris catchment. Beside 236 mm SL; Iran: Zabol, Taheri spring (known as Nahr- adaptations to subterranean habitat, it is distin- e-Taheri), Sistan Basin, 30°53'59.7" N 61°34'25.1" E. guished from the two other Paracobitis species known until now from the Tigris catchment by Diagnosis. Paracobitis rhadinaea is distinguished the forked caudal fin (vs. slightly emarginate or from the other epigean species of Paracobitis in truncate). Nalbant & Bianco (1998) speculated the Middle East by a combination of characters, that P. smithi might be related to P. vignai, a spe- none of them unique. The body is fully covered cies endemic to the Helmand drainage, but with- by scales (vs. scales absent or restricted to poste- out giving any reason for this speculation. rior flank behind dorsal-fin origin in all other species in the Middle East except P. longicauda), the colour pattern consist of a midlateral row of Paracobitis vignai Nalbant & Bianco, 1998 irregularly set and shaped large dark-brown (Fig. 12) blotches on flank posterior to dorsal-fin base (vs. irregularly set, small dark-brown blotches or short Paracobitis vignai Nalbant & Bianco, 1998: 115, bars not forming a midlateral row in P. longi fig. 14 cauda), the caudal fin is slightly emarginate or truncate (vs. deeply emarginate or slightly forked Material examined. CMNFI 1979-0229, 3, 87-116 mm in P. vignai) and the posterior nare opening is SL; Iran: Sistan prov.: ditch 5 km from Zabol, 31°03' N slit-shaped (vs. ovoid or roundish in all species 61°33' E. except P. rhadinaea and P. vignai). Diagnosis. Paracobitis vignai is distinguished Distribution. Paracobitis rhadinaea is known from from the other epigean species of Paracobitis in the Sistan basin in Iran (Esmaeili et al., 2010) and the Middle East by the absence of scales (vs. pres- the Helmand River in Afghanistan (Bânârescu & ence). It is further distinguished by the combina- Nalbant, 1966). tion of characters: caudal fin deeply emarginate or slightly furcate (vs. moderately or slightly emarginate in P. malapterura and P. rhadinaea), and Paracobitis smithi (Greenwood, 1976) posterior nare opening is slit-shaped (vs. ovoid (Fig. 11) or roundish in all species except P. longicauda and P. rhadinaea). Noemacheilus smithi Greenwood, 1976: 130, fig. 1 Distribution. Paracobitis vignai is known from Material examined. FSJF 3431, 1, 28 mm SL; Iran: the Sistan basin in Iran. Kuzistan prov.: Natural well at Kaaje-Ru, near Baq-e- Loveh oasis, 33°05' N 48°36' E.

Fig. 10. Paracobitis rhadinaea, Collection of K. Golzarianpour, 130 mm SL (above) and 121 mm SL (below); Iran: Sistan.

Fig. 11. Paracobitis smithi, FSJF 3431, 28 mm SL; Iran: Natural well at Kaaje-Ru (photograph: Iraj H. Segherlou).

Fig. 12. Paracobitis vignai, CMNFI 1979-0229, 87.4 mm SL; Iran: Sistan.

Remarks. Paracobitis vignai was described as be- Paracobitis basharensis, new species ing without scales, and this is the case in the three (Figs. 13-14) small specimens examined for this study. Holotype. ZM-CBSU J2920, 58 mm SL; Iran: Kohkiluyeh and Boyer-Ahmad prov.: Bashar River at Dehno, 30°38'42.6" N 51°37'14.26" E; O. Tabiee, 16 July 2012.

Fig. 13. Paracobitis basharensis; Iran: Bashar River; a, ZM-CBSU J2920, holotype, 58.4 mm SL; and b, ZM-CBSU J2919, paratype, 61.4 mm.

Fig. 14. Paracobitis basharensis, Collection of K. Golzarianpour, not catalogued, about 50 mm SL; Iran: Karoun drainage.

Paratype. ZM-CBSU J2919, 61 mm SL; same data tion of head roundish, flattened on ventral surface. as holotype. Caudal peduncle strongly compressed laterally, without crest 2.0-2.3 times longer than deep. Diagnosis. Paracobitis basharensis is distinguished A small, axillary lobe at base of pelvic fin, com- from the other epigean species of Paracobitis in pletely attached to body. Pelvic-fin origin in front the Middle East listed above by its dorsal-fin of vertical of dorsal-fin origin. Pectoral fin reach- origin at about one eye diameter behind a vertical ing approximately 50 % of distance from pectoral- of pelvic-fin origin (vs. above or in front). fin origin to pelvic-fin origin. Pelvic fin not reaching anus. Dorsal fin reaching approximate- Description. For general appearance see Figs. ly to anteriormost tip of adipose crest when 13-14; morphometric data are provided in Table 2. folded backwards. Anus about one eye diameter Medium sized, elongate and laterally compressed behind anal-fin origin. Anal fin reaching ap- 3 species with short head. Predorsal contour almost proximately to /4 of caudal peduncle. Moder- flat, prepelvic contour straight. Body deepest at ately low adipose crest on caudal peduncle. mid way between pectoral and dorsal-fin origin, Margin of dorsal fin straight or convex. Caudal or slightly behind the pectoral fin, depth decreas- fin truncate or slightly emarginate. Largest known ing towards caudal-fin base. No hump at nape. specimen 61.4 mm SL. 1 Greatest body width at pectoral-fin base, body Dorsal fin with 7 /2 branched rays. Anal fin 1 almost equally wide until dorsal fin-origin. Sec- with 5 /2 branched rays. Caudal fin with 9 + 8

Ichthyol. Explor. Freshwaters, Vol. 25, No. 1 Copyright © Verlag Dr. Friedrich Pfeil 24 branched rays. Pectoral fin with 9-10 branched barbel reaching vertical to posterior half of eye. rays, pelvic fin with 5-6 branched rays. Flank No external sexual dimorphism observed. behind dorsal-fin origin covered with small, deeply embedded scales. Back and anterior flank Coloration. In alcohol, background colour on naked. Lateral line complete, with 85-91 pores, head and body beige with brown pattern. Dorsal pores often irregularly set and sometimes slit- surface of head plain cream brown with many shaped on caudal peduncle. Anterior nostril irregularly shaped dots. Cheeks and ventral sur- opening developed as a pointed and flap-like face of head cream or pale brown in preserved tube. Posterior nostril oval, and distal tip of an- fishes. Many medium sized, brown, irregularly terior nostril reaching to posterior nostril when shaped and widely placed blotches forming a folded down. One central and lateral pore in widely mottled pattern on predorsal back and on supratemporal canal. 11 pores in anterior infraor- flank. Adipose crest with few dark-brown blotch- bital canal, 4 pores in posterior infraorbital canal, es, not confluent at base, extending ventrally to 8 pores in supraorbital canal and 8 pores in upper part of caudal peduncle. A dark-brown bar preoperculo-mandibular canal. No suborbital flap at posterior extremity of caudal peduncle. Fin or groove in males. Mouth small, arched. Lips membranes hyaline. Anterior dorsal fin with a moderately thick with prominent furrows. dark-brown blotch at base. Base of middle dorsal- A median interruption in lower lip. Upper lip fin rays hyaline, base of posterior dorsal-fin rays without median incision. Processus dentiformis brown. Dorsal-fin rays brown in middle and with relatively small and blunt. No median notch in hyaline distal margin. Caudal-fin rays with hya- lower jaw. Barbels moderately long, inner rostral line base and distal margin and dark-brown barbel not reaching to base of maxillary barbel; middle part of rays. Pectoral, pelvic and anal-fin outer one reaching vertical of or slightly beyond rays hyaline. posterior base of maxillary barbel. Maxillary

Table 2. Morphometric data of Paracobitis basharensis (holotype, ZM-CBSU J2920; paratype, ZM-CBSU J2919), and P. molavii (holotype, ZFMK 56826; paratypes, FSJF 3357, n = 6). H, holotype.

