Pristimantis Citriogaster

istributio Duellman, 1992 (Amphibia: D Craugastoridae): First record from Ecuador, altitudinal 1* 1,2 1

raphic g distribution extension with distribution map and phylogram eo Teresa Camacho-Badani , Mario H. Yánez-Muñoz and Santiago R. Ron G n o 1 Pontificia Universidad Católica del Ecuador, Escuela de Ciencias Biológicas, Museo de Zoología, Apartado 17-01 2184, Quito, Ecuador. 2 Museo Ecuatoriano de [email protected] Naturales, División de Herpetología, Sección Vertebrados, Rumipamba 341 y Av. de los Shyris. Casilla postal: 17-

otes 07-8976. Quito, Ecuador.

N * Corresponding author:

Abstract: Pristimantis citriogaster (Duellman,

Using genetic and morphological evidence, we provide the first report of 1992) from Ecuador (previously only know from the type locality in eastern lowlands of Peru). The new records in Ecuador also represent an altitudinal extension.

Pristimantis The terrestrial craugastorid frogs of the genuset al. Zumi, canton Nangaritza, Provincia Zamora Chichipe, contain 448 species, making it the most 4°13’44.51”P. citriogaster S, 78°39’27.9” W at 874 m. diverse vertebrate genus in the world (Hedges The Ecuadorian specimens agree with the descriptions 2008). Their diversityet al. center areet the al. tropicalPristimantis Andes and of by Duellman (1992), Duellman and Pramuk citriogasterin Ecuador one in three speciesP. conspicillatus of anurans belongs species group,to this (1999), and Duellman and Lehr (2009), are characterized genus (Hedges 2008; Ron 2011). by skin on dorsum shagreen without tubercles; indistinct is part of the et al. dorsolateral folds; skin on venter smooth; tympanum which contains 37 species and is distributed principally distinct, round; first finger longer than second; fingers in northern South America (Hedges 2008). It was lacking lateral fringes or keels; ulnar tubercles present described by Duellman (1992), the holotype (KU 212277) distally; tubercles absent on heel and tarsus; toes barely is an adult female from Cataratas Ahuashiyacu,Pristimantis 06°30’ S, webbed basally, lacking lateral fringes or keels; posterior citriogaster76°20’ W, 730 m above sea level, 14 km by road NE from surfaces of the thighs mottledP. citriogaster dark brown and cream; flecks Tarapoto, Departamento de San Martín, Peru. on throat and ventral surface of thighs. The characteristic is only known from its typeet al. locality at bright yellow belly of in life could not elevations between 600–800 m, and is categorizedP. citriogaster as Data be verified because only photos in dorsal view of live Deficient in the UICN Red List (Rodriguez 2011). specimensP. were zeuctotylus available. within In contrast the P. conspicillatus with Duellman species and Herein, we present the first record of from Pramuk (1999) report of a round palmar tubercle (shared Ecuador based on examination of specimens deposited only with at Museo de Zoología, Pontificia Universidad Católica group), the Ecuadorian specimens haveP. acitriogaster bifid palmar del Ecuador (QCAZ), from southeast Ecuador (Figure tubercle, which would be at the extreme of the variation 1). Specimen identification was based on comparisons reported in the original description of by with morphological characters reported by Lynch and Duellman (1992): “the palmar tubercle could be large, Duellman (1980), Duellman and Pramuk (1999), and Duellman and Lehr (2009). The identification was corroborated by genetic characters from three individuals: QCAZ 17023 (GenBank Accession Number JQ964419; Figure 2), subadult collected in September 2001 by Omar Torres-Carvajal, Jennifer Pramuk, and Lena M. Echelle in General Leonidas Plaza (Limón), Provincia Morona, adult Santiago, 2°57’55.8” S, 78°25’9.4” W at 1094 m; QCAZ 41833 (GenBank Accession Number JQ964421) male collected in December, 2007 by David Salazar and María José Endara at Río Napinaza, 6.6 km N from General (Leonidas Plaza (Limón), Provincia Morona Santiago, 2°55’22”S, 78°24’26.6” W at 1000 m; and QCAZ 41487 Figure 1. Pristimantis citriogaster GenBank Accession Number JQ964420), adult female Dorsal view of a subadult (QCAZ collected in April, 2009 by Juan M. Guayasamín, Elicio E. 17023) collected in General Leonidas Plaza (Limón), Provincia Morona Tapia and Silvia Aldás-Alarcón in Las Orquideas, Parroquia Santiago, Ecuador. Photo: Omar Torres-Carvajal. 513 Camacho-Badani et al. | First record of Pristimantis citriogaster from Ecuador

