(Peltecanthon) Staigi (Coleoptera) No Domínio De Mata Atlântica

Universidade Federal de Pernambuco Centro de Biociências Programa de Pós-Graduacão em Genética

Celso Alexandre Ferreira Neto

Análise da estrutura genética de populações de Canthon (Peltecanthon) staigi (Coleoptera) no domínio de Mata Atlântica.

Recife 2016

Celso Alexandre Ferreira Neto

Análise da estrutura genética de populações de Canthon (Peltecanthon) staigi (Coleoptera) no domínio de Mata Atlântica.

Tese apresentada ao Programa de Pós-Graduação em Genética da Universidade Federal de Pernambuco como parte dos requisitos exigidos para obtenção do título de Doutor em Genética.

Orientador: Rita de Cássia de Moura Coorientador: Valdir de Queiroz Balbino

Recife 2016

Catalogação na Fonte: Bibliotecário Bruno Márcio Gouveia, CRB-4/1788

Neto, Celso Alexandre Ferreira Análise de estrutura genética de populações de Canthon (Peltecanthon) sataigi (Coleoptera) no domínio de Mata Atlântica / Celso Alexandre Ferreira Neto. – Recife: O Autor, 2016. 183 f.: il. . Orientadores: Rita de Cássia de Moura, Valdir de Queiroz Balbino Tese (doutorado) – Universidade Federal de Pernambuco. Centro de Biociências. Programa de Pós-graduação em Genética, 2016.

Inclui referências, anexos apêndices

1. Besouro 2. Genética de populações 3. Mata atlântica I. Moura, Rita de Cássia (orient.) II. Balbino, Valdir de Queiroz (coorient.) III. Título.

595.76 CDD (22.ed.) UFPE/CB-2010-269 3

Celso Alexandre Ferreira Neto

Análise da estrutura genética de populações de Canthon (Peltecanthon) staigi (Coleoptera) no domínio de Mata Atlântica

Aprovado em 17/06/2016

Banca Examinadora:

______Dra. Rita de Cássia de Moura Universidade de Pernambuco

______Dr. Martín Alejandro Montes Universidade Federal Rural de Pernambuco

______Dr. Maria Raquel Moura Coimbra Universidade Federal Rural de Pernambuco

______Dr. Carlos Alberto Santiago Figueirêdo Júnior Universidade Federal de Pernambuco

______Dr. Ana Maria Benko Iseppon Universidade Federal de Pernambuco

Recife 2016 3

Dedico o maior passo e desafio da minha vida, este trabalho, às duas pessoas que com muito amor e perseverança me proporcionaram a base da minha educação e do meu caráter. Aos meus pais, Hélia e Hilton.

Agradecimentos

Agradeço à Universidade Federal de Pernambuco (UFPE) pela oportunidade de cursar e vivenciar o Programa de Pós-Graduação em Genética, que ao longo de quatro anos instruiu-me como aluno e pesquisador, dando-me a oportunidade de desenvolver o que considero minha maior competência, à docência.

À Universidade de Pernambuco (UPE), minha segunda casa pela qual tenho um apreço gigantesco, que desde a minha graduação tem me auxiliado com o espaço físico, equipamentos e insumos dos laboratórios, amizade dos funcionários e professores, meus eternos mestres.

À Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco

(FACEPE) pela Bolsa de doutorado (IBPG-0831-2.02/11), pela oportunidade legitimada de exercer a docência, uma das maiores realizações de minha vida, e pelos recursos destinados aos projetos APQ 0464-2.02/10 – R. C. Moura e APQ

1104-2.08/08 – M.S.M. Cavalcanti.

À Profª Drª Rita de Cássia de Moura, uma das maiores responsáveis por eu ter chegado aqui, pois com sua imensa bagagem profissional me orientou nos momentos acadêmicos, me aconselhou e me alertou nos momentos que me senti perdido, foi amiga nas horas de descontração, escutou-me nos momentos de angústia, e teve uma paciência enorme nos momentos que errei e/ou perdi o foco e/ou desanimei.

Ao Prof. Dr. Valdir Queiroz Balbino, pela co-orientação e disponibilidade.

Agradeço também aos seguintes pesquisadores e Instituições: à equipe da

Profa Dra Anete Pereira da UNICAMP pela oportunidade de participar do curso

“Construção de Bancos Enriquecidos em Microssatélites de Eucariotos; ás Dra

Tereza Cartaxo, Dra Adriana Vieira e Dra Nara Diniz da UPE; ao Dr. Amaro de 5

Castro, a Dra Tania Rieger e ao Dr. Tyago Eufrásio, respectivamente, do IPA e

UFPE que contribuíram no desenvolvimento do trabalho através da disponibilidade de infraestrutura; ao Dr. Neto Costa Ferreira e Msc. Manassés Daniel da UFPE pelo compartilhamento de conhecimentos científicos; à Dra Karla Yotoco e a MsC Tércia

Vargas UFV pela doação das amostras de Canthon (Peltecanthon) staigi coletadas no sudeste do Brasil; ao Dr. Fernando Silva da UFPA e a MsC Cristiane Costa da

UFLA pela identificação da espécie analisada; à Dra Luciana Iannuzzi da UFPE pela confirmação da identificação dos espécimes.

Ao pessoal do Laboratório de Biodiversidade e Genética de Insetos (LBGI) -

UPE, eu não tenho palavras para traduzir meu amor e todo meu sentimento de gratidão por toda ajuda e empenho fornecido a mim, meus amigos de laboratório sabem bem que meus atos traduzem melhor meus sentimentos. Obrigado Adriana,

Crislaine (Crislaininha), Rógean (Rrrrrrógean), Zilpa (Zilps!) e minhas meninas Aline

(Alininha), Karol (Kerolaine), Moara (Moarete) e Rafaelle (Rafinha), pela contribuição direta no meu trabalho, através de encorajamento. E aos antigos, Amanda, Cristiane

(Crisinha), Diogo, Fernando (Pai), Janaína (Janinha), Jéssica (Jessiquinha), Julliana

(Jujuzinha), Lucas, Luís (Camões), Profa Marília (minha primeira orientadora) e

Sárah (Sarita). À Dona Teresa, que além de cuidar do Departamento de Biologia, cuidou de mim como cuida de um filho, junto com o Sr. Eduardo. Um grande agradecimento ao Sr. Rômulo por viabilizar diversas coletas e ser sempre tão animado e descontraído, o que ajuda muito a reaver os ânimos cansados.

Um agradecimento especial, dentre os amigos de laboratório, ao Dr. Geyner

Alves por ter contribuído diretamente no meu trabalho, seja com sua expertise e/ou contribuições nos manuscritos; e a Igor (O metaleiro!), que participou ativamente do primeiro artigo dessa tese e madrugou comigo entre PCRs, géis, e matrizes binárias.

À minha família, a base que tenho para edificar meu caráter e todos os meus projetos de vida. À minha mãe, mulher que mais amo na vida, meu maior exemplo de amor, sabedoria e compaixão, que mesmo diante de tantas provações e dificuldades, se manteve firme e lutando, servindo de inspiração para mim. Ao meu pai, que com seu amor e experiência de vida, ensinou o bem e me afastou do mal. À minha irmã Hítala que me orgulhou sendo monitora de genética na sua graduação; ao meu irmão Hilton, que apesar das brigas, percebo uma admiração pelo irmão mais velho; e à minha irmã mais nova, Alice, minha pequena Padwan. À vovó Maria, que com sua enorme sabedoria me deu conselhos valorosos. À vovó “Nêga”, sempre serena e contente, mostrando-me que a tristeza é um estado nocivo. Ao meu vovô Celso, do qual eu herdo meu nome, que beirou a morte, mas continuou conosco, compartilhando ensinamentos e passagens de sua vida que irei levar comigo para sempre.

À Erika Ekatherina, minha noiva, que me deu carinho e me apoiou diante das minhas tristezas, inseguranças e frustrações, além de me mostrar que é possível viver sem falar o tempo todo sobre ciência. Ao clube do Bolinha, meus amigos de graduação que juntos fundamos o In primis sapientia, grupo de discussão sobre ciência, artes e filosofia, o que alimentou minha fome por conhecimento; e aos amigos não biólogos/cientistas, que mesmo me zoando o tempo todo sobre o meu trabalho, torceram pela minha felicidade e tentaram me levar para a diversão.

"Preocupo-me como alcançarei a morte, porém a morte não me frustra nem me assusta, pois é inevitável... O único inevitável que me frustra e ao mesmo tempo me assusta é saber que morrerei sem ter aprendido tudo que o universo me permite aprender."

Celso Alexandre

Resumo

O besouro Canthon (Peltecanthon) staigi ocorre no domínio de Mata Atlântica sendo considerado um bioindicador. Este trabalho teve como objetivo analisar a estrutura genética populacional de C. (P.) staigi em oito remanescentes localizados no Nordeste e Sudeste brasileiro através de marcadores ISSR e SSR. Foram obtidos

186 loci polimórficos de ISSR e vinte e quatro loci de SSR para C. (P.) staigi, destes quatro foram polimórficos e cinco transferíveis para espécies relacionadas. Os valores de maior e menor heterozigosidade foram verificados nas populações de

PES - PE/ GUA - PB e TAM - PE, respectivamente, com esta última apresentando desequilíbrio de Hardy-Weinberg. No Nordeste, através dos dois marcadores, foi observada baixa estruturação genética e fluxo gênico histórico, sugerindo a ocorrência de uma população única no estado de Pernambuco. Analisando através de SSR apenas as populações PERD – MG e RNV – ES, no Sudeste, também foi observada baixa estruturação genética e fluxo gênico histórico. Considerando todas as populações, as do Nordeste se mostraram geneticamente diferenciadas em relação às do Sudeste, sendo observado que C. (P.) staigi está distribuído em duas

áreas geográfica e geneticamente bem separadas. A população GUA-PB apresentou prevalência de um cluster gênico diferente em relação às populações de

PE, apontando para um início de diferenciação genética e isolamento no limite de distribuição da espécie. Adicionalmente, não foi observada uma correlação direta entre a riqueza da diversidade genética e o tamanho dos remanescentes de mata

Atlântica, exceto em TAM, cujo remanescente é menor que 295 ha.

Palavras-chave: Besouro; Scarabaeinae; Microssatélites; Fluxo gênico histórico;

SSR; ISSR.

Abstract

The Canthon (Peltecanthon) staigi beetle occurs in Atlantic Forest Domain being considered bioindicator. This study aimed to analyze the population genetic structure of C. (P.) staigi in eight remainings located in the Northeast and Southeast

Brazil through ISSR and SSR markers. Were obtained 186 polymorphic loci of ISSR and twenty-four loci SSR to C. (P.) staigi, these four were polymorphic and five transferable to related species. Values of higher and lower heterozygosity were observed in PES - PE / GUA - PB and TAM – PE populations, respectively with this last presenting desequilibrium of Hardy-Weinberg. In the Northeast, through the two markers, low genetic structuring and historical gene flow was observed, suggesting occurrence of a single population in state of Pernambuco. Analysing through SSR only PERD - MG and RNV – ES populations, in Southeast, also there was a low genetic structuring and gene flow history. Considering all populations, such as the

Northeast have shown genetically differentiated relationship as do the Southeast, being observed that C. (P.) staigi is distributed in two geographic areas and genetically separate. The GUA-PB population presented prevalence of one set different gene in relation to PE populations, pointing to genetic differentiation and isolation in species distribution limit. Additionally, not observed a direct correlation between genetic diversity and size of the Atlantic Forest remnants, excepted in TAM, a remnant smaller than 295 ha.

Key words: Beetle; Scarabaeinae; Microsatellites; Historical gene flow; Genetic structuring.

Lista de Ilustrações

Revisão da Literatura

Figura 1: Visão dorsal de um espécime de Canthon (Peltecanthon) staigi 27

(Scarabaedae: Scarabaenae). Escala =2 mm. Fonte: Vaz-de-Mello et al.,

2011.

Figura 2: Esquema da estrutura das sequências microssatélites (SSR) e 33 suas inter-sequências (ISSR) mostrando onde que os primers de cada marcador devem flanquear para amplificação de cada uma das sequências específicas. Fonte: autor.

Capítulo I

Figura 1: South America map showing the collection points of Canthon 51

(Peltecanthon) staigi in the States of Pernambuco and Paraíba in Brazilian

North-East

Figura 2: Values of Delta K in accordance with the method described by 59

Evanno et al. (2005). From the results obtained, six ISSR primers were used and 186 polymorphic bands were obtained for six Canthon (P.) staigi populations. Note that the highest peak occurred in K = 2 and the lowest peak in K = 4

Figura 3: Ancestry of each individual in either of the two groups plotted by 59 the Structure 2.3.4 program, by means of six ISSR markers and 186 polymorphic bands in Canthon (Peltecanthon) staigi. Each vertical bar represents one of 180 individuals that were analyzed, and its population of origin is noted. The length of the bar is proportional to the inferred

11 ancestry within each group for each individual

Figura 4: Principal Coordinates analyses (PCoA) constructed through 61

ISSR analysis from six Canthon (Peltecanthon) staigi populations with 186 polymorphic bands

Figura S1: Ancestry of each individual in either of the four groups plotted 75 by the Structure 2.3.4 program, by means of six ISSR markers with 295 amplified bands in Canthon (P.) staigi. Each vertical bar represents one of

180 individuals and the population of origin is cited below. The length of the bar is proportional to the inferred ancestry within each group for each individual.

Capítulo III

Figura 1: Mapa parcial da costa brasileira destacando as populações de 94

Canthon (P.) staigi estudadas. Nos estados da Paraíba-PB foi coletada a população GUA, em Pernambuco-PE as populações ITA, ALD, TAM,

BON e PES, em Minas Gerais - MG a população PERD e no Espírito

Santo - ES a população RNV.

Figura 2: Ancestralidade dos indivíduos dos dois grupos, Nordeste e 99

Sudeste, plotados pelo programa Structure 2.3.4, através da análise de quatro marcadores microssatélites e um total de 27 alelos polimórficos na espécie Canthon (Peltecanthon) staigi. A análise totaliza 227 indivíduos.

Valores de Delta K obtidos de acordo com o método descrito por Evanno et al. (2005). Note o pico em K=2.

Figura 3: Ancestralidade dos indivíduos de Canthon (Peltecanthon) staigi 100 plotados pelo programa Structure 2.3.4, através da análise de quatro

12 marcadores microssatélites em populações de Pernambuco e Paraíba.

Valores de Delta K obtidos de acordo com o método descrito por Evanno et al. (2005). Note o maior pico em K=2 e um menor pico em K=4.

Figura 4: Ancestralidade dos indivíduos de Canthon (Peltecanthon) staigi 100 plotados pelo programa Structure 2.3.4, através da análise de quatro marcadores microssatélites em populações de Minas Gerais e Espírito

Santo. Valores de Delta K obtidos de acordo com o método descrito por

Evanno et al. (2005). Note um maior pico em K=2 e um segundo maior em K=7.

Apêndice

Figura 1: Gel de agarose mostrando o DNA da espécie Canthon (P.) 174 staigi no poço 1, digerido pela endonuclease AfaI durante a construção da biblioteca enriquecida em microssatélites, apresentando fragmentos entre

1200pb e 700pb.

Figura 2: Gel de agarose mostrando o DNA da espécie Canthon (P.) 175 staigi no poço 1, após pré-amplificação durante a construção da biblioteca enriquecida em microssatélites, apresentando fragmentos entre 1200pb e

300pb.

Figura 3: Gel de agarose mostrando o DNA da espécie Canthon (P.) 175 staigi no poço 1, após amplificação durante a construção da biblioteca enriquecida em microssatélites, apresentando fragmentos entre 1200pb e

200pb.

Lista de Tabelas

Revisão da Literatura

Tabela 1: Estudos de desenvolvimento de microssatélites em 40 coleópteros.

Capítulo I

Tabela 1: Collected Canthon (P.) staigi populations, main 52 environmental characteristics and geographic coordinates.

Tabela 2: Analyzed populations and their respective environments, 56 the polymorphic indexes and HE.

Tabela 3: Mantel Test through a pairwise analysis based on FST in 57 the six populations analyzed.

Tabela 4: Parameters estimated by the Hickory for the ƒ = 0 model. 58

Tabela 5: Proportion of individuals from each population related to 60 groups formed by the Structure program with K = 2.

Tabela S1: Most informative primers determined by the total number 73 of amplified fragments. Diversity Genetic Index (Dg); Polymorphism

Information Content (PIC), Marker Index (MI), and Resolution Power

RP.

Tabela S2: ISSR primers tested in species C. (P.) staigi. 74

Capítulo II

Tabela 1: Characterization of four polymorphic microsatellite markers 83 developed for C. (P.) staigi. Locus name, primer sequence (F: forward, R: reverse), anneling temperature (Ta), repeat motif,

14 fragment size range in base pairs (bp), number of alleles per locus

(A), observed heterozygosity (HO), expected heterozygosity (HE), and

GenBank accession numbers.

Tabela 2: Location of sampled populations and parameters of 84 genetic diversity in C. (P) staigi.

Tabela 3: Transferability of eight microsatellite markers developed 85 for C. (P.) staigi accross five different tribes of Scarabaeinae.

Tabela S1: List of loci which were monomorphic in C. (P.) staigi. 86

Capítulo III

Tabela 1: Informações dos locais de coleta e número amostral de 93

Canthon (Peltecanthon) staigi nas regiões Nordeste e Sudeste do

Brasil.

Tabela 2: Número de alelos, heterozigosidade esperada e 97 observada, FIS e riqueza alélica das populações de Canthon

(Petelcanthon) staigi gerados a partir da análise de quatro primers de microssatélites.

Tabela 3: Valores de FST par a par (diagonal inferior) e distância 99 geográfica (Km) das populações de Canthon (Peltecanthon) staigi.

Apêndice

Tabela 1: Primers de microssatélites minerados a partir da biblioteca 176 enriquecida de microssatélites para a espécie Canthon (P.) staigi.

Tabela 2: Primers de marcadores ISSR testados na espécie 177

Canthon (P.) staigi.

Lista de Abreviaturas, Siglas e Símbolos

2n Número diploide A Número de alelos AIK Akaike Information Criterion ALD Aldeia - PE AMOVA Analysis of Molecular Variance (Análise de Variância Molecular) BON Bonito - PE Bp Pares de Bases CBMEG Centro de Biologia Molecular e Engenharia Genética CEON Centro de Oncologia CNPq Conselho Nacional de Desenvolvimento Científico e Tecnológico COBEA Colégio Brasileiro de Experimentação Animal COI Citocromo Oxidase I DE Delaware Dg Diversidade Genética DIC Deviance Information Criterion DNA Ácido Desoxirribonucleico DNAr Ácido Desoxirribonucléico Ribossomal ES Espírito Santo FACEPE Fundação de Amparo a Ciência e Tecnologia de Pernambuco

FIS (ou ƒ) Índice de endogamia de Wright

FIT (ou F) Índice de Heterozigosidade de Wright FISH Fluorescent in situ hybridization

FST (ou θ) Índice de diferenciação genética de Wright

GST Coeficiente de divergência genética entre populações GUA Guaribas – PB ha Hectare HC Heterocromatina Constitutiva

HE Heterozigosidade esperada

HO Heterozigosidade observada

HS Heterozigosidade Panmítica

HT Heterozigosidade Total HWE Equilíbrio de Hardy-Weinberg IBAMA Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis IBD Isolation by distance ICB Instituto de Ciências Biológicas IPA Instituto Agronômico de Pernambuco ISSR Inter Simple Sequence Repeats ITA Itamaracá – PE K Número de cluster genéticos KM Quilômetro LBGI Laboratório de Biodiversidade e Genética de Insetos LED Laboratório de Experimentação em Drosophila M Taxa de migração MG Minas Gerais MI Marker Index MSA Microsatellite Analyser N Número amostral

Ne Tamanho efetivo populacional

Nm Número efetivo de migrantes O Oeste PB Paraíba PCoA Principal Coordinates analyses PCR Polimerase Chain Reaction PE Pernambuco PERD Parque Estadual Rio Doce – MG PES Pesqueira -PE PIC Polymorphism Information Content POP População RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Lenght Polymorphism RNAr Ácido Ribonucleico Ribossomal RNV Reserva Natural Vale do Rio Doce – ES

RP Resolution Power rrnL Gene mitocondrial ribossomal 16S S Sul SISBIO Sistema de Autorização e Informação em Biodiversidade SSR Simple Sequence Repeats TAM Tamandaré - PE UFPE Universidade Federal de Pernambuco UNICAMP Universidade Estadual de Campinas UPE Universidade de Pernambuco W West

Xyp Mecanismo sexual Xy paraquedas

Sumário

Resumo 9

Abstract 10

Lista de Ilustrações 11

Lista de Tabelas 14

Lista de Abreviaturas, Siglas e Símbolos 16

1. Introdução 21

2. Revisão da Literatura 23 2.1 Considerações gerais sobre o gênero Canthon (Coleoptera: 23 Scarabaeidae) 2.2 Marcadores moleculares aplicados ao estudo da estrutura 30 genética populacional de insetos

2.2.1 Marcadores ISSR (Inter Simple Sequence Repeats) 32 2.2.2 Marcadores Microssatélites (Simple Sequence Repeats 35 – SSR) 2.3 Análise da diversidade e estrutura genética populacional em 41 Coleoptera

3. Objetivos 46 3.1 Objetivo geral 46 3.2 Objetivos específicos 46

4. Capítulo I - Evidence of historical gene flow of Canthon 47 (Peltecanthon) staigi (Coleoptera: Scarabaeidae) Populations in the Atlantic Forest Domain

5. Capítulo II – Isolation and characterization of microsatellite 76 markers in Canthon (Petelcanthon) staigi (Scarabaeidae) and cross- amplification in related species.

6. Capítulo III - Diferenciação Genética de Populações do Nordeste e 88 Sudeste Brasileiro de Canthon (Peltecanthon) staigi (Coleoptera: Scarabaeidae) no domínio de Mata Atlântica

7. Discussão Geral 106

8. Conclusões 109

9. Referências Bibliográficas 110

10. Anexos 122

10.1 Anexo 1: Normas dos periódicos 122

10.2 Anexo 2: Comprovantes de submissão (Major Reviews) dos 157 manuscritos

10.3 Anexo 3: Protocolos 159

11. Apêndices 174

12. Currículo Lattes 178

1. Introdução

O besouro Canthon (Peltecanthon) staigi (Scarabaeidae) é um escarabeíneo exclusivamente americano e está distribuído desde o estado da

Paraíba no Brasil até o sul do continente Americano, no Paraguai e Argentina, ocorrendo em diferentes habitats do domínio Mata Atlântica como em restingas, brejos de altitude e Mata Atlântica strictu sensu. Canthon (P.) staigi é uma espécie estenotópica, ou seja, está restrita a habitats específicos, principalmente em

áreas de floresta, sendo registradas com menor frequência em pastagens ou bosques. Devido ao hábito estritamente coprófago e comportamento telecoprídeo, esta espécie desempenha atividades de realocamento da matéria orgânica, aeração do solo e dispersão secundária de sementes dentro das áreas florestadas.

Por ser uma espécie encontrada em áreas florestadas, as comunidades destes besouros sofrem maior influência de fatores bióticos (cobertura vegetal, fitofisionomia, oferta de matéria orgânica) e abióticos (variações na pluviosidade, temperatura e tamanho do remanescente) do ambiente. Mudanças ambientais, resultantes da descaracterização e fragmentação do habitat, podem levar a alterações na estrutura da comunidade na qual C. (P.) staigi está inserido bem como de outros escarabeíneos, resultando, por exemplo, na redução da diversidade de espécies além do número de indivíduos por espécie em populações remanescentes, o que caracteriza esta espécie como um bom bioindicador.

Ao longo da distribuição de C. (P.) staigi no Brasil, o bioma Mata Atlântica sofreu um intenso processo de fragmentação, desde o início do século XVI e

21 principalmente no século XX, especificamente na costa brasileira, resultanto na diminuição da sua cobertura original, restando atualmente em menos 16%. Em meio a esse cenário, o estado de Pernambuco, hoje com cerca de apenas 4% da cobertura original de Mata Atlântica, bem como o bloco Sudeste/Sul, tendo como a Serra Geral, da Mantiqueira e do Mar sua principal área de abrangência e perfazendo a maior percentagem da cobertura vegetal atual, são considerados dois centros de endemismo de diversas espécies vegetais e animais.

Sendo as comunidades de escarabeíneos sensíveis a mudanças ambientais e C. (P.) staigi uma espécie distribuída em diversos habitats da Mata

Atlântica, é fundamental a análise da estrutura genética de suas populações remanescentes, especialmente no Nordeste, onde a Mata Atlântica se encontra mais fragmentada. A caracterização da diversidade genética das populações de

C. (P.) staigi foi realizada com base em marcadores moleculares dominantes e codominantes, respectivamente, ISSR e SSR. Estes têm sido utilizados em estudos populacionais de insetos, dentre eles representantes de Coleoptera, totalizando até o momento 13 famílias analisadas, dentre elas Scarabaeidae com uma espécie.

Este tipo de análise permitiu verificar a existência de correlação entre a distância geográfica e genética das diferentes populações de C. (P.) staigi e os principais fatores evolutivos presentes na estruturação das populações analisadas.

2. Revisão da Literatura

2.1 Considerações gerais sobre o gênero Canthon (Coleoptera:

Scarabaeidae)

A ordem Coleoptera (Insecta), cujos representantes são conhecidos como besouros, possui grande radiação adaptativa, ampla distribuição mundial e cerca de 360.000 espécies descritas. Coleoptera está dividida em quatro subordens:

Adephaga, Archostemata, Myxophaga e Polyphaga, sendo esta última subordem mais representativa com aproximadamente 90% das espécies descritas

(Lawrence and Newton, 1995; Costa 2000). Polyphaga possui 16 superfamílias, dentre elas Scarabaeoidea com aproximadamente 31.000 espécies distribuídas em 13 famílias, as quais em sua maioria têm sido estudadas taxonomicamente

(Lawrence and Britton, 1991; Ratcliffe et al., 2002). A família Scarabaeidae é a maior em número e, por conseguinte a mais diversa, com aproximadamente 2.000 gêneros e 27.800 espécies, distribuídas nas sete subfamílias: Aphodinae,

Cetoniinae, Dynastinae, Melolonthinae, Orphininae, Rutelinae e Scarabaeinae

(Crowson, 1981; Vanin and Ide, 2002).

A subfamília Scarabaeinae apresenta grande radiação adaptativa reunindo mais de 20% das espécies da família Scarabaeidae (Costa, 2000; Vaz-de-Mello,

2000), pertencentes a 12 tribos e 234 gêneros distribuídos mundialmente (Vaz-de-

Mello, 2007), com registro para o Brasil de 49 gêneros e aproximadamente 620 espécies, das quais 323 são endêmicas (Vaz-de-Mello, 2000). Nove tribos apresentam ocorrência na região neotropical: Ateuchini, Canthonini, Coprini,

Eucraniini, Eurysternini, Oniticellini, Onitini, Onthophagini e Phanaeini (Zunino,

1985; Cambefort, 1991).

As espécies dessa subfamília, assim como todos os besouros, apresentam um ciclo de vida com uma média de uma geração por ano, sendo o tempo de vida dos besouros das regiões tropicais, em média, menor que das regiões temperadas (Ritcher, 1958) Esses animais apresentam um desenveovimento holometábolo, existindo os estágios de ovo, com posterior eclosão da larva, transformação em pupa e posteriormente adulto, utilizando como recurso alimentar, tanto no estágio adulto como no de larva, fezes, carcaças ou outros detritos orgânicos, que concentram grande quantidade de energia (Halffter and

Matthews, 1966). Esse hábito é muito importante para a reprodução, devido ao fato das fêmeas adultas realizarem a ovoposição no interior do recurso alimentar utilizado (Halffter and Edmonds, 1982). Geralmente, a reprodução e a alimentação estão associadas à alocação de uma porção do recurso para um local distante da fonte original, evitando a competição com outras espécies de

Scarabaeinae ou com outros animais (Hanski and Cambefort, 1991; Louzada and

Lopes, 1997).

A tribo Canthonini representa o grupo mais característico e diversificado da região neotropical, sendo um dos grupos mais ricos da fauna americana (29 gêneros e 367 espécies) e compreende os besouros telecoprídeos da América do

Sul, junto com as tribos Eucranini e Sysiphini (Louzada and Lopes, 1997; Rivera-

Cervantes and Halffter, 1999; Vaz-de-Mello, 1999; Medina et al., 2003). O gênero

Canthon Hoffmannsegg, 1817 se destaca por incluir o maior número e diversidade de espécies da tribo Canthonini, sendo exclusivamente americano e apresentando 174 espécies, das quais 75 ocorrem no Brasil (Pereira and

Martínez, 1956; Vaz-de-Mello, 1999).

Trabalhos filogenéticos que utilizaram sequências mitocondriais (Villalba et al., 2002), nucleares (Ocampo and Hawks, 2006) ou ambas (Monaghan et al.,

2007) em Scarabaeinae apontaram monofilia da subfamília. De uma forma geral, indicaram uma dicotomia entre os clados dos besouros formadores de túneis e os roladores, sendo este último um clado bastante diverso, com comportamentos variando de formadores de esferas, que são roladas ou carregadas, com a utilização das patas dianteiras ou traseiras (Ocampo and Hawks, 2006).

Monaghan et al. (2007) utilizaram genes rDNA 28S (nuclear) e rrnL

(mitocondrial) na análise filogenética de Scarabaeinae e verificaram que a tribo

Canthonini representa um dos clados mais recentes da região Neotropical.

Canthonini apresenta diversas linhagens parafiléticas, com destaque para o gênero Canthon, que aparentemente mostra-se como um grupo polifilético, indicando a necessidade de revisão do mesmo. Canthonini parece experimentar uma intensa radiação adaptativa, o que explicaria sua diversidade, como também observado por Wirta et al. (2010), que utilizando-se de genes nuclerares (rDNA

18S e 28S) e mitocondriais (COI) realizaram uma análise filogenética de 104 espécies de Canthonini oriundos da ilha de Madagascar. Os dados indicaram uma tendência da tribo à especiação alopátrica, tendo as montanhas, rios e bacias hidrográficas desempenhado o papel de barreiras geográficas entre as populações (Wirta et al., 2010).

A história taxonômica de Canthon revela dificuldades na definição das características que o representam e na organização interna dos grupos que o compõem (Medina et al., 2003). As dificuldades remontam desde sua proposição por Hoffmansegg em 1817, seguida pela revisão feita por Harold em 1868 e estudos taxonômicos subsequentes. O gênero Canthon foi subdividido em 13

25 gêneros (Halffter and Martinez, 1967), cuja maioria foi posteriormente alocada para a condição de subgêneros de Canthon (Halffter and Martinez, 1977).

A última revisão de Canthon incluiu alguns gêneros, como o antigo gênero

Peltecanthon (Pereira, 1953), a condição de subgênero, totalizando para Canthon nove subgêneros: Boreocanthon, Canthon, Glaphyrocanthon, Gonicanthon,

Francmonrosia, Nesocanthon, Peltecanthon, Trichocanthon e Pseudepilissus

(Halffter and Martínez, 1977). Ainda segundo Halffter e Martinez (1977) o subgênero Peltecanthon possui três espécies, Canthon (Pelthecanthon) sulcatus

Castelnau, 1840, C. (Pelthecanthon) auricollis Redtenbacher, 1867 e C.

(Peltecanthon) staigi Pereira, 1953 (Figura 1), as quais se diferenciam dentre outros caracteres pela forma do escutelo (Halffter and Martínez, 1967; 1977).

O tamanho dos espécimes de Canthon varia de dois a 25 mm de tamanho, tem corpo em forma redonda ou oval, com ausência de chifres e carena na cabeça e pronoto. O dimorfismo sexual, na maioria dos subgêneros de Canthon, se limita às tíbias posteriores, onde o espólon do macho se apresenta dilatado e muitas vezes bifurcado, enquanto que nas fêmeas a estrutura tem a forma aguda

(Halffter and Mathews, 1966).

A grande variação nos padrões de coloração de indivíduos da mesma espécie (que variam entre verde, azul e levemente dourado) em diferentes regiões geográficas, também resulta em implicações na taxonomia do grupo

(Halffter and Martínez, 1967; Medina et al., 2003). Segundo Kohlmann (1984) a pequena variação morfológica e grande diversidade de Canthon como dos demais

Canthonini não se deve à especialização morfológica e sim à plasticidade etológica e ecológica.

Figura 1. Visão dorsal de um espécime de Canthon (Peltecanthon) staigi (Scarabaedae: Scarabaenae). Escala = 2 mm. Fonte: Vaz-de-Mello et al. (2011).

Canthon (P.) staigi é uma das espécies com maior distribuição na região

Neotropical, ocorrendo em diferentes habitats da Mata Atlântica Brasileira até o sul do continente Americano, no Paraguai e Argentina (Halffter and Martínez,

1967, 1977). No Brasil, essa espécie ocorre entre os estados da Paraíba e

Paraná, no domínio de Mata Atlântica Chuvosa, e particularmente nos estados de

Minas Gerais e Bahia, no domínio de Mata Atlântica Semi-decídua, preferencialmente em habitas fechados, com um único registro até o momento para a Caatinga (Endres et al., 2007; Costa et al. 2013; Costa et al., 2014;

Hernández et al., 2014; Medina and Lopes, 2014).

Os escarabeíneos possuem hábito detritívoro (utilizam fezes de vertebrados, carcaça e matéria orgânica em decomposição como alimento) que está associado com sua reprodução, pois aproveitam a matéria orgânica para posterior ovoposição e alimento de suas larvas (Halffter and Matthews, 1966;

Halffter and Edmonds, 1982; Hanski and Cambefort, 1991; Louzada and Lopes,

1997). Considerando a forma de alocação e aproveitamento da matéria orgânica, esses besouros compõem três guildas bem definidas: (1) paracoprídeos

(escavadores), que escavam o solo abaixo ou ao lado da fonte; (2) endocoprídeos

(residentes), que permanecem enterrados abaixo ou dentro da fonte de recursos; e (3) telecoprídeos (roladores), que formam uma esfera de matéria orgânica a partir da fonte e então deslocam essa esfera para longe (Gill, 1991). Com base nos escarabeíneos telecoprídeos foi dado o nome vulgar “rola-bosta” a esses besouros (Halffter and Edmonds, 1982).

A forma de alocação e aproveitamento da matéria orgânica pelos escarabeíneos contribui para os serviços ecossistêmicos prestados por esses besouros, como por exemplo, incorporação da matéria orgânica em decomposição ao solo, incremento da permeabilidade e aeração do solo, controle de parasitas e moscas vetores, dispersão secundária de sementes e polinização

(Avendaño-Mendoza et al., 2005; Louzada, 2008). Além desses serviços prestados, o fato de a comunidade de escarabeíneos ser estruturalmente sensível

às pequenas variações ambientais (Halffter and Favila, 1993; Andresen, 2005), como fragmentação, modificação e degradação do habitat (Gardner et al.,2008;

Spector and Ayzama, 2003; Filgueiras et al., 2011), torna esse grupo um bom bioindicador. Visto que após as variações ambientais observam-se mudanças na riqueza, abundância, composição de espécies e modificações na estrutura das guildas (Halffter and Favila, 1993; Andresen, 2005; Nichols et al.,2007).

A maioria das espécies de Canthon são estenotópicas, ou seja, são restritas à habitats específicos, principalmente em áreas de floresta, sendo registradas com menor frequência em pastagens ou bosques (Díaz, 1997; Costa et al., 2013). A maioria delas apresenta um hábito copro-necrófago, podendo utilizar excrementos de mamíferos arborícolas, frutos em decomposição ou fungos como alimento (Halffter and Martinez, 1977; Rivera-Cervantes and Halffter,

1999; Vaz-de-Mello, 2000). No entanto, algumas espécies do gênero Canthon, como C. quadriguttatus e C. hyalinus são ectoparasitas das espécies Alouatta sp. e Callicebus brunneus, respectivamente. Outro hábito diferenciado no gênero se refere ao predatismo de formigas, observado em C. dives e C. virens (Pereira and

Martinez, 1956).

O hábito estritamente coprófago e o comportamento telecoprideo de C. (P) staigi são fundamentais para o realocamento da matéria orgânica dentro das

áreas florestadas, sendo também uma maneira de dispersar secundariamente sementes que estão presentes nas fezes de animais maiores, como aves e mamíferos, contribuindo para o reflorestamento natural (Halffter, 1977; Silva et al.,

2011; Hernandez et al., 2014). Como é uma espécie abundante em remanescentes de mata Atlântica (Endres et al., 2007; Hernández et al., 2014) e sensível às mudanças ambientais, como perda de habitat, que afeta seriamente a densidade populacional dessa espécie e consequentemente a dinâmica ecológica da mesma, C. (P) staigi é considerada uma espécie bioindicadora (Hernández et al., 2014).

O gênero Canthon apesar de sua diversidade de espécies e importância ecológica não tem sido analisado geneticamente, exceto pela análise citogenética de seis espécies, sendo elas: Canthon (P.) staigi e C. indigaceus com 2n = 18; C. muticus, C. septemmaculatus, C. aff carbonarius e C. chalybaeus com 2n = 20; todas com cariótipos simétricos e mecanismo sexual Xyp (Smith and Virkki, 1978;

Yadav and Pillai, 1979; Vidal, 1984; Bione, 2004; Cabral-de-Mello et al., 2008;

2011).

Apenas Canthon (P.) staigi foi analisada por técnicas diferenciais e por

Hibridização in situ fluorescente (FISH). A mesma apresentou grandes blocos

29 pericentroméricos de heterocromatina constitutiva (HC) em todos os cromossomos autossômicos e o cromossomo X quase totalmente heterocromático (Bione, 2004), padrão similar à maioria dos escarabeíneos, exceto pelo tamanho dos blocos (Cabral-de-Mello et al. 2011). O mapeamento por hibridização in situ fluorescente dos genes ribossomais (DNAr) 45S e 5S foi realizado por Cabral-de-Mello et al. (2011), que observaram dois bivalentes autossômicos, cada um com duas marcações de cada cluster. A escassez de análises citogenéticas no gênero Canthon se dá em especial pela dificuldade de obtenção de boas preparações cromossômicas e da necessidade de ajustes para aplicação da FISH (Moura, comunicação pessoal).

2.2 Marcadores moleculares aplicados ao estudo da estrutura genética populacional de insetos

Os marcadores moleculares são ferramentas informativas na análise da estrutura genética dentro e entre diferentes populações de insetos, pois possibilitam o acesso a variabilidade genética em diferentes níveis desde proteínas até o DNA. Os primeiros marcadores moleculares foram estabelecidos a partir da variação no padrão eletroforético de proteínas, como a hemoglobina e as isozimas, sendo gradativamente substituídos pelo uso de marcadores moleculares baseados em DNA, pois estes apresentam uma taxa de polimorfismo superior, independentes do estágio de vida do indivíduo (fator importante no estudo de organismos holometábolos), e por apresentarem maior reprodutibilidade, favorecendo o estudo da diversidade genética (Zietkiewicz et al., 1994).

