Insights Into the Mechanism of Cell Death Induced by Saporin Delivered Into

TIV 2972 No. of Pages 12, Model 5G 24 October 2012

Toxicology in Vitro xxx (2012) xxx–xxx 1 Contents lists available at SciVerse ScienceDirect

Toxicology in Vitro

journal homepage: www.elsevier.com/locate/toxinvit

2 Insights into the mechanism of cell death induced by saporin delivered into

3 cancer cells by an antibody fusion protein targeting the transferrin receptor 1

a,⇑ a,1 a,b a a 4 Q1 Tracy R. Daniels-Wells , Gustavo Helguera , José A. Rodríguez , Lai Sum Leoh , Michael A. Erb , a c,d c,d e,f,g,h 5 Graciel Diamante , David Casero , Pellegrini Matteo , Otoniel Martínez-Maza , a,b,e,f 6 Manuel L. Penichet

7 a Division of Surgical Oncology, Department of Surgery, University of California, Los Angeles, CA, USA 8 b The Molecular Biology Institute, University of California, Los Angeles, CA, USA 9 c Department of Molecular Cell and Developmental Biology, University of California, Los Angeles, CA, USA 10 d Institute for Genomics and Proteomics, University of California, Los Angeles, CA, USA 11 e Department of Microbiology, Immunology, and Molecular Genetics, University of California, Los Angeles, CA, USA 12 f Jonsson Comprehensive Cancer Center, University of California, Los Angeles, CA, USA 13 g Department of Obstetrics and Gynecology, David Geffen School of Medicine, University of California, Los Angeles, CA, USA 14 h Department of Epidemiology, Fielding School of Public Health, University of California, Los Angeles, CA, USA

15 16 article info abstract 1830 19 Article history: We previously developed an antibody-avidin fusion protein (ch128.1Av) that targets the human transfer- 31 20 Received 24 August 2012 rin receptor 1 (TfR1) and exhibits direct cytotoxicity against malignant B cells in an iron-dependent man- 32 21 Accepted 8 October 2012 ner. ch128.1Av is also a delivery system and its conjugation with biotinylated saporin (b-SO6), a plant 33 22 Available online xxxx ribosome-inactivating toxin, results in a dramatic iron-independent cytotoxicity, both in malignant cells 34 that are sensitive or resistant to ch128.1Av alone, in which the toxin effectively inhibits protein synthesis 35 23 Keywords: and triggers caspase activation. We have now found that the ch128.1Av/b-SO6 complex induces a tran- 36 24 Saporin scriptional response consistent with oxidative stress and DNA damage, a response that is not observed 37 25 Immunotoxin with ch128.1Av alone. Furthermore, we show that the antioxidant N-acetylcysteine partially blocks 38 26 Transferrin receptor 27 Oxidative stress saporin-induced apoptosis suggesting that oxidative stress contributes to DNA damage and ultimately 39 28 Ribosome-inactivating protein saporin-induced cell death. Interestingly, the toxin was detected in nuclear extracts by immunoblotting, 40 29 suggesting the possibility that saporin might induce direct DNA damage. However, confocal microscopy 41 did not show a clear and consistent pattern of intranuclear localization. Finally, using the long-term 42 culture-initiating cell assay we found that ch128.1Av/b-SO6 is not toxic to normal human hematopoietic 43 stem cells suggesting that this critical cell population would be preserved in therapeutic interventions 44 using this immunotoxin. 45 Ó 2012 Published by Elsevier Ltd. 46

47 48 49 50 1. Introduction (Lombardi et al., 2010). It is a Type I RIP in that it consists of a sin- 53 gle catalytic polypeptide chain and lacks a cell-binding chain. It has 54 51 Saporin is a ribosome-inactivating protein (RIP) isolated from similar catalytic activity to that of ricin, a Type II RIP that consists 55 52 the plant Saponaria ofﬁcinalis that strongly blocks protein synthesis of both the catalytic and cell-binding domains (de Virgilio et al., 56

Abbreviations: b-SO6, biotinylated saporin-6; BCA, bicinchoninic acid; BFU-e, burst forming unit-erythroid; BHLHB2, basic-helix-loop-helix transcription factor B2; BMMC, bone marrow mononuclear cells; CDC14B, dual speciﬁcity protein tyrosine phosphatase family; CFU-e, colony forming unit-erythroid; CFU-GM, colony forming unit- granulocyte/macorphage; CHX, cycloheximide; ch128.1Av, mouse/human chimeric antibody avidin fusion protein targeting CD71; DNS, dansyl hapten (5-dimethylamino naphthalene-1-sulfonyl chloride); FYTTD1, forty-two-three domain containing 1; GADD45B, growth arrest DNA damage-inducible gene 45b; GAPDH, glyceraldehyde 3- phosphate dehydrogenase; HIST2H4, Core histone 2H4; HRP, horseradish peroxidase; kDa, kilodlatons; KLF6, Kruppel-like transcription factor 6; LFC, log base 2-fold change; LTC-IC, long-term culture-initiating cell; MM, multiple myeloma; mw, molecular weight; NAC, N-acetylcysteine; NFKBIE, NF-jB, inhibitor epsilon (IjBe); NHL, non-Hodgkin’s lymhoma; NIH, National Institutes of Health; QPCR, quantitative polymerase chain reaction; RGS1, regulator of G-protin signaling; RIP, ribosomal-inactivating protein; ROS, reactive oxygen species; SO6, saporin-6; TBP, TATA-box binding protein; Tf, transferrin; TfR1, transferrin receptor 1 (also known as CD71); THUMD2, THUMP domain containing 2; TSC22D3, glucocorticoid-induced leucine zipper (TFGb-stimulated clone 22 domain); TXNIP, thioredoxin interacting protein. ⇑ Corresponding author. Address: Division of Surgical Oncology, Department of Surgery, UCLA, 10833 Le Conte Avenue, CHS 54-140, Box 951782, Los Angeles, CA 90095- 1782, USA. Tel.: +1 310 825 0457; fax: +1 310 825 7575. E-mail address: [email protected] (T.R. Daniels-Wells). 1 Present address: School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina.

0887-2333/$ - see front matter Ó 2012 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.tiv.2012.10.006

Please cite this article in press as: Daniels-Wells, T.R., et al. Insights into the mechanism of cell death induced by saporin delivered into cancer cells by an antibody fusion protein targeting the transferrin receptor 1. Toxicol. in Vitro (2012), http://dx.doi.org/10.1016/j.tiv.2012.10.006 TIV 2972 No. of Pages 12, Model 5G 24 October 2012

