www.nature.com/scientificreports
OPEN A newly isolated strain of Halomonas sp. (HA1) exerts anticancer potential via induction of apoptosis and G2/M arrest in hepatocellular carcinoma (HepG2) cell line Islam M. El‑Garawani1*, Sabha M. El‑Sabbagh2, Nasser H. Abbas3, Hany S. Ahmed2, Omaima A. Eissa2, Doaa M. Abo‑Atya4, Shaden A. M. Khalifa5 & Hesham R. El‑Seedi4,6,7*
Marine bacterial strains are of great interest for their ability to produce secondary metabolites with anticancer potentials. Isolation, identifcation, characterization and anticancer activities of isolated bacteria from El-Hamra Lake, Wadi El-Natrun (Egypt) were the objectives of this study. The isolated bacteria were identifed as a moderately halophilic alkaliphilic strain. Ethyl acetate extraction was performed and identifed by liquid chromatography-mass spectrophotometry (LC–MS–MS) and nuclear magnetic resonance analysis (NMR). Cytotoxicity of the extract was assessed on the HepG2 cell line and normal human peripheral lymphocytes (HPBL) in vitro. Halomonas sp. HA1 extract analyses revealed anticancer potential. Many compounds have been identifed including cyclo-(Leu- Leu), cyclo-(Pro-Phe), C17-sphinganine, hexanedioic acid, bis (2-ethylhexyl) ester, surfactin C14 and
C15. The extract exhibited an IC50 of 68 ± 1.8 μg/mL and caused marked morphological changes in treated HepG2 cells. For mechanistic anticancer evaluation, 20 and 40 µg/mL of bacterial extract were examined. The up-regulation of apoptosis-related genes’ expression, P53, CASP-3, and BAX/ BCL-2 at mRNA and protein levels proved the involvement of P53-dependant mitochondrial apoptotic
pathway. The anti-proliferative properties were confrmed by signifcant G2/M cell cycle arrest and PCNA down-regulation in the treated cells. Low cytotoxicity was observed in HPBL compared to HepG2 cells. In conclusion, results suggest that the apoptotic and anti-proliferative efects of Halomonas sp. HA1 extract on HepG2 cells can provide it as a candidate for future pharmaceutical industries.
Abbreviations NMR Nuclear magnetic resonance LC–MS–MS Liquid chromatography-mass spectrophotometry MeOH Methanol DMSO Dimethyl sulphoxide
1Department of Zoology, Faculty of Science, Menoufa University, Menoufa 32511, Egypt. 2Department of Botany and Microbiology, Faculty of Science, Menoufa University, Menoufa 32511, Egypt. 3Department of Molecular BiologyGenetic Engineering and Biotechnology Research Institute, University of Sadat City, Sadat City 32958, Egypt. 4Department of Chemistry, Faculty of Science, Menoufa University, Menoufa 32511, Egypt. 5Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm University, 10691 Stockholm, Sweden. 6Pharmacognosy Group, Department of Pharmaceutical Biosciences, Uppsala University, Biomedical Centre, 75 123 Uppsala, Sweden. 7International Research Center for Food Nutrition and Safety, Jiangsu University, Zhenjiang 212013, China. *email: [email protected]; hesham.el‑[email protected]
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 1 Vol.:(0123456789) www.nature.com/scientificreports/
Figure 1. Te phylogenetic tree based on 16 s rRNA sequences constructed by the neighbor-joining method, showing the position of strain HA1 and representatives of some related taxa.
HPBL Normal human peripheral lymphocytes BCL-2 B-cell lymphoma-2 proteins BAX BCL-2-associated X protein
Hepatocellular carcinoma (HCC) is the ffh type of cancer in patients with chronic liver disease and cirrhosis and the second cause of death in cancer patients 1. Tere are nearly 800,000 deaths annually due to HCC 2, and the HCC’s prevalence has gradually increased over the past decade 3. Cancer treatment can involve surgical inter- vention, radiation, chemotherapy, targeted therapy and/or other therapies 4. Despite the extreme eforts to treat HCC efectively, side efects are involved, such as immunodefciency, cell damage, and neurological, renal, and cardiac toxicity 5–7. Currently, the pharmaceutical industry and research are focused on developing and applying new strategies to lower the side efects and enhance the economic value8,9. Terefore, fnding and developing natural products-derived anticancer drugs with good efcacy and low toxicity10,11 from diferent sources such as essential oils12,13, certain types of mushrooms14 or even plant crude extracts15,16 are very crucial. Microbial metabolites are among the most important natural cancer chemotherapeutics 17. With actinomycin discovery, they began to appear around 1940, and since then, most anticancer compounds have been derived from natural sources 18. More than 60 percent of the existing compounds with antineoplastic activities are initially either identifed from or inspired by natural compounds and their derivatives19. Bacteria are the greatest produc- ers of bioactive products and thus of immense importance for the drugs discovery20. Marine pharmacology is a new discipline that explores the potential pharmaceutical products that originated in the marine world. In the last two decades, extensive screening of marine compounds and their antivirals 21, antibacterial22, antifungal23, antiparasitic 24, antitumor 25, and anti-infammatory26 activities have been reported. Systematic studies of various soda lakes have shown that microorganisms, which thrive in these areas, are adapted to the extreme pH and salt conditions, many of which are alkaliphilic and halophilic or extremely halotolerant, and many represent separate alkaliphilic lines within the recognized taxa. El-Hamra Lake, Wadi El-Natrun (Egypt) has a high water salinity (300 g/L) and pH 10.0. In both saline and alkaline conditions, haloalkaliphilic bacteria can be present and the preliminary results prompted the identifcation of the metabolites produced by alkaliphilic bacteria 27. Marine bacteria have genes such as PKS (polyketides) and NRPS (natural products) that are characteristic of secondary metabolite production. Halomonas strains from a marine origin may generate siderophores (low molecular weight Fe 3+ chelating molecules) and loihichelins 28. Te progression of gastric adenocarcinoma cell lines (HM02), hepatocellular carcinoma (HepG2) and breast cancer (MCF-7) has been inhibited by apoptosis initiation and cell cycle arrest when treated with marine-derived Halomonas sp. (GWS-BW-H8hM strain)29,30. However, to the best of our knowledge, the novel strain has not been studied yet. Consequently, the characteriza- tion of bioactive compounds and evaluation of the possible anticancer potential of the bacterial extract against the HepG2 cell line were warranted. Results Identifcation of bacterial strain. Morphological investigations showed two isolates of gram-negative short motile rods. Full-length 16S rRNA (about 1,500 bp) was sequenced and deposited under GenBank acces- sion numbers (KT223026) for H. HA1 isolate. Te isolated H. HA1 16S rRNA sequence showed 99% similarity with the 16S rRNA gene sequence of Halomonas denitrifcans BC7. However, the isolated strain is closer to Halomonas nitroreducens evolutionary group (Fig. 1).
LC–MS‑MS and NMR fraction analyses of H. HA1 extract. Te molecular networking of metabo- lome mass profle for the species Halomonas sp.HA1 was screened and exhibited in 67 parent ions (nodes) (Fig. 2). Te number of nodes was considered an indication of the unique peaks. Compounds with related molecular weight and shared class grouped together to form a cluster. Four clusters are noticed with some chemically
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 2 Vol:.(1234567890) www.nature.com/scientificreports/
Figure 2. Molecular network of 67 parent ions produced from Halomonas sp. HA1. Te fuchsia nodes indicate to the whole molecular weights that have unique detected peaks in the molecular network. Te green Nodes represent parent ions that are identifed from the molecular networking database as they have been already isolated before. Te yellow nodes indicate some identifed compounds but with wrong precursor parent ions so they should not be recognized.