O primeiro estudo publicado com o objetivo de analisar a estrutura genética de populações naturais de insetos foi realizado por Lewontin e Hubby (1966) na

30 espécie Drosophila pseudoobscura, tendo como base a análise da diversidade de proteínas em cinco populações a partir da caracterização de 18 loci, sendo apenas sete polimórficos apresentando heterozigosidade média de 12%. Desta forma, os autores sugeriram que a diversidade genética observada poderia estar subestimada, dada a base genética do marcador utilizado. A partir do descobrimento das enzimas de restrição em 1968, foi desenvolvida a primeira técnica baseada em DNA denominada RFLP (Restriction Fragment Lenght

Polymorphism) (Linn and Arber, 1968; Meselson and Yuan, 1968). Por ser uma técnica que tem como base as diferenças e similaridade da sequência de bases nitrogenadas do DNA, e consequentemente, um maior polimorfismo que os marcadores baseados em proteínas, ela passou a ser também utilizada na caracterização da estrutura genética de populações.

A partir do desenvolvimento da Reação em Cadeia da Polimerase

(Polimerase Chain Reaction - PCR), vários marcadores baseados em DNA foram estabelecidos, como o RAPD (Random Amplified Polymorphic DNA – Amplificado

Aleatório Polimórfico de DNA) e o ISSR (Inter-simple sequence repeat –

Sequência entre repetições simples) classificados como dominantes; e os SSR

(Single Sequence Repeat), classificados como codominantes. A despeito da grande variedade de marcadores que surgiram com aplicação na biotecnologia em decorrência de seu desenvolvimento, a escolha do marcador adequado para a caracterização da estrutura genética populacional é baseada principalmente no problema, objetivos e número amostral do estudo (Lynch and Milligan, 1994;

Baverstock and Moritz, 1996).

Em diversos grupos de insetos os marcadores moleculares têm auxiliado no entendimento de várias análises no âmbito da ecologia molecular, tais como:

(1) caracterização de diferentes níveis de diversidade genética em populações de laboratório (Kim et al, 2007), semi-domésticas (Kar et al., 2005) e naturais (Freiria et al., 2012; Chen et al., 2013), bem como no direcionamento de estratégias de conservação e manejo para espécies naturais (Liu et al., 2010; Machkour-M’Rabet et al., 2014) e espécies pragas (Lopez et al., 2013); (2) análise da existência de isolamento genético populacional por distância geográfica (Manrique-Poyato et al., 2013; Fuentes-Contreras et al., 2014; (3) detecção de possíveis padrões de introgressão genética a partir do cruzamento de espécies próximas (Hundsdoerfer et al., 2005); (4) estabelecimento de status taxonômico a partir da análise da variação genética de populações de complexos específicos (Marin et al., 2010);

(5) entender o fluxo gênico e a dinâmica demográfica recente de populações

(Legrand et al., 2011) e (6) detectar a influência da perda (Gaublomme et al.,

2013) e da poluição do habitat (Lagisz et al. 2010) na diversidade genética.

2.2.1 Marcadores ISSR (Inter Simple Sequence Repeats)

Inicialmente, os marcadores ISSR foram descritos por Zietkiewicz (1994) como uma alternativa menos onerosa na caracterização da diversidade genética.

Uma das vantagens do uso desse tipo de marcador é a possibilidade de aplicação em organismos sem informação genética prévia, além de seu perfil multilocus, gerando padrões de DNA (fingerprinting de DNA), de forma que constituem uma fonte potencial de caracteres informativos ao nível de diferenciação de populações naturais em espécies e até mesmo para gêneros próximos (Simon et al., 2007). Outra característica importante é que as sequências ISSR são abundantes ao longo dos genomas dos eucariotos e evoluem rapidamente (Fang

32 and Roose, 1997; Esselman et al., 1999), favorecendo na distinção entre indivíduos de populações diferentes através de marcas polimórficas.

A amplificação dos marcadores ISSR é realizada por PCR se utilizando de um primer único, longo, com repetições de di- ou tri- ou tetranucleotídeos, os quais pareiam a sequências de microssatélites - SSR (Figura 2), o que permite o uso de maiores temperaturas de pareamento aumentando sua reprodutibilidade

(Fang et al., 1997). Os primers de ISSR podem ser de dois tipos: (1) não ancorado (Gupta et al., 1994); ou (2) ancorado, apresentando um ou dois nucleotídeos adicionais, tanto na extremidade 5’ quanto na extremidade 3’ podendo possuir um dinucleotídeo parcialmente degenerado no final (Zietjiewicz et al., 1994; Wolfe, 2005). Adicionalmente, alguns estudos mostraram que através da amplificação de marcadores ISSR foram alcançados níveis de reprodutibilidade entre 92 e 95%, possivelmente devido ao uso de primers longos quando comparado com outros marcadores dominantes (Bornet and Branchard,

2001; Reddy et al., 2009).

Figura 2: Esquema da estrutura das sequências microssatélites (SSR) e suas inter-sequências

(ISSR) mostrando onde que os primers de cada marcador devem parear para amplificação de cada uma das sequências específicas. Fonte: autor.

Dada as suas características genéticas e produção de padrões de amplificação com um alto grau de polimorfismo, o ISSR é considerado um marcador com um bom custo benefício, gerando resultados rápidos e sensíveis, permitindo que sejam utilizados com sucesso na detecção de polimorfismos intra- específicos e na consequente caracterização da diversidade genética de várias espécies e populações (Abbot, 2001; Gui et al., 2008).

Particularmente em insetos, os ISSR têm sido utilizados como uma ferramenta bastante informativa na análise de diferentes fatores relacionados à estrutura genética populacional, abrangendo os mais diversos objetivos, como (1) averiguar diferenças inter e intra-populacionais de insetos de investigação forense

(He et al., 2007), (2) estimar a diversidade genética de populações para entendimento da estrutura populacional (Souza et al., 2008; Manjeri et al., 2011;

Saha et al., 2011; Chen et al., 2013) e (3) avaliar isolamento por distância de diferentes populações (Manrique-Poyato et al., 2013).

Considerando a ordem Coleoptera, representada pelos besouros, que constitui o grupo mais diverso dentre os insetos, ainda são poucos os estudos direcionados à análise da estrutura genética de populações remanescentes.

Apesar do poder informativo dos marcadores ISSR, existem na literatura apenas três estudos publicados nos quais esse marcador foi utilizado na caracterização da estrutura genética de populações de besouros. O primeiro deles foi realizado por Souza et al. (2008) os quais analisaram 12 populações brasileiras do besouro

Zabrotes subfasciatus (Bruchidae), com o objetivo de avaliar a diversidade genética dessas populações, encontrando pouca diferenciação genética entre as

34 populações estudadas, concluindo que as populações analisadas não se apresentam geograficamente estruturadas.

Em outro estudo desenvolvido por Marin et al. (2010), 11 populações do besouro Coccinella septempunctata (Coccinellidae) foram analisadas através de

ISSR e marcadores mitocondriais, tendo como principal objetivo testar se as diferentes populações eram compostas por espécies de um complexo específico.

Baseado na estrutura genética das populações analisadas esta hipótese foi refutada, pois os indivíduos não se diferenciaram entre si, sugerindo a presença de uma única espécie. Um terceiro estudo abordando seis populações do besouro

Oryctes rhinoceros (Scarabaeidae) verificou um alto polimorfismo dos loci de

ISSR, auxiliando na compreensão da variação genética entre as populações desse besouro, que possivelmente está inserido em um complexo de espécies crípticas na Malásia (Manjeri et al., 2011).

2.2.2 Marcadores Microssatélites (Simple Sequence Repeats – SSR)

Os microssatélites (SSR) são sequências de DNA que podem ser encontradas em todos os organismos eucariotos e organelas atualmente conhecidos, sendo formados por até seis nucleotídeos repetidos em tandem

(Chambers and Macavoy, 2000). No genoma esses marcadores podem ser encontrados, tanto em regiões não funcionais, como, em menor frequência, em regiões funcionais. Microssatélites apresentam alta taxa de mutação e contribuem para a rápida evolução do genoma, criando e mantendo um quantitativo de variação genética (Tautz et al., 1986; Kashi et al., 1997). Essa variação é fruto do processo de deslizamento da enzima DNA polimerase durante a replicação do

DNA, o que gera um número variável de repetições, contribuindo para o aumento

35 da diversidade genética mesmo entre indivíduos de uma mesma população

(Schlötterer and Tautz, 1992).

Os SSR apresentam uma série de características informativas para estudos populacionais, com destaque para: (1) abundância e grande dispersão no genoma dos eucariotos; (2) fácil detecção por metodologias moleculares convencionais, como PCR, (3) alta probabilidade de encontrar sítios informativos polimórficos; (4) co-dominância de alelos levando à identificação clara de heterozigotos; e (5) é um marcador molecular neutro (Brohede and Ellegren,

1999).

A amplificação dos SSR ocorre através de PCR a partir de um par de primers específicos que flanqueiam os microssatélites formando loci genéticos muito polimórficos, resultantes da presença de diferentes números de elementos simples repetidos. Portanto, cada SSR, independente do elemento repetido é uma fonte multialélica de alta variação genética (Sunnucks, 2000).

Como desvantagens os SSR apresentam a necessidade do conhecimento prévio das sequências flanqueadoras dos microssatélites para se desenhar primers locus-específicos. Uma alternativa é a realização da amplificação heteróloga, ou seja, a amplificação a partir de primers desenvolvidos para espécies próximas. Outra forma de desenvolver marcadores microssatélites envolve etapas de clonagem, detecção dos microssatélites em uma biblioteca genômica e sequenciamento, o que torna a metodologia onerosa.

Apesar do alto custo, os marcadores SSR reúnem características de grande potencial informativo para estudos populacionais. Desta forma, metodologias alternativas de isolamento e caracterização destes marcadores vêm sendo desenvolvidas e barateadas, como a biblioteca enriquecida de

36 microssatélites, desenvolvida através da seleção de fragmentos hibridizados a uma sonda complementar a sequência de microssatélites de interesse (Zane et al., 2002). Uma outra técnica com melhor custo benefício devido a quantidade de loci de SSR gerados, é o sequenciamento genômico de baixa cobertura com posterior mineração de microssatélites (Rasmussen and Noor, 2009).

Os trabalhos com insetos nas ordens Coleoptera, Diptera, Lepidoptera,

Hymenoptera e Hemiptera que utilizam os marcadores SSR têm sido realizados com o objetivo de (1) analisar a estrutura populacional para validar programas de controle biológico (Aketarawong et al., 2011) e identificar mudanças na diversidade genética devido à perda de habitat (Gaublomme et al., 2013), (2) acessar o grau de diversidade genética em populações naturais (Freiria et al.,

2012), (3) testar a existência de isolamento por distância (Fuentes-Contreras et al., 2014), (4) detectar fluxo gênico recente de populações (Legrand et al., 2011),

(5) medir as consequências da poluição ambiental por metais, como zinco e cadmio, na variabilidade genética das populações (Lagisz et al., 2010), (6) compreender a origem geográfica de espécies (Baliraine et al., 2004) e (7) investigar a introdução de espécies exóticas de besouros em outros ambientes

(Meixner et al., 2002).

Em relação aos estudos com SSR que tratam da estruturação genética especificamente na ordem Coleoptera, podemos destacar inicialmente os realizados por Kim e Sappington (2005), na espécie Diabrotica virgifera virgifera

(Chrysomelidae), no qual os autores observaram uma diferenciação genética progressiva ao longo dos últimos 50 anos aproximadamente, entre 10 populações estudadas, fruto possivelmente da expansão para o oeste em direção às grandes planícies; e o trabalho de Schrey et al. (2008), que investigaram a estrutura

37 populacional do besouro Dendroctonus frontalis (Curculionidae) e observaram elevado fluxo gênico entre as populações dessa espécie nas florestas do

Mississipi-USA, auxiliando na elaboração de futuros planos de manejo da espécie.

Em estudos recentes com SSR a fragmentação do habitat causada por destruição de florestas e/ou poluição, e seus efeitos na estruturação genética das populações naturais, têm sido tema de vários estudos em coleópteros, dada a importância ecológica desse grupo. Desta forma, em diferentes espécies de besouros da família Carabidae, como Carabus violaceus (Keller et al., 2004), C. auronitens (Drees et al., 2008), C. problematicus (Gaublomme et al., 2013) e

Pterostichus oblongopunctatus (Lagisz et al., 2010), foi observada uma relação positiva entre as mudanças ambientais e a estruturação genética populacional desses besouros, demonstrando que as populações dessas espécies estão intimamente ligadas com a estruturação ambiental.

Vários dos estudos publicados com SSR para espécies de Coleoptera são focados no desenvolvimento de microssatélites específicos, os quais abrangem

20 diferentes famílias (Tabela 1). Apesar do número crescente de estudos em

Coleoptera nos últimos dez anos, a família Scarabaeidae, apesar de reconhecida como a mais diversa em número de espécies dentro da superfamília

Scarabaeoidea (Lawrence and Britton, 1991; Ratcliffe et al., 2002) ainda é muito pouco representada quando se trata de estudos que caracterizam a estrutura genética de populações remanescentes. Na literatura existem análises, por exemplo, a partir da variação de alozimas, como nos besouros Prodontria modesta e P. bicolorata (Emerson and Wallis, 1994) e em cinco espécies do gênero Aegialia (Porter and Rust, 1996); além destas, foi publicado apenas mais

38 um estudo baseado em marcadores do gene mitocondrial citocromo oxidase I

(COI), no gênero Osmoderma (Landvik et al., 2013). Em relação aos marcadores

SSR ainda não existe nenhum estudo.

Tabela 1: Estudos de desenvolvimento de microssatélites em coleópteros.

Família N° de espécies Referências Estudada estudadas Alvarez et al., 2003 Bruchidae 03 Sembene et al., 2003 Aebi et al., 2004 Buprestidae 01 Keever et al., 2013 Takami and Katada, 2001 Brouat et al., 2002 Garnier et al., 2002 Dhuyvetter and Desender, 2003 Carabidae 09 Gaublomme et al., 2003 Lagisz and Wolff, 2004 Contreras-Díaz et al., 2005 Keller and Largiadèr, 2002 O'Callaghan et al., 2014 Carter et al., 2008; 2009 Cerambycidae 03 Drag et al., 2013 Haran and Roux-Morabito, 2014 Batley et al., 1998 Patt et al., 2004a Margraf et al., 2005 Chrysomelidae 07 Verbaarschot et al., 2007 Kim et al., 2008 Waits and Stolz, 2008 Harman et al., 2009 Loiseau et al., 2009 Coccinellidae 02 Bouanani et al., 2015 Cucujidae 01 Røed et al. 2014 Liewlaksaneeyanawin et al., 2001 Dhuyvetter et al., 2002 Sallé et al., 2003 Kim and Sappington, 2004 Patt et al., 2004b Curculionidae 11 Ernst et al., 2005 Forgie et al., 2006 Maroja et al., 2007 Schrey et al., 2007 Davis et al., 2009 Kajtoch et al., 2012 Elateridae 01 Velez and Feder, 2005 Geotrupidae 01 Racz et al., 2015 Hispidae 01 Ma et al., 2011 Histeridae 01 Omondi et al., 2009 Laemophloeidae 01 Wu et al., 2016 Lucanidae 01 Kang et al., 2015 Evans et al., 2008 Nitidulidae 02 Cassel-Lundhagen et al., 2009 Platypodidae 01 Takahashi et al., 2008 Scarabaeidae 01 Manjeri et al., 2012 Kerdelhué et al., 2003 Scolytidae 02 Gauthier and Rasplus, 2004 Silphidae 01 Suzuki and Yao, 2014 Tenebrionidae 01 Demuth et al., 2007

2.3 Análise da diversidade e estrutura genética populacional em Coleoptera

Ao longo da evolução biológica, uma grande variedade de espécies surgiu, hoje representando a atual biodiversidade, produto de variações hereditárias que podem ser classficadas em unidades taxonômicas. A biodiversidade é o reflexo da diversidade genética acumulada ao longo da evolução por determinadas espécies ou mesmo populações, sendo, toda variação biológica hereditária gerada e acumulada fundamentalmente, por mutação na sequência nucleotídica do DNA (Templeton, 2011).

Através do uso dos marcadores moleculares é possível caracterizar a diversidade genética de diferentes espécies como também de populações de uma determinada espécie. Para isso, são analisados diferentes parâmetros, como frequência, número (A) e riqueza alélica, número de alelos efetivos, raros e exclusivos, as heterozigosidades esperada (HE) e observada (HO), variância molecular (AMOVA), dentre outros (Templeton, 2011; Manrique-Poyato et al.,

2013; Fuentes-Contreras et al., 2014). Através da análise desses parâmetros, é possível caracterizar em diferentes níveis, a variação da diversidade genética entre espécies/populações de acordo com marcadores moleculares específicos

(Clark and Hartl, 2010; Templeton, 2011).

O estudo dos alelos (frequência, número, alelos efetivos, raros e exclusivos) tem como objetivo analisar o grau de polimorfismo do marcador utilizado, como também o grau de diversidade alélica que uma determinada população pode apresentar. A partir do estudo desse fator, pode-se inferir a presença de acasalamentos preferenciais, desequilíbrio de ligação, fluxo e deriva genética, efeito fundador, bottleneck, dentre outros, sendo a base dos outros parâmetros estudados em genética de populações (Hartl et al., 2010).

A HE aponta para a probabilidade de um indivíduo ser heterozigoto para um determinado locus, sendo dependente do número de alelos e de suas frequências:

2 HE= 1- ∑ Pi , sendo Pi a frequência do iésimo alelo;

Sendo assim, quanto maior a diversidade genética de uma população, e consequentemente a diversidade de alelos, maiores as chances de um indivíduo daquela população ser heterozigoto (Cruz, 2008). A HE pode ser calculada a partir de marcadores co-dominantes e projetada a partir dos dominantes, uma vez que seu cálculo se dá através da frequência alélica, e em estudos com marcadores dominantes, a presença de um fragmento amplificado é contado como um alelo.

Por sua vez a HO é calculada dividindo-se o número de indivíduos heterozigotos pelo número de indivíduos totais daquela população, sendo possível apenas calculá-la através do uso de marcadores co-dominantes. Em estudos populacionais, a HO é de suma importância para o cálculo do equilíbrio de Hardy-

Weinberg (HWE). Uma determinada população encontra-se em equilíbrio quando sua HO é estatisticamente semelhante à sua HE, pois em equilíbrio, as frequências alélicas devem se manter constantes ao longo das gerações, sendo assim, a presença ou ausência do HWE depende da relação entre HO e HE (Cruz, 2008).

Em Coleoptera, através do uso de marcadores microssatélites, tem se observado valores de HE média, por locus, variando de 0,190 a 0,934, e HO média, por locus, de um valor nulo (populações totalmente endozigóticas) a 0,933

(Brouat et al., 2003; Dhuyvetter et al., 2004; Keller et al., 2004; Kim and

Sappington, 2005; Kim et al., 2007; Salle et al., 2007; Schrey et al., 2008; Lagisz et al., 2010; Gaublomme et al., 2013). Por outro lado, Souza et al. (2008) utilizando-se de marcadores ISSR, calculou a HE variando entre 0,2253 e 0,3281

42 em populações do besouro Zabrotes subfasciatus. Em Coleoptera, diversos podem ser os fatores que provocam variações nas frequências alélicas e na heterozigosidade, como perda de habitat, barreiras geográficas, eventos de bottleneck e até mesmo poluição dos ambientes (Keller et al., 2004; Drees et al.,

2008; Lagisz et al., 2010; Gaublomme et al., 2013).

A análise de variância molecular (AMOVA) permite estudar a distribuição da variação molecular entre diferentes grupos, que podem ser delimitados por populações pertencentes a uma mesma região geográfica, habitat ou caracterizada por algum fenótipo compartilhado entre seus indivíduos. Através da

AMOVA é possível também testar hipóteses a respeito da diferenciação entre tais populações ou subpopulações, a partir da dissimilaridade entre dados moleculares, dominantes ou co-dominantes. Sendo assim, é possível calcular a variação genética entre os grupos, entre as populações dentro dos grupos, e dentro das populações (Excoffier et al., 1992). De uma maneira geral, utilizando tanto marcadores codominantes quanto dominantes, a maioria da variação genética em estudos populacionais de besouros está situada dentro das populações, como visto nos besouros Coccinella septempunctata (57,2%) (Marin et al., 2010), Z. subfasciatus (66%) (Souza et al. 2008), Pterostichus oblongopunctatus (93,3%) (Lagisz et al., 2010) e Carabus problematicus (93.39%)

(Gaublomme et al., 2013), o que indica que os coleópteros preservam a maior parte de sua diversidade genética dentro de suas populações. Entretanto, Kim e

Sappington (2005) encontraram uma variação de 93,77% particionada dentro dos indivíduos de cada população do besouro Diabrotica virgifera virgifera, o que parece ser uma exceção dentre os estudos em Coleoptera.

Além dos parâmetros utilizados para o cálculo da diversidade genética, outros índices também são importantes na análise da estrutura genética de populações. Nesse sentido, os índices de Wright (FST, FIS e FIT), o coeficiente de divergência genética entre populações (GST), o equilíbrio de Hardy-Weinberg e o tamanho efetivo (Ne), podem revelar como determinado grupo, subpopulação ou população estão geneticamente estruturados (Drees et al., 2008; Manrique-

Poyato et al., 2013; Fuentes-Contreras et al., 2014). A estruturação genética de uma população revela as relações hereditárias existentes entre os indivíduos, resultantes do nível de endogamia e da diferenciação genética entre eles, como também de eventos que tenham alterado as frequências genotípicas e alélicas do grupo, como efeito fundador, bottleneck e deriva genética (Templeton, 2011).

Os índices de Wright (1965) indicam o grau de estruturação e endogamia de uma população ou subpopulações. O índice FST (ou θ), tendo como análogo o

índice GST, é o coeficiente de ancestralidade, e representa a probabilidade de dois indivíduos, pertencentes à subpopulações diferentes, possuírem o mesmo alelo por descendência, e assim, possibilitando uma estimativa da diferenciação e isolamento genético dessas subpopulações (FST=0 as subpopulações possuem frequências idênticas de alelos, FST=1 as populações fixaram alelos diferentes).

Já o índice FIS (ou ƒ) mede a fixação dos alelos ao nível dos indivíduos dentro de uma determinada população, sendo também uma medida de correlação de gametas devido à endogamia dentro das subpopulações. Por último, o FIT (ou F) mede o desvio das frequências genotípicas da população em relação ao desequilíbrio de Hardy-Weinberg, sendo uma medida da heterozigosidade de um indivíduo em relação ao total da população (Templeton, 2011).

Em Coleoptera, os estudos têm mostrado que os valores de FST, de uma maneira geral, estão relacionados positivamente com a distância e isolamento geográfico das populações, como também a presença de barreiras geográficas existentes e possíveis preferências de acasalamento entre os indivíduos, podendo variar de zero até 0,439 (Keller et al., 2004; Ciosi et al., 2011). Dentre os diferentes estudos, os autores têm considerado, em geral, o valor de FST>0.1 um indicativo de diferenciação genética populacional, devido a uma estruturação daquela população em análise (Brouat et al., 2002; Dhuyvetter et al. 2004; Kim and Sappingnton, 2005; Kim et al., 2007; Salle et al., 2007; Drees et al., 2008;

Schrey et al., 2008; Souza et al., 2008; Drury et al., 2009; Lagisz et al., 2010;

Semeao et al., 2010; Gaublomme et al., 2013; Zhang et al., 2013).

Além da análise das características intrínsecas de uma determinada população e as relações entre seus indivíduos, é possível averiguar as relações existentes entre diferentes populações de uma mesma espécie analisando-se parâmetros como, a correlação entre as distâncias genética e geográfica (Teste de Mantel), o fluxo gênico (Nm) e a taxa de migração (m). Esses aspectos genéticos em Coleoptera têm sido afetados pelos mesmos fatores que interferem no FST, por exemplo, sendo assim um indicativo da sensibilidade das populações de besouros às modificações ambientais (Brouat et al., 2002; Keller et al., 2004;

Kim and Sappingnton, 2005; Salle et al., 2007; Drees et al., 2008; Lagisz et al.,

2010; Templeton, 2011; Gaublomme et al., 2013; Zhang et al., 2013).

3. Objetivos

3.1 Objetivo Geral

Caracterizar a estrutura genética populacional da espécie Canthon

(Peltecanthon) staigi (Coleoptera: Scarabaeidae) oriunda de áreas de domínio de

Mata Atlântica das regiões nordeste e sudeste do Brasil.

3.2 Objetivos Específicos

- Desenvolver marcadores moleculares para Canthon (P.) staigi, com a finalidade de realizar análises abordando a estrutura genética populacional;

- Testar a amplificação heteróloga de microssatélites específicos de Canthon (P.) staigi em espécies relacionadas com o intuito de contribuir para estudos populacionais;

- Analisar a estrutura genética de oito populações de Canthon (P.) staigi, com o intuito de avaliar a distribuição da diversidade genética entre diferentes habitats de domínio Mata Atlântica.

4. Capítulo I

Evidence of historical gene flow of Canthon (Peltecanthon) staigi (Coleoptera: Scarabaeidae) Populations in the Atlantic Forest Domain

Short Title: Evidence of historical gene flow of Canthon (Peltecanthon) staigi Populations

Celso Alexandre Ferreira-Neto1,2, Geyner Alves dos Santos Cruz1, Igor Costa de Amorim1,2, Valdir Queiroz Balbino2, Rita de Cássia de Moura1

1-Instituto de Ciências Biológicas, Universidade de Pernambuco, Recife, Brasil. 2-Departamento de Genética, Universidade Federal de Pernambuco, Recife, Brasil.

Corresponding Author: Rita de Cássia de Moura ([email protected])

Submetido à Journal of Insect Conservation ISSN 1572-9753

Evidence of historical gene flow of Canthon (Peltecanthon) staigi (Coleoptera: Scarabaeidae) Populations in the Atlantic Forest Domain Celso Alexandre Ferreira-Neto1,2, Geyner Alves dos Santos Cruz1, Igor Costa de Amorim1,2, Valdir Queiroz Balbino2, Rita de Cássia de Moura1 1-Instituto de Ciências Biológicas, Universidade de Pernambuco, Recife, Brasil. 2-Departamento de Genética, Universidade Federal de Pernambuco, Recife, Brasil.

Abstract

Canthon (Peltecanthon) staigi (Coleoptera) is only found in the American continent and occurs in different environments of Atlantic Forest such as Restinga, “Brejo de Altitude”, and the Atlantic Forest sensu stricto. In this study, we analyzed the genetic structure, through the inter simple sequence repeats (ISSR) markers, of six C. (P.) staigi populations from the Atlantic Forest domain, Brazilian Northeast. A high rate of polymorphism (70.32

%) was detected with an expected heterozygosity (HE) ranging from 0.16095 (Restinga,

Tamandaré population) to 0.24004 (“Brejo de Altitude”, Pesqueira population). The mean fixation index FST = 0.06637 was low suggesting genetic flow among the populations, and there was no genetic and geographic correlation. The ƒ = 0 model proved to be the best adapted to the data produced by the ISSR analysis and was reflected by the biological behavior of the species. The genetic structuring of two clusters (K = 2) suggests the existence of two distinct gene pools distributed among the six populations. Even though the populations occur in fragmented remnants of Atlantic forest domain, the low genetic structuring observed could be related with the dispersion ability of this species, indicating, therefore, a metapopulation, where the HE seems to be influenced by the ecological community structure of C. (P.) staigi and size of the each studied fragment.

Key words: ISSR; Genetic Diversity; Scarabaeinae; Dung Beetles; Metapopulation.

Introduction

The neotropical genus Canthon belongs to Scarabaeinae (Scarabaeidae) subfamily and comprises about 170 species, commonly known as “dung beetles”. The species

Canthon (Peltecanthon) staigi Pereira 1953, is inserted in a well-defined telecoprid guilds of dung beetles and play a key ecological role in the reforestation, as part of process of reallocating organic material and seeds dispersal (Halffter et al. 1992; Halffter and Favila

1993; Ratcliffe et al. 2002). This species is also notable because of its wide geographic distribution, in different habitats on the Atlantic Forest domain, ranging from Brazil to

Paraguay and Argentina (Halffter and Martínez 1967; Halffter and Martínez 1977). In

Brazil, C. (P.) staigi is found on both main vegetation types, the coastal forest or Atlantic

Rain Forest between the States of Paraíba and Paraná (6°S to 25°S approximately) and the tropical seasonal forest or Atlantic Semi-deciduous forest, particularly in the States of

Minas Gerais and Bahia, where the species has also been reported in Caatinga, revealing a great adaptation power of this species (Leitão-Filho and Morellato 1997; Oliveira-Filho and Fontes 2000; Endres et al. 2007; Medina and Lopes 2014; Costa et al. 2014;

Hernández et al. 2014;).

Despite the wide geographic distribution of C. (P.) staigi, in the Brazilian

Northeast, the Atlantic Forest has suffered intense deforestation especially at the north portion of São Francisco River, where a unit known as Pernambuco endemism center is located (Prance 1987). Pernambuco State has experienced a serious deforestation caused specially by sugarcane monoculture, which hastened the disappearance of a large part of the Atlantic Forest (Silveira et al. 2003; Santos et al. 2008; Pereira et al. 2014). Even though C. (P.) staigi is considered an abundant species in the Atlantic Forest remains

(Endres et al. 2007; Hernández et al. 2014), it is sensible to environmental changes, like habitat loss, which seriously disturb its population density and consequently the ecological

49 dynamics on the level of guild structure, thus being considered a bioindicator (Halffter and

Favila 1993; McGeoch et al. 2002; Spector and Ayzama 2003; Gardner et al. 2008;

Hernández et al. 2014).

Considering the high degree of Atlantic Forest fragmentation, the characterization of genetic diversity of C. (P.) staigi requires an understanding of the population genetic structure within and among the remaining forest fragments. Molecular data are essential to analyze genetic diversity and gene flow among populations, as contribute directly to the management and conservation of the species (Marinho et al. 2002; Freitas 2004). The genetic information underlie the best choices and strategies in order to maximize the retention of genetic diversity and reduce inbreeding within populations, which is essential to keep their evolutionary potential (Gao et al. 2012).

The genetic diversity of insects has been accessed through different molecular markers, including the dominants, such as the Inter Simple Sequence Repeats (ISSR). The ISSR markers produce rapid and sensitive results that follow the standard single Medelian inheritance, also, combining high reproducibility with high variability, which enables a cost-efficient genome-wide sampling (He et al. 2007; Souza et al. 2008). On insects, the

ISSR has been successfully applied on the study of population genetic diversity (Saha et al.

2011; Chen et al. 2013; Lopez et al. 2013; Manrique-Poyato et al. 2013; Machkour-

M’Rabet et al. 2014), although an informative marker, few studies were realized on

Coleoptera using ISSR, such as those conducted in Zabrotes subfasciatus (Souza et al.

2008), Coccinella septempunctata (Marin et al. 2010) and Oryctes rhinoceros (Manjeri et al. 2011).

Given the ecological importance of C. (P.) staigi, the aim of this study was to analyze their population genetic structure on different habitats of the Atlantic Forest domain specifically on remaining of Restinga (forest formations on sandy substrates on the

Brazil Atlantic coast), Atlantic Forest stricto sensu and “Brejo de Altitude” in States of

Brazilian Northeastern.

Materials and Methods

Biological Samples

In total 180 individuals from six different populations in Atlantic Forest stricto sensu, Restinga and Brejo, were collected using pitfall traps baited with human feces

(Table 1, Fig. 1). For each population 30 C. (P.) staigi specimens were analyzed. The specimens were sedated, sacrificed, placed in absolute alcohol, and stored at -20ºC. In addition, vouchers were made for each population on a model basis, and these were included in the Scientific Collection of Scarabaeidae (Coleoptera) at Instituto de Ciências

Biológicas (ICB), Universidade de Pernambuco (UPE).

Fig. 1 South America map showing the collection points of Canthon (Peltecanthon) staigi in the States of Pernambuco and Paraíba in Brazilian North-Eastern region.

Table 1: Collected Canthon (P.) staigi populations, main environmental characteristics, fragment size and altitude, and geographic coordinates.

Main characteristics Geographic Environment Population of the remaining coordinates forests Atlantic Biological Reserve with Forest stricto 06°36'44''S Guaribas - GUA secondary vegetation sensu (PB) 35°17'34''O 463.75 ha / 165 m

Urban forest with secondary vegetation influenced by 08°01'18''S Aldeia - ALD (PE) anthropological activities located in the 34°58'52''O Metropolitan area 1.110 ha / 139 m Restinga Island environment 07°44'52''S Itamaracá - ITA with secondary forest 34°49'32''O (PE) 486.75 ha / 44 m

Coastal environment Tamandaré - TAM with high deforestation 08°30'41''S (PE) level caused by enterprises, as resorts 35°00'17''O and hotels 17.6 ha / 12 m “Brejo de Secondary vegetation Altitude” influenced by Bonito - BON (PE) 08°28'13''S Forest anthropological activities 35°43'43''O 295 ha / 466 m

Secondary vegetation 08°21'28''S Pesqueira - PES influenced by (PE) anthropological 36°41'47''O activities 4,051.62 ha / 778 m

All collections were performed with the permission of IBAMA (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis) by licenses issued by SISBIO

(Sistema de Autorização e Informação em Biodiversidade): 16.278-1; 41761-1 and 41761-

DNA isolation and ISSR analysis

DNA was isolated using phenol chloroform according to Sambrook and Russel

(2000). The extracted DNA was purified through enzymatic digestion by RNAse

(10 mg/mL) for 2 h at 37 °C. Following this, the quality and concentration of DNA was determined through agarose gel electrophoresis (1 %) and compared with a DNA phage

Lambda DNA/Hind III marker (Fermentas Life Science), and through spectrophotometry on a NanoDrop® 2000c (NanoDrop Technologies, Wilmington, DE).

The volume of each PCR reaction included: 25 µL, which 12.5 ng of genomic

DNA, 0.1xPCR buffer, 0.25 mM MgCl, 0.2mM dNTP (Invitrogen), 2 pmol primer, and 1

U Taq polymerase (Invitrogen). The conditions for the PCR were 94 °C for 4 min, followed by 35 cycles of 94 °C for 30 s, the annealing temperature for each primer for 45 s and 72 °C for 2 min, and then a final extension of 72 °C for 7 min. The amplified DNA was placed in 3x loading buffer, submitted to electrophoresis in agarose gel (2 %), and subsequently analyzed under a transilluminator (Gel Logic/Carestream MI SE).

Selection of primers

A total of 49 ISSR primers (Table S2) (Biotechnology Laboratory, University of

British Columbia) were tested in an individual of C. (P.) staigi. Further 16 primers that generated well-defined fragments were chosen to the primer selection step. These primers were applied to a sample set of nine specimens, three of each populations; ITA, PES, and

TAM (Table 1). The genotyped fragments of DNA were compiled in a binary matrix of presence (1) and absence (0). This matrix was analyzed with regard to choose the most informative primers based on: the total number of amplified fragments; index of genetic diversity (Dg); PIC – Polymorphism Information Content (Roldán-Ruiz et al. 1999); MI -

Marker Index (Prevost and Wilkinson 1999); and RP - Resolution Power (Varshney et al.

2007). In addition, Pearson’s correlation was calculated between the PIC, MI, and RP indices. On the basis of this analysis, the six most informative primers were selected (Table

S1), and applied on the 180 specimens from six C. (P.) staigi populations.

Reproducibility

For the reproducibility of the ISSRs, two independent ISSR analyses were performed, and the error rate was calculated according to the Jaccard distance (Holland et al. 2008). Furthermore, no reproducible loci were eliminated of the genetic analyses.

Genetic diversity and the F statistic

Genetic diversity indices, expected heterozygosity (HE), genetic differentiation, and the molecular variance index – AMOVA (this latter based on 1000 permutations) were calculated in ARLEQUIN 3.5 (Excoffier and Lisher 2010). The Genodive software 2.0

(Meirmans and Van Tienderen 2004) was used to calculate the GST index, which is an analogue of FST.

Isolation by distance (IBD)

The IBD (Wright 1965) was analyzed on the basis of a correlation between the genetic and geographic distances through the Mantel Test (Sokal and Rohlf 1995), by

54 means of 10,000 random permutations to determine the level of significance, through software ALERQUIN 3.5.

Population model test

Data produced by ISSR were tested by means of a Bayesian approach in

Hickory1.1 software (Holsinger et al. 2002) for four different population models: (i) full model, where values of population differentiation (theta, θ, parametric analogue of

Wright’s FST) and inbreeding (ƒ, an analogue of FIS) differ from zero, (ii) the ƒ = 0 model, which assumes an absence of inbreeding among the populations, (iii) the theta = 0 model, based on the absence of population differentiation, and (iv) the free model, where the values are chosen at random. A better model was chosen based on DIC (deviance information criterion) parameters for AIC (Akaike information criterion) in the selection by Bayesian and Dbar models, which is a measure of how well the model is adapted to the analyzed data (lower values indicate the most suitable model).

Number of genetic clusters

Genetic clusters were analyzed in the Structure 2.3.2 program (Pritchard et al.

2000) by employing the Bayesian method where the K value was identified and analyzed to determine the level of genetic mixing among the populations. The interaction between individuals took place on the basis of 660,000 replicas (60,000 in the burning stage), using the Admixture model with correlated allele frequencies. The number of genetic clusters was inferred from the method employed by Evanno et al. (2005), which uses the delta K value.

Principal Coordinates Analysis (PCoA)

The graphical method PCoA was conducted on the genetic matrix through

GENALEX V6.5 (Peakall and Smouse 2006) to identify the relationship and the most probable genetic structure among the six populations sampled.

Results

The six ISSR primers used in the population analysis amplified 219 loci, of which

186 were polymorphic (Table 2). The DNA fragments ranged from 200 to 2200 bp. The

GUA and ITA populations had a larger number of amplified fragments, while ALD the lowest number. Moreover, the ITA population had a larger number of polymorphic fragments, while ALD the lowest number. The error rate (Jaccard distance) varied between

3,87 % and 31,18 % with a mean of 14,56 %.

Table 2: Analyzed populations and their respective environments, the polymorphic indexes and HE. Polymorphic % Population Enviroments H fragments Polymorphism E Guaribas – GUA Atlantic 154 70,32 0.21393 Forest stricto Aldeia - ALD 139 63,47 0.17442 sensu Pesqueira – PES “Brejo de 186 84,93 0.24004 Bonito – BOM Altitude” 139 63,47 0.17368 Itamaracá – ITA 182 83,11 0.22774 Restinga Tamandaré – TAM 124 56,62 0.16095

Genetic diversity

Molecular variation (AMOVA) of 6.64 % was found among the populations, while

93.36 % within them. In addition, the fixation index (FST = 0.06637) suggests low genetic structuring among the analyzed populations. The index of GST with a value of 0.078, also

56 indicated low genetic structuring and high gene flow. The observed rate of mean polymorphism was 70,32 %. The expected heterozygosity (HE) was, on average, 0.22354

(standard deviation of 0.12026 among the loci) and the average HE in each population is showed in Table 2.