Pristimantis citriogaster and broadly ovoid; emarginatedP. conspicillatus or slightly bifid distally”. by 45 cycles of 95°C for 20 s, annealing at 52°C for 25 s Differences between and extension al 72°C for 1 min and a final extension for other species of the speciesP. citriogaster group from has 7 min at 72 °C. PCR products were cleaned by ExoSAP the eastern lowlands and foothills of Ecuador are listed digest and sequenced inet Macrogen al. (Macrogen Inc., Seúl, in Table 1. In coloration,P. condorthe venter of Corea) Secuences were edited and aligned using Geneious mottling on the throat, laterally on the belly and ventral Pro 5.4.6 (Drummond , 2011) and Mesquite 2.74 surfaces of the thighs; P. lymanihas isa densely immaculate pigmented except (Maddison and Maddison, 2011). The phylogeny was throat and mottling on the belly and ventral surfaces of obtained using Bayesian inference as implemented in the thighs; the venter in program MrBayes 3.1.2 (Ronquist and Huelsenbeck, for the presence of dark bars in the margin of the lips and 2003). The Bayesian analysis consisted of two parallel runs mottling in the posterior surfaces of the thighs. Differences of the6 Metropolis coupled Monte Carlo Markov chain for 1 with the other species are listed in Table 1. x 10 generations. Each run had four chains. Convergence into a stationary distribution was determined by reaching average standard deviation split frequencies < 0.05 between runs. The first 50% of the sampled generations were discarded as burn-in and the remaining were used to estimate the Bayesian tree, posterior probabilities and other model parameters. The model of sequence evolution was chosen with JModelTest version 0.1.1 (Posada, 2008) using the Akaike Information Criterion with sample size correction as optimality measure. The phylogeny (Figure 3) shows strongP. citriogaster support (Bayesian posteriorP. citriogaster probability = 0.99) for a clade composed of the Ecuadorian samples of and a paratype of from the type locality in Peru (KU212278) from San Martin, Sanp Martin, genetic Cataratas distance Figure 2. Pristimantis citriogaster in Ahnashiyacu, 14 km NE Tarapoto (GenBank Accession Number EF493700). The uncorrected Map showing first records of between the Ecuadorian and Peruvian samples rangeset Ecuador, based on specimens deposited at Museo de Zoología, Pontificia Universidad Católica del Ecuador (QCAZ) and the type locality in Peru al.from 3.2% to 3.3%., et al. This genetic distanceet al. in 16S rRNA extracted from Duellman (1992). could be indicative of interspecific differences (Fouquet are2007; either Vieites P. citriogaster 2009; Funk 2011). Thus, the Based on sequences of 582 bp of mitochondrial DNA genetic evidence suggests thatP. citriogaster the Ecuadorian samples (16S rRNA gene) obtained using forward primer 16L19 or a closely related undescribed (secuence:et AATACCTAACGAACTTAGCGATAGCTGGTT) al., et al., and species. We assign them to based on the reverse primer 16H36E (AAGCTCCAWAGGGTCTTCTCGTC) congruence in morphology between our samples and (Heinicke 2007; Hedges 2008) and a method the species descriptions provided by Duellman (1992), of PCR amplification under the following conditions: Duellman and Pramuk (1999) and Duellman and Lehr initial denaturation for 5 min at 94 °C for 1 min followed (2009).

