The Activation of Protein Kinase SLK

ARTEM LUHOVY

Faculty of Medicine, Division of Experimental Medicine McGill University, Montreal, Quebec

August, 2010

A THESIS SUBMITTED TO MCGILL UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS OF THE DEGREE OF THE

MASTERS OF SCIENCE

Page 1 of 68 Table of contents: Introduction 5

Abstract (English) 5

Résumé (Français) 6

Table of Abbreviations 7

Background 8

The Nephron 8 Fig. 1: Development of the Nephron. (Rosenblum 2008)! 8

Kidney Development 9 Fig. 2: Glomerulus. (Rosenblum 2008)! 9

Ischemia-Reperfusion Injury and Acute Renal Failure 10

MAPK Pathways 11

Ste20-Like Kinase, SLK: Functions and Localization 12

SLK mRNA & Amino Acid Sequence 14 Fig. 3: Domains of SLK.! 14

Protein Kinase Activation 15 Fig. 4: Kinase activation segment. (Pike, Rellos et al. 2008)! 16 Fig. 5: Non-consensus auto activation.! 18

In Trans Auto-Activation via Activation Segment Domain Exchange 18 Fig. 6: Activation Segment Domain Exchange.! 19

SLK Crystal Structure 19 Fig. 7: SLK Homodimerization. (Pike, 2008)! 19 Fig. 8: Activation segment. (Pike, 2008)! 19 Fig. 9: Activation Segment Phosphorylation induces Hydrogen Bond Network in Homodimerized SLK. (Pike, 2008)! 20 Fig. 10: Lys-Glu bond possibly responsible for sustained catalytic activity in SLK monomer. (Pike, Rellos et al. 2008)! 22 Fig. 11: Highly conserved amino acids in evolutionarily related protein (Pike, Rellos et al. 2008)! 22

Objective of the Research Project and Hypotheses 23

Speciﬁc Aims 24

Materials and Methods 25

Insertion of Point Mutations 25

Page 2 of 68 Cell Culture 26

Transfection and Cell Harvesting 27

Immunoblotting 27

Immune Complex Kinase Assay 28 Table 1: PCR and Sequencing Primers! 29

SLK Homodimerization Construct 30

Dual Luciferase Reporter (DLR) Assays 32

Measurement of Apoptosis and Late Apoptosis 32

Statistics 33

Results 34

Activation Segment Point Mutations Inhibit SLK Kinase Activity 34

Expression of Activation Segment SLK Mutants Affects JNK, p38 and AP-1 35

SLK Homodimerization Increases Kinase Activity of SLK WT, but not SLK Mutants 36

The T183A/S189A SLK Double Mutant Fails to Induce Apoptosis and Late Apoptosis 38

Phosphomimetic Mutations in SLK (T183D, T183E, S189D, S189E) Do Not Enhance Kinase Activity 39

SLK Mutants Fv-SLK 1-373 K63R, E79A Show Reduced Kinase Activity 39

Interaction of SLK WT with the T183A/S189A Double Mutant 40

Figures(1-11 in Background) 42

Fig. 12: Point mutations in the SLK activation domain inhibit catalytic activity 42

Fig. 13: Point mutations in the SLK activation domain reduce JNK phosphorylation. 43

Fig. 14: Point mutations in the SLK activation domain reduce p38 phosphorylation and reduce AP-1 activity 44

Fig. 15: SLK homodimerization increases kinase activity of Fv-SLK 1-373 WT, but not SLK mutants T183A/S189A and T193A. 45

Fig. 16: SLK may be activated by PKA 46

Fig. 17: Fv-SLK 1-373 T183A/S189A fails to induce apoptosis and late apoptosis in GEC 47

Fig. 18: Phosphomimetic mutations Fv-SLK 1-373 T183D & T183E do not enhance kinase activity 48

Page 3 of 68 Fig. 19: Phosphomimetic mutations in Fv-SLK 1-373 S189D & S189E do not enhance kinase activity 49

Fig. 20: Fv-SLK 1-373 Mutants K63R and E79A show reduced kinase activity 50

Fig. 21: Interaction of Fv-SLK 1-373 WT with Fv-SLK 1-373 T183A/S189A 51

Discussion and Conclusion 52

SLK Activation 52

Downstream Effects of SLK Activation 53

Homodimerization of SLK 54

SLK Activation Segment Mutants 55

Function of SLK 56

SLKʼs Pathophysiological Role 57

SLK Regulation 58

Conclusion 61

Acknowledgments 62 Bibliography (all) 63

Page 4 of 68 Introduction

Abstract (English) The inappropriate expression, localization, or activation of kidney protein kinases may precipitate renal dysplasia or cystic diseases. The expression and activation of the Ste20-like kinase, SLK, is increased during renal development and recovery from ischemic acute renal failure (ARF). Activation of SLK promotes apoptosis and, during development and healing, SLK may regulate cell growth. Alternatively, in glomerular diseases, the activation of SLK and apoptosis of glomerular epithelial cells (GEC) may be harmful and lead to sclerotic glomerular injury. The overall aim of the project is to elucidate the regulation of SLK activity in order to better understand the role of SLK in kidney development and injury. It is proposed that activation of SLK may be due to upregulation of expression, which may then favor homodimerization and autophosphorylation. Serine and threonine residues were mutated in the putative activation segment of the SLK catalytic domain. Wild type (WT) and mutant proteins were expressed in COS-1 cells or GEC. Compared with SLK WT, the S189A mutant and the T183A/S189A double mutant showed trivial in vitro kinase activity, while kinase activity was reduced significantly by the T183A mutation. Expression of SLK WT increased activation-specific phosphorylation of c-Jun N-terminal kinase (JNK) and p38 kinase, reflecting enhanced signaling via stress kinase pathways. In contrast, activation of JNK by SLK T183A, S189A, and T183A/S189A and p38 by T183A/S189A was impaired. Similarly, expression of SLK WT stimulated activator protein-1 (AP1) reporter activity, but activation of AP1 by the three SLK mutants was ineffective. To test if homodimerization of SLK affects phosphorylation, the cDNA encoding the SLK catalytic domain (amino acids 1-373) was fused with a cDNA for a modified FK506 binding protein, Fv (SLK-Fv). After transfection, addition of AP20187 (an FK506 analog) induced regulated dimerization of SLK-Fv. AP20187-stimulated dimerization enhanced the kinase activity of SLK-Fv WT. In contrast, kinase activities of SLK-Fv T183A/S189A and activation site mutants E79A, K63R, T193A were weak, and were not enhanced after dimerization. Surprisingly, phosphomimetic mutants of SLK-Fv, including T183D, T183E, S189D, and S189E showed weak kinase activity, which was unaffected by dimerization. Co-transfection of SLK and T183A/S189A failed to silence the kinase activity of the WT in an in vitro kinase assay. Finally, apoptosis and late apoptosis were increased after expression of SLK-Fv WT, but not T183A/S189A. Thus, phosphorylation of T183, S189 and T193 plays a key role in the activation and signaling of SLK and could represent a target for novel therapeutic approaches to renal injury.

Page 5 of 68 Résumé (Français) Une expression, une localisation ou une activation inappropriée des protéines kinases rénales peut provoquer une dysplasie rénale ou une maladie cystique prématurée. Lʼexpression et lʼactivation de la protéine Ste20-like kinase (SLK) sont plus élevées pendant le développement des reins et durant la guérison dʼune insuffisance rénale ischémique aiguë. Une activation de la protéine SLK entraîne lʼapoptose des cellules in vitro et in vivo. Au cours du développement et de la régénérescence cellulaire, SLK peut réguler la croissance cellulaire. Par contre, dans les glomérulonéphrites, lʼactivation de la SLK et une apoptose des cellules épithéliales glomérulaires (GEC) peuvent être dommageables et peuvent provoquer des lésions glomérulaires sclérotiques. Lʼobjectif de ce projet est dʼélucider la régulation de lʼactivité de la SLK dans le but de mieux comprendre son rôle dans le développement et les lésions ou maladies glomérulaires rénales. Ce projet postule que lʼactivation de la protéine SLK peut être due à une régulation à la hausse de lʼexpression, qui peut alors favoriser une homodimérisation et une autophosphorylation. Pour étudier le rôle de la phosphorylation dans la régulation de lʼactivation, les résidus sérine (S189) et thréonine (T183) ont été mutés dans le segment putatif du domaine catalytique de la SLK. Deux mutants simples (T183A et S189A) et un double mutant (T183A/S189A) ont été créés. La forme sauvage (WT) et les mutants de la SLK ont été exprimés dans les cellules cos-1 et GEC. SLK WT phosphorylais la protéine basique de myéline (MBP) contrairement aux mutants S189A et T183A/S189A qui montraient une activité kinase in vitro non significative. La mutation T183A diminuait la phosphorylation de MBP significativement. Lʼanalyse des voies de signalisation de la kinase N-terminal c-jun (JNK) et de la p38 par la SLK a été étudiée sachant que lʼexpression de la SLK WT stimule la phosphorylation de la JNK et de la p38. Tant que T183A/S189A nʼa pas pu activer la JNK et la p38, les mutants T183A et S189A ont activé la JNK à un degré moindre que la SLK WT. Ces résultats démontrent que la phosphorylation de T183 et de S189 est importante pour lʼactivation de la SLK. De façon similaire, lʼexpression de la SLK WT a stimulé lʼactivation de la protéine activatrice 1 (AP1), un facteur de transcription de la famille c-fos et c-Jun, tandis que les trois mutants ont été incapables de stimuler AP1. Pour déterminer si lʼhomodimérisation de la SLK affecte la phosphorylation, lʼADN complémentaire de la SLK codant le domaine catalytique (1-373) a été fusionné avec lʼADN complémentaire dʼune protéine modifiée qui sʼattache à des molécules FK506 (Fv), pour créer SLK-Fv. Après la transfection, lʼaddition du AP20187, un analogue de FK506, induit la dimérisation de la SLK-Fv. La dimérisation occasionnée par lʼAP20187 a augmenté lʼactivité catalytique de la SLK-Fv. Par contre, tous les mutants Fv fusionnés T183A/S189A, E79A, K63R et T193A démontraient une activité catalytique faible, que la dimérisation nʼa pas pu augmenter. Ce qui est particulièrement intéressant, les mutants phosphomimétiques T183D, T183E, S189D et S189E montraient aussi une activité catalytique faible qui nʼa pas été affectée par la dimérisation. Finalement, lʼapoptose et la nécrose sont accrues suite à une surexpression de la SLK-Fv WT, mais pas avec le mutant T183A/S189A-Fv. Ainsi, les acides aminés K63 et E79 et la phosphorylation de T183, S189 et T193 jouent un rôle important dans la régulation de la SLK et pourraient être ciblés par des approches thérapeutiques pour le traitement des néphropathies.

Page 6 of 68 Table of Abbreviations

AP1 - Activator Protein-1 HA - Hema Agglutinin

ARE - Adenine and Uridine Rich Element IgG - Immunoglobulin G

ARF - Acute Renal Failure JNK - c-Jun N-terminal kinase

ATP - Adenosine Tri-Phosphate MAPK - Mitogen-Activated Protein Kinase

BSA - Bovine Serum Albumin mRNA - Messenger RNA cDNA - Complementary DNA PCR - Polymerase Chain Reaction

CNS - Central Nervous System PKA - Protein Kinase A

COS-1 - cell line that is CV-1 (simian) in RNA - Ribonucleic Acid origin and carrying SV40 genetic material

DLR - Dual Luciferase Reporter RT-PCR - Reverse Transcriptase Polymerase Chain Reaction

DNA - Deoxyribonucleic Acid SDS-PAGE - Sodium Dodecyl Sulfate PolyAcrylamide Gel Electrophoresis dNTP - Deoxyribonucleotide Triphosphate SLK - Ste20-like Kinase

EGF - Epidermal Growth Factor SLK-Fv - cDNA encoding the SLK catalytic domain (amino acids 1-373) fused to cDNA for a modiﬁed FK506 binding protein, Fv

ERK - Extracellular Signal-Regulated TUNEL - Terminal deoxynucleotidyl Kinase transferase dUTP nick end labeling

GCK - Germinal Center Kinase UTR - Un-Translated Region

GEC - Glomerular Epithelial Cells WT - Wild Type

Page 7 of 68 Background

The Nephron Fig. 1: Development of the Nephron. (Rosenblum 2008)

The nephron is the basic functional unit of the kidney (Fig. 1) and is responsible for

ﬁltering plasma by removing toxins and metabolic waste. Solute from the glomerular capillaries enters via the renal corpuscle of the nephron. The renal corpuscle consists of

Bowman’s capsule and the glomerulus, which is made up of interdigitating podocytes

(glomerular epithelial cells; GEC), endothelial cells and mesangial cells, and extracellular matrix. Solute filters into the urinary space through the narrow filtration slits between the foot processes of the podocytes via the filtration diaphragms. Solute travels to the proximal convoluted tubule, the loop of Henle and the distal convoluted tubule, where water, nutrients and small proteins are selectively reabsorbed. The kidneys ensure that waste is collected as a concentrated fluid to be excreted as urine.