P. basharensis P. molavii H P H min max mean SD Standard length (mm) 58.4 61.4 63.9 46.0 66.4 In percent of standard length Head length 21.1 21.4 21.2 20.5 22.6 21.7 0.7 Body depth at dorsal-fin origin 11.8 12.4 14.0 14.0 18.0 15.5 1.3 Predorsal length 54.3 51.6 52.4 51.1 55.7 53.2 1.7 Preanal length 73.8 77.7 75.6 75.6 78.0 77.0 0.9 Prepelvic length 51.5 51.2 50.1 50.1 53.9 51.9 1.4 Distance between pectoral and pelvic-fin origins 29.6 30.7 31.4 29.4 32.6 31.3 1.4 Distance between pelvic and anal-fin origins 22.2 24.5 25.4 23.4 25.9 24.8 1.1 Distance between vent and anal-fin origin 3.1 3.2 3.4 2.3 3.7 3.3 0.5 Depth of caudal peduncle 9.5 10.4 9.2 8.9 10.4 9.6 0.6 Length of caudal peduncle 20.1 18.5 16.9 14.2 17.6 15.8 1.4 Dorsal-fin depth 13.0 14.2 13.9 13.9 15.8 15.2 0.6 Anal-fin base length 6.0 6.9 9.1 7.8 9.9 8.7 0.8 Pectoral-fin length 15.5 14.8 13.8 12.3 15.4 13.9 1.1 Pelvic-fin length 12.4 12.7 12.5 11.6 13.5 12.4 0.6 In percent of head length Head depth at eye 41 45 44 44 46 44.4 0.7 Snout length 42 41 42 40 44 42.1 1.3 Eye diameter 16 15 11 11 18 15.0 2.2 Postorbital distance 47 52 50 46 51 48.9 1.8 Maximum head width 61 61 63 57 65 61.8 2.8 Interorbital width 30 30 29 27 29 28.8 0.7

Distribution. Paracobitis basharensis is known opening (vs. slit-shaped in P. longicauda, P. rhadi from the Bashar River which flows to the Karoun. naea and P. vignai).

Etymology. The species is named for the Bashar River in the Karun drainage in which its type Paracobitis molavii, new species locality is situated. An adjective. (Fig. 15-18)

Remarks. Kiavash Golzarianpour (Gonbad) Holotype. ZFMK 56826, 64 mm SL; Iraq: Sulay- found two individuals of this species in the maniyah prov: Zalm at Khurmal, 35°18.38' N 45° Karoun drainage (one individual shown on 58.26' E; J. Freyhof, 7 June 2012. Fig. 14). In both individuals, the dorsal-fin origin is situated clearly behind a vertical of the pelvic- Paratypes. FSJF 3357, 6, 46-66 mm SL; same data fin origin, and they have a widely mottled brown as holotype. (GenBank accession numbers: KJ colour pattern. According to Kiavash Golzarian- 723506, KJ723507, KJ723516, KJ723494) pour, the species is very rare, or very difficult to locate, and he was able to catch only two indi- Additional material (non types). ZM-CBSU M495, 1, viduals despite intensive efforts. The type mate- 59 mm SL; Iran: West Azerbaijan Prov.: Piranshahr- rial for the description was made available by Sardasht road, Little Zab River, 31°11'12" N 51°16'16" E. Omid Tabiee (Arsanjan) who also found only two (GenBank accession number: KJ723517). individuals. These two fishes are also characterized by the posterior position of the dorsal-fin Diagnosis. Paracobitis molavii is distinguished origin and the typical colour pattern. Despite from the other species of Paracobitis in the Middle efforts to find the species again in 2014, HRE could East by having a truncate caudal fin (vs. emargin- not obtain additional material. ate or slightly forked). Relative to the three con- Paracobitis basharensis is distinguished from geners studied for molecular data in the Middle the other species discussed above by the position East, P. molavii is characterized by ten fixed nu- of the dorsal-fin origin, which is situated about cleotide substitutions in the mtDNA COI barcode one eye-diameter behind the vertical of the pelvic- region studied (Table 1). fin origin (vs. in front of the vertical of the pelvic- fin origin in all other species). In one individual Description. For general appearance see Figs. of P. zabgawraensis, a new species described below, 15-18; morphometric data are provided in Table 2. the dorsal-fin origin is also in front of the vertical Medium sized, stout and laterally compressed of the pelvic-fin origin. See the comparative notes species with short head. Predorsal contour slight- on P. zabgawraensis to distinguish these two spe- ly convex, prepelvic contour straight. Body deep- cies from the Tigris drainage. est at dorsal-fin origin, depth, measured without Paracobitis basharensis is further distinguished adipose crest, decreasing towards caudal-fin base. from P. malapterura by a colour pattern of many No hump at nape. Greatest body width at pecto- brown, medium sized, widely spaces and irregu- ral-fin base, body width decreasing almost equal- larly shaped blotches forming a mottled pattern ly behind head. Section of head roundish, flat- on predorsal back and on flank (vs. a coarse brown tened on ventral surface. Males with enlarged marbled pattern and a prominent lateral series of cheeks and dorso-laterally flattened head. Caudal blotches fused into a stripe in some individuals peduncle strongly compressed laterally, without smaller than 80 mm SL). crest 1.4-1.8 times longer than deep. A small Paracobitis basharensis is further distinguished axillary lobe at base of pelvic fin, completely at- from the other epigean species of Paracobitis in tached to body. Pelvic-fin origin below first the Middle East by a combination of characters, branched dorsal-fin ray. Pectoral fin reaching none of them unique. In P. basharensis the flank approximately 35-50 % of distance from pectoral- behind the dorsal-fin origin is covered by small fin origin to pelvic-fin origin. Pelvic fin not reach- scales (vs. scales fully absent in P. vignai or body ing anus. Moderately high to high dorsal and fully covered by scales in P. longicauda and short ventral adipose crest on caudal peduncle. P. rhadinaea). Paracobitis basharensis has a slightly Dorsal fin reaching to or slightly beyond anteri- emarginate caudal fin (vs. deeply emarginate or ormost tip of dorsal adipose crest when folded forked in P. vignai) and a roundish posterior nare down. Anal fin reaching beyond anteriormost tip

Fig. 15. Paracobitis molavii, ZFMK 56826, holotype, 64 mm SL; Iraq: Zalm at Khurmal.

Fig. 16. Paracobitis molavii, FSJF 3357, paratypes; Iraq: Zalm at Khurmal; a, 60 mm SL; b, 56 mm SL; c, 52 mm SL; and d, 46 mm SL.

Fig. 17. Paracobitis molavii, FSJF 3357, paratypes; Iraq: Zalm at Khurmal; a, 60 mm SL; b, 56 mm SL; c, 52 mm SL; and d, 46 mm SL.

