VU Research Portal

Disturbed blood flow and altered TGF-?/BMP signaling in pulmonary arterial hypertension Happé, C.M.

2020

document version Publisher's PDF, also known as Version of record

Link to publication in VU Research Portal

citation for published version (APA) Happé, C. M. (2020). Disturbed blood flow and altered TGF-?/BMP signaling in pulmonary arterial hypertension.

General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

• Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ?

Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

E-mail address: [email protected]

Download date: 08. Oct. 2021 Disturbed blood flow and altered TGF-β/BMP signaling in pulmonary arterial hypertension

Christiaan Maurice Happé Cover desgin and Lay-out: Chris Happé

Printed by: Ridderprint

ISBN: 978-94-6416-034-5

Disturbed blood flow and altered TGF-β/BMP signaling in pulmonary arterial hypertension

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus prof.dr. V. Subramaniam in het openbaar te verdedigen ten overstaan van de promotiecommissie van de Faculteit der Geneeskunde op woensdag 30 september 2020 om 13.45 uur in de aula van de universiteit, De Boelelaan 1105

door

Christiaan Maurice Happé

geboren te Purmerend promotor: prof.dr. H.J. Bogaard copromotor: dr. F.S. Handoko-de Man

Voor mijn ouders Overige leden promotiecommissie: Prof. dr. V.W.M. van Hinsbergh Prof. dr. J.D. van Buul Prof. dr. K. Grünberg Dr. B. Bartelds Dr. P. Dorfmüller

The research presented in this thesis was performed at the Departments op Pulmonolgy and Physiology of VU University Medical Center / Amsterdam Cardiolvascular Sciences, Amsterdam

This work was supported by the Dutch CardioVascular Alliance (DCVA): the Dutch Heart Foundation, Dutch Federation of University Medical Centers, the Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Sciences Grant 2012-08 and 2018-2023 awarded to the Phaedra consortium (http://www.phaedraresearch. nl).

Financiel support by the Lung Foundation Netherlands (Longfonds, grant number 3.3.12.036) was greatly acknowledged. Contents

Part I

Chapter 1 General introduction and outline of the thesis

Chapter 2 Reconciling paradigms of abnormal pulmonary blood flow and quasi malignant cellular alterations in pulmonary arterial hypertension

Chapter 3 Vascular remodeling in the pulmonary circulation after major lung resection

Chapter 4 Pneumonectomy combined with SU5416 induces severe pulmonary hypertension in rats

Chapter 5 Delayed Microvascular Shear-adaptation in Pulmonary Arterial Hypertension: Role of PECAM-1 Cleavage

Part II

Chapter 6 General introduction

Chapter 7 Bone Morphogenetic Protein Receptor Type 2 Mutation in Pulmonary Arterial Hypertension, A view on the right ventricle

Chapter 8 The BMP receptor 2 in Pulmonary Arterial Hypertension

Chapter 9 Summary and future perspectives

Chapter 10 Nederlandse Samenvatting List of publications Dankwoord Curriculum Vitae

General introduction 1 and outline of this thesis

C.M. Happé • H.J. Bogaard • F.S. de Man 10

Pulmonary Arterial Hypertension

Pulmonary hypertension (PH) is a disease that is characterized by an increased blood pressure in the pulmonary vascular system. Clinical classification of the disease can distinguish between different forms of PH and causes relating to disease development. Pulmonary arterial hypertension (group 1) is defined by an increase in mean pulmonary artery pressure ≥ 25 mmHg combined with a pulmonary wedge pressure ≤ 15 mmHg. While this form is associated with heritable factors congenital heart disease and several toxins (amongst others), a small (percentage) group of PAH cases remains idiopathic of nature. Common in the disease is that the dense vascular network in the lungs is affected due to multiple factors eventually leading to loss of pulmonary vascular radius and possible rarefaction of pulmonary vessels. Following this decrease in functional lung vascular volume, pulmonary vascular resistance (PVR) causing an increased pressure in the right ventricle (RV). The increased load, needed to maintain a sufficient cardiac output, ultimately culminates in RV adaptation, failure and death of the patient (Figure 1).

dyn·s/cm dyn·s/cm

NORMAL PULMONARY ARTERIAL HYPERTENSION

Figure 1. The left side represent a healthy situation with a dense lung vascular network, unobstructed vessels and a normal pulmonary vascular resistance (dyn.s/cm). In pulmonary arterial hypertension narrowing and occlusion of vessels combined with vascular rarefaction culminates in increases pulmonary vascular resistance (dyn.s/cm) and right heart failure. General introduction 11

Vascular remodeling Pulmonary arterial hypertension Lung vascular remodeling is an important factor in PAH disease development. From previous 1 research we have learned that this can be initiated by external factors such as toxins, or endogenous factors which include aberrant cellular signaling or a (normal) cellular response to a primary initiator such as a congenital cardiac defect. A major contributor in vascular remodeling is the endothelial cell, which forms the inner lining of the blood vessels and therefore serves as a barrier and an integrator of external stimuli. In response to these stimuli EC cellular signaling can cause cells to adapt to these factors, thereby adapting to opposed challenges. One of the earlier examples of this adaptation are described in the papers by Paul Wood, an early pioneer in the field, describing vascular remodeling in patients with Eisenmenger’s syndrome. Patients with this syndrome, suffer from an left-to right cardiac shunt causes by a congenital heart defect. Due to this, the lung vascular system is exposed an abnormal pulmonary blood flow (PBF). If remained untreated, these patients will develop pulmonary hypertension due to vascular remodeling caused by the abnormal PBF and ultimately reversal of the shunt will occur.

Figure 2. Normal vessel on the left. A single layer of endothelial cells (ECs or intima) forms as a barrier. ECs are surrounded by vascular smooth muscle cells (SMCs or media) followed by a layer of connective tissue (adventitia). An abnormal pulmonary blood flow (pbf) can elicit an adaptive response form the endothelium and SMC cell layer. While vessel diameter may decrease, the overall structure of the vessel remains preserved. In pulmonary arterial hypertension endothelial cells start to proliferate uncontrollably. This type of remodeling culminates in occlusion of the vessel.

While an abnormal PBF alone is able to elicit a adaptational response from the endothelium, this factor alone is not able to account for the lung vascular remodeling which is observed in PAH. While remodeling due to flow is seen as an adaptational process, in PAH, the adaptive response of the endothelium has been described as wound healing gone awry or “cancer-like”. 12

Vascular pathology in PAH is characterized by vessel obliteration and formation of plexiform lesions. To