(Widmaier, Raff et al. 2006)

Page 8 of 68 Kidney Development Fig. 2: Glomerulus. (Rosenblum 2008)

The adult kidney is formed by two fundamental and complementary processes, nephrogenesis and branching morphogenesis. During nephrogenesis, the glomerulus and tubules are formed with the exception of the collecting duct. Branching morphogenesis entails the development of the collecting ducts, calyces, pelvis and ureter. The adult kidney arises from two embryonic tissues, the metanephric mesenchyme and the ureteric bud. The ureteric bud originates as an epithelial outgrowth of the caudal portion of the Wolfﬁan duct. Both the metanephric mesenchyme and the ureteric bud are derived from the intermediate mesoderm, which lies posterior to the mesonephros. All epithelial cell types comprising the mature nephron are derived from the metanephric mesenchyme. (Rosenblum 2008)

Development of the adult kidney is preceded by the formation of two other mesenchyme-derived structures, including the pronephros and the mesonephros. While both the pronephros and the mesonephros can be described as kidney-like, they are

Page 9 of 68 transient structures that do not contribute to the permanent kidney. While the anterior pronephros degenerates in mammals, the more posterior mesonephros gives rise to reproductive organs in males, including the rete testis, efferent ducts, epididymis, vas deferens, seminal vesicle and prostate. The mesonephric portion of the Wolfﬁan duct degenerates in females. (Rosenblum 2008)

Growth factor and mitogen-activated protein kinase (MAPK) pathways are important mediators of renal cell growth and differentiation. During development, there is both proliferation and apoptosis of cells (Koseki, Herzlinger et al. 1992); (Savill 1999), which requires tight regulation. The extracellular signal-regulated kinase (ERK) and p38 pathways are strongly expressed in developing kidneys and their inhibition may disrupt nephrogenesis and kidney growth (Cybulsky, Takano et al. 2004). ERK has been implicated in branching nephrogenesis (Dressler 2006), while the stimulation of the ERK pathway promotes cell proliferation, survival, differentiation and migration (Fisher,

Michael et al. 2001).

Ischemia-Reperfusion Injury and Acute Renal Failure Acute renal failure is a process that typically involves injury of the renal tubular epithelial cells, and to a lesser extent, glomerular cells of the nephron (Waikar, Curhan et al. 2006). Acute renal failure may lead to rapid cessation of renal function, and is one of the most common and serious complications of hospitalized patients (Waikar, Curhan et al. 2006). It affects 288 people per 100,000 and the incidence has been on the rise for

Page 10 of 68 over 20 years (Waikar, Curhan et al. 2006). Risk factors include chronic kidney disease and diabetes.

Ischemia-reperfusion injury is a major cause of acute renal failure. Shock, sepsis or kidney transplantation may result in a transient decrease in blood ﬂow to the kidneys.

In turn, this results in ischemia, characterized by renal ATP depletion, a buildup of metabolites and acidosis. Upon restoration of renal blood ﬂow (reperfusion), DNA and proteins, including those making up plasma membranes of cells are damaged by reactive oxygen species and inﬂammation. Damage to cells making up the renal tubules, including disruption of tight junctions impairs the tubular reabsorptive process

(Chamoun, Burne et al. 2000). Damaged cells may recover from injury, but extensive damage may result in apoptosis or necrosis. Such cells may detach and cause obstruction of the renal tubules. Sublethally damaged cells may undergo a process of dedifferentiation, proliferation and redifferentiation, which recapitulates renal development and reconstitutes normal renal epithelium (Cybulsky, Takano et al. 2009).

MAPK Pathways Kidneys subjected to ischemia-reperfusion injury show activation of MAPKs, including

ERK, c-Jun N-terminal kinase (JNK) and p38, during the reperfusion phase. Exogenous addition of epidermal growth factor (EGF) in animal models accelerates recovery of tubular function following ischemia-reperfusion injury (Liu and Humes 1993); (Nigam and Lieberthal 2000). In contrast, p38 along with JNK are stress-activated protein

Page 11 of 68 kinases which are phosphorylated and activated following exposure to ultra violet radiation, heat or osmotic shock (Liu and Humes 1993); (Nigam and Lieberthal 2000).

Phospho (p)-JNK and p-p-38 in turn phosphorylate downstream targets in the cytosol or the nucleus, including, activator protein-1 (AP-1), c-Jun, Bim, Bmf & p53 (JNK)

(Davis 2000), and ATF-2 & Bcl-2 (p38) (De Chiara, Marcocci et al. 2006). Stimulation of

JNK and p38 pathways leads to the withdrawal from the cell cycle, apoptosis or cell repair (Liu and Humes 1993); (Nigam and Lieberthal 2000). JNK is transiently activated after ischemia, while inhibition of the JNK/AP-1 pathway improves outcome in a rat model of neonatal ischemia-reperfusion brain injury (Nijboer, van der Kooij et al. 2010).

Ste20-Like Kinase, SLK: Functions and Localization Mammalian SLK is a serine/threonine protein kinase related to yeast Ste20, an integral part of the yeast pheromone pathway (Zhao, Leung et al. 1995); (Dan, Watanabe et al.

2001). The Ste20 kinase family is divided into the p21-activated kinases and the germinal center kinases (GCK); SLK is classiﬁed as a group V GCK (Dan, Watanabe et al. 2001); (Delpire 2009). SLK is expressed ubiquitously, including in the heart, skeletal muscle, liver, lung, brain testes and kidney (Zhang, Hume et al. 2002). SLK is expressed in the forebrain, midbrain and hindbrain of the developing central nervous system and in renal proximal and distal tubular epithelial cells and podocytes (GEC) in adult and fetal kidneys (Zhang, Hume et al. 2002). Developing rat kidneys show increased SLK mRNA on embryonic days 17, 19 and 21 as compared to adult control kidneys

(Cybulsky, Takano et al. 2004). In adult and fetal kidneys, SLK is strongly expressed in

Page 12 of 68 the renal proximal and distal tubular epithelial cells (Cybulsky, Takano et al. 2004). A fainter, patchy expression is also noted in podocytes/GEC (Cybulsky, 2004). Transfected cells that over-express SLK show apoptotic markers in annexin-5 and TUNEL assays

(Sabourin and Rudnicki 1999). SLK co-localizes with the mitotic spindle in cells undergoing mitosis and plays a role in cell cycle progression (Ellinger-Ziegelbauer,

Karasuyama et al. 2000). Activity of endogenous SLK in HeLa cells increases after the release from G1/S arrest, reaching a maximum in G2/M. Activity then decreases in cells exiting mitosis and entering G1, with levels of SLK expression remaining stable

(Ellinger-Ziegelbauer, Karasuyama et al. 2000).

SLK is also reported to localize at the microtubules and centrosomes (Zinovkina,

Poltaraus et al. 1997); (Zinovkina, Poltaraus et al. 1998); (Nadezhdina, Zinovkina et al.

2001); (Wagner, Flood et al. 2002). SLK is localized to the cytosol, nuclei, microtubules and centrosomes in Chinese hamster ovary cells (Zinovkina, Poltaraus et al. 1997). SLK increases stress ﬁber disassembly (O'Reilly, Wagner et al. 2005) while SLK depletion disrupts radial microtubule arrays in a variety of cell types (Burakov, Kovalenko et al.

2005). Due to its ubiquitous expression and role in cell cycle progression, the function of

SLK may differ depending on the cell type, developmental period and phase of the cell cycle. For example, SLK, along with multiple growth factors, receptors, cellular interactions and interactions with the surrounding matrix is important for renal development (Sorokin and Ekblom 1992). Kidneys recovering from acute renal failure as

Page 13 of 68 a result of ischemia reperfusion injury may recapitulate developmental kidney

processes (Cybulsky, Takano et al. 2009). Understanding the role of SLK in these

molecular pathways may be a key to developing novel approaches to treat and

diagnose kidney injury or perhaps cancer.

SLK mRNA & Amino Acid Sequence SLK consists of ~1235 amino acids, and contains a N-terminal catalytic domain and an

extensive C-terminal “regulatory” domain. When analyzed by SDS-PAGE, the

molecular mass of SLK (200 kDa) is greater than 139 kDa as predicted by the amino acid

sequence (Yamada, Tsujikawa et al. 2000), suggesting the presence of post-translational

modiﬁcations (Cybulsky, Takano et al. 2004). It has been suggested that cleavage of SLK

by caspase-3 may activate SLK, such that it becomes an effector of apoptosis and

cytoskeletal remodeling (Sabourin, Tamai et al. 2000).

Between the N-terminal catalytic domain of SLK and the C-terminal regulatory domain

lies a long unstructured sequence which appears to include four PEST sequences that

relate to the rapid degradation of a protein (Cybulsky, Takano et al. 2004). Sequences

rich in proline (P), glutamic acid (E), serine (S) and threonine (T) may act as a signal

peptide for protein degradation, possibly via the proteosome (Rechsteiner and Rogers

1996). The C-terminal region also contains coiled-coil domains, which may allow for the

dimerization of the protein (Fig. 3) (Cybulsky, Takano et al. 2004).

NH2- Catalytic 4 PEST sequences Regulatory domain, coiled-coils -COOH Fig. 3: Domains of SLK.

Page 14 of 68 SLK mRNA is unstable and contains adenine and uridine rich elements (ARE) in the 3’ untranslated region, including at least nine AUUUA motifs, which appear to regulate mRNA stability (Cybulsky, Takano et al. 2007). This appears to be the ﬁrst example of a

MAPK family member’s 3‘UTR regulating mRNA stability (Cybulsky, Takano et al.

2007). SLK mRNA has at least three distinct isoforms with approximate sizes of 6, 7 and

8kb (Sabourin and Rudnicki 1999). Some if not all the isoforms bind a ~30 kDa ARE binding protein (Cybulsky, Takano et al. 2007).

Protein Kinase Activation Protein kinases form a diverse and important gene family in eukaryotes (Scheeff and

Bourne 2005). They are involved in the regulation of many cellular processes and their dysregulation can result in disease and cancer (Cowley 2008); (Ali, Ali et al. 2009).

Protein kinases are the pharmaceutical industry’s most studied class of drug target and at least ten protein kinase inhibitors have already been approved for cancer treatment in the United States (Cohen 2009). Kinases are tightly regulated, often via their activation segment, which may be phosphorylated by other kinases to allow catalytic activity

(Nolen, Taylor et al. 2004). Typically, a kinase will phosphorylate the activation segment of a downstream kinase, activating it, and allowing the downstream kinase to further propagate a signal (Nolen, Taylor et al. 2004).

The three dimensional conformation of a protein is essential to its function (Caetano-

Anollés, Wang et al. 2009). Studying the site of protein-protein interaction provides

Page 15 of 68 information about the mechanisms of molecular recognition and functional mechanism of proteins (Ezkurdia, Bartoli et al. 2009). Detailed knowledge about the interacting surface provided by a crystal structure provides targets for analysis via point mutation and for drug design (Ezkurdia, Bartoli et al. 2009).

Fig. 4: Kinase activation segment. (Pike, Rellos et al. 2008) Activation segments of

protein kinases include a

magnesium binding site with

a highly conserved DFG

motif, a short beta strand

(Beta 9), an activation loop, a

P + 1 loop, and an APE

domain (Fig. 4) (Pike, Rellos et al. 2008). The activation segment is typically hinged around two invariable anchor points formed by the DFG motif and the central part of the P + 1 loop along with the alpha EF helix (Nolen, Taylor et al. 2004). The aspartate in the DFG domain is responsible for chelating a magnesium atom that positions a phosphate for phosphotransfer (Nolen, Taylor et al. 2004).

While unphosphorylated, the activation segment is largely unstructured.

Phosphorylation of the activation segment at the primary phosphorylation site

Page 16 of 68 stabilizes the kinase in a conformation suitable for substrate binding. Kinases may also have a secondary phosphorylation site in their activation segment, which may increase activity either moderately or extensively. Secondary phosphorylation may also aid in the recruitment of substrate by changing the conformation of a kinase such that substrate may bind more easily. Once a kinase is stabilized and activated, the catalytic domain of the protein identiﬁes a speciﬁc substrate, and phosphorylates the substrate via its active site. This process can be facilitated by increasing the local concentration of a kinase relative to a substrate, and may include dimerization of the kinase (Nolen,

Taylor et al. 2004).