Fig. 18. Paracobitis molavii, FSJF 3357, paratype, 56 mm SL; Iraq: Zalm at Khurmal. of ventral adipose crest when folded down. Anus 8 + 8 branched rays. Pectoral fin with 8-9, and about one eye diameter or slightly less in front of pelvic fin with 6-7 branched rays. Flank behind anal-fin origin. Margin of dorsal fin convex. Cau- dorsal-fin origin covered with small, deeply em- dal fin truncate. Largest known specimen 66 mm bedded and often irregularly set scales. Back and SL. anterior flank naked. Lateral line complete or 1 Dorsal fin with 7 /2 branched rays. Anal fin almost complete, with 77-85 pores, often irregu- 1 with 5 /2 branched rays. Caudal fin with 9 + 8 or larly set and in some specimens lateral line inter-

Ichthyol. Explor. Freshwaters, Vol. 25, No. 1 Copyright © Verlag Dr. Friedrich Pfeil 28 rupted on caudal peduncle. Anterior nostril Coloration. In alcohol and life, background col- opening developed as pointed and flap-like tube. our on head and body beige with brown pattern. Posterior nostril oval, distal tip of anterior nostril Dorsal surface of head plain dark-brown or with overlapping posterior nostril when folded down. irregular narrow cream yellow vermiculation and One central and one lateral pore in supratem- cream yellow spots. Cheeks and ventral surface poral canal. 12-14 pores in anterior infraorbital of head cream or pale yellow in preserved fishes, canal, three pores in posterior infraorbital canal, brown in life. Dorsal adipose crest yellowish in 6-8 pores in supraorbital canal and 10 pores in life, yellowish-brown in preserved specimens. preoperculo-mandibular canal. No suborbital flap Brown, small, irregularly shaped and closely set or groove in males. Mouth small, arched. blotches often forming a dense mottled pattern Lips moderately thick with prominent fur- on predorsal back and flank, indistinct in life. rows. A median interruption in lower lip. Upper A very faint inner axial streak visible in preserved lip without or with a very small median incision. specimens. Adipose crest with a series of large Processus dentiformis short and blunt. No me- dark-brown blotches, usually confluent at base, dian notch in lower jaw. Barbels long, inner extending ventrally to upper part of caudal pe- 2 rostral barbel reaching to or about /3 of distance duncle in some individuals. In some individuals, to base of maxillary barbel; outer one reaching adipose crest with a submarginal yellowish area beyond base of maxillary barbel, almost to a and a black margin. Dark-brown blotches reach- vertical of anterior nostril. Maxillary barbel reaching from base of adipose crest up to its margin in ing slightly beyond posterior border of eye. Males some individuals. Black adipose margin incom- more elongate than females and with swollen plete or absent in some individuals. A dark-brown cheeks. or black bar at posterior extremity of caudal peduncle and a jet black spot at uppermost caudal- fin base, confluent with bar. Fin membranes hya-

Table 3. Morphometric data of P. persa (holotype, ZM-CBSU J2659; paratypes, ZM-CBSU J2660-J2671, J2689-J2694, n = 19), and P. zabgawraensis (holotype, ZFMK 56827, paratypes, FSJF 3374, n = 3). H, holotype.

P. persa P. zabgawraensis H min max mean SD H paratypes Standard length (mm) 48.7 22. 71.2 69.0 74.0 58.8 73.4 In percent of standard length Head length 22.3 22.6 26.2 24.9 1.1 21.6 19.9 19.9 20.2 Body depth at dorsal-fin origin 16.4 11.9 15.5 12.9 0.9 12.9 12.0 13.2 12.3 Predorsal length 52.3 49.0 53.7 51.6 1.4 54.2 51.9 53.3 52.8 Preanal length 74.2 71.1 76.3 73.8 1.3 78.2 76.6 77.5 74.4 Prepelvic length 50.8 48.1 54.4 52.2 1.5 52.6 51.6 52.5 51.9 Distance between pectoral and pelvic-fin origins 31.0 26.8 33.2 28.9 1.8 30.0 32.4 31.3 30.9 Distance between pelvic and anal-fin origins 23.8 19.7 25.8 22.0 1.6 25.7 23.8 24.8 26.3 Distance between vent and anal-fin origin 2.6 1.1 4.9 2.5 1.2 2.1 2.1 3.3 2.9 Depth of caudal peduncle 10.5 8.2 10.3 9.7 0.6 8.3 8.4 8.1 8.8 Length of caudal peduncle 18.5 15.4 20.7 18.5 1.3 17.0 17.0 15.2 15.3 Dorsal-fin depth 16.6 15.8 21.1 19.0 1.6 14.4 11.8 15.1 13.6 Anal-fin base length 7.9 5.9 8.9 7.9 0.7 8.1 7.4 7.7 7.8 Pectoral-fin length 17.7 16.1 21.6 19.3 1.5 12.3 13.2 13.8 11.7 Pelvic-fin length 14.9 13.4 17.1 15.4 1 11.7 12.4 13.6 11.3 In percent of head length Head depth at eye 41 39 48 42.4 3 39 39 43 41 Snout length 41 34 47 38.8 4.4 40 41 39 43 Eye diameter 14 12 18 14.8 1.5 14 14 16 17 Postorbital distance 41 42 46 43.5 1.3 48 48 47 52 Maximum head width 58 47 66 54.0 5.5 59 58 54 62 Interorbital width 29 23 31 25.2 2.1 32 30 29 28

Freyhof et al.: Review of Paracobitis Copyright © Verlag Dr. Friedrich Pfeil 29 line. Anterior dorsal fin with a dark-brown blotch Paracobitis molavii is the only described species at base and a second dark-brown blotch at middle of Paracobitis in the Middle East with a truncate of dorsal-fin base. Base of dorsal-fin rays hyaline, caudal fin (vs. emarginate or slightly forked). We brown in middle and with hyaline distal margin. are aware of another, undescribed species of Pectoral and caudal-fin rays with hyaline base Paracobitis with a truncate caudal fin found in the and distal margin and black or dark-brown rays, Atrak River drainage in the south-eastern Cas- irregularly set, elongated dark black or brown pian basin. Berg (1949: 447) examined this species blotches and spots or rays completely black. Anal- and identified it as Nemacheilus malapterurus. He fin base dark-brown or black. Anal-fin rays with differentiated N. malapterurus from P. longicauda an elongated black blotch in the middle and hya- by the presence of scales only on the caudal pe- line margin. Pelvic-fin rays hyaline with a dark- duncle (vs. body completely covered by scales in brown or black stripe in middle. P. longicauda). We examined few Paracobitis from Atrak drainage and this species is well differenti- Distribution. Paracobitis molavii was found in a ated from P. molavii by a naked body with scales headwater stream of the Little Zab River in Iran present only in some individuals and only on the and in the upper Sirwan (Kurdish) drainage dorsal adipose crest (vs. caudal peduncle covered [Sirvan (Persian) or Diyala (Arabic)] in Iran and with scales in P. molavii). Iraq. Both rivers are left side tributaries of the Tigris flowing down from the Zagros mountains. Paracobitis persa, new species Etymology. Named for Jalal ad-Din Muhammad (Fig. 19-22) Balkhi, also‌ known as as Jalal ad-Din Muhammad Rumi ) or simply Mowlavi, Molavi and Rumi, a Holotype. ZM-CBSU J2659, 49 mm SL; Iran: Fars Persian poet, jurist, theologian, and Sufi mystic. prov.: Maloosjan spring east of Beiza, Kor basin, A noun in apposition. 29°52'23" N 52°27'57" E; H. R. Esmaeili, H. Jamali, S. Aminaghai & M. Masoudi, 16 July 2012. Remarks. The phylogenetic tree reconstruction (Fig. 1) suggests that P. molavii is closely related Paratypes. ZM-CBSU J2663-J2671, 9, 22-50 mm to P. malapterura. It is separated from P. malapter SL; FSJF 3450, 3, 35-54 mm SL; same data as ura by a 3.8 % K2P COI sequence divergence, holotype. – ZM-CBSU J2689-J2694, 6, 39-71 mm which is considered as a good indicator that these SL; Iran: Fars prov.: Maloosjan spring east of fishes represent different species (see Herbert et Beiza, Kor basin, 29°52'23" N 52°27'57" E; G. Say al., 2003). Paracobitis molavii is distinguished from yadzadeh, S. Aminaghai & Y. Bakhshi, 22 April the other species in the Middle East by having a 2013. (GenBank accession numbers: KJ723509, truncate caudal fin (vs. emarginate or forked). KJ723504) Paracobitis molavii is further distinguished from P. malapterura by a colour pattern consisting of Additional material. FSJF 3218, 2, 32, 50 mm SL; Iran: brown, small, irregularly shaped and closely set Fars prov.: Maloosjan spring, Kor River basin, 29°52' blotches often forming a dense mottled pattern 37" N 52°28'50" E; R. Patimar, 2010. – CMNFI 77-0510A, 2, 74-81 mm SL; Iran: Fars prov.: stream in front of on predorsal back and on flank (vs. a coarse brown Naqsh-e Rostam, 29°59'30" N 52°54' E, B. Coad, 6 Oct marbled pattern and a prominent lateral series of 1976, ZM-CBSU 750, 1, 57.3 mm SL; Iran: Fars prov.: blotches fused into a stripe in some individuals Sivand (Pulvar) River, Kor basin, 29°59'30" N 52°50'00" E; smaller than 80 mm SL). H. R. Esmaeili & V. Niknejad, 17 July 2003. Paracobitis molavii is further distinguished from the other epigean species of Paracobitis in Diagnosis. Paracobitis persa is superficially simi- the Middle East listed above by a combination lar to P. malapterura from which it is distinguished of characters, none of them unique. The scales by having a very shallow caudal adipose crest, are restricted to the flank behind the dorsal-fin its depth at the highest point being 2.1-3.2 % SL origin or slightly anterior of the dorsal-fin base (vs. 3.3-3.8 in P. malapterura of same size), the (vs. absent in P. vignai or present on whole body tube of the anterior nostril not reaching beyond in P. longicauda and P. rhadinaea) and P. molavii the posterior tip of the posterior nostril when has a roundish posterior nare opening (vs. slit- folded back (vs. fully overlapping posterior nostril shaped in P. longicauda, P. rhadinaea and P. vignai). when folded back in P. malapterura) and the