Compound name Precursor mass (m/z) Database fragments Identifed fragments Cyclo-(L-pro-L-val) 197.064 179.12, 169.14, 152.11, 141.14, 124.12 and 70.07 – Ile-Pro 211.06 – 183.128, 138.125, 114.102, 98.065, 86.105 and 70.064 Cyclo-[L-(4-hydroxy-Pro)-L-leu] 227.058 199.15, 181.14, 153.15, 136.12 and 86.08 – Cyclo-(Leu-Leu) 227.115 – – Cyclo (Pro-Phe) 245.042 217.69, 120.03 and 70.79 154.100, 120.10 and 70.064 Palmitamide 256.21 – – Pro-Tyr 261.038 243.06, 233.09, 215.04, 135.92, 119.94 and 85.94 187.183, 120.085 and 86.056 9-Octadecenamide 282.205 265.27, 247.30, 149.10 and 135.13 – C17-Sphinganine 288.218 – – Hexanedioic acid, bis(2-ethylhexyl) ester 371.135 – – 909.46, 891.41, 86e3.38, 685.37, 667.44, 582.31, 554.33 Surfactin C14 1,022.48 - and 441.23 1,018.47, 923.58, 905.42, 877.39, 808.44, 792.44, 923.574, 685.500, 596.445, 483.382, 441.298, 326.238, Surfactin C15 1,036.52 695.38, 685.37, 667.35, 596.41, 554.27 and 441.24 272.167 and 86.088
Table 1. Te parent and the fragments’ masses of the identifed compounds compared with that of the standards from the molecular networking database.
related identifed compounds. From the 67 nodes only 15 parent ions within the molecular network matched 15 known standards from the molecular networking database but three of them in the yellow nodes [M+H]+ (m/z; 200.128, 228.164 and 393.265) have wrong precursor parent ions, so their identifcation can’t be considered (Fig. 2 and Table 1). Six identifed dipeptides (Ile-Pro, cyclo-(L-pro-L-val), cyclo-(Pro-Phe), Pro-Tyr, cyclo-(Leu-Leu) and cyclo- [L-(4-hydroxy-Pro)-L-leu]) with [M + H]+ (211.06, 197.064, 245.042, 261.038, 227.115 and 227.058) respectively
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 3 Vol.:(0123456789) www.nature.com/scientificreports/
Figure 3. Te cytotoxic efect of the H. HA1 extract on HepG2 using MTT assay afer 24 h. Incubation with serial concentrations of the extract showed a potent anticancer efect with an IC 50: 68 ± 1.8 µg/mL. Data were represented as (Mean ± SD) of three diferent experiments (n = 3). H. HA1: Halomonas. HA1.
are clustered together (Fig. 2 and Table 1). Palmitamide and 9-octadecenamide with [M + H]+ (256.21 and 282.205) (Fig. 2 and Table 1), are two identifed fatty acid amides produced as endogenous substances. One sphingolipid (aminodiol) that is C17-sphinganine with m/z 288.218 [M+H]+ (Fig. 2 and Table 1), was isolated from diferent fungus species 31. C17-sphingolipid identifed as mycotoxin (C17-SAMT) analog exerted potent toxicity in diferent assays 32,33. Te most potent identifed compounds were two biosurfactants (Surfactin C14 and surfactin C15) with m/z 1,022.48 and 1,036.52 [M+H]+ (Fig. S1). Te parent ion masses fragmentation data for Surfactin C15 and Surfactin C14 from the molecular network- ing database were compared (Figs. S1,S2). Surfactin C15 parent ion fragmentations are recognized from MS/MS chromatogram and the fragment with [M+H]+ m/z 685.500 represents the base peak ion (Fig. S3). Surfactin C15 fragmentation mechanism in the positive ion mode starts by loss of fragment ion [M+]+ m/z • 113.13 and C8H17 then continuous cleavage of diferent peptide bonds and loss of diferent amino acid fragments + · to reach the last fragment with [M+H] (m/z 85.09) and molecular formula C5H11N2 (Fig. S4).
Anticancer activities. Cytotoxicity on HepG2 cells. Te bacterial extract has been examined for their an- ticancer activity against HepG2 cell line using MTT assay. Results, as shown in Fig. 3, refected a strong cytotoxic potential of the extract with 68 ± 1.8 μg/mL maximal inhibitory concentration (IC50).
Assessment of morphological changes in HepG2. Results of the inverted phase-contrast examination demonstrated the remarkable anticancer potentials as evidenced by cellular shrinkage and irregular cell shapes following bacterial extract treatments in a dose-dependent manner when compared with control groups (Fig. 4). Furthermore, AO/EB staining revealed cytoplasmic vacuolation, membrane blebbing and irregular nuclear morphology as hallmarks of apoptosis and cell death. Te records of abnormal morphology were signifcant (P < 0.05) with H. HA1 extract incubations compared to control HepG2 cells (Fig. 5).
Flow cytometric analysis of cell cycle distribution. Cell cycle analysis revealed signifcant (P < 0.05) G2/M cell cycle arrest in H. HA1 crude extract-treated HepG2 cells (Fig. 6A). Results showed remarkable accu- mulation of G2/M populations in treated cells with 18.42 and 24.18% for 20 and 40 µg/mL respectively when compared to 13.45% in untreated cells. However, cisplatin induced signifcant (P < 0.05) apoptosis particularly in S phase when compared with untreated cells (Fig. 6B).
Immunocytochemical assessment of apoptosis and proliferation‑related proteins. Changes in protein expression of P53, CASP-3, and BAX/BCL-2 ratio were examined in treated cells and controls. Results revealed that H. HA1 extract induced apoptosis as confrmed by P53 and CASP-3 signifcant (P < 0.05) up-reg- ulation of protein expression. Te evaluated immunocytochemical reactivities showed an increase of ~ 5 and 8 folds, in P53 protein level, for 20 and 40 µg/mL respectively, relative to the control. Te level of CASP-3 (procas- pase-3) protein was increased by ~ 11 and 6 folds, for 20 and 40 µg/mL respectively, when compared to untreated cells. Moreover, BAX/BCL-2 ratio exhibited a signifcant (P < 0.05) concentration-dependent elevation when compared to the control confrming that the induction of apoptosis was via the intrinsic mitochondrial pathway (Fig. 7). However, PCNA, a nuclear proliferating marker, showed a signifcant (P < 0.05) down-regulation in H.
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 4 Vol:.(1234567890) www.nature.com/scientificreports/
Figure 4. Representative photomicrographs of control and treated HepG2 cells afer 24 h. Cellular morphological alterations and detached cells were observed by phase contrast light inverted microscope (Olympus IMT-2, Japan). H. HA1: Halomonas. HA1; Cisplatin (3 µg/mL).
Figure 5. Representative photomicrographs of cellular alterations in untreated and treated HepG2 cells afer 24 h of diferent incubations. Observable decrease in viability of cells and increased morphological alterations towards apoptosis induction such as membrane blebbing (white arrows) were noticed afer acridine orange/ ethidium bromide (AO/EB) double fuorescent labeling (A). Data represent the means of three independent experiments; bars, standard deviation and a: signifcant (P < 0.05) with respect to the control (B). H. HA1: Halomonas. HA1; Cisplatin (3 µg/mL).
HA1 (7.3 and 15.7% for 20 and 40 µg/mL, respectively) and cisplatin-treated cells (13.7%) when compared with the untreated group (91.7%).
Altered mRNA expression of apoptosis markers. Te apoptotic efect of H. HA1 crude extract on HepG2 was confrmed by apoptosis-related genes expression. Te mRNA expression was quantifed by qRT-
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 5 Vol.:(0123456789) www.nature.com/scientificreports/
Figure 6. Efect of diferent concentrations of H. HA1 crude extract incubation for 24 h on cell cycle distribution of treated and control HepG2 cells. Te cell cycle phases were analyzed according to DNA content as evaluated afer propidium iodide (PI) labeling (B). Data represent means of three diferent experiments; bars, standard deviation; and a, signifcant increase (P < 0.05) relative to untreated cells (A). H. HA1: Halomonas. HA1; Cisplatin (3 µg/mL).
PCR for P53, CASP-3, BAX and BCL-2 genes in the control and treated cells. Results of P53 and CASP-3 showed signifcant up-regulation among H. HA1 treated cells (~ 6 and 2.5 folds, for 20 and 40 µg/mL respectively). BAX/ BCL-2 ratio exhibited a signifcant (P < 0.05) elevation with H. HA1 crude extract treatment (~ 0.95 and 1.2 folds, for 20 and 40 µg/mL, respectively) compared to the untreated control. Tese results suggest that H. HA1 extract induced apoptosis in HepG2 cells via the intrinsic mitochondrial pathway. Te lower concentration of H. HA1 (20 µg/mL) was more potent in apoptosis induction than the higher one (Fig. 8).