Isolation by distance (IBD)

According to Mantel Test (based on the FST values), no significant correlation was found between the geographic distribution and the genetic differentiation (r = 0.133888, P

= 0.391), which suggests there was no isolation by distance (IBD) (see Table 3).

Table 3: Mantel Test through a pairwise analysis based on FST in the six populations analyzed.

Population GUA ALD PES BON ITA TAM GUA - 131 Km 249 Km 204 Km 119 Km 197 Km ALD 0.13745 - 190 Km 100 Km 24 Km 67 Km PES 0.10125 0.07539 - 108 Km 202 Km 186 Km BON 0.09813 0.08417 0.03822 - 122 Km 78 Km ITA 0.10857 0.06582 0.03865 0.03379 - 84 Km TAM 0.05579 0.06485 0.00000 0.04111 0.00000 -

Population models test

Based on the tested population models, the lowest DIC and Dbar values were found for the full model and ƒ = 0. However, the full model revealed an average rate of inbreeding of 0.720425, with a maximum value of 0.9918 (Table S2). These values are considered high in account of the low level of the genetic diferentiation (GST = 0.078). For this reason, the ƒ = 0 model was chosen as being most suitable and its values are shown in

Table 4.

Table 4: Parameters estimated by the Hickory for the ƒ = 0 model Standard Parameter Mean 2.50 % 97.50 % deviation theta-I 0.00961817 0.0013988 0.00715814 0.012595 theta-II 0.00406332 0.00120453 0.0019693 0.00660366 theta-III 0.00334877 0.000972205 0.00164329 0.00534203 theta-Y 0.00555892 0.00100593 0.00376699 0.00769472 Rho 0.583111 0.0922693 0.408204 0.759737

HS [Itamaracá] 0.132728 0.00238347 0.128202 0.137425

HS [Pesqueira] 0.133557 0.00240206 0.128926 0.13836

HS [Guaribas] 0.135122 0.00256974 0.130236 0.140311

HS [Tamandaré] 0.126995 0.00262889 0.121836 0.132097

HS [Aldeia] 0.129475 0.00239072 0.124825 0.134079

HS [Bonito] 0.127121 0.00258878 0.121835 0.132074

HS 0.00177434 0.127437 0.130779 0.134443

HT 0.131276 0.00178118 0.127886 0.134904

GST-B 0.00337184 0.000985072 0.00164816 0.0053996

Population structure

On the basis of the 10 K (clusters) tested, the highest ΔK was K = 2 according to the method/correction described by Evanno et al. (2005), although a lower peak was observed for K = 4 (Fig. 2). A greater prevalence of Cluster 1 was observed in the GUA population while Cluster 2 was more prevalent in the ALD population (Table 5, Fig. 3, and

Fig. S1).

Principal coordinates analysis of C. (P.) staigi populations allowed graphical examination of the first two major axes of multivariate genetic variation, showing a GUA separation by first axis reinforcing the structuring tendency of this population. The PCoA also reinforced the historical gene flow by individual’s dispersion on the graphic (Fig. 4).

Fig. 2 Values of Delta K in accordance with the method described by Evanno et al. (2005).

From the results obtained, six ISSR primers were used and 186 polymorphic bands were obtained for six Canthon (P.) staigi populations. Note that the highest peak occurred in K

= 2 and the lowest peak in K = 4

Fig. 3 Ancestry of each individual in either of the two groups plotted by the Structure 2.3.4 program, by means of six ISSR markers and 186 polymorphic bands in Canthon

(Peltecanthon) staigi. Each vertical bar represents one of 180 individuals that were analyzed, and its population of origin is noted. The length of the bar is proportional to the inferred ancestry within each group for each individual

Table 5: Proportion of individuals from each population related to groups formed by the

Structure program with K = 2

Population Group 1 Group 2 GUA 94.82 % 5.18 % ALD 15.16 % 84.83 % PES 73.53 % 26.47 % BON 19.18 % 80.82 % ITA 61.65 % 38.35 % TAM 28.39 % 71.61 %

Fig. 4 Principal Coordinates analyses (PCoA) constructed through ISSR analysis from six Canthon (Peltecanthon) staigi populations with 186 polymorphic bands

Discussion

The observed rate of mean polymorphism (70.32 %) to C. (P.) staigi populations is similar to other coleopteran species like Zabrotes subfasciatus (Bohemann, 1833) studied by Souza et al. (2008) in Brazil, who also observed a polymorphism rate between 74 % and

83.32 % using the same molecular markers performed in the present work. Other studies, with natural insect populations based on ISSR, have been made, on various species of

Lepidoptera, lac insect Kerria spp., acridians Eyprepocnemis plorans (Charpentier 1825) and Sogatella furcifera (Horváth, 1899), and Hemipterian Bactericera cockerelli (Sulc)

(Hundsdoerfer et al. 2005; Pradeep et al. 2005; Liu et al. 2010; Manjeri et al. 2011; Saha et al. 2011; Chen et al. 2013; Lopez et al. 2013; Manrique-Poyato et al. 2013; Machkour-

M’Rabetet al. 2014). Moreover, plague insects like Plutella xylostella (Linnaeus, 1758)

(Roux et al. 2007) have also been genetically characterized by ISSR markers, and all of these works presented rates of polymorphism above 50 %. The results described here and those of previous studies confirm the resolving power of the ISSR marker when used in insect population studies.

The genetic diversity of C. (P.) staigi (HE of 22.35 %) was similar when compared to other genetic analysis of insect populations (about 20 %), such as the butterflies Baronia brevicornis (Machkour-M’Rabet et al. 2014), P. xylostella (Roux et al. 2007) and

Antheraea mylitta Drury (Kar et al. 2005), as well as the grasshopper E. plorans

(Manrique-Poyato et al. 2013). On the other hand, species like Z. subfasciatus (beetle) revealed HE values with mean of 27 % (Souza et al. 2008) and also reports with values less than 20 %, as observed in the fairyfly Gonatocerus ashmeadi HE = 11,6 % (León and Jones

2005), therefore, the studies using ISSR show that the variation of HE on insects in general is higher (11 – 25 %) when compared with the variation on beetles (22 – 27 %).

Variations in the HE of 0.16095 to 0.24004 (Table 2) were observed on C. (P.) staigi individuals from different environments composed by distinct sets of ecological and abiotic factors on each populations, the restinga enviroment for instance (ITA and TAM), displays a level of more pronounced historical degradation (Rizzini 1979) caused by urban expansion, thereby presenting the smallest area among all studied. Therefore, in this habitat/ecosystem was observed the lower value of HE = 0.16841 in TAM population

(Table 2). The low rate of HE found in this population may result from a lack of ecological structuring within the beetle communities, owing to the reduced size of the habitat fragment (17.6 ha), while ITA, a Restinga environment too, presents a HE value of 0.22774

(Table 2) and a fragment size of 486.75 ha.

Scarabaeidae demands at least 85 ha to maintain a well-structured community

(Larsen et al. 2008), being corroborated by Filgueiras et al. (2011), that observed in the

Atlantic Forest the large fragments (>100 ha) guarantee the integrity of dung beetles communities once the dung beetle seems to be sensitive to changes in its community and habitat, as C. (P.) staigi. The loss of area, observed in TAM, can result in allelic loss, inbreeding, or isolation of the population. These factors are highlighted in ecologically degraded environments due to the loss of natural habitat (Manrique-Poyato et al. 2013) resulting in the calculated HE index. According to On the other hand, the PES population, inserted on the largest studied area (4,051.62 hectares), showed the highest HE value

(0.22467), suggesting indeed that the reduction process of the remaining forest fragments probably influence not only the ecological structure of C. (P.) staigi but also the genetic diversity.

The stability of the beetle community does not only depend on the fragment size, but also other environmental factors such as supply of organic matter and species diversity

(Larsen et al. 2008). Anthropic activities in the Atlantic Forest have been well evidenced in

63 forests inserted in metropolitan areas (Joly et al. 2014), and these activities could be responsible for loss of habitat and interference in natural communities, a suitable explanation for the ALD population, for example, that presents a value of HE (0.16095).

This environment is currently surrounded by private condominiums or illegal occupations, while GUA population, also in an Atlantic Forest stricto sensu fragment, even in a smaller fragment has a greater HE (0.21738), and thus illustrates that different conditions within fragments are also determinants for the level of genetic diversity of C. (P.) staigi.

Regarding the structure analysis, the population model ƒ = 0 and the high index of historic gene flow suggest a low genetic structuring among the populations (GST = 0.078) of C. (P.) staigi. This could be a result of aerial displacement of this species in areas of the

Atlantic Forest, since flight ability is remarkable on Scarabaeinae, as seen in the beetle

Digitonthophagus gazella that can reach a displacement of two to 800 km/year (Barbero and López-Guerrero 1992). Moreover, C. (P.) staigi has been reported in other environments outside the forest, as “Caatinga” (Medina and Lopes 2014). In addition, the telecoprid habit of C. (P.) staigi also contribute to the specimens dispersion, once the individuals form a mass of organic material and displace this material away from the main source along the forest (Endres et al. 2007). Despite the fragmentation of habitats, the ecological and biological characteristics of this species play an important role in shaping the genetic structure populations.

Despite the dispersal ability of C. (P.) staigi, the fragmentation process is an adverse factor that affects the displacement of Canthon species. Arellano et al. (2008) observed that Canthon cyanellus cyanellus Le Conte is able to disperse easily in complex tropical deciduous forest landscape but has difficulties in pasturelands. The fragments of

Atlantic Forest and Restinga studied here are geographically isolated, mainly by a matrix of sugar-cane monoculture. Nevertheless, the ISSR results revealed very low level of

64 genetic differentiation between populations (FST = 0.06755) and most of molecular variation (AMOVA) was observed within populations rather than between them, also suggesting high levels of historical gene flow. The intense Atlantic Forest deforestation process began around 500 years ago, which is unlikely to result in deep changes on allelic fixation of the analyzed populations. Considering the geographical isolation of the studied remnants and the low genetic structure among C. (P) staigi populations, we suggest that the populations analyzed are in fact a metapopulation. Moreover, through Mantel test was observed no isolation by distance reinforcing this hypothesis.

The pattern of genomic mixing pointed to the structuring of only two genetic clusters (K = 2); Cluster 1 and Cluster 2 (Fig. 3) with a dispersion of the populations on

PCoA analysis (Fig. 4), indicating no pattern of genetic differentiation; the population

GUA (separated by first axis in PCoA analysis – Fig. 4) which was the unique of this study present on a Biological Reserve, appeared to be the most structured in relation to other populations. It is already known that reduction of habitats within the Atlantic Forest represents a risk to biodiversity in Brazil, therefore studies of bioindicator species contribute for the quantification of the extent of this process and identification of those habitats with a significant genetic and ecological biodiversity. According to Nichols et al.

(2007), who undertook a revision and meta-analysis about the response of dung beetles to tropical forest modification and fragmentation, the preservation of these habitats is essential, because through better future management it may be possible to mitigate the loss of diversity suffered by the populations of these environments and thus, ensure their preservation.

Conclusions

Based on our results the telecoprid habit and habitat fragmentation seems to influence the genetic diversity and, consequently, play an important role in shaping the genetic population structure of the species C. (P.) staigi. Furthermore, given the low genetic structure of the C. (P.) staigi populations, the metapopulation hypothesis seems to be the likely explanation, once the isolation of the forest remnants and the dispersal ability of C. (P) staigi might be key factors on the genetic differentiation of these populations over the time.

Acknowledgments

We are grateful to Msc. Cristiane Maria Queiroz da Costa and Prof. Dr. Fernando

Silva for the collection and identification of specimens. This study was supported by a grant from the Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco

(FACEPE-IBPG-0831-2.02/11), funding to doctorate of the student CAFN and

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES-20130558), funding to post-doc researcher, and CNPq (National Counsel of Technological and

Scientific Development) fund PQ R.C.M. process 305298/2014-3).

References

- Arellano L, León-Cortés JL, Ovaskainen O (2008) Patterns of abundance and movement in relation to landscape structure: a study of a common scarab (Canthon cyanellus cyanellus) in Southern Mexico. Landscape Ecol 23:69–78. doi: 10.1007/s10980-007-9165-

- Barbero E, López-Guerrero Y (1992) Some considerations on the dispersal power of

Digitonthophagus gazella (Fabricius 1787) in the New World (Coleoptera Scarabaeidae

Scarabaeinae). Tropical Zoology 5,1:115-120. doi: 10.1080/03946975.1992.10539184

- Chen F, Shi J, Luo Y, Sun S, Pu M (2013) Genetic Characterization of the Gypsy Moth from China (Lepidoptera, Lymantriidae) Using Inter Simple Sequence Repeats Markers.

PLoS One 9(1). Doi: 10.1371/journal.pone.0073017

- Costa CMQ, Barretto JW, Moura RC (2014) Changes in the dung beetle community in response to restinga forest degradation. Journal of Insect Conservation 18:895-902. doi:

10.1007/s10841-014-9697-6

- Endres AA, Creão-Duarte AJ, Hernández MIM (2007) Diversidade de Scarabaeidae s. str. (Coleoptera) da Reserva Biológica Guaribas, Mamanguape, Paraíba, Brasil: uma comparação entre Mata Atlântica e Tabuleiro Nordestino. Revista Brasileira de

Entomologia 51: 67-71

- Evanno G, Regnaut S, Goudet, J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol 14:2611–2620. doi:

10.1111/j.1365-294X.2005.02553.x

- Excoffier L, Lisher HEL (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour

10:564–567. doi: 10.1111/j.1755-0998.2010.02847.x

- Freitas BM (2004) Solitary Bees: Conservation, Rearing and Management for

Pollination. Fortaleza, Ceará, Brazil: Ed. Imprensa Univrsitária; 282p

- Gao Q, Yue GD, Li WQ, Wang JY, Xu JH, Yin Y (2012) Recent progress using high- throughput sequencing technologies in plant molecular breeding. J Integr Plant Biol

54(4):215–227. doi: 10.1111/j.1744-7909.2012.01115.x

- Gardner TA, MIM Hernández, Barlow J, Peres CA (2008) Understanding the biodiversity consequences of habitat change: the value of secondary and plantation forests for neotropical dung beetles. Journal of Applied Ecology 45:883-893. doi: 10.1111/j.1365-

2664.2008.01454.x

- Halffter G, Martínez A (1967) Revisión monográfica de los Canthonina americanos (2ª parte). Revista de la Sociedad Mexicana de Historia Natural 28:79–116

- Halffter G, Martínez A (1977) Revisión monográfica de los Canthonina americanos, IV

Parte. Clave para géneros y subgéneros. Folia Entom Mex 38:29–107

- Halffter G, Favila ME, Halffter V (1992) A comparative study of the structure of the scarab gild in Mexican tropical rain forests and derived ecosystems. Folia Entom Mex

84:131-156

- Halffter G, Favila ME (1993) The Scarabaeidae (Insecta: Coleoptera) an animal group for analyzing, inventorying and monitoring biodiversity in tropical rainforest and modified landscapes. Biology Internacional 27:15–21

- He L, Wang S, Miao X, Wu H, Huang Y (2007) Identification of necrophagous fly species using ISSR and SCAR markers. Forensic Sci Int 168:148–153

- Hernández MIM, Barreto PSCS, Valderêz HC, Creão-Duarte AJ, Favila ME (2014)

Response of a dung beetle assemblage along a reforestation gradient in Restinga forest.

Journal of Insect Conservation 18:539-546. doi: 10.1007/s10841-014-9645-5

- Holland BR, Clarke AC, Meudt HM (2008) Optimizing automated AFLP scoring parameters to improve phylogenetic resolution. Syst Biol 57:347–366. doi:

10.1080/10635150802044037

- Holsinger KE, Lewis PO, Dey DK (2002) A Bayesian method for analysis of genetic population structure with dominant marker data. Mol Ecol 11:1157–1164. doi:

10.1046/j.1365-294X.2002.01512

- Hundsdoerfer AK, Kitching IJ, Wink M (2005) The phylogeny of the Hyles euphorbiae complex (Lepidoptera: Sphingidae): molecular evidence from sequence data and ISSR-

PCR fingerprints. Org Divers Evol 5:173–198. doi:10.1016/j.ode.2004.11.012

- Joly Ca, Metzger JP, Tabarelli M (2014) Experiences from the Brazilian Atlantic Forest: ecological findings and conservation initiatives. New Phytologist 204:459–473

- Kar PK, Vijayan K, Mohandas TP, Nair CV, Saratchandra B, Thangavelu K (2005)

Genetic variability and genetic structure of wild and semi-domestic populations of tasar silkworm (Antheraea mylitta) ecorace Daba as revealed through ISSR markers. Genetica

125:173–183

- Larsen TH, Lopera A, Forsyth A (2008) Understanding Trait-Dependent Community

Disassembly: Dung Beetles, Density Functions, and Forest Fragmentation. Conserv Biol

22:1288–1298

- Leitão-Filho HF, Morellato LPC (1997) Semideciduous forests of Southeastern Brasil ‒

Serra do Japi. In: Davis SD, Heywood VH, Herrera-MacBryde O, Villa-Lobos J, Hamilton

AC (eds.) Centres for plant diversity: a guide and strategy for their conservation. IUCN,

WWF, Washington, pp 381-384

- León JH, Jones WA (2005) Genetic differentiation among geographic populations of

Gonatocerus ashmeadi, the predominant egg parasitoid of the glassy-winged sharpshooter,

Homalodisca coagulata. Journal of Insect Science 5:2

- Liu J, Gui F, Li Z (2010) Genetic diversity of the planthopper, Sogatella furcifera in the

Greater Mekong Subregion detected by inter-simplesequence repeats (ISSR) markers.

Journal of Insect Science 10:52. doi: 10.1673/031.010.5201

- Lopez B, Favela S, Ponce G, Foroughbakhch R, Flores AE (2013) Genetic Variation in

Bactericera cockerelli (Hemiptera: Triozidae) from Mexico. Journal of Economic

Entomology 106(2):1004-1010

- Machkour-M’Rabet S, Leberger R, León-Cortés JL, Gers C, Legal L (2014) Population structure and genetic diversity of the only extant Baroninae swallowtail butterfly, Baronia brevicornis, revealed byISSR markers. Journal Insect Conservation 18:385-396. doi:

10.1007/s10841-014-9647-3

- Manjeri G, Muhamad R, Faridah QZ, Tan SG (2011) Genetic variation studies in Oryctes rhinoceros (L.) (Coleoptera: Scarabaeidae) from oil palm plantations using random amplified microsatellite (RAMs) markers. Biochem Syst Ecol 10:2611–2617

- Manrique-Poyato MI, López-León MD, Gómez R, Perfectti F, Camacho JPM (2013)

Population Genetic Structure of the Grasshopper Eyprepocnemis plorans in the South and

East of the Iberian Peninsula. PLoS One 8:1–8. doi: 10.1371/journal.pone.0059041

- Marin J, Crouau-Roy B, Hemptinne JL, Lecompte E, Magro A (2010) Coccinella septempunctata (Coleoptera, Coccinellidae): a species complex? Zoologica Scripta

39(6):591-602. doi: 10.1111/j.1463-6409.2010.00450.x

- Marinho CGS, Zanetti R, Delabie JHC, Schlindwein MN, Ramos LS (2002) Diversidade de Formigas (Hymenoptera: Formicidae) da Serapilheira em Eucaliptais (Myrtaceae) e

Área de Cerrado de Minas Gerais. Neotrop Entomol 31:187–195

- McGeoch MA, Rensburg BJV, Botes A (2002) The verification and application of bioindicators: a case study of dung beetles in a savanna ecosystem. J Appl Ecol 39:661-

672. doi: 10.1046/j.1365-2664.2002.00743.x

- Medina AM, Lopes PP (2014) Seasonality in the dung beetle community in a Brazilian tropical dry forest: Do small changes make a difference? J Insect Sci 14:1–11. doi:

10.1673/031.014.123

- Meirmans PG, Van Tienderen PH (2004) Genotype and Genodive: two programs for the analysis of genetic diversity of asexual organisms. Mol Ecol Notes 4:792–794. doi:

10.1111/j.1471-8286.2004.00770.x

- Nichols E, Larsen T, Spector S, Davis AL, Escobar F, Favila M (2007) The Scarabaeinae

Research Network. Global dung beetle response to tropical forest modification and fragmentation: A quantitative literature review and meta-analysis. Biol Conserv 137:1–19.

- Oliveira-Filho AT, Ratter JA (2000) Padrões florísticos das matas ciliares da região do

Cerrado e a evolução das paisagens do Brasil Central durante o Quaternário Tardio. In:

Rodrigues RR, Leitão Filho HF (eds.) Matas ciliares: conservação e recuperação. EDUSP,

São Paulo.

- Peakall R, Smouse PE (2006) GENALEX V6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295

- Pereira GA, Dantas SM, Silveira LF, Roda SA, Albano C, Sonntag FA (2014) Status of the globally threatened forest birds of northeast Brazil. Papéis Avulsos de Zoologia, Museu de Zoologia da Universidade de São Paulo 54:177–194

- Pradeep AR, Chatterjee SN, Nair CV (2005) Genetic differentiation induced by selection in an inbred population of the silkworm Bombyx mori, revealed by RAPD and ISSR marker systems. J Appl Genet 46(3):291–298

- Prance GT (1987) Biogeography of neotropical plants. In: Whitmore TC, Prance GT

(eds.) Biogeography and Quaternary history in tropical America. Oxford, Oxford

University Press, pp 224

- Prevost A, Wilkinson MJ (1999) A new system of comparing PCR primers applied to

ISSR fingerprint of potato cultivars. Theor Appl Genet 98:107–112

- Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945–959

- Ratcliffe BC, Jameson ML, Smith ABT (2002) Scarabaeidae. In: Arnett JRRH, Thomas

MC, Skellei PE, Frank JH. American Beetles, Polyphaga: Scarabaeoidea through

Curculionoidea. Ed. CRC Press LLC 2:39–81

- Rizzini CT (1979) Tratado de fitogeografia do Brasil. v.2. Aspectos ecológicos. Hucitec /

Edusp.; São Paulo

- Roldán-Ruiz I, Dendauw J, Van BE, Depicker A, De Loose M (2000) AFLP markers reveals high polymorphic rates in ryegrasses (Lolium spp.). Mol Breed 6:125–134

- Roux O, Gevrey M, Arvanitakis L, Gers C, Bordat D, Legal L (2007) ISSR-PCR: Tool for discrimination and genetic structure analysis of Plutella xylostella populations native to different geographical areas. Mol Phylogenet Evol 43:240–250. doi:10.1016/j.ympev.2006.09.017

- Saha D, Ranjan SK, Mallick CB, Vidyarthi AS, Ramani R (2011) Genetic diversity in lac resin-secreting insects belonging to Kerria spp., as revealed through ISSR markers.

Biochem Syst Ecol 39:112–120. doi:10.1016/j.bse.2011.01.016

- Sambrook J, Russel D W (2000) Molecular Cloning. 3rd edition. Cold Spring Harbor

Laboratory Press, New York

- Santos BA, Peres CA, Oliveira MA, Grillo A, Alves-Costa CP, Tabarelli M (2008)

Drastic erosion in functional attributes of tree assemblages in Atlantic forest fragments of northeastern Brazil. Biol Conserv 141: 249–260. doi:10.1016/j.biocon.2007.09.018

- Silveira LF, Olmos F, Long, A (2003) Birds in Atlantic Forest Fragments in north-east

Brazil. Cotinga 20: 32-46

- Sokal RR, Rohlf FJ (1995) Biometry (3rd ed.). New York, Freeman, pp 813–819

- Souza GA, Carvalho MRO, Martins ER, Guedes RNC, Oliveira LO (2008) Diversidade genética estimada com marcadores ISSR em populações brasileiras de Zabrotes subfasciatus. Pesquisa Agropecuária Brasileira 43:843–849

- Spector S, Ayzama S (2003) Rapid turnover and edge effects in Dung Beetle assemblages

(Scarabaeidae) at a Bolivian Neotropical Forest–Savanna Ecotone. Biotropica 35:394–404. doi: 10.1111/j.1744-7429.2003.tb00593.x

- Varshney RK, Chabane K, Hendre PS, Aggarwal RK, Graner A (2007) Comparative assessment of EST-SSR, EST-SNP and AFLP marker for evaluation of genetic diversity and conservation of genetic resources using wild, cultivated and elite barleys. Plant Sci

173:638–649. doi:10.1016/j.plantsci.2007.08.010

- Wright S (1965) The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution 19: 395–420

Supporting Information Captions

Table S1: Most informative primers determined by the total number of amplified fragments. Diversity Genetic Index (Dg); Polymorphism Information Content (PIC),

Marker Index (MI), and Resolution Power RP.

Total of Polymorphic Polymorphism Primers PIC MI RP fragments fragments frequency 808* 17 17 1 0,421 7,160 11,111 809* 15 15 1 0,454 7,723 11,333 818* 18 18 1 0,413 7,024 12,000 826* 16 16 1 0,386 6,559 9,556 827 8 7 0,875 0,309 4,591 3,556 829 2 1 0,5 0,122 1,041 0,286 836 19 18 0,947368421 0,385 6,195 11,333 842* 15 15 1 0,402 6,828 9,556 846* 11 11 1 0,406 6,906 7,750

848* 16 16 1 0,328 5,578 7,000 857* 31 31 1 0,376 6,391 17,778 855* 24 23 0,958333333 0,426 6,939 16,889 861 9 8 0,888888889 0,368 5,555 4,889 862* 8 8 1 0,387 6,574 4,750 864* 28 27 0,964285714 0,349 5,724 14,222 873* 35 35 1 0,408 6,932 22,222 Total 272 266 0,945867272 0,371218 6,107641 10,26438 (Gd)

Table S2 Tabela 2: ISSR primers tested in species C. (P.) staigi.

807 AGA GAG AGA GAG AGA GT 846* CAC ACA CAC ACA CAC ART 808* AGA GAG AGA GAG AGA GC 847 CAC ACA CAC ACA CAC ARC 809* AGA GAG AGA GAG AGA GG 848* CAC ACA CAC ACA CAC ARG 810 GAG AGA GAG AGA GAG AT 849 GTG TGT GTG TGT GTG TYA 811 GAG AGA GAG AGA GAG AC 850 GTG TGT GTG TGT GTG TYC 812 GAG AGA GAG AGA GAG AA 851 GTG TGT GTG TGT GTG TYG 816 CAC ACA CAC ACA CAC AT 852 TCT CTC TCT CTC TCT CRA 817 CAC ACA CAC ACA CAC AA 853 TCT CTC TCT CTC TCT CRT 818* CAC ACA CAC ACA CAC AG 855* ACA CAC ACA CAC ACA CYT 819 GTG TGT GTG TGT GTG TA 856 ACA CAC ACA CAC ACA CYA 824 TCT CTC TCT CTC TCT CG 857* ACA CAC ACA CAC ACA CYG 825 ACA CAC ACA CAC ACA CT 858 TGT GTG TGT GTG TGT GRT 826* ACA CAC ACA CAC ACA CC 859 TGT GTG TGT GTG TGT GRC 827* ACA CAC ACA CAC ACA CG 860 TGT GTG TGT GTG TGT GRA 828 TGT GTG TGT GTG TGT GA 861* ACC ACC ACC ACC ACC ACC 829* TGT GTG TGT GTG TGT GC 862* AGC AGC AGC AGC AGC AGC 830 TGT GTG TGT GTG TGT GG 864* ATG ATG ATG ATG ATG ATG 834 AGA GAG AGA GAG AGA GYT 866 CTC CTC CTC CTC CTC CTC 835 AGA GAG AGA GAG AGA GYC 868 GAA GAA GAA GAA GAA GAA 836* AGA GAG AGA GAG AGA GYA 869 GTT GTT GTT GTT GTT GTT 840 GAG AGA GAG AGA GAG AYT 873* GAC AGA CAG ACA GAC A 841 GAG AGA GAG AGA GAG AYC 876 GAT AGA TAG ACA GAC A 842* GAG AGA GAG AGA GAG AYG 878 GGA TGG ATG GAT GGA T 844 CTC TCT CTC TCT CTC TRC 879 CTT CAC TTC ACT TCA 845 CTC TCT CTC TCT CTC TRG *Primers that presented better amplification.

Fig. S1 Ancestry of each individual in either of the four groups plotted by the Structure

2.3.4 program, by means of six ISSR markers with 295 amplified bands in Canthon (P.) staigi populations (Itamaracá-PE, TAM, Pesqueira-PE, PES, Guaribas-PB, GUA,

Tamandaré-PE, TAM, Aldeia-PE, ALD and Bonito-PE, BON). Each vertical bar represents one of 180 individuals and the population of origin is cited below. The length of the bar is proportional to the inferred ancestry within each group for each individual.

5. Capítulo II

Isolation and characterization of microsatellite markers in Canthon (Petelcanthon) staigi (Scarabaeidae) and cross- amplification in related species.

Geyner Alves dos Santos Cruz1; Celso Alexandre Ferreira-Neto1,2; Amaro de Castro Lira Neto3; Rita de Cássia de Moura1

1-Institute of Biological Sciences, Pernambuco University, Recife, Brazil. 2-Genetics Department, Federal University of Pernambuco, Recife, Brazil. 3-Agronomic Institute of Pernambuco, Recife, Brazil

Corresponding author(s): Geyner Alves dos Santos Cruz ([email protected]) / Rita de Cássia de Moura ([email protected])

Submetido à Entomological Science ISSN 1479-8298

Isolation and characterization of microsatellite markers in Canthon (Petelcanthon) staigi (Scarabaeidae) and cross-amplification in related species.

Geyner Alves dos Santos Cruz1; Celso Alexandre Ferreira-Neto1,2; Amaro de Castro Lira

Neto3; Rita de Cássia de Moura1

1-Institute of Biological Sciences, Pernambuco University, Recife, Brazil. 2-Genetics Department, Federal University of Pernambuco, Recife, Brazil. 3-Agronomic Institute of Pernambuco, Recife, Brazil Corresponding author(s): Geyner Alves dos Santos Cruz ([email protected]) /

Rita de Cássia de Moura ([email protected])

The species Canthon (Peltecanthon) staigi is a Neotropical "dung beetle" from Brazilian Atlantic Rainforest, which plays a key ecological role reallocating organic material and in some cases being a seed disperser. Moreover, this species is considered a bio indicator once is sensible to environment changes like the habitat loss. Despite its' ecological importance nothing is known regarding the population structure of this dung beetle species. Molecular markers are informative tools to evaluate the extent and distribution of genetic diversity of the C. (P.) staigi populations remaining. Here we report the isolation and characterization of the first microsatellite markers for C. (P.) staigi. Four polymorphic microsatellite loci were characterized with allele numbers ranging from four to five per locus. The observed and expected heterozygosity ranged from 0.466 to 0.516 and 0.485 to 0.623, respectively. All loci were observed on Hardy Weinberg equilibrium. Linkage disequilibrium was not detected in any loci. From a subset of 24 loci it was observed positive transferability of six loci on four different tribes of Scarabaeinae. The loci will be used for studying population genetic structure of C. (P.) staigi and the cross-species ampliﬁcation success extends the utility of these markers to be applied also on related species.

Key-words: Atlantic Rainforest, Coleoptera, dung beetles, genetic diversity

The species Canthon (Peltecanthon) staigi Pereira, 1953 (Scarabaeidae:

Scarabaeinae), is inserted in a well-defined telecoprid guilds of dung beetles and plays an important ecological role in reallocate organic material and disperse seeds (Halffter et al.

1992; Halffter & Favila 1993; Ratcliffe et al. 2002). Its' widely distributed on fragmented

Atlantic forest domain (Endres et al. 2007; Costa et al. 2014; Hernández et al. 2014;

Medina & Lopes 2014) and is considered a bioindicator species, due to sensitivity to environmental changes (Hernández et al. 2014). Here we report the isolation and

77 characterization of four polymorphic microsatellite loci from C. (P.) staigi. Our data are informative for future studies of population genetic structure and cross-amplification among related species of five tribes of Scarabaeinae subfamily.

Total genomic DNA was extracted from two individuals of C. (P.) staigi according to Sambrook and Russel (2001). Genomic DNA was digested by restriction enzyme AfaI

(Promega, Madison, Wisconsin, USA) and the fragments were linked to adapters (Rsa21

5'-CTCTTGCTTACGCGTGGACTA-3' / Rsa25 5'-

TAGTCCACGCGTAAGCAAGAGCACA-3'). The library was enriched for (CT)8 and

(GT)8 repeats using biotinylated microsatellite probes. The target fragments were captured by the use of streptavidin-coated magnetic beads (Promega Corporation, Madison,

Wisconsin, USA). Microsatellite-enriched DNA fragments were ligated into a pGEM-T vector (Promega) and the plasmids were introduced by electroporation into Escherichia coli XL-1 Blue strains. Transformed cells were grown on Petri dishes with LuriaeBertani

(LB) agar medium containing ampicillin (50 mg/ml), tetraciclin (12,5 mg/ml), IPTG

(Isopropylthio-B-D-galactoside) (100 mM) and X galactosidase (5-bromo-4-chloro- indolyl-B-D-galactoside) (20 mg/ml).

A total of 96 recombinant colonies were obtained and sequenced using the BigDye terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems), T7 (5'-

TAATACGACTCACTATAGGG-3') and SP6 (5'-ATTTAGGTGACACTATAG-3') sequencing primers and 3100 DNA Analyser (Applied Biosystems). For clones containing

SSR motifs, forward and reverse sequences were aligned to obtain the consensus sequence using Chromatogram Explorer 3.2 (Heracle BioSoft S.R.L., Romania). Microsatellite amplification-specific primers were designed from 24 loci of applicable flanking sequences with the software PRIMER3 (Rozen & Skaletsky 2000). Polymorphic loci are presented in

Table 1.

The polymerase chain reactions (PCR) were performed in a Biocycler 96-Well

Thermal Cycler (Applied Biosystems) in a reaction volume of 10 µL containing ~5 ng

DNA template, 10x PCR buffer, 0.50 mM MgCl2, 2.5 mM dNTP, 5 U/µL Taq polymerase

(Invitrogen), 10 pmol forward primer and 10 pmol reverse primer. A touchdown cycle program was used as follow: 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, the annealing temperature for each primer for 45 s (the optimum annealing temperature of different primers was screened by gradient temperature PCR) and 72°C for 45 s, and a final extension of 72°C for 10 min. The amplicons were checked on 1,8% agarose gel stained with GelRed (Biotium, Hayward, California, USA) and were genotyped in 7% polyacrylamide denatured gel stained with silver nitrate. The genotyping was performed using a 100 bp DNA ladder (Invitrogen) as size standard marker. Sixty individuals from two populations collected on Atlantic forest fragments on the states of Paraíba and

Pernambuco, Brazil, were analyzed regarding genetic diversity (Table 2).

The 24 microsatellite loci were tested in seven species belonging to four tribes of

Scarabaeinae subfamily. The PCR conditions and amplicons checking were performed as previously described. The bands amplified on the expected size were subsequently sequenced by Macrogen Inc. (Seoul, Rep. of Korea), in order to check the presence of microsatellite motifs (Table 3).

Genetic diversity per locus and population were evaluated regarding the allelic richness (R), number of alleles (A), observed (HO) and expected (HE) heterozygosity and inbreeding coefficient (FIS) on MSA program (Dieringer & Schlötterer 2003); test of

Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) for all loci using

ARLEQUIN 3.5 (Excoffier & Lisher 2010); calculation of polymorphic information content (PIC) (Roldán-Ruiz et al. 1999) (Table 3); genotyping errors regarding null alleles, stuttering, and allele dropout using Micro-Checker 2.2.3 (Van Oosterhout et al. 2004).

The microsatellite enrichment library of 96 recombinant colonies resulted on 45 microsatellite repeat motifs, of which 24 presented applicable flanking regions for primer design. From these four were polymorphic while 20 were monomorphic. The polymorphic loci generate a total of 19 alleles, ranging from four to five per locus. For monomorphic loci see Table S1. The HO ranged from 0.466 to 0.516 while HE ranged from 0.485 to

0.623, per locus. The PIC index ranged from 0.312 to 0.368 per locus (Table 1). All loci were in HW equilibrium and no linkage disequilibrium was detected. Furthermore, no evidence of scoring error was found.

Regarding the two populations, GUA presented higher values of allelic richness, HE and HO than the PES population (Table 1). Interestingly, the observed FIS value in PES was lower than GUA, which means that population GUA could be suffering greater inbreeding depression, likely caused by geographic isolation on the range margin of the C. (P.) staigi spatial distribution.

The cross-species amplification tests revealed eight primer loci (Cstms02; Cstms06;

Cstms10; Cstms12; Cstms14; Cstms15; Cstms19; Cstms20) which amplified satisfactorily among all species from four tribes. However, just six loci presented microsatellite motifs, indicating that are possibly useful for population genetics analysis of other beetle species

(Table 3).

The four polymorphic loci isolated for C. (P.) staigi will be used to study the genetic diversity and population genetic structure of C. (P.) staigi, providing knowledge which will be important for conservation strategies of this species.

Acknowledgments

We are grateful to Msc. Cristiane Maria Queiroz da Costa and Prof. Dr. Fernando

Silva for the collection and identification of specimens. This study was supported by grants

80 from the Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco

(FACEPE-IBPG-0831-2.02/11), funding to doctorate of the student CAFN and

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES-20130558), funding to post-doc researcher and by National Counsel of Technological and Scientific

Development (CNPq fund PQ R.C.M. process 305298/2014-3).

References

Costa CMQ, Barretto JW, Moura RC (2014) Changes in the dung beetle community in

response to restinga forest degradation. Journal of Insect Conservation 18,

895-902.

Dieringer D, Schlötterer C (2003) Microsatellite Analyser (MSA): a platform independent

analysis tool for large microsatellite data sets. Molecular Ecology Notes 3, 167-169.

Endres AA, Creão-Duarte AJ, Hernández MIM (2007) Diversidade de Scarabaeidae s. str.

(Coleoptera) da Reserva Biológica Guaribas, Mamanguape, Paraíba, Brasil: uma

comparação entre Mata Atlântica e Tabuleiro Nordestino. Revista Brasileira de

Entomologia 51, 67-71.

Excoffier L, Lisher HEL (2010) Arlequin suite ver 3.5: a new series of programs to

perform population genetics analyses under Linux and Windows. Molecular

Ecology Resources 10, 564–567.

Halffter G, Favila ME (1993) The Scarabaeidae (Insecta: Coleoptera) an animal group for

analyzing, inventorying and monitoring biodiversity in tropical rainforest and

modified landscapes. Biology Internacional 27,15–21.

Halffter G, Favila ME, Halffter V (1992) A comparative study of the structure of the

scarab gild in Mexican tropical rain forests and derived ecosystems. Folia

Entomológica Mexicana 84,131-156.

Hernández MIM, Barreto PSCS, Valderêz HC, Creão-Duarte AJ, Favila ME (2014)

Response of a dung beetle assemblage along a reforestation gradient in Restinga

forest. Journal of Insect Conservation 18, 539-546.

Medina AM, Lopes PP (2014) Seasonality in the dung beetle community in a Brazilian

tropical dry forest: Do small changes make a difference? Journal of Insect Science

14, 1–11.