Fig. 19. Paracobitis persa, ZM-CBSU J2659, holotype, 48.7 mm SL; Iran: Malosjan spring.

Fig. 20. Paracobitis persa, paratypes; Iran: Malosjan spring; a, FSJF 3450, 53.8 mm SL; b, ZM-CBSU J2692, 43.2 mm SL; and c, ZM-CBSU J 2664, 38.6 mm SL. midlateral stripe being always disconnected from ied for molecular data in the Middle East, P. per the blotches and saddles on the caudal adipose sa is characterized by four fixed nucleotide sub- crest (vs. connected in individuals larger than stitutions in the mtDNA COI barcode region 50 mm SL). Relative to the three congeners stud- (Table 1).

Fig. 21. Paracobitis persa, paratypes; Iran: Malosjan spring; a, FSJF 3450, 53.8 mm SL; b, ZM-CBSU J2692, 43.2 mm SL; and c, ZM-CBSU J 2664, 38.6 mm SL.

Fig. 22. Paracobitis persa, ZM-CBSU-J2 689, paratype, 71.2 mm SL; Iran: Malsosjan spring.

Description. For general appearance see Figs. high adipose crest and a very shallow ventral 19-22; morphometric data are provided in Table 3. adipose crest on caudal peduncle. Dorsal fin Medium-sized, elongate and laterally compressed reaching anteriormost tip of adipose crest when species with short head. Predorsal contour convex, folded down. Anus about one eye diameter be- prepelvic contour straight. Body deepest at about hind anal-fin origin. Margin of dorsal fin straight dorsal-fin origin or slightly anterior to it, depth or convex. Caudal fin emarginate. Largest known decreasing towards caudal-fin base. No hump at specimen 81 mm SL. 1 nape. Greatest body width at pectoral-fin base, Dorsal fin with 7 /2 branched rays. Anal fin 1 body almost equally wide until dorsal fin-origin. with 5 /2 branched rays. Caudal fin with 9 + 8 Section of head roundish, flattened on ventral branched rays. Pectoral fin with 9-11, and pelvic surface. Caudal peduncle strongly compressed fin with 7-8 branched rays. Flank behind dorsal- laterally, without crest 1.4-1.5 times longer than fin origin covered with small, deeply embedded deep. A small, often indistinct axillary lobe at scales. Back and anterior flank naked. Lateral line base of pelvic fin, completely attached to body. complete, with 85-91 pores, often irregularly set Pelvic-fin origin below last unbranched dorsal-fin and in some individuals slit-shaped on caudal ray. Pectoral fin reaching approximately 50 % of peduncle. Anterior nostril opening as pointed distance from pectoral-fin origin to pelvic-fin and flap-like tube. Posterior nostril oval, poste- origin. Pelvic fin not reaching anus. Moderately rior tip of anterior nostril not reaching to poste-