Fig 5. Non-consensus auto activation

A subset of kinases can also auto-activate via self-phosphorylation of their activation segment by their catalytic domain (Oliver, Knapp et al. 2007). This form of activation requires that the activation segment contain a consensus sequence that can be recognized by the catalytic domain. In contrast, receptor tyrosine kinases dimerize in response to ligand, and activate signaling cascades following dimerization-induced reciprocal phosphorylation (Lemmon and Schlessinger 2010). In some dimerizing kinases, activation segment dimerization is a mechanism for kinase autophosphorylation of non-consensus sites (Oliver, Knapp et al. 2007). This allows the catalytic domain of one dimerization partner to phosphorylate the activation domain of the other partner even if the activation domain does not correspond to the substrate

Page 17 of 68 consensus sequence of the catalytic domain

(Fig. 5).

Fig. 5: Non-consensus auto activation. In Trans Auto-Activation via Activation Segment Domain Exchange

Activation segment domain exchange is a mechanism proposed for the in trans activation of kinases that do not require a Fig. 5: Non-consensus auto activation consensus sequence to be present in the activation segment of their binding partner. In this model, dimerization is induced in an adjacent homodimerization domain. Homodimerization occurs in an anti-parallel arrangement of the binding partners, such that the activation segment of one kinase is next to the catalytic site of the other kinase and vice versa. As such, the kinases are ideally positioned so that a transient activation of one catalytic site leads to the phosphorylation of the activation segment of the binding partner. This in turn leads to the activation of the binding partner and the phosphorylation of the original kinase in its activation segment; the ﬁnal result is the activation of two kinases (Fig. 6), which can dissociate, and phosphorylate downstream targets, including activating other kinases, thus amplifying and propagating a signaling cascade (Oliver, Knapp et al. 2007).

Page 18 of 68 Activation segment Catalytic P domain Dimerization P domain Catalytic domain Activation Dimerization segment domain

Fig. 6: Activation Segment Domain Exchange.

SLK Crystal Structure The crystal structure of SLK was published a few months before the start of my

Master’s degree and served as the basis for this project. The crystal structure described

the catalytic domain of

SLK as both a monomer

and a homodimer. Fig. 7

shows a theoretical scheme

Fig. 7: SLK Homodimerization. (Pike, Rellos et al. 2008) of how two monomeric

SLK catalytic domains (one in blue one in yellow) may form an anti-parallel homodimer. The kinase domains are in a closed active conformation with the αC helix forming a salt bridge between the αC glutamate, E97, and the active site lysine, K63

(Pike, Rellos et al. 2008).

Fig.Fig. 7: 8:SLK Activation Homodimerization. segment. (Pike, (Pike, 2008) 2008)

Page 19 of 68 The activation loop of SLK contains at least two potential phosphorylation sites, T183 and S189 (Fig. 8). The crystal structure predicts that during homodimerization of SLK catalytic domains, T183 and S189 of the activation segment of one molecule enters into close contact with the catalytic domain of the other and vice

Fig. 8: Activation segment. (Pike, 2008) versa. Interestingly, in one study, it

Fig. 9: Activation Segment Phosphorylation induces Hydrogen Bond Network in Homodimerized SLK. (Pike, 2008) was found that SLK recognizes the sequence X-X-X-Y-X-T*-Φ-R/K-X-X-X (*, site for phosphorylation; Φ, hydrophobic or aromatic amino acid), a sequence which does not appear in the activation segment of SLK (Pike, Rellos et al. 2008). Despite this, when

SLK is dimerized, it appears to

phosphorylate its partner’s

activation segment at T183,

inducing the formation of a

hydrogen bond network

involving R186 and R187,

possibly leading to a Fig. 9: Activation Segment Phosphorylation induces Hydrogen Bond Network in Homodimerized SLK. conformational change, which (Pike, Rellos et al. 2008)

Page 20 of 68 allows sustained catalytic activity by its partner’s catalytic domain. The phosphorylation of T183 appears to aid in the phosphorylation of S189, which is oriented towards the solvent, via the adjacent SLK monomer’s closely positioned catalytic aspartate D155 (Fig. 9). In the study by Pike et al., S189 phosphorylation appeared to be necessary for monomeric SLK kinase activity. The crystal structure of

Pike et al. also predicts that phosphorylation of SLK at T183 and S189 would increase the number of hydrogen bonds formed at the dimer interface from 18 to 29. Pike et al. further note that a bond between lysine 63 and glutamine 79 (Fig. 10) might be sufficient to lock an SLK monomer in the active confirmation, following activation domain exchange. Thus, once SLK enters the active confirmation, the activation segment may be less relevant for catalytic activity. The authors of the paper suggest that phosphorylation of SLK induces a conformation suitable for substrate binding, while at the same time Fig. 10: Lys-Glu bond possibly responsible for sustained catalytic activity in SLK monomer. (Pike, Rellos et al. 2008) decreasing affinity of one SLK monomer for another. This process may facilitate the dissociation of a SLK dimer into active monomers following activation segment domain exchange. Finally, Pike et al. noted that T193 in SLK was highly conserved in

Page 21 of 68 evolutionarily related kinases DAPK3 and CHK2, where it was also a known

phosphorylation site (orange), possibly playing a regulatory role (Pike, Rellos et al.

2008), (Fig. 11).

T183 S189 T193

Fig. 10: Lys-Glu bond possibly responsible for sustained catalytic activity in SLK monomer. (Pike, Rellos et al. 2008) Fig. 11: Highly conserved amino acids in evolutionarily related protein (Pike, Rellos et al. 2008)

Fig. 11: Highly conserved amino acids in evolutionarily related protein kinases (Pike, Rellos et al. 2008)

In summary, Pike et al. suggest that the role of T183 phosphorylation is to facilitate the

phosphorylation of S189 by stabilizing dimeric SLK. The phosphorylation of T183 and

S189 could be accompanied by a conformational change, which allows the formation of

a bond between K63 and E79, providing a mechanism for the sustained activity of a

monomeric SLK catalytic domain. The conformational change then lowers the afﬁnity of

one monomer for another, so that the SLK catalytic domain dimer dissociates in an

active form, allowing SLK to phosphorylate downstream targets. As such, amino acids

K63, E79, T183, S189 and T193 in SLK were identiﬁed for further study.

Page 22 of 68 Objective of the Research Project and Hypotheses

Expression and activation of SLK is increased during kidney development and recovery from ischemic acute kidney injury, which recapitulates certain aspects of kidney development (Cybulsky, Takano et al. 2004). SLK promotes apoptosis and therefore, may regulate cell growth during development, injury or healing. The regulation of SLK kinase activity appears complex and may involve mRNA and protein stability, level of protein expression, homodimerization, phosphorylation, etc. The objective of this study was to determine the role of phosphorylation in the regulation of kinase activity, focusing on amino acids K63, E79, T183, S189 and T193. If these residues are important to SLK activation, potentially as SLK substrates via activation segment domain exchange (T183, S189 and T193) or by forming a bond in the catalytic domain which sustains catalytic activity (K63, E79), then point mutations at these sites would result in a kinase with reduced activity. To test this hypothesis, residues T183, S189 and T193 in the putative activation segment of the SLK catalytic domain, as well as K63 and E79, near the active site, were mutated. SLK WT and mutant proteins were expressed in

COS-1 cells or GEC in order to study kinase activity or biological effects.

Page 23 of 68 Speciﬁc Aims

The speciﬁc aims are as follows:

1) To construct three full-length SLK mutants containing: a threonine 183 to alanine point mutation, a serine 189 to alanine mutation, and both a threonine 183 to alanine and a serine 189 to alanine mutation.

2) To express wild type and mutant SLKs in COS-1 cells via transient transfection, and determine kinase activity of mutants and wild type protein.

3) To overexpress mutant and wild type SLK in GEC and compare downstream signalling (speciﬁcally, effects on the activity of p38 and JNK).

4) To determine if threonine 183 and serine 189 phosphorylation is functionally important for SLK, by determining if mutant and wild type SLKs induce cell death.

5) To introduce mutations into a fusion protein containing the catalytic domain of SLK and a dimerization domain. This protein will enable the study of dimerization on the phosphorylation and activation of SLK.

6) To construct phosphomimetic mutants of SLK, including serine 189D, serine 189E, threonine 183D and threonine 183E, and determine if they are sufﬁcient for enhanced kinase activity.

7) To construct SLK mutants lysine 63R, glutamic acid 79A, threonine 193A, and determine if these amino acids are functionally important for SLK activity.

8) To determine the kinase activity of SLK WT dimerized with the T183A/S189A double mutant.

Page 24 of 68 Materials and Methods

Insertion of Point Mutations Point mutations in SLK were generated using polymerase chain reaction (PCR)-based mutagenesis. For the T183A mutation (Fig. 11), the PCR reactions included Full Length

SLK Forward and T183A Reverse primers (T183A Reaction 1), and T183A Forward/Full

Length SLK Reverse primers (T183A Reaction 2). Full length HA-tagged SLK (SLK WT) in a pcDNA 3.1 expression vector (Invitrogen) was used as template (see Table 1 for nucleotide sequences). Products of T183A reactions 1 and 2 were combined in a third

PCR reaction using primers Full Length SLK Forward and Full Length SLK Reverse

(Reaction 3) to generate a 1674 base pair SLK T183A cDNA. Pwo polymerase was incubated with 10mM dNTP, primers, and template DNA for 4 min, 94º C; [1 min; 94º C;

1 min, 60º C; 2 min, 72º C] for 35 cycles, followed by a ﬁnal elongation for 10 min, 72º C.

By analogy, the S189A mutant (Fig. 11) was generated using the primers Full Length

SLK Forward/S189A Reverse (S189A Reaction 1), S189A Forward/Full Length SLK

Reverse (S189A Reaction 2). Similarly, S189A Reaction 1 and 2 underwent PCR using

Reaction 3 primers to generate the complete S189A insert.

In order to generate the T183A/S189A mutant, a cDNA containing the S189A mutation was employed as template for PCR reactions using the T183A Reaction 1 and 2 primers.

These products were then incubated with the Reaction 3 primers to form the complete

T183A/S189A cDNA.

Page 25 of 68 PCR products were blunt-end ligated into the pPCR-Script Amp SK(+) cloning vector

(PRC-Script Amp Cloning Kit, Stratagene). The vector containing the cDNA insert was digested with SalI and Bsp1407I (Fermentas) and the SalI/Bsp14071 digest insert was ligated into the pcDNA 3.1-HA-SLK, replacing the analogous WT cDNA fragment. All

PCR products were sequenced by Génome Québec using a 3730xl DNA Analyzer system (Applied Biosystems).

Cell Culture COS-1 cells were maintained in Dulbecco’s modiﬁed Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Wisent). Rat GEC were maintained in a 1:1 ratio of DMEM to Ham’s F12 medium, supplemented with 5% NuSerum (BD

Bioscience) and 0.5% hormone mix. NuSerum contains 25% fetal bovine serum and

5ng/ml epidermal growth factor and hormones. Hormone mix contains insulin (5μg/

ml), Prostaglandin E1 (25ng/ml), triiodothyronine (0.325ng/ml), Na2SeO3 (1.73ng/ml), apo transferrin (5μg/ml), hydrocortisone (18.12ng/ml) in DMEM. All cell cultures were

maintained at 37˚C in a mix of 5% CO2 and 95% air. Conﬂuent cells were passed by rinsing with Ca2+ and Mg2+ free Hank’s balanced salt solution prior to incubating with

0.05% trypsin-0.02% EDTA in Ca2+ and Mg2+ free Hank’s balanced salt solution until cells detached. Cells were then re-plated in a 1/10 dilution. All experiments were conducted between passages 30 and 55.

Page 26 of 68 Transfection and Cell Harvesting Trypsinized cells were counted using a hemocytometer. 7.5 x 105 COS-1 cells were passed into 100mm plates and incubated for 24 h. Cells were transiently transfected with 4.5μl Lipofectamine 2000 (Invitrogen) and 1.5μg DNA according to the procedure provided by the manufacturer. Transfected cells were rinsed three times with PBS and lysed with 150μl of lysis buffer (1% Triton X-100, 125mM NaCl, 10mM Tris (pH 7.5),

1mM EGTA, 2mM Na3VO4, 5mM Na4P3O7, 25 mM NaF with 20 μM leupeptin, 20μM pepstatin and 0.2mM PMSF or 10μl/ml inhibitor cocktail (Fermentas). Lysates were centrifuged for 10 minutes at 10,000g. Protein concentrations were measured via a

Bradford assay and standardized to 50μg protein in 50μl lysis buffer.