Figure 3. Pristimantis conspicillatus

Bayesian consensus phylogram depictingP. relationshipscitriogaster among species of the species group. Phylogram derived from analysis of 582 bp of mtDNA (gene 16S) under model of evolution GTR + G + I. Numbers next to species names are GenBank accession numbers or QCAZ catalog numbers (for Ecuadorian samples of ). Posterior probabilities resulting from Bayesian Markov chain Monte Carlo searches appear below branches. 514 Camacho-Badani et al. | First record of Pristimantis citriogaster from Ecuador

Table 1. Pristimantis conspicillatus Pristimantis fenestratus Morphological diagnostic characters and distribution of the species of species group from the Amazon Basin in Ecuador. * does not have confirmed records in Ecuador but is probably present according to the potential distribution map shown by Padial andALTITUDINAL De la Riva (2009); Frost (2011) also reportsSKIN its ONpresence POSTERIOR in southeastern SURFACES of Ecuador.INNER TARSAL SPECIES THROAT AND BELLY REFERENCE RANGE (M) VENTER OF THE THIGHS FOLD Pristimantis citriogaster throat cream Cream with brown flecks on Mottled dark brown and Duellman, 1992; Duellman and Pristimantis 600–1094 Smooth Present condor white spots Pramuk, 1999; This work Densely pigmented throat, Brown with cream or Short or reduced Duellman and Pramuk, 1999; Pristimantis 1300–1975 Smooth conspicillatus mottling on belly tubercle 1999Duellman and Lehr, 2009 Venter white, dusky marks on Dark enclosing white (red Lynch, 1975; Duellman and Pramuk, 300–1000 Smooth Absent Pristimantis throat and limbs in life) spots lymani Cream, immaculate except reticulations Black with white spots or Lynch and Duellman, 1997; 2000–2500 for dark bars on the margin Smooth Long fold Pristimantis Duellman and Lehr, 2009 malkini of lips 1999 Black with greenish Flap-like on distal Lynch, 1980; Duellman and Pramuk, Pristimantis < 400 Throat white, venter yellow Smooth metabates redyellow spots flecks half of tarsus et al. Dark brown with cream to Bearing distinct Duellman and Pramuk, 1999; 525–860 Dark flecks on throat Smooth Pristimantis fold distally Cisneros-Heredia 2009 skydmainos areolate Flores and Rodriguez, 1997; Venter cream with brown Weakly Dark with minute cream Bearing distinct 250–750 Cisneros-Heredia, 2006; Duellman Pristimantis flecks on throat flecks fold distally or pale reddish (same as and Lehr, 2009 fenestratus* or mottling on throat Yellowish, pale grayish, Not confirmed Pale cream with brown spots dorsal color) Duellman and Lehr, 2009. Frost, Smooth Low fold distally in Ecuador 2011

Eleutherodactylus conspicillatus Flores, G., andCopeia L. O. Rodriguez. 1997. Two new species of the The Ecuadorian records increase the latitudinal group (Anura: Leptodactylidae) distribution range in 452 km northwest from the type from Perú. 1997: 388-394. Pristimantislocality and extends the altitudinal upper limit to 1094 m Fouquet A, A. Gilles, M. Vences,PLoS ONE C. Marty, M. Blanc and N. J. Gemmell. 2007. UnderestimationAmphibian of Species Species Richness of the in Neotropical World: an online Frogs reference.Revealed above sea level. This newPristimantis record increases the diversity of Versionby mtDNA 5.5 Analyses. (31 January, 2011) 2(10): e1109. to 109 species in Ecuador and confirmset the al. Frost, D.R. 2011. continuity of lowland communities between . Electronic Database accessible at http://research.amnh.org/vz/herpetology/amphibia/. Captured on northern Peru and southern Ecuador (Yánez-Muñoz 01 January 2012. Proceedings of the Royal 2012). Funk,Society W.C., M.B-Biological Caminer andSciences S.R. Ron. 2011 High levels of cryptic species Acknowledgments: diversiy uncovered in Amazonian frogs. . doi:10.1098/rspb.2011.1653. This work had the support of the project Hedges, S.B., W.E. Duellman and M.P. Heinicke.Zootaxa 2008. New World “Inventario y Caracterización Genética y Morfológica de la Diversidad de direct-developing frogs (Anura: Terrarana): Molecular phylogeny, Anfibios, Aves y Reptiles de los Andes del Ecuador” (PIC-08-0000470) classification, biogeography, and conservation. 1737: 1-182. granted by SENESCYT, Secretaría Nacional de Ciencia y Tecnología del Heinicke, M.P., W.E. ProceedingsDuellman, and of the S.B. National Hedges. Academy 2007. Major of Sciences Caribbean Ecuador and executed by Museo de Zoología (QCAZ) de la Pontificia and Central American frog faunas originated by oceanic Universidad Católica del Ecuador. Ministerio de Ambiente of Ecuador dispersal. Mesquite: A modular system 104: and Dirección General Forestal y Fauna Silvestre (DGFFS) issued for10092-10097. evolutionary analysis, version 2.75 collection permits (008-09 IC-FAU-DNB/MA). We thank Omar Torres- Maddison, W.P. and D.R. Maddison. 2011. Carvajal, Jennifer B. Pramuk, Lena M. Echelle, David Salazar, María José . Software accessible at Endara, Juan M. Guayasamín, Elicio E. Tapia, and Silvia Aldás-Alarcón http://mesquiteproject.org.Pristimantis for specimen collection. Teresa Camacho Badani thanks to Organization PadialZoological J.M. and Journal I. De la of Riva. the Linnean2009. Integrative Society taxonomy reveals cryptic of American States Scholarships for supporting her graduate studies at Amazonian species of (Anura: Strabomantidae).Pristimantis the Masters program in Conservation Biology at Pontificia Universidad citriogaster In IUCN Red 155: List of97-122 Threatened Species. Católica del Ecuador. Mario Yanez-Muñoz thanks to the Unidad ABC of the Rodríguez,Version L., 2011.2 J.L. Martinez, J. Icochea and A. Angulo. 2004. I. Municipio de Quito for partly supporting his participation at the same org . IUCN 2011. MastersLiterature program. Cited . Electronic Database accessible at www.iucnredlist. . CapturedAmphibiaWebEcuador. on 09 December Version2011. 2011.0. Museo de Zoología, Eleutherodactylus skydmainos . Check Ron,Pontificia S.R., L.A. Universidad Coloma, J.M.Católica Guayasamin del Ecuador and M.H. Yanez-Muñoz. Cisneros-HerediaList D. F. 2006. Amphibia, Brachycephalidae, 2011. : First country record, Ecuador . Electronic Database 2:47-49 Pristimantis metabates Accessible at http://zoologia.puce.edu.ec/Vertebrados/anfibios/ Cisneros-Heredia D. F., Armijos-OjedaPristimantis D. and K. skydmainos Valarezo. 2009. First AnfibiosEcuador. Captured on 10 January 2012. Bioinformatics country record of (Duellman and Pramuk) Ronquist, F. and J.P. Huelsenbeck, 2003. MrBayes version 3.1: Bayesian andHerpetology distribution Notes extension of (Flores and phylogenetic inference under mixed models. 19: Rodriguez) in eastern Ecuador (Amphibia,Eleutherodactylus Anura, Satrabomantidae). conspicillatus 1572-1574. 2:185-188. Revista Vieites, D.R., K.C. Wollenberg, F. Andreone, J. Kohler,Proceedings F. Glaw of and the M. National Vences. DuellmanEspañola W.E. de 1992. Herpetología A new species of the Academy2009. Vast of underestimationSciences of the United of Madagascar’s States of America biodiversity evidenced group (Anura: Leptodactylidae) from Terrestrial northeastern breeding Peru. frogs by an integrative amphibian inventory. (Strabomantidae) in Perú 6: 23–29 106: 8267-8272. Duellman, W.E. and E. Lehr. 2009. Yánez-Muñoz, M.H., E. Toral-Contreras,Pristimantis P.A. Meza-Ramos, J. P. Reyes-Puig, . Natur- und Tier-Verlag, Naturwissenschaft,Eleutherodactylus E.P. Bejarano-Muñoz,Check J.J. Mueses-Cisneros List and D. Paucar. 2012. New Münster. 380 p. Scientifics country records for five species of Jiménez de la Espada, DuellmanPapers W.E. Natural and J.P. History Pramuk. Museum 1999. FrogsThe University of the Genus of Kansas 1870 from Ecuador. 8(2): 286-290. (Anura: Leptodactylidae) in the Andes of Northern Peru. 13: 1-78 Drummond A. J., B. Ashton, S. Buxton, M. Cheung,Geneious A. Cooper, v5.4 C. Duran, M. Received: February 2012 Field J. Heled, M. Kearse, S. Markowitz, R. Moir, S. Stones-Havas, S. Accepted: April 2012 Sturrock, T. Thierer and A. Wilson. 2011 , Available from Published online: June 2012 http://www.geneious.com/ Editorial responsibility: Raúl Maneyro

515