Ichthyol. Explor. Freshwaters, Vol. 25, No. 1 Copyright © Verlag Dr. Friedrich Pfeil 32 rior nostril when folded down. One central and Etymology. The species is named for its distribu- lateral pore in supratemporal canal. A second, tion in the Iranian Fars province. A noun in ap- much smaller lateral pore in supratemporal canal position. in some individuals. 9-13 pores in anterior infraorbital canal, three pores in posterior infraor- Remarks. The phylogenetic tree reconstruction bital canal, 6-8 pores in supraorbital canal and (Fig. 1) places P. persa at the root of the pair eight pores in preoperculo-mandibular canal. No P. malapterura and P. molavii. It is separated from suborbital flap or groove in males. Mouth small, P. malapterua by 3.2 % and from P. molawii by arched. Lips moderately thick with prominent 3.8 % K2P COI sequence divergence, which can furrows. A median interruption in lower lip. Up- be considered a good indicator that different spe- per lip without median incision. Processus den- cies are involved (see Herbert et al., 2003). The tiformis large and blunt. No median notch in colour pattern of P. persa is very similar to that of lower jaw. Barbels moderately long, inner rostral P. malapterura of the same size. All P. persa exam- 2 barbel reaching to about /3 of distance to base of ined have a marbled brown colour pattern on the maxillary barbel; outer one reaching vertical of predorsal back. In P. malapterura smaller than or slightly beyond posterior base of maxillary 45 mm SL, there are many small and large ir- barbel. Maxillary barbel reaching vertical of pos- regularly shaped brown blotches on the predor- terior half of eye. No external sexual dimorphism sal back, and in larger individuals these blotches observed. fuse into a marbled pattern identical to the one observed in P. persa. Juvenile P. malapterura small- Coloration. In alcohol and life, background col- er than 45 mm SL also have a midlateral series of our on head and body beige with brown pattern. irregularly shaped dark-brown blotches usually Dorsal surface of head pale-brown with an ir- fused into a stripe as it is the case in P. persa of regular net of narrow beige lines or pale-brown all sizes. In larger individuals of both species, the background or beige and brown marbled. Pre- marbled pattern on the back and the upper ante- dorsal back with a coarse brown marbled pattern. rior flank expands and fuse with the midlateral A midlateral series of irregularly shaped dark- stripe or blotches into a coarse marbled pattern brown blotches fused into a stripe. A series of 3-6 (Fig. 7-8 in P. malapterura; Fig. 20 in P. persa). On dark-brown irregularly shaped saddles or mar- the flank behind the dorsal-fin base, the midlat- morate pattern on dorsal adipose crest extending eral stripe is disconnected from the blotches and ventrally to upper part of caudal peduncle. saddles on the caudal adipose crest in P. persa, Midlateral stripe and marbled dorsal pattern while in P. malapterura larger than 50 mm SL, the confluent on anterior flank in individuals larger midlateral stripe or the midlateral series of than 40 mm SL. Midlateral stripe always discon- blotches are connected to the blotches and saddles nected from blotches and saddles on caudal adi- on the caudal adipose crest. pose crest. Bold dark-brown, irregularly shaped Paracobitis persa is distinguished from P. mo bar at caudal-fin base, wider in middle. A dark- lavii by having a emarginate caudal peduncle (vs. brown spot at uppermost caudal-fin base, conflu- truncate), and a colour pattern of coarse brown ent with bar at caudal-fin base in some individu- marbling and a prominent lateral series of blotch- als. Anterior dorsal fin with dark-brown blotch es or a midlateral stripe (vs. many medium sized, at base and a second dark-brown blotch at middle brown, irregularly shaped blotches forming a of dorsal-fin base, both blotches confluent with mottled pattern on predorsal back and on flank). blotches below dorsal-fin base. Rays in dorsal and Paracobitis persa is distinguished from the caudal fin hyaline at base and at tip, dark-brown other epigean species of Paracobitis in the Middle in middle; a dark-brown bar on distal part of East by a combination of characters, none of them caudal rays in some individuals. Anal, pectoral unique. The scales are restricted to the flank be- and pelvic fins hyaline, dusty brown membranes hind the dorsal-fin origin or slightly anterior of in some individuals. the dorsal-fin base (vs. absent in P. vignai or the body fully covered by scales in P. longicauda and Distribution. Paracobitis persa is known from P. rhadinaea), the caudal fin is moderately deeply Maloosjsn spring and from Sivand River, which emarginate (vs. deeply emarginate or forked in are both situated in the endorheic Kor basin in P. vignai) and P. persa has a roundish posterior southern Iran. nare opening (vs. slit-shaped in P. longicauda,

P. rhadinaea and P. vignai). Paracobitis persa is ized by 19 fixed nucleotide substitutions in the further distinguished by a naked back and ante- mtDNA COI barcode region studied (Table 1). rior flank (vs. body fully covered by scales in P. longicauda and P. rhadinaea or body fully naked Description. For general appearance see Figs. in P. vignai). 23-26; morphometric data are provided in Table 3. Despite several studies on the freshwater Medium-sized, very elongate and laterally com- fishes of the Kor basin (Saadati, 1977; Esmaeili et pressed species with short head. Predorsal con- al., 2007, 2008; Teimori et al., 2010) P. persa is now tour convex, prepelvic contour straight. Body only known from two sites. The type locality is deepest at nape or about middle between nape an isolated spring and the outflowing stream, and dorsal-fin base, depth decreasing towards where it was recorded by Rahman Patimar (Gon- caudal-fin base. No hump at nape. Greatest body bad) and later by GS & HRE. In the collections of width at pectoral-fin base, body almost equally CMNFI and in ZM-CBSU, there are specimens wide until dorsal fin-origin. Section of head from the Sivand (Pulvar) River close to the village roundish, flattened on ventral surface. Caudal Naqshem-e-Rostam (29°59'30" N 52°54' E). Recent peduncle strongly compressed laterally, without investigations by HRE and GS failed to find the crest 1.7-2.1 times longer than deep. No, or a very species in this area, or adjacent sites, since the small axillary lobe at base of pelvic fin, com- river dried out due to the construction of a dam pletely attached to body. Pelvic-fin origin below upstream on the Sivand River. The species might or very slightly in front of dorsal-fin origin. Pec- now survive in a single site. Field work is strong- toral fin reaching approximately 30-40 % of ly recommended to better understand the geo- distance from pectoral-fin origin to pelvic-fin graphic distribution of the species. The species origin. Pelvic fin not reaching anus. Moderately seems to be already Critically Endangered fol- high to shallow adipose crest on caudal peduncle. lowing the IUCN criteria as it is restricted to one No ventral adipose crest. Dorsal fin not reaching population in single site in a landscape which is or reaching to anteriormost tip of dorsal adipose more and more drying out. The population should crest when folded down. Anus about one eye be frequently monitored, as the species might be diameter or slightly less in front of anal-fin origin. already heading to extinction. Margin of dorsal fin convex. Caudal fin emarginate. Largest known specimen 73 mm SL. 1 Dorsal fin with 7 /2 branched rays. Anal fin 1 Paracobitis zabgawraensis, new species with 5 /2 branched rays. Caudal fin with 9 + 8 (Fig. 23-26) branched rays. Pectoral fin with 8-9, pelvic fin with 7-8 branched rays. Flank behind dorsal-fin Holotype. ZFMK 56827, 69 mm SL; Iraq: Erbil origin covered with small, deeply embedded prov.: Chami Rean River near Ziraran, 36°56.60' N scales. Back and anterior flank naked, few iso- 44°11.72' E; Jörg Freyhof, 13 June 2012. lated scales along lateral line on anterior flank. Lateral line complete or reaching to middle of Paratypes. FSJF 3374, 3, 59-74 mm SL; same data caudal peduncle, with 90-94 pores in fishes with as holotype. (GenBank accession numbers: KJ complete lateral line, 74 pores in one individual 723514, KJ723497) with incomplete lateral line. Anterior nostril opening as pointed and flap-like tube. Posterior Diagnosis. Paracobitis zabgawraensis is distin- nostril oval, posterior tip of anterior nostril not, guished from the other epigean species of Para or just overlapping posterior nostril when folded cobitis in the Middle East by having the dorsal-fin down. One central and lateral pore in supratem- origin above the pelvic-fin origin (vs. dorsal-fin poral canal. A second lateral pore in supratem- origin behind pelvic-fin origin in P. basharensis or poral canal, at one side only in two individuals. in front in all other species) and a unique colour 9-10 pores in anterior infraorbital canal, three pattern, which is almost plain brown with a yel- pores in posterior infraorbital canal, 8-9 pores in lowish narrow reticulate pattern (vs. mottled or supraorbital canal and 9-11 pores in preoperculo- marbled, with a midlateral stripe or with large mandibular canal. No suborbital flap or groove brown blotches in other species). Compared to in males. Mouth small, arched. Lips moderately the three congeners studied for molecular data thick with prominent furrows. A median inter- in the Middle East, P. zabgawraensis is character- ruption in lower lip. Upper lip with small me-

Fig. 23. Paracobitis zabgawraensis, ZFMK 56827, holotype, 69 mm SL; Iraq: Chami Rean River.

Fig. 24. Paracobitis zabgawraensis, FSJF 3374, paratypes; Iraq: Chami Rean River; a, 73 mm SL; b, 74 mm SL; and c, 59 mm SL dian incision. Processus dentiformis large and or slightly before base of maxillary barbel. Max- blunt. A median notch in lower jaw in large illary barbel reaching vertical of middle or pos- specimens. Barbels moderately long, inner rostral terior half of eye. No external sexual dimorphism 2 barbel reaching to about /3 of distance to base of observed. maxillary barbel; outer one reaching vertical of

Fig. 25. Paracobitis zabgawraensis, FSJF 3374, paratypes; Iraq: Chami Rean River; a, 73 mm SL; b, 74 mm SL; and c, 59 mm SL.