Efect of the extract on normal human peripheral lymphocytes. Assessment of cytotoxicity on nor- mal HPBL. HPBLs were treated with H. HA1 crude extract for 24 h. Trypan blue exclusion method (Fig. 9) and AO/EB dual fuorescent staining (Fig. 10) were performed. Results revealed low cytotoxicity and morphological changes among extract-treated groups compared to higher toxicity of mitomycin C-treated cells (Figs. 9, 10B).
Assessment of DNA single‑strand breaks (comet assay). For DNA single-strand breaks assessment in normal cells, HPBLs were treated with H. HA1 crude extract for 24 h. Te comet assay was carried out (Fig. 11A). Results revealed signifcant (P < 0.05) genotoxic efect with high concentration (40 µg/mL) of H. HA1 extract as well as mitomycin C-treated group when compared to control cells (Fig. 11B). Discussion Currently, natural product extracts are considered to be the most promising source of new drugs for cancer34. Several studies have indicated the advantages of marine fora and fauna extracts in combating cancer and a num- ber of other diseases 35–37. Bacteria are the greatest producers of bioactive natural products and are of immense importance for drug discovery 20. In this study, the newly identifed strain of bacteria Halomonas sp. HA1 was investigated for its anticancer potential against HepG2 cells. In agreement with some earlier studies on some microbial extracts, the results clearly indicated that the crude extract of Halomonas sp. HA1 showed a signifcant anticancer efect on HepG2 cells associated with decreased viability and morphological alterations of the treated cells leading eventually to cell death29,30,38. To investigate the pro-apoptotic pathway of H. HA1 bacterial extract, the changes in apoptosis regulatory genes upon applying the extract on HepG2 cells were evaluated. Apoptosis is a process involving alterations in the expression of an array of genes. BCL-2 family plays a crucial role in apoptosis regulation 39. However, one of the early apoptosis hallmark changes is a reduction in mitochondrial membrane potential. Te potential decrease of the mitochondrial membrane found as a result of mitochondrial membrane depolarization indicated the mitochondrial damage. Another factor in the process
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 6 Vol:.(1234567890) www.nature.com/scientificreports/
Figure 7. Efects of crude extract incubation for 24 h on the positively stained cells in control and treated HepG2 cells. Increased percentage of P53, CASP-3 positive immuno-reactive cells and elevated BAX/BCL-2 ratio as well as decreased levels of PCNA were noticed in treated cells. Data represent means of fve diferent felds; bars, standard deviation; and a, signifcant (P < 0.05) relative to untreated cells. H. HA1: Halomonas. HA1; Cisplatin (3 µg/mL).
Figure 8. Efect of H. HA1 crude extract on relative mRNA alterations of P53, CASP-3 and BAX/BCL-2. Data (means of three experiments) were standardized to the level of GAPDH mRNA and expressed as fold-induction relative to the control mRNA levels. Bars, standard deviation and a: signifcant (P < 0.05) compared to untreated cells. H. HA1: Halomonas. HA1; Cisplatin (3 µg/mL).
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 7 Vol.:(0123456789) www.nature.com/scientificreports/
Figure 9. Efect on HPBL afer incubation with various concentrations of H. HA1 extract, for 24 h. Cells were stained with trypan blue (TB) for cytotoxicity assessment. Data were represented as Mean ± SD of three independent experiments (n = 3). Bars, standard deviation and a: signifcant (P < 0.05) compared to the untreated cells. H. HA1: Halomonas. HA1; Mitomycin C (0.5 µg/mL).
Figure 10. Efect on HPBL afer incubation with various concentrations of HL extract, for 24 h. Cells were labeled with AO/EB fuorescent staining for cell death (A). Data were represented as Mean ± SD of three independent experiments (B). Bars, standard deviation and a: signifcant (P < 0.05) compared to the untreated cells (n = 3). H. HA1: Halomonas. HA1; Mitomycin C (0.5 µg/mL).
of mitochondrial apoptosis pathway afer mitochondrial membrane destruction is the release of pro-apoptotic protein factors from the mitochondria 40. In the present study, BAX/BCL-2, CASP-3 (as a procaspase-3) and P53 were assessed at the transcriptional and protein levels. Te ratio of BAX/BCL-2 mRNA expression recorded a signifcant increase as well as CASP-3 and P53 up-regulation in treated HepG2 cells. It is well-known that BAX is up-regulated by P53 protein while
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 8 Vol:.(1234567890) www.nature.com/scientificreports/
Figure 11. Efect of H. HA1 extract on DNA single-strand breaks (alkaline comet assay) in HepG2 cells stained with ethidium bromide (A). Data were represented as Mean ± SD of three independent experiments (B). Bars, standard deviation and a: signifcant (P < 0.05) compared to the untreated cells (n = 3). H. HA1: Halomonas. HA1; Mitomycin C (0.5 µg/mL).
BCL-2 protein expression is down-regulated by P53 41. P53 is a nuclear transcriptional factor that usually is activated in apoptosis by regulating numerous down-stream efectors42. Over-expression of BAX (pro-apoptotic protein)43 and inhibition of BCL-2 protein expression can speed up cell apoptosis. Apoptosis can be induced by P53-mitochondrial localization in a transcription-independent manner 44,45 or by induction of endoplasmic reticulum stress to prevent P53-dependent apoptosis via the glycogen synthase kinase-3β pathway 46. Te expres- sion profle of H. HA1 extract indicated the P53-dependant mitochondrial apoptotic pathway. Tese results are in agreement with Ruiz-Ruiz et al.47, suggesting the anti-proliferative efect of the novel halophilic Halomonas sp. extract. Te results of CASP-3 expression profle exhibted caspase-dependent apoptosis. However, due to the elevated toxicity and stress of the higher concentration of the extract, treated cells may tend to undergo apoptosis via caspase-independent pathway48 owned to the processes of autophagy, endoplasmic reticulum stress or mitotic catastrophe 49. Further, the diferent biological and technical factors, such as transcriptional or post-translational alterations as well as a long half-life of some proteins, can afect the association between mRNA expression and the level of proteins50. Te treatments may cause internal cellular dysfunctions which lead to the degradation of mRNA molecules faster than the protein ones 51. Although the cleaved caspase-3 has not been assessed in this study, the morphological apoptotic features such as membrane blebbing, loss of membrane integrity, nuclear fragmentation and elevated BAX/BCL-2 ratio suggested the occurrence of apoptosis52. Moreover, the loss of membrane integrity, confrmed by AO/EB labeling, is a late event in apoptosis. Caspase-3 is one of the death substrates that serve as an efector in apoptosis inducing phosphatidylserine (PS) externalization, shrinkage of cell, membrane blebbing, and DNA fragmentation by cleaving53,54. In the absence of caspase-3, the cells mor- phological features were impaired 55 and cytochrome c release was also delayed 56. Due to apoptosis induction, the decreased value of CASP-3 protein in the higher concentration of the extract may be due to the increase of the expected cleavage process occurred in the procaspase-3 protein. However, the CASP-3 cleavage assessment is needed in the future studies. Collectively, the explanation of the diferent transcriptional level of CASP-3 in comparison to its protein level as well as the decreased levels of up-regulated P53 and CASP-3 in the higher concentration-treated cells could be proved. Moreover, the analysis of cell cycle distribution revealed accumulations of sub-G0 (apoptotic cells) and signif- cant G2/M arrest in addition to the down-expression of PCNA (proliferating-cell nuclear antigen) protein. Te expression of PCNA protein regulates the cell cycle and promotes apoptosis in fetal and neonatal mouse ovaries 57. 58 Further, the arrest of G 2/M phase may enable damaged cells to undergo apoptosis . However, cisplatin-induced 59 arrest in sub-G0 and S phases (DNA synthesis) eventually led to DNA damage and apoptosis . Te down- regulation of PCNA, the anti-proliferative efects and the cell cycle arrest are key players of the apoptotic cascade. Te results suggested the anti-proliferative and apoptotic efects of Halomonas sp. HA1 extract can be attrib- uted to the secondary metabolites identifed by LC–MS-MS and NMR analysis of Halomonas sp. HA1 extract. However, sphinganine is the backbone precursor of sphingolipids60. Sphingolipids are produced in most eukar- yotic cells but rarely in prokaryotes, which possess only glycerol-based phospholipids in their membrane61.