Ratcliffe BC, Jameson ML, Smith ABT (2002) Scarabaeidae. In: Arnett JRRH, Thomas

MC, Skellei PE, Frank JH (eds.) American Beetles, Polyphaga: Scarabaeoidea

through Curculionoidea pp 39–81. Boca Raton, Florida.

Roldán-Ruiz I, Dendauw J, Van BE, Depicker A, De Loose M (2000) AFLP markers

reveals high polymorphic rates in ryegrasses (Lolium spp.). Molecular Breeding

6,125–134.

Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist

programmers. In: Misener, S., Krawetz, S.A. (Eds.), Methods in Molecular Biology,

vol. 132. Bioinformatics Methods and Protocols pp. 365-386. Humana Press,

Totowa, New Jersey, USA.

Sambrook J, Russel DW (2001) Molecular Cloning. Cold Spring Harbor Laboratory Press,

New York

Van Oosterhout C, Hutchinson, WF, Wills DPM, Shipley P (2004). MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular

Ecology Notes 4, 535-538.

Table 01: Characterization of four polymorphic microsatellite markers developed for C. (P) staigi (Scarabaeidae). Locus name, GenBank accession numbers, primer sequence (F: forward, R: reverse), anneling temperature (Ta), repeat motif, fragment size range in base pairs (bp), number of alleles per locus (A), observed heterozygosity (HO), expected heterozygosity (HE), and polymorphic information content (PIC).

Locus GenBank Sequence (5' 3') Ta (°C) Repeat motif Size range (bp) A HO HE PIC F: GGACTGTTTTGAGCGTTACCAT 54.5 Cstms01 ? (TTGTG)2 161 - 196 5 0.533 0.572 0.312 R: GGCCCCTCCAGTATAGAAAATC F: GTTCTTATTGTAGCTTCGTTCATGC 52 Cstms02 ? (TGTCGA)2 397 - 361 5 0.499 0.583 0.339 R: GACTAACACATCTCACGGGGAA F: GCTGGTTTCATCAACTGCATTA 55.6 Cstms04 ? (TTATT)2 242-267 5 0.566 0.580 0.338 R: ACATACCACCCAGTCCTTTGTC F: AATCGCTTTAATCTTGTCTGGG 55.6 Cstms09 ? (ATTT)3(ATGAAT)2 178 - 198 4 0.533 0.479 0.368 R: CTCAAAATCCCTAGAAGAACACG All loci departed significantly from HWE at the 0.05 level.

Table 02: Location of sampled populations and parameters of genetic diversity in C. (P) staigi.

Population Latitude S Longitude W N R HO HE FIS Guaribas - GUA 06°36'44'' 35°17'34'' 30 2.7 0.516 0.623 0.168 Pesqueira - PES 08°21'28'' 36°41'47'' 30 2.0 0.466 0.485 0.034 Number of individuals sampled (N), allelic richness (R), observed heterozygosity (HO), expected heterozygosity (HE), and inbreeding coefficient (FIS). Significant departure from HWE (P < 0.00250).

Table 03: Transferability of eight microsatellite markers developed for C. (P) staigi accross five different tribes of Scarabaeinae (Scarabaeidae).

Tribes/Species Cstms02* Cstms06 Cstms10 Cstms12 Cstms14 Cstms15 Cstms19 Cstms20 Canthonini Canthon nigripenne + + + + - - + + Coprini Coprophanaeus ensifer - - + - - - - - Dichotomiini Dichotomius bos ------Dichotomius geminatus ------+ Eurysternini Eurysternus caribaus ------Eurysternus hyrtelus - - + - - - - - Phanaeini Phanaeus splendidus - - + - - - - - Total 1 1 4 1 0 0 1 2 '+' indicates successful amplification and presence of microsatellite motif; '-' indicates absence of microsatellite motif *Polymorphic locus on C. (P) staigi species.

Table S1: List of loci which were monomorphic in C. (P) staigi.

Expected allele Locus Sequence (5'  3') Repeat motif T (°C) a size (bp) F: TGCCACAACTCGTTTATTCCTA Cstms03 (AACGT)2 56.8 151 R: CGAAAACAACTGTAACGCCATA F: TCAGTGGTGAAACTCGTCTTTT Cstms05 (T)10 58 235 R: GCGTGGACTAACAGCAAGTAAT F: AATCCCGAGCTTATGTGCTG Cstms06 (TGCACA)2 53.2 386 R: AGCTGCAACACTCCTTCTAATTG F: CGTGGACTACCCACTTGAAATAA Cstms07 (ATAAG)2 (AGACA)2 56.4 374 R: TGGATCGAAGCGAGATCAAT F: GGCCCCTCCAGTATAGAAAATC Cstms08 (AAATA)2 (CACAA)2 52.6 161 R: GGACTGTTTTGAGCGTTACCAT F: GTCTCAATAACAACGGATGGC Cstms10 (ATGAAT)2 52 132 R: AGCTAACACTTGCTGGTGGATT F: TTGCCATCTTCTTCTTCAACTG Cstms12 (TTAAAA)2 58 293 R: GCTTTATGACCACTAGCCGATT F: AATCGGCTAGTGGTCATAAAGC Cstms13 (ATTAT)2 55 262 R: GGCAATCCCTTTGAACCTAAAT F: TTGCTGAATGATCGAAGTGATG Cstms14 (ATAGC)2 51 231 R: TTCTTCTAAGTCCTCACCAGCG F: GTGTTTCTGACAAGAGCAAGGA Cstms15 (GCCAG)2 (AAAAAG)2 55 344 R: CTGTATTTGTTGACCTAGCAATCG F: GTTGGCTCGAATTTTAACCTGT Cstms17 (AATT)3 (ATACA)2 56.4 337 R: CGCGTGGACTAACTCAATGTAA F: CCTAATCTTCTAAACAAACCGC Cstms18 (TAATT)2 (CTAAC)2 (TTTCT)2 54.5 400 R: CGCGTGGACTAGCTTTATG F: TCCTTTGTTCTTATCGCCCTTA Cstms19 (TAAAAG)2 (CTTTC)2 51 254 R: GTAGGATCGTTTTGCTCTTGCT Cstms20 F: AGCTGCAACACTCCTTCTAATTG (TGTGCA)2 55 386

R: AATCCCGAGCTTATGTGCTG F: TGGATCGAAGCGAGATCAAT Cstms21 (TGTCT)2 (TCTTA)2 55.5 374 R: CGTGGACTACCCACTTGAAATAA F: GGACTGTTTTGAGCGTTACCAT Cstms22 (TTGTG)2 (TTTTA)2 53.6 161 R: GGCCCCTCCAGTATAGAAAATC F: CTGTATTTGTTGACCTAGCAATCG Cstms23 (TCTTTT)2 (CTGGC)2 55 344 R: GTGTTTCTGACAAGAGCAAGGA F: GCACAAATAACGAAGAGGAAGG Cstms24 (ACTAA)2 (AATTT)2 54.5 367 R: ATGCTGTGAATGTTGCTGAACT F: GGTTTCGAGTATTTGGATTTAAGCG Cstms25 (TTGTA)2 (AATT)3 54.5 235 R: AGTGTCCTTTGAGTGTGATTCCTGT F: CGCGTGGACTAGCTTTATG Cstms26 (GGTTA)2 (AGAAA)2 (AATTA)2 54.5 400 R: CCTAATCTTCTAAACAAACCGC

Note: Ta = anneling temperature

6. Capítulo III

Diferenciação Genética de Populações do Nordeste e Sudeste Brasileiro de Canthon (Peltecanthon) staigi (Coleoptera: Scarabaeidae) no domínio de Mata Atlântica

Celso Alexandre Ferreira-Neto1,2; Geyner Alves dos Santos Cruz1; Amaro de Castro Lira Neto3; Valdir Queiroz Balbino2; Rita de Cássia de Moura1

1-Instituto de Ciências Biológicas, Universidade de Pernambuco, Recife, Brasil. 2-Departamento de Genética, Universidade Federal de Pernambuco, Recife, Brasil. 3-Instituto Agronômico de Pernambuco, Recife, Brasil

Artigo que será submetido à International Journal of Molecular Sciences ISSN 1422-0067

Resumo

Canthon (Peltecanthon) staigi está distribuído em diferentes habitats da

Mata Atlântica, contribuindo com sua dinâmica através da realização de serviços ambientais. O objetivo desse trabalho foi caracterizar a estrutura genética das populações de C. (P.) staigi ocorrentes no domínio de Mata Atlântica do Nordeste e Sudeste Brasileiro, analisando a influência do processo de fragmentação na distribuição de sua diversidade genética através de marcadores microssatélites

(SSR). Foram usados quatro primers, obtendo-se 27 alelos, com HE e HO por população variando de 0.30 a 0.67 e 0.14 a 0.69, respectivamente. Foi encontrada correlação entre a distância genética e geográfica e alto índice de estrruturação apenas quando comparados os grupos Nordeste e Sudeste. Entre os dois grupos e entre suas populações foram encontrados dois pools gênicos, havendo diferenciação entre populações do Nordeste e Sudeste. Os dados indicaram a presença de fluxo gênico histórico entre as populações dos dois grupos, com a formação de uma metapopulação no Nordeste. Contudo, a população GUA apresentou-se geneticamente diferenciada em relação às demais populações. Apesar da variação no tamanho dos fragmentos no domínio Mata

Atlântica, não foi observada uma correlação direta entre a riqueza da diversidade genética e o tamanho destes, exceto em um dos remanescentes, cujo tamanho foi menor que 295 ha.

Palavras-chaves: Scarabaeinae; Rola-bosta; SSR; Diversidade Genética;

Estruturação genética.

Introdução

O gênero Canthon Hoffmannsegg, 1817 é exclusivamente americano e caracterizado como o grupo mais diverso da tribo Canthonini, subfamília

Scarabaeinae, apresentando 174 espécies, das quais 75 ocorrem no Brasil

(Pereira and Martínez, 1956; Vaz-de-Mello, 1999). Dentre seus representantes,

Canthon (Peltecanthon) staigi (Pereira, 1953) assim como outros membros de

Scarabaeinae, presta serviços ambientais, como a realocação da matéria orgânica, a dispersão de sementes e a aeração do solo (McGeoch et al., 2002;

Spector and Ayzama, 2003; Endres et al., 2007; Gardner et al., 2008). Além disso, esta espécie se destaca pela sua distribuição e abundância em diferentes habitats do domínio Mata Atlântica como restingas, brejos de Altitude e Mata Atlântica strictu sensu (Silveira et al., 2003; Santos et al., 2008; Costa et al., 2013;

Hernandez et al., 2014; Pereira et al., 2014; Salomão and Ianuzzi, 2015).

A distribuição da espécie C. (P.) staigi no bioma Mata Atlântica, o qual atualmente corresponde de 11,4 % a 16 % de sua cobertura original (Ribeiro et al., 2009), com tamanho médio de fragmentos menores do que dez hectares

(Ranta et al., 1998), vulnerabiliza as guildas desta espécie, visto que os representantes de Scarabaeidae necessitam de no mínimo 85 ha para manterem bem estruturadas as suas comunidades (Larsen et al., 2008). Por estarem intimamente ligados à dinâmica (variações na pluviosidade, tamanho do remanescente, fitofisionomia, oferta de material orgânico, dentre outros) da Mata

Atlântica, os escarabeíneos, como a espécie C. (P.) staigi, apresentam modificações na estrutura de suas guildas em resposta às variações ambientais, como fragmentação, modificação e degradação de habitat, o que os torna bons

90 bioindicadores (Halffter and Favila, 1993; Spector and Ayzama, 2003; Gardner et al.,2008; Costa et al., 2013; Hernandez et al., 2014; Salomão and Iannuzzi, 2015).

Estudos em escarabeíneos utilizando, por exemplo, o marcador SSR

(Simple Sequence Repeats) para verificar a diversidade genética e estrutura populacional em espécies da subfamília Scarabaeinae, bem como a possível influência das variações ambientais não foram realizados até o momento. Por outro lado nas famílias tais como Carabidae, Cerambicydae, Curculionidae e

Dysticidae, foi observado que alterações na diversidade genética observadas em espécies de besouros, possivelmente decorreram da fragmentação do habitat e da presença de barreiras geográficas, que resultaram na diminuição do fluxo gênico e estruturação genética de populações isoladas (Brouat et al., 2003; Keller et al., 2004; Beebee, 2007; Drees et al., 2008; Carter et al., 2009; Lagisz et al.,

2010; Gaublomme et al., 2013; Kajtoch et al., 2014).

Por ser uma espécie estenotópica, abundante e distribuída em diferentes habitats no domínio Mata Atlântica, a caracterização da estrutura genética das populações remanescentes de C. (P.) staigi permitirá analisar a influência do processo de fragmentação na distribuição de sua diversidade genética. Desta forma, nesse trabalho foi analisado se há correlação entre as distâncias geográfica e genética das populações analisadas, além de testar a hipótese de que os índices de endogamia são superiores em áreas de maior fragmentação, especialmente no Nordeste, onde este processo foi mais acentuado.

Materiais e Métodos

Amostras Biológicas

Um total de 227 indivíduos de C. (P.) staigi provenientes de oito populações diferentes distribuídas no Nordeste e Sudeste brasileiro foram coletados utilizando armadilhas do tipo pitfall (Tabela 1, Figura 1). Os espécimes coletados foram sedados, sacrificados e conservados em álcool absoluto (-20 °C).

Vouchers de cada população foram confeccionados a partir de um espécime e posteriormente incluídos na Coleção Científica de Scarabaeidae (Coleoptera) do

Instituto de Ciências Biológicas (ICB), Universidade de Pernambuco (UPE).

Todas as coletas foram realizadas com a permissão do IBAMA (Instituto

Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis) e licenças emitidas pelo SISBIO (Sistema de Autorização e Informação em Biodiversidade):

16.278-1; 41761-1 e 41761-5.

Tabela 1 – Informações dos locais de coleta e número amostral de Canthon (Peltecanthon) staigi nas regiões Nordeste e Sudeste do Brasil. Região/Estado Localidade e Tipo de Área Código das habitat e N Latitude Longitude (ha) populações Mata NORDESTE

Paraíba Guaribas - GUA FES 30 463,75 06° 36' 44'' S 35° 17' 34'' O Pernambuco Aldeia - ALD FES 29 1.110 08° 01' 18'' S 34° 58' 52'' O Itamaracá - ITA Restinga 29 486,75 07° 44' 52'' S 34° 49' 32'' O Tamandaré - TAM Restinga 23 17,6 08° 45' 35''S 35° 06' 17'' O Bonito - BON FOD 29 295 08° 28' 13'' S 35° 43' 43'' O Pesqueira - PES FOD 30 4.051 08° 21' 28'' S 36° 41' 47'' O SUDESTE

Minas Gerais Parque Estadual FES 27 35.970 19° 41’ 34'' S 42° 35’ 05” O Rio Doce - PERD

Espírito Santo

Reserva Natural Vale do Rio Doce FES 30 23.000 40° 01’ 28” S 19° 08’ 28” O RNV *FES - Floresta Estacional Semidecídua; FOD - Floresta Ombrófila Densa (Brejo de

Altitude).

Figura 1: Mapa parcial da costa brasileira destacando as populações de Canthon (P.)

staigi estudadas. No estado da Paraíba-PB foi coletada a população GUA, em

Pernambuco-PE as populações ITA, ALD, TAM, BON e PES, em Minas Gerais - MG a

população PERD e no Espírito Santo - ES a população RNV. Adaptado de S.O.S.

Mata Atlântica.

Extração do DNA

O DNA genômico foi extraído e isolado utilizando o método Fenol-

Clorofórmio segundo Sambrook e Russel (2001). O DNA extraído foi purificado por digestão enzimática através de RNAse (10 mg/mL) por 2 h à 37 °C.

Posteriormente, a qualidade e concentração do DNA foram determinadas através de eletroforese em gel de agarose (1%) por meio de comparação visual com o marcador fago Lambda DNA/HindIII (Fermentas Life Science), e também através

94 de espectrofotometria em NanoDrop® 2000c (NanoDrop Technologies,

Wilmington, DE).

Amplificação das sequências microssatélites

Quatro loci de microssatélites (Cstms 01, Cstms 02, Cstms 04, Cstms 09) obtidos no trabalho de Cruz et al. (submetido) foram amplificados através de reações em cadeia da polimerase (PCR), sendo realizadas em termociclador

Biocycler 96-Well Thermal Cycler (Applied Biosystems) utilizando-se um volume total de 10 µL contendo aproximadamente 5 ng de DNA molde, 10x de PCR buffer, 0,5 mM de MgCl2, 2,5 mM de dNTP, 5 U/µL de Taq polimerase

(Invitrogen), 10 pmol do primer forward e 10 pmol do primer reverse. O seguinte programa de ciclos foi adotado: uma etapa de 94°C por 5 min, seguido por 30 ciclos de três etapas, sendo a primeira a 94 °C por 30 s, a segunda sob a temperatura de pareamento de cada primer por 45 s e a útlima etapa a 72 °C por

45 s, após os ciclos uma extensão final a 72 °C por 10 min. Os fragmentos amplificados foram genotipados em gel de poliacrilamida desnaturante a 7 % e corados com nitrato de prata. A genotipagem foi realizada baseada em DNA

Ladder (Invitrogen) de 100 pb como marcador padrão.

Análises da diversidade genética, estatística F e isolamento por distância

A análise da diversidade genética consistiu nos cálculos da riqueza alélica, número de alelos raros e privados e frequências alélicas através do programa

Microsatellite Analyser 4.05 (MSA) (Dieringer and Schlötterer, 2003). Além disso, também foram calculados índices de heterozigosidades esperada (HE) e observada (HO) e equilíbrio de Hardy-Weinberg no ARLEQUIN 3.5 (Excoffier and

Lisher, 2010). O software Micro-Checker 2.2.3 (van Oosterhout et al., 2004) foi

95 utilizado para avaliar erros de genotipagem devido a efeitos de alelo dropout, alelos nulos e stuttering.

Os índices GST e de estatística F de Wright (FIS e FST) foram calculados utilizando o programa Microsatellite Analyser 4.05 (MSA). O índice de variância molecular – AMOVA (baseado em 1000 permutações) foi calculado no

ARLEQUIN 3.5. Para o cálculo da AMOVA dois grupos foram considerados, o grupo Nordeste (GUA, ALD, TAM, ITA, PES e BON) e o grupo Sudeste (PERD e

RNV). Adicionalmente, ainda no ARLEQUIN 3.5 foi calculado o índice de isolamento por distância (Wright, 1965) com base na correlação entre as distâncias genética e geográfica através do teste de Mantel (Sokal e Rohlf, 1995) a partir de 10000 permutações randômicas para determinação do nível de significância.

Número de clusters genéticos

Os clusters genéticos e sua estruturação foram analisados através do programa Structure 2.3.2 (Pritchard et al., 2000) empregando o método Bayesiano onde o valor de K foi identificado e analisado para determinar o nível de mistura genética entre as populações. As interações entre os indivíduos foram tomadas com base em 660.000 réplicas (60.000 no estágio de burning), utilizando o modelo de Admixture com frequências de alelos correlacionadas. O número de clusters genéticos foi inferido a partir do método de Evanno et al. (2005). Três testes de clusterização genética foram executados, um considerando apenas as seis populações do Nordeste (GUA, ALD, TAM, ITA, PES e BON), outro considerando as populações do Sudeste (PERD e RNV) e um terceiro considerando as oito populações.

Resultados

A partir da análise de quatro loci polimórficos de microssatélites, um total de 27 alelos foi encontrado (média de 6,75 alelos por locus) variando de cinco a oito alelos por locus, sendo os alelos 381 e 379 do locus Ctsms 02 o mais raro e o mais frequente, respectivamente. Apenas duas populações apresentaram alelos privados, GUA e PERD, sendo quatro e um respectivamente. A riqueza alélica variou de 4.97 a 7.42, como mostrado na Tabela 2. As HE e HO por população variaram de 0.30 a 0.67 e 0.14 a 0.69, respectivamente, enquanto que o coeficiente de endocruzamento (FIS) variou de -0.17 a 0.41 (Tabela 2). Dentre os loci estudados, apenas o locus 03 apresentou desvio do equilíbrio de Hardy-

Weinberg na população TAM. Além disso, o programa Micro-Checker detectou efeito de stuttering e alelos nulos na população TAM, nos loci Cstms 01 e Cstms

04.

Tabela 2: Caracterização da diversidade genética de oito

populações de C. staigi do domínio Mata Altântica

Pop A AP RA HE HO FIS GUA 11 4 2.75 0.62 0.53 0.17 ALD 9 - 2.24 0.45 0.42 0.08 ITA 11 - 2.74 0.57 0.55 0.04 TAM 8 - 2.00 0.47 0.24 0.41 BON 8 - 2.00 0.49 0.42 0.08 PES 8 - 2.00 0.49 0.50 0.03 PERD** 11 1 2.67 0.57 0.62 -0.17 RNV 10 - 2.50 0.56 0.62 0.09 A – Número de Alelos; AP – Alelos Privados; RA – Riqueza

alélica; HE – Heterozigosidade esperada; HO –

Heterozigosidade observada; FIS – Índice de endocruzamento;

Os índices de estruturação (FST) e de endogamia (FIS) apresentaram um valor de 0,4697 e 0,0837, respectivamente, quando analisadas todas as populações. Analisando-se apenas as populações do Nordeste ou apenas do

Sudeste, o índice médio de FST foi de 0,18 e de 0,02, respectivamente. O teste de

Mantel revelou um coeficiente de relação de 0,825 (P= 0.006), apontando correlação positiva entre as distâncias genética e geográfica das populações do

Nordeste e Sudeste (Tabela 3). A análise da variância molecular (AMOVA), considerando todas as populações, revelou os seguintes dados: variação de

53,01 % dentro das populações, 37,30 % entre as regiões Nordeste (GUA, ALD,

ITA, TAM, BON e PES) e Sudeste (PERD e RNV), e 9,69 % entre as populações dentro de cada região. Considerando apenas as populações do Nordeste, o teste de Mantel não revelou correlação significativa (P= 0.171). Além disso, para estas populações os dados de AMOVA foram de 81,93 % da variação dentro das populações e 18,07 % entre as populações. Por sua vez, considerando apenas as populações do Sudeste, foi observado 97,85 % da variação dentro das populações e 2,15 % entre as populações.

Os resultados encontrados a partir da análise no software Bottleneck não indicaram influência de gargalo genético em nenhuma das populações. O programa NeEstimator relevou um tamanho efetivo populacional (Ne) estatisticamente infinito para as populações PES, BON, GUA e PERD, enquanto

ALD, ITA, TAM e RNV apresentaram, respectivamente, Ne de 6,3; 8,6; 11,5 e

56,7.

Tabela 3: Valores de FST par a par (diagonal inferior) e distância geográfica

(Km) (diagonal superior) das populações de Canthon (Peltecanthon) staigi.

GUA ALD ITA TAM BON PES PERD RNV GUA - 131 119 197 204 249 1641 1581 ALD 0.3916 - 24 67 100 190 1538 1465 ITA 0.2838 0.0373 - 84 122 202 1562 1486 TAM 0.3521 0.0120 0.0176 - 78 186 1490 1411 BON 0.3566 0.0452 0.0215 -0.0181 - 108 1451 1379 PES 0.3274 0.0842 0.0320 0.0057 -0.00003 - 1403 1242 PERD 0.4031 0.4923 0.4327 0.4702 0.4753 0.4708 - 204 RNV 0.4049 0.4898 0.4328 0.4670 0.4738 0.4702 0.0215 -

Através do programa Structure, quando analisadas todas as populações, foi observado dois clusters genéticos (K=2), revelando completa distinção genética entre as populações do Nordeste e Sudeste (Figura 2). Quando a análise foi realizada considerando apenas as populações de PE e PB (Nordeste) foram observado também dois clusters genéticos (K=2), onde a população GUA-PB mostrou-se com predominância de um pool gênico em relação as populações de

PE (Figura 3). Por sua vez, entre as populações PERD e RNV (Sudeste), foi observado a mistura de dois clusters genéticos (Figura 4).

Figura 2: Ancestralidade dos indivíduos dos dois grupos, Nordeste e Sudeste, plotados pelo programa Structure 2.3.4, através da análise de quatro marcadores microssatélites e

99 um total de 27 alelos polimórficos na espécie Canthon (Peltecanthon) staigi. A análise totaliza 227 indivíduos. Valores de Delta K obtidos de acordo com o método descrito por

Evanno et al. (2005). Note o pico em K=2.

Figura 3: Ancestralidade dos indivíduos de Canthon (Peltecanthon) staigi plotados pelo programa Structure 2.3.4, através da análise de quatro marcadores microssatélites em populações de Pernambuco e Paraíba. Valores de Delta K obtidos de acordo com o método descrito por Evanno et al. (2005). Note o maior pico em K=2 e um menor pico em

K=4.

Figura 4: Ancestralidade dos indivíduos de Canthon (Peltecanthon) staigi plotados pelo programa Structure 2.3.4, através da análise de quatro marcadores microssatélites em populações de Minas Gerais e Espírito Santo. Valores de Delta K obtidos de acordo com o método descrito por Evanno et al. (2005). Note um maior pico em K=2 e um segundo maior em K=7.

100

Discussão

Considerando a variação de HO (0.14 a 0.69) e HE (0.30 a 0.67) foi observado que as populações estudadas estão em equilíbrio de Hardy-Weinberg, com exceção de TAM, que além de apresentar a menor HO, também apresentou influência de alelos nulos. Adicionalmente, o índice de endocruzamento (FIS =

0.41) em TAM foi o maior entre as populações estudadas, sendo um indicativo de redução do tamanho populacional, dado o tamanho reduzido do fragmento florestal o qual ocupa, ou possivelmente o efeito Wahlund. A menor heterozigosidade observada em TAM deve ser atribuída também à presença de alelos nulos, além da influência de outros fatores como a deriva genética e a endogamia (Frankham, 1996). Recentemente Ferreira-Neto et al. (submetido) observaram em C. (P.) staigi, através do marcador ISSR, baixo valor de heterozigosidade na população TAM, e associou este índice à falta de estruturação ecológica da comunidade, decorrente do reduzido tamanho do fragmento florestal.

Como observado por Salomão e Iannuzzi (2015) através de um estudo de inventário, o tamanho dos fragmentos de Mata Atlântica pode influenciar na comunidade de escarabeíneos, alterando a abundância e composição de espécies, incluindo C. (P.) staigi. Além disso, os dados obtidos (baixa heterozigosidade e elevado nível de endogamia) apontam para a ocorrência de deriva genética na população TAM, a única oriunda de uma área menor que 85 ha, característica que deve ser considerada no processo de estruturação das comunidades de Scarabaeidae, uma vez que esta é a área mínima necessária para a população se manter bem estruturada (Larsen et al., 2008). Gaublomme et al. (2013) utilizando oito loci de SSR em populações do besouro Carabus

101 problematicus coletadas em fragmentos que variaram em tamanho de 30 a 46 ha, verificaram que a diminuição da área de floresta acarretou em uma diminuição da diversidade genética das populações, com a ausência de registro em áreas menores que 30 ha, similar ao observado em TAM.

Considerando dados de estruturação genética das populações de C. (P.) staigi, a correlação positiva identificada entre as distâncias genética e geográfica das populações do Nordeste e Sudeste é um indicativo de isolamento por distância (IBD). Adicionalmente, o valor encontrado de FST=0,4697 observado entre as regiões Nordeste e Sudeste reforça essa hipótese, pois sugere alta estruturação genética, considerando que para coleópteros em geral o valor de

FST>0.1 foi considerado um indicativo de diferenciação genética populacional

(Lagisz et al., 2010; Semeao et al., 2010; Gaublomme et al., 2013; Zhang et al.

2013). Quando analisadas apenas as populações do Nordeste, o valor de

FST=0,18 foi considerado moderado, indicando também estruturação genética, diferente do observado por Ferreira-Neto et al. (submetido) que estudando estas mesmas populações de C. (P.) staigi do Nordeste, através de ISSR, encontrou um baixo valor para o FST (0.066), sugerindo uma baixa estruturação entre as populações de Pernambuco e Paraíba, essa diferença pode ser resultado das características intrínsecas de cada marcador, como a taxa mutacional da região genômica que o mesmo abrange. Contudo, estes autores observaram diferenciação genética de nível moderada, através da análise pareada dos índices

FST entre GUA e as demais populações do Nordeste.

Os resultados de AMOVA indicaram a maior variância molecular contida entre populações dentro das regiões Nordeste e Sudeste (53,01%), e também um nível de diferenciação entre essas regiões (37,30%). De forma oposta, quando

102 analisadas apenas as populações do Nordeste e Sudeste separadamente, a variação genética dentro das populações foi alta, indicando fluxo gênico histórico entre populações vizinhas. Cosiderando os dados do Nordeste, apesar da fragmentação da Mata Atlântica, é sugerida a existência de uma metapopulação formada por cinco subpopulações de PE. A formação de dois clusters genéticos no grupo Nordeste, reforçando a existência de uma metapopulação no centro de endemismo Pernambuco (Figura 3). Evidências de fluxo gênico histórico nas populações do Nordeste, também foram encontradas por Ferreira-Neto et al.

(submetido) que através de marcadores ISSR observaram variação molecular de

93,36% dentro das populações.

Por sua vez, analisando as populações da região Sudeste não foi observada estruturação genética, com os clusters genéticos distribuídos de maneira uniforme entre os indivíduos de PERD e RNV, indicando fluxo gênico histórico. Contudo, baseado na correlação de Evanno et al. (2005), também foi observado para essas populações um segundo maior pico, representando sete cluster genéticos distintos, que pode ser resultado do número de alelos encontrados e de populações amostradas para essa região.

Dentre as populações analisadas, GUA apresentou o maior número de alelos privados, além do segundo maior índice de endocruzamento (FIS=0.17), dados que podem indicar algum nível de isolamento genético ou ainda que se trata de uma população mais recente (Schroeder et al., 2009), possivelmente decorrente da expansão de C. (P.) staigi, cujo registro da espécie tem como limite o estado da Paraíba (Endres et al., 2007). Adicionalmente, os dados do software

Structure indicam um pool genético diferenciado de GUA em relação às populações de Pernambuco, o que seria mais uma evidência da tendência à

103 estruturação dessa população. Não foi observada um relação positiva entre a diversidade ou estruturação genética e o tipo de ambiente no qual as populações estavam inseridas.

Conclusões

Apesar da fragmentação do bioma Mata Atlântica ao longo da distribuição de C. (P.) staigi, existe fluxo gênico histórico entre as populações dessa espécie distribuídas no Nordeste, o que contribuiu para a configuração de uma metapopulação ao norte do São Francisco, em Pernambuco. Adicionalmente, a população GUA se encontra em processo de isolamento no limite de distribuição da espécie, e consequentemente, se apresenta geneticamente diferenciada em relação às demais populações do Nordeste. Não foi observada estruturação de metapopulação na região Sudeste, apesar da conectividade entre as populações.

Embora haja variação no tamanho dos fragmentos estudados no domínio Mata

Atlântica, só foi observada uma correlação direta entre a riqueza da diversidade genética e o tamanho destes em TAM, cujo remanescente é menor que 295 ha, o que pode estar contribuindo para a alta taxa de endocruzamento observada nessa população.

Agradecimentos

Agradecemos à Msc. Cristiane Maria Queiroz da Costa e ao Prof. Dr.

Fernando Silva pela coleta e identificação dos espécimes, e à Dra Karla Yotoco e a

MsC Tércia Vargas UFV pela doação das amostras de Canthon (Peltecanthon) staigi coletadas no sudeste do Brasil. Este estudo foi financiado pela Fundação de

Amparo à Ciência e Tecnologia do Estado de Pernambuco (FACEPE-IBPG-0831-

104

2.02/11), dando suporte ao estudante de doutorado CAFN e pela Coordenação de

Aperfeiçoamento de Pessoal de Nível Superior (CAPES-20130558) com suporte ao pesquisador pós-doutorando GASC, e pelo CNPq (Conselho Nacional de desenvolvimento Científico e Tecnológico) através do financiamento PQ R.C.M. processo 305298/2014-3.

Referências Bibliográficas

Beebee TJC (2007) Population structure and its implications for conservation of the great silver beetle Hydrophilus piceus in Britain. Freshwater Biology 52: 2101–2111 Brouat C, Sennedot F, Audiot P, Leblois R and Rasplus JY (2003) Fine-scale genetic structure of two carabid species with contrasted levels of habitat specialization. Molecular Ecology 12: 1731–1745. doi: 10.1046/j.1365- 294X.2003.01861.x Carter ME, Smith MT and Harrison RG (2009) Patterns of Genetic Variation Among Populations of the Asian Longhorned Beetle (Coleoptera: Cerambycidae) in China and Korea. Annals of the Entomological Society of America 102(5): 895-905 Carter M, Smith M and Harrison R (2010) Genetic analyses of the Asian longhorned beetle (Coleoptera, Cerambycidae, Anoplophora glabripennis), America, Europe and Asia in North. Biol Invasions 12:1165–1182 doi: 10.1007/s10530-009-9538-9 Ciosi M, Miller NJ, Toepfer S, Estoup A and Guillemaud T (2011) Stratified dispersal and increasing genetic variation during the invasion of Central Europe by the western corn rootworm, Diabrotica virgifera virgifera. Evolutionary Applications 4: 54-70 doi:10.1111/j.1752-4571.2010.00133.x Cornuet JM and Luikart G (1997) Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144:2001-2014 Costa FC, Pessoa KKT, Liberal CN, Filgueiras BKC, Salomão RP and Iannuzzi L (2013) What is the importance of open habitat in a predominantly closed forest area to the dung beetle (Coleoptera, Scarabaeinae) assemblage? Revista Brasileira de Entomologia doi: 10.1590/S0085-56262013000300012 Dieringer D and Schlötterer C (2003) Microsatellite Analyser (MSA): a platform independent analysis tool for large microsatellite data sets. Molecular Ecology Notes 3: 167-169 doi: 10.1046/j.1471-8286 .2003.00351.x Do C, Waples RS, Peel D, Macbeth GM, Tillet BJ and Ovenden JR (2014) NeEstimator V2: re-implementation of software for the estimation of contemporary effective population size (Ne) from genetic data. Molecular Ecology Resources 14:209-214 Drag L, Hauck D, Berces S, Michalcewicz J, Jelaska LS, Aurenhammer S and Cizek L (2015) Genetic differentiation of populations of the threatened saproxylic beetle Rosalia longicorn, Rosalia alpina (Coleoptera:

105

Cerambycidae) in Central and South-east Europe. Biological Journal of the Linnean Society 116: 911–925. Drees C, Matern A, Rasplus JY, Terlutter H, Assmann T and Weber F (2008) Microsatellites and allozymes as the genetic memory of habitat fragmentation and defragmentation in populations of the ground beetle Carabus auronitens (Col., Carabidae). Journal of Biogeograph 35: 1937–1949 Endres AA, Creão-Duarte AJ and Hernández MIM (2007) Diversidade de Scarabaeidae s. str. (Coleoptera) da Reserva Biológica Guaribas, Mamanguape, Paraíba, Brasil: uma comparação entre Mata Atlântica e Tabuleiro Nordestino. Revista Brasileira de Entomologia 51: 67-71 Evanno G, Regnaut S and Goudet, J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol 14:2611–2620. doi: 10.1111/j.1365-294X.2005.02553.x Excoffier L and Lisher HEL (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564–567. doi: 10.1111/j.1755-0998.2010.02847.x Frankham R (1996) Relationship of genetic variation to population size in wildlife. Conserv. Biol. 10:1500–1508 Gardner TA, MIM Hernández, Barlow J and Peres CA (2008) Understanding the biodiversity consequences of habitat change: the value of secondary and plantation forests for neotropical dung beetles. Journal of Applied Ecology 45:883-893. doi: 10.1111/j.1365-2664.2008.01454.x Gaublomme E, Maebe K, Doninck KV, Dhuyvetter H, Li X, Desender O and Hendrick F (2013) Loss of genetic diversity and increased genetic structuring in response to forest area reduction in a ground dwelling insect: a case study of the flightless carabid beetle Carabus problematicus (Coleoptera, Carabidae)Insect Conservation and Diversity 6: 473–482 Gauthier N (2010) Multiple cryptic genetic units in Hypothenemus hampei (Coleoptera: Scolytinae): evidence from microsatellite and mitochondrial DNA sequence data. Biological Journal of the Linnean Society 101: 113–129 Halffter G and Favila ME (1993) The Scarabaeidae (Insecta: Coleoptera) an animal group for analyzing, inventorying and monitoring biodiversity in tropical rainforest and modified landscapes. Biology Internacional 27:15–21 Hernández MIM, Barreto PSCS, Valderêz HC, Creão-Duarte AJ, Favila ME (2014) Response of a dung beetle assemblage along a reforestation gradient in Restinga forest. Journal of Insect Conservation 18:539-546. doi: 10.1007/s10841-014-9645-5 Kajtoch L, Mazur M, Kubisz D, Mazur MA and Babik W (2014) Low effective population sizes and limited connectivity in xerothermic beetles: implications for the conservation of an endangered habitat. Animal Conservation 17: 454– 466 Keever CC, Nieman C, Ramsay L, Ritland CE, Bauer LS, Lyons DB and Cory JS (2013) Microsatellite population genetics of the emerald ash borer (Agrilus planipennis Fairmaire): comparisons between Asian and North American populations. Biol Invasions 15: 1537–1559 doi: 10.1007/s10530-012-0389-4 Keller I, Nentwig W and Largiadèr CR (2004) Recent habitat fragmentation due to roads can lead to significant genetic differentiation in an abundant flightless ground beetle. Molecular Ecology 13: 2983–2994 Lagisz M, Wolff K, Sanderson RA and Laskowski R (2010) Genetic population structure of the ground beetle, Pterostichus oblongopunctatus, inhabiting a

106

fragmented and polluted landscape: Evidence for sex-biased dispersal. Journal of Insect Science 10:105 available online: insectsicence.org/10.105 Larsen TH, Lopera A, Forsyth A (2008) Understanding Trait-Dependent Community Disassembly: Dung Beetles, Density Functions, and Forest Fragmentation. Conserv Biol 22:1288–1298Louzada JNC and Lopes FS (1997) A comunidade de Scarabaeidae copro-necrófagos (Coleoptera) de fragmento de Mata Atlântica. Revista Brasileira de Entomologia 41: 117-121. McGeoch MA, Rensburg BJV and Botes A (2002) The verification and application of bioindicators: a case study of dung beetles in a savanna ecosystem. J Appl Ecol 39:661-672. doi: 10.1046/j.1365-2664.2002.00743.x Pereira FSCMS and Martines A (1956) Os gêneros de Canthonini Americanos (col. Scarabaeidae). Ver. Brasil. de entomologia 6: 91-192. Pereira GA, Dantas SM, Silveira LF, Roda SA, Albano C and Sonntag FA (2014) Status of the globally threatened forest birds of northeast Brazil. Papéis Avulsos de Zoologia, Museu de Zoologia da Universidade de São Paulo 54:177–194 Pritchard JK, Stephens M and Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945–959 Ranta P, Blom T, Niemelä J, Joensuu E and Siitonen M (1998) The fragmented Atlanticrain forest of Brazil: size, shape and distribution of forest fragments. Biodivers.Conserv. 7: 385–403 Ribeiro MC, Metzger JP, Martensen AC, Ponzoni F and Hirota MM (2009) Brazilian Atlantic forest: how much is left and how is the remaining forest distributed? Implications for conservation. Biological Conservation 142: 1141–1153. Salomão RP and Iannuzzi L (2015) Dung beetle (Coleoptera, Scarabaeidae) assemblage of a highly fragmented landscape of Atlantic forest: from small to the largest fragments of northeastern Brazilian region. Revista Brasileira de Entomologia 59: 126–131 Samarasekera GDNG, Bartell NV, Lindgren BS, Cooke JEK, Davis CS, James PMA, Coltman DW, Mock KE and Murray BW. Spatial genetic structure of the mountain pine beetle (Dendroctonus ponderosae) outbreak in western Canada: historical patterns and contemporary dispersal. Molecular Ecology 21: 2931–2948 doi: 10.1111/j.1365-294X.2012.05587.x Sambrook J and Russel D W (2000) Molecular Cloning. 3rd edition. Cold Spring Harbor Laboratory Press, New York Santos BA, Peres CA, Oliveira MA, Grillo A, Alves-Costa CP and Tabarelli M (2008) Drastic erosion in functional attributes of tree assemblages in Atlantic forest fragments of northeastern Brazil. Biol Conserv 141: 249–260. doi:10.1016/j.biocon.2007.09.018 Schroeder KB, Jakobsson M, Crawford MH, Schurr TG, Boca SM, Conrad DF, Tito RY, Osipova LP, Tarskaia LA, Zhadanov SI, Wall JD, Pritchard JK, Malhi RS, Smith DG and Rosenberg NA (2009) Haplotypic background of a private allele at high frequency in the Americas. Mol Biol Evol. 26(5):995-1016. doi: 10.1093/molbev/msp024 Semeao AA, Campbell JF, Beeman RW, Whitworth RJ, Sloderbeck PE, Lorenzen MD (2010) Genetic structure of Tribolium castaneum populations in mills. 10th International Working Conference on Stored Product Protection. doi: 0.5073/jka.2010.425.312

107

Silveira LF, Olmos F and Long A (2003) Birds in Atlantic Forest Fragments in north-east Brazil. Cotinga 20: 32 46 Sokal RR and Rohlf FJ (1995) Biometry (3rd ed.). New York, Freeman, pp 813– 819 Spector S and Ayzama S (2003) Rapid turnover and edge effects in Dung Beetle assemblages (Scarabaeidae) at a Bolivian Neotropical Forest–Savanna Ecotone. Biotropica 35:394–404. doi: 10.1111/j.1744-7429.2003.tb00593.x van Oosterhout C, Hutchinson WF, Wills DPM and Shipley P (2004) Micro- Checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. Vaz-de-Mello FZ (1999) Scarabaeidae s. str. (Coleoptera: Scarabaeoidea) de um fragmento de floresta amazônica no estado do Acre, Brasil: Taxocenose. Na. Soc.Entomol. Brasil. 28: 447-453. Wang G, Zhang X, Hou Y and Tang B (2014) Analysis of the population genetic structure of Rhynchophorus ferrugineus in Fujian, China, revealed by microsatellite loci and mitochondrial COI sequences. Entomologia Experimentalis et Applicata 155: 28–38 doi: 10.1111/eea.12282 Wright S (1965) The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution 19: 395–420 Zhang JJ, Yang J, Li YC, Liu N and Zhang RZ (2013) Genetic relationships of introduced Colorado potato beetle Leptinotarsa decemlineata populations in Xinjiang, China. Insect Science 20: 643–654. doi 10.1111/j.1744- 7917.2012.01565.x

108

7. Discussão Geral

Os dados obtidos no presente trabalho apontam que a estrutura genética das populações da espécie Canthon (Peltecanthon) staigi, distribuídas em diferentes habitats da Mata Atlântica Brasileira, como restinga, Brejo de Altitude e

Mata Atlântica stricto sensu, vem sendo influenciada pela distância geográfica e fragmentação da Mata. Apresentando características de uma espécie bioindicadora, C. (P.) stagi responde às mudanças na dinâmica do habitat, como a diminuição espacial do habitat, podendo levar a perda alélica, endocruzamento ou subdivisão das populações.