2 T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx

57 2010). RIPs are N-glycosidases that depurinate specific adenine death. These data suggest that the death induced by the conjugate 123 58 residues of the 23S/25S/28S ribosomal subunits leading to the irre- is exclusively mediated by the toxin and not the direct cytotoxic ef- 124 59 versible block in protein synthesis. Saporin has also been reported fects of the fusion protein. A previous report on the gene expres- 125 60 to have DNase-like activity (Gasperi-Campani et al., 2005; Ron- sion analysis of ch128.1Av alone showed a transcriptional 126 61 cuzzi and Gasperi-Campani, 1996), although this is controversial response consistent with iron deprivation mediated in part by 127 62 (Lombardi et al., 2010). It has also been reported that the glycosi- p53 (Rodriguez et al., 2011). We now show that the ch128.1Av/ 128 63 dase activity of saporin is not required for its cytotoxicity (Cimini b-SO6 immunotoxin induces a different transcriptional response, 129 64 et al., 2011; Sikriwal et al., 2008). There are several isoforms of which is consistent with the induction of oxidative stress and 130 65 saporin that have been identified and named based on the tissue DNA damage. The induction of lethal oxidative stress was con- 131 66 of origin and chromatographic peak in ion-exchange chromatogra- firmed through the analysis of cell death in the presence of an anti- 132 67 phy (Lombardi et al., 2010). Saporin-6 (SO6), one of the most active oxidant. In addition, we have conducted studies that suggest 133 68 forms of the toxin, is produced in the seeds of the plant and repre- nuclear localization of the toxin. Finally, we found that 134 69 sents the major peak (peak 6) in chromatography analysis of seed ch128.1Av/b-SO6 does not show toxicity to normal human hema- 135 70 extracts (Lombardi et al., 2010). This peak contains up to 4 differ- topoietic stem cells or non-committed (early) progenitor cells. 136 71 ent isoforms of the toxin that has either an aspartic or glutamic 72 acid residue in position 48 and either a lysine or arginine residue 2. Materials and methods 137 73 at position 91. Due to its high cytotoxicity, high stability and resis- 74 tance to denaturation (Santanche et al., 1997), and inability to 2.1. Cell lines 138 75 readily enter cells, saporin is a promising therapeutic agent for 76 delivery into cancer cells. IM-9 (a human EBV-transformed B-lymphoblastoid cell line) 139 77 An antibody-avidin fusion protein (ch128.1Av) was previously and U266 (a human MM cell line) were purchased from the Amer- 140 78 produced as a delivery system for a broad range of biotinylated ther- ican Type Culture Collection (ATCC, Manassas, VA). Both malignant 141 79 apeutic agents, such as SO6, into cancer cells (Daniels et al., 2007; Ng B-cell lines were grown in RPMI 1640 medium (Life Technologies, 142 80 et al., 2002, 2006). This fusion protein contains avidin genetically Carlsbad, CA) supplemented with 10% heat inactivated fetal bovine 143 81 fused to the C 3 domains of the human IgG3 heavy chains. The anti- H serum (Atlanta Biologicals Inc., Lawrenceville, GA) and grown in 5% 144 82 body is specific for the human transferrin receptor 1 (TfR1, also CO2 and 37 °C. 145 83 known as CD71) and does not compete with the endogenous ligand 84 transferrin (Tf) for receptor binding (Ng et al., 2006; Rodriguez et al., 85 2007). The TfR1 is a Type II transmembrane homodimeric protein 2.2. Recombinant antibody-avidin fusion protein production and 146 86 involved in iron uptake and regulation of cell growth (Daniels et immunotoxin formation 147 87 al., 2006b). It is widely expressed at low levels on many cell types, 88 but shows increased expression on rapidly dividing cells including The antibody-avidin fusion protein ch128.1Av (formerly known 148 89 malignant cells due to their increased need for iron (Daniels et al., as anti-human TfR IgG3-Av) has been previously described (Ng et 149 90 2006b). Because of its central role in cancer pathology, its accessibil- al., 2002, 2006). It consists of a mouse/human chimeric IgG3 anti- 150 91 ity on the cell surface, and its ability to internalize through receptor- body genetically fused to avidin via its CH3 domains. The IgG3 con- 151 92 mediated endocytosis, the TfR1 has been used for the targeted deliv- tains the variable regions of the murine antibody 128.1. A similar 152 93 ery of numerous different therapeutic agents into cancer cells (Dan- non-targeting isotype control fusion protein specfic for the hapten 153 94 iels et al., 2012, 2006a). The TfR1 can be targeted in two ways, either dansyl (DNS): 5-dimethylamino naphthalene-1-sulfonyl chloride 154 95 through the use of conjugates containing Tf, or through the use of (IgG3-Av) has been previously reported (Ng et al., 2006). Both fu- 155 96 antibodies like ch128.1Av. In addition to its delivery potential, sion proteins, expressed in murine myeloma cells, were purified 156 97 ch128.1Av is cytotoxic to certain human malignant B cells, includ- from cell culture supernatants using affinity chromatography. Pro- 157 98 ing multiple myeloma (MM) and non-Hodgkin’s lymphoma (NHL) teins were dialyzed into buffer (150 mM NaCl, 50 mM Tris–HCl, pH 158 99 cells (Ng et al., 2002, 2006; Ortiz-Sanchez et al., 2009), an activity 7.8) and protein concentrations were determined by the bicinch- 159 100 that is higher compared to that of its parental antibody (ch128.1) oninic acid (BCA) Protein Assay (Thermo Fisher Scientfic, Walnut, 160 101 without avidin (Daniels et al., 2011; Ng et al., 2006). This activity CA). Mono-biotinylated saporin (b-SO6, mw 30 kDa) was 161 102 is due to an alteration in the TfR cycling pathway, increased TfR deg- purchased from Advanced Targeting Systems (San Diego, CA) as a 162 103 radation, and the induction of lethal iron starvation in sensitive cells custom conjugate of one biotin per toxin molecule. ch128.1Av or 163 104 (Daniels et al., 2007; Ng et al., 2006; Rodriguez et al., 2011). How- IgG3-Av was conjugated to b-SO6 in a 1:1 M ratio on ice for 164 105 ever, both ch128.1Av and its parental antibody demonstrated 30 min before the addition to cell culture medium as previously 165 106 in vivo anti-cancer activity in two xenograft mouse models of dis- described (Daniels et al., 2007). 166 107 seminated human MM (Daniels et al., 2011). Taken together, 108 ch128.1Av is a versatile approach for the treatment of B-cell malig- 2.3. Microarray hybridization and data quality control 167 109 nancies in that it can be directly cytotoxic through the disruption of 110 iron metabolism or it can be used as a universal delivery system for IM-9 and U266 cells were incubated for 1, 3, 9, or 24 h with 168 111 many therapeutic agents. 10 nM ch128.1Av alone or conjugated to b-SO6. Control samples 169 112 Previously we have shown that ch128.1Av delivers the active consisted of cells incubated with an equal volume of buffer alone 170 113 b-SO6 toxin into human malignant B cells resulting in protein syn- for the same time points. Total mRNA was collected from all samples 171 114 thesis inhibition, caspase activation (especially caspases 2 and 3), using the RNeasy Kit (Qiagen, Valencia, CA). RNA was quantified and 172 115 and the induction of apoptosis in both cells that are sensitive to the integrity evaluated using a Agilent 2100 Bioanalyzer (Agilent 173 116 the fusion protein alone and those that are resistant (Daniels et Technologies, Inc., Santa Clara, CA). RNA was hybridized onto 174 117 al., 2007). The cytotoxicity of b-SO6 conjugated to ch128.1Av in HumanRef-8 v2 Expression BeadChips (Illumina, Inc., San Diego, 175 118 cells that are sensitive to the direct effects of ch128.1Av occurs CA) and global gene expression profiles for these samples were col- 176 119 much faster than that of the ch128.1Av alone. Additionally, the lected using the BeadArray software package (Illumina). Quality 177 120 cytotoxicity of the conjugate could not be blocked by the addition control, preprocessing, data normalization, and statistical analysis 178 121 of excess iron (Daniels et al., 2007), indicating that in contrast to of differential expression was performed as described previously 179 122 ch128.1Av alone, iron starvation does not play a role in this cell (Rodriguez et al., 2011). All changes were deemed significant 180

T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx 3

181 (p < 0.05) based on a regularized Bayesian test. Data for ch128.1Av- (Coralville, IA). The GAPDH reference gene kit labeled with Yel- 227 182 treated cells has already been reported (Rodriguez et al., 2011). low555 (Roche Applied Science) was used as a housekeeping gene. 228 All other probes were labeled with FAM. Real time PCR reactions 229 183 2.4. Proliferation and apoptosis assays (total volume of 20 lL) were prepared using the LightCycler 480 230 Probes Master Mix (Roche Applied Science) as instructed by the 231 184 IM-9 and U266 cells were incubated for 48 h with 10 nM manufacturer and run on the LightCycler 480 in the GenoSeq UCLA 232 185 ch128.1Av alone or conjugated to b-SO6. Control cells were incu- Genotyping and Sequencing core facility. The LightCycler 1.5 Soft- 233 186 bated with an equal volume of buffer alone. Inhibition of cell pro- ware (Roche Applied Science) was used to analyze all data. This 234 3 187 liferation was monitored using the [ H]-thymidine incorporation software uses the DDCT method to calculate the fold change in 235 188 assay as previously described (Daniels et al., 2007). Apoptosis gene expression compared to the reference gene in treated versus 236 189 was assessed using Annexin V staining and flow cytometry as de- control cells treated with buffer alone. 237 190 scribed previously (Daniels et al., 2007). For antioxidant studies, 191 IM-9 and U266 cells were treated with 10 or 1 nM ch128.1Av, b- 2.6. Confocal microscopy 238 192 SO6, or the ch128.1Av/b-SO6 complex in the presence or absence 193 of 2 mM of the antioxidant N-acetylcysteine (NAC) for 48 h. As a ch128.1Av (10 nM) conjugated to b-SO6 was labeled with Ze- 239 194 commonly used protein synthesis inhibitor, cells were treated with nonÒ (excitation 594 nm; Life Technologies) and the labeled com- 240 195 cycloheximide (CHX, ThermoFisher Scientific, Walnut, CA). Differ- plex was incubated with IM-9 or U266 cells for 1 or 16 h. Cells 241 196 ent concentrations of CHX were used for the two cell lines since were collected, fixed with 3.7% paraformaldehyde, permeabilized 242 197 U226 can be resistant to apoptosis due to the high level of Bcl-xL with 0.2% Triton-X and incubated with a goat anti-saporin anti- 243 198 expression (Catlett-Falcone et al., 1999). U266 cells were treated body labeled with Alexa FluorÒ 488 (Advanced Targeting Systems) 244 199 with either 100 or 10 lg/mL CHX and IM-9 cells were treated with for at least 2 h followed by the anti-goat IgG labeled with Alexa 245 200 1.0 or 0.1 lg/mL CHX (in the presence or absence of 2 mM NAC). FluorÒ 488 (Life Technologies) for 1 h. After washing, cells were 246 201 Apoptosis was then assessed by flow cytometry. Ten thousand mounted on slides in VectashieldÒ mounting medium with 247 202 events were recorded for each sample on a Becton–Dickinson FAC- 1.5 lg/mL DAPI (Vector Labs, Burlingame, CA). Images were ob- 248 203 Scan Analytic Flow Cytometer (BD Biosciences, San Jose, CA) in the tained using a confocal microscope (Leica, Wetzlar, Germany) 249 204 UCLA Jonsson Comprehensive Cancer Center and Center for AIDS equipped with an oil-immersion NA 1.4 60 objective. Images 250 205 Research Flow Cytometry Core Facility. Data were analyzed using were analyzed using ImageJ software (NIH). Confocal laser scan- 251 206 the FCS Express V3 software (De Novo Software, Los Angeles, CA). ning microscopy was performed in the California NanoSystems 252 Institute Advanced Light Microscopy/Spectroscopy Shared Re- 253 207 2.5. Validation by real time, quantitative PCR (QPCR) source Facility at UCLA. 254