Fig. 26. Paracobitis zabgawraensis, FSJF 3374, paratype, 73 mm SL; Iraq: Chami Rean River.

Coloration. In alcohol and life, body pale cream with a cream vermiculate or reticulate pattern, yellow with dark to pale brown pattern. Colour most prominent on flank behind dorsal-fin origin. pattern most distinct in smallest individual, but A very faint inner axial streak visible in preserved indistinct, almost plain in larger individuals. specimens. A dark-brown or black bar at poste- Dorsal surface of head plain dark-brown with an rior extremity of caudal peduncle. In smallest irregular narrow cream yellow vermiculation and individual, a jet black spot at uppermost caudal- cream yellow spots, distinct in smallest individ- fin base. Membrane of caudal fin with black ual but indistinct in larger individuals. Cheeks blotches. Membranes of other fins hyaline. Ante- and ventral surface of head cream or pale yellow rior dorsal fin with a dark-brown blotch at base in preserved fishes, brown in life. Dorsal adipose and a second dark-brown blotch at middle of crest and base of fins yellowish in life, yellowish- dorsal-fin base. Both blotches absent in one large brown in preserved specimens. An indistinct individual. Base of dorsal-fin hyaline, or with coarse, dark-brown marbled pattern on predorsal. minute dark-brown spots. Dorsal-fin rays dark- Flank without any distinct pattern in largest in- brown with hyaline distal margin. Pectoral- and dividual. In smaller individuals, flank pale brown caudal-fin rays with many irregularly set dark-

Ichthyol. Explor. Freshwaters, Vol. 25, No. 1 Copyright © Verlag Dr. Friedrich Pfeil 36 brown stripes and spots and hyaline distal Bânârescu & Nalbant (1964: 29) described two margin. Anal- and pelvic-fin rays dark-brown specimens identified as Paracobitis malapterura with hyaline base and hyaline distal margin, from the Habour at Ekibey tüssebab (Beytüssebap, anterior part of anal-fin base covered with dark- 37°36'00" N 43°10'12" E) in Turkey. They also show brown blotches. a drawing of one of the individuals (pl. 6: fig. 8), which has a plain brown anterior body and very Distribution. Paracobitis zabgawraensis is known fine pale brown lines on the posterior body. The from a headwater stream of the Great Zab River description as well as the figure clearly shows in Iraqi Kurdistan and the Habour in Turkey. P. zabgawraensis.

Etymology. The species is named for the Great Comparative material. Oxynoemacheilus cyri: Material Zab River, the Zab Gawra in Kurdish language. used in the molecular genetic analysis: FSJF DNA-2407; An adjective. Turkey: stream between Göle and Ardahan close to Yigitkonagı, 40°58'09" N 42°35'12" E. (GenBank accession numbers: KJ723498, KJ723513) Remarks. In our phylogenetic tree based on the COI barcode region (Fig. 1), P. zabgawraensis is placed at the base of all other Paracobitis species Acknowledgments studied here. It is separated from P. persa by 5.4 % K2P COI sequence divergence, which is consid- We are pleased to thank S. Vatandoust, H. Mousavi, H. ered as a strong indicator that these populations Jamali, S. Aminaghai, M. Masoudi, R. Zamanian Nejad, represent different species (see Herbert et al., A. Gholamifard, S. Mirghiasi, B. Parsi, M. Ghasemian 2003). and Y. Bakhshi for helping with fish collection in Iran, In one of the individuals of P. zabgawraensis, and Shiraz University for financial support. Many the dorsal-fin origin is situated slightly behind a thanks to Hana A. Raza and Mariwan Qadir (Nature vertical of pelvic-fin origin, while in all others it Iraq, Sulaymaniyah) for their great help during fieldwork in Iraqi Kurdistan; to Rahman Patimar and Kia- is above the pelvic-fin origin. Paracobitis basharen vash Golzarianpour (both Gonbad), Theo Nalbant sis is another species from the Tigris drainage in (Bucarest), Omid Tabiee (Arsanjan) and Iraj Hashemza- which the dorsal-fin origin is situated behind a deh Segherloo (Shahrekord) for providing unpublished vertical of pelvic-fin origin. In one individual of information, pictures and material; Brian Coad (CM- P. zabgawraensis, the dorsal-fin origin is slightly NFI), Ekaterina Vasileva (ZMMU), Kai Borkenhagen behind a vertical of pelvic-fin origin (vs. about (SMF) and Patrice Pruvost (MNHN) for allowing access one eye diameter behind a vertical of pelvic-fin to material under their care. Many thanks to Environ- origin in P. basharensis). Paracobitis zabgawraensis ment Departments of Fars and Semnan Provinces for supporting field surveys in Iran. This study is a product also has an unique colour pattern, which is almost of the FREDIE project, supported by the Leibniz As- plain brown with a yellowish, narrow reticulate sociation Joint Initiative for Research and Innovation pattern in individuals larger than 70 mm SL (vs. (SAW). Rajeev Raghavan (Cochin) read and helped marbled or with small brown blotches, or flank improve the English text. with brown, large, irregularly shaped and widely set blotches). It is further distinguished from P. basharensis by a very slender body (body depth Literature cited at dorsal-fin origin 12-13 % SL vs. 14-18), a deeper caudal peduncle, 1.7-2.1 (vs. 2.0-2.3) times Abdoli, A. 2000. The inland water fishes of Iran. Ira- longer than deep. Paracobitis zabgawraensis is nian Museum of Nature and Wildlife, Tehran, further distinguished by a naked anterior flank, 378 pp. [In Farsi]. where few scales are found along the lateral line Aucher Eloy, R. 1843. Relations de voyages en Orient de 1830 à 1838; revues et annotées par M. le Comte only (vs. scales being fully absent in P. vignai or Jaubert, accompagnées d’une carte géographique a body fully covered by scales in P. longicauda and où sont tracés tous les itinéraires suivis par Aucher- P. rhadinaea). Paracobitis zabgawraensis has a slight- Eloy. Roret, Paris, (1): i-xxxi, 1-364; (2): 365-775, ly emarginate caudal fin (vs. deeply emarginate 1 map. or forked in P. vignai) and a roundish posterior Bânârescu, P. & T. T. Nalbant. 1964. Süsswasserfische nare opening (vs. slit-shaped in P. longicauda, der Türkei. 2. Teil. Cobitidae. Mitteilungen aus dem P. rhadinaea and P. vignai). Hamburgischen Zoologischen Museum und Insti- tut, 61: 159-201.