A espécie C. (P.) stagi, assim como outros escarabeíneos, sofre influência direta em sua comunidade devido ao tamanho do fragmento, sendo plausível considerar a influência do tamanho do fragmento de Mata na diversidade e estrutura genética (Salomão e Iannuzi, 2015). A influência do tamanho do habitat em comunidades de besouros também foi observada por Larsen et al. (2008), verificando que as comunidades de Scarabaeidae necessitam de pelo menos 85 ha para uma boa manutenção de sua estrutura. Apesar das diferentes fitofisionomias da Mata Atlântica, não foi observada um correlação direta entre o tipo de fitofisionomia do fragmento no qual a população estava inserida e a diversidade e estruturação genética.

Na população de TAM-PE, fragmento de Mata bastante degradado e reduzido, com aproximadamente 17 ha, pode-se observar uma baixa heterozigosidade, que em pequenas populações pode ser fruto da presença de alelos nulos como também de deriva genética (Frankham, 1996). Por outro lado, a população de BON-PE segundo menor fragmento (295 ha) de Mata analisado,

106 não apresentou redução na diversidade genética. Sob a luz de tais resultados, tanto dos marcadores SSR e ISSR, as populações de C. (P.) staigi residentes em fragmentos menores que 295 ha parecem sofrer eventos deletérios responsáveis pela diminuição da diversidade genética, fruto da fragmentação do habitat.

Adicionalmente, o índice FIS calculado a partir das análises dos marcadores microssatélites apontam a população de TAM-PE como o deme que mais experimentou endocruzamento, fato que resultou na diminuição da diversidade genética. Essa população está inserida em área de restinga, um dos habitats que mais sofreu degradação ao longo da história, causada principalmente pela expansão urbana (SOS Mata Atlântica/INPE, 2001).

A população de GUA-PB apresentou uma tendência ao isolamento genético e consequentemente estruturação genética, o que é corroborado pelos dados do software Structure, tanto através da análise dos marcadores ISSR quanto SSR, indicando um pool genético diferenciado em relação às populações de Pernambuco. Adicionalmente, a presença de quatro alelos privados e taxas de endogamia aumentadas na população, acarentando no segundo maior índice de endocruzamento (FIS=0.17), pode ser um indicativo de isolamento da população.

(Schroeder et al., 2009). Ao norte do rio São Francisco, o registro de C. (P.) staigi tem como limite o estado da Paraíba (Endres et al., 2007), sendo assim, GUA dentre as populações amostradas encontra-se na borda da distribuição da espécie.

Devido aos diferentes mecanismos evolutivos aos quais as sequências utilizadas (SSR e ISSR) estão sujeitas, podemos observar que os microssatélites apresetanram melhor resolução em relação à estruturação da população GUA em relação às demais do grupo Nordeste, no entanto os dois marcadores, no geral,

107 apresentaram dados de estruturação e diversidade genética semelhantes.

Adicionalmente, loci de SSR desenvolvidos especificamente para C. (P.) staigi podem ser úteis em estudo de estrutura e diversidade genética em espécies relacionadas.

O valor encontrado de FST=0,18, através do marcador SSR, entre as populações do Nordeste é considerado moderado, indicando estruturação genética, no entanto, os estudos com ISSR indicaram um FST médio nestas mesmas populações de 0,06637. Por outro lado, através do marcador ISSR, foi observada diferenciação genética de nível moderada quando considerada a análise pareada dos índices FST entre GUA e as demais populações do Nordeste.

Adicionalmente, os dados de AMOVA apontam para uma variância molecular maior dentro das populações, indicando a presença de fluxo gênico histórico entre as populações do Nordeste e a formação de uma metapopulação entre as populações de Pernambuco, configuração resultante possivelmente do poder de dispersão dos indivíduos, seus hábitos ecológicos e a conectividade histórica do bioma Mata Atlântica.

Os dados de SSR mostraram que entre as populações do Sudeste (PERD e RNV) existe fluxo gênico histórico e um pool gênico distribuído de maneira uniforme entre os indivíduos de ambas as populações, sugerindo a ausência de diferenciação genética entre essas duas populações.Essas duas populações estão separadas não somente geográfica como geneticamente do grupo

Nordeste, como observado a partir dos índices FST, AMOVA, teste de Mantel e análise de Evanno.

108

8. Conclusões

- Os dados dos marcadores ISSR e SSR foram congruentes, no entanto, o

último marcador apresentou melhor resolução em relação à estruturação genética populacional.

- O poder de dispersão e hábitos da espécie Canthon (Peltecanthon) staigi e a conectividade histórica da Mata Atlântica, possivelmente contribuíram para o fluxo gênico histórico, propiciando a formação de uma única população no estado de Pernambuco.

- Nos estados de Pernambuco e Paraíba, existem, no mínimo, duas unidades de conservação da espécie C. (P.) staigi, apresentando dois diferentes patrimônios genéticos.

- Populações de C. (P.) staigi em fragmentos pequenos de Mata Atlântica, como TAM com 17 ha, sofrem alta taxa de endocruzamento influenciando na riqueza da diversidade genética.

- A população GUA se encontra em processo de isolamento no limite de distribuição da espécie, mostrando uma tendência à estruturação genética em relação às demais populações do Nordeste.

109

9. Referências Bibliográficas

Abbot P (2001) Individual and population variation in invertebrates revealed by Inter-simple Sequence Repeats (ISSRs). Journal of Insect Science 1: 8 Aebi A, Shani T, Butcher RDJ, Alvarez N, Risterucci AM and Benrey B (2004) Isolation and characterization of polymorphic microsatellite markers in Zabrotes subfasciatus Boheman (Coleoptera: Bruchidae). Molecular Ecology Notes 4: 752–754 doi: 10.1111/j.1471-8286.2004.00808.x Aketarawong N, Chinvinijkul S, Orankanok W, Guglielmino CR, Thanaphum S, Franz G and Malacrida AR (2011) The utility of microsatellite DNA markers for the evaluation of area-wide integrated pest management using SIT for the fruit fly, Bactrocera dorsalis (Hendel), control programs in Thailand. Genetica 139: 129–140 doi 10.1007/s10709-010-9510-8 Alvarez N, Aebi A, Risterucci AM, Hossaert-Mckey M and Benrey B. (2003) Isolation and characterization of polymorphic microsatellite loci in Acanthoscelides obvelatus Bridwell (Coleoptera: Bruchidae). Molecular Ecology Notes doi: 10.1046/j.1471-8286 .2003.00335.x Andresen E (2005) Effects of season and vegetation type on community organization of dung beetles in a tropical dry forest. Biotropica 37 (2): 291- 300. Avendaño-Mendoza et al. (2005) Dung beetle community (Coleoptera: Scarabaeidae: Scarabaeinae) in a tropical landscape at the Lachua Region, Guatemala. Biodiversity and conservation 14: 801-822. Baliraine N, Bonizzoni M, Guglielmino CR, Osir EO, Lux SA, Mulaa FJ, Gomulski LM, Zheng L, Quilici S, Gasperi G and Malacrida AR (2004) Population genetics of the potentially invasive African fruit fly species, Ceratitis rosa and Ceratitis fasciventris (Diptera: Tephritidae). Molecular Ecology (2004) 13: 683–695 doi: 10.1046/j.1365-294X.2004.02105.x Batley J, Edwards KJ, Wiltshire CW, Glen D and Karp A (1998) The isolation and characterization of microsatellite loci in the willow beetles, Phyllodecta vulgatissima (L.) and P. vitellinae (L.). Molecular Ecology 7: 1431-1439 Baverstock PR and Moritz C (1996). Project design. p. 17–27. In Hillis DM et al. (ed.) Molecular systematics. Sinauer Associates, Sunderland, MA Bione EG (2004) Citogenética em representantes da subfamília Scarabaeinae (ColeopteraScarabaeidae). Universidade de São Paulo. Ribeirão Preto, Dr tese. Bornet B and Branchard M (2001) Nonanchored inter simple sequence repeat (ISSR) markers: reproducible and specific tools for genome fingerprinting. Plant Molecular Biology 19: 209‑215 Bouanani MA, Magne F, Lecompte E and Crouau-Roy B (2015) Development of 18 novel polymorphic microsatellites from Coccinella septempunctata and cross-species amplification in Coccinellidae species. Conservation Genet Resour 7: 445–449 doi: 10.1007/s12686-014-0392-4 Brohede J and Ellegren H (1999) Microsatellite evolution: polarity of substitutions within repeats and neutrality of flanking sequences. Proceedings of the Royal Society of London Series B 266: 825-833. Brouat C, Mondor-Genson G, Audiot P, Sennedot F, Lesobre L and Rasplus JY (2002) Isolation and characterization of microsatellite loci in the ground

110

beetle Carabus nemoralis (Coleoptera, Carabidae). Molecular Ecology Notes 2: 119–120. Brouat C, Sennedot F, Audiot P, Leblois R and Rasplus JY (2003) Fine-scale genetic structure of two carabid species with contrasted levels of habitat specialization. Molecular Ecology 12: 1731–1745. doi: 10.1046/j.1365- 294X.2003.01861.x Cabral-de-Mello DC, Oliveira SG, Ramos IC, Moura RC (2008) Karyotype differentiation patterns in species of the subfamily Scarabaeinae (Scarabaeidae, Coleoptera). Micron 39: 1243–1250 Cabral-de-Mello DC, Oliveira SG, Moura RC and Martins C (2011) Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin. BMC Genetics 12: 88 Cambefort Y (1991) Biogreography and evolution. In: Hansky I and Cambefort Y. Dung Beetle Ecology. Princenton, NJ: Princeton University Press 51-67. Carter M, Casa AM, Zeid M, Mitchell SE and Kresovich S (2008) Isolation and characterization of microsatellite loci for the Asian longhorned beetle, Anoplophora glabripennis. Permanent Genetic Resources Note. doi: 10.1111/j.1755-0998.2008.02485.x Carter ME, Smith MT and Harrison RG (2009) Patterns of Genetic Variation Among Populations of the Asian Longhorned Beetle (Coleoptera: Cerambycidae) in China and Korea. Annals of the Entomological Society of America 102(5): 895-905 Cassel-Lundhagen A, Öberg S, Högfeldt C and Ekbom B (2009) Species-specific primers for predation studies of the pollen beetle, Meligethes aeneus (Coleoptera, Nitidulidae). Molecular Ecology Resources 9: 1132–1134 doi: 10.1111/j.1755-0998.2009.02540.x Chambers GK and MacAvoy ES (2000) Microsatellites: consensus and controversy. Comp Biochem Physiol B Biochem Mol Biol 126 (4): 455-76 Chen F, Shi J, Luo Y, Sun S and Pu M (2013) Genetic Characterization of the Gypsy Moth from China (Lepidoptera, Lymantriidae) Using Inter Simple Sequence Repeats Markers. PLoS One 9(1). Doi: 10.1371/journal.pone.0073017 Ciosi M, Miller NJ, Toepfer S, Estoup A and Guillemaud T (2011) Stratified dispersal and increasing genetic variation during the invasion of Central Europe by the western corn rootworm, Diabrotica virgifera virgifera. Evolutionary Applications 4: 54-70 doi:10.1111/j.1752-4571.2010.00133.x Clark AG and Hartl DL (2010) Princípios de Genética de Populações. Artmed, 4ª ed. Porto Alegre. Contreras-Díaz HG, Pestano J, Suárez NM, Oromí P and Juan C (2006) Microsatellite loci in the Canary Islands endemic ground beetle Trechus flavocinctus and their applicability to cave-dwelling related species. Molecular Ecology Notes 6: 54–56 doi: 10.1111/j.1471-8286.2005.01135.x Costa C (2000) Estado de conocimiento de los Coleoptera Neotropicales. In: Vanin AS, Lobo JM and Melic A (eds.): Proyecto de Red Iberoamericana de Biogreografia y Entoologia Sistemática. PriIbes-2000, M3m: Monografias Terceiro Milênio v2 SEA, Zaragoza, p. 193-205. Costa FC, Pessoa KKT, Liberal CN, Filgueiras BKC, Salomão RP and Iannuzzi L (2013) What is the importance of open habitat in a predominantly closed forest area to the dung beetle (Coleoptera, Scarabaeinae) assemblage?

111

Revista Brasileira de Entomologia 57(3): 329–334 doi: 10.1590/S0085- 56262013000300012 Costa CMQ, Barretto JW and Moura RC (2014) Changes in the dung beetle community in response to restinga forest degradation. Journal of Insect Conservation 18:895-902. doi: 10.1007/s10841-014-9697-6 Crowson RA (1981) The biology of Coleoptera. London: Academic Press, 802p. Cruz CD (2008) Programa GENES: diversidade genética. Viçosa, Ed. UFV. Davis CS, Mock KE, Bentz BJ, Bromilow SM, Bartell NV, Murray BW, Roe AD and Cooke JEC (2009) Isolation and characterization of 16 microsatellite loci in the mountain pine beetle, Dendroctonus ponderosae Hopkins (Coleoptera: Curculionidae: Scolytinae). Permanent Genetic Resources Note doi: 10.1111/j.1755-0998.2009.02579.x Demuth JP, Drury DW, Peters ML, Van Dyken JD, Priest NK and Wade MJ (2007) Genome-wide survey of Tribolium castaneum microsatellites and description of 509 polymorphic markers. Mol Ecol Notes 7:1189–1195. Dhuyvetter H, Verdyck P, Gaublomme E, Desender K, Mondor-Genson G and Rasplus JY (2002) Isolation and characterization of microsatellite loci in the Galápagos Opuntia weevil Gerstaeckeria galapagoensis (Coleoptera, Curculionidae). Molecular Ecology Notes 2: 475-477 doi: 10.1046/j.1471- 8278 .2002.00283.x Dhuyvetter H and Desender K (2003) Isolation and characterization of microsatellite loci in the saltmarsh beetle Pogonus chalceus (Coleoptera, Carabidae). Molecular Ecology Notes 3: 460–461 doi: 10.1046/j.1471- 8286.2003.00483.x Dhuyvetter H, Gaublomme E and Desender K (2004) Genetic differentiation and local adaptation in the salt-marsh beetle Pogonus chalceus: a comparison between allozyme and microsatellite loci. Molecular Ecology 13: 1065–1074. doi: 10.1111/j.1365-294X.2004.02134.x Díaz RA (1997) Ecologia y comportamiento de escarabajos rodadores del estiercol (Scarabaeidae: Scarabaeinae) de selvas y pastizales en 10s Tuxtlas, Veracruz, México - Universidad Nacional Autonoma de México, Facultad de Ciencias, Tese de Mestrado. 174 pp. Drag L, Kosnar J and Cizek L (2013) Development and characterization of ten polymorphic microsatellite loci for the Great Capricorn beetle (Cerambyx cerdo) (Coleoptera: Cerambycidae). Conservation Genet Resour 5: 907–909. doi 10.1007/s12686-013-9930-8 Drees C, Matern A, Rasplus JY, Terlutter H, Assmann T and Weber F (2008) Microsatellites and allozymes as the genetic memory of habitat fragmentation and defragmentation in populations of the ground beetle Carabus auronitens (Col., Carabidae). Journal of Biogeograph 35: 1937–1949 Drury DW, Siniard AL and Wade MJ (2009) Genetic Differentiation among Wild Populations of Tribolium castaneum Estimated Using Microsatellite Markers. Journal of Heredity 100(6): 732–741. doi:10.1093/jhered/esp077 Emerson BC and Wallis GP (1994) Species status and population genetic structure of the flightless chafer beetles Prodontria modesta and P. bicolorata (Coleoptera; Scarabaeidae) from South Island, New Zealand. Molecular Ecology 3 (4): 339–345 doi: 10.1111/j.1365-294X.1994.tb00073.x Endres AA, Creão-Duarte AJ and Hernández MIM (2007) Diversidade de Scarabaeidae s. str. (Coleoptera) da Reserva Biológica Guaribas,

112

Mamanguape, Paraíba, Brasil: uma comparação entre Mata Atlântica e Tabuleiro Nordestino. Revista Brasileira de Entomologia 51: 67-71 Ernst JA, Ascunce MS, Clark MA and Nigg HN (2005) Polymorphic microsatellite loci for Diaprepes root weevil (Diaprepes abbreviatus L.). Molecular Ecology Notes 6: 1-4 Esselman EJ, Jianqiang L, Crawford DJ, Winduss JL and Wolfe AD (1999) Clonal diversity in the rare Calamagrostis porteri ssp. Insperata (Poaceae): comparative results for allozymes and random amplified polymorphic DNA (RAPD) and inter simple sequence repeat (ISSR) markers. Molecular Ecology 8: 443-451 Evanno G, Regnaut S and Goudet, J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol 14:2611–2620. doi: 10.1111/j.1365-294X.2005.02553.x Evans JD, Spiewok S, Teixeira EW and Neumann P (2008) Microsatellite loci for the small hive beetle, Aethina tumida, a nest parasite of honey bees. Molecular Ecology Resources 8: 698–700 doi: 10.1111/j.1471- 8286.2007.02052.x Excoffier L, Smouse PE and Quattro JM (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131: 479-491 Fang DQ and Roose ML (1997) Identification of closely related citrus cultivars with inter-simple sequence repeat markers. Theoretical and Applied Genetics 95 (3): 408-417 Fang DQ, Roose ML, Krueger RR and Federici CT (1997) Fingerprinting trifoliate orange germplasm accessions with isozymes, RFLPs and inter-simple sequence repeat markers. Theor Appl Genet 95: 211–219 Filgueiras BKC, Iannuzzi L and Leal IR (2011) Habitat fragmentation alters the structure of dung beetle communities in the Atlantic Forest. Biological Conservation 144: 362–369 doi:10.1016/j.biocon.2010.09.013 Forgie SA, Goodacre SL, Taylor MI and Emerson BC (2006) Characterization of microsatellite loci in Brachyderes rugatus, the Canary Islands pine weevil (Coleoptera: Curculionidae). Molecular Ecology Notes 6: 820–822 doi: 10.1111/j.1471-8286.2006.01357.x Frankham R (1996) Relationship of genetic variation to population size in wildlife. Conserv. Biol. 10:1500–1508 Freiria GA, Ruim JB, Souza RF and Sofia SH (2012) Population structure and genetic diversity of the orchid bee Eufriesea violacea (Hymenoptera, Apidae, Euglossini) from Atlantic Forest remnants in southern and southeastern Brazil. Apidologie 43: 392–402. doi: 10.1007/s13592-011-0104-y Fuentes-Contreras E, Basoalto E, Franck P, Lavandero B, Knight AL and Ramírez CC (2014) Measuring Local Genetic Variability in Populations of Codling Moth (Lepidoptera: Tortricidae) Across an Unmanaged and Commercial Orchard Interface. Environmental Entomology 43(2): 520-527. doi: 10.1603/EN13131 Gardner TA, MIM Hernández, Barlow J and Peres CA (2008) Understanding the biodiversity consequences of habitat change: the value of secondary and plantation forests for neotropical dung beetles. Journal of Applied Ecology 45:883-893. doi: 10.1111/j.1365-2664.2008.01454.x Garnier S, Brouat C, Mondor-Genson G, Prieur B, Sennedot F and Rasplus JY (2002) Microsatellite DNA markers for two endemic ground beetles: Carabus

113

punctatoauratus and C. solieri. Molecular Ecology Notes 2: 572-574 doi: 10.1046/j.1471-8278 .2002.00330.x Gaublomme E, Dhuyvetter H, Verdyck P, Mondor-Genson G, Rasplus JY and Desender K (2003) Isolation and characterization of microsatellite loci in the ground beetle Carabus problematicus (Coleoptera, Carabidae). Molecular Ecology Notes 3: 341–343 doi: 10.1046/j.1471-8286.2003.00441.x Gaublomme E, Maebe K, Doninck KV, Dhuyvetter H, Li X, Desender O and Hendrick F (2013) Loss of genetic diversity and increased genetic structuring in response to forest area reduction in a ground dwelling insect: a case study of the flightless carabid beetle Carabus problematicus (Coleoptera, Carabidae). Insect Conservation and Diversity 6: 473–482 Gauthier N and Rasplus JY (2004) Polymorphic microsatellite loci in the Coffee Berry Borer, Hypothenemus hampei (Coleoptera, Scolytidae). Molecular Ecology Notes 4: 294 –296 doi: 10.1111/j.1471-8286.2004.00647.x Gill BD (1991) Dung Beetles in Tropical American forest. In: Hanski I and Cambefort Y. Dung Beetle Ecology. Princeton NJ: Princeton University Press 211-229. Gui FR, Wan FH and Guo JY (2008) Population genetics of Ageratina adenophora using inter-simple sequence repeat (ISSR) molecular markers in China. Plant Biosystems 142(2): 255–263 Gupta M, Chyi YS, Romero-Severson J and Owen JL (1994) Amplification of DNA markers from evolutionarily diverse genomes using single primers of simplesequence repeats. Theor Appl Genet 89: 998–1006 Halffter G and Mathews EG (1966) The natural history of dung beetles of the subfamily Scarabaeinae (Coleoptera, Scarabaeidae). Folia Entomologica Mexicana 12 (14): 1-312. Halffter G and Martínez A (1967) Revisión monográfica de los Canthonina americanos (2ª parte). Revista de la Sociedad Mexicana de Historia Natural 28:79–116 Halffter G and Martínez A (1977) Revisión monográfica de los Canthonina americanos, IV Parte. Clave para géneros y subgéneros. Folia Entom Mex 38:29–107 Halffter G and Edmonds WD (1982) The nesting behavior of dung beetles (Scarabaeinae): An ecological and evolutive approach. México DF: Man and the Biosphere Program UNESCO. 176p. Halffter G and Favila ME (1993) The Scarabaeidae (Insecta: Coleoptera) an animal group for analyzing, inventorying and monitoring biodiversity in x'tropical rainforest and modified landscapes. Biology Internacional 27:15–21 Hanski I and Cambefort Y (1991) Dung Beetle Ecology. Princeton NJ: Princeton University Press. 481p. Haran J and Roux-Morabito G (2014) Development of 12 microsatellites loci for the longhorn beetle Monochamus galloprovincialis (Coleoptera Cerambycidae), vector of the Pine Wood Nematode in Europe. Conservation Genet Resour 6: 975–977 doi: 10.1007/s12686-014-0262-0 Harman HM, Weir BS, Wells SJ and Howitt RLJ (2009) Isolation and characterization of microsatellite loci from Lochmaea suturalis, the heather beetle (Coleoptera: Chrysomelidae), a pest in Europe and a biocontrol agent in New Zealand. Molecular Ecology Resources 9: 594–596 doi: 10.1111/j.1755-0998.2008.02448.x

114

He L, Wang S, Miao X, Wu H and Huang Y (2007) Identification of necrophagous fly species using ISSR and SCAR markers. Forensic Sci Int 168:148–153 Hernández MIM, Barreto PSCS, Valderêz HC, Creão-Duarte AJ and Favila ME (2014) Response of a dung beetle assemblage along a reforestation gradient in Restinga forest. Journal of Insect Conservation 18:539-546. doi: 10.1007/s10841-014-9645-5 Hundsdoerfer AK, Kitching IJ and Wink M (2005) The phylogeny of the Hyles euphorbiae complex (Lepidoptera: Sphingidae): molecular evidence from sequence data and ISSR-PCR fingerprints. Org Divers Evol 5:173–198. doi:10.1016/j.ode.2004.11.012 Kajtoch L, Nadachowska-Brzyska K and Babik W (2012) Development and characterization of microsatellite loci in the Centricnemus leucogrammus weevil. Mol Biol Rep 39:11131–11136 doi: 10.1007/s11033-012-2021-1 Kang TH, Han SH and Park SJ (2015) Development of Seven Microsatellite Markers Using Next Generation Sequencing for the Conservation on the Korean Population of Dorcus hopei (E. Saunders, 1854) (Coleoptera, Lucanidae). Int. J. Mol. Sci. 16: 21330-21341 doi:10.3390/ijms160921330 Kar PK, Vijayan K, Mohandas TP, Nair CV, Saratchandra B and Thangavelu K (2005) Genetic variability and genetic structure of wild and semi-domestic populations of tasar silkworm (Antheraea mylitta) ecorace Daba as revealed through ISSR markers. Genetica 125:173–183 Kashi Y, King D and Soller M (1997) Simple sequence repeats as a source of quantitative genetic variation. Trends Genet. 13: 74–78 Keever CC, Nieman C, Ramsay L, Ritland CE, Bauer LS, Lyons DB and Cory JS (2013) Microsatellite population genetics of the emerald ash borer (Agrilus planipennis Fairmaire): comparisons between Asian and North American populations. Biol Invasions 15: 1537–1559 doi: 10.1007/s10530-012-0389-4 Keller I and Largiadèr CR (2002) Identification of one X-linked and five autosomal microsatellite loci in Carabus violaceus (Coleoptera, Carabidae) and their applicability to related taxa. Molecular Ecology Notes 2: 290–292 doi:10.1046/j.1471-8286 .2002.00237.x Keller I, Nentwig W and Largiadèr CR (2004) Recent habitat fragmentation due to roads can lead to significant genetic differentiation in an abundant flightless ground beetle. Molecular Ecology 13: 2983–2994 Kerdelhué C, Mondor-Genson G, Rasplus JY, Robert A and Lieutier F (2003) Characterization of five microsatellite loci in the pine shoot beetle Tomicus piniperda (Coleoptera: Scolytidae). Molecular Ecology Notes 3: 100-101 doi: 10.1046/j.1471-8286 .2003.00364.x Kim KS and Sappington TW (2004) Isolation and characterization of polymorphic microsatellite loci in the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae). Molecular Ecology Notes 4: 701–703 doi: 10.1111/j.1471-8286.2004.00765.x Kim KS and Sappington TW (2005) Genetic Structuring of Western Corn Rootworm (Coleoptera: Chrysomelidae) Populations in the United States Based on Microsatellite Loci Analysis. Environmental Entomology 34(2): 494- 503. doi: 10.1603/0046-225X-34.2.494 Kim KS, French BW, Sumerford DV and Sappington TW (2007) Genetic Diversity in Laboratory Colonies of Western Corn Rootworm (Coleoptera: Chrysomelidae), Including a Nondiapause Colony. Environmental

115

Entomology 36(3): 637-645. doi: 10.1603/0046- 225X(2007)36[637:GDILCO]2.0.CO;2 Kim KS, Stolz U, Miller NJ, Waits ER, Guillemaud T, Sumerford DV and Sappington TW (2008) A Core Set of Microsatellite Markers for Western Corn Rootworm (Coleoptera: Chrysomelidae) Population Genetics Studies. Environ. Entomol. 37 (2): 293-300 Kohlmann B (1984) Biosistemática de las especies norte-americanas del género Ateuchus (Coleoptera: Scarabaeidae: Scarabaeinae). Folia Entomol. Mex. 60: 3-81 Lagisz M and Wolff K (2004) Microsatellite DNA markers for the ground beetle Pterostichus oblongopunctatus F. Molecular Ecology Notes 4: 113–115 doi: 10.1111/j.1471-8286.2004.00586.x Lagisz M, Wolff K, Sanderson RA and Laskowski R (2010) Genetic population structure of the ground beetle, Pterostichus oblongopunctatus, inhabiting a fragmented and polluted landscape: Evidence for sex-biased dispersal. Journal of Insect Science 10:105 available online: insectsicence.org/10.105 Landvik M, Wahlberg N and Roslin T (2013) The identity of the Finnish Osmoderma (Coleoptera: Scarabaeidae, Cetoniinae) population established by COI sequencing. Entomol. Fennica 24: 147–155 Larsen TH, Lopera A and Forsyth A (2008) Understanding Trait-Dependent Community Disassembly: Dung Beetles, Density Functions, and Forest Fragmentation. Conserv Biol 22:1288–1298 Lawrence JF and Britton EB (1991) Coleoptera. In: The Insects of Australia, 2nd edition. Volume I. Melbourne University Press. Carlton Lawrence JF and Newton AF (1995) Families and subfamilies of Coleoptera (with selected genera, notes, references and data on family-group names). In: Pakaluk E (eds) Biology, Phylogeny, and classification of Coleoptera: Papers Celebrating the 80th Birthday of Roy A. Crowson., 779-1092. Legrand D, Vautrin D, Lachaise D and Cariou ML (2011) Microsatellite variation suggests a recent fine-scale population structure of Drosophila sechellia, a species endemic of the Seychelles archipelago. Genetica 139: 909–919 doi: 10.1007/s10709-011-9595-8 Lewontin RC and Hubby JL (1966) A molecular approach to the study of genic heterozygosity in natural populations. II. Amount of variation and degree of heterozygosity in natural populations of Drosophila pseudoobscura. Genetics 54: 595-609 Liewlaksaneeyanawin C, Ritland CE, Newton GH and El-Kassaby YA (2001) Characterization of microsatellite loci in white pine weevil (Pissodes strobi). Molecular Ecology Notes 1: 248-249 Linn S, Arber W (1968) Host specificity of DNA produced by Escherichia coli, X. In vitro restriction of phage fd replicative form. Proc Natl Acad Sci U S A.59 (4):1300–1306 Liu J, Gui F and Li Z (2010) Genetic diversity of the planthopper, Sogatella furcifera in the Greater Mekong Subregion detected by inter-simplesequence repeats (ISSR) markers. Journal of Insect Science 10:52. doi: 10.1673/031.010.5201 Loiseau A, Malausa T, Lombaert E, Martin JF and Estoup A (2009) Isolation and characterization of microsatellites in the harlequin ladybird, Harmonia axyridis (Coleoptera, Coccinellidae), and cross-species amplification within the family

116

Coccinellidae. Permanent Genetic Resources Note. doi: 10.1111/j.1755- 0998.2009.02517.x Lopez B, Favela S, Ponce G, Foroughbakhch R and Flores AE (2013) Genetic Variation in Bactericera cockerelli (Hemiptera: Triozidae) from Mexico. Journal of Economic Entomology 106(2):1004-1010 Louzada JNC (2008) Scarabaeinae (Coleoptera: Scarabaeidae) detritívoros em ecossistemas tropicais: biodiversidade e serviços ambientais. In: Moreira FMS, Siqueira JO and Brussaard L. Biodiversidade do solo em ecossistemas brasileiros. Lavras: UFLA, p. 299-322. Louzada JNC and Lopes FS (1997) A comunidade de Scarabaeidae copro- necrófagos (Coleoptera) de fragmento de Mata Atlântica. Revista Brasileira de Entomologia 41: 117-121. Lynch M and Milligan BG (1994) Analysis of population genetic structure with RAPD markers. Molecular Ecology 3: 91-99 Ma Cl, Wu HL, Hu HY, Wu X, Ma GC, Fu YG and Peng ZQ (2011) Isolation and characterization of eight polymorphic microsatellite loci for the coconut pest, Brontispa longissima (Coleoptera: Hispidae). Genet. Mol. Res. 10 (1): 429- 432 Machkour-M’Rabet S, Leberger R, León-Cortés JL, Gers C and Legal L (2014) Population structure and genetic diversity of the only extant Baroninae swallowtail butterfly, Baronia brevicornis, revealed by ISSR markers. Journal Insect Conservation 18:385-396. doi: 10.1007/s10841-014-9647-3 Margraf N, Gautschi B and Rahier M (2005) Isolation and characterization of microsatellite loci in the Alpine leaf beetle, Oreina elongata. Molecular Ecology Notes 5: 419–420 doi: 10.1111/j.1471-8286.2005.00946.x Manjeri G, Muhamad R, Faridah QZ and Tan SG (2011) Genetic variation studies in Oryctes rhinoceros (L.) (Coleoptera: Scarabaeidae) from oil palm plantations using random amplified microsatellite (RAMs) markers. Biochem Syst Ecol 10:2611–2617 Manjeri G, Muhamad R, Faridah QZ and Tan SG (2012) Development of single locus DNA microsatellite markers in Oryctes rhinoceros (Linnaeus) using 5’ anchored RAMs-PCR method. J. Genet. 91, e92–e96. Manrique-Poyato MI, López-León MD, Gómez R, Perfectti F and Camacho JPM (2013) Population Genetic Structure of the Grasshopper Eyprepocnemis plorans in the South and East of the Iberian Peninsula. PLoS One 8:1–8. doi: 10.1371/journal.pone.0059041 Marin J, Crouau-Roy B, Hemptinne JL, Lecompte E and Magro A (2010) Coccinella septempunctata (Coleoptera, Coccinellidae): a species complex? Zoologica Scripta 39(6):591-602. doi: 10.1111/j.1463-6409.2010.00450.x Maroja LS, Bogdanowicz SM, Wallin KF, Raffa KF and Harrison RG (2007) Phylogeography of spruce beetles (Dendroctonus rufipennis Kirby) (Curculionidae: Scolytinae) in North America. Molecular Ecology 16: 2560– 2573 doi: 10.1111/j.1365-294X.2007.03320.x Medina CA, Scholtz C and Gill BD (2003) Morphological variation and systematics of Canthon Hoffmannsegg 1817, and related genera of New World Canthonini dung beetles (Coleoptera, Scarabaeidae). Deutsche Entomologische Zeitschrift 50:23–68. Medina AM and Lopes PP (2014) Seasonality in the dung beetle community in a Brazilian tropical dry forest: Do small changes make a difference? J Insect Sci 14:1–11. doi: 10.1673/031.014.123