208 New RNA samples were collected using the RNeasy Kit (Qiagen) 2.7. Western Blot analysis of nuclear extracts 255 209 from IM-9 and U266 cells treated with either 10 nM ch128.1Av, b- 210 SO6, or the ch128.1Av/b-SO6 complex for 24 h. U266 and IM-9 Both IM-9 and U266 cells were treated in 60 mm dishes with 256 211 cells were also treated with 100 lg/mL or 1.0 lg/mL CHX, respec- 10 nM ch128.1Av/b-SO6 for either 1 or 16 h. Nuclear and cytoplas- 257 212 tively, for 24 h as a control protein synthesis inhibitor. cDNA was mic extracts were prepared using the Nuclear Extract Kit (Active 258 213 prepared using 2 lg of RNA and the High-Capacity cDNA Reverse Motif, Carlsbad, CA) as described by the manufacturer. Control cells 259 214 Transcription Kit (Applied Biosystems, Carlsbad, CA) according to were incubated with an equal volume of buffer alone. Protein con- 260 215 the manufacturer’s protocol. For all QPCR reactions, cDNA samples centrations were determined using the BCA protein assay (Thermo 261 216 were diluted 1:100 since this dilution was pre-determined to be Fisher Scientfic). Proteins (20 lg for cytoplasmic fractions and 2 lg 262 217 overall the best for target and housekeeping genes in untreated for nuclear extracts) were then separated on 4–12% Bis–Tris Nu- 263 218 cells. The Universal Probe Library Real Time PCR System (Roche Ap- PAGE gels (Life Technologeis) in MOPS buffer. Proteins were trans- 264 219 plied Science, Indianapolis, IN) was used for validation of gene ferred to Whatman Protran nitrocellulose membranes (Thermo 265 220 expression. This system uses sequence-specific primers that recog- Fisher Scientific) and probed with a goat anti-saporin antibody la- 266 221 nize the gene of interest as well as fluorescently labeled probes beled with horseradish peroxidase (HRP; Advanced Targeting Sys- 267 222 that attach to the piece of DNA that is being amplified. The online tems). A rabbit anti-human GAPDH antibody (Cell Signaling 268 223 Assay Design Center (Roche Applied Science) that uses the gene Technology, Boston, MA) was used as a control for cytoplasmic pro- 269 224 accession numbers was used to identify the universal probe and tein and was detected using a donkey anti-rabbit IgG-HRP (GE 270 225 primer sequences for each reaction. This information is given in Ta- Healthcare Life Sciences, Piscataway, NJ). The murine antibody tar- 271 226 ble 1. Primers were synthesized by Integrated DNA Technologies geting the human TATA-box binding protein (TBP; Life Technolo- 272

Table 1 Gene, probe, and primer information for real time PCR analysis.

Gene Accession # UPL Probe # 50 Primer 30 Primer TXNIP NM_006472.3 85 cttctggaagaccagccaac gaagctcaaagccgaacttg CDC14B AF023158.1 66 gggtgccattgcagtacatt agatcctgacccacgcaat RGS1 NM_002922.3 84 tgaaatcttccaagtccaagg tccaaagacattttgaccagttt GADD45b AF087853.1 10 cattgtctcctggtcacgaa taggggacccactggttgt HIST2H4 AF525682.1 25 gagtgagagggacctgagca cctctcgacatttcgtcattt BHLHB2 AB043885.1 66 tggattcccctgagttaaggt tcaggaaaatcctttgacagataa TSC22D3 BC072446.1 10 tggtggccatagacaacaag tctcggatctgctccttcag KLF6 BC000311.2 85 gatgagttaaccaggcacttcc agaggtgcctcttcatgtgc NFKBIE ENST00000275015.4 79 gctctgttgcctggcttt agccagatggagtgctgtct FYTTD1 BC039734.1 25 gcaatgaaaacctcgacaaaa attgctgggcaccacttt THUMP2 BC013299.2 86 gacttgactttcagagtatcttgtcg aattccaattacttttcctacctcct

UPL: universal probe library (Roche Applied Sciences).

4 T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx

273 gies) was used as a nuclear protein control as previously described A Time course (hours) 274 (Dansithong et al., 2008) and was detected using a sheep anti- 0 1 39 24 275 mouse IgG-HRP antibody (GE Healthcare Life Sciences). For all 276 Western Blots the ChemiGlow West Chemiluminescent Substrate Buffer control 277 (ProteinSimple, San Jose, CA) was used as described by the manu- IM-9 278 facturer and blots were developed on a Kodak X-OMAT 2000A ch128.1Av/b-SO6 279 (Rochester, NY). Buffer control U266 ch128.1Av/b-SO6 280 2.8. Long-term culture-initiating cell assay (LTC-IC) B ch128.1Av ch128.1Av/b-SO6 281 Bone marrow mononuclear cells (BMMC, StemCell Technolo- 282 gies, Vancouver, Canada) were treated with 10 nM ch128.1Av, b- 283 SO6, ch128.1Av/b-SO6 or IgG3-Av/b-SO6 for 1 h in Iscove’s Mod- 120 284 ﬁed Dulbecco’s Medium with 2% FBS. Cells were then washed 3 100 285 times and the assay was carried out as recommended in the LTC- 286 IC Procedure Manual (StemCell Technologies) and as described 80 287 previously (Daniels et al., 2011). In brief, treated cells were seeded 60 288 on a M2-10B4 murine ﬁbroblast (ATCC) feeder layer in human 289 long-term medium (StemCell Technologies). Cells were cultured 40 (% of control) of (% 290 for 5 weeks with half media changes weekly. Both nonadherent 20 291 and adherent cells were harvested and seeded in quadruplicate

292 in MethoCult GF + H4435 (‘‘Complete PLUS’’ methylcellulose med- ThymidineH] Incorporation 3 293 ium with recombinant cytokines and erythropoietin; StemCell [ IM-9 U266 294 Technologies). After an 18-day incubation total colony numbers Control ch128.1Av ch128.1Av/b-SO6 295 were determined using an Olympus CK2 inverted microscope C 296 (Olympus America Inc., Center Valley, PA). The assay was con- 0.7 12.5 5.8 21.9 5.2 68.4 297 ducted using BMMC from 3 different donors. IM-9

298 3. Results 3.3 4.3 4.6

299 3.1. Global gene expression analysis in cells treated with the 2.2 5.4 2.0 3.8 1.5 31.6 300 ch128.1Av/b-SO6 conjugate

Propidium iodide Propidium U266 301 Two cell lines were chosen for the global gene expression anal- 302 ysis. IM-9 cells are highly sensitive to the effects of the fusion pro- 9.7 7.8 40.2 303 tein alone, while U266 cells are resistant (Daniels et al., 2007; Ng et 304 al., 2006; Rodriguez et al., 2011). Both malignant B-cell lines have Annexin V 305 been previously shown to be sensitive to apoptosis-induced by the 306 ch128.1Av/b-SO6 conjugate (Daniels et al., 2007). RNA was col- Fig. 1. Time course protocol for mRNA isolation and verification of the cytotoxic 307 lected for analysis from both cells lines at various time points after effects of the fusion protein alone and conjugated to b-SO6. Cells were treated with 10 nM ch128.1 alone or conjugated to b-SO6 for the indicated times in duplicate 308 treatment with ch128.1Av/b-SO6 (Fig. 1A). Cells incubated with samples in a 48-well plate at 200,000 cells/well (A). At each time point RNA was 309 buffer alone were used as controls. Treated cells were also moni- collected for microarray analysis. Control wells were treated with buffer alone. 310 tored simultaneously for the expected cytotoxic effects at 48 h Additional wells for each treatment were incubated in parallel for 48 h to measure 311 using proliferation and apoptosis assays (Fig. 1B, C). As expected, the anti-proliferative (B) and pro-apoptotic (C) effect of ch128.1Av and ch128.1Av/ 3 312 ch128.1Av was only cytotoxic to IM-9 cells, while both cell lines b-SO6 on IM-9 and U266 cells. The anti-proliferative effect was measured by [ H]- thymidine incorporation and values expressed as the % of buffer control. Error bars 313 were sensitive to the effects of the conjugate. represent standard deviation. Apoptosis was determined by flow cytometry in cells 314 HumanRef-8 v2 Expression BeadChips were used to monitor labeled with Annexin-V/Propidium Iodide. Percentage of total cells is shown in the 315 gene expression changes. The data normalization process is de- corner of each quadrant. 316 scribed and shown in Supplementary Fig. 1. The number of differ- 317 entially expressed genes (LFC > 1, p < 0.05) in IM-9 cells was higher were further analyzed by QPCR to confirm the gene expression 333 318 than those of U266. Most of the changes in IM-9 cells occurred at 9 changes (Fig. 5, Table 2). In the QPCR analysis, the changes ob- 334 319 and 24 h and included both up and down regulation of genes served in the 11 genes in IM-9 cells were of higher magnitude than 335 320 (Fig. 2A). Limited changes were detected in U266 cells treated with those of U266 and were consistent with the microarray data. All 11 336 321 the conjugate and all changes were upregulation of the specified genes tested by QPCR showed upregulation upon treatment with 337 322 genes (Fig. 2B). A focused view of the expressional changes the ch128.1Av/b-SO6 conjugate, but not with the fusion protein 338 323 (LFC > 1, p < 0.05) that occurred in IM-9 cells after 9 h of treatment or the toxin alone. These genes are different from those that were 339 324 with the conjugate (compared to buffer alone) is shown in Fig. 2C. previously shown to be differentially expressed in response to the 340 325 Gene expression changes (LFC > 1, p < 0.05) in the two cells lines fusion protein alone, which are consistent with a response to iron 341 326 for the same treatment times are compared in Fig. 3 and ontologies deprivation (Rodriguez et al., 2011). However, 10 of the genes were 342 327 are shown in Fig. 4. A Venn diagram (Supplementary Fig. 2) shows also upregulated in both cell lines upon treatment with the 343 328 the gene expression changes that were observed in IM-9 and U266 commonly used protein synthesis inhibitor CHX (Supplementary 344 329 cells. A set of 11 genes were upregulated in both cell lines: TXNIP, Table 1). HIST2H4 was the only gene not consistently upregulated 345 330 CDC14B, HIST2H4, RGS1, THUMPD2, KLF6, BHLHB1, FYTTD1, by CHX in both cell lines. Thus, this transcriptional response 346 331 GADD45B, TSC22D3, and NFKBIE. No genes were found to be down- appears to be in response to protein synthesis inhibition in general 347 332 regulated in both cell lines. The expression levels of these 11 genes and not a specific response to the ch128.1Av/b-SO6 conjugate. 348

T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx 5

Fig. 2. Gene expression analysis in cells treated with ch128.1Av complexed to b-SO6. Changes in gene expression with a greater than 1.0 Log base 2-fold change (LFC) after 1, 3, 9, or 24 h of ch128.1Av/b-SO6 treatment with respect to their time matched control (buffer alone) are shown for IM-9 (A) and U266 (B) cells clustered by time point and magnitude of change. Changes in IM-9 greater than 1.0 LFC at 9 h (C) post treatment are also shown for comparison with changes in U266 at 24 h. Clustering was conducted using the Cluster program and visualized using Java TreeView.