Bânârescu, P & T. T. Nalbant. 1966. The 3rd Danish Kessler, K. T. 1872. [Ichthyological fauna of Turkestan]. Expedition to Central Asia. Zoological results 34. Izvestiia Imperatorskago Obschchestva Liubitelei Cobitidae (Pisces) from Afghanistan and Iran. Vi- Estestvozaniia, Antropologii i Etnografii, 10: 47-76. denskabelige Meddelelser fra Dansk Naturhistorisk [In Russian]. Forening i København, 129: 149-186. Kessler, K. 1874. [Fishes (Pisces)]. In A. P. Fedchenko, Bânârescu, P, & T. T. Nalbant. 1995 A generical classi- [Travel to Turkestan. Vol. 2. Zoogeographical ex- fication of Nemacheilinae with description of two ploration]. Izvestiya Obshchestva Lyubitelei Estest- new genera (Teleostei: Cypriniformes: Cobitidae). voznaniya, Antropologii i Etnografi , 11: 1-63, 8 pls. Travaux du Muséum d’Histoire Naturelle “Grigore [In Russian]. Antipa”, 35: 429-496. Kottelat, M. 1990. Indochinese nemacheilines. A revision Berg, L. S. 1949. [Freshwater fishes of the U.S.S.R. and of nemacheiline loaches (Pisces: Cypriniformes) of adjacent countries. Part. 2. Fourth edition]. Izdatel- Thailand, Burma, Laos, Cambodia and southern stvo Akademii Nauk SSSR, Moskva & Leningrad, Viet Nam. Pfeil, München, 262 pp. pp. 470-925. [In Russian; translation: Israel Program — 2012. Conspectus cobitidum: an inventory of the for Scientific Translations, Jerusalem, 1965]. loaches of the world (Teleostei: Cypriniformes: Biomatters. 2013. Geneious Pro. Available: http://www. Cobitoidei). The Raffles Bulletin of Zoology, Suppl. geneious.com 26: 1-199. Bleeker, P. 1863. Sur les genres de la famille des Cobi- Kottelat, M. & J. Freyhof. 2007. Handbook of European tioïdes. Nederlandsch Tijdschrift voor de Dierkunde, freshwater fishes. Kottelat, Cornol and Freyhof, 1: 361-368. Berlin, xiv + 646 pp. Coad, B. W. 2010. Freshwater fishes of Iraq. Pensoft Meier, R., K. Shiyang, G. Vaidya & P. K. L. Ng. 2006. Publishers, Sofia & Moscow, 294 pp. DNA barcoding and taxonomy in Diptera: a tale of Cuvier, G. & A. Valenciennes. 1846. Histoire naturelle high intraspecific variability and low identification des poissons. Tome dix-huitième. Bertrand, Paris, success. Systematic Biology 55: 715-728. xix + 505 pp., pls. 520-553. Min, R,. X. Y. Chen, & J. X. Yang. 2010. Paracobitis nan Edgar, R. C. 2004. MUSCLE: multiple sequence align- panjiangensis, a new loach (Balitoridae: Nemacheil- ment with high accuracy and high throughput. inae) from Yunnan, China. Environmental Biology Nucleic Acids Research, 32: 1792-1797. of Fishes, 87: 199-204. Esmaeili, H. R., B. W. Coad, A. Gholamifard, N. Nazari Nalbant, T. T. & P. G. Bianco. 1998. The loaches of Iran & A. Teimory. 2010. Annotated checklist of the and adjacent regions with description of six new freshwater fishes of Iran. Zoosystematica Rossica, species (Cobitoidea). Italian Journal of Zoology, 65: 19: 361-386. 109-123. Esmaeili, H. R., A. Teimori, B. W. Coad & Z. Gholami. Nguyen, V. H., 2005. [Freshwater fishes of Vietnam. 2008. Threatened fishes of the world: Cobitis linea Volume 2] . Nhà Xuât Ban Nông Nghiêp [Agricul- (Heckel, 1849) (Cobitidae). Environmental Biology ture Publishing House], Hanoi, 759 pp. [In Vietna- of Fishes, 83: 407-408. mese]. Esmaeili, H. R., A. Teimory & A. Khosravi. 2007. A note Posada, D. & K. A. Crandall. 1998. MODELTEST: test- on the biodiversity of Ghadamghah spring-stream ing the model of DNA substitution. Bioinformatics, system in Fars Province, Southwest Iran. Iranian 14: 817-818. Journal of Animal Biosystematics, 3: 15-22. Prokofiev, A. M. 2009. Problems of the classification Freyhof, J., F. Erk’akan, C. Özeren, & A. J. Perdices. and phylogeny of Nemacheiline loaches of the group 2012. An overview of the western Palaearctic loach lacking the preethmoid I (Cypriniformes: Balitori- genus Oxynoemacheilus (Teleostei: Nemacheilidae). dae: Nemacheilinae). Journal of Ichthyology, 49: Ichthyological Exploration of Freshwaters, 22: 301- 874-898. 312. Saadati, M. A. G. 1977. Taxonomy and distribution of Hebert, P. D. N., A. Cywinska, S. L. Ball & J. R. de the freshwater fishes of Iran. M. S. Thesis, Colorado Waard. 2003. Biological identifications through State University, Fort Collins, xiii + 212 pp. DNA barcodes. Proceedings Biological Sciences B, Saitou. N. & M. Nei. 1987. The Neighbor-Joining Biological Sciences, 270: 313-321. Method – a new method for reconstructing phylo- Ivanova, N. V., T. S. Zemlak, R. H. Hanner & P. D. N. genetic trees. Molecular Biology and Evolution, 4: Hebert. 2007. Universal primer cocktails for fish 406-425. DNA barcoding. Molecular Ecology Notes 7: 544- Srivathsan, A. & R. Meier. 2012. On the inappropriate 548. use of Kimura-2-parameter (K2P) divergences in Kehl, M. 2009. Quaternary climate change in Iran – the the DNA-barcoding literature. Cladistics, 28: 190- state of knowledge. Erdkunde, 63: 1-77. 194. Kehl, M., M. Frechen & A. Skowronek. 2009. Nature Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis and age of Late Quaternary basin fill deposits in Using Parsimony (* and Other Methods). Version the Basin of Persepolis/Southern Iran. Quaternary 4. Sinauer Associates, Sunderland. International, 196: 57-70.

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Teimori, A., H. R. Esmaeili & A. Gholamhosseini 2010. Nei & S. Kumar. 2011. MEGA5: Molecular Evolu- The ichthyofauna of Kor and Helleh River basins tionary Genetics Analysis using Maximum Likeli- in southwest of Iran with reference to taxonomic hood, Evolutionary Distance, and Maximum Par- and zoogeographic features of native fishes. Ira- simony Methods. Molecular Biology and Evolution, nian Journal of Animal Biosystematics, 6: 1-8. 28: 2731-2739.

Received 24 March 2014 Revised 17 April 2014 Accepted 18 April 2014

Freyhof et al.: Review of Paracobitis Ichthyological Exploration of Freshwaters An international journal for field-orientated ichthyology