117

Meixner MD, Mcpheron BA, Silva JG, Gasparich GE and Sheppard WS (2002) The Mediterranean fruit fly in California: evidence for multiple introductions and persistent populations based on microsatellite and mitochondrial DNA variability. Molecular Ecology 11: 891–899 Meselson M and Yuan R (1968) DNA restriction enzyme from Escherichia coli. Nature 217:1110-1114 Monaghan MT, Inward DJ, Hunt T and Vogler AP (2007) A molecular phylogenetic analysis of the Scarabaeinae (dung beetles). Mol. Phylogenet. Evol. 45:(2) 674-692 Nichols E, Larsen T, Spector S, Davis AL, Escobar F and Favila M (2007) The Scarabaeinae Research Network. Global dung beetle response to tropical forest modification and fragmentation: A quantitative literature review and meta-analysis. Biol Conserv 137:1–19. O’Callaghan MJ, Finn DS, Williams M and Sadler JP (2014) Development and Characterization of Seven Polymorphic Microsatellite Loci in Bembidion atrocaeruleum (Coleoptera: Carabidae). Journal of Insect Science 14 (203) doi: 10.1093/jisesa/ieu065 Ocampo FC and Hawks DC (2006) Molecular phylogenetics and evolution of the food relocation behaviour of the dung beetle tribe Eucraniini (Coleoptera : Scarabaeidae : Scarabaeinae). Invertebrate Systematics 20: (5) 557–570. Omondi AB, Orantes LC, Berg JV, Masiga D and Schulthess F (2009) Isolation and characterization of microsatellite markers from Teretrius nigrescens Lewis (Coleoptera: Histeridae), predator of the storage pest Prostephanus truncatus (Horn) (Coleoptera: Bostrichidae). Permanent Genetic Resources Note doi: 10.1111/j.1755-0998.2009.02613.x Patt A, Misof B, Wagner TH and Naumann CM (2004a) Isolation and characterization of microsatellite loci in Monolepta vincta Gerstaecker, 1871 (Coleoptera, Chrysomelidae, Galerucinae). Molecular Ecology Notes 4: 572– 574 doi: 10.1111/j.1471-8286.2004.00738.x Patt A, Misof B, Wagner TH and Naumann CM (2004b) Characterization of microsatellite loci in Amphitmetus transversus (Kolbe, 1897) (Coleoptera, Curculionidae). Molecular Ecology Notes 4: 188–190 doi: 10.1111/j.1471- 8286.2004.00610.x Pereira FSCMS and Martines A (1956) Os gêneros de Canthonini Americanos (col. Scarabaeidae). Ver. Brasil. de entomologia 6: 91-192. Porter JL and Rust RW (1996) Allozyme Variation within Five Species of Aegialia (Coleoptera: Scarabaeidae). Annals of the Entomological Society of America 89 (5): 710-721 doi: 10.1093/aesa/89.5.710 Racz R, Bereczki J, Sramkó G, Kosztolányi A, Tóth JP, Póliska S, Horváth A, Barta E and Barta Z (2015) Isolation and characterization of 15 microsatellite loci from Lethrus apterus (Coleoptera: Geotrupidae). Ann. Zool. Fennici 52: 45-50 Rasmussen DA and Noor MAF (2009) What can you do with 0.1× genome coverage? A case study based on a genome survey of the scuttle fly Megaselia scalaris (Phoridae). B. M. C. Genomics 10: 382. doi 10.1186/1471-2164-10-382 Ratcliffe BC, Jameson ML and Smith ABT (2002) Scarabaeidae. In: Arnett JRRH, Thomas MC, Skellei PE, Frank JH. American Beetles, Polyphaga: Scarabaeoidea through Curculionoidea. Ed. CRC Press LLC 2:39–81

118

Reddy SC, Babu AP, Swamy BPM, Kaladhar K and Sarla N (2009) ISSR markers based on GA and AG repeats reveal genetic relationship among rice varieties tolerant to drought, flood, or salinity. J Zhejiang Univ Sci B 10(2): 133–141 Richer PO (1958) Biology of Scarabaeidae. Annu. Rev. Entomol. 3: 311-334 Rivera-Cervantes and Halffter G (1999) Monografia de las espécies mexicanas de Canthon del subgénero Glaphyrocanthon (Coleoptera: Scarabaeidae: Scarabaeinae). Acta Zool. Mex. 77:23-150 Rizzini CT (1979) Tratado de fitogeografia do Brasil. v.2. Aspectos ecológicos. Hucitec / Edusp.; São Paulo Røed KH, Birkemoe T, Sverdrup-Thygeson A, Horak J, Midthjell L and Leinaas HP (2014) Isolation and characterization of ten microsatellite loci for the wood- living and threatened beetle Cucujus cinnaberinus (Coleoptera: Cucujidae). Conservation Genet Resour 6:641–643. Doi: 10.1007/s12686-014-0164-1 Saha D, Ranjan SK, Mallick CB, Vidyarthi AS and Ramani R (2011) Genetic diversity in lac resin-secreting insects belonging to Kerria spp., as revealed through ISSR markers. Biochem Syst Ecol 39:112–120. doi:10.1016/j.bse.2011.01.016 Sallé A, Kerdelhué C, Breton M and Lieutier F (2003) Characterization of microsatellite loci in the spruce bark beetle Ips typographus (Coleoptera: Scolytinae) Molecular Ecology Notes 3: 336–337 doi: 10.1046/j.1471- 8286.2003.00443.x Sallé A, Arthofer W, Lieutier F, Stauffer C and Kerdelhué C (2007) Phylogeography of a host-specific insect: genetic structure of Ips typographus in Europe does not reflect past fragmentation of its host. Biological Journal of the Linnean Society 90: 239–246 Salomão RP and Iannuzzi L (2015) Dung beetle (Coleoptera, Scarabaeidae) assemblage of a highly fragmented landscape of Atlantic forest: from small to the largest fragments of northeastern Brazilian region. Revista Brasileira de Entomologia 59: 126–131 Schlötterer C and Tautz D (1992) Slippage synthesis of simple sequence DNA. Nucleic Acids Res 20 (2): 211-5 Schrey NM, Schrey AW, Heist EJ and Reeve JD (2007) Microsatellite loci for the southern pine beetle (Dendroctonus frontalis) and cross-species amplification in Dendroctonus. Molecular Ecology Notes 7: 857–859 doi: 10.1111/j.1471- 8286.2007.01728.x Schrey NM, Schrey AW, Heist EJ and Reeve JD (2008) Fine-Scale Genetic Population Structure of Southern Pine Beetle (Coleoptera: Curculionidae) in Mississippi Forests. Environmental Entomology 37(1): 271-276. doi 0046- 225X/08/0271-0276$04.00/0 Schroeder KB, Jakobsson M, Crawford MH, Schurr TG, Boca SM, Conrad DF, Tito RY, Osipova LP, Tarskaia LA, Zhadanov SI, Wall JD, Pritchard JK, Malhi RS, Smith DG and Rosenberg NA (2009) Haplotypic background of a private allele at high frequency in the Americas. Mol Biol Evol. 26(5):995-1016. doi: 10.1093/molbev/msp024 Sembène M, Vautrin D, Silvain JF, Rasplus JY and Delobel A (2003) Isolation and characterization of polymorphic microsatellites in the groundnut seed beetle, Caryedon serratus (Coleoptera, Bruchidae). Molecular Ecology Notes 3: 299–301 doi: 10.1046/j.1471-8286.2003.00430.x Semeao AA, Campbell JF, Beeman RW, Whitworth RJ, Sloderbeck PE, Lorenzen MD (2010) Genetic structure of Tribolium castaneum populations in mills. 10th

119

International Working Conference on Stored Product Protection. doi: 0.5073/jka.2010.425.312 Silva PG, Vaz-de-Mello FZ and Di Mare RA (2011) Guia de identificação das espécies de Scarabaeinae (Coleoptera: Scarabaeidae) do município de Santa Maria, Rio Grande do Sul, Brasil. Biota Neotropica 14: 329-345 Simon MV, Benko-Iseppon AM, Resende LV, Winter P and Kahl G (2007). Genetic diversity and phylogenetic relationships in Vigna Savi germplasm revealed by DNA amplification fingerprinting (DAF). Genome 50: 538-547 Smith SG and Virkki N (1978) Coleoptera. In: Animal Cytogenetics (John B e.) Bonrtraeger, Berlin, Stuttgard, 366p. Souza GA, Carvalho MRO, Martins ER, Guedes RNC and Oliveira LO (2008) Diversidade genética estimada com marcadores ISSR em populações brasileiras de Zabrotes subfasciatus. Pesquisa Agropecuária Brasileira 43:843–849 Spector S and Ayzama S (2003) Rapid turnover and edge effects in Dung Beetle assemblages (Scarabaeidae) at a Bolivian Neotropical Forest–Savanna Ecotone. Biotropica 35:394–404. doi: 10.1111/j.1744-7429.2003.tb00593.x Sunnucks P (2000) Efficient genetic markers for population biology. Trends in Ecology & Evolution 15: 199–203. doi: 10.1016/S0169-5347(00)01825-5. Suzuki S and Yao I (2014) Isolation of nine polymorphic microsatellite loci from the burying beetle, Nicrophorus quadripunctatus (Coleoptera: Silphidae). Appl Entomol Zool 49:493–497 doi: 10.1007/s13355-014-0269-8 Takahashi Y, Matsushita N and Hogetsu T (2008) Development and characterization of 12 compound microsatellite markers in Platypus quercivorus (Murayama) (Coleoptera: Platypodidae). Conserv Genet 9:1381– 1383 doi 10.1007/s10592-007-9502-0 Takami Y and Katada S (2001) Microsatellite DNA markers for the ground beetle Carabus insulicola. Molecular Ecology Notes 1: 128-130 Tautz D, Trick M and Dover G (1986) Cryptic simplicity in DNA is a major source of genetic variation. Nature 322: 652–656 Templeton AR (2011) Genética de populações e teoria microevolutiva. SBG, Ribeirão Preto, SP, 705p. Vanin SA and Ide S (2002) Classificação comentada de Coleoptera: Proyecto de Red Iberoameicana de Biogeografia y Entomologia Sistemática. PrIbes- 2002, M3m: Monografias Terceiro Milênio PrIbes Vaz-de-Mello FZ (1999) Scarabaeidae s. str. (Coleoptera: Scarabaeoidea) de um fragmento de floresta amazônica no estado do Acre, Brasil: Taxocenose. Na. Soc.Entomol. Brasil. 28: 447-453. Vaz-de-Mello FZ (2000) Estado atual de conhecimento dos Scarabaeidae S. STR. (Coleoptera: Scarabaeoidea) do Brasil. In: Piera FM, Morrone JJ and Melic A (eds), Hacia um Proyecto CYTED para el inventario y estimação de la diversidade Entomologica em Iberoamérica: PrIbes-2000, M3m Monografias Terceiro Milenio, Zaragoza: 183-195. Vaz-de-Mello FZ (2007) Revision Taxonómica y Anpalisis Filogenético de la Tribu Ateuchini (Coleoptera, Scarabaeidae: Scarabaeinae). Xalapa: Departamento de Biodiversidad y Ecologia Animal, Instituto de Ecologia, A.C. 238p. Tese(Doutorado em Ciências – Área Sistemática). Velez S and Feder L (2005) Isolation and characterization of novel dinucleotide repeat microsatellite in the Jamaican click beetle Pyrophorus

120

plagiophthalamus (Coleoptera: Elateridae). Molecular Ecology Notes 5: 899- 901 doi: 10.1111/j.1471-8286.2005.01106.x Verbaarschot P, Calvo D, Esselink GD, Molina JM, Vrieling K and Jong PW (2007) Isolation of polymorphic microsatellite loci from the flea beetle Phyllotreta nemorum L. (Coleoptera: Chrysomelidae). Molecular Ecology Notes 7: 60–62 doi: 10.1111/j.1471-8286.2006.01524.x Vidal OR (1984) Coleoptera from Argentina. Genetica 65: 235-239 Villalba S, Lobo JM, Martín-Piera F and Zardoya R (2002) Phylogenetic relationship of iberian dung beetles (Coleoptera: Scarabaeinae): Insights on the evolution of nesting behavior. J Mol Evol 55: 116-126. doi: 10.1007/s00239-002-2314-4 Waits ER and Stolz U (2008) Polymorphic microsatellite loci from northern and Mexican corn rootworms (Insecta: Coleoptera: Chrysomelidae) and cross- amplification with other Diabrotica spp. Molecular Ecology Resources 8: 707– 709 doi: 10.1111/j.1471-8286.2007.02056.x Wirta H, Viljanen H, Orsini L, Montreuil O and Hanski I (2010) Three parallel radiations of Canthonini dung beetles in Madagascar. Mol. Phylogenet. Evol. 57:(2)710-727. Wolfe AD (2005) ISSR techniques for evolutionary biology. Methods Enzymol. 395:134-44. doi:10.1016/S0076-6879(05)95009-X Wright S (1965) The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution 19: 395–420 Wu Y, Li F, Li Z, Stejskal V, Kučerová Z, Opit G, Aulicky R, Zhang T, He P and Cao Y (2016) Microsatellite markers for Cryptolestes ferrugineus (Coleoptera: Laemophloeidae) and other Cryptolestes species. Bulletin of Entomological Research 106: 154–160 doi:10.1017/S0007485315000899 Yadav JS and Pillai RK (1979) Evolution of karyotypes and phylogenetic relationships in Scarabaeidae (Coleoptera). Zool Anz Jena 202: 105-118 Zane L, Bargelloni L and Patarnello T (2002) Strategies for microsatellite isolation: a review. Mol. Ecol. 11: 1–16 Zhang JJ, Yang J, Li YC, Liu N and Zhang RZ (2013) Genetic relationships of introduced Colorado potato beetle Leptinotarsa decemlineata populations in Xinjiang, China. Insect Science 20: 643–654. doi 10.1111/j.1744- 7917.2012.01565.x Zietjiewicz E, Rafalski A and Labuda D (1994) Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20: 176-183. Zunino M (1985) Las relaciones taxonomicas de los Phanaeina (Coleoptera, Scarabaeinae) y sus implicaciones biogeographicas. Folia Entomologica Mexicana 64: 101-115.

121

10. Anexos

10.1 Anexo 1: Normas dos períódicos

Normas da Revista Journal of Insect Conservation

MANUSCRIPT SUBMISSION Manuscript Submission Submission of a manuscript implies: that the work described has not been published before; that it is not under consideration for publication anywhere else; that its publication has been approved by all co-authors, if any, as well as by the responsible authorities – tacitly or explicitly – at the institute where the work has been carried out. The publisher will not be held legally responsible should there be any claims for compensation.

Permissions Authors wishing to include figures, tables, or text passages that have already been published elsewhere are required to obtain permission from the copyright owner(s) for both the print and online format and to include evidence that such permission has been granted when submitting their papers. Any material received without such evidence will be assumed to originate from the authors.

Online Submission Please follow the hyperlink “Submit online” on the right and upload all of your manuscript files following the instructions given on the screen.

ADDITIONAL REQUEST Upon submission, the e-mail addresses of all authors will be requested. At the end of the submission process, the corresponding author will receive an acknowledgement e-mail and all co-authors will be contacted automatically to confirm their affiliation to the submitted work.

TITLE PAGE

Title Page The title page should include:  The name(s) of the author(s)  A concise and informative title  The affiliation(s) and address(es) of the author(s)

122

 The e-mail address, telephone and fax numbers of the corresponding author Abstract Please provide an abstract of 150 to 250 words. The abstract should not contain any undefined abbreviations or unspecified references.

Keywords Please provide 4 to 6 keywords which can be used for indexing purposes.

TEXT Text Formatting Manuscripts should be submitted in Word.  Use a normal, plain font (e.g., 10-point Times Roman) for text.  Use italics for emphasis.  Use the automatic page numbering function to number the pages.  Do not use field functions.  Use tab stops or other commands for indents, not the space bar.  Use the table function, not spreadsheets, to make tables.  Use the equation editor or MathType for equations.  Save your file in docx format (Word 2007 or higher) or doc format (older Word versions). Manuscripts with mathematical content can also be submitted in LaTeX.  LaTeX macro package (zip, 182 kB)

Headings Please use no more than three levels of displayed headings.

Abbreviations Abbreviations should be defined at first mention and used consistently thereafter.

Footnotes Footnotes can be used to give additional information, which may include the citation of a reference included in the reference list. They should not consist solely of a reference citation, and they should never include the bibliographic details of a reference. They should also not contain any figures or tables. Footnotes to the text are numbered consecutively; those to tables should be indicated by superscript lower-case letters (or asterisks for significance values and other statistical data). Footnotes to the title or the authors of the article are not given reference symbols. Always use footnotes instead of endnotes.

123

Acknowledgments Acknowledgments of people, grants, funds, etc. should be placed in a separate section on the title page. The names of funding organizations should be written in full.

SCIENTIFIC STYLE Please always use internationally accepted signs and symbols for units (SI units).

SCIENTIFIC STYLE Nomenclature: Insofar as possible, authors should use systematic names similar to those used by Chemical Abstract Service or IUPAC.

REFERENCES Citation Cite references in the text by name and year in parentheses. Some examples:  Negotiation research spans many disciplines (Thompson 1990).  This result was later contradicted by Becker and Seligman (1996).  This effect has been widely studied (Abbott 1991; Barakat et al. 1995; Kelso and Smith 1998; Medvec et al. 1999).

Reference list The list of references should only include works that are cited in the text and that have been published or accepted for publication. Personal communications and unpublished works should only be mentioned in the text. Do not use footnotes or endnotes as a substitute for a reference list. Reference list entries should be alphabetized by the last names of the first author of each work.  Journal article Gamelin FX, Baquet G, Berthoin S, Thevenet D, Nourry C, Nottin S, Bosquet L (2009) Effect of high intensity intermittent training on heart rate variability in prepubescent children. Eur J Appl Physiol 105:731-738. doi: 10.1007/s00421-008-0955-8 Ideally, the names of all authors should be provided, but the usage of “et al” in long author lists will also be accepted: Smith J, Jones M Jr, Houghton L et al (1999) Future of health insurance. N Engl J Med 965:325–329  Article by DOI Slifka MK, Whitton JL (2000) Clinical implications of dysregulated cytokine production. J Mol Med. doi:10.1007/s001090000086  Book South J, Blass B (2001) The future of modern genomics. Blackwell, London  Book chapter

124

Brown B, Aaron M (2001) The politics of nature. In: Smith J (ed) The rise of modern genomics, 3rd edn. Wiley, New York, pp 230-257  Online document Cartwright J (2007) Big stars have weather too. IOP Publishing PhysicsWeb. http://physicsweb.org/articles/news/11/6/16/1. Accessed 26 June 2007  Dissertation Trent JW (1975) Experimental acute renal failure. Dissertation, University of California Always use the standard abbreviation of a journal’s name according to the ISSN List of Title Word Abbreviations, see  ISSN LTWA If you are unsure, please use the full journal title. For authors using EndNote, Springer provides an output style that supports the formatting of in-text citations and reference list.

TABLES  All tables are to be numbered using Arabic numerals.  Tables should always be cited in text in consecutive numerical order.  For each table, please supply a table caption (title) explaining the components of the table.  Identify any previously published material by giving the original source in the form of a reference at the end of the table caption.  Footnotes to tables should be indicated by superscript lower-case letters (or asterisks for significance values and other statistical data) and included beneath the table body.

ARTWORK AND ILLUSTRATIONS GUIDELINES Electronic Figure Submission  Supply all figures electronically.  Indicate what graphics program was used to create the artwork.  For vector graphics, the preferred format is EPS; for halftones, please use TIFF format. MSOffice files are also acceptable.  Vector graphics containing fonts must have the fonts embedded in the files.  Name your figure files with "Fig" and the figure number, e.g., Fig1.eps.

Line Art

 Definition: Black and white graphic with no shading.  Do not use faint lines and/or lettering and check that all lines and lettering within the figures are legible at final size.  All lines should be at least 0.1 mm (0.3 pt) wide.  Scanned line drawings and line drawings in bitmap format should have a minimum resolution of 1200 dpi.

125

 Vector graphics containing fonts must have the fonts embedded in the files.

Halftone Art

 Definition: Photographs, drawings, or paintings with fine shading, etc.  If any magnification is used in the photographs, indicate this by using scale bars within the figures themselves.  Halftones should have a minimum resolution of 300 dpi.

Combination Art

 Definition: a combination of halftone and line art, e.g., halftones containing line drawing, extensive lettering, color diagrams, etc.  Combination artwork should have a minimum resolution of 600 dpi.

Color Art  Color art is free of charge for online publication.  If black and white will be shown in the print version, make sure that the main information will still be visible. Many colors are not distinguishable from one another when converted to black and white. A simple way to check this is to make a xerographic copy to see if the necessary distinctions between the different colors are still apparent.  If the figures will be printed in black and white, do not refer to color in the captions.  Color illustrations should be submitted as RGB (8 bits per channel). Figure Lettering  To add lettering, it is best to use Helvetica or Arial (sans serif fonts).  Keep lettering consistently sized throughout your final-sized artwork, usually about 2–3 mm (8–12 pt).  Variance of type size within an illustration should be minimal, e.g., do not use 8-pt type on an axis and 20-pt type for the axis label.  Avoid 's such as shading, outline letters, etc.  Do not include titles or captions within your illustrations.

Figure Numbering  All figures are to be numbered using Arabic numerals.  Figures should always be cited in text in consecutive numerical order.  Figure parts should be denoted by lowercase letters (a, b, c, etc.).  If an appendix appears in your article and it contains one or more figures, continue the consecutive numbering of the main text. Do not number the appendix figures,

126

"A1, A2, A3, etc." Figures in online appendices (Electronic Supplementary Material) should, however, be numbered separately.

Figure Captions  Each figure should have a concise caption describing accurately what the figure depicts. Include the captions in the text file of the manuscript, not in the figure file.  Figure captions begin with the term Fig. in bold type, followed by the figure number, also in bold type.  No punctuation is to be included after the number, nor is any punctuation to be placed at the end of the caption.  Identify all elements found in the figure in the figure caption; and use boxes, circles, etc., as coordinate points in graphs.  Identify previously published material by giving the original source in the form of a reference citation at the end of the figure caption.

Figure Placement and Size  Figures should be submitted separately from the text, if possible.  When preparing your figures, size figures to fit in the column width.  For most journals the figures should be 39 mm, 84 mm, 129 mm, or 174 mm wide and not higher than 234 mm.  For books and book-sized journals, the figures should be 80 mm or 122 mm wide and not higher than 198 mm.

Permissions If you include figures that have already been published elsewhere, you must obtain permission from the copyright owner(s) for both the print and online format. Please be aware that some publishers do not grant electronic rights for free and that Springer will not be able to refund any costs that may have occurred to receive these permissions. In such cases, material from other sources should be used.

Accessibility In order to give people of all abilities and disabilities access to the content of your figures, please make sure that  All figures have descriptive captions (blind users could then use a text-to- speech software or a text-to-Braille hardware)  Patterns are used instead of or in addition to colors for conveying information (colorblind users would then be able to distinguish the visual elements)  Any figure lettering has a contrast ratio of at least 4.5:1

127

DOES SPRINGER PROVIDE ENGLISH LANGUAGE SUPPORT? Manuscripts that are accepted for publication will be checked by our copyeditors for spelling and formal style. This may not be sufficient if English is not your native language and substantial editing would be required. In that case, you may want to have your manuscript edited by a native speaker prior to submission. A clear and concise language will help editors and reviewers concentrate on the scientific content of your paper and thus smooth the peer review process. The following editing service provides language editing for scientific articles in all areas Springer publishes in:  Edanz English editing for scientists Use of an editing service is neither a requirement nor a guarantee of acceptance for publication. Please contact the editing service directly to make arrangements for editing and payment.

For Authors from China 文章在投稿前进行专业的语言润色将对作者的投稿进程有所帮助。作者可自愿选择使用Springer推荐的编辑服务，使用与否并不作为判断文章是否被录用的依据。提高文章的语言质量将有助于审稿人理解文章的内容，通过对学术内容的判断来决定文章的取舍，而不会因为语言问题导致直接退稿。作者需自行联系Springer推荐的编辑服务公司，协商编辑事宜。  理文编辑

For Authors from Japan ジャーナルに論文を投稿する前に、ネイティブ・スピーカーによる英文校閲を希望されている方には、Edanz社をご紹介しています。サービス内容、料金および申込方法など、日本語による詳しい説明はエダンズグループジャパン株式会社の下記サイトをご覧ください。  エダンズグループジャパン For Authors from Korea 영어 논문 투고에 앞서 원어민에게 영문 교정을 받고자 하시는 분들께 Edanz 회사를 소개해 드립니다. 서비스 내용, 가격 및 신청 방법 등에 대한 자세한 사항은 저희 Edanz Editing Global 웹사이트를 참조해 주시면 감사하겠습니다.  Edanz Editing Global

ETHICAL RESPONSIBILITIES OF AUTHORS This journal is committed to upholding the integrity of the scientific record. As a member of the Committee on Publication Ethics (COPE) the journal will follow the COPE guidelines on how to deal with potential acts of misconduct.

128

Authors should refrain from misrepresenting research results which could damage the trust in the journal, the professionalism of scientific authorship, and ultimately the entire scientific endeavour. Maintaining integrity of the research and its presentation can be achieved by following the rules of good scientific practice, which include:  The manuscript has not been submitted to more than one journal for simultaneous consideration.  The manuscript has not been published previously (partly or in full), unless the new work concerns an expansion of previous work (please provide transparency on the re-use of material to avoid the hint of text- recycling (“self-plagiarism”)).  A single study is not split up into several parts to increase the quantity of submissions and submitted to various journals or to one journal over time (e.g. “salami-publishing”).  No data have been fabricated or manipulated (including images) to support your conclusions  No data, text, or theories by others are presented as if they were the author’s own (“plagiarism”). Proper acknowledgements to other works must be given (this includes material that is closely copied (near verbatim), summarized and/or paraphrased), quotation marks are used for verbatim copying of material, and permissions are secured for material that is copyrighted.

Important note: the journal may use software to screen for plagiarism.  Consent to submit has been received explicitly from all co-authors, as well as from the responsible authorities - tacitly or explicitly - at the institute/organization where the work has been carried out, before the work is submitted.  Authors whose names appear on the submission have contributed sufficiently to the scientific work and therefore share collective responsibility and accountability for the results. In addition:  Changes of authorship or in the order of authors are not accepted after acceptance of a manuscript.  Requesting to add or delete authors at revision stage, proof stage, or after publication is a serious matter and may be considered when justifiably warranted. Justification for changes in authorship must be compelling and may be considered only after receipt of written approval from all authors and a convincing, detailed explanation about the role/deletion of the new/deleted author. In case of changes at revision stage, a letter must accompany the revised manuscript. In case of changes after acceptance or publication, the request and documentation must be sent via the Publisher to the Editor-in- Chief. In all cases, further documentation may be required to support your request. The decision on accepting the change rests with the Editor-in-Chief of the journal and may be turned down. Therefore authors are strongly advised to ensure the correct author group, corresponding author, and order of authors at submission.

129

 Upon request authors should be prepared to send relevant documentation or data in order to verify the validity of the results. This could be in the form of raw data, samples, records, etc. If there is a suspicion of misconduct, the journal will carry out an investigation following the COPE guidelines. If, after investigation, the allegation seems to raise valid concerns, the accused author will be contacted and given an opportunity to address the issue. If misconduct has been established beyond reasonable doubt, this may result in the Editor-in-Chief’s implementation of the following measures, including, but not limited to:  If the article is still under consideration, it may be rejected and returned to the author.  If the article has already been published online, depending on the nature and severity of the infraction, either an erratum will be placed with the article or in severe cases complete retraction of the article will occur. The reason must be given in the published erratum or retraction note.  The author’s institution may be informed.

DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST Authors must disclose all relationships or interests that could have direct or potential influence or impart bias on the work. Although an author may not feel there is any conflict, disclosure of relationships and interests provides a more complete and transparent process, leading to an accurate and objective assessment of the work. Awareness of a real or perceived conflicts of interest is a perspective to which the readers are entitled. This is not meant to imply that a financial relationship with an organization that sponsored the research or compensation received for consultancy work is inappropriate. Examples of potential conflicts of interests that are directly or indirectly related to the research may include but are not limited to the following:  Research grants from funding agencies (please give the research funder and the grant number)  Honoraria for speaking at symposia  Financial support for attending symposia  Financial support for educational programs  Employment or consultation  Support from a project sponsor  Position on advisory board or board of directors or other type of management relationships  Multiple affiliations  Financial relationships, for example equity ownership or investment interest  Intellectual property rights (e.g. patents, copyrights and royalties from such rights)  Holdings of spouse and/or children that may have financial interest in the work In addition, interests that go beyond financial interests and compensation (non- financial interests) that may be important to readers should be disclosed. These may include but are not limited to personal relationships or competing interests

130

directly or indirectly tied to this research, or professional interests or personal beliefs that may influence your research. The corresponding author collects the conflict of interest disclosure forms from all authors. In author collaborations where formal agreements for representation allow it, it is sufficient for the corresponding author to sign the disclosure form on behalf of all authors. Examples of forms can be found  here: The corresponding author will include a summary statement in the text of the manuscript in a separate section before the reference list, that reflects what is recorded in the potential conflict of interest disclosure form(s). See below examples of disclosures: Funding: This study was funded by X (grant number X). Conflict of Interest: Author A has received research grants from Company A. Author B has received a speaker honorarium from Company X and owns stock in Company Y. Author C is a member of committee Z. If no conflict exists, the authors should state: Conflict of Interest: The authors declare that they have no conflict of interest.

AFTER ACCEPTANCE Upon acceptance of your article you will receive a link to the special Author Query Application at Springer’s web page where you can sign the Copyright Transfer Statement online and indicate whether you wish to order OpenChoice, offprints, or printing of figures in color. Once the Author Query Application has been completed, your article will be processed and you will receive the proofs.

Open Choice In addition to the normal publication process (whereby an article is submitted to the journal and access to that article is granted to customers who have purchased a subscription), Springer provides an alternative publishing option: Springer Open Choice. A Springer Open Choice article receives all the benefits of a regular subscription-based article, but in addition is made available publicly through Springer’s online platform SpringerLink.  Springer Open Choice

Copyright transfer Authors will be asked to transfer copyright of the article to the Publisher (or grant the Publisher exclusive publication and dissemination rights). This will ensure the widest possible protection and dissemination of information under copyright laws. Open Choice articles do not require transfer of copyright as the copyright remains with the author. In opting for open access, the author(s) agree to publish the article under the Creative Commons Attribution License. Offprints Offprints can be ordered by the corresponding author.

131

Color illustrations Online publication of color illustrations is free of charge. For color in the print version, authors will be expected to make a contribution towards the extra costs.

Proof reading The purpose of the proof is to check for typesetting or conversion errors and the completeness and accuracy of the text, tables and figures. Substantial changes in content, e.g., new results, corrected values, title and authorship, are not allowed without the approval of the Editor. After online publication, further changes can only be made in the form of an Erratum, which will be hyperlinked to the article.

Online First The article will be published online after receipt of the corrected proofs. This is the official first publication citable with the DOI. After release of the printed version, the paper can also be cited by issue and page numbers.

132

Normas da Revista International Journal of Molecular Sciences

Manuscript Submission Overview

Types of Publications IJMS has no restrictions on the length of manuscripts, provided that the text is concise and comprehensive. Full experimental details must be provided so that the results can be reproduced by other groups. IJMS encourages authors to publish all experimental controls and full datasets as supplementary files (please read the guidelines about Supplementary Materials carefully and references to unpublished data).

The different types of articles published in IJMS are indicated in the first section of the Aims & Scope. The main types are:

Articles: research manuscripts report new evidence or new conclusions which have neither been published before nor are under consideration for publication in another journal. MDPI considers all original research manuscripts provided that the work reports scientifically sound experiments and provides a substantial amount of new information. We strongly recommend authors not to unnecessarily divide their work into several related manuscripts. Short communications of preliminary, but significant, results will also be considered. Reviews: review manuscripts provide concise and precise updates on the latest progress made in a given area of research. Conference Papers: Expanded and high quality conference papers are also considered in IJMS if they fulfill the following requirements: (1) the paper should be expanded to the size of a research article; (2) the conference paper should be cited and noted on the first page of the paper; (3) if the authors do not hold the copyright to the published conference paper, authors should seek the appropriate permission from the copyright holder; (4) authors are asked to disclose that it is conference paper in their cover letter and include a statement on what has been changed compared to the original conference paper. Submission Process Manuscripts for IJMS should be submitted online at susy.mdpi.com. The submitting author, who is generally the corresponding author, is responsible for the manuscript during the submission and peer-review process. The submitting authors must ensure that all co-authors have been included in the author list (read the criteria to qualify for authorship) and that they all have read and approved the submitted version of the manuscript. To submit your manuscript, register and log in to this website. Once you are registered, click here to go to the submission form

133 for IJMS. All co-authors can see the manuscript details in the submission system, if they register and log in using the e-mail address provided during manuscript submission.

Accepted File Formats Authors must use the Microsoft Word template or LaTeX template to prepare their manuscript. Using the template file will substantially shorten the time to complete copy-editing and publication of accepted manuscripts. Accepted file formats are:

Microsoft Word: Manuscripts prepared in Microsoft Word must be converted into a single file before submission. When preparing manuscripts in Microsoft Word, the IJMS Microsoft Word template file must be used. Please insert your graphics (schemes, figures, etc.) in the main text after the paragraph of its first citation. LaTeX: Manuscripts prepared in LaTeX must be collated into one ZIP folder (include all source files and images, so that the Editorial Office can recompile the submitted PDF). When preparing manuscripts in LaTeX, please use the IJMS LaTeX template files. You can now also use the online application writeLaTeX to submit articles directly to IJMS. The MDPI LaTeX template file should be selected from the writeLaTeX template gallery. Cover Letter A cover letter must be included with each manuscript submission. It should be concise and explain why the content of your paper is significant, placing your findings in the context of existing work and why it fits the scope of the journal. Please confirm that neither the manuscript nor any parts of its content are currently under consideration or published in another journal. Any prior submissions of the manuscript to MDPI journals must be acknowledged. The names of proposed and excluded reviewers should be provided in the submission system, not in the cover letter.

Note for Authors Funded by the National Institutes of Health (NIH) This journal automatically deposits papers to PubMed Central after publication of an issue. Authors do not need to separately submit their papers through the NIH Manuscript Submission System (NIHMS, http://nihms.nih.gov/).

Preparation of a Manuscript

General Considerations Research manuscripts should comprise: Front matter: Title, Author list, Affiliations, Abstract, Keywords Research manuscript sections: Introduction, Results, Discussion, Experimental Section, Conclusions (optional), Supplementary Materials Back matter: Acknowledgments, Author Contributions, Conflicts of Interests, References.

134

Review manuscripts should comprise the front matter, literature review sections and the back matter. The template file can also be used to prepare the front and back matter of your review manuscript. It is not necessary to follow the remaining structure. Abstract Graphic: Authors are encouraged to provide a graphical abstract as a self-explanatory image to appear alongside with the text abstract in the Table of Contents, if you have not done so already. Figures should be a high quality image in any common image format. Note that images displayed online will be up to 11 by 9 cm on screen and the figure should be clear at this size. "Data not shown" should be avoided in research manuscripts. We encourage our authors to publish all observations related to the submitted manuscript as Supplementary Materials. "Unpublished data" intended for publication in a different manuscript, i.e., in a manuscript that is either planned, "in preparation" or that have been "submitted" but not yet accepted, should be cited in the text and a reference should be added in the References section. "Personal Communications" should also be cited in the text and reference added in the References section. (see also the MDPI reference list and citations style guide). Abbreviations should be defined in parentheses the first time they appear in the abstract, main text and in figure captions. SI Units (International System of Units) should be used for this journal. Imperial, US customary and other units should be converted to SI units whenever possible before submission of a manuscript to the journal. Accession numbers of RNA, DNA and protein sequences used in the manuscript should be provided in the Experimental Section section. Please also read the Guidelines for Deposition of Sequences and of Expression Data Equations: If you are using Word, please use either the Microsoft Equation Editor or the MathType add-on in your paper. Equations should be editable by the editorial office and not appear in a picture format. Supplementary Materials and Research Data: To maintain the transparency and reproducibility of research results, authors are encouraged to make their experimental and research data openly available either by depositing into data repositories or by publishing the data and files as "Supplementary Materials". Large datasets and files should be deposited in specialized data repositories. Small datasets, spreadsheets, images, video sequences, conference slides, software source code, etc. can be uploaded as "Supplementary Files" during the manuscript submission process. The supplementary files will also be made available to the referees during the peer-review process and be published online alongside the manuscript. Please read the information about Supplementary Materials and Data Deposit for additional guidelines.

Front Matter These sections should appear in all manuscript types

135

Title: The title of your manuscript should be concise, specific and relevant. When gene or protein names are included, the abbreviated name rather than full name should be used. Author List and Affiliations: Authors' full first and last names must be provided. The initials of any middle names can be added. The PubMed/MEDLINE standard format is used for affiliations: complete address information including city, zip code, state/province, country, and all email addresses. At least one author should be designated as corresponding author, and his or her email address and other details should be included at the end of the affiliation section. Please read the criteria to qualify for authorship. Abstract: The abstract should be a total of about 200 words maximum. The abstract should be a single paragraph and should follow the style of structured abstracts, but without headings: 1) Background: Place the question addressed in a broad context and highlight the purpose of the study; 2) Methods: Describe briefly the main methods or treatments applied; 3) Results: Summarize the article's main findings; and 4) Conclusion: Indicate the main conclusions or interpretations. The abstract should be an objective representation of the article: it must not contain results which are not presented and substantiated in the main text and should not exaggerate the main conclusions. Keywords: Three to ten pertinent keywords need to be added after the abstract. We recommend that the keywords are specific to the article, yet reasonably common within the subject discipline. Research Manuscript Sections Introduction: The introduction should briefly place the study in a broad context and highlight why it is important. It should define the purpose of the work and its significance. The current state of the research field should be reviewed carefully and key publications should be cited. Please highlight controversial and diverging hypotheses when necessary. Finally, briefly mention the main aim of the work and highlight the main conclusions. As far as possible, please keep the introduction comprehensible to scientists outside your particular field of research. Results: This section may be divided by subheadings. It should provide a concise and precise description of the experimental results, their interpretation as well as the experimental conclusions that can be drawn. Discussion: This section may be divided by subheadings. Authors should discuss the results and how they can be interpreted in perspective of previous studies and of the working hypotheses. The findings and their implications should be discussed in the broadest context possible. Future research directions may also be highlighted. Experimental Section: This section should be divided by subheadings. Materials and Methods should be described with sufficient details to allow others to replicate and build on published results. Please note that publication of your manuscript implies that you must make all materials, data, and protocols associated with the publication available to readers. Give the name and version of any software used. Please disclose at the submission stage any restrictions on the availability of

136 materials or information. New methods and protocols should be described in detail while well-established methods can be briefly described and appropriately cited. Research manuscripts reporting large datasets that are deposited in a publicly available database should specify where the data have been deposited and provide the relevant accession numbers. If the accession numbers have not yet been obtained at the time of submission, please state that they will be provided during review. They must be provided prior to publication. Conclusions: This section is not mandatory, but can be added to the manuscript if the discussion is unusually long or complex. Supplementary Materials: This section should be included when supplementary information is published online alongside the manuscript. Please indicate the name and title of each supplementary file as follows Figure S1: title, Table S1: title, etc.

Back Matter Acknowledgments: All sources of funding of the study should be disclosed. Please clearly indicate grants that you have received in support of your research work. Clearly state if you received funds for covering the costs to publish in open access. Note that some funders will not refund article processing charges (APC) if the funder and grant number are not clearly identified in the paper. Funding information can be entered separately into the submission system by the authors during submission of their manuscript. Such funding information, if available, will be deposited to FundRef if the manuscript is finally published. Authors must have obtained specific permission from individuals and institutions to mention their names in the Acknowledgements. Author Contributions: For research articles with several authors, a short paragraph specifying their individual contributions must be provided. The following statements should be used "X and Y conceived and designed the experiments; X performed the experiments; Y analyzed the data; W contributed reagents/materials/analysis tools; Y wrote the paper." Authorship must be limited to those who have contributed substantially to the work reported. Please read the section concerning the criteria to qualify for authorship carefully. Conflicts of Interest: Authors must identify and declare any personal circumstances or interest that may be perceived as inappropriately influencing the representation or interpretation of reported research results. If there is no conflict of interest, please state "The authors declare no conflict of interest." Any role of the funding sponsors in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript, or in the decision to publish the results must be declared in this section. If there is no role, please state “The funding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results”. References: References must be numbered in order of appearance in the text (including tables and legends) and listed individually at the end of the manuscript.