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 9 Vol.:(0123456789) www.nature.com/scientificreports/
However, a few isolated bacterial species produce sphingolipids62–64. A previous study reported that, both cyclic dipeptides cyclo-(prolyltyrosyl) and cyclo-(prolylphenylalanyl) isolated from Bacillus spp. showed potential anticancer activity 65. Another study showed that a CDP mix composed of cyclo-(L-Pro-L-Tyr), cyclo-(L-Pro-L- Val), and cyclo-(L-Pro-L-Phe), isolated from the P. aeruginosa PAO1 strain, exhibited anticancer activity in HeLa and Caco-2 cell lines66. In another study cyclo-(-Pro-Tyr) exhibited anticancer and anti-proliferative activity against HepG2 cell lines67. A previous study has proven the anticancer activity of 1, 2-Benzenedicarboxylic acid, bis (2-ethylhexyl) ester on PC3, MCF, HCT-116, A549, and MIAPACA cell lines 68. Surfactin biosynthesis occurs in many natural microorganisms i.e. Bacillus pumilus, B. mojavensis, B. circulans, B. natto, and B. amylolique- faciens69; B. safensis F4 and B. subtilis strains 70,71. It exhibits powerful therapeutic activities i.e. antimicrobial, antimycoplasma, antiviral, anti-infammatory, antibacterial and antitumor10,70,72–75. Additionally, it is widely applicable environmentally in biopesticides, food processing, pharmaceuticals, cosmetics and oil recovery 76–78. In fact, surfactin mediated a forceful anticancer activity on various cancer cell lines. It showed anti-prolif- erative potentials on human breast cancer cells (MCF-7)79, cervical cancer (HeLa) and hepatoma (Bel-7402)80. An in vivo anticancer activities of surfactin on mice ascites tumors were also reported 81. It also inhibited the 82 growth of LoVo colon cancer cells, with IC 50 of 26 µM at 48 h . Te anticancer activity of surfactin is attributed to its amphiphilic nature. Lipopeptides including surfactin exert cytotoxicity on cancer cells with diferent IC 50 depending on the length of fatty acid chains 80. Terefore, surfactin C15 should exhibit higher anticancer activity than surfactin C14 and it is supposed to be responsible for the anticancer activity of the extract. In conclusion, we reported for the frst time that, Halomonas sp. HA1 extract has a potent anticancer activity on HepG2 cells via anti-proliferative and apoptotic potentials. Surfactin C14 and Surfactin C15, biosurfactants, were identifed in Halomonas sp. HA1 extract by LC–MS-MS and NMR analyses. However, further in vivo studies are needed to investigate the metabolism and the impact of biotransformation on the efcacy of H. HA1 extract’s active constituents as anticancer agents. Methods Isolation of haloalkaliphilic bacteria. Water samples were collected from El-Hamra Lake in Wadi El- Natrun, Egypt where the pH was 10.0 and water salinity was 300 g/L. Halophile growth medium (HGM) was 83 prepared according to Dorn et al. , and pH 9 was adjusted using NaHCO 3. Te media were supplemented with 3 M NaCl and 2.0 mL 10% (w/v) yeast extract per liter. Te water sample was added to HGM media with 1:10 (v/v) and incubated at 30 °C for 48 h. Two more successive culturing were carried out using 50 µL of diluted culture spread on an agar plate of the same media. Single colonies were plated on new agar plates with the same media for biochemical characterization.
Phylogenetic analysis of the 16S ribosomal RNA gene. Genomic DNA was extracted from the pure culture using GeneJET Genomic DNA Purifcation Kit (Termo Fisher Scientifc, US). PCR amplifcation of the 16S rRNA gene carried out using Bact 27f. (5′-AGAGTTTGATC (A/C)-TGGCTCAG-3′), Bact 1492r (5′-TACGG(C/T)-ACCTTGTTACGACTT-3′), and Bact 1098r (5′-AAGGGTTGCGCTCGTTGCG-3′)84. Using a 3,100 Genetic Analyzer (Applied Biosystems, US), the amplifed products were sequenced according to the manufacturer’s protocols. Te obtained sequence of 16S rRNA gene was compared using the BLASTN program against the nucleotide sequences collection (nr/nt) database, available at the National Center for Biotechnol- ogy Information website (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Phylogenetic tree relative to high scoring BLASTP hits was performed using the (MEGA 7.0.26) sofware. Te complete sequence of 1, 2 CDG of Halomonas was isolated using universal primer UDOG: (5′-ATG ACTGTT AAA ATT TAT GAC ACC CCT GAA G-3 ′) and reversal primer RDOG: (5′-TTATGG ACG CGC TTG CAG CTC-3′). Primers were designed according to sequence alignment of 1, 2 DOG NCBI database sequences. Te PCR conditions were 94 °C for 30 s, 60 °C 30 s and 72 °C for 1 min. Using a 3100 Genetic Analyzer (Applied Biosystems, US), PCR products were sequenced following the manufacturer’s protocols. Te obtained sequence of 16S rRNA gene was compared using the BLASTN program against the nucleotide sequences collection database, available at the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Te phylogenetic tree relative to high scoring BLASTP hits was performed using the (MEGA 7.0.26) sofware.
Preparation of crude extract. Te bacterial isolate was cultured in (HGM) medium and incubated in shaker incubator 100 rpm at 30 °C for 72 h. Te culture medium was centrifuged at 6,500 rpm for 20 min. Te supernatant was collected and fltered through a 0.45 µm sterile membrane. Ethyl acetate was added to culture fltrate (1:1) and stirred at 130 rpm for 12 h. the ethyl acetate phase on the upper part of the culture was removed and followed by vacuum evaporation to obtain the dry extracts by vacuum rotary evaporator 40 °C85. Crude extracts produced were stored at − 20 °C for further investigations.
Characterization of bacterial extract using NMR and LC–MS‑MS. Generally, 1H and 13C NMR spectra were recorded on a Bruker DRX 600 spectrometer at 600.1 and at 150.9 MHz, respectively, at 25 °C using CD3OD as the solvent. All chemical shifs are expressed relative to TMS 86. For the LC–MS analysis the crude extract was dissolved in 50% acetonitrile (ACN), 0.1% formic acid (FA). Te samples were injected by syringe through a PicoTip emittor at 0.3 µL/min connected to a Q-Tof Micro (Waters, Milford, Massachusetts, US) with the voltage set at 1.4 kV. Te analysis was carried out in positive ion mode and linear gradient from 10% (v/v) H 2O to 99% (v/v) ACN in 0.1% (v/v) FA at a fow rate of 0.3 µL/min over 75 min. Te analysis was followed by LC/MS–MS via dissolved 0.1 mg/mL in LC–MS solvent: 60% MeCN in 0.1% FA with a linear gradient ranging from 10–60% (v/v) MeCN in 0.1% (v/v) FA at a fow rate of 0.3 mL/ min over 75 min. Te capillary temperature was set at 220 °C and the spray voltage at 4 kV87.
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 10 Vol:.(1234567890) www.nature.com/scientificreports/
Biological investigations. Te efect of the extract was evaluated against hepatocellular carcinoma (HepG2) cell line as well as the normal human peripheral lymphocytes (HPBL) in vitro. Te study was approved and followed the Institutional Ethical Committee guidelines at Faculty of Science, Menoufa University, Egypt (MUFS-F-GE-4-20).