349 3.2. The effect of the antioxidant N-acetylcysteine on saporin-induced examine whether oxidative stress plays a role in the apoptosis 354 350 apoptosis mediated by the toxin, the antioxidant NAC was co-incubated with 355 the conjugate or CHX for the full 48 h and apoptosis assessed. 356 351 The gene expression proﬁle of IM-9 and U266 cells treated with Cells were treated with 1nM ch128.1Av/b-SO6 since this concen- 357 352 the ch128.1Av/b-SO6 conjugate is consistent with the induction of tration consistently induces a high level of apoptosis in both cell 358 353 oxidative stress and DNA damage triggered by the toxin. In order to lines. Additionally, we used a high concentration (10 nM) of the 359

6 T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx

ch128.1Av/b-SO6 in IM-9 (Supplementary Fig. 3) and U266 (Sup- 374 plementary Fig. 4) cells over a 24-h period. The ch128.1Av/b-SO6 375 complex was intracellularly localized after 30 min. The complex 376 was seen in punctate structures in the cytoplasm and accumulated 377 around the nucleus. The toxin appeared to colocalize with 378 ch128.1Av; however, no strong intranuclear localization of saporin 379 was detected by confocal microscopy at any time point tested. 380 Nevertheless, Western Blot analysis showed that the toxin was de- 381 tected in nuclear extracts in both IM-9 and U266 cells as early as 382 1 h after treatment (Fig. 7). After 16 h post-exposure, there ap- 383 peared to be higher levels of b-SO6 in the nuclear extracts. 384

3.4. In vitro toxicity to hematopoietic stem cells and early progenitors 385

Since the ch128.1Av/b-SO6 conjugate targets malignant hema- 386 topoietic cancers via interaction with TfR1, we evaluated the po- 387 tential toxicity of the conjugate on normal hematopoietic stem 388 and early progenitor cells using the long-term cell-initiating cul- 389 ture (LTC-IC) assay. The LT-IC assay enumerates the number of or 390 pluripotent hematopoietic stem and noncommitted, early progen- 391 itor cells within a given sample. The number of colonies at the end 392 of the assay correlates with the number of viable pluripotent pro- 393 genitor cells after treatment. Exposure to ch128.1Av/b-SO6 did not 394 result in a reduction of colony number (Table 3) when we tested 395 BMMC from 3 different donors, suggesting that the conjugate is 396 not toxic to this population of cells. ch128.1Av or b-SO6 alone, as 397 well as the isotype control conjugate (IgG3-Av/b-SO6), also did 398 not affect colony formation. 399

4. Discussion 400

We have previously shown that the delivery of the single chain 401 RIP b-SO6 using ch128.1Av effectively blocks protein synthesis, 402 activates caspases 2 and 3, and to lesser extent caspases 8 and 9, 403 and induces apoptosis in malignant B cells (Daniels et al., 2007). 404 In order to further explore the mechanism of cell-death induced 405 by this immunotoxin, we conducted a global gene expression anal- 406 ysis in two different human malignant B-cell lines, one that is sen- 407 sitive to the cytotoxic effects of the fusion protein alone (IM-9) and 408 Fig. 3. Comparison of gene expression changes in IM-9 and U266 at the various one that is not (U266). Eleven genes that were differentially ex- 409 time points. Direct comparison in gene expression changes between IM-9 and U266 pressed in both cell lines were identified. Since these genes were 410 cells treated with ch128.1Av/b-SO6 in which genes with a variance greater than 0.4 are clustered over the various time points and the magnitude of difference between similarly activated in both cell lines, they may represent a general- 411 the RNA levels in each cell line. In this case genes whose transcripts are present at a ized response to the toxin in malignant B cells. The proteins en- 412 higher level in U266 than in IM-9 are shown in yellow. Clustering was conducted coded by 11 genes upregulated in both cell lines in response to 413 using the Cluster program and visualized using Java TreeView. (For interpretation of the immuntoxin are involved in the cellular response to oxidative 414 the references to colour in this figure legend, the reader is referred to the web 415 version of this article.) stress, DNA damage, or are involved with RNA processing. KLF6 is a zinc finger-containing transcription factor whose expression in- 416 creases upon treatment with hydrogen peroxide (Cullingford et 417 al., 2008; Ghaleb and Yang, 2008). It also acts as a tumor suppres- 418 360 conjugate as to determine if the effects of NAC were dose-depen- sor that has been shown to interact with Cyclin D1 causing cell cy- 419 361 dent. We also used a high and a low dose of CHX. As expected, cle arrest (Benzeno et al., 2004). TXNIP can also act as a tumor 420 362 ch128.1Av alone had no effect on U266 cells. In IM-9 cells suppressor and plays a role in redox homeostasis through its inter- 421 363 ch128.1Av had an effect that was not blocked by NAC. However, action with the antioxidant thioredoxin (Zhou and Chng, 2012). 422 364 in both cell lines ch128.1Av/b-SO6 strongly induced apoptosis that The expression of TXNIP is increased upon treatment with various 423 365 could be blocked by NAC in a dose-dependent manner (Fig. 6). CHX anti-cancer agents and it has been shown to render cells more sen- 424 366 induced apoptosis in both cell lines; however, NAC did not block sitive to oxidative stress (Yoshioka et al., 2006). CDC14B is a phos- 425 367 this cell death. phatase known to regulate the cell cycle. Its expression was shown 426 to increase upon treatment with the plant toxin curcumin, which 427 368 3.3. Analysis of saporin localization induced DNA damage in lung carcinoma cells (Skommer et al., 428 2007). It has also been suggested that CDC14B may be required 429 369 To address the possibility that b-SO6 can cause direct DNA dam- for DNA repair of double stranded breaks (Mocciaro et al., 2010; 430 370 age upon delivery by ch128.1Av into the cells, we performed local- Wei et al., 2011). BHLHB2 has been previously shown to be upreg- 431 371 ization studies by confocal microscopy. If saporin is found within ulated in response to DNA damaging agents in a p53-independent 432 372 the nucleus, it would be possible that the toxin can cause direct manner (Thin et al., 2007). It is also a regulator of ionizing radia- 433 373 DNA damage. Therefore, we followed the internalization of tion-induced apoptosis and cell death caused by other stress 434

T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx 7

Fig. 4. Gene clustering according to ontologies. The same list of genes shown in Fig. 3 are now shown clustered by their corresponding ontologies, with statistically enriched ontologies listed at right alongside their corresponding p-values. Clustering was conducted using the Cluster program and visualized using Java TreeView.

435 stimuli including hypoxia and serum starvation (Yamada and and cellular damage that can lead to apoptosis or necrosis (Fogg et 451 436 Miyamoto, 2005). GADD45B is induced by various stress stimuli al., 2011; Mates et al., 2012; Ray et al., 2012). Speciﬁcally, ROS can 452 437 including DNA damage, DNA alkylating agents, UVB radiation, cause DNA damage by inducing DNA strand breaks, mutations, 453 438 and the multi-kinase inhibitor sorafenib (Ou et al., 2010; Thyss et deletions, gene ampliﬁcation, and rearrangements. The upregula- 454 439 al., 2005; Zumbrun et al., 2009). Additionally, GADD45B was in- tion of the above mentioned genes by b-SO6 delivered into cells 455 440 duced by treatment with either the verotoxin or shiga toxin 2, tox- by ch128.1Av suggests that the toxin may increase the oxidative 456 441 ins produced by Escherichia coli that inhibit protein synthesis (the stress level within the cell through the induction of ROS. Further- 457 442 shiga toxin 2 is an N-glycosyidase), in human colorectal carcinoma more, these data, together with the fact that caspase-2 can func- 458 443 cells or brain microvascular endothelial cells, respectively (Bhatta- tion in response to DNA damage (Cullen and Martin, 2009; 459 444 charjee et al., 2005; Fujii et al., 2008). The gene encoding the core Krumschnabel et al., 2009; Zhivotovsky and Orrenius, 2005), is 460 445 histone protein HIST2H4 was also upregulated in both IM-9 and highly activated by ch128.1Av/b-SO6 (Daniels et al., 2007) suggest 461 446 U266 cells. HIST2H4 can regulate DNA repair and has been shown that the toxin induces DNA damage in treated cells. 462 447 to be upregulated by photodynamic therapy, which induces an in- Treatment with the ch128.1Av/b-SO6 conjugate also upregu- 463 448 crease in cellular ROS levels (Cekaite et al., 2007). Reactive oxygen lated other genes involved in RNA binding and processing, as well 464 449 species (ROS) can interact with signaling molecules, other proteins, as the inhibition of the NF-jB pathway. THUMPD2 encodes for a 465 450 and nucleic acids causing a variety of changes in growth signaling methyltransferase with a putative RNA-binding domain whose 466

8 T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx

A U266 is understandable as a compensatory response, given the fact that 471 b-SO6 strongly inhibits protein synthesis. Additionally, the NF-jB 472 ch128.1Av ch128.1Av/b-SO6 b-SO6 16 pathway is also affected by b-SO6 treatment. The NF-jB family 473 14 of transcription factors play a role in immunity, inﬂammatory re- 474 sponses, and ultimately cell growth (Bubici et al., 2006). A unique 475 12 interaction occurs between ROS and the NF-jB pathway. Depend- 476 10 ing on the circumstances, ROS can either induce or inhibit the NF- 477 jB pathway (Bubici et al., 2006). The activity of these transcription 478 8 factors is regulated by a family of inhibitors (IjBs), one of which is 479 encoded by the gene NFKBIE (I B )(Li and Nabel, 1997; Whiteside 480