137

We recommend preparing the references with a bibliography software package, such as EndNote, ReferenceManager or Zotero to avoid typing mistakes and duplicated references. Citations and References in Supplementary files are permitted provided that they also appear in the main text and in the reference list. In the text, reference numbers should be placed in square brackets [ ], and placed before the punctuation; for example [1], [1–3] or [1,3]. For embedded citations in the text with pagination, use both parentheses and brackets to indicate the reference number and page numbers; for example [5] (p. 10). or [6] (pp. 101–105). The Reference list should include the full title as recommended by the ACS style guide. The style file for endnote, MDPI.ens, can be found at http://endnote.com/downloads/style/mdpi References should be described as follows depending on the type of work: Journal Articles: 1. Author 1, A.B.; Author 2, C.D. Title of the article. Abbreviated Journal Name Year, Volume, page range, DOI or other identifier. Available online: URL (accessed on Day Month Year). Books and Book Chapters: 2. Author 1, A.; Author 2, B. Book Title, 3rd ed.; Publisher: Publisher Location, Country, Year; pp. 154–196. 3. Author 1, A.; Author 2, B. Title of the chapter. In Book Title, 2nd ed.; Editor 1, A.; Editor 2, B., Eds.; Publisher: Publisher Location, Country, Year; Volume 3, pp. 154–196. Unpublished work, submitted work, personal communication: 4. Author 1, A.B.; Author 2, C. Title of Unpublished Work. status (unpublished; manuscript in preparation). 5.Author 1, A.B.; Author 2, C. Title of Unpublished Work. Abbreviated Journal Name stage of publication (under review; accepted; in press). 6.Author 1, A.B. (University, City, State, Country); Author 2, C. (Institute, City, State, Country). Personal communication, Year. Conference Proceedings: 7. Author 1, A.B.; Author 2, C.D.; Author 3, E.F. Title of Presentation. In Title of the Collected Work (if available), Proceedings of the Name of the Conference, Location of Conference, Country, Date of Conference; Editor 1, Editor 2, Eds. (if available); Publisher: City, Country, Year (if available); Abstract Number (optional), Pagination (optional). Thesis: 8. Author 1, A.B. Title of Thesis. Level of Thesis, Degree-Granting University, Location of University, Date of Completion. Websites: 9.Title of Site. Available online: URL (accessed on Day Month Year). Unlike published works, websites may change over time or disappear, so we encourage you create an archive of the cited website using a service such as WebCite. Archived websites should be cited using the link provided as follows:

138

10. Title of Site. URL (archived on Day Month Year). See the Reference List and Citations Guide for more detailed information. Preparing Figures, Schemes and Tables All figure files should be separately uploaded during submission. Figures and schemes must be provided at a sufficiently high resolution (minimum 1000 pixels width/height, or a resolution of 300 dpi or higher). All Figure file formats are accepted. However, TIFF, JPEG, EPS and PDF files are preferred. IJMS can publish multimedia files in articles or as supplementary materials. Please get in touch with the Editorial office for further information. All Figures, Schemes and Tables should also be inserted into the main text close to their first citation and must be numbered following their number of appearance (Figure 1, Scheme I, Figure 2, Scheme II, Table 1, etc.). All Figures, Schemes and Tables should have a short explanatory title and a caption. All table columns should have an explanatory heading. To facilitate the copy- editing of larger tables, smaller fonts may be used, but in no less than 8 pt. in size. Authors should use the Table option of Microsoft Word to create tables. For multi-panel figures, the file must contain all data in one file. For tips on creating multi-panel figures, please read the helpful advice provided by L2 Molecule. Authors are encouraged to prepare figures and schemes in color (RGB at 8-bit per channel). Full color graphics will be published free of charge.

Qualification for Authorship

Authorship must include and be strictly limited to researchers who substantially contributed to the design of the study, the production, analysis, or interpretation of the results, and/or preparation of the manuscript. Those who contributed to the work but do not qualify for authorship should be listed in the acknowledgments. More detailed guidance on authorship is given by the International Council of Medical Journal Editors (ICMJE). The journal also adheres to the standards of the Committee on Publication Ethics (COPE) that "all authors should agree to be listed and should approve the submitted and accepted versions of the publication. Any change to the author list should be approved by all authors including any who have been removed from the list. The corresponding author should act as a point of contact between the editor and the other authors and should keep co-authors informed and involve them in major decisions about the publication (e.g. answering reviewers’ comments)." [1]

Wager, E.; Kleinert, S. Responsible research publication: international standards for authors. A position statement developed at the 2nd World Conference on Research Integrity, Singapore, July 22-24, 2010. In Promoting Research Integrity in a Global Environment; Mayer, T., Steneck, N., eds.; Imperial College Press / World Scientific Publishing: Singapore; Chapter 50, pp. 309-16.

139

Potential Conflicts of Interest

It is the authors' responsibility to identify and declare any personal circumstances or interests that may be perceived as inappropriately influencing the representation or interpretation of clinical research. If there is no conflict, please state "The authors declare no conflict of interest". This should be conveyed in a separate "Conflicts of Interest" section preceding the "References" sections at the end of the manuscript. Financial support for the study must be fully disclosed in the "Acknowledgments" section.

Editorial Procedures and Peer-Review

Initial Checks All submitted manuscripts received by the Editorial Office will be checked by a professional in-house Managing Editor to determine whether it is properly prepared and whether the manuscript follows the ethical policies of the journal, including those for human and animal experimentation. Manuscripts that do not fit the journals ethical policy will be rejected before peer-review. Manuscripts that are not properly prepared will be returned to the authors for revision and resubmission. After these checks, the Managing Editor will consult the journals’ Editor-in-Chief or the Guest Editor (or an Editorial Board member in case of a conflict of interest) to determine whether the manuscript fits the scope of the journal and whether it is scientifically sound. No judgment on the significance or potential impact of the work will be made at this stage. Reject decisions at this stage will be verified by the Editor-in-Chief.

Peer-Review Once a manuscript passes the initial checks, it will be assigned to at least two independent experts for peer-review. A single-blind review is applied, where authors' identities are known to reviewers. Peer review comments are confidential and will only be disclosed with the express agreement of the reviewer.

In the case of regular submissions, in-house assistant editors will invite experts, including recommendations by an academic editor. These experts may also include Editorial Board members and Guest Editors of the journal. In the case of a special issue, the Guest Editor will advise in the selection of reviewers. Potential reviewers suggested by the authors may also be considered. Reviewers should not have published with any of the co-authors during the past five years and should not currently work or collaborate with one of the institutes of the co- authors of the submitted manuscript.

Editorial Decision and Revision

140

Based on the comments and advice of the peer-reviewers, an external editor – usually the Editor-in-Chief or a Guest Editor – will make a decision to accept, reject, or to ask authors to revise the manuscript.

For Minor Revisions the authors will have one week to resubmit their revised manuscript. For Major Revisions the authors will have two weeks to resubmit their revised manuscript. However, authors should contact the editorial office if extended revision time is anticipated.

Author Appeals Authors may appeal a rejection by sending an e-mail to the Editorial Office of the journal. The appeal must provide a detailed justification, including point-by-point responses to the reviewers' and/or Editor's comments. The Managing Editor of the journal will forward the manuscript and relating information (including the identities of the referees) to an Editorial Board member who was not involved in the initial decision-making process. If no appropriate Editorial Board member is available, the editor will identify a suitable external scientist. The Editorial Board member will be asked to give an advisory recommendation on the manuscript and may recommend acceptance, further peer-review, or uphold the original rejection decision. A reject decision at this stage will be final and cannot be revoked.

In the case of a special issue, the Managing Editor of the journal will forward the manuscript and relating information (including the identities of the referees) to the Editor-in-Chief who will be asked to give an advisory recommendation on the manuscript and may recommend acceptance, further peer-review, or uphold the original rejection decision. A reject decision at this stage will be final and cannot be revoked.

Production and Publication Once accepted, the manuscript will undergo professional copy-editing, English editing, proofreading by the authors, final corrections, pagination, and, publication on the www.mdpi.com website.

Suggesting Reviewers

During the submission process, authors are pre encouraged to list five names of potential reviewers with the appropriate expertise to review the manuscript. The editors will not necessarily approach these referees. Please provide detailed contact information (address, homepage, phone, e-mail address). The proposed referees should neither be current collaborators of the co-authors nor have published with any of the co-authors of the manuscript within the last five years. Proposed reviewers should be from different institutions to the authors. You may identify appropriate Editorial Board members of the journal as potential reviewers.

141

You may also suggest reviewers from among the authors that you frequently cite in your paper.

English Corrections

This journal is published in English. To facilitate proper peer-reviewing of your manuscript, it is essential that it is submitted in grammatically correct English. If you are not a native English speaker, we strongly recommend that you have your manuscript professionally edited before submission or read by a native English- speaking colleague. Professional editing will mean that reviewers and future readers are better able to read and assess the content of your manuscript. For additional information see the English Editing Guidelines for Authors.

Publication Ethics Statement

IJMS is a member of the Committee on Publication Ethics (COPE). We fully adhere to its Code of Conduct and to its Best Practice Guidelines.

The editors of this journal take the responsibility to enforce a rigorous peer-review process together with strict ethical policies and standards to ensure to add high quality scientific works to the field of scholarly publication. Unfortunately, cases of plagiarism, data falsification, image manipulation, inappropriate authorship credit, and the like, do arise. The editors of IJMS take such publishing ethics issues very seriously and are trained to proceed in such cases with a zero tolerance policy.

Authors wishing to publish their papers in IJMS are asked to abide to the following rules:

Any facts that might be perceived as a possible conflict of interest of the author(s) must be disclosed in the paper prior to submission. Authors should accurately present their research findings and include an objective discussion of the significance of their findings. Data and methods used in the research need to be presented in sufficient detail in the paper, so that other researchers can replicate the work. Raw data should preferably be publicly deposited by the authors before submission of their manuscript. Authors need to at least have the raw data readily available for presentation to the referees and the editors of the journal, if requested. Authors need to ensure appropriate measures are taken so that raw data is retained in full for a reasonable time after publication. Simultaneous submission of manuscripts to more than one journal is not tolerated. Republishing content that is not novel is not tolerated (for example, an English translation of a paper that is already published in another language will not be accepted).

142

If errors and inaccuracies are found by the authors after publication of their paper, they need to be promptly communicated to the editors of this journal so that appropriate actions can be taken. Please refer to our policy regarding publication of publishing addenda and corrections. Your manuscript should not contain any information that has already been published. If you include already published figures or images, please obtain the necessary permission from the copyright holder to publish under the CC-BY license. Plagiarism, data fabrication and image manipulation are not tolerated. Plagiarism is not acceptable in IJMS submissions. Plagiarism includes copying text, ideas, images, or data from another source, even from your own publications, without giving any credit to the original source.

Reuse of text that is copied from another source must be between quotes and the original source must be cited. If a study's design or the manuscript's structure or language has been inspired by previous works, these works must be explicitly cited.

If plagiarism is detected during the peer review process, the manuscript may be rejected. If plagiarism is detected after publication, we may publish a correction or retract the paper.

Image files must not be manipulated or adjusted in any way that could lead to misinterpretation of the information provided by the original image. Irregular manipulation includes: 1) introduction, enhancement, moving, or removing features from the original image; 2) grouping of images that should obviously be presented separately (e.g., from different parts of the same gel, or from different gels); or 3) modifying the contrast, brightness or color balance to obscure, eliminate or enhance some information.

If irregular image manipulation is identified and confirmed during the peer review process, we may reject the manuscript. If irregular image manipulation is identified and confirmed after publication, we may correct or retract the paper.

Our in-house editors will investigate any allegations of publication misconduct and may contact the authors' institutions or funders if necessary. If evidence of misconduct is found, appropriate action will be taken to correct or retract the publication. Authors are expected to comply with the best ethical publication practices when publishing with MDPI.

Supplementary Materials and Data Deposit

143

In order to maintain the integrity, transparency and reproducibility of research records, and to retain important chemical and structural information, authors are strongly encouraged to make their experimental and research data openly available either by depositing into data repositories or by publishing the data and files as supplementary information in this journal. Additional data and files can be uploaded as "Supplementary Files" during the manuscript submission process. The supplementary files will also be available to the referees as part of the peer- review process, although referees are not specifically asked to review these files. Accepted file formats include (but are not limited to): spectral data (NMR, IR, Raman, ESR, etc.) in JCAMP (JDX) format 3D coordinate structures (in PDB, MOL, XYZ or other common format) crystallographic information (in CIF format) data tables and spreadsheets (text files, MS Excel, OpenOffice, CSV, XML, etc.) text documents (text files, PDF, MS Word, OpenOffice, etc.; text documents will usually be converted to PDF files for publication) images (JPEG, PNG, GIF, TIFF, BMP, etc.) videos (AVI, MPG, QuickTime, etc.) executables (EXE, Java, etc.) software source code Citations and References in Supplementary files are permitted provided that they also appear in the main text and in the reference list.

Large data sets and files should be deposited to specialized service providers (such as Figshare) or institutional/subject repositories, preferably those that use the DataCite mechanism. For a list of specialized repositories for the deposit of scientific and experimental data, please consult databib.org or re3data.org. The data repository name, link to the data set (URL) and accession number, doi or handle number of the data set must be provided in the paper. The journal Data (ISSN 2306-5729) also accepts submissions of data set papers, and the publication of small data sets along with the paper, and/or software source codes is encouraged.

Guidelines for Deposition of Sequences and of Expression Data

New sequence information must be deposited to the appropriate database prior to submission of the manuscript. Accession numbers provided by the database should be included in the submitted manuscript. Manuscripts will not be published until the accession number is provided.

New nucleic acid sequences must be deposited in one of the following databases: GenBank, EMBL, or DDBJ. Sequences should be submitted to only one database.

144

New high throughput sequencing (HTS) datasets(RNA-seq, ChIP-Seq, degradome analysis, …) must be deposited either in the GEO database or in the NCBI’s Sequence Read Archive. New microarray data must be deposited either in GEO or ArrayExpress databases. The "Minimal Information About a Microarray Experiment" (MIAME) guidelines published by the Microarray Gene Expression Data Society must be followed. New protein sequences obtained by protein sequencing must be submitted to UniProt (submission tool SPIN). All sequence names and the accession numbers provided by the databases should be provided in the Materials and Methods section of the article.

Research Ethics Guidelines

1. Research Involving Animals

The editors will require that the benefits potentially derived from any research causing harm to animals are significant in relation to any suffering endured by animals, and that procedures followed are unlikely to cause offense to the majority of readers. Authors should particularly ensure that their research complies with the commonly-accepted '3Rs':

Replacement of animals by alternatives wherever possible, Reduction in number of animals used, and Refinement of experimental conditions and procedures to minimize the harm to animals. Any experimental work must be conducted in accordance with relevant national legislation on the use of animals for research. Authors should follow the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines (http://www.nc3rs.org.uk/page.asp?id=1357) for reporting experiments using live animals. Authors may use the ARRIVE guidelines as a checklist (www.nc3rs.org.uk/ARRIVEchecklist).

An approval from an ethics committee must be obtained before undertaking the research. The project identification code, date of approval and name of the ethics committee or institutional review board should be cited in the Methods section.

Editors reserve the rights to reject any submission that does not meet these requirements.

An example of Ethical Statements:

The animal protocols used in this work were evaluated and approved by the Animal Use and Ethic Committee (CEUA) of the Institute Pasteur Montevideo

145

(Protocol 2009_1_3284). They are in accordance with FELASA guidelines and the National law for Laboratory Animal Experimentation (Law no. 18.611).

2. Research Involving Human Subjects

When reporting on research that involves human subjects, human material, human tissues or human data, authors must declare that the investigations were carried out following the rules of the Declaration of Helsinki of 1975 (http://www.wma.net/en/30publications/10policies/b3/), revised in 2008. According to point 23 of this declaration, an approval from an ethics committee should have been obtained before undertaking the research. As a minimum, a statement including the project identification code, date of approval and name of the ethics committee or institutional review board should be cited in the Methods Section of the article. Data relating to individual participants must be described in detail, but private information identifying participants need not be included unless the identifiable materials are of relevance to the research (for example, photographs of participants’ faces that show a particular symptom). A written informed consent for publication must be obtained from participating patients in this case.

Editors reserve the rights to reject any submission that does not meet these requirements.

Example of Ethical Statements:

All subjects gave their informed consent for inclusion before they participated in the study. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of XXX (Project identification code).

3. Research Involving Cell Lines

Methods sections for submissions reporting on research with cell lines should state the origin of any cell lines. For established cell lines the provenance should be stated and references must also be given to either a published paper or to a commercial source. If previously unpublished de novo cell lines were used, including those gifted from another laboratory, details of institutional review board or ethics committee approval must be given, and confirmation of written informed consent must be provided if the line is of human origin.

An example of Ethical Statements:

The HCT116 cell line was obtained from XXXX. The MLH1+ cell line was provided by XXXXX, Ltd. The DLD-1 cell line was obtained from Dr. XXXX. The DR-GFP

146 and SA-GFP reporter plasmids were obtained from Dr. XXX and the Rad51K133A expression vector was obtained from Dr. XXXX.

4. Research Involving Plants

Experimental research on plants (either cultivated or wild) including collection of plant material, must comply with institutional, national, or international guidelines. We recommend that authors comply with the Convention on Biological Diversity and the Convention on the Trade in Endangered Species of Wild Fauna and Flora.

For each submitted manuscript supporting genetic information and origin must be provided. For research manuscripts involving rare and non-model plants (other than, e.g., Arabidopsis thaliana, Nicotiana benthamiana, Oriza sativa, or many other typical model plants), voucher specimens must be deposited in an accessible herbarium or museum. Vouchers may be requested for review by future investigators to verify the identity of the material used in the study (especially if taxonomic rearrangements occur in the future). They should include details of the populations sampled on the site of collection (GPS coordinates), date of collection, and document the part(s) used in the study where appropriate. For rare, threatened or endangered species this can be waived but it is necessary for the author to describe this in the cover letter.

Editors reserve the rights to reject any submission that does not meet these requirements.

An example of Ethical Statements:

Torenia fournieri plants were used in this study. White-flowered Crown White (CrW) and violet-flowered Crown Violet (CrV) cultivars selected from ‘Crown Mix’ (XXX Company, City, Country) were kindly provided by Dr. XXX (XXX Institute, City, Country).

Arabidopis mutant lines (SALKxxxx, SAILxxxx,…) were kindly provided by Dr. XXX , institute, city, country).

147

Normas da Revista Entomological Science

Author Guidelines

Authors wishing to submit to Entomological Science should read these instructions carefully before preparing their manuscripts. They are also recommended to consult the following reference: Scientific Style and Format: The CBE Manual for Authors, Editors, and Publishers, Eighth Edition, CBE Style Manual Committee, 1994, Cambridge University Press (http://www.scientificstyleandformat.org/Home.html).

AIMS AND SCOPE

Entomological Science is the official English language journal of the Entomological Society of Japan. The Journal publishes original research papers and reviews from any entomological discipline or from directly allied field in ecology, behavioral biology, physiology, biochemistry, development, genetics, systematics, morphology, evolution and general entomology. Papers of applied entomology will be considered for publication if they significantly advance the field of entomological science in the opinion of the Editors and Editorial Board.

ONLINE SUBMISSION Authors should submit their manuscripts to Entomological Science online to facilitate even quicker and more efficient processing. Please log onto the sitedirectly at: http://mc.manuscriptcentral.com/ens

All manuscripts submitted to the Journal must comply with these Author Guidelines. Failure to do so will result in return of the manuscript and possible delay in publication.

Manuscripts should be written so that they are intelligible to the professional reader who is not a specialist in the particular field. They should be written in English, in a clear, concise, direct style. Where contributions are judged as acceptable for publication on the basis of scientific content, the Editor and the Publisher reserve the right to modify typescripts to eliminate ambiguity and repetition and improve communication between author and reader.

Pre-submission English-language editing Authors for whom English is a second language may choose to have their manuscript professionally edited before submission. A list of independent suppliers of editing services can be found at http://authorservices.wiley.com/bauthor/english_language.asp. All services should be paid for and arranged by the author, and the use of these services does not guarantee acceptance or preference for publication.

MANUSCRIPT CATEGORIES AND STANDARD Manuscripts may be submitted as research papers or review articles. Research papers should be the product of original scientific research or observation, and are

148 classed as either Original Articles or Short Communications. Short Communications should have the main body of the text (excepting title, authors’ information, abstract, key words, acknowledgments and reference list) no longer than three printed pages (one page approximately equivalent to 770 words or 5100 letters including spaces of solid text).

All manuscripts, including short communications, should include a discussion of the significance of the results and their relationship to other work, and will be reviewed by at least two referees. Manuscripts will be considered for publication only if they have not been published or submitted for publication elsewhere.

MAIN DOCUMENT OF MANUSCRIPT

File formats and page settings Manuscripts must be on A4 size pages, in 12 pt font size, with 24 to 28 lines per page. The manuscript has to be submitted as Microsoft Word or Rich Text Format.

A submission template in Microsoft Word is available for Original Article and Short Communication.

Manuscript composition The manuscript should start with the title of the paper, followed by the names of the authors, the addresses of the institutions at which the work was carried out, an abstract, key words and the main body of text. The abstract should be a concise summary (250 words or fewer) of the manuscript's significant content. There should be three to seven key words, which should not duplicate words in the title and should be arranged in alphabetical order, and preferably include the order and family names of the major organism(s) considered, if not appearing in the title.

The IMRAD format ("Introduction", "Materials and methods", "Results" and "Discussion") is recommended for Original Articles, although following this format is at the author's discretion. The main body of text in Short Communications should not be divided into sections with headings.

Character and paragraph formats Words to be italicized should be typed in italics but should not be underlined, and capitalization should be avoided in all cases except for headings, abbreviations of depositories and/or institutions, and technical terms. Hard returns should be used only at the end of a paragraph and words should not be hyphenated. Other formatting, such as headings and subheadings, should follow that in the latest issue of Entomological Science.

Units and numeric values Measurements should be expressed in units of SI (International System of Units). A space should be inserted between number and unit except ˚C and %., and before and after =, ±, and so on. Numbers between one and ten in the main body of the text should be written in full except dates, the numbering of figures, numbers accompanying metrical units (such as mm, m, km, mg, g, kg, s, min and h), and numbers used in taxonomic descriptions. Numbers greater than ten should be

149 written as numerals. Numbers greater than 1000 should not include any thousand separators. Fractions should be written as decimals.

Scientific names All papers must conform to the latest edition of the International Code of Zoological Nomenclature. The first mention of an animal should include the full scientific name with the authority and, particularly in taxonomic papers, the year of publication. The authority and the year of publication should be separated by a comma. Genus names should not be abbreviated at the beginning of a sentence.

Research permits If the research was carried out in areas for which research permits are necessary (e.g. nature reserves) or if it deals with organisms for which collection or import/export permits are required, the authors must clearly detail obtaining these permits in the acknowledgments paragraph.

Taxonomic papers In taxonomic papers, type specimens must be clearly designated and type depositories must be clearly indicated. Authors are required to deposit the name- bearing type material in an internationally recognized institution (not in private collections). For the number of segment, Roman numerals (e.g. tergum X) should be used. Body part terms specific to a given taxon should be explained in the "MATERIALS AND METHODS" or be indicated in figures. The second couplets of the key should start with a dash only (‒). The list of specimens examined should be as compact as possible; for example, "Specimens examined. Japan: 1♀ (IUNH), Mito, 26.xi.2004, J. Kojima; 3♂2♀ (IUNH), . . ." The holotypes (or other name-bearing types) and paratypes (or paralectotypes) are listed separately, and full label data should be given for the name-bearing types in quotation marks when they are designated in the paper. All publications including new nomenclatural acts will be registered to ZooBank by the Editorial Office before online publication.

Acknowledgments Acknowledgments should be typed in a single paragraph headed "ACKNOWLEDGMENTS", directly preceding the "REFERENCES" section. The source of financial grants and other funding must be acknowledged, including a frank declaration of the authors' industrial links and affiliations. The contribution of colleagues or institutions should also be acknowledged. Personal thanks and thanks to editors and anonymous reviewers are not appropriate.

REFERENCES The Harvard (author/date) system of referencing should be used. In the text, give the author's name followed by the year in parentheses: Smith (2000). If there are two authors, use 'and': Smith and Jones (2001); but if cited within parentheses use '&': (Smith & Jones 2001). When reference is made to a work by three or more authors, the first name followed by et al. should be used: MacDonald et al. (2002). Multiple references within the same parentheses should be chronologically ordered and be separated with semicolon. In taxonomic papers references in synonymic lists should be cited in the following style: Drosophila melanogaster Meigen, 1830: 85; Kikkawa & Peng, 1938: 534.

150

In the reference list, references should be listed in alphabetical order of the first authors. The order of references of the same first author is as follows: (1) single- authored references should be chronologically ordered; (2) references of two authors should be listed in alphabetical order of the second author; (3) references of three or more authors should be chronologically ordered (those of the same year should be discriminated by adding a letter of ‘a’, ‘b’, …, even though co- authors are different). Cite the names of all authors (or editors) when there are six or fewer; when seven or more, list the first three followed by et al. Do not use ibid. or op cit. The title of the cited work should be given in full and journal titles should not be abbreviated. Reference to unpublished data and personal communications should be avoided if at all possible, but if absolutely necessary should be cited in the text only, e.g. (A. Smith, unpubl. data, 2000). All other citations in the text (including synonymic lists), tables and figures must be listed in the reference list.

Journal articles with sequential page numbers of volume Atkinson WD, Shorrocks B (1984) Aggregation of larval Diptera ... for coexistence. American Naturalist 124, 336‒351. (Use a ‘dash’ but not ‘hyphen’ as the connector of page numbers.)

Journal articles without sequential page numbers of volume Sugime Y, Ogawa K, Watanabe D, Shimoji H, Koshikawa S, Miura T (2015) Expansion of presoldier cuticle contributes to head elongation during soldier differentiation in termites. The Science of Nature 102, Article ID 71. DOI: 10.1007/s00114-015-1322-3

Journal articles published online in early view Kohyama TI, Matsubayashi KW, Katakura H (2015) Heterospecific sperm reduction in interspecific crosses between two closely related phytophagous ladybird beetles, Henosepilachna vigintioctomaculata and H. pustulosa (Coleoptera: Coccinellidae). Entomological Science. Published online: 4 Dec 2015; DOI: 10.1111/ens.12159

Books Gerson U, Simley R (1990) Acarine Biocontrol Agents: An Illustrated Key and Manual. Chapman and Hall, London.

Chapter in a book Weis AE (1992) Plant variation ... herbivore performance. In: Fritz RS, Simms EL (eds) Plant ... and Pathogens, pp 140‒171. University of Chicago Press, Chicago, IL.

Title in English but text in a language other than English Matsuura M (1995) Social Wasps of Japan in Color. Hokkaido University Press, Sapporo. (In Japanese.)

Title translated by the author(s) into English Tanaka A (1990) [Feeding Habits of Diptera]. Hokuryukan, Tokyo. (In Japanese.)

Software

151

Sorenson MD, Franzosa EA (2007) TreeRot, Version 3. Boston University, Boston, MA. Available from URL: http://people.bu.edu/msoren/TreeRot.html

Database Japanese Ant Database Group (2003) Japanese Ant Image Database 2003 [updated 19 Oct 2006; cited 15 Dec 2015]. Available from URL: http://ant.edb.miyakyo-u.ac.jp/E/index.html

We recommend the use of a tool such as Reference Manager for reference management and formatting. Reference Manager reference styles can be searched for here: http://www.refman.com/support/rmstyles.asp

TABLES AND FIGURES

Tables and figures should be limited to those required for clear communication and must be referred to: in the text, Table 1, Tables 1 and 2, Tables 1‒3, Figure 1, Figures 1 and 2, Figures 1‒3; within parentheses, (Table 1), (Tables 1,2), (Tables 1‒3), (Fig. 1), (Fig. 1A), (Fig. 1A,B), (Figs 1,2), (Figs 1A,2A), (Figs 1‒3). The same data should not be presented in both table and figure formats. Each table should be typed with title (one sentence) and footnotes (if necessary) on a separate page (or multiple pages if required) at the end of main text or as a separate file, and be numbered in sequence with Arabic characters. In electronic files, tables should be prepared in editable formats of MS Word or Excel; pasted images are not acceptable.

All illustrations, including photographs, graphs and maps are treated as figures, even if they are arranged in plates. Figures should be arranged in size no larger than 170 x 220 mm and, if possible, they should be sized to fit within a single column (up to 80 mm) or full text width (up to 170 mm) in order to utilize the paper layout. Publication of color figures is free of charge. Authors may be asked to restructure the figures in plate by order of Editors if some are considered to be smaller.

All lettering in the figures, where possible, should be in 'Arial' font and 12 pt or bigger.

The degree of magnification used should be indicated by means of a scale line.

Figure legends should be included with the main text of the manuscript, after the references on separate page(s).

For digital figure files format, 300 dpi TIFF in halftone images and EPS or 800 dpi TIFF in line arts or combination figures are recommended. If the provided files are too low in resolution or are problematic, authors may be asked for a resupply after acceptance.

Wiley websites for authors also provide detailed information on the preparation and submission of articles at http://authorservices.wiley.com/bauthor/journal.asp, and figures at http://authorservices.wiley.com/bauthor/illustration.asp

152

Supporting Information Authors are welcome to submit additional ”Supporting Information”, such as data sets or additional figures or tables. This material will not be published in the print edition of the journal but it will be viewable via the online edition. Only material that is a valuable addition to the article should be included. Such supporting information should be referred to in the text as, for example,”see Table S1”. Supporting files are hosted by the Publisher in the format supplied by the author and are not copy-edited by the Publisher. It is the responsibility of the author to supply supporting information in an appropriate file format and to ensure that it is accurate and correct. Prior to publication, authors will be sent the URL of their Supporting Information for them to check the content. Extensive editing of material is not possible at this stage and the author has the responsibility to ensure that material is sent in a correct form at the time of submission.

Authors should include a ”Supporting Information” section immediately after their References section, which should be in the following form:

SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher’s web-site:

Appendix S1 Characters used for the parsimony analysis. Table S1 A list of species studied. Figure S1 Holotype and allotype of Drosophila (Siphlodora) pengi.

Please note: Wiley is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

For information on how to submit files, please click Here.

PUBLICATION ETHICS GUIDELINES Entomological Science is committed to integrity in scientific research and recognizes the importance of maintaining the highest ethical standards. Please find the following Best Practice Guidelines on Publication Ethics. Further information at http://publicationethics.org/

English: http://authorservices.wiley.com/bauthor/publicationethics.asp Chinese: http://authorservices.wiley.com/bauthor/PublicationEthic_Simplified_Chinese_low. pdf Japanese: http://authorservices.wiley.com/bauthor/Publication_Ethics_Bklt_jap.pdf

All submitted manuscripts are screened for possible plagiarism with the detection tool CrossCheck, which compares submitted manuscript against a database of published papers (as well as web pages) and reports the extent of similarity to previously published works.

PAGE CHARGES

153

It is Journal policy that a page charge fee is levied on articles appearing in the Journal that are in excess of 16 printed pages for Original Articles and unsolicited Review Articles. No page charge is applied to Invited Review Articles.

MEMBERS (The Entomological Society of Japan) at least one author of the article: For manuscripts exceeding this limit a page charge of ¥8 000/US$65 per each additional page is levied.

NON-MEMBERS:For manuscripts exceeding this limit a page charge of ¥12 000/US$100 per each additional page is levied. This procedure notwithstanding, no paper will be rejected or given extraordinary treatment on any basis other than its scientific merit. Any articles received by Wiley with page charges will not be published until the form has been returned.

Membership in The Entomological Society of Japan is open to anyone who has interest in entomology. Please visit the society's website at: http://www.entsoc.jp

Accepted papers will be passed to Wiley’s production team for publication. The author identified as the formal corresponding author for the paper will receive an email prompting them to login into Wiley’s Author Services, where via the Wiley Author Licensing Service (WALS) they will be asked to complete an electronic license agreement on behalf of all authors on the paper.

Authors may choose to publish under the terms of the journal’s standard copyright transfer agreement (CTA), or under open access terms made available via Wiley OnlineOpen.

Standard Copyright Transfer Agreement: FAQs about the terms and conditions of the standard CTA in place for the journal, including standard terms regarding archiving of the accepted version of the paper, are available at: Copyright Terms and Conditions FAQs.

Note that in signing the journal’s licence agreement authors agree that consent to reproduce figures from another source has been obtained.

OnlineOpen – Wiley’s Open Access Option: OnlineOpen is available to authors of articles who wish to make their article freely available to all on Wiley Online Library under a Creative Commons license. With OnlineOpen, the author, the author's funding agency, or the author's institution pays a fee to ensure that the article is made open access. Authors of OnlineOpen articles are permitted to post the final, published PDF of their article on their personal website, and in an institutional repository or other free public server immediately after publication. All OnlineOpen articles are treated in the same way as any other article. They go through the journal's standard peer-review process and will be accepted or rejected based on their own merit.

ESJ member discount on OnlineOpen fee is available from 2016 when one of authors of an article in Entomological Science is the society member. For further

154 information and the discount code, please contact the editorial office at ent- [email protected]

OnlineOpen licenses. Authors choosing OnlineOpen retain copyright in their article and have a choice of publishing under the following Creative Commons License terms: Creative Commons Attribution License (CC BY); Creative Commons Attribution Non-Commercial License (CC BY NC); Creative Commons Attribution Non-Commercial-NoDerivs License (CC BY NC ND). To preview the terms and conditions of these open access agreements please visit the Copyright Terms and Conditions FAQs.

Funder Open Access and Self-Archiving Compliance: Please click here for more information on Wiley’s compliance with specific Funder Open Access and Self Archiving Policies, and click here for more detailed information specifically about Self-Archiving definitions and policies.

PUBLICATION PROCESS AFTER ACCEPTANCE

Wiley’s Author Services

Author Services enables authors to track their article through the production process to publication online and in print. Authors can check the status of their articles online and choose to receive automated e-mails at key stages of production. The corresponding author will receive a unique link that enables them to register and have their article automatically added to the system. Please ensure that a complete e-mail address is provided when submitting the manuscript. Visit Author Services (https://authorservices.wiley.com/bauthor/default.asp) for more details on online production tracking and for a wealth of resources including FAQs and tips on article preparation, submission and more.

Proofs

Once the paper has been typeset the corresponding author will receive an e-mail alert containing instructions on how to provide proof corrections to the article. It is therefore essential that a working e-mail address is provided for the corresponding author. Proofs should be corrected carefully; responsibility for detecting errors lies with the author.

Early View

The journal offers rapid speed to publication via Wiley’s Early View service. Early View articles are complete full-text articles published online in advance of their publication in a printed issue. Early View articles are complete and final. They have been fully reviewed, revised and edited for publication, and the authors' final corrections have been incorporated. Because they are in final form, no changes can be made after online publication. Early View articles are given a Digital Object Identifier (DOI), which allows the article to be cited and tracked before allocation to an issue. After print publication, the DOI remains valid and can continue to be used to cite and access the article. More information about DOIs can be found at http://www.doi.org/faq.html.

155

POST ACCEPTANCE

Article PDF for authors

A PDF of the article will be made available to the corresponding author via Author Services.

Printed Offprints

Printed offprints may be ordered online for a fee. Please click on the following link and fill in the necessary details and ensure that you type information in all of the required fields: http://offprint.cosprinters.com/cos. If you have queries about offprints please e-mail: [email protected].

EDITORIAL OFFICE CONTACT DETAILS

Editorial Office of Entomological Science, Hokkaido University Museum, Hokkaido University, Kita Ku, Sapporo 060-0810 Japan Tel: +81-11-706-3739 Fax: +81-11-706-4029 Email: [email protected]

156

10.2 Anexo 2

A - Comprovante de submissão em Major Revisions do manuscrito (Capítulo I)

157

B - Comprovante de submissão do manuscrito (Capítulo III)

158

10.3 Anexo 3: Protocolos

1- Extração de DNA genômico por Fenol-Clorofórmio (Sambrook e Russel, 2001) com modificações

- Em tubo de 2 mL, macerar o tecido em 495 µL de solução de extração; - Deixar por 1 h em banho-maria por 50 °C; - Adicionar 5 µL de proteinase K e incubar por 1 h e 30 min, homogeneizando periodicamente; - Adicionar 500 µL de fenol-clorofórmio (1:1) e homogeneizar com movimentos rotatórios durante 15 min; - Centrifugar a 14000 rpm durante 17 min a 4° C; - Transferir camada superior para outro tubo de 2 mL; - Adicionar 0,2 x de NaCl 1 M do volume transferido e 2 x de etanol gelado a 100 % do volume transferido, homogeneizar suavemente para precipitar o DNA; - Centrifugar a 14000 rpm durante 17 min a 4 °C; - Descartar o sobrenadante (ver o pellet) e acrescentar cuidadosamente 375 µL de etanol gelado a 70 %, sem agitar; - Centrifugar a 14000 rpm durante 17 min a 4 °C; - Descartar o sobrenadante e secar em câmara de fluxo sob temperatura ambiente por 16 h; - Ressuspender o DNA com 50 µL de solução TE

2- Construção de Biblioteca Enriquecida em Microssatélites segundo Kijaset et al. (1994) com modificações de Billote et al., (1999)

Digestão do DNA - Em um tubo de 1,5 mL - 50 μL de Água MilliQ; - 10 μL de Tampão da enzima; - 10 μL de Espermidina (40 mM); - 5 μL de Enzima Afa I (10 u/μL); - 25 μL de DNA em uma concentração de 250 ng/μL; - Incubar por 3h a 37°C em estufa. Colocar metade do volume da enzima (2,5 μL), incubar por 1 h, colocar a outra metade de enzima e incubar por mais 2 h. - Observar fragmentos de 700 a 1200 pb em gel (Apêndice – Figura 1).

159

Ligação de adaptadores Em um tubo de 0,6 mL - 12 μL de Água MilliQ; - 5 μL de Tampão 5 X (Invitrogen); - 1,5 μL de primer Afa21 (10 μM); - 1,5 μL de primer Afa25 (10 μM); - 2 μL de T4 DNA ligase (Invitrogen) (1 u/μL); - 3 μL de DNA digerido; Incubar por 2 h a 20 °C em termociclador;

Pré-amplificação via PCR Em um tubo de 0,6 mL - 26 μL de Água MilliQ; - 5 μL de Tampão 10X;

- 3 μL de MgCl2 (25 mM) - 4 μL de dNTP (2,5 mM) - 2 μL de primer Afa21 (10 μM) - 5 μL de Taq DNA polimerase (3 U) - 5 μL da solução de Ligação - Ciclos: 95 °C 4 min, seguido de 20 ciclos (94 °C 30 s, 60 °C 1 min, 72 °C 1 min) e 72 °C por 8 min. - Observar bandas de 300 a 1200 pb em gel (Apêndice – Figura 2)

Purificação (Quiaquick PCR purification kit) - Purificar 40 μL (aproximadamente) utilizando o kit; - Adicionar 5 x volumes de tampão PB (kit) (200 μL aproximadamente) aos 40 μL de amostra de PCR e misturar; - Se a solução apresentar cor laranja ou violeta, adicionar 10 μL de acetato de sódio 3 M, pH 5.0 e misturar; - A solução deve se tornar amarela; - Colocar a coluna do kit em tubo coletor de 2 mL; - Aplicar a amostra na coluna e centrifugar por 1 min em rotação de 12000 a 13000 rpm;

160

- Descartar a solução do tubo coletor e colocar a coluna no mesmo tubo coletor. - Lavar adicionando 700 μL de tampão PE (kit) à coluna e centrifugar por 1 min em rotação de 12000 a 13000 rpm; - Descartar a solução do tubo coletor; - Colocar a coluna no mesmo tubo coletor; - Centrifugar por mais 1 min em rotação de 12000 a 13000 rpm para garantir que todo o etanol seja descartado; - Colocar a coluna em um tubo novo de 1,5 mL; - Adicionar à coluna 50 μL de água milliQ no centro da membrana e centrifugar por 1 min em rotação de 12000 a 13000 rpm; - Repetir o passo anterior para garantir a completa eluição do DNA ligado à coluna.