Anticancer activities. Maintenance of HepG2 cell line. Hepatocellular carcinoma (HepG2) cell line was acquired from VACSERA, Giza, Egypt. Te concentration of cells per milliliter was determined using a hemocy- tometer and calculated using the following equation: Cells/mL = 104 × Average count per square × (Dilution factor)
Te cell line was maintained and cultured in Dulbecco’s modifed Eagle’s medium (DMEM) supplemented with 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells were incubated in a humidi- 4 2 fed 5% CO 2 atmosphere at 37 °C in T25 culture fasks at a density of 2 × 10 cells/cm . Te medium in fasks was changed every 48 h. Te confuency of cells was confrmed by an inverted microscope until reaching 75%. Cells were harvested afer trypsinization (0.025% trypsin and 0.02% EDTA) then washed twice with phosphate- bufered saline (PBS). All experiments were done in triplicates. All reagents and media were purchased from Lonza supplier, Egypt.
Cytotoxicity on HepG2 cell line. To evaluate the maximal half inhibitory concentration (IC50), cytotoxic- ity of H. HA1 bacterial extract was carried out by microculture tetrazolium (MTT) assay method, 3-(4, 5-dimeth- ylthiazolyl-2)-2, 5-diphenyltetrazolium bromide, against HepG2 cell line. Cells were seeded into 96-well plates at a plating density of 1 × 104 cells/well and incubated to allow the attachment of cells prior to the addition of treat- ments. Te bacterial extract was dissolved in dimethyl sulfoxide (DMSO) and diluted in serum-free medium. Afer reaching the confuency of 75%, various concentrations (0–1,000 μg/mL) of the extract were added to the cultures then incubated for 24 h. Cisplatin (3 μg/mL) was used as a positive control 46 and DMSO (8 μL/ mL) as negative solvent control. Afer 24 h, 100 μL of MTT in PBS were added to each well and incubated at 37 °C for 4 h. Te formazan crystals were formed then solubilized in 100μL of acidifed isopropanol and then measured the absorbance at 630 nm by using enzyme-linked immunosorbent assay (ELISA) microplate reader (Bio-RAD microplate reader, Japan). Te percentages of cell inhibition were determined using the following formula: % Cell inhibition = (1 − OD (absorbance) test/OD Control) × 100
Tis assay was carried out in triplicate. Te IC50 value was determined from % cell inhibition and concentra- tion curve88. For further anticancer mechanistic investigations, HepG2 cells were incubated with 20 and 40 μg/ mL of bacterial extract for 24 h.
Morphological changes in HepG2. Phase contrast inverted microscopy. HepG2 cells were examined under the inverted Olympus BX41 microscope (Tokyo, Japan) at × 400 magnifcation to observe morphological alterations among treated groups.
Acridine orange/ethidium bromide (AO/EB) double fuorescent labeling. In order to investigate the altered cell structure towards apoptosis or necrosis, AO/EB staining was carried out89. Briefy, 4 μL of treated and control cell suspensions were transferred to glass slides then they were stained with 1μL AO/ EB staining solution (100 μg/mL AO and 100 μg/mL EB). Cells were examined immediately by a fuorescent microscope (Olympus BX 41, Japan) at 400 × magnifcation. One hundred cells were counted per each feld of randomly selected fve felds.
Flow cytometric analysis of cell cycle distribution. Cell cycle distribution and DNA content of treated cells and controls were evaluated by fow cytometry afer propidium iodide (PI) labeling. Afer various treatments period, cells were trypsinized and washed with PBS twice and then fxed with cold ethanol (70%) for 2 h. Te alcohol was entirely removed and cells were collected and washed with PBS at 1,200 rpm for 5 min. Cells were kept in PBS containing 50 μg/mL of RNase A for 2 h at 37 °C, mixed with 25 μg/mL of PI stain90,91 and analyzed on a FACS fow cytometer (Becton Dickinson, US) according to the manufacturer’s instructions. Te analyses of cell cycle phases were performed using BD FACS Diva sofware. All reagents used were Sigma- Aldrich, Germany.
Immunocytochemical staining. Te immunocytochemical reactions were performed using the avi- din–biotin complex immunoperoxidase technique92. Control and treated cells were harvested and smeared on positive-charged slides13. Slides were then processed for P53 (tumor suppressor protein), BCL-2 (anti-apop- totic protein), BAX (BCL-2 associated X protein, apoptosis regulator) and caspase-3 (pro-apoptotic protein) immune-reaction. Moreover, PCNA (proliferating-cell nuclear antigen) were also used as proliferation markers. Across fve randomly selected felds, two hundred HepG2 cells were studied. As the immunocytochemical reac- tivity, the mean percentage of positive cells was calculated (positive cells/total number of counted cells) × 100. Cells were counted under a light microscope (Olympus BX41, Japan) at × 400 magnifcation. All antibodies used were Invitrogen, CA, US.
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 11 Vol.:(0123456789) www.nature.com/scientificreports/
Name Accession number Sense (5′–3′) Antisense (5′–3′) GAPDH NM_001289745.2 GGATTTGGTCGTATTGGG GGAAGATGGTGATGGGATT BCL-2 NM_001114735.1 TACAGGCTGGCTCAGGACTAT CGCAACATTTTGTAGCACTCTG BAX NM_001291431.1 CCCGAGAGGTCTTTTTCCGAG CCAGCCCATGATGGTTCTGAT CASP-3 NM_001354777.1 GGCGCTCTGGTTTTCGTTAAT CAGTTCTGTACCACGGCAGG P53 NM_001126112.2 TTCCCTGGATTGGCCAGACT GCAGGCCAACTTGTTCAGTG
Table 2. Primer sequences of genes analyzed by real-time PCR. GAPDH Glyceraldehyde-3-phosphate dehydrogenase; BCL-2 B-cell lymphoma 2; BAX BCL-2-associated X protein; CASP-3 Caspase-3.
Quantitative real‑time polymerase chain reaction (qPCR). Te qPCR was carried out in treated and control cells to assess BCL-2, BAX, P53, and CASP-3 mRNA expressions. Briefy, total RNA was extracted using RNeasy Plus Minikit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Te quality of RNA was assessed by agarose gel and quantifed by nanodrop (Quawell Q5000 UV–Vis Spectrophotometer, UK). For cDNA synthesis, total RNA was reverse transcribed following the manufacturer’s instructions RevertAid H Minus Reverse Transcriptase (Termo Fisher Scientifc, US). Real-time PCR was performed using Power SYBR Master Mix (Termo Fisher Scientifc, US) on an Applied Biosystems 7500 system (Foster City, US) following the standard program of 40 cycles with 58 °C for primer annealing. Samples of cDNA were run in triplicate. All data were then normalized to the endogenous control, GAPDH, a housekeeping gene. Fold change in gene ΔΔ expression was calculated using the comparative threshold cycle ( CT) method. Primer sequences and acces- sion numbers of genes used in this study are provided in Table 2.
Cytotoxicity of the bacterial extract on normal human peripheral blood lymphocytes (HPBL). Cells’ culture and isolation. Te extract toxicity was done on HPBL isolated from three male vol- unteers (healthy and non-smoker). Written informed consent was obtained from the three involved volunteers. Peripheral venous blood samples were collected using sterile syringes and then transferred into sterile tubes (KEMICO vacutainer, Egypt) containing K2-EDTA. Samples were processed for culturing in RPMI-1640 me- dium supplemented with 15% fetal calf serum, phytohemagglutinin (2%) and 1% (100 U/mL penicillin and 100 μg/mL streptomycin) at 37 °C and humidifed 5% CO 2 atmosphere. Afer 48 h of culture setup, various treatments were applied and the cultures extended for 24 h. For HPBL isolation afer the treatment period, cultures were incubated with fve folds of erythrocyte lysing bufer (0.015 M NH 4C1, 1 mM NaHCO3, 0.l mM EDTA) for 15 min. Ten, centrifugation was done for 5 min at 1,500 rpm in a cooling centrifuge (Sigma 3 K 30, Germany). Te incubation was repeated until a white pellet of lymphocytes appeared 93. All reagents were from Lonza, Switzerland.
Trypan blue exclusion assay. Using the 0.4 percent trypan blue (Sigma-Aldrich, Germany) solution, the HPBL cells were stained and examined immediately under a light microscope at × 200 magnifcation (Olympus BX41, Japan). Randomly fve felds were selected and 200 cells/feld were scored. Finally, cytotoxicity was calcu- lated as follows: Cytotoxicity = 1 − (No. of unstained viable cells/No. of stained and unstained cells) × 100.