Immunoblotting After the addition of Laemmli buffer to samples, proteins were separated by SDS-PAGE, and were then electrophoretically transferred to a nitrocellulose membrane. Membranes were blocked with 5% bovine serum albumin in TTBS (containing 10mM Tris (pH 7.5),

50mM NaCl, 2.5mM EDTA, 0.05% Tween 20). Membranes were incubated with a primary antibody for 120 minutes at room temperature, washed three times in TTBS (5 minute washes), incubated with a horseradish peroxidase labelled secondary antibody for 60 minutes and washed three times with TTBS (5 minute washes). Then, membranes were incubated with ECL reagent (GE Healthcare) and exposed to X-ray ﬁlm. Primary antibodies included anti-HA (Santa Cruz), p38 (Sigma), p-p38 (Thr180/Tyr182, Cell

Signaling), JNK (Cell Signaling), p-JNK (Thr183/Tyr185, Cell Signaling), and p-protein

Page 27 of 68 kinase A (PKA; Cell Signaling). Secondary antibodies include peroxidase-conjugated

AfﬁniPure sheep anti-mouse IgG (H+L) and goat anti-Rabbit IgG, F(ab’) (Jackson

Immuno Research). The ECL signals were quantiﬁed by scanning densitometry, using

NIH ImageJ software.

Immune Complex Kinase Assay Cell lysates were immunoprecipitated with anti-HA antibody overnight at 4º C or non- immune mouse IgG, and then incubated with protein A-agarose beads for 1 hour at 4º

C. After washing three times with lysis buffer and four times with kinase buffer (20mM

Hepes, pH 7.2, 20mM β-glycerophosphate, 10mM MgCl2, 1mM dithiothreitol, 0.5mM

Na3VO4), samples were incubated with 0.5 mg/ml bovine brain myelin basic protein

(Sigma) and 20μM [γ-32P] ATP (2.5μCi) for 5 minutes at 30º C. Following the addition of

Laemmli buffer, samples were boiled for 5 minutes, and subjected to SDS-PAGE and autoradiography. The bands were quantiﬁed by scanning densitometry using NIH

ImageJ software.

Page 28 of 68

Table 1: PCR and Sequencing Primers

Full Length SLK Forward CGACGGAGCCTTTGGGAAA

Full Length SLK Reverse TCCTTAGTACCACCAGCCTCAGGAC

T183A Forward AAACACGAGGGCAATTCAAAGAAGAGAT

T183A Reverse ATCTCTTCTTTGAATTGCCCTCGTGTTT

S189A Forward AGATGCCTTTATTGGTACACCATATTGGAT

S189A Reverse GTGTACCAATAAAGGCATCTCTTCTTTGAATT

T183E-Forward AAACACGAGGAAAATTCAAAGAAGAGAT

T183E-Reverse ATCTCTTCTTTGAATTTCCCTCGTGTTT

T183D-Forward AAACACGAGGATAATTCAAAGAAGAGAT

T183D-Reverse ATCTCTTCTTTGAATATCCCTCGTGTTT

S189E-Forward AGATGAATTTATTGGTACACCATATTGGAT

S189E-Reverse GTGTACCAATAAATTCATCTCTTCTTTGAATT

S189D-Forward AGATGACTTTATTGGTACACCATATTGGAT

S189D-Reverse GTGTACCAATAAAGTCATCTCTTCTTTGAATT

T193A-Forward CTTTATTGGTGCACCATATTGGATGG

T193A-Reverse AATATGGTGCACCAATAAAGGAATCTC

K63R-Forward CTGCTGCAAGAGTGATTGACAC

K63R-Reverse CAATCACTCTTGCAGCAGCTAAA

E79A-Forward AGATTACATGGTAGCGATTGACATATTAGC

E79A-Reverse GCTAATATGTCAATCGCTACCATGTAATCT

Primer 1 CCGGAATTCGCCGCCGCCATGTCCTTCTTCAATTTCCGTAAGA

-XbaI Primer 1 TAGAAGGCATCCAGAAGCTTGACTATAT

-XbaI Primer 2 TAGTCAAGCTTCTGGATGCCTTCTAT

Primer 4 CTAGCTAGTCTAGAGAGTTTATCTTCAGAGTTACTACGTTCTG

Fv2E-Forward ATCCACGCTGTTTTGACCTC

Fv2E-Reverse 1 CATGTTTGTCCCCTTTTAGGA

Page 29 of 68 SLK Homodimerization Construct

To better understand how homodimerization of SLK regulates its kinase activity, the catalytic domains of SLK WT and SLK mutants were fused with two modiﬁed FK506 binding protein (FKBP domains). A silent mutation that removed an internal XbaI site in the catalytic domain of SLK (amino acids 1-373) was created by PCR, using Primer 1 /-

XbaI Primer 1 (-XbaI Reaction 1) and Primer 3/-XbaI Primer 2 (-XbaI Reaction 2). The

SLK(-XbaI) cDNA was formed by PCR by combining the products from -XbaI reaction 1 and 2 and using Primer 1 and Primer 4. To create point mutations, SLK(-XbaI) was used as template for PCRs with Primer 1 and T193A Reverse (T193A Reaction 1) and T193A

Forward and Primer 4 (T193A Reaction 2), before being combined into the full insert with Primer 1 and Primer 4 (T193A Reaction 3). Similarly, SLK mutants T183D, T183E,

S189D, S189E, K63R and E79A were formed using three reactions (Fig. 11). The nucleotide sequences of the primers are included in Table 1. PCR products were blunt

Page 30 of 68 end ligated into pPCR-Script Amp SK(+) cloning vector (Stratagene). The vector was digested with EcoRI and XbaI (Invitrogen) and the WT or mutant cDNAs encoding the

SLK kinase domains were subcloned into pC4M-Fv2E , upstream of two FKBP domains and a HA tag (Ariad Pharmaceuticals; www.ariad.com). (The myristolylation sequence was deleted from the pC4M-Fv2E vector.) All PCR products were veriﬁed by DNA sequencing.

After transfection and expression of the Fv-SLK 1-373 protein, homodimerization was induced by addition of 100nM AP20187, an FK506 analogue to the cell culture medium.

Page 31 of 68 Dual Luciferase Reporter (DLR) Assays DLR assays were performed using the Dual-Luciferase Reporter Assay System

(Promega). 9x104 GEC cells were plated and co-transfected 24 hours later with the gene of interest, pRL-TK (renilla luciferase), and firefly luciferase conjugated to an AP-1 promoter (pRL-TK serves as an internal control which quantifies transfection efficiency, while firefly luciferase serves as the principal reporter). After 48 hours, cells were treated with or without 100nM AP20187 and allowed to incubate for 3 hours before lysis

(incubation with passive lysis buffer while rocking for 15 minutes). Lysates were centrifuged for 30 seconds at room temperature, mixed with luciferase assay reagent 2

(which measures firefly luciferase activity) and Stop&Glo reagent and buffer (which measures renilla luciferase activity) according to manufacturer’s specifications.

Luciferase activity was measured with a Lumat LB 9507 luminometer (Berthold) and the ratio between ﬁreﬂy and renilla luciferase activity was calculated.

Measurement of Apoptosis and Late Apoptosis GEC were transfected, and after 48 hours were treated with or without 100nm AP20187 for 3 hours. Cells were stained with Hoechst H33342 dye (1μg/ml) for 10 min at 37º C without ﬁxation. After washing with PBS, cells were stained with propidium iodide

(5μg/ml). Images were acquired using a Axio Observer ﬂuorescence microscope (Zeiss) and camera, and the cells were then counted manually. Cell nuclei which showed chromosomal condensation, but which had an intact cell membrane impermeable to propidium iodide were counted as ‘apoptotic,’ while propidium iodide stained cells

Page 32 of 68 were counted as ‘late apoptotic’. In this assay, nuclei of apoptotic cells (which show chromatin condensation and fragmentation) stain brightly with H-33342, but these cells generally do not stain with propidium iodide, because apoptotic cells usually possess intact plasma membranes. However, in cell culture, propidium iodide-positive cells are generally late-apoptotic, as apoptotic cells are not phagocytosed and may proceed to necrosis. All other Hoechst stained cells were counted as ‘normal’.

Statistics Densitometric quantiﬁcation of immunoblots and autoradiograms was normalized to

SLK WT, which was considered 1 arbitrary unit. One-way analysis of variance was used to determine significant differences among groups. Where significant differences were found, individual comparisons were made between groups using the t statistic, and adjusting the critical value according to the Bonferroni method. Results are presented as mean ± standard error of the mean (SEM). In the figures: * is P < 0.05; ** is P < 0.005.

Page 33 of 68 Results

Activation Segment Point Mutations Inhibit SLK Kinase Activity To better understand the role of the activation segment of SLK in regulating catalytic activity, research was focused on serine and threonine residues that are highly conserved among SLK and other protein kinase catalytic domains. Serines and threonines can serve as substrates for other kinases, activating the kinase catalytic site upon being phosphorylated. Mutations to alanine permit the silencing of these sites without disturbing the three dimensional architecture of the protein, thus providing insight into their role in SLK kinase activity. Point mutations, including T183A, S189A and T183A/S189A were introduced into the HA-tagged full length cDNA of SLK via

PCR. Expression of SLK WT and the three SLK mutants was conﬁrmed with SDS-PAGE and immunobloting (Fig. 12B). To determine the effect of the T183A, S189A and T183A/

S189A mutations on the kinase activity of SLK, an immune complex kinase assay was performed, where HA-SLK was immunoprecipitated with anti-HA antibody and the immune complexes were incubated with myelin basic protein (MBP). Compared to wild type SLK, T183A SLK showed signiﬁcantly reduced substrate phosphorylation, while the S189A mutation, as well as the double mutation appeared to be even more severe, completely abolishing catalytic activity (Fig. 12A and C). In parallel, autophosphorylation of SLK is also reduced by the mutations (Fig. 12A).

Page 34 of 68 Expression of Activation Segment SLK Mutants Affects JNK, p38 and AP-1 Having demonstrated impaired kinase activity, the next step was to examine the effect of these mutations on downstream targets of SLK. Over-expression of SLK has previously been shown to activate proteins in the MAPK pathway, including ASK1 and p38 (Hao, Takano et al. 2006), as well as JNK. These stress-activated protein kinase pathways tend to be anti-proliferative and pro-apoptotic. To determine whether the activation segment point mutations affected SLK’s downstream signaling capacity, SLK

WT, T183A, S189A and T183A/S189A mutants were over-expressed in GEC, a well- studied differentiated kidney epithelial cell line. Phospho-antibodies were used to detect activation-specific changes in JNK (Fig. 13) and p38 (Fig. 14). SLK WT significantly increased phospho-JNK (p-JNK), compared with the pRC/RSV control vector, reflecting enhanced signaling via stress kinase pathways. In contrast, SLK activation domain mutants T183A, S189A and, in particular, T183A/S189A showed a reduced ability to stimulate JNK phosphorylation, with no statistically significant difference between the T183A/S189A double mutant and the empty vector (Fig. 13A, D and E). Similarly, SLK WT significantly increased p38 phosphorylation, compared to the pRC/RSV control vector, while the T183A/S189A double mutant failed to increase p38 phosphorylation above baseline (Fig. 14A and D). In these experiments, the expression of JNK and p38 remained constant (Fig. 13B and 14B, respectively). This result confirms that SLK signals via JNK and p38, and demonstrates that decreased catalytic activity as a result of the activation segment double point mutation impairs this signaling.

Page 35 of 68 To further confirm the role of SLK in pro-apoptotic cell signaling, the effect of SLK on the activation of AP-1 was examined. AP-1 is a transcription factor that lies downstream of pathways, including JNK and p38, and controls a number of cellular processes, such as differentiation, proliferation, and apoptosis (Shaulian and Karin 2001). AP-1 activity, using an AP-1 promoter-firefly luciferase reporter was monitored. SLK WT and to a lesser extent T183A SLK stimulated AP-1 reporter activity, while S189A and T183A/

S189A were ineffective (Fig. 14E). This assay conﬁrms the capacity of SLK to signal via pro-apoptotic pathways, and demonstrates a critical role for activation segment phosphorylation.

SLK Homodimerization Increases Kinase Activity of SLK WT, but not SLK Mutants The T183 and S189 sites of SLK are important to catalytic activity, but it has also been suggested that the two phosphorylation sites play a role in SLK autoactivation in trans via activation segment domain exchange, similarly to the evolutionarily related protein kinase, Chk2 (Pike, Rellos et al. 2008). Anti-parallel homodimerization of SLK, as suggested by its crystal structure, could allow for the catalytic site of one SLK molecule to phosphorylate the activation segment of another SLK molecule, which in turn could phosphorylate the ﬁrst SLK molecule, should it not be fully active already. This model would predict that an increase in the local concentration of SLK due to increased transcription, decreased degradation, and/or increased dimerization would serve to increase SLK activity. Furthermore, it should also be noted that T193 in SLK is highly

Page 36 of 68 conserved among evolutionarily related protein kinases. In Chk2 and DAPK3, this threonine is known to be phosphorylated, and possibly regulates activity.