Seleção de fragmentos contendo microssatélites - Ressuspender 600 μL de esferas magnéticas por agitação; - Magnetizar e esperar 30 s; - Com cuidado, aspirar o sobrenadante; - Adicionar 300 μL de 0,5 x SSC, ressuspender, magnetizar, e descartar o sobrenadante; - Repetir a etapa anterior 3 vezes; - Ressuspender em 100 μL de 0,5 x SSC; - Misturar 400 μL de água MilliQ aos 100 μL de DNA purificado; - Incubar a 95 °C no banho-Maria por 15 min; - Adicionar 13 μL de 20 x SSC e depois 3 μL de cada oligo de microssatélite biotinolado (50 μM): - Biotina - IIIII(CT)8 e Biotina - IIIII(GT)8; - Deixar sob temperatura ambiente por 20 min, agitando lentamente a cada 2 min; - Misturar os 100 μL de esferas magnéticas pré-lavadas com os 519 μL (400 μL de H20 + 100 μL de DNA + 3 μL de oligo (CT) + 3 μL de oligo (GT) + 13 μL de 20 x SSC) de mistura de hibridização; - Incubar por 10 min sob temperatura ambiente agitando suavemente o tempo todo; - Magnetizar por 30 s e aspirar o sobrenadante; - Ressuspender em 300 μL de 0,1 x SSC;

161

- Repetir as duas etapas anteriores 3 vezes; - Ressuspender em 100 μL de água, magnetizar e esperar por 30 s; - Reservar o sobrenadante em um tubo de 2 mL e ressuspender mais uma vez com 150 μL de água. - Magnetizar novamente e retirar o sobrenadante (150 μL); - Misturar as duas partes (250 μL); - Conservar a -20 °C.

Amplificação dos fragmentos selecionados Em um tubo de 0,6 mL - 51,5 μL de Água MilliQ; - 10 μL de Tampão de PCR 10X;

- 6 μL de MgCl2 (25 mM); - 8 μL de dNTP (2,5 mM); - 4 μL de primer Afa21 (10μM); - 0,5 μL de Taq DNA polimerase; - 20 μL dos fragmentos selecionados - Ciclo: 95 °C 1 min, seguido de 25 ciclos (94 °C 40 s, 60 °C 1 min, 72 °C 2 min) e 72 °C por 5 min; - É esperado um smear (rastro) entre 200 e 1200 pb (Apêndice - Figura 3); - Não deve haver bandas preferenciais.

Clonagem em vetor pGEM-T Em um tubo de 0,6 mL - 5 μL de Tampão 2X; - 1 μL de Plasmídeo pGEM-T; - 3 μl de produto de amplificação; - 1 μl Ligase; - Incubar overnight a 4° C (termociclador ou geladeira) ou por no mínimo 12 h;

Eletroporação em XL1-Blue (Eletroporador Bio-Rad E. coli Pulser para cuvetas de 0,2 cm)

162

- Envolver a cuveta de eletroporação em papel alumínio e incubar em gelo por 10min; - Retirar as eletrocompetentes do Freezer a -80 °C e incubar em gelo; - Ajustar a voltagem do equipamento para 2,5 KV (2.500 V); - Adicionar de 1 a 2 μL da reação de ligação na célula; - Retirar a cuveta do gelo e tirar o papel alumínio que a envolve; - Recolher célula + ligação e colocar a mistura dentro da cuveta com cuidado; - Certificar-se que as células atingiram o fundo da cuveta, caso seja necessário, bater a cuveta delicadamente para que a mistura atinja o fundo; - Colocar a cuveta contendo a mistura (célula + ligação) na câmera de choque; - Eletroporar (tempo ideal de corrente é entre 4,8 e 5,2 milissegundos), em caso de estouro das células (estalo sonoro), a transformação foi comprometida; - Retirar rapidamente a cuveta do aparelho e adicionar 950μL de meio SOC (ou LB líquido); - Misturar com a pipeta até que o liquido se torne homogêneo; - Incubar as células em tubos tipo falcon (15 mL) por 1 h a 37 ºC; - Ressuspender as células com uma ponteira e plaquear 50 μL, 100 μL e 150 μL por placa contendo Meio LB + ampicilina (100mg/mL); - Adicionar 30 μL de IPTG + 30 μL de X-Gal a cada placa, totalizando três placas por biblioteca. - Colocar um volume de cada (bactéria, IPTG e X-Gal) em uma porção oposta da placa; - Espalhar com uma alça de Drigalsky até secar e incubar overnight (16 h a 20 h) a 37 °C; - Colocar em geladeira por 1 a 2 h para que as colônias fiquem azuis.

Manutenção dos clones - Utilizar placas ELISA com fundo em U, contendo 200 μL de meio 2YT-HMFM + ampicilina (100 μg/mL) por poço. As colônias brancas devem ser repicadas; - Os dois últimos poços H11 e H12 devem conter uma colônia AZUL (controle positivo) e um controle negativo (sem colônia); - Deixar crescer em overnight (16 h a 20 h) a 37 °C; - Deixar em freezer a -20 °C por 30 min e então, armazenar em freezer -80 °C. Etiquetar devidamente as placas;

163

Amplificação do insertos clonados - Dentro do fluxo laminar, retirar as placas com os clones a serem amplificados deixando-as descongelar em gelo; - Preparar o mix da reação de PCR e aliquotar nas microplacas; - Colocar 2 μL do material estocado e saído do freezer, o qual deve estar descongelado; Em um tubo de 0,6 mL - 13,25 μL de Água MilliQ; - 2,5 μL de Tampão 10X; - 2,0 μL de MgCl2 (25 mM); - 2,0 μL de dNTP (2,5 mM); - 1,25 μL de primer Afa21 (10 μM); - 2,0 μL de Taq DNA polimerase; - 2,0 μL de DNA clone; - Ciclos: 95 °C 4min, 30 ciclos (94 °C 30 s, 52 °C 45 s, 72 °C 1 min e 30 s) e 72 °C por 8 min; - Observar 2/3 bandas de diferentes tamanhos em gel.

Inoculação e extração plasmidial - Colocar 1 mL de meio Circle Grow contendo ampicilina em cada poço da placa deep well; - Inocular 2μL dos clones individuais com o auxílio de pipeta multicanal; - Selar a placa com adesivo; - Incubar a 37 ºC em shaker (300 rpm), durante 22 h; -Centrifugar por 6 min sob rotação de 3000 rpm a 20 °C, para sedimentar as células; - Descartar o sobrenadante e manter a placa invertida sobre papel absorvente por 1 min; - Adicionar a cada poço 240 μL de GTE, selar a placa com adesivo e ressuspender as células agitando no vortex por 2 min;

164

- Centrifugar por 6 min a 4000 rpm (20 ºC); - Descartar o sobrenadante com cuidado; - Adicionar a cada poço 63,75 μL de GTE + 1,25 μL de RNAse (10 mg/mL), selar a placa com adesivo comum e agitar no vortex por 5 min; - Adicionar a cada poço 60 μL de NaOH 0,2 M – SDS 1 %, selar a placa com adesivo e misturar 10 x por inversão; - Incubar por 10 min sob temperatura ambiente; - Colocar na centrífuga e dar um spin (até 1000 rpm); - Adicionar a cada poço 60 μL de KOAc 3 M (estocado a 4 ºC), selar a placa com adesivo e misturar 10 x por inversão; - Colocar na centrífuga e dar um spin (até 1000 rpm); - Remover o adesivo e incubar em estufa a 90 ºC por 30 min; - Esfriar a placa em gelo por 10 min e centrifugar por 10 min a 4000 rpm a 4 ºC; - Fixar com fita adesiva uma placa filtro no topo de uma placa de fundo em V, atentando para o alinhamento dos poços; - Transferir todo o volume para a placa filtro e centrifugar por 4 min a 4000 rpm (20 ºC). Não coletar o pellet (semelhante a uma “nata”); - Remover a placa filtro e adicionar ao filtrado 90 μL de isopropanol; - Selar a placa com adesivo e misturar 20 x por inversão; - Centrifugar por 45 min a 4000 rpm (4 ºC); - Descartar cuidadosamente o sobrenadante e adicionar 160 μL de etanol 70 % gelado; - Centrifugar por 10min a 4000 rpm a 4 ºC, e descartar o sobrenadante; - Inverter a placa sobre papel absorvente, colocá-la invertida na centrífuga e dar um spin até 300 rpm (aceleração e desaceleração baixas). - Deixar secar por 60 min à temperatura ambiente (ao abrigo da luz); - Ressuspender em 30 μL de água MilliQ (overnight). - Observar em gel da banda mais baixa para a mais alta: DNA coil, linearizado, supercoil e dímero.

3- Sequenciamento da biblioteca de microssatélites Preparo das reações de sequenciamento Reação de Sequenciamento para o ABI 3500xL: - 2 μL de Tampão Save Money;

165

- 0,5 μL de primer (5 pmol/μL); - 0,4 μL de Big Dye (v3.1); - 4 μL de DNA (200 a 500 ng); - 3,1 μL de água MilliQ; - Ciclos: 95 °C por 1 min, seguido de 26 ciclos (95 °C 20 s, 50 °C 20 s, 60 °C 4 min).

Purificação e preparação das amostras - Adicionar 2,5 μL de EDTA 125 mM a cada amostra (verificar se o EDTA atingiu a reação); - Adicionar 25 μL de etanol 100 % a cada amostra; - Selar e inverter 4 x; - Incubar as amostras à temperatura ambiente por 15 min protegidas da luz; - Centrifugar por 35min a 4000 rpm a 4 °C; - Inverter a amostra sobre papel e dar um spin até 250 rpm, com aceleração e desaceleração baixas; - Adicionar 30 μL de etanol 70 % gelado; - Centrifugar por 10 min a 4000 rpm a 4 °C; - Inverter a amostra sobre papel e dar um spin até 250 rpm, com aceleração e desaceleração baixas; - Deixar as amostras secando por 45 min (protegidas da luz); - Envolver em papel alumínio e estocar a 4 °C; - Para sequenciar, ressuspender o DNA em 10 μL de Formamida Hi-Di, misturar e desnaturar por 3 min a 95 °C.

4- PCR ISSR

Reagentes PCR - 1 µL DNA molde (5 ng) - 1 µL Buffer 10 x - 1,0 µL de primer (10 pM)

- 1,0 µL MgCl2 (50 mM) - 1,0 µL dNTPs (2,5 mM)

- 5,0 µL H2Odd

166

- 0,04 µL Taq

Programa PCR 1ª Etapa – 94 °C por 4 min; 2ª Etapa – 35 ciclos de: 94 °C por 30 s X °C por 45 s 72 °C por 2 min 3ª Etapa – 72 °C por 7 min Após PCR, carregamento de 2 µL de produto de PCR junto com DNA ladder 100 pb e análise em agarose 2 % com registro fotográfico em transluminador Gel Logic/Carestream MI SE.

5- PCR SSR e Análise em gel de acrilamida 7%

Reagentes PCR - 1 µL DNA molde (5 ng) - 1 µL Buffer 10x - 0,04 µL de primer F (10 pM) - 0,16 µL de primer R (10 pM)

- 0,3 µL MgCl2 (50 mM) - 0,8 µL dNTPs (2,5 mM)

- 6,6 µL H2Odd - 0,1 µL Taq

Programa PCR 1ª Etapa – 94 °C por 5 min; 2ª Etapa – 30 ciclos de: 94 °C por 30 s X °C por 45 s 72 °C por 45 s 3ª Etapa – 72 °C por 10 min

Armazenar em freezer e início da preparação da acrilamida.

167

Matriz de acrilamida 1- Prepare a acrilamida a 30 % - 58 g de acrilamida - 2 g de bis-acrilamida - Complete com água destilada para 200 mL e dissolva

2- Prepare o TBE 5x - 54 g de Tris base - 27,5 g de ácido bórico - 4,75 g de EDTA Dissódico - Completar para 1 L com água destilada e dissolver

3- Acrilamida 7 % -> Em um béquer de 1 L pesar 198 g de ureia, adicionar 154 mL da acrilamida a 30 % e 132 mL do TBE 5x. Completar com água destilada para 660mL. - Essa quantidade dá para 11 géis.

4- Limpar as placas - Com as placas limpas, passar álcool 70 % com papel toalha ou higiênico e esperar secar; - Aplicar 1 mL de repel na placa maior (não cortada) utilizando pedaço de papel tolha ou higiênico; - Aplicar 1 mL de solução de bind (1 mL de etanol + 5 uL de ác. Acético + 5 uL de bind) na placa menor (cortada) com papel tolha ou higiênico; - Esperar 20 min até secar. Limpar os separadores e o pente; - Com a placa seca, passe cola em um dos lados de cada separador (use uma cola bastão), então cole os separadores nas bordas laterais da placa maior e espere 10min para a cola secar; - Coloque a placa menor em cima da maior (lembre-se que os lados que foram tratados com repel e bind devem ficar frente a frente), faltando dois dedos na parte de cima para alinhar as placas;

5- Aplicando a acrilamida

168

- Em um béquer, coloque 60 ml de acrilamida a 7 % e misture com 200 uL de APS 10 % mais 100 uL de TEMED. Agite um pouco e comece a aplicar no espaço que fica entre a borda da placa menor e a borda da placa maior, não coloque o gel todo, é aos poucos; - Por capilaridade a solução começará a fluir para o espaço entre as placas. Fique atento para que não se formem bolhas no caminho do gel. Com as pontas dos dedos dê pequenas pancadas no vidro, e você notará que o gel irá fluir mais rapidamente; - A medida que o gel flui para o espaço entre as placas, coloque mais gel no espaço de entrada, e repita esse procedimento (pequenas pancadas no vidro/aplicar gel na borda superior) até que todo o gel preencha todo o espaço entre as placas; - Deslize a placa menor para se alinhar com a maior na borda superior (os dois dedos que faltavam para alinhar); - Aplique o restante do gel no espaço superior, tire o excesso, e coloque o pente sem fazer bolhas (movimentos laterais no momento de colocar o pente ajudam a evitar a formação de bolhas);

6- Câmara úmida – cobrir as extremidade superior e inferior da placa com papel e umedecer com TBE 1x; 7- Dia seguinte: montar a placa na cuba vertical -> encaixar o recipiente inferior, prender a placa com as presilhas, preencher o recipiente inferior com TBE 1x. Encaixar o prendedor superior e apertar de forma igual os lados da placa. Preencher a parte superior com TBE 1x. - Após montada a placa, lave os poços fazendo fluxo com uma pipeta Pasteur ou uma seringa com o próprio TBE 1x que está na cuba;

8- Conecte a cuba na fonte e inicie a pré-corrida -> 300 mA, 50 W, 2500 V, por 30 min.

9- Enquanto ocorre a pré-corrida, aplique o tampão de carregamento/desnaturante (load + formamida) (se sua amostra tem 10 uL de reação final, aplique 5 uL de tampão). No termociclador, desnature as amostras a

169

95 °C por 5 min. Após esse tempo, retire as amostras do termociclador, mesmo a temperatura ambiente o DNA não irá se renaturar, pois o tampão não permite;

10- Para o carregamento das amostras, caso você tenha dúvidas onde está o poço, aplique um pouco de tampão de carregamento, ele irá sedimentar e indicará onde estão os poços. Após isso, corra o gel por 1min para esse tampão adentrar no gel. Lave mais uma vez os poços, e então aplique as amostras junto com o ladder de 100 pb. - As configurações de corrida são: 300 mA, 65 W, 1600V

11- Após 1 h 50 min a corrida deve ser finalizada (as bandas azuis, mais adiantadas, passam da linha inferior da placa);

12- Tratamentos na placa - Separar as placas de vidro. Todo o procedimento de coloração será realizado com o gel aderido a placa menor; - Fixação: incubar o gel em 2 L de solução fixadora (10 % de etanol, 1,0 % acido acético) por 10 minutos; - Lavar com água deonizada por 1 minuto. - Pré-tratamento Incubar o gel em 2 L de solução de acido nítrico a 1,5% por 3 minutos. - Lavar com água deonizada por 1 minuto. - Coloração: Incubar o gel em 2 L de solução de nitrato de prata a 0,2 % durante 20 minutos sob agitação; - Lavar com água deonizada por 1 minuto. - Revelação: incubar o gel em 2 L de solução de revelação (60 g de

Na2CO3 e completar com água deonizada para 2L e resfriar no congelador) Na hora de usar, adicionar 1,5 mL de formaldeído 37 % à solução. Esperar até o aparecimento das bandas (5 a 10 minutos). A solução de revelação deve estar resfriada em geladeira. - Stop: incubar o gel em 2 L de solução de acido acético a 5,0 % para parar a revelação. - Lavar o gel rapidamente em água destilada.

170

- Análise do gel com base no ladder e com o auxílio de régua e registro com máquina fotográfica.

6-Soluções

Solução de extração de DNA genômico - 10 µL de NaCl (5 M) - 5 µL de Tris – HCl pH8 (1 M) - 25 µL de SDS (0,5 M)

- 430 µL de H2O destilada

Meio SOC - 20 g de Triptona; - 5 g de Extrato de levedura; - 0,5 g de NaCl; - Completar para 950 mL com Água milliQ - Adicionar a essa solução 10 mL de KCl 250 mM e ajustar o pH para 7,0; completar para 1 L e autoclavar;

- Adicionar 5 mL de MgCl2 2 M e autoclavar; Deixar esfriar e adicionar 20 mL de solução 1 M de glicose estéril (estoque -20 °C).

Meio LB LÍQUIDO - 10 g de Triptona; - 5 g de Extrato de levedura; - 10 g de NaCl;

- Completar para 1 L com H2O MilliQ; - Ajustar o pH para 7,5 e autoclavar (estoque: 4ºC).

Meio 2YT- HMFM Meio 2YT (450mL) - 8 g de Triptona; - 5 g de Extrato de levedura;

171

- 2,5 g de NaCl; - Completar para 450 mL com Água MilliQ; - Autoclavar.

Meio 10HMFM (50mL) Solução 1 (40 mL);

- 0,038 g de MgSO4(7H20);

- 0,225 g de Na3citrato(2H20);

- 0,450 g de (NH4)2SO4 (sulfato de amônio); - 22 g de Glicerol; - Completar para 15 mL com Água MilliQ;

- Dissolver o MgSO4 na água e posteriormente adicionar o Na3citrato

(2H2O) e o (NH4)2SO4. - Adicionar o glicerol e ajustar o volume para 40 mL; - Filtrar (filtro 0,22). Solução 2 (10 mL)

- 0,9 g de KH2PO4;

- 2,35 g de K2HPO4; - Completar para 10 mL com água MilliQ; - Autoclavar. - No fluxo laminar, misturar as soluções 1 e 2 (10HMFM). Misturar em seguida o meio 2YT ao 10HMFM (estoque: 4 ºC).

Meio Circle Grow - 40 g de Circle Grow; - Completar para 1 L com água destilada; - Autoclavar (estoque: 4 °C).

GTE - Glicose-TRIS-EDTA - 23 mL de Glicose 20 %; - 13 mL de Tris 1M (pH 7,4); - 10 mL de EDTA 0,5 M (pH 8,0); - Completar para 500 ml com água MilliQ;

172

- Estoque: 4 ºC.

173

11. Apêndice

Figura 1: Gel de agarose mostrando o DNA da espécie Canthon (P.) staigi no poço 1, digerido pela endonuclease AfaI durante a construção da biblioteca enriquecida em microssatélites, apresentando fragmentos entre 1200 pb e 700 pb.

174

Figura 2: Gel de agarose mostrando o DNA da espécie Canthon (P.) staigi no poço 1, após pré-amplificação durante a construção da biblioteca enriquecida em microssatélites, apresentando fragmentos entre 1200 pb e 300 pb.

Figura 3: Gel de agarose mostrando o DNA da espécie Canthon (P.) staigi no poço 1, após amplificação durante a construção da biblioteca enriquecida em microssatélites, apresentando fragmentos entre 1200 pb e 200 pb.

175

Tabela 1- Primers de microssatélites minerados a partir da biblioteca enriquecida de microssatélites para a espécie Canthon (P.) staigi. Nome Foward 5’-3’ Reverse 5’-3’ Sequência alvo Cstms1 GGACTGTTTTGAGCGTTACCAT GGCCCCTCCAGTATAGAAAATC (TTGTG)n Cstms2 GTTCTTATTGTAGCTTCGTTCATGC GAGCTTATGTGCTGACTTGCTG (TGTGCA)n (CTTTT)n Cstms3 TGCCACAACTCGTTTATTCCTA CGAAAACAACTGTAACGCCATA (AACGT)n Cstms4 GCTGGTTTCATCAACTGCATTA ACATACCACCCAGTCCTTTGTC (TTATT)n Cstms5 TCAGTGGTGAAACTCGTCTTTT GCGTGGACTAACAGCAAGTAAT (T)n Cstms6 AATCCCGAGCTTATGTGCTG AGCTGCAACACTCCTTCTAATTG (TGCACA)n Cstms7 CGTGGACTACCCACTTGAAATAA TGGATCGAAGCGAGATCAAT (ATAAG)n (AGACA)n Cstms8 GGCCCCTCCAGTATAGAAAATC GGACTGTTTTGAGCGTTACCAT (AAATA)n (CACAA)n Cstms9 AATCGCTTTAATCTTGTCTGGG CTCAAAATCCCTAGAAGAACACG (ATTTT)n Cstms10 GTCTCAATAACAACGGATGGC AGCTAACACTTGCTGGTGGATT (ATGAAT)n Cstms11 CCAGCCATTTTGAGCTATCACT CAAATACTTTCGGGATTTCAGC (AATTC)n (AATAA)n Cstms12 TTGCCATCTTCTTCTTCAACTG GCTTTATGACCACTAGCCGATT (TTAAAA)n Cstms13 AATCGGCTAGTGGTCATAAAGC GGCAATCCCTTTGAACCTAAAT (ATTAT)n Cstms14 TTGCTGAATGATCGAAGTGATG TTCTTCTAAGTCCTCACCAGCG (ATAGC)n Cstms15 GTGTTTCTGACAAGAGCAAGGA CTGTATTTGTTGACCTAGCAATCG (GCCAG)n (AAAAAG)n Cstms16 ATGCTGTGAATGTTGCTGAACT GCACAAATAACGAAGAGGAAGG (TAAAT)n (TTTAG)n Cstms17 GTTGGCTCGAATTTTAACCTGT CGCGTGGACTAACTCAATGTAA (AATT)n (ATACA)n Cstms18 CCTAATCTTCTAAACAAACCGC CGCGTGGACTAGCTTTATG (TAATT)n (CTAAC)n (TTTCT)n Cstms19 TCCTTTGTTCTTATCGCCCTTA GTAGGATCGTTTTGCTCTTGCT (TAAAAG)n (CTTTC)n Cstms20 AGCTGCAACACTCCTTCTAATTG AATCCCGAGCTTATGTGCTG (TGTGCA)n Cstms21 TGGATCGAAGCGAGATCAAT CGTGGACTACCCACTTGAAATAA (TGTCT)n (TCTTA)n Cstms22 GGACTGTTTTGAGCGTTACCAT GGCCCCTCCAGTATAGAAAATC (TTGTG)n (TTTTA)n Cstms23 CTGTATTTGTTGACCTAGCAATCG GTGTTTCTGACAAGAGCAAGGA (TCTTTT)n (CTGGC)n Cstms24 GCACAAATAACGAAGAGGAAGG ATGCTGTGAATGTTGCTGAACT (ACTAA)n (AATTT)n Cstms25 GGTTTCGAGTATTTGGATTTAAGCG AGTGTCCTTTGAGTGTGATTCCTG (TTGTA)n T (AATT)n Cstms26 CGCGTGGACTAGCTTTATG CCTAATCTTCTAAACAAACCGC (GGTTA)n (AGAAA)n (AATTA)n Cstms27 AGTGGCTATCCTAACTGCACAA TTTGGTATCGCGTTGACTTCTA (A)n Cstms28 GCGTGGACTAACAGCAAGTAAT TCAGTGGTGAAACTCGTCTTTT (A)n

176

Tabela 2: Primers de marcadores ISSR testados na espécie C. (P.) staigi.

*Primers que apresentaram melhor amplificação.

177

12. Curriculum vitae (Lattes)

Celso Alexandre Ferreira Neto Curriculum Vitae

Maio/2016

178

Celso Alexandre Ferreira Neto Curriculum Vitae ______Dados pessoais

Nome Celso Alexandre Ferreira Neto Filiação Hilton Alexandre Ferreira e Hélia Maria da Silva Ferreira Nascimento 23/07/1987 - Limoeiro/PE - Brasil Carteira de Identidade 7228630 SDS - PE - 24/12/2002 CPF 071.005.634-61

Endereço residencial Rua Prof. Moraes Rego, 788/201 Bl A Várzea - Recife 50670-420, PE - Brasil Telefone: 81 92650178

Endereço profissional Universidade de Pernambuco Rua Arnóbio Marques Santo Amaro - Recife 50100-130, PE - Brasil Telefone: 81 34238582

Endereço eletrônico E-mail para contato : [email protected] E-mail alternativo [email protected]

______Formação acadêmica/titulação

2012 Doutorado em Genética. Universidade Federal de Pernambuco, UFPE, Recife, Brasil Título: Análise da estrutura genética de populações de Canthon (Peltecanthon) staigi (Coleoptera) no domínio de Mata Atlântica. Orientador: Rita de Cássia de Moura

2010 - 2012 Mestrado em Biologia Celular e Molecular Aplicada. Universidade de Pernambuco, UPE, Recife, Brasil Título: Diferenciação cariotípica em espécies de Cyclocephala (Coleoptera: Scarabaeidae) com base em mapeamento físico de DNA repetitivo., Ano de obtenção: 2012 Orientador: Rita de Cássia de Moura Bolsista do(a): Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Graduação interrompido(a) em Biomedicina. Universidade Federal de Pernambuco, UFPE, Recife, Brasil Ano de interrupção: 2010

2006 - 2009 Graduação em Ciências Biológicas. Universidade de Pernambuco, UPE, Recife, Brasil Título: BIOLOGIA REPRODUTIVA DO GAFANHOTO RHAMMATOCERUS BRASILIENSIS (ORTHOPTERA:ACRIDIDAE) Orientador: Marília de França Rocha

2002 - 2004 Ensino Médio (2o grau) . Escola Regina Coeli, E.R.C, Brasil

106

______Formação complementar

2013 - 2013 Curso de curta duração em Bioinformática. (Carga horária: 90h). Universidade Federal de Pernambuco, UFPE, Recife, Brasil

2011 - 2011 Curso de curta duração em Identificação dos gêneros de Scarabaeinae. (Carga horária: 30h). Universidade de Pernambuco, UPE, Recife, Brasil

2010 - 2010 Curso de curta duração em Análise Filogenética Bayesiana. (Carga horária: 3h). Sociedade Brasileira de Genética, SBG, Ribeirao Preto, Brasil

2010 - 2010 Curso de curta duração em Citogenética Molecular Animal. (Carga horária: 40h). Universidade de Pernambuco, UPE, Recife, Brasil

2009 - 2009 Curso de curta duração em Elementos de Transposição. (Carga horária: 3h). Sociedade Brasileira de Genética, SBG, Ribeirao Preto, Brasil

2008 - 2008 Curso de curta duração em Citogenética Clássica e Molecular. (Carga horária: 3h). Sociedade Brasileira de Genética, SBG, Ribeirao Preto, Brasil

2007 - 2007 Extensão universitária em II Curso de Genética Humana Básica. (Carga horária: 30h). Universidade de Pernambuco, UPE, Recife, Brasil

2007 - 2007 Curso de curta duração em Terapia Gênica. Federação das Sociedades de Biologia Experimental, FeSBE, Sao Paulo, Brasil

2006 - 2006 Curso de curta duração em Imunogenética Básica. (Carga horária: 9h). Universidade de Pernambuco, UPE, Recife, Brasil

2002 - 2002 Curso de curta duração em Infórmatica Básica. Fôntase Informática, F.I., Brasil

______Atuação profissional

1. Faculdade de Comunicação Tecnologia e Turismo de Olinda - FACOTTUR ______Vínculo institucional

2016 - Atual Vínculo: Celetista , Enquadramento funcional: Professor de Bioquímica , Carga horária: 10, Regime: Parcial

2. Faculdade Maurício de Nassau - Recife - UNINASSAU ______

107

Vínculo institucional

2013 - Atual Vínculo: Celetista , Enquadramento funcional: Docente , Carga horária: 9, Regime: Parcial

3. Universidade Federal de Pernambuco - UFPE ______Vínculo institucional

2012 - Atual Vínculo: Bolsista , Enquadramento funcional: Estudante de Doutorado , Carga horária: 48, Regime: Dedicação exclusiva

4. Universidade de Pernambuco - UPE ______Vínculo institucional

2010 - 2012 Vínculo: Bolsista , Enquadramento funcional: Estudante de Mestrado , Carga horária: 48, Regime: Dedicação exclusiva 2007 - 2009 Vínculo: Estagiário , Enquadramento funcional: Estagiário , Carga horária: 20, Regime: Parcial

______Atividades

06/2008 - 06/2009 Estágio, Reitoria, Instituto de Ciências Biológicas Estágio: Estágio com bolsa PIBIC - CNPq/UPE na área de Citogenética de Insetos

06/2007 - 06/2008 Estágio, Reitoria, Instituto de Ciências Biológicas Estágio: Estágio com bolsa PIBIC - CNPq/UPE na área de Biologia Reprodutiva de Gafanhoto

03/2007 - 06/2007 Estágio, Reitoria, Instituto de Ciências Biológicas Estágio: Estágio Voluntário na área de Biologia Reprodutiva de Gafanhotos

______Idiomas

Inglês Compreende Razoavelmente , Fala Razoavelmente , Escreve Razoavelmente , Lê Bem

Espanhol Compreende Bem , Fala Razoavelmente , Escreve Razoavelmente , Lê Bem

Português Compreende Bem , Fala Bem , Escreve Bem , Lê Bem

108

______Prêmios e títulos

2012 Menção Honrosa por trabalho apresentado em encontro, Universidade Federal do Vale do São Francisco

Producão

______Produção bibliográfica Apresentação de trabalho e palestra

1. FERREIRA NETO, C. A. Aconselhamento Genético, 2015. (Conferência ou palestra,Apresentação de Trabalho)

2. FERREIRA NETO, C. A.; AMORIM, I. C.; Cruz, GAS; BALBINO, V. Q.; MOURA, R. C. Análise Preliminar da Estrutura Genética de três populações da espécie Canthon staigi (Scarabaeidae) ocorrentes no Nordeste Brasileiro, 2014. (Congresso,Apresentação de Trabalho)

3. FERREIRA NETO, C. A.; AMORIM, I. C.; Cruz, GAS; BALBINO, V. Q.; MOURA, R. C. Caracterização dos tipos de microssatélites desenvolvidos a partir de biblioteca enriquecida para a espécie Canthon staigi (Scarabaeidae, Coleoptera), 2014. (Congresso,Apresentação de Trabalho)

4. FERREIRA NETO, C. A. ASTROBIOLOGIA: O que a Astronomia tem a ver com a Biologia?, 2013. (Conferência ou palestra,Apresentação de Trabalho)

5. FERREIRA NETO, C. A. Ecologia e Genética de Insetos, 2013. (Conferência ou palestra,Apresentação de Trabalho)

Produção técnica Demais produções técnicas

1. FERREIRA NETO, C. A. Citogenética Molecular Animal, 2012. (Aperfeiçoamento, Curso de curta duração ministrado)

Educação e Popularização de C&T Apresentação de trabalho e palestra

1. FERREIRA NETO, C. A. ASTROBIOLOGIA: O que a Astronomia tem a ver com a Biologia?, 2013. (Conferência ou palestra,Apresentação de Trabalho)

Eventos

109

Participação em eventos

1. Apresentação de Poster / Painel no(a) Congresso Brasileiro de Genética, 2015. (Congresso) INVESTIGATING THE GENETIC STRUCTURE OF THE CANTHON (PELTECANTHON) STAIGI (COLEOPTERA: SCARABAEIDAE) POPULATIONS IN THE ATLANTIC FOREST DOMAIN.

2. Apresentação de Poster / Painel no(a) XX Encontro de Genética do Nordeste, 2014. (Encontro) “ANÁLISE PRELIMINAR DA ESTRUTURA GENÉTICA DE TRÊS POPULAÇÕES DA ESPÉCIE CANTHON STAIGI (SCARABAEIDAE) OCORRENTES NO NORDESTE BRASILEIRO”.

3. Apresentação de Poster / Painel no(a) XX Encontro de Genética do Nordeste, 2014. (Encontro) “CARACTERIZAÇÃO DOS TIPOS DE MICROSSATÉLITES DESENVOLVIDOS A PARTIR DE BIBLIOTECA ENRIQUECIDA PARA A ESPÉCIE CANTHON STAIGI (SCARABEIDAE, COLEOPTERA)”.

4. Apresentação de Poster / Painel no(a) XIX Encontro de Genética do Nordeste, 2012. (Encontro) Localização de sítios de DNAr 18S em duas espécies de Dynastinae (Coleoptera:Scarabaeidae) usando bandeamento NOR e hibridização in situ fluorescente.

5. Apresentação de Poster / Painel no(a) XV Congreso Latinoamericano de Genética, 2012. (Congresso) Localização de sítios de DNAr 18S em espécies de Cyclocephala (Coleoptera) usando AgNO3 e FISH.

Bancas

Bancas Participação em banca de trabalhos de conclusão

Curso de aperfeiçoamento/especialização

1. ROCHA, M. F.; Teixeira, S. F.; Romaguera, A. M. A.; FERREIRA NETO, C. A. Participação em banca de Maria Edilene da Silva Henrique. Jogo Didático como estratégia de ensino-aprendizagem, 2013 (Ensino de Biologia) Universidade de Pernambuco

Graduação

1. Cruz, GAS; Montes, MA; FERREIRA NETO, C. A. Participação em banca de Rógean Vinícius Santos Soares. Análise do status taxonômico de Euchroma gigantea (Coleoptera: Buprestidae) utilizando DNA barcode, 2015 (Ciências Biológicas) Universidade de Pernambuco

2. FERREIRA NETO, C. A. Participação em banca de Janete da Conceição Ferreira; Claudiene Mendes da SIlva. A atuação do enfermeiro no diagnóstico e na prevenção do câncer no colo do útero na unidade básica de saúde: Revisão Integrativa, 2014 (Enfermagem) Faculdade Maurício de Nassau - Recife

3. FERREIRA NETO, C. A. Participação em banca de Nayara Tays Ramos;Rosiane Maria dos Santos;Sara Joelza Costa. Alzheimer: Impactos à saúde familiar, 2014

110

(Enfermagem) Faculdade Maurício de Nassau - Recife

4. FERREIRA NETO, C. A. Participação em banca de Andrezza Silva Cabral;Anne Karoline;Bárbara Augusta M. M. T.. Impactos Negativos da Utilização de Instrumentos com Coluna de Mercúrio, 2014 (Enfermagem) Faculdade Maurício de Nassau - Recife

5. FERREIRA NETO, C. A. Participação em banca de Angela Maria Constância;Maria Helena Silva;Nazady Albertina. Importância do pai no aleitamento materno e os desafios da Enfermagem, 2014 (Enfermagem) Faculdade Maurício de Nassau - Recife

6. FERREIRA NETO, C. A. Participação em banca de Rozeline Afonso Torres. Prevenção da Infecção Urinária relacionada à sonda vesical de demora, 2014 (Enfermagem) Faculdade Maurício de Nassau - Recife

7. FERREIRA NETO, C. A. Participação em banca de Annellem de Sá Leitão Santana; Ana Roberta de Farias Santos. Síndrome de Burnot em Enfermeiros de UTI, 2014 (Enfermagem) Faculdade Maurício de Nassau - Recife

Participação em banca de comissões julgadoras

Outra

1. Encontro de Pós-Graduação, Pesquisa e Extensão, Seminário de Iniciação Científica, Seminário de Inovação Tecnológica, Seminário de Extensão da UPE, 2013 Universidade de Pernambuco

2. Avaliação de Pôsteres no Encontro de Pós-graduação, Pesquisa e Extensão, Seminário de Iniciação Científica, Seminário de Inovação Tecnológica, Seminário de Extensão, 2012 Universidade de Pernambuco

______Totais de produção

Produção bibliográfica Apresentações de trabalhos (Conferência ou palestra)...... 5 Apresentações de trabalhos (Congresso)...... 5 Apresentações de trabalhos (Seminário)...... 3 Demais produções bibliográficas...... 1

Produção técnica Curso de curta duração ministrado (aperfeiçoamento)...... 1

Eventos Participações em eventos (congresso)...... 7

111

Participações em eventos (seminário)...... 3 Participações em eventos (oficina)...... 1 Participações em eventos (encontro)...... 7 Participações em eventos (outra)...... 1 Organização de evento (outro)...... 2 Participação em banca de trabalhos de conclusão (curso de aperfeiçoamento/especialização). 1 Participação em banca de trabalhos de conclusão (graduação)...... 8 Participação em banca de comissões julgadoras (outra)...... 2

Produção cultural Artes Visuais(Pintura)...... 2

______Outras informações relevantes

1 Aprovado em quinto lugar (Nota Final 69,47) no concurso do IF Sertão Edital nº 92/2015, referente ao concurso público para preenchimento de 52 vagas efetivas de professores do Ensino Básico, Técnico e Tecnológico (EBTT).

Foi monitor da disciplina de Genética para o curso de Enfermagem da Universidade de Pernambuco, no período de 02/2008 a 01/2009

Professor voluntário de Biologia no Projeto Vestibular Cidadão, da Universidade Federal de Pernambuco.

Professor convidado na Escola Técnica Estadual Agamenom Magalhães no curso técnico de Química Industrial, tendo ministrado aulas de bioquímica.

Professor convidado no curso de especialização em Perícia, Auditoria e Gestão Ambiental do Instituto de Ciências Biológicas, Universidade de Pernambuco, tendo ministrado aula de Genética da Conservação.

112