Acridine orange/ethidium bromide (AO/EB) dual fuorescent staining. Te AO/EB staining was performed to investigate the viability of cells. Briefy, 4 μL of treated and control cells were stained with 1 μL stain solution AO/EB (100 μg/mL AO and 100 μg/mL EB) on glass slides and examined immediately by a fuorescent microscope (Olympus BX 41, Japan) at × 400 magnifcation. Randomly fve felds were observed and 200 cells were counted from each. Two types of cells were observed, based on the emitted fuorescence: viable cells were green-colored cells with intact structures and late apoptotic or dead cells showed an orange-to-red color 89.
DNA single‑strand breaks (comet assay). Te alkaline single-cell gel electrophoresis (comet assay) method 94 was carried out to evaluate the genotoxicity on normal HPBL. Briefy, cells were suspended in low melting point agarose gel (Sigma-Aldrich, Germany) on a microscopic glass slide between two layers of ultra- pure normal melting agarose (Sigma-Aldrich, Germany). Ten, slides were immersed in lysis bufer (2.5 M NaCl, 100 mM EDTA and 10 mM Tris, pH 10.0) with freshly added 1% Triton X-100 (Sigma-Aldrich, Germany) and 10% DMSO for 1 h at 4 °C. Subsequently, slides were kept in the freshly prepared alkaline bufer (300 mM NaOH and 1 mM EDTA, pH > 13) for 20 min at 4 °C. Ten, slides were electrophoresed in electric current of 25 V and 300 mA for 10 min. Te slides were then immersed for 3 min in neutralizing bufer (0.4 M Tris–HCl, pH 7.5). Tey were stained with ethidium bromide (Sigma-Aldrich, Germany). Visualization of cells was carried out by a fuorescence microscope (Olympus BX 41, Japan), and representative images were taken. About 100 randomly selected cells were examined per one feld of the total examined fve felds. Te results were divided as normal nuclei with no migrated tails and damaged with a migrated tail or with no distinct nucleus.
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 12 Vol:.(1234567890) www.nature.com/scientificreports/
Statistical analysis. Data are reported as the mean ± standard deviation (SD). Data for multiple variable comparisons were analyzed by one-way analysis of variance. Duncan’s test was used as a post-hoc test using the statistical package SPSS version 17.0 sofware to compare the signifcance of diferences between groups (SPSS, Inc., Chicago, IL, US) and signifcance was considered at a probability level of P < 0.05. Data availability All data of this study are introduced in this published article.
Received: 9 March 2020; Accepted: 28 July 2020
References 1. Zhu, R. X., Seto, W. K., Lai, C. L. & Yuen, M. F. Epidemiology of hepatocellular carcinoma in the Asia-Pacifc region. Gut Liver 10, 332–339 (2016). 2. Akinyemiju, T. et al. Te burden of primary liver cancer and underlying etiologies from 1990 to 2015 at the global, regional, and national level: results from the Global Burden of Disease Study 2015. JAMA Oncol. 3, 1683–1691 (2017). 3. Yang, J. D. & Roberts, L. R. Hepatocellular carcinoma: A global view. Nat. Rev. Gastroenterol. Hepatol. 7, 448–458 (2010). 4. Kreidieh, M., Zeidan, Y. H. & Shamseddine, A. Te Combination of Stereotactic Body Radiation Terapy and Immunotherapy in Primary Liver Tumors. J. Oncol. 2019, (2019). 5. Florea, A.-M.M. & Büsselberg, D. Cisplatin as an anti-tumor drug: Cellular mechanisms of activity, drug resistance and induced side efects. Cancers (Basel). 3, 1351–1371 (2011). 6. Hanif, R. et al. Efects of nonsteroidal anti-infammatory drugs on proliferation and on induction of apoptosis in colon cancer cells by a prostaglandin-independent pathway. Biochem. Pharmacol. 52, 237–245 (1996). 7. Kamesaki, H. Mechanisms involved in chemotherapy-induced apoptosis and their implications in cancer chemotherapy. Int. J. Hematol. 68, 29–43 (1998). 8. Tohamy, A. A., El-Garawani, I. M., Ibrahim, S. R. & Abdel Moneim, A. E. Te apoptotic properties of Salvia aegyptiaca and Trigo- nella foenum-graecum extracts on Ehrlich ascites carcinoma cells: Te efectiveness of combined treatment. Res. J. Pharm. Biol. Chem. Sci. 29:710–722 (2016). 9. Prada-Gracia, D., Huerta-Yépez, S. & Moreno-Vargas, L. M. Application of computational methods for anticancer drug discovery, design, and optimization. Bol. Méd. Hosp. Infant. México 73, 411–423 (2016). 10. Zhai, S. Q., Li, J. & Shi, Q. C. Composition characterization, antioxidant capacities and anti-proliferative efects of the polysac- charides isolated from Trametes lactinea (Berk.) Pat. Int. J. Biol. Macromol. 115, 114–123 (2018). 11. El-Garawani, I. et al. In vitro antigenotoxic, antihelminthic and antioxidant potentials based on the extracted metabolites from lichen, candelariella vitellina. Pharmaceutics https://doi.org/10.3390/pharmaceutics12050477 (2020). 12. El-Garawani, I., El Nabi, S. H., Nafe, E. & Almeldin, S. Foeniculum Vulgare and Pelargonium Graveolens essential oil mixture triggers the cell cycle arrest and apoptosis in MCF-7 cells. Anticancer. Agents Med. Chem. https://doi.org/10.2174/1573399815 666190326115116 (2019). 13. El-Garawani, I. M., El-Nabi, S. H., Dawoud, G. T., Esmail, S. M. & Abdel Moneim, A. E. Triggering of apoptosis and cell cycle arrest by fennel and clove oils in Caco-2 cells: the role of combination. Toxicol. Mech. Methods 29, 710–722 (2019). 14. Elkhateeb, W. A. et al. Ganoderma applanatum secondary metabolites induced apoptosis through diferent pathways: In vivo and in vitro anticancer studies. Biomed. Pharmacother. 101, 264–277 (2018). 15. El-Nabi, S. H., Dawoud, G., El-Garawani, I. & El-Shafey, S. HPLC analysis of phenolic acids, antioxidant activity and in vitro efectiveness of green and roasted Cafea arabica bean extracts: a comparative study. Anti-Cancer Agents Med. Chem. 18, 1281–1288 (2018). 16. Ahmed, A., Ali, M. & Sherif, N. Anticancer activity of Morus nigra on human breast cancer cell line ( MCF-7): the role of fresh and dry fruit extracts. J. Biosci. Appl. Res 2, 352–361 (2016). 17. El-Garawani, I. M. et al. Candelariella vitellina extract triggers in vitro and in vivo cell death through induction of apoptosis: A novel anticancer agent. Food Chem. Toxicol. 127, 110–119 (2019). 18. Demain, A. L. & Sanchez, S. Microbial drug discovery: 80 Years of progress. J. Antibiot. (Tokyo) 62, 5–16 (2009). 19. Charu, G., Dhan, P., Garg, A. P. & Sneh, G. Nutraceuticals from microbes. In Phytochemicals of Nutraceutical Importance 79–102 (CABI, Wallingford, 2014). 20. Berdy, J. Bioactive microbial metabolites. J. Antibiot. (Tokyo) 58, 1–26 (2005). 21. Dang, V. T., Benkendorf, K., Green, T. & Speck, P. Marine snails and slugs: a great place to look for antiviral drugs. J. Virol. 89, 8114–8118 (2015). 22. Desbois, A. P., Mearns-Spragg, A. & Smith, V. J. A fatty acid from the diatom Phaeodactylum tricornutum is antibacterial against diverse bacteria including multi-resistant Staphylococcus aureus (MRSA). Mar. Biotechnol. 11, 45–52 (2009). 23. Plaza, A. et al. Celebesides A-C and theopapuamides B-D, depsipeptides from an Indonesian sponge that inhibit HIV-1 entry. J. Org. Chem. 74, 504–512 (2009). 24. Wei, X., Nieves, K. & Rodríguez, A. D. Neopetrosiamine A, biologically active bis-piperidine alkaloid from the Caribbean sea sponge Neopetrosia proxima. Bioorgan. Med. Chem. Lett. 20, 5905–5908 (2010). 25. Nuijen, B. et al. Pharmaceutical development of anticancer agents derived from marine sources. Anticancer. Drugs 11, 793–811 (2000). 26. Asolkar, R. N. et al. Arenamides A-C, cytotoxic NFkappaB inhibitors from the marine actinomycete Salinispora arenicola. J. Nat. Prod. 72, 396–402 (2009). 27. Eltem, R. & Ucar, F. Te determination of antimicrobial activity spectrum of 23 Bacillus strains isolated from Denizli-Acigol (Bitter Lake) which is soda lake (Na2SO4). J. KUKEM 21, 57–64 (1998). 28. Giddings, L.-A. & Newman, D. J. Bioactive compounds from marine extremophiles. In Bioactive Compounds from Marine Extre- mophiles 1–124 (Springer, Cham, 2015). 29. Bitzer, J. et al. New aminophenoxazinones from a marine Halomonas sp.: fermentation, structure elucidation, and biological activ- ity. J. Antibiot. (Tokyo) 59, 86–92 (2006). 30. Sagar, S. et al. Induction of apoptosis in cancer cell lines by the Red Sea brine pool bacterial extracts. BMC Complement. Altern. Med. 13, 344 (2013). 31. Mi, J. N., Wang, J. R. & Jiang, Z. H. Quantitative profling of sphingolipids in wild Cordyceps and its mycelia by using UHPLC-MS. Sci. Rep. 6, 1–11 (2016). 32. Marrouchi, R. et al. Toxic C17-sphinganine analogue mycotoxin, contaminating tunisian mussels, causes faccid paralysis in rodents. Mar. Drugs 11, 4724–4740 (2013). 33. Kharrat, R. et al. Te marine phycotoxin gymnodimine targets muscular and neuronal nicotinic acetylcholine receptor subtypes with high afnity. J. Neurochem. 107, 952–963 (2008).