To determine how dimerization affects SLK activity and to determine if T193 phosphorylation is functionally important, the cDNA catalytic domain of SLK (amino acids 1-373) was ligated into the vector, pC4M-Fv2E upstream of two modiﬁed FKBP domains. This cDNA construct produced a protein consisting of SLK (1-373) fused with two FKBP domains at the C-terminus. Addition of the FK506 analogue, AP20187, induced regulated dimerization of the FKBP domains. COS-1 cells that were transfected with the FKBP-1-373 SLK fusion protein (Fv-SLK 1-373) and treated with AP20187 showed enhanced kinase activity compared to COS-1 cells transfected with Fv-SLK

1-373 WT alone (Fig. 15A-C). In contrast, transfection with Fv-SLK 1-373 T183A/S189A and Fv-SLK 1-373 T193A showed insigniﬁcant kinase activity in the presence or absence of AP20187 (Fig. 15A-C).

The amino acid sequence around S189 in SLK (RRDS) is a putative phosphorylation motif for PKA. Using a commercially available anti-p-PKA substrate antibody, which recognizes the sequence RRXS/T, phosphorylation of Fv-SLK 1-373 WT was observed.

Interestingly, phosphorylation was increased in the dimeric WT form (AP20187-treated cells), as compared with the monomer, and was decreased in the Fv-SLK 1-373 T183D mutant (Fig. 16). As expected, phosphorylation was absent in the Fv-SLK 1-373 S189E

Page 37 of 68 mutant. This result demonstrates phosphorylation at a putative PKA site, although it does not conclusively implicate a role for PKA.

The T183A/S189A SLK Double Mutant Fails to Induce Apoptosis and Late Apoptosis Previous studies have shown that SLK is a proapoptotic protein kinase. To examine the effects of mutations in the SLK activation segment on cell death, GEC were co- transfected with Fv-SLK 1-373 SLK and the Fv-SLK 1-373 T183A/S189A double mutant and were treated with or without AP20187. Then, cells were stained with Hoechst

H33342 and propidium iodide. Hoechst H33342 stains nuclei, while propidium iodide is only able to enter the cytoplasm of cells with damaged plasma membranes. Hoechst- stained cells showing condensed nuclei were labelled apoptotic, while propidium iodide stained cells were labelled late apoptotic. Compared with cells transfected with pRC/RSV, Fv-SLK 1-373 WT transfected cells showed enhanced apoptosis and late apoptosis (Fig. 17 A and B respectively). Stimulation with AP20187 (to dimerize the SLK catalytic domain) increased the number of late apoptotic cells in Fv-SLK 1-373 transfections (Fig. 17B). In contrast, cells transfected with Fv-SLK 1-373 T183A/S189A did not show apoptosis nor late apoptosis, compared to control (Fig. 17). This result is consistent with previous experiments which showed that the over-expression of SLK

WT stimulates pro-apoptotic pathways in cultured cells.

Page 38 of 68 Phosphomimetic Mutations in SLK (T183D, T183E, S189D, S189E) Do Not Enhance Kinase Activity Instead of mutating the serine and threonine phosphorylation sites to an alanine, these serine and threonine residues were mutated to aspartate and glutamic acid. Such mutations are believed to imitate the negative charge that would be present when a serine or a threonine is phosphorylated. Surprisingly, instead of increasing kinase activity, the Fv-SLK 1-373 T183D and T183E mutants showed significantly reduced kinase activity (Fig. 18). Furthermore, the Fv-SLK 1-373 S189D and S189E mutations also showed significantly reduced kinase activity. (Fig. 19). Since the phosphomimetic mutations had the same effects as the alanine mutations, the result indicates that phosphorylation, but not a negative charge-induced conformational change, is needed for kinase activity. Alternatively, the negative charges at S189 and T183 may be necessary for kinase activity, but they may not be sufficient.

SLK Mutants Fv-SLK 1-373 K63R, E79A Show Reduced Kinase Activity The studies described above addressed the role of various phosphorylation sites in the regulation of kinase activity. The study by Pike et al. suggested that additional amino acids may be required for sustaining SLK kinase activity. K63 is the ATP binding site of

SLK, which is essential for kinase activity. Based on the crystal structure of the SLK catalytic domain, K63 may form a salt bridge with E79, which may lock SLK in an active conformation following SLK phosphorylation at T183 and S189. To test if E79 was functionally important, an E79A mutant was generated using PCR. For comparison, a

K63R mutation (PCR primers are presented in Table 1) was produced. The two cDNAs

Page 39 of 68 were transfected in COS-1 cells and expression of both proteins was conﬁrmed by immunoblotting. As expected, the K63R mutation abolished kinase activity in Fv-SLK

1-373 K63R (in an immune complex kinase assay; Fig. 20). Kinase activity was markedly attenuated in the Fv-SLK 1-373 E79A mutant, conﬁrming the functional importance of

E79 (Fig. 20).

Interaction of SLK WT with the T183A/S189A Double Mutant This set of experiments evaluated kinase activity when both WT and mutant SLK catalytic domains were present together. COS-1 cells were transfected with Fv-SLK

1-373 WT alone (100%), Fv-SLK 1-373 T183A/S189A alone (100%), Fv-SLK 1-373 WT

(50%) together with Fv-SLK 1-373 T183A/S189A (50%), and Fv-SLK 1-373 WT (50%) together with control plasmid (pRC/RSV; 50%). Cells were then treated with or without

AP20187, and lysates were subjected to an immune complex kinase assay. A statistically signiﬁcant difference in activity was noted between Fv-SLK 1-373 WT and the Fv-SLK

1-373 double mutant (with or without AP20187) (Fig. 21). In cells co-transfected with

Fv-SLK 1-373 WT and Fv-SLK 1-373 T183A/S189A, one would predict the presence of both monomers; following addition of AP20187, one would predict formation of WT homodimers (25%), mutant homodimers (25%), and WT and mutant heterodimers

(50%). A signiﬁcantly greater activity was noted between the Fv-SLK 1-373 WT-T183A/

S189A mixture and the SLK double mutant (with or without AP20187) (Fig. 21).

Page 40 of 68 There was no statistically signiﬁcant difference between Fv-SLK 1-373 WT and the Fv-

SLK 1-373 WT-T183/S189 mixture (with or without AP20187), even though the cells in the latter mixture had been transfected with only 50% of the amount of Fv-SLK 1-373

WT. Furthermore, when comparing Fv-SLK 1-373 WT+T183A/S189A to SLK WT+pRC/

RSV, there was no statistical difference between the two conditions (with or without

AP20187) (Fig. 21). One can conclude that the mixing of the Fv-SLK 1-373 WT and the double mutant does not reduce the Fv-SLK 1-373 WT kinase activity signiﬁcantly.

Whether or not Fv-SLK 1-373 WT “rescues” the SLK double mutant is less clear, and this aspect will require further study.

Page 41 of 68 Figures (1-11 in Background)

Fig. 12: Point mutations in the SLK activation domain inhibit catalytic activity

A) Anti-HA -260 kDa SLK - -117 kDa -48 kDa -34 kDa

-26 kDa -19 kDa MBP -

SLK WT SLK SLK SLK T183A/ T183A S189A S189A -260 kDa B) HA -

C) 1.2 +++

1.0

0.8 +++ 0.6 ns

0.4

0.2 NS NS *** *** 0 SLK WT SLK T183A SLK S189A SLK T183A/S189A Normal Mouse IgG

A) Point mutations T183A and S189A in the SLK activation domain signiﬁcantly reduce SLK catalytic activity as measured by an in vitro immune complex kinase assay, with myelin basic protein (MBP). Autophosphorylation of SLK is also reduced by the mutations.

B) Lysates immunoblotted with anti-HA antibody show equal expression after transfection.

C) Normalized densitometry of myelin basic protein band (n=5). NS = not signiﬁcantly different vs Normal Mouse IgG, +++ = p<0.0003 vs Normal Mouse IgG, ns = not signiﬁcant vs SLK WT, *** = p<0.0006 vs SLK WT.

Page 42 of 68 Fig. 13: Point mutations in the SLK activation domain reduce JNK phosphorylation. A) p-JNK levels

p-JNK 54 - -55 kDa p-JNK 46 - -43 kDa JNK Expression -55 kDa B) JNK 54 -

JNK 46 - -43 kDa

C) Amido Black stain - -43 kDa SLK SLK SLK SLK pRC/ WT T183A S189A T183A/ RSV S189A D) p-JNK (54kDa) 1.00 + ns ns 0.75 *

0.50 **

0.25

0 SLK WT SLK T183A SLK S189A SLK T183A/S189A pRC/RSV E) p-JNK (46kDa) 1.00 ns ns

0.75 ns ** ** 0.50

0.25

0 SLK WT SLK T183A SLK S189A SLK T183A/S189A pRC/RSV Wild type SLK and activation domain SLK mutants were transfected in GEC. Lysates were blotted with phospho-speciﬁc antibodies against p-JNK (A). JNK expression remained constant (B). C) Amido black stain (control for protein loading). D) Normalized densitometry of 54 kDa p-JNK. E) Normalized densitometry of 46kDa p-JNK. (n=6) * = p<0.05, ** = p<0.005 vs SLK WT, + = p<0.05 vs pRC/RSV, ns = not signiﬁcant vs pRC/RSV. Page 43 of 68 Fig. 14: Point mutations in the SLK activation domain reduce p38 phosphorylation and reduce AP-1 activity -43 kDa A) p-p38 - -34 kDa

-43 kDa B) p38 - -34 kDa -43 kDa C) Amido Black stain - -34 kDa SLK SLK SLK SLK pRC/ WT T183A S189A T183A/ RSV S189A

D) p-p38 1.00 ++ ++ 0.75 ns * 0.50 **

0.25

0 SLK WT SLK T183A SLK S189A SLK T183A/S189A pRC/RSV

E) AP-1 Reporter 6.00

4.50

ns 3.00 ns ns * 1.50 **

0 SLK WT SLK T183A SLK S189A SLK T183A/S189A pRC/RSV

Wild type SLK and activation domain SLK mutants were transfected in GEC. Lysates were blotted with phospho-speciﬁc antibodies against p-p38 (A), p38 expression remained constant B). C) is an amido black loading control. D) Normalized densitometry of p-p38, (n=6). E) Normalized AP-1 dual luciferase assay, (n=6). * = p<0.05 vs WT, ** = p<0.007 vs WT, ++ = p<0.007 vs pRC/RSV, ns = not signiﬁcantly different vs pRC/RSV.

Page 44 of 68 Fig. 15: SLK homodimerization increases kinase activity of Fv-SLK 1-373 WT, but not SLK mutants T183A/S189A and T193A. A) Immune complex kinase assay; AP20187-stimulated dimerization enhanced the kinase activity of Fv-SLK 1-373 WT; in contrast, kinase activities of Fv-SLK 1-373 mutants T183A/ S189A and T193A were weak, and there was no enhancement after dimerization. B) Anti-HA blot shows even loading. C) Normalized densitometry of kinase activity. A) Anti HA + - + + + + + AP20187 - + + - + - + - 95 kDa Fv-SLK 1-373 - - 72 kDa

- 55 kDa

- 43 kDa

- 34 kDa

- 26 kDa

MBP - - 17 kDa

Fv-SLK 1-373 WT Fv-SLK 1-373 Fv-SLK 1-373 T183A/S189A T193A

B) HA - AP20187 - + - + - +

C) Fv-SLK 1-373 WT, T183A/S189A, T193A Kinase Activity 5.00 ** 3.75

2.50

1.25

0 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 T183A/ Fv-SLK Fv-SLK 1-373 T193A WT WT + AP20187 T183A/S189APage 45 of 68S189A + AP20187 1-373 T193A + AP20187 Fig. 16: SLK may be activated by PKA

A) Fv-SLK 1-373 WT and Fv-SLK 1-373 activation domain mutants were transfected in COS and treated with drug AP20187 (D) as indicated. Lysates were blotted with phospho-speciﬁc antibodies. Potential P-PKA Substrate sequence RRDS detected on SLK. Phosphorylation is increased with AP20187 treatment of Fv-SLK 1-373 WT. Phosphorylation is not present in Fv-SLK 1-373 S189E mutant with and without AP20187, suggesting this antibody is detecting region RRDS189. The Fv-SLK 1-373 T183D mutant shows decreased basal phosphorylation which was increased with AP20187 stimulation. B) Loading control, anti HA blot. p-PKA substrate (anti RRXS/T)