INSTRUCTIONS TO CONTRIBUTORS

Warning normal library channels cannot be cited. In-press manuscripts can be Prospective authors should read carefully the following instructions and cited only if they have been formally accepted. follow them when submitting a manuscript. Doing so significantly hastens Tables. Tables should be included in the text file, at the end. Use Word publication and saves money and efforts. Manuscripts which do not satisfy format and do not anchor them. Tables must be numbered sequentially the instructions below may be rejected at the Editor’s discretion and will with Arabic numerals; they should have concise but self-explanatory head- not be returned. ings. Do not insert frames, vertical rules, dotted lines or footnotes. The Submission of manuscripts location of first citation of each table should be clearly indicated in the text. The original manuscript should be sent to the Editor, Maurice Kottelat, Figures. Detailed instructions for the preparation of digital images are by e-mail ([email protected]). Additional information is requested: here: http://pfeil-verlag.de/div/eimag.php 1) the name, postal and e-mail addresses, telephone and fax numbers of the corresponding author; For the submission of new manuscript only low resolution copies are 2) the names, postal and e-mail addresses of up to four persons outside needed. Do not send large files at this stage. Case by case, if needed, we the authors’ institutions who are qualified to review the paper; and may ask you to send the original files at the time of submission. 3) a statement that the material has not been published and is not consid- All maps, graphs, charts, drawings and photographs are regarded as ered for publication elsewhere and that it will not be submitted elsewhere figures and are to be numbered consecutively and in the sequence of unless it is rejected or withdrawn. In submitting a manuscript, the author(s) their first citation in the text. When several charts or photographs are accept(s) transfer of the copyright to the Publisher. grouped as one figure, they must be trimmed and spaced as intended Co-authors, corresponding author for final reproduction. Each part of such a group figure should be lettered Authors are those who have played a significant role in designing and with a lower case block letter in the lower left corner. Where needed, scale conducting the research and in writing the manuscript. Individuals who should be indicated on the figure by a scale bar. have only collected data, provided material or financial support, or re- All illustrations should be designed to fit a width of 68 or 140 mm and a viewed the manuscript should be listed in acknowledgments. Honorary depth no greater than 200 mm. Lettering should be large enough to be authorship is not accepted. easily seen when reduced onto a journal column (68 mm). Co-authors should designate a single corresponding author to whom correspondence and proofs will be sent. All correspondence regarding the If a vector-graphics program is used, the original files saved by this paper should go through the corresponding author. Correspondence will not program and all linked files must be submitted. Do not export or save the be sent to other co-authors and correspondence from other co-authors re- figure in a different format (for more details see the informations on http:// garding the manuscript will neither be answered nor taken into consideration. pfeil-verlag.de/div/eimag.php If line drawings are scanned, the resolution must be 1200 dpi or more Format and the format must be bitmap (1 pixel = 1 bit). Files. The manuscript should be submitted in DOC or RTF format only. If halftones are scanned, the resolution should never be lower than 400 dpi, The text, captions, tables etc. must all be included in the same file. It the applied to a width of 14 cm, even for photographs designed for column width. manuscript includes only a few illustrations, include them in low resolution in the word file. If the manuscript includes numerous illustrations they must Photographic prints and slides and original drawings must be scanned be submitted in a separate PDF file; send all figures in low resolution and for submission. We will ask to send the original after acceptance of the with caption in a single file. The files should be less than 8 MB. manuscript. Text. All manuscripts are subject to editorial revision before final acceptance Colour illustrations should preferably be submitted as slides (photographic for publication. Nothing in the manuscript should be underlined. Titles with slides, not slides prepared by a printer). Digital images should be only numerical series designations are not permitted. Titles should be brief, unmodified (raw) data files as originally saved by the camera or the fewer than 20 words and should indicate clearly the field of study and scanner. If the data files are modified, a copy of the original, unmodified the group of fishes investigated. All abbreviations should be explained in file should be submitted too. the Method section (or figure caption when appropriate) or a reference to The decision to print in colour or in black and white any figure originally published explanations should be provided; exceptions are very common submitted in colour remains with the editor and publisher. This decision abbreviations, such as mm, km, kg, sec, min, yr, vs., SL. Footnotes are will be based on scientific justification, quality of the original, layout and not permitted. All measurements must be in metric units. The first page other editorial, financial and production constraints. By submitting colour should include: title of the paper, author(s), addresses and abstract, all originals, the authors know and accept that they may be published in black left justified. The text should be followed by Material Examined (if ap- and white. propriate), Acknowledgments (if any), Appendix (if any) and Literature Review Cited, in that order. Keys are desirable in taxonomic papers. They should Each manuscript will be sent to two reviewers for confidential evalua- be dichotomous and not serially indented. tion. When justified, the reviewer’s comments will be forwarded to the Nomenclature. Names of living organisms should follow the appropriate corresponding author. When submitting a revised manuscript, authors and current International Codes of Nomenclature. Only formal names of should briefly indicate the reasons for disregarding any suggestion they genera and species should be written in italics. Names of authors and pub- consider unacceptable. Remember that if a reviewer had questions or did lication dates of scientific names should be mentioned once, in introduction not understand you, other readers may make the same experience and or discussion, depending where most convenient, exceptionally as a table; the answers should be in the manuscript and not in a letter to the editor. bibliographical references must be included in the Literature cited section. Changes in style, format and layout requested by the Editor are non- Very old and classical works can be omitted if not absolutely justified. negotiable and non-observance will result in rejection of the manuscript. Revised manuscripts received more than 6 months after the reviewers’ Language. Manuscripts should be written in English. All papers must comments had been sent will not be considered or will be treated as new have a concise but informative abstract in English. In taxonomic papers, submissions. the abstract must include at least clear diagnosis of the new taxa. This maybe omitted for papers including the descriptions of many new taxa; Proofs, Reprints and Page Charges consult the editor first. A second abstract, provided by the author(s), in A PDF proof file will be sent to the corresponding author; it should be the language of the country or area concerned by the text is acceptable. checked and returned to the Editor within one week. If corrections are not A maximum of two abstracts is permitted. received within this delay, they may be done by the Editor, at the author’s risks. Authors may be charged for any changes other than printer’s error. Acknowledgments. Identify individuals by first name(s) and surname. Do Reprint orders must be forwarded with the corrections. The correspond- not list titles, position or institution. Acknowledge individuals, not positions. ing author is responsible for contacting the co-authors and forwarding Idiosyncrasy and private jokes are not permitted. their reprint orders. Literature cited. Format for Literature Cited is that of the most recent The authors will receive a PDF file for personal use free of charge; issue. Do not abbreviate the names of journals. For books, give full name high-resolution PDF files for unlimited use may be ordered. There will be of publishing company or institution, and city. Manuscripts in preparation, no page charges and no charges for justified colour illustrations. abstracts, in-house reports and other literature not obtainable through Ichthyological Exploration of Freshwaters An international journal for field-orientated ichthyology

Volume 25 • Number 1 • August 2014

C O N T E N T S

Freyhof, Jörg and Müfit Özulug: Acanthobrama thisbeae, a new species of bream from southern Anatolia, Turkey (Teleostei: Cyprinidae)...... 1 Freyhof, Jörg, Hamid Reza Esmaeili, Golnaz Sayyadzadeh and Matthias Geiger: Review of the crested loaches of the genus Paracobitis from Iran and Iraq with the description of four new species (Teleostei: Nemacheilidae)...... 11 Esguícero, André L. H. and Ricardo M. C. Castro: Knodus figueiredoi, a new characid from the Rio das Garças, upper Rio Araguaia basin, Brazil, with comments on the taxonomic limits of the genera Knodus and Bryconamericus (Teleostei: Characidae)...... 39 Lamboj, Anton: Two new species of Parananochromis from Cameroon, Central Africa (Tele- ostei: Cichlidae)...... 49 Kim, Daemin, Hyung-Bae Jeon and Ho Young Suk: Tanakia latimarginata, a new species of bitterling from the Nakdong River, South Korea (Teleostei: Cyprinidae)...... 59 Low, Bi Wei, Heok Hui Tan and Ralf Britz: Trichopodus poptae, a new anabantoid fish from Borneo (Teleostei: Osphronemidae)...... 69 Costa, Wilson J. E. M.: Six new species of seasonal killifishes of the genus Cynolebias from the São Francisco river basin, Brazilian Caatinga, with notes on C. porosus (Cyprinodonti- formes: Rivulidae)...... 79

Cover photograph Parananochromis orsorum, female (photograph by A. Lamboj) Anton Lamboj (this volume pp. 49-57)

Articles appearing in this journal are indexed in:

AQUATIC SCIENCES and FISHERIES ABSTRACTS BIOLIS - BIOLOGISCHE LITERATUR INFORMATION SENCKENBERG CAMBRIDGE SCIENTIFIC ABSTRACTS CURRENT CONTENTS/AGRICULTURE, BIOLOGY & ENVIRONMENTAL SCIENCES and SCIE FISHLIT ZOOLOGICAL RECORD