Fold Change 6 j e et al., 1997). This inhibitor blocks NF-jB activity by sequestering 481 4 certain family members in the cytoplasm and keeping them from 482 2 translocating to the nucleus. In our studies, b-SO6 also upregulated 483 the protein encoded by the TSC22D3 gene. This protein is known to 484 0 inhibit inﬂammation (Beaulieu et al., 2010) and NF-jB activity (Di 485 P 2 1 B 3 E I 4B D 5 D 1 PD T 2 Marco et al., 2007). Furthermore, TSC22D3 is upregulated by gluco- 486 XN RGS1 KLF6 LHB1 2 T DC ST2H4 YT FKBI I UM H F DD4 N C H B A SC corticoid treatment in MM cells (Grugan et al., 2008). Moreover, 487 H T G T ch128.1Av/b-SO6 upregulates the RGS1 protein that is known to 488 B IM-9 block signal transduction blocking the activity of GTPase activating 489 proteins (Bansal et al., 2007). Recently, RGS1 levels increased in 490 30 plant cells treated with ozone, which was shown to induce ROS 491 levels (Booker et al., 2012). Taken together, our data suggest that 492 25 b-SO6 induces a transcriptional response in malignant B cells con- 493 sistent with the induction of oxidative stress/DNA damage that re- 494 20 sults in the blockage of signal transduction, cell cycle arrest, and 495 ultimately apoptosis. However, 10 out of the 11 genes that were 496 15 upregulated by the ch128.1Av/b-SO6 conjugate were also upregu- 497 lated by the protein synthesis inhibitor CHX. This compound inter- 498

Fold Change 10 feres with the translocation step in protein synthesis and thus, 499 inhibits translational elongation. These data suggest that the ob- 500 5 served transcriptional response is not specific to the effects of 501 the toxin per se, but rather, is a response to a block in protein 502 0 synthesis. 503 P B 4 B I 4 H B1 5 N 1 GS1 TD1 2D3 BIE 504 KLF6 H K To our knowledge this is a pioneer study in terms of the gobal T2T R L T 2 F TX DC S UM PD2 H Y DD 4 C C I BH F A N expression analysis in cancer cells treated with SO6 alone or bound 505 H TH G TS to any delivery vehicle. However, a gene expression analysis has 506 Fig. 5. Validation of gene expression changes by real time PCR. Freshly isolated RNA been conducted in human airway cells treated with the native ricin 507 from U266 (A) and IM-9 (B) cells treated with either 10 nM ch128.1Av, b-SO6, or toxin for 24 h (Wong et al., 2007). This analysis showed the upreg- 508 ch128.1Av/b-SO6 for 24 h was converted to cDNA and gene expression determined ulation of a variety of histones; however, HIST2H4 (upregulated by 509 using relative quantification analysis on a Roche LightCycler 480 System. Data is shown as the fold change in target gene expression compared to the housekeeping b-SO6 in our studies) was not one of them. Ricin did increase the 510 gene GAPDH. All samples were tested in triplicate and the standard deviations are expression of HIST2H2AA and TNFAIP3, which were observed to 511 shown. Data are representative of two independent experiments carried out with be upregulated by b-SO6 in our studies, but only in IM-9 cells. Fur- 512 different RNA preparations. thermore, in murine kidney cells isolated from animals in which ri- 513 cin was administered intravenously, gene expression changes 514 included a decrease in ATF4 expression and an increase in ICAM- 515 Table 2 Comparison of microarray and QPCR data for the 11 genes commonly upregulated in 1(Korcheva et al., 2005), which were also differentially expressed 516 IM-9 and U266 cells. in our studies in IM-9 cells only. In general, the genes upregulated 517 by ricin in these two studies did not overlap with the 11 genes that 518 Gene U266 U266 QPCR IM-9 IM-9 QPCR Micoarray (Fold Change) Microarray (Fold Change) were seen to be upregulated in both IM-9 and U266 cells under our 519 (Fold Change) (Fold Change) study conditions. 520 TXNIP 3.0 8.2 8.4 22.4 In order to confirm the role of ROS in the cell-death mediated by 521 CDC14B 2.9 2.2 15.2 2.9 b-SO6, we co-incubated cells with the antioxidant NAC. Surpris- 522 HIST2H4 2.3 2.0 9.4 5.7 ingly, even though b-SO6 is a potent inhibitor of protein synthesis, 523 RGS1 4.1 14.5 6.8 18.8 the protective effect of NAC was very strong. This suggests that, in 524 THUMPD2 2.1 5.3 3.6 6.2 525 KLF6 2.3 5.6 4.6 8.6 addition to the inhibition of protein synthesis, ROS play a major BHLHB1 2.0 2.9 2.9 1.9 role in b-SO6-mediated cytotoxicity. In our study, NAC was unable 526 FYTTD1 2.1 2.0 3.5 2.5 to block the effects of CHX, even though the transcriptional re- 527 GADD45B 2.1 13.1 13.5 25.5 sponse to CHX and the immunotoxin were similar. We observed 528 TSC22D3 2.9 12.8 2.9 8.1 that apoptosis induced by CHX occurred at a faster rate and thus, 529 NFKBIE 2.1 4.9 6.4 7.5 the effects of CHX may have been too strong for NAC to neutralize. 530 Alternatively, there may be a difference in the type of ROS gener- 531 ated by the two treatments and NAC can only protect from those 532 467 function is not understood (Aravind and Koonin, 2001). FYTTD1 en- induced by b-SO6. Further studies are needed to understand this 533 468 codes a protein that is required for mRNA processing and export phenomenon. The fact that NAC can block apoptosis induced by 534 469 from the nucleus to the cytosol (Hautbergue et al., 2009). This our conjugate is consistent with the observation that NAC was able 535 470 upregulation of proteins involved in RNA binding and processing to block the DNA damage induced by abrin, a Type I RIP similar to 536

T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx 9

IM-9 U266

120 -NAC +NAC 100 -NAC +NAC + 100 80 80 * 60 60 nnexin V 40 40

% A n * 20 20

ch128.1Av ch128.1Av/ b-SO6 1 g/mL ch128 .1Av ch128.1Av/ b-SO6 100 g/mL b-S06 CHX b-S06 CHX 10 nM Treatments 10 nM Treatments

100 IM-9 100 U266

+ 80 80

60 60

nexin V * 40 40

20 20 * % An

ch128.1Av ch128.1Av/ b-SO6 0.1 g/mL ch128.1Av ch128.1Av/ b-SO6 10 g/mL b-SO6 CHX b-S06 CHX 1 nM Treatments 1 nM Treatments

Fig. 6. Protection of ch128.1Av/b-SO6-induced cell death by the antioxidant NAC. IM-9 (left panels) and U266 (right panels) cells were treated with 10 nM (top panels) or 1 nM (bottom panels) ch128.1Av, b-SO6, or ch128.1Av/b-SO6 for 48 h with or without the addition of 2 mM NAC. CHX was used as a common protein synthesis inhibitor. The percentage of Annexin V positive cells was determined using ﬂow cytometry. Data are the average of three independent experiments. Error bars indicate the standard deviation. ⁄p < 0.01, Student’s t-test.

U266 IM-9 Table 3 Effect of ch128.1Av on normal pluripotent hematopoietic progenitor cells from three Nucleus Cytoplasm Nucleus Cytoplasm separate donors as determined by the LTC-IC assay. MW (kDa) C 1h 16h C 1h 16h C 1h 16h C 1h 16h Donor 1 Donor 2 Donor 3 41 Untreated 7 ± 0.96 1 ± 0.82 13 ± 1.71 Buffer 13 ± 1.00 3 ± 1.83 ND saporin 30 ch128.1Av 15 ± 2.20 3 ± 1.50 13 ± 2.16 b-SO6 15 ± 2.63 9 ± 2.08 21 ± 1.15 IgG3-Av/b-SO6 10 ± 1.83 8 ± 1.71 20 ± 2.71 ch128.1Av/b-SO6 12 ± 1.50 10 ± 2.65 21 ± 2.5 41 GAPDH Data represent the mean of quadruplicates ±the standard deviation. LTC-IC indi- 30 cates long-term cell-initiating culture; ND, not determined. Data for the untreated, buffer, and ch128.1Av alone have been previously reported (Daniels et al., 2011). All samples were tested simultaneously in each donor. 53 TBP 41

synthesis but did not appear to induce DNA damage. This is consis- 543 Fig. 7. Detection of b-SO6 in nuclear extracts of cells treated with ch128.Av/b-SO6 tent with our study showing that NAC did not block the cytotoxic 544 conjugate. U266 (left panels) and IM-9 (right panels) were treated with 10 nM effects of CHX. Taken together, these studies suggest that while 545 ch128.1Av/b-SO6 for either 1 h or 16 h followed by the preparation of nuclear and 546 cytoplasmic extracts. Saporin within these extracts was detected by Western Blot RIPs are potent inhibitors of protein synthesis, they also induce analysis. Control cells (‘‘C’’) were incubated with an equal amount of buffer for 16 h. oxidative stress that contributes their cytotoxic effects. 547 GAPDH was used a control for cytoplasmic protein, while TBP was used as a control Although SO6 lacks a cell-binding domain, at high concentra- 548 for nuclear protein. tions and under certain conditions, it can enter cells and cause 549 cytotoxicity (Lombardi et al., 2010). It has been suggested that in 550 some cases the LDL-related family of receptors may be involved 551 537 b-SO6, in U937 human myeloleukemic cells (Bhaskar et al., 2008). in the uptake of the natural toxin in mammalian cells. It has also 552 538 Ricin-induced apoptosis is also mediated by the generation of ROS been suggested that the natural toxin is taken up mostly by recep- 553 539 in the HeLa human cervical cancer cell line (Rao et al., 2005). How- tor-independent endocytosis (Bolognesi et al., 2012). Since SO6 is 554 540 ever, ricin has also been shown to cause direct DNA damage that known to act on the ribosomes to block protein synthesis, the toxin 555 541 occurs prior to the induction of apoptosis (Brigotti et al., 2002). must ultimately reach the cytosol. However, its intracellular traf- 556 542 CHX was also used in that study and was shown to block protein ﬁcking is still largely unknown (Lombardi et al., 2010). It has been 557