1-373 SLK - 72kDa

Fv-SLK Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 1-373 S189E S189E +D WT WT+D T183D +D T183D

1-373 SLK - 72kDa

anti HA

Page 46 of 68 Fig. 17: Fv-SLK 1-373 T183A/S189A fails to induce apoptosis and late apoptosis in GEC

Transfection of SLK-Fv increases apoptosis and necrosis as compared to pRC/RSV transfected cell lines. In contrast SLK-Fv activation domain mutant T183A/S189A-Fv did not affect apoptosis or necrosis. A) Percentage of apoptotic cells following Hoechst and propidium iodide staining in cells transfected with a control vector, SLK-Fv or T183A/S189A treated with and without AP20187, (n=4), + = p<0.05, ++ = p<0.005 vs SLK + AP20187. B) Percentage of late apoptotic cells following Hoechst and propidium iodide staining in cells transfected with a control vector, SLK-Fv or T183A/S189A treated with and without AP20187, (n=4), * = p<0.05 vs SLK, + = p<0.05, vs SLK + AP20187. A) 8 *** = p<0.0006 vs SLK +++ = p<0.00008 vs SLK+AP20187

+ 4

% Apoptotic *** 2 ***

0 pRC/RSV pRC/RSV + AP20187 Fv-SLK 1-373 WT Fv-SLK 1-373 WT Fv-SLK 1-373 Fv-SLK 1-373 B) + AP20187 T183A/S189A T183A/S189A 4 + AP20187

2 % Late Apoptotic

+ * + * 0 pRC/RSV pRC/RSV + AP20187 Fv-SLK 1-373 WT Fv-SLK 1-373WT Fv-SLK 1-373 Fv-SLK 1-373 + AP20187 T183A/S189A T183A/S189A Page 47 of 68 + AP20187 Fig. 18: Phosphomimetic mutations Fv-SLK 1-373 T183D & T183E do not enhance kinase activity A) AP20187 + + - + + - + + - Anti HA + - + + - + + - + 1-373 SLK - - 72 kDa

- 55 kDa

- 43 kDa

- 34 kDa

- 26 kDa

MBP - - 17 kDa

Fv-SLK 1-373 WT Fv-SLK 1-373 T183D Fv-SLK 1-373 T183E

B) HA - - 72kDa AP20187 - + - + - +

C) 4

0 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 WT+ AP20187 WT T183D + T183D T183E + AP20187 T183E AP20187

A) SLK-FV 1-373 T183D and Fv-SLK 1-373 T183E show no activity in an in vitro immune complex kinase assay. AP20187 induced dimerization failed to stimulate T183D and T183E kinase activity. B) Anti-HA blot shows even loading. C) Normalized densitometry of kinase activity. (n=2)

Page 48 of 68 Fig. 19: Phosphomimetic mutations in Fv-SLK 1-373 S189D & S189E do not enhance kinase activity

AP20187 + + - + + - + + - Anti HA + - + + - + + - + - 95 kDa 1-373 SLK - - 72 kDa

- 55 kDa - 43 kDa

- 34 kDa

- 26 kDa MBP - - 17 kDa

Fv-SLK 1-373 WT Fv-SLK 1-373 S189D Fv-SLK 1-373 S189E B) HA - - 72kDa

AP20187 - + - + - +

C) S189D,E 15.00

11.25

7.50

3.75

0 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 WT + AP20187 WT S189D + AP20187 S189D S189E + AP20187 S189E

A) Fv-SLK 1-373 S189D and S189E show no activity in an in vitro kinase assay. AP20187 induced dimerization failed to stimulate Fv-SLK 1-373 S189D and S189E kinase activity. B) Anti-HA blot shows even loading. C) Normalized densitometry of kinase activity. (n=2)

Page 49 of 68 Fig. 20: Fv-SLK 1-373 Mutants K63R and E79A show reduced kinase activity A)

AP20187 - + + + + + - +

Anti HA + - + + + + + +

- 95 kDa 1-373 SLK - - 72 kDa - 55 kDa

- 43 kDa

- 34 kDa

- 26 kDa

MBP - - 17 kDa

Fv-SLK Fv-SLK 1-373 WT 1-373 Fv-SLK 1-373 Fv-SLK 1-373 T183A/ K63R E79A S189A B) HA - - 72kDa

AP20187 - + + - + - +

C) 2.0 *** = p<0.0000025 vs SLK +++ = p<0.0000025 vs SLK+D 1.5

1.0

+++ 0.5 +++ *** *** +++

0 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 WT K63R E79A WT + D K63R + D E79A + D T183A/S189A + D A) Fv-SLK 1-373 K63R and E79A show no activity in an in vitro immune complex kinase assay. AP20187 induced dimerization failed to stimulate Fv-SLK 1-373 K63R and E79A kinase activity. B) Anti-HA blot shows even loading. C) Normalized densitometry of kinase activity. Drug (D) refers to AP20187. (n=6) Page 50 of 68 Fig. 21: Interaction of Fv-SLK 1-373 WT with Fv-SLK 1-373 T183A/S189A

A) AP20187 - + + - + - + - + Anti HA + - + + + + + + +

- 95 kDa 1-373 SLK - - 72 kDa - 55 kDa - 43 kDa

- 34 kDa

- 26 kDa

MBP - - 17 kDa B) Fv-SLK 1-373 WT Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 WT T183A/S189A WT + T183A/ + pRC/RSV S189A

3.00 72kDa - 1-373 SLK

C) 2.25

+++ 1.50 **

0.75 ! @@@

0 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 Fv-SLK 1-373 WT WT + AP20187 T183A/S189A T183A/S189A WT with WT with T183A/S189A WT with pRC/RSV WT with pRC/RSV + AP20187 T183A/S189A + AP20187 + AP20187 A) COS-1 cells were transfected with Fv-SLK 1-373 WT alone (100%), Fv-SLK 1-373 T183A/S189A alone (100%), Fv-SLK 1-373 WT (50%) together with Fv-SLK 1-373 T183A/S189A (50%), and Fv-SLK 1-373 WT (50%) together with control plasmid (pRC/ RSV; 50%). Cells were then treated with or without AP20187, and lysates were subjected to an immune complex kinase assay. B) Anti HA blot shows loading. Last two lanes were transfected with 50% Fv-SLK 1-373 WT. C) Densitometry of kinase activity. n=8 columns 1-6; n=4 columns 7 and 8.

! = P<0.05 vs WT, ** = P<0.005 vs T183A/S189A, @@@ = p<2E-5 vs WT + AP20187, +++ = p< 7.5E-4 vs T183A/S189A + AP20187.

Page 51 of 68 Discussion and Conclusion

SLK Activation In a recent study, Pike et al showed that the crystalized catalytic domain of SLK (amino acids 19-321) formed homodimers in vitro, in an arrangement consistent with activation segment domain exchange. On the basis of these results, the present study further addressed the activation of SLK, using full length SLK and the catalytic domain of SLK

(amino acids 1-373) coupled to an artiﬁcial dimerization domain. SLK mutants T183A and S189A showed signiﬁcantly reduced catalytic activity (measured with myelin basic protein as substrate), and decreased phosphorylation, as seen by the ~200kDa (full length SLK) and 72kDa (Fv-SLK 1-373) bands in the respective immune complex kinase assays (Fig. 12 and 15). The phosphorylation of SLK paralleled exogenous kinase activity (i.e. myelin basic protein phosphorylation), and may be due entirely to homodimerization and autophosphorylation. Nevertheless, it is also possible that an upstream activator is, at least in part, responsible for SLK phosphorylation. The amino acid sequence around S189 in SLK (RRDS) is a putative phosphorylation motif for protein kinase A (PKA). Using an anti-phospho PKA substrate antibody, which recognizes the sequence RRXS/T, phosphorylation of Fv-SLK 1-373 WT was observed

(Fig. 16). Phosphorylation was increased in the dimeric Fv-SLK 1-373 WT, as compared with the monomer, was decreased in the Fv-SLK 1-373 T183 mutant, and as expected, was absent in the Fv-SLK 1-373 S189 mutant. While this result demonstrates

Page 52 of 68 phosphorylation at a putative PKA site, it does not conclusively implicate a role for

PKA; nevertheless, the result provides an avenue for further research.

Downstream Effects of SLK Activation The decreased catalytic activity of SLK was also reﬂected in decreased p38 and JNK phosphorylation in the full length SLK T183A/S189A mutant, compared to SLK WT

(Fig. 13 and 14). While the decreases in p-JNK and p-p38 were signiﬁcant, they were less impressive than the complete loss of catalytic activity in the in vitro kinases assay, observed with the full length SLK S189A and T183A/S189A mutants, compared to SLK

WT (Fig. 12 and 15). This is likely due to the fact that kinase activity was measured in lysates of cultured COS-1 cells, which are transfected efficiently and allow for high-level expression of transfected cDNAs. In contrast, signaling via JNK and p38 was studied in cultured GEC, where transfection efficiency is low. While COS-1 cells are a good model for biochemical analysis, GEC are a more differentiated cell line. Furthermore, in COS-1 cells, the HA tag on SLK was used to immunoprecipitate SLK, removing any confounding effects of endogenous SLK from the system. In contrast, a potential interaction of the ectopic forms of SLK with some endogenous SLK molecules in GEC, as well as negative feedback provided by other signaling cascades may be have been sufficient to blunt differences in p38 and JNK phosphorylation between groups.

Nevertheless, there was a signiﬁcant difference in p38 and JNK phosphorylation, and

AP-1 stimulation between SLK WT and SLK T183A/S189A in GEC (Fig. 13 and 14).

Page 53 of 68 Furthermore, the attenuated effect of the SLK mutant on downstream signaling targets was sufﬁcient to cause a decrease in apoptosis and late apoptosis in GEC (see below).

Homodimerization of SLK Analysis of the SLK amino acid sequence shows an α-helical coiled-coil structure in the

C-terminal domain. Proteins with coiled-coils are believed to dimerize/oligomerize via this structure. Thus, it was reasonable to propose that regulation of SLK may involve homodimerization, and that dimerization facilitates autophosphorylation and activation. Homodimerization of SLK most likely then facilitates the activation of SLK via the catalytic domains by increasing the local concentration of SLK catalytic domains.

To address dimerization more directly, an FKBP-SLK 1-373 fusion protein (Fv-SLK

1-373), which allows for controlled dimerization upon addition of the compound

AP20187 was employed (Fig. 15). As such, Fv-SLK 1-373 WT without AP20187 would be largely monomeric, with potentially minimal basal dimerization of the catalytic domain, while treatment of Fv-SLK 1-373 WT with AP20187 would stimulate dimerization at the

FKBP domain, which in turn would facilitate the homodimerization of the catalytic domain of SLK by increasing its local concentration. Monomeric Fv-SLK 1-373 WT was shown to have some catalytic activity and to autophosphorylate in an in vitro kinase assay. The overexpression of SLK likely provided a sufﬁcient concentration of Fv-SLK

1-373 WT to allow transient dimerization of the SLK catalytic domain leading to auto- activation. Nevertheless, addition of AP20187 greatly enhanced both auto-activation and catalytic activity of SLK.

Page 54 of 68 Enhanced catalytic activity of SLK was shown to increase apoptosis and late apoptosis in GEC (Fig. 17). The overexpression of monomeric SLK was shown to signiﬁcantly increase apoptosis and late apoptosis in cultured GEC, while addition of AP20187 tended to shift apoptotic cells towards late apoptosis (a more severe form of cell injury), in keeping with more SLK proapoptotic activity following dimerization. Most likely, an analogous mechanism would operate with full length SLK, where dimerization would occur via the coiled-coil domains.

SLK Activation Segment Mutants Based on the crystal structure of SLK, Pike et al. predicted that the domain-exchanged activation segments are in an active conformation following dimerization and activation segment domain exchange. A salt bridge is formed between the αC helix glutamate

(E79) and the active site lysine (K63). This salt bridge correctly positions the αC helix for catalytic activity and appears to stabilize the monomer in an active conﬁrmation.

Disruption of this salt bridge may thus prevent sustained catalytic activity following activation segment domain exchange. This prediction was conﬁrmed, as the E79A mutant (in both monomeric and dimeric forms) showed signiﬁcantly reduced kinase activity in an in vitro kinase assay (Fig. 20).

Taken together, the results show that dimerization of the activation segment and phosphorylation at residues T183, S189 and T193 plays a key role in the regulation of the catalytic activity of SLK. Furthermore residues K63 and E79 may be playing a role in

Page 55 of 68 sustained catalytic activity by forming a bond and locking SLK in an active conformation. After induction of point mutations in T183 and S189, catalytic function was reduced or disabled, signaling cascades were disrupted and the pro-apoptotic effect of SLK was attenuated. Catalytic activity was similarly reduced in SLK mutants T193A,

K63R and E79A. Although downstream signaling and apoptosis was not studied with these mutants, it is reasonable to conclude that these processes would also be disrupted by the mutations.