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 13 Vol.:(0123456789) www.nature.com/scientificreports/
34. El-Gendy, M. M. A., Shaaban, M., El-Bondkly, A. M. & Shaaban, K. A. Bioactive benzopyrone derivatives from new recombinant fusant of marine streptomyces. Appl. Biochem. Biotechnol. 150, 85–96 (2008). 35. Cooper, E. L. & Albert, R. Tunicates: A vertebrate ancestral source of antitumor compounds. In Handbook of Anticancer Drugs from Marine Origin 383–395 (Springer, Cham, 2015). 36. Lee, J.-C. et al. Marine algal natural products with anti-oxidative, anti-infammatory, and anti-cancer properties. Cancer Cell Int. 13, 55 (2013). 37. Sithranga Boopathy, N. & Kathiresan, K. Anticancer drugs from marine flora: an overview. J. Oncol. https://doi. org/10.1155/2010/214186 (2010). 38. Ganguly, R. K., Midya, S. & Chakraborty, S. K. Antioxidant and anticancer roles of a novel strain of Bacillus anthracis isolated from vermicompost prepared from paper mill sludge. Biomed Res. Int. https://doi.org/10.1155/2018/1073687 (2018). 39. Burlacu, A. Regulation of apoptosis by Bcl-2 family proteins. J. Cell. Mol. Med. 7, 249–257 (2003). 40. Zhu, L., Wang, P., Qin, Q. L., Zhang, H. & Wu, Y. J. Protective efect of polypeptides from larva of housefy (Musca domestica) on hydrogen peroxide-induced oxidative damage in HepG2 cells. Food Chem. Toxicol. 60, 385–390 (2013). 41. Kumar, S., Sharma, V. K., Yadav, S. & Dey, S. Antiproliferative and apoptotic efects of black turtle bean extracts on human breast cancer cell line through extrinsic and intrinsic pathway. Chem. Cent. J. 11, 1–10 (2017). 42. Tan, J., Wang, B. & Zhu, L. Regulation of survivin and Bcl-2 in HepG2 cell apoptosis induced by quercetin. Chem. Biodivers. 6, 1101–1110 (2009). 43. Abdel Moneim, A. E. Indigofera oblongifolia prevents lead acetate-induced hepatotoxicity, oxidative stress, fbrosis and apoptosis in rats. PLoS ONE 11, e158965 (2016). 44. Marchenko, N. D., Zaika, A. & Moll, U. M. Death signal-induced localization of p53 protein to mitochondria a potential role in apoptotic signaling. J. Biol. Chem. 275, 16202–16212 (2000). 45. Mihara, M. et al. p53 has a direct apoptogenic role at the mitochondria. Mol. Cell 11, 577–590 (2003). 46. Qu, L. et al. Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents p53-dependent apoptosis by a pathway involving glycogen synthase kinase-3β. Genes Dev. 18, 261–277 (2004). 47. Ruiz-Ruiz, C. et al. An exopolysaccharide produced by the novel halophilic bacterium Halomonas stenophila strain B100 selectively induces apoptosis in human T leukaemia cells. Appl. Microbiol. Biotechnol. 89, 345–355 (2011). 48. Liu, T., Brouha, B. & Grossman, D. Rapid induction of mitochondrial events and caspase-independent apoptosis in Survivin- targeted melanoma cells. Oncogene 23, 39–48 (2004). 49. Bröker, L. E., Kruyt, F. A. E. & Giaccone, G. Cell death independent of caspases: a review. Clin. Cancer Res. 11, 3155–3162 (2005). 50. Maier, T., Güell, M. & Serrano, L. Correlation of mRNA and protein in complex biological samples. FEBS Lett. https://doi. org/10.1016/j.febslet.2009.10.036 (2009). 51. Wu, G., Nie, L. & Zhang, W. Integrative analyses of posttranscriptional regulation in the yeast Saccharomyces cerevisiae using transcriptomic and proteomic data. Curr. Microbiol. https://doi.org/10.1007/s00284-008-9145-5 (2008). 52. Elmore, S. Apoptosis: a review of programmed cell death. Toxicol. Pathol. https://doi.org/10.1080/01926230701320337 (2007). 53. Shalini, S., Dorstyn, L., Dawar, S. & Kumar, S. Old, new and emerging functions of caspases. Cell Death Difer. https://doi. org/10.1038/cdd.2014.216 (2015). 54. Galluzzi, L. et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Difer. https://doi.org/10.1038/s41418-017-0012-4 (2018). 55. Jänicke, R. U., Sprengart, M. L., Wati, M. R. & Porter, A. G. Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J. Biol. Chem. https://doi.org/10.1074/jbc.273.16.9357 (1998). 56. Blanc, C. et al. Caspase-3 is essential for procaspase-9 processing and cisplatin-induced apoptosis of MCF-7 breast cancer cells. Cancer Res. 60, 4386–4390 (2000). 57. Xu, B. et al. Proliferating cell nuclear antigen (PCNA) regulates primordial follicle assembly by promoting apoptosis of oocytes in fetal and neonatal mouse ovaries. PLoS ONE 6, e16046 (2011). 58. DiPaola, R. S. To arrest or not to G(2)-M Cell-cycle arrest. Clin. Cancer Res. 8, 3311–3314 (2002). 59. Bennukul, K., Numkliang, S. & Leardkamolkarn, V. Melatonin attenuates cisplatin-induced HepG2 cell death via the regulation of mTOR and ERCC1 expressions. World J. Hepatol. 6, 230 (2014). 60. Brandwagt, B. F. et al. A longevity assurance gene homolog of tomato mediates resistance to Altemaria alternata f sp lycopersici toxins and fumonisin B1. Proc. Natl. Acad. Sci. USA 97, 4961–4966 (2000). 61. Van Meer, G. & De Kroon, A. I. P. M. Lipid map of the mammalian cell. J. Cell Sci. 124, 5–8 (2011). 62. Olsen, I. & Jantzen, E. Sphingolipids in bacteria and fungi. Anaerobe 7, 103–112 (2001). 63. Batrakov, S. G., Mosezhnyi, A. E., Ruzhitsky, A. O., Sheichenko, V. I. & Nikitin, D. I. Te polar-lipid composition of the sphingolipid- producing bacterium Flectobacillus major. Biochim. Biophys. Acta 1484, 225–240 (2000). 64. An, D. et al. Sphingolipids from a symbiotic microbe regulate homeostasis of host intestinal natural killer T cells. Cell 156, 123–133 (2014). 65. Hong, S. et al. Inhibitory efect against Akt by cyclic dipeptides isolated from Bacillus sp. J. Microbiol. Biotechnol. 18, 682–685 (2008). 66. Vázquez-Rivera, D. et al. Cytotoxicity of cyclodipeptides from pseudomonas aeruginosa PAO1 leads to apoptosis in human cancer cell lines. Biomed Res. Int. 20, 15. https://doi.org/10.1155/2015/197608 (2015). 67. Karanam, G., Arumugam, M. K. & Sirpu Natesh, N. Anticancer efect of marine sponge-associated Bacillus pumilus AMK1 derived dipeptide Cyclo (-Pro-Tyr) in human liver cancer cell line through apoptosis and G2/M phase arrest. Int. J. Pept. Res. Ter. 26, 445–457 (2020). 