10 T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx

558 suggested that SO6 can remove adenine from DNA through its N- conjugate is toxic to late (committed) progenitor cells of both the 624 559 glycosidase activity (Gasperi-Campani et al., 2005; Roncuzzi and erythroid and myeloid lineages (CFU-e, BFU-e and CFU-GM) (Dan- 625 560 Gasperi-Campani, 1996), although this is controversial (Lombardi iels et al., 2011) that are known to express the TfR1 (Daniels et al., 626 561 et al., 2010). However, if this is the case, SO6 must reach the nu- 2006b). Our results are consistent with a previous in vitro study 627 562 cleus. Although the catalytic activity of SO6 is similar to that of ri- (that also used the LTC-IC assay), which demonstrated the deple- 628 563 cin, the intracellular trafficking of the two toxins clearly differs. tion of committed progenitor cells while pluripotent progenitors 629 564 Ricin (a Type II RIP that contains a cell-binding domain) undergoes were spared if human bone marrow cells were treated with an 630 565 retrograde transport through the endoplasmic reticulum where it immuntoxin composed of SO6 chemically conjugated with the 631 566 exploits the ER-associated degradation pathway to reach the cyto- OKT9 antibody that targets the TfR1 (Benedetti et al., 1994). To- 632 567 sol (Spooner et al., 2006; Vago et al., 2005). Previous studies have gether, these results suggests that while the immunotoxin may 633 568 suggested that saporin (specific isoform not specified) may traffic have toxicity against committed progenitor cells, these cells can 634 569 through an endosomal compartment due to partial colocalization be repopulated by the pluripotent progenitors that are not affected 635 570 with disulphide isomerase, an endoplasmic reticulum marker, in by treatment with the conjugate. These results also suggest that 636 571 GL15 human glioblastoma cells (Cimini et al., 2011) and LAMP2, the ch128.1Av/b-SO6 conjugate may be a therapeutic option for 637 572 a late endosome marker, in Vero monkey kidney cells (Vago et the ex vivo purging of cancer cells during autologous stem cell 638 573 al., 2005). Saporin did not colocalize with the early endosome mar- transplantation, a treatment option for some patients affected with 639 574 ker EEA1 or the Golgi marker Golgin 97 (Vago et al., 2005). Another incurable B-cell malignancies such as MM, in which grafts can be 640 575 study found SO6 localized intracellularly within 20 min (Bolognesi contaminated with MM cells that may shorten progression-free 641 576 et al., 2012). At this time SO6 was detected in endocytic vesicles in survival (Bashey et al., 2008; Vogel et al., 2005). 642 577 the HeLa cytosol accumulating in a perinuclear vesicular structure In conclusion, in this study we further examined the mecha- 643 578 via fluorescence microscopy detection. About 30% of SO6 colocal- nism of b-SO6-induced apoptosis when the toxin is delivered into 644 579 ized with the endosomal compartment (ER marker BiP) while malignant B cells using ch128.1Av. Our results here suggest that in 645 580 around 7% co-localized with the Golgi apparatus (Golgi marker addition to its RIP function, b-SO6 induces the generation of ROS, 646 581 GM130) as seen by confocal microscopy. After a 1-h incubation, which may play a role in DNA damage and ultimately the induction 647 582 4% of endocytosed SO6 was detected in the nucleus. Using trans- of apoptosis in malignant B cells by the ch128.1Av/b-SO6 conju- 648 583 mission electron microscopy, gold-saporin molecules were seen gate. Our studies confirm the dual activity of ch128.1Av, in that 649 584 migrating from the plasma membrane and clear vesicles and vacu- it can be a direct anti-cancer agent, as well as an effective delivery 650 585 oles into perinuclear late endosomes and lysosomes, with approx- agent for the transport of active molecules into cancer cells. Thus, 651 586 imately 10% of cells showing saporin nuclear localization ch128.1Av alone or conjugated to therapeutic agents should be fur- 652 587 (Bolognesi et al., 2012). In addition, recombinant 125I-SO6 appears ther explored as a potential therapy for B-cell malignancies. 653 588 to migrate from the cytosol to the nuclear fraction over time in 589 J774A.1 mouse macrophage cells as detected by immunoblotting Conflicts of interest 654 590 (Bagga et al., 2003). 591 It stands to reason that conjugation of SO6 to a delivery vehicle The authors have no conflicts to disclose. 655 592 would alter the natural trafficking of the toxin at least at the early 593 stages. The delivery of saporin (specific isoform not specified) con- Acknowledgements 656 594 jugated to polyamidoamine dendrimer (PAMAM) coupled with the 595 photochemical internalization (PCI) technology, which break- This work was supported in part by NIH/NCI R01CA107023, 657 596 downs endosomal/lysosomal membranes by activating photosen- R01CA57152, and K01CA138559. This work was also supported 658 597 sitizers localized on the membranes, resulted in enhanced by the Howard Hughes Medical Institute Gilliam Fellowship, the 659 598 delivery of saporin into Ca9–22 gingival cancer cells (Lai et al., Whitcome Fellowship of the Molecular Biology Institute at UCLA, 660 599 2008). Furthermore, saporin was found in the nucleus under these the UCLA Amgen Scholars Program, and the Amgen Foundation. 661 600 conditions. In our colocalization studies, b-SO6 delivered by The UCLA Jonsson Comprehensive Cancer Center and Center for 662 601 ch128.1Av accumulated in cytoplasmic vesicles and did not show AIDS Research Flow Cytometry Core Facility is supported by the 663 602 a clear and consistent pattern of intranuclear localization. Since NIH awards CA16042 and AI28697, the Jonsson Cancer Center, 664 603 we used only 10 nM of the toxin in our studies, and such small per- the UCLA AIDS Institute, and the UCLA School of Medicine. The 665 604 centage of saporin has been reported to enter the nucleus, it is pos- UCLA CNSI Advanced Light Microscopy/Spectroscopy Shared Re- 666 605 sible that b-SO6 was not clearly observed in the nucleus due to the source Facility is supported by NIH-NCRR shared resources grant 667 606 detection limits of confocal microscopy. However, we were able to (CJX1-44835-WS-29646) and NSF Major Research Instrumentation 668 607 detect b-SO6 in nuclear extracts of treated cells by Western Blot grant (CHE-0722519). Gustavo Helguera is member of the National 669 608 analysis, although we cannot determine if the toxin is associated Council for Scientific and Technological Research (CONICET), 670 609 with the nuclear membrane or if it is actually within the nucleus. Argentina and is supported by PICT PRH 2008-00315, PIP 114- 671 610 Since the toxin may have reached the nucleus, it is possible that 2011-01-00139, and UBACYT 200-2011-02-00027. 672 611 it can interact directly with DNA, although we do not have direct 612 evidence for this at this time. Whether or not b-SO6 directly in- Appendix A. Supplementary data 673 613 duces DNA damage, its high toxicity and inability to enter cells 614 at low concentrations make it a meaningful therapeutic agent for Supplementary data associated with this article can be found, in 674 615 delivery purposes. the online version, at http://dx.doi.org/10.1016/j.tiv.2012.10.006. 675 616 Toxicity to normal cells is always a concern with any anti-can- 617 cer drug. In order to address this concern, we evaluated the toxicity References 676 618 of ch128.1Av/b-SO6 on hematopoietic stem and non-committed 619 progenitor cells. Our data show that there was no observed toxicity Aravind, L., Koonin, E.V., 2001. THUMP-a predicted RNA-binding domain shared by 677 620 on this population of cells. This is consistent with the fact that 4-thiouridine, pseudouridine synthases and RNA methylases. Trends Biochem. 678 679 621 these non-committed progenitors express very low levels of the Sci. 26, 215–217. Bagga, S., Seth, D., Batra, J.K., 2003. The cytotoxic activity of ribosome-inactivating 680 622 TfR1/CD71 (Gross et al., 1997; Knaan-Shanzer et al., 2008; Lans- protein saporin-6 is attributed to its rRNA N-glycosidase and internucleosomal 681 623 dorp and Dragowska, 1992). We have previously shown that the DNA fragmentation activities. J. Biol. Chem. 278, 4813–4820. 682