Function of SLK The presence of SLK in the kidney was originally identiﬁed while screening for expression of receptor threonine kinases in the developing kidney, using a RT-PCR approach, which employed PCR primers based on highly conserved receptor tyrosine kinase catalytic domains (Cybulsky, Takano et al. 2004). Further studies demonstrated that SLK expression and kinase activity increased in the developing rat kidney, compared with adult control. In addition, SLK expression and kinase activity increased in adult kidneys recovering from ischemic injury. In kidney cells, active SLK was shown to phosphorylate apoptosis signal-regulating kinase-1 and p38 (Hao, Takano et al. 2006), as well as p53 (Cybulsky, Takano et al. 2009).

Based on studies in cell culture, and more recently in vivo, over-expression of SLK activates pro-apoptotic signaling pathways. Stable over-expression reduced cell proliferation, increased apoptosis, and exacerbated apoptosis and necrosis in an in vitro

Page 56 of 68 model of ischemia-reperfusion injury (Cybulsky, Takano et al. 2004). In vivo, podocyte- speciﬁc expression of SLK in transgenic mice resulted in podocyte injury and proteinuria (Cybulsky, in press). These results suggest that SLK may exacerbate cell injury in glomerulonephritis and acute renal failure.

SLKʼs Pathophysiological Role In addition to renal pathophysiology, recently SLK has been implicated in acute kidney injury-induced acute lung injury (Hassoun, Lie et al. 2009) and as a vasodilator, acting via RhoA and the angiotensin II type 2 receptor (Guilluy, Rolli-Derkinderen et al. 2008).

Other investigators have demonstrated a role for SLK in cancer cell motility via interaction with v-Src (Chaar, O'Reilly et al. 2006) and in breast cancer via ERB-2

(Roovers, 2009). Furthermore, SLK co-precipitates with ASAP1 a protein which increases tumor cell motility, invasiveness, stimulates metastasis formation in vivo, and correlates with poor survival in colorectal cancer patients (Muller, Stein et al. 2010). The

SLK genomic sequence is localized to chromosomal locus 10q25.1 (Delpire 2009), a region that is consistently mutated in Sézary Syndrome, an aggressive form of cutaneous T-cell lymphoma (Vermeer, van Doorn et al. 2008). Understanding how SLK is regulated could unravel the apparent contradiction between SLK as a protein that induces apoptosis in normal cell lines, but leads to increased metastasis and a worse outcome in cancerous cells. Perhaps some cancer lines overexpress or underexpress associated proteins (upstream or downstream) in order to produce the actin disassembling, motility inducing SLK effects without the pro-apoptotic effects.

Page 57 of 68 SLK Regulation Kinases such as SLK can be activated a number of ways. As discussed above, an upstream kinase can potentially recognize the activation segment of SLK as a substrate and activate catalytic activity by phosphorylating the activation segment (Pike, Rellos et al. 2008). This step could potentially facilitate dimerization and further activation. The addition of a phosphate group at the activation segment can be coupled to a conformational change in the kinase, which allows sustained catalytic activity (Pike,

Rellos et al. 2008). Other kinases, such as the receptor tyrosine kinases, are activated by ligands (Lemmon and Schlessinger 2010). Still other kinases are auto-activating and may be regulated by homodimerization (Nolen, Taylor et al. 2004). As such, the local concentration of an auto-activating kinase may determine whether or not a dimerization event occurs, leading to auto-activation.

The protein kinase, Chk2, was shown to homodimerize in an anti-parallel arrangement, leading to a model known as trans-autophosphorylation (Pirruccello 2006). In this model, anti-parallel dimerization induces reciprocal phosphorylation, which activates each binding partner with a conformation change, but it also induces the dissociation of the homodimer back into monomers. These monomers can thus continue the activation cascade. The SLK catalytic domain is structurally related to Chk 2 (Pike, Rellos et al.

2008). It is thus not surprising that by crystallography, it was shown to homodimerize in an anti-parallel arrangement similarly to Chk2. Thus, if SLK activation were to proceed via trans-autophosphorylation, following anti-parallel dimerization, the level of SLK

Page 58 of 68 expression would regulate the probability of a dimerization event. Therefore, increased

SLK mRNA transcription and translation, or decreased SLK mRNA degradation would increase the concentration of SLK in the cell, thereby increasing the likelihood of a dimerization event resulting in trans-autophosphorylation. This leads to the question of which mRNA binding proteins and which transcription factors have an effect on SLK mRNA stability. Previously, it was shown that the 3‘UTR of the SLK mRNA increased mRNA degradation, and bound a ~30kDa ARE binding protein (Cybulsky, Takano et al.

2007).

The addition of a FK506 analogue AP20187, which dimerized FKBP domains adjacent to the catalytic domain of SLK was sufﬁcient to increase catalytic activity (Fig. 15).

Moreover, addition of AP20187 appeared to shift SLK’s pro-apoptotic effect towards a late apoptotic effect (Fig. 17). Preliminary studies indicated that dimerization of SLK enhances downstream signaling (Delarosa, Guillemette et al. 2009). According to the crystallography model of Pike et al., during the process of activation segment domain exchange, the phosphorylation of SLK’s activation segment by its binding partner actually predicted a decreased afﬁnity for dimerization. This view is supported by the studies employing the T183D, T183E, S189D and S189E mutants (Fig. 18 and 19).

Addition of a negative charge to the activation segment by the aspartic or glutamic acid substitutions at these sites may have resulted in a repulsive effect of the charge without the proper conformational change that is induced by phosphoserine or

Page 59 of 68 phosphothreonine; consequently the kinase domain may not have been able to dimerize properly, and there was no increase in catalytic activity. It is also possible that an upstream kinase which typically phosphorylates SLK after recognizing a consensus sequence centered around S189 induces conformational changes in SLK that are required for sustained catalytic activity. Without the consensus sequence, SLK would not be recognized, conformational changes would not occur and there would be no sustained catalytic activity. Alternatively, another SLK molecule was responsible for phosphorylating SLK at the activation segment and this recognition was lost. If local concentration alone was able to increase SLK kinase activity, one would expect that the

AP20187-treated S189D and S189E mutants would be kinase active, but this was not the case.

Further study is needed to determine if mutations are dominant in the case of heterodimerization of wild type SLK and a serine or threonine mutant. This question was approached by comparing kinase activity of Fv-SLK 1-373 WT homodimers with

Fv-SLK 1-373 WT and Fv-SLK 1-373 T183A/S189A heterodimers, and with Fv-SLK

1-373 T183A/S189A homodimers. In keeping with earlier results, WT monomers and dimers were highly active, whereas mutant monomers and dimers were inactive (Fig.

21). In cells co-transfected with in Fv-SLK 1-373 WT and Fv-SLK 1-373 T183A/S189A, one would predict the presence of both monomers, plus a mixture of homo and heterodimers. The kinase activity of the mixture was substantially greater than the

Page 60 of 68 activity of mutant monomers and homodimers, and was comparable to Fv-SLK 1-373

WT monomers and homodimers. Therefore, the mixing of the Fv-SLK 1-373 WT and the

Fv-SLK 1-373 double mutant did not reduce the Fv-SLK 1-373 WT kinase activity significantly. The use of a controlled heterodimerization system, which could force hetero-dimerization specifically would be of particular value in order to conclusively determine whether heterodimerization of SLK WT and SLK T183A/S189A is sufficient to rescue kinase activity.

Conclusion The results in this and previous studies demonstrate that the regulation of SLK activity is complex, and that SLK may perform various physiological functions depending on the organ system and type of disease. The delineation of key phosphorylation sites in

SLK provides potential novel targets for design of pharmaceutical compounds, which may be useful in treating acute renal injury, cancer, and other diseases. Changes in SLK expression or phosphorylation could potentially serve as a diagnostic marker of cancer severity, or as a target for pharmaceutical compounds. In addition, in the future, studies may show that SLK may serve as a prognostic marker in patients with glomerulonephritis or acute kidney injury.

Page 61 of 68 Acknowledgments I would like to thank everyone in the Nephrology Division who helped train me and deepened my understanding of molecular biology. These last two years would not have been so enjoyable without the collaborative spirit of our lab. In particular, I would like to thank my supervisor, Dr. Andrey Cybulsky for his guidance, his efforts scrutinizing my results and interpretations and his meticulousness looking over the various drafts of this thesis. While my results and thesis owe everything to my fellow researchers including Joan Papillon, Julie Guillemette and Dr. Thomas Kitzler, soon to be Dr. Erika

Hooker, Lamine Aoudjit, Yulia Zilber, Dr. Elena Torban and Dr. Tomoko Takano, I accept as my own any faults contained herein; thank you for lending me your time - and your equipment. I would also like to thank the members of my thesis committee: Dr. Louise

Larose, Dr. Serge Lemay and Dr. Jean-Jacques Lebrun, who questioned me tirelessly during my committee meetings; it was a very humbling experience to see how far I have come and how far I still need to go. Thank you Jacob Saltiel for proofreading my thesis and enduring the endless science-jargon! I would also like to acknowledge Ariad for providing their homodimerization kit, including samples of AP20187 and Sierra

Delarosa for the Fv-SLK 1-373 WT construct. I would like to thank Joan Papillon, Julie

Guillemette and Dr. Serge Lemay, not only for correcting my French abstract, but for correcting my spoken French in the lab. Thanks to them, I can tell my “ARN” from my

“ADN”! Finally, I would like to thank my parents Yurij and Zorianna, my sister Adriana and the rest of my family for their continued support. In particular I would like to thank my Aunt Vera for her ﬁnancial support during CEGEP, my undergrad and beyond. Я

дуже вдячний!

Page 62 of 68 Bibliography (all)

1.Ali AS, Ali S, El-Rayes BF, Philip PA, Sarkar FH. Exploitation of protein kinase C: A useful target for cancer therapy. Cancer Treatment Reviews. 2009;35(1):1-8.

2.Burakov AV, Kovalenko OV, Potekhina ES, Nadezhdina ES, Zinovkina LA. LOSK (SLK) protein kinase activity is necessary for microtubule organization in the interphase cell centrosome. Dokl Biol Sci. 2005 Jul-Aug;403:317-9.

3.Burakov AV, Zhapparova ON, Kovalenko OV, Zinovkina LA, Potekhina ES, Shanina NA, et al. Ste20-related protein kinase LOSK (SLK) controls microtubule radial array in interphase. Mol Biol Cell. 2008 May;19(5):1952-61.

4.Caetano-Anollés G, Wang M, Caetano-Anollés D, Mittenthal JE. The origin, evolution and structure of the protein world. Biochem J. 2009 February 1, 2009;417(3):621-37.

5.Chaar Z, O'Reilly P, Gelman I, Sabourin LA. v-Src-dependent down-regulation of the Ste20-like kinase SLK by casein kinase II. J Biol Chem. 2006 Sep 22;281 (38):28193-9.

6.Chamoun F, Burne M, O'Donnell M, Rabb H. Pathophysiologic role of selectins and their ligands in ischemia reperfusion injury. Front Biosci. 2000 Nov 1;5:E103-9.

7.Cohen P. Targeting protein kinases for the development of anti-inﬂammatory drugs. Current Opinion in Cell Biology. 2009;21(2):317-24.

8.Cowley BD, Jr. Calcium, cyclic AMP, and MAP kinases: dysregulation in polycystic kidney disease. Kidney Int. 2008 Feb;73(3):251-3.

9.Cybulsky AV, Takano T, Guillemette J, Papillon J, Volpini RA, Di Battista JA. The Ste20-like kinase SLK promotes p53 transactivation and apoptosis. Am J Physiol Renal Physiol. 2009 Oct;297(4):F971-80.

10.Cybulsky AV, Takano T, Papillon J, Hao W, Mancini A, Di Battista JA, et al. The 3'- untranslated region of the Ste20-like kinase SLK regulates SLK expression. Am J Physiol Renal Physiol. 2007 Feb;292(2):F845-52.

11.Cybulsky AV, Takano T, Papillon J, Khadir A, Bijian K, Chien CC, et al. Renal expression and activity of the germinal center kinase SK2. Am J Physiol Renal Physiol. 2004 Jan;286(1):F16-25.

12.Dan I, Watanabe NM, Kusumi A. The Ste20 group kinases as regulators of MAP kinase cascades. Trends Cell Biol. 2001 May;11(5):220-30.

Page 63 of 68 13.Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell. 2000 Oct 13;103(2):239-52.