68. Save, S. A., Lokhande, R. S. & Chowdhary, A. S. Determination of 1, 2-benzenedicarboxylic acid, bis (2-ethylhexyl) ester from the twigs of Tevetia peruviana as a colwell biomarker. JIPBS 2, 349–362 (2015). 69. Wu, Y. S. et al. Anticancer activities of surfactin potential application of nanotechnology assisted surfactin delivery. Front. Phar- macol. 8, 761 (2017). 70. Abdelli, F. et al. Antibacterial, anti-adherent and cytotoxic activities of surfactin(s) from a lipolytic strain Bacillus safensis F4. Biodegradation 30, 287–300 (2019). 71. Alvionita, M. & Hertadi, R. Bioconversion of glycerol to biosurfactant by halophilic bacteria Halomonas elongata BK-AG18. Indones. J. Chem. 19, 48–57 (2019). 72. Kim, S. D. et al. A comparison of the anti-infammatory activity of surfactin A, B, C, and D from Bacillus subtilis. J. Microbiol. Biotechnol. 16, 1656–1659 (2006). 73. Meena, K. R., Sharma, A. & Kanwar, S. S. Antitumoral and antimicrobial activity of surfactin extracted from Bacillus subtilis KLP2015. Int. J. Pept. Res. Ter. 26, 423–433 (2020). 74. Vollenbroich, D., Pauli, G., Özel, M. & Vater, J. Antimycoplasma properties and application in cell culture of surfactin, a lipopeptide antibiotic from Bacillus subtilis. Appl. Environ. Microbiol. 63, 44–49 (1997). 75. Kracht, M. et al. Antiviral and hemolytic activities of surfactin isoforms and their methyl ester derivatives. J. Antibiot. 52, 613–619 (1999). 76. Sen, R. Surfactin: Biosynthesis, Genetics and Potential Applications 316–323 (Springer, New York, 2010). 77. Jacques, P. Surfactin and Other Lipopeptides from Bacillus spp 57–91 (Springer, Berlin, 2011).
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 14 Vol:.(1234567890) www.nature.com/scientificreports/
78. Heerklotz, H. & Seelig, J. Detergent-like action of the antibiotic peptide surfactin on lipid membranes. Biophys. J. 81, 1547–1554 (2001). 79. Lee, J. H. et al. Te production of surfactin during the fermentation of cheonggukjang by potential probiotic Bacillus subtilis CSY191 and the resultant growth suppression of MCF-7 human breast cancer cells. Food Chem. 131, 1347–1354 (2012). 80. Liu, X. et al. Efect of themicrobial lipopeptide on tumor cell lines: apoptosis induced by disturbing the fatty acid composition of cell membrane. Protein Cell 1, 584–594 (2010). 81. Kameda, Y. & Kanatomo, S. Abstracts papers, Te 88th Annual Meeting of Pharmaceutical Society of Japan. In Te 88th Annual Meeting of Pharmaceutical Society of Japan (p. 431) (1968). 82. Kim, S. Y. et al. Surfactin from Bacillus subtilis displays anti-proliferative efect via apoptosis induction, cell cycle arrest and survival signaling suppression. FEBS Lett. 581, 865–871 (2007). 83. Dorn, E., Hellwig, M., Reineke, W. & Knackmuss, H. J. Isolation and characterization of a 3-chlorobenzoate degrading pseu- domonad. Arch. Microbiol. 99, 61–70 (1974). 84. Chang, Y.-J. et al. Phylogenetic analysis of aerobic freshwater and marine enrichment cultures efcient in hydrocarbon degrada- tion: efect of profling method. J. Microbiol. Methods 40, 19–31 (2000). 85. Tomas, A. T. et al. In vitro anticancer activity of microbial isolates from diverse habitats. Braz. J. Pharm. Sci. 47, 279–287 (2011). 86. Miao, L. et al. Te anti-infammatory potential of Portulaca oleracea L. (purslane) extract by partial suppression on NF-κB and MAPK activation. Food Chem. 290, 239–245 (2019). 87. El-Seedi, H. R. et al. Te traditional medical uses and cytotoxic activities of sixty-one Egyptian plants: discovery of an active cardiac glycoside from Urginea maritima. J. Ethnopharmacol. 145, 746–757 (2013). 88. Takur, A. N. et al. Antiangiogenic, antimicrobial, and cytotoxic potential of sponge-associated bacteria. Mar. Biotechnol. 7, 245–252 (2005). 89. Liu, K., Liu, P. C., Li, R. & Wu, X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with fow cytometry. Med. Sci. Monit. Basic Res. 21, 15–20 (2015). 90. Dassonneville, L. et al. Cytotoxicity and cell cycle efects of the plant alkaloids cryptolepine and neocryptolepine: relation to drug- induced apoptosis. Eur. J. Pharmacol. 409, 9–18 (2000). 91. Dengler, R. et al. Immunocytochemical and fow cytometric detection of proteinase 3 (myeloblastin) in normal and leukaemic myeloid cells. Br. J. Haematol. 89, 250–257 (1995). 92. Hsu, S.-M., Raine, L. & Fanger, H. X. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a com- parison between ABC and unlabeled antibody (PAP) procedures. J. Histochem. Cytochem. 29, 577–580 (1981). 93. El-Garawani, I. M. Ameliorative efect of Cymbopogon citratus extract on cisplatin-induced genotoxicity in human leukocytes. J. Biosci. Appl. Res. 1, 304–310 (2015). 94. Singh, N. P., McCoy, M. T., Tice, R. R. & Schneider, E. L. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp. Cell Res. 175, 184–191 (1988). Acknowledgements We are very grateful to the Swedish Research links grant VR (Stockholm, Sweden), Grant number 2016-05908 for generous fnancial support. Dr. S.A.M. Khalifa thanks the Department of Molecular Biosciences, Wenner- Grens Institute, Stockholm University, Sweden. Author contributions H.S., S.S. and I.EL-G. planned and designed the experiments; I.El-G. and N.A. performed analyzed and wrote the biological and molecular experiments; H.S. and D.M. performed, analyzed and wrote the phytochemical experiments; H.A. performed the microbiological experiments; H.A. and I.El-G. wrote the manuscript; I.El-G., S.K. and O.E. revised the manuscript. All authors read and approved the fnal manuscript.
Competing interests Te authors declare no competing interests. Additional information Supplementary information is available for this paper at https://doi.org/10.1038/s41598-020-70945-8. Correspondence and requests for materials should be addressed to I.M.E.-G. or H.R.E.-S. Reprints and permissions information is available at www.nature.com/reprints. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional afliations. Open Access Tis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Te images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© Te Author(s) 2020
Scientific Reports | (2020) 10:14076 | https://doi.org/10.1038/s41598-020-70945-8 15 Vol.:(0123456789)