T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx 11

683 Bansal, G., Druey, K.M., Xie, Z., 2007. R4 RGS proteins: regulation of G-protein Di Marco, B., Massetti, M., Bruscoli, S., Macchiarulo, A., Di Virgilio, R., Velardi, E., 768 684 signaling and beyond. Pharmacol. Ther. 116, 473–495. Donato, V., Migliorati, G., Riccardi, C., 2007. Glucocorticoid-induced leucine 769 685 Bashey, A., Perez, W.S., Zhang, M.J., Anderson, K.C., Ballen, K., Berenson, J.R., To, L.B., zipper (GILZ)/NF-kappaB interaction: role of GILZ homo-dimerization and C- 770 686 Fonseca, R., Freytes, C.O., Gale, R.P., Gibson, J., Giralt, S.A., Kyle, R.A., Lazarus, terminal domain. Nucleic Acids Res. 35, 517–528. 771 687 H.M., Maharaj, D., McCarthy, P.L., Milone, G.A., Nimer, S., Pavlovsky, S., Reece, Fogg, V.C., Lanning, N.J., Mackeigan, J.P., 2011. Mitochondria in cancer: at the 772 688 D.E., Schiller, G., Vesole, D.H., Hari, P., 2008. Comparison of twin and autologous crossroads of life and death. Chin. J. Cancer 30, 526–539. 773 689 transplants for multiple myeloma. Biol. Blood Marrow Transplant. 14, 1118– Fujii, J., Wood, K., Matsuda, F., Carneiro-Filho, B.A., Schlegel, K.H., Yutsudo, T., 774 690 1124. Binnington-Boyd, B., Lingwood, C.A., Obata, F., Kim, K.S., Yoshida, S., Obrig, T., 775 691 Beaulieu, E., Ngo, D., Santos, L., Yang, Y.H., Smith, M., Jorgensen, C., Escriou, V., 2008. Shiga toxin 2 causes apoptosis in human brain microvascular endothelial 776 692 Scherman, D., Courties, G., Apparailly, F., Morand, E.F., 2010. Glucocorticoid- cells via C/EBP homologous protein. Infect. Immun. 76, 3679–3689. 777 693 induced leucine zipper is an endogenous antiinflammatory mediator in Gasperi-Campani, A., Brognara, I., Baiocchi, D., Roncuzzi, L., 2005. Mitochondrial 778 694 arthritis. Arthritis Rheum. 62, 2651–2661. DNA D-loop as a new target of saporin 6 nuclease activity. Toxicon 45, 475–480. 779 695 Benedetti, G., Bondesan, P., Caracciolo, D., Cherasco, C., Ruggieri, D., Gastaldi, M.E., Ghaleb, A.M., Yang, V.W., 2008. The pathobiology of kruppel-like factors in 780 696 Pileri, A., Gianni, A.M., Tarella, C., 1994. Selection and characterization of early colorectal cancer. Curr. Colorectal Cancer Rep. 4, 59–64. 781 697 hematopoietic progenitors using an anti-CD71/S06 immunotoxin. Exp. Gross, S., Helm, K., Gruntmeir, J.J., Stillman, W.S., Pyatt, D.W., Irons, R.D., 1997. 782 698 Hematol. 22, 166–173. Characterization and phenotypic analysis of differentiating CD34+ human bone 783 699 Benzeno, S., Narla, G., Allina, J., Cheng, G.Z., Reeves, H.L., Banck, M.S., Odin, J.A., Diehl, marrow cells in liquid culture. Eur. J. Haematol. 59, 318–326. 784 700 J.A., Germain, D., Friedman, S.L., 2004. Cyclin-dependent kinase inhibition by Grugan, K.D., Ma, C., Singhal, S., Krett, N.L., Rosen, S.T., 2008. Dual regulation of 785 701 the KLF6 tumor suppressor protein through interaction with cyclin D1. Cancer glucocorticoid-induced leucine zipper (GILZ) by the glucocorticoid receptor and 786 702 Res. 64, 3885–3891. the PI3-kinase/AKT pathways in multiple myeloma. J. Steroid Biochem. Mol. 787 703 Bhaskar, A.S., Deb, U., Kumar, O., Lakshmana Rao, P.V., 2008. Abrin induced Biol. 110, 244–254. 788 704 oxidative stress mediated DNA damage in human leukemic cells and its reversal Hautbergue, G.M., Hung, M.L., Walsh, M.J., Snijders, A.P., Chang, C.T., Jones, R., 789 705 by N-acetylcysteine. Toxicol. In Vitro 22, 1902–1908. Ponting, C.P., Dickman, M.J., Wilson, S.A., 2009. UIF, a New mRNA export adaptor 790 706 Bhattacharjee, R.N., Park, K.S., Uematsu, S., Okada, K., Hoshino, K., Takeda, K., that works together with REF/ALY, requires FACT for recruitment to mRNA. 791 707 Takeuchi, O., Akira, S., Iida, T., Honda, T., 2005. Escherichia coli verotoxin 1 Curr. Biol. 19, 1918–1924. 792 708 mediates apoptosis in human HCT116 colon cancer cells by inducing Knaan-Shanzer, S., van der Velde-van Dijke, I., van de Watering, M.J., de Leeuw, P.J., 793 709 overexpression of the GADD family of genes and S phase arrest. FEBS Lett. Valerio, D., van Bekkum, D.W., de Vries, A.A., 2008. Phenotypic and functional 794 710 579, 6604–6610. reversal within the early human hematopoietic compartment. Stem Cells 26, 795 711 Bolognesi, A., Polito, L., Scicchitano, V., Orrico, C., Pasquinelli, G., Musiani, S., Santi, S., 3210–3217. 796 712 Riccio, M., Bortolotti, M., Battelli, M.G., 2012. Endocytosis and intracellular Korcheva, V., Wong, J., Corless, C., Iordanov, M., Magun, B., 2005. Administration of 797 713 localisation of Type 1 ribosome-inactivating protein saporin-s6. J. Biol. Regul. ricin induces a severe inflammatory response via nonredundant stimulation of 798 714 Homeost. Agents 26, 97–109. ERK, JNK, and P38 MAPK and provides a mouse model of hemolytic uremic 799 715 Booker, F., Burkey, K., Morgan, P., Fiscus, E., Jones, A., 2012. Minimal influence of G- syndrome. Am. J. Pathol. 166, 323–339. 800 716 protein null mutations on ozone-induced changes in gene expression, foliar Krumschnabel, G., Sohm, B., Bock, F., Manzl, C., Villunger, A., 2009. The enigma of 801 717 injury, gas exchange and peroxidase activity in Arabidopsis thaliana L. Plant Cell caspase-2: the laymen’s view. Cell Death Differ. 16, 195–207. 802 718 Environ. 35, 668–681. Lai, P.S., Pai, C.L., Peng, C.L., Shieh, M.J., Berg, K., Lou, P.J., 2008. Enhanced 803 719 Brigotti, M., Alfieri, R., Sestili, P., Bonelli, M., Petronini, P.G., Guidarelli, A., Barbieri, L., cytotoxicity of saporin by polyamidoamine dendrimer conjugation and 804 720 Stirpe, F., Sperti, S., 2002. Damage to nuclear DNA induced by shiga toxin 1 and photochemical internalization. J. Biomed. Mater. Res. A 87, 147–155. 805 721 ricin in human endothelial cells. FASEB J. 16, 365–372. Lansdorp, P.M., Dragowska, W., 1992. Long-term erythropoiesis from constant 806 722 Bubici, C., Papa, S., Dean, K., Franzoso, G., 2006. Mutual cross-talk between reactive numbers of CD34+ cells in serum-free cultures initiated with highly purified 807 723 oxygen species and nuclear factor-kappa B: molecular basis and biological progenitor cells from human bone marrow. J. Exp. Med. 175, 1501–1509. 808 724 significance. Oncogene 25, 6731–6748. Li, Z., Nabel, G.J., 1997. A new member of the I kappaB protein family, I kappaB 809 725 Catlett-Falcone, R., Landowski, T.H., Oshiro, M.M., Turkson, J., Levitzki, A., Savino, R., epsilon, inhibits RelA (p65)-mediated NF-kappaB transcription. Mol. Cell. Biol. 810 726 Ciliberto, G., Moscinski, L., Fernandez-Luna, J.L., Nunez, G., Dalton, W.S., Jove, R., 17, 6184–6190. 811 727 1999. Constitutive activation of Stat3 signaling confers resistance to apoptosis Lombardi, A., Marshall, R.S., Savino, C., Serena Fabrini, M., Ceriotti, A., 2010. Type I 812 728 in human U266 myeloma cells. Immunity 10, 105–115. ribosome-inactivating proteins from Saponaria officinialis. In: Lord, J.M., Hartley, 813 729 Cekaite, L., Peng, Q., Reiner, A., Shahzidi, S., Tveito, S., Furre, I.E., Hovig, E., 2007. M.R. (Eds.), Toxic Plant Proteins. Springer-Verlag, Berlin Heidelberg, Germany, 814 730 Mapping of oxidative stress responses of human tumor cells following pp. 55–78. 815 731 photodynamic therapy using hexaminolevulinate. BMC Genomics 8, 273. Mates, J.M., Segura, J.A., Alonso, F.J., Marquez, J., 2012. Oxidative stress in apoptosis 816 732 Cimini, A., Mei, S., Benedetti, E., Laurenti, G., Koutris, I., Cinque, B., Cifone, M.G., and cancer: an update. Arch. Toxicol., 19–25 (Epub ahead of print). 817 733 Galzio, R., Pitari, G., Di Leandro, L., Giansanti, F., Lombardi, A., Fabbrini, M.S., Mocciaro, A., Berdougo, E., Zeng, K., Black, E., Vagnarelli, P., Earnshaw, W., Gillespie, 818 734 Ippoliti, R., 2011. Distinct cellular responses induced by saporin and a D., Jallepalli, P., Schiebel, E., 2010. Vertebrate cells genetically deficient for 819 735 transferrin-saporin conjugate in two different human glioblastoma cell lines. Cdc14A or Cdc14B retain DNA damage checkpoint proficiency but are impaired 820 736 J. Cell Physiol. 227, 939–951. in DNA repair. J. Cell Biol. 189, 631–639. 821 737 Cullen, S.P., Martin, S.J., 2009. Caspase activation pathways: some recent progress. Ng, P.P., Dela Cruz, J.S., Sorour, D.N., Stinebaugh, J.M., Shin, S.U., Shin, D.S., Morrison, 822 738 Cell Death Differ. 16, 935–938. S.L., Penichet, M.L., 2002. An anti-transferrin receptor-avidin fusion protein 823 739 Cullingford, T.E., Butler, M.J., Marshall, A.K., Tham el, L., Sugden, P.H., Clerk, A., 2008. exhibits both strong proapoptotic activity and the ability to deliver various 824 740 Differential regulation of Kruppel-like factor family transcription factor molecules into cancer cells. Proc. Natl. Acad. Sci. USA 99, 10706–10711. 825 741 expression in neonatal rat cardiac myocytes: effects of endothelin-1, Ng, P.P., Helguera, G., Daniels, T.R., Lomas, S.Z., Rodriguez, J.A., Schiller, G., Bonavida, 826 742 oxidative stress and cytokines. Biochim. Biophys. Acta 1783, 1229–1236. B., Morrison, S.L., Penichet, M.L., 2006. Molecular events contributing to cell 827 743 Daniels, T.R., Bernabeu, E., Rodriguez, J.A., Patel, S., Kozman, M., Chiappetta, D.A., death in malignant human hematopoietic cells elicited by an IgG3-avidin fusion 828 744 Holler, E., Ljubimova, J.Y., Helguera, G., Penichet, M.L., 2012. The transferrin protein targeting the transferrin receptor. Blood 108, 2745–2754. 829 745 receptor and the targeted delivery of therapeutic agents against cancer. Ortiz-Sanchez, E., Daniels, T.R., Helguera, G., Martinez-Maza, O., Bonavida, B., 830 746 Biochim. Biophys. Acta 1820, 291–317. Penichet, M.L., 2009. Enhanced cytotoxicity of an anti-transferrin receptor IgG3- 831 747 Daniels, T.R., Delgado, T., Helguera, G., Penichet, M.L., 2006a. The transferrin avidin fusion protein in combination with gambogic acid against human 832 748 receptor part II: targeted delivery of therapeutic agents into cancer cells. Clin. malignant hematopoietic cells: functional relevance of iron, the receptor, and 833 749 Immunol. 121, 159–176. reactive oxygen species. Leukemia 23, 59–70. 834 750 Daniels, T.R., Delgado, T., Rodriguez, J.A., Helguera, G., Penichet, M.L., 2006b. The Ou, D.L., Shen, Y.C., Yu, S.L., Chen, K.F., Yeh, P.Y., Fan, H.H., Feng, W.C., Wang, C.T., Lin, 835 751 transferrin receptor part I: biology and targeting with cytotoxic antibodies for L.I., Hsu, C., Cheng, A.L., 2010. Induction of DNA damage-inducible gene 836 752 the treatment of cancer. Clin. Immunol. 121, 144–158. GADD45beta contributes to sorafenib-induced apoptosis in hepatocellular 837 753 Daniels, T.R., Ng, P.P., Delgado, T., Lynch, M.R., Schiller, G., Helguera, G., Penichet, carcinoma cells. Cancer Res. 70, 9309–9318. 838 754 M.L., 2007. Conjugation of an anti transferrin receptor IgG3-avidin fusion Rao, P.V., Jayaraj, R., Bhaskar, A.S., Kumar, O., Bhattacharya, R., Saxena, P., Dash, P.K., 839 755 protein with biotinylated saporin results in significant enhancement of its Vijayaraghavan, R., 2005. Mechanism of ricin-induced apoptosis in human 840 756 cytotoxicity against malignant hematopoietic cells. Mol. Cancer Ther. 6, 2995– cervical cancer cells. Biochem. Pharmacol. 69, 855–865. 841 757 3008. Ray, P.D., Huang, B.W., Tsuji, Y., 2012. Reactive oxygen species (ROS) homeostasis 842 758 Daniels, T.R., Ortiz-Sanchez, E., Luria-Perez, R., Quintero, R., Helguera, G., Bonavida, and redox regulation in cellular signaling. Cell. Signal. 24, 981–990. 843 759 B., Martinez-Maza, O., Penichet, M.L., 2011. An antibody-based multifaceted Rodriguez, J.A., Helguera, G., Daniels, T.R., Neacato, I.I., Lopez-Valdes, H.E., Charles, 844 760 approach targeting the human transferrin receptor for the treatment of B-cell A.C., Penichet, M.L., 2007. Binding specificity and internalization properties of 845 761 malignancies. J. Immunother. 34, 500–508. an antibody-avidin fusion protein targeting the human transferrin receptor. J. 846 762 Dansithong, W., Wolf, C.M., Sarkar, P., Paul, S., Chiang, A., Holt, I., Morris, G.E., Control. Release 124, 35–42. 847 763 Branco, D., Sherwood, M.C., Comai, L., Berul, C.I., Reddy, S., 2008. Cytoplasmic Rodriguez, J.A., Luria-Perez, R., Lopez-Valdes, H.E., Casero, D., Daniels, T.R., Patel, S., 848 764 CUG RNA foci are insufficient to elicit key DM1 features. PLoS One 3, e3968. Avila, D., Leuchter, R., So, S., Ortiz-Sanchez, E., Bonavida, B., Martinez-Maza, O., 849 765 de Virgilio, M., Lombardi, A., Caliandro, R., Fabbrini, M.S., 2010. Ribosome- Charles, A.C., Pellegrini, M., Helguera, G., Penichet, M.L., 2011. Lethal iron 850 766 inactivating proteins: from plant defense to tumor attack. Toxins (Basel) 2, deprivation induced by non-neutralizing antibodies targeting transferrin 851 767 2699–2737. receptor 1 in malignant B cells. Leuk. Lymphoma 52, 2169–2178. 852