14.De Chiara G, Marcocci ME, Torcia M, Lucibello M, Rosini P, Bonini P, et al. Bcl-2 Phosphorylation by p38 MAPK: identiﬁcation of target sites and biologic consequences. J Biol Chem. 2006 Jul 28;281(30):21353-61.

15.Delarosa S, Guillemette J, Papillon J, Cybulsky AV. Activity of Ste20-Like Kinase, SLK, Is Regulated by Dimerization. Montreal: McGill University; 2009.

16.Delpire E. The mammalian family of sterile 20p-like protein kinases. Pﬂugers Arch. 2009 Sep;458(5):953-67.

17.Dressler GR. The Cellular Basis of Kidney Development. Annual Review of Cell and Developmental Biology. 2006;22(1):509-29.

18.Ellinger-Ziegelbauer H, Karasuyama H, Yamada E, Tsujikawa K, Todokoro K, Nishida E. Ste20-like kinase (SLK), a regulatory kinase for polo-like kinase (Plk) during the G2/M transition in somatic cells. Genes Cells. 2000 Jun;5(6):491-8.

19.Ezkurdia I, Bartoli L, Fariselli P, Casadio R, Valencia A, Tress ML. Progress and challenges in predicting protein-protein interaction sites. Brief Bioinform. 2009 May 1, 2009;10(3):233-46.

20.Fisher CE, Michael L, Barnett MW, Davies JA. Erk MAP kinase regulates branching morphogenesis in the developing mouse kidney. Development. 2001 Nov;128(21):4329-38.

21.Guilluy C, Rolli-Derkinderen M, Loufrani L, Bourge A, Henrion D, Sabourin L, et al. Ste20-related kinase SLK phosphorylates Ser188 of RhoA to induce vasodilation in response to angiotensin II Type 2 receptor activation. Circ Res. 2008 May 23;102(10):1265-74.

22.Hao W, Takano T, Guillemette J, Papillon J, Ren G, Cybulsky AV. Induction of apoptosis by the Ste20-like kinase SLK, a germinal center kinase that activates apoptosis signal-regulating kinase and p38. J Biol Chem. 2006 Feb 10;281(6): 3075-84.

23.Hassoun HT, Lie ML, Grigoryev DN, Liu M, Tuder RM, Rabb H. Kidney ischemia- reperfusion injury induces caspase-dependent pulmonary apoptosis. Am J Physiol Renal Physiol. 2009 Jul;297(1):F125-37.

24.Itoh S, Kameda Y, Yamada E, Tsujikawa K, Mimura T, Kohama Y. Molecular cloning and characterization of a novel putative STE20-like kinase in guinea pigs. Arch Biochem Biophys. 1997 Apr 15;340(2):201-7.

25.Johnson TM, Antrobus R, Johnson LN. Plk1 activation by Ste20-like kinase (Slk) phosphorylation and polo-box phosphopeptide binding assayed with the

Page 64 of 68 substrate translationally controlled tumor protein (TCTP). Biochemistry. 2008 Mar 25;47(12):3688-96.

26.Johnson TM, Antrobus R, Johnson LN. Plk1 activation by Ste20-like kinase (Slk) phosphorylation and polo-box phosphopeptide binding assayed with the substrate translationally controlled tumor protein (TCTP). Biochemistry. 2008 Mar 25;47(12):3688-96.

27.Koseki C, Herzlinger D, al-Awqati Q. Apoptosis in metanephric development. J Cell Biol. 1992 Dec;119(5):1327-33.

28.Lameire N, Van Biesen W, Vanholder R. Acute renal failure. Lancet. 2005 Jan 29- Feb 4;365(9457):417-30.

29.Lameire N, Van Biesen W, Vanholder R. The changing epidemiology of acute renal failure. Nat Clin Pract Nephrol. 2006 Jul;2(7):364-77.

30.Lemmon MA, Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell. 2010 Jun 25;141(7):1117-34.

31.Liu S, Humes HD. Cellular and molecular aspects of renal repair in acute renal failure. Curr Opin Nephrol Hypertens. 1993 Jul;2(4):618-24.

32.Muller T, Stein U, Poletti A, Garzia L, Rothley M, Plaumann D, et al. ASAP1 promotes tumor cell motility and invasiveness, stimulates metastasis formation in vivo, and correlates with poor survival in colorectal cancer patients. Oncogene. 2010 Apr 22;29(16):2393-403.

33.Nadezhdina ES, Zinovkina LA, Fais D, Chentsov Iu S. [Spermatozoa of the loach Misgurnus fossilis as a test system for identiﬁcation of new centromere proteins]. Ontogenez. 2001 Jan-Feb;32(1):41-50.

34.Nigam S, Lieberthal W. Acute renal failure. III. The role of growth factors in the process of renal regeneration and repair. Am J Physiol Renal Physiol. 2000 Jul; 279(1):F3-F11.

35.Nijboer CH, van der Kooij MA, van Bel F, Ohl F, Heijnen CJ, Kavelaars A. Inhibition of the JNK/AP-1 pathway reduces neuronal death and improves behavioral outcome after neonatal hypoxic-ischemic brain injury. Brain Behav Immun. 2010 Jul;24(5):812-21.

36.Nolen B, Taylor S, Ghosh G. Regulation of Protein Kinases: Controlling Activity through Activation Segment Conformation. Molecular Cell. 2004;15(5):661-75.

37.O'Reilly PG, Wagner S, Franks DJ, Cailliau K, Browaeys E, Dissous C, et al. The Ste20-like kinase SLK is required for cell cycle progression through G2. J Biol Chem. 2005 Dec 23;280(51):42383-90.

Page 65 of 68 38.Oliver AW, Knapp S, Pearl LH. Activation segment exchange: a common mechanism of kinase autophosphorylation? Trends Biochem Sci. 2007 Aug;32 (8):351-6.

39.Pannu N, Klarenbach S, Wiebe N, Manns B, Tonelli M. Renal replacement therapy in patients with acute renal failure: a systematic review. JAMA. 2008 Feb 20;299(7):793-805.

40.Park KM, Chen A, Bonventre JV. Prevention of kidney ischemia/reperfusion- induced functional injury and JNK, p38, and MAPK kinase activation by remote ischemic pretreatment. J Biol Chem. 2001 Apr 13;276(15):11870-6.

41.Pike AC, Rellos P, Niesen FH, Turnbull A, Oliver AW, Parker SA, et al. Activation segment dimerization: a mechanism for kinase autophosphorylation of non- consensus sites. EMBO J. 2008 Feb 20;27(4):704-14.

42.Pirruccello M. A dimeric kinase assembly underlying autophosphorylatin in the p21 activated kinases. J Mol Biol. 2006;361:312-26.

43.Potekhina ES, Zinovkina LA, Nadezhdina ES. Enzymatic activity of protein kinase LOSK: possible regulatory role of the structural domain. Biochemistry (Mosc). 2003 Feb;68(2):188-95.

44.Rechsteiner M, Rogers SW. PEST sequences and regulation by proteolysis. Trends in Biochemical Sciences. 1996;21(7):267-71.

45.Roovers K, Wagner S, Storbeck CJ, O'Reilly P, Lo V, Northey JJ, et al. The Ste20-like kinase SLK is required for ErbB2-driven breast cancer cell motility. Oncogene. 2009 Aug 6;28(31):2839-48.

46.Rosenblum ND. Developmental biology of the human kidney. Semin Fetal Neonatal Med. 2008 Jun;13(3):125-32.

47.Sabourin LA, Rudnicki MA. Induction of apoptosis by SLK, a Ste20-related kinase. Oncogene. 1999 Dec 9;18(52):7566-75.

48.Sabourin LA, Tamai K, Seale P, Wagner J, Rudnicki MA. Caspase 3 cleavage of the Ste20-related kinase SLK releases and activates an apoptosis-inducing kinase domain and an actin-disassembling region. Mol Cell Biol. 2000 Jan;20(2): 684-96.

49.Savill J. Regulation of glomerular cell number by apoptosis. Kidney Int. 1999 Oct; 56(4):1216-22.

50.Scheeff ED, Bourne PE. Structural Evolution of the Protein Kinase‚ÄìLike Superfamily. PLoS Comput Biol. 2005;1(5):e49.

Page 66 of 68 51.Scott JD, Pawson T. Cell signaling in space and time: where proteins come together and when they're apart. Science. 2009 Nov 27;326(5957):1220-4.

52.Shaulian E, Karin M. AP-1 in cell proliferation and survival. Oncogene. 2001 Apr 30;20(19):2390-400.

53.Sorokin L, Ekblom P. Development of tubular and glomerular cells of the kidney. Kidney Int. 1992 Mar;41(3):657-64.

54.Storbeck CJ, Daniel K, Zhang YH, Lunde J, Scime A, Asakura A, et al. Ste20-like kinase SLK displays myoﬁber type speciﬁcity and is involved in C2C12 myoblast differentiation. Muscle Nerve. 2004 Apr;29(4):553-64.

55.Storbeck CJ, Wagner S, O'Reilly P, McKay M, Parks RJ, Westphal H, et al. The Ldb1 and Ldb2 transcriptional cofactors interact with the Ste20-like kinase SLK and regulate cell migration. Mol Biol Cell. 2009 Oct;20(19):4174-82.

56.Vermeer MH, van Doorn R, Dijkman R, Mao X, Whittaker S, van Voorst Vader PC, et al. Novel and highly recurrent chromosomal alterations in Sezary syndrome. Cancer Res. 2008 Apr 15;68(8):2689-98.

57.Wagner S, Flood TA, O'Reilly P, Hume K, Sabourin LA. Association of the Ste20- like kinase (SLK) with the microtubule. Role in Rac1-mediated regulation of actin dynamics during cell adhesion and spreading. J Biol Chem. 2002 Oct 4;277(40): 37685-92.

58.Wagner S, Storbeck CJ, Roovers K, Chaar ZY, Kolodziej P, McKay M, et al. FAK/ src-family dependent activation of the Ste20-like kinase SLK is required for microtubule-dependent focal adhesion turnover and cell migration. PLoS One. 2008;3(4):e1868.

59.Wagner SM, Sabourin LA. A novel role for the Ste20 kinase SLK in adhesion signaling and cell migration. Cell Adh Migr. 2009 Apr;3(2):182-4.

60.Waikar SS, Curhan GC, Wald R, McCarthy EP, Chertow GM. Declining mortality in patients with acute renal failure, 1988 to 2002. J Am Soc Nephrol. 2006 Apr;17 (4):1143-50.

61.Widmaier EP, Raff H, Strang KT. Vander's human physiology : the mechanisms of body function. 10 ed. Boston: McGraw-Hill; 2006.

62.Yamada E, Tsujikawa K, Itoh S, Kameda Y, Kohama Y, Yamamoto H. Molecular cloning and characterization of a novel human STE20-like kinase, hSLK. Biochim Biophys Acta. 2000 Feb 28;1495(3):250-62.

63.Zhang X, Crespo A, Fernandez A. Turning promiscuous kinase inhibitors into safer drugs. Trends Biotechnol. 2008 Jun;26(6):295-301.

Page 67 of 68 64.Zhang YH, Hume K, Cadonic R, Thompson C, Hakim A, Staines W, et al. Expression of the Ste20-like kinase SLK during embryonic development and in the murine adult central nervous system. Brain Res Dev Brain Res. 2002 Dec 15;139(2):205-15.

65.Zhao ZS, Leung T, Manser E, Lim L. Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24. Mol Cell Biol. 1995 Oct;15(10):5246-57.

66.Zhu L, Koistinen H, Landegren U, Stenman UH. Proximity ligation measurement of the complex between prostate speciﬁc antigen and alpha1-protease inhibitor. Clin Chem. 2009 Sep;55(9):1665-71.

67.Zhu L, Koistinen H, Wu P, Narvanen A, Schallmeiner E, Fredriksson S, et al. A sensitive proximity ligation assay for active PSA. Biol Chem. 2006 Jun;387(6): 769-72.

68.Zhu L, Leinonen J, Zhang WM, Finne P, Stenman UH. Dual-label immunoassay for simultaneous measurement of prostate-speciﬁc antigen (PSA)-alpha1- antichymotrypsin complex together with free or total PSA. Clin Chem. 2003 Jan; 49(1):97-103.

69.Zinovkina LA, Poltaraus AB, Solov'ianova OB, Nadezhdina ES. [A proposed new mammalian cell protein kinase, associated with microtubules]. Mol Biol (Mosk). 1998 Mar-Apr;32(2):341-8.

70.Zinovkina LA, Poltaraus AB, Solovyanova OB, Nadezhdina ES. Chinese hamster protein homologous to human putative protein kinase KIAA0204 is associated with nuclei, microtubules and centrosomes in CHO-K1 cells. FEBS Lett. 1997 Sep 1;414(1):135-9.

Page 68 of 68