12 T.R. Daniels-Wells et al. / Toxicology in Vitro xxx (2012) xxx–xxx

853 Roncuzzi, L., Gasperi-Campani, A., 1996. DNA-nuclease activity of the single-chain Vogel, W., Kopp, H.G., Kanz, L., Einsele, H., 2005. Myeloma cell contamination of 878 854 ribosome-inactivating proteins dianthin 30, saporin 6 and gelonin. FEBS Lett. peripheral blood stem-cell grafts can predict the outcome in multiple myeloma 879 855 392, 16–20. patients after high-dose chemotherapy and autologous stem-cell 880 856 Santanche, S., Bellelli, A., Brunori, M., 1997. The unusual stability of saporin, a transplantation. J. Cancer Res. Clin. Oncol. 131, 214–218. 881 857 candidate for the synthesis of immunotoxins. Biochem. Biophys. Res. Commun. Wei, Z., Peddibhotla, S., Lin, H., Fang, X., Li, M., Rosen, J.M., Zhang, P., 2011. Early- 882 858 234, 129–132. onset aging and defective DNA damage response in Cdc14b-deficient mice. Mol. 883 859 Sikriwal, D., Ghosh, P., Batra, J.K., 2008. Ribosome inactivating protein saporin Cell. Biol. 31, 1470–1477. 884 860 induces apoptosis through mitochondrial cascade, independent of translation Whiteside, S.T., Epinat, J.C., Rice, N.R., Israel, A., 1997. I kappa B epsilon, a novel 885 861 inhibition. Int. J. Biochem. Cell Biol. 40, 2880–2888. member of the I kappa B family, controls RelA and cRel NF-kappa B activity. 886 862 Skommer, J., Wlodkowic, D., Pelkonen, J., 2007. Gene-expression profiling during EMBO J. 16, 1413–1426. 887 863 curcumin-induced apoptosis reveals downregulation of CXCR4. Exp. Hematol. Wong, J., Korcheva, V., Jacoby, D.B., Magun, B.E., 2007. Proinflammatory responses of 888 864 35, 84–95. human airway cells to ricin involve stress-activated protein kinases and NF- 889 865 Spooner, R.A., Smith, D.C., Easton, A.J., Roberts, L.M., Lord, J.M., 2006. Retrograde kappaB. Am. J. Physiol. Lung Cell. Mol. Physiol. 293, L1385–L1394. 890 866 transport pathways utilised by viruses and protein toxins. Virol. J. 3, 26– Yamada, K., Miyamoto, K., 2005. Basic helix-loop-helix transcription factors, 891 867 35. BHLHB2 and BHLHB3; their gene expressions are regulated by multiple 892 868 Thin, T.H., Li, L., Chung, T.K., Sun, H., Taneja, R., 2007. Stra13 is induced by genotoxic extracellular stimuli. Front. Biosci. 10, 3151–3171. 893 869 stress and regulates ionizing-radiation-induced apoptosis. EMBO Rep. 8, 401– Yoshioka, J., Schreiter, E.R., Lee, R.T., 2006. Role of thioredoxin in cell growth through 894 870 407. interactions with signaling molecules. Antioxid. Redox Signal. 8, 2143–2151. 895 871 Thyss, R., Virolle, V., Imbert, V., Peyron, J.F., Aberdam, D., Virolle, T., 2005. NF- Zhivotovsky, B., Orrenius, S., 2005. Caspase-2 function in response to DNA damage. 896 872 kappaB/Egr-1/Gadd45 are sequentially activated upon UVB irradiation to Biochem. Biophys. Res. Commun. 331, 859–867. 897 873 mediate epidermal cell death. EMBO J. 24, 128–137. Zhou, J., Chng, W.J., 2012. Roles of thioredoxin binding protein (TXNIP) in oxidative 898 874 Vago, R., Marsden, C.J., Lord, J.M., Ippoliti, R., Flavell, D.J., Flavell, S.U., Ceriotti, stress apoptosis and cancer. Mitochondrion (Epub ahead of print). 899 875 A., Fabbrini, M.S., 2005. Saporin and ricin A chain follow different Zumbrun, S.D., Hoffman, B., Liebermann, D.A., 2009. Distinct mechanisms are 900 876 intracellular routes to enter the cytosol of intoxicated cells. FEBS J. 272, utilized to induce stress sensor gadd45b by different stress stimuli. J. Cell. 901 877 4983–4995. Biochem. 108, 1220–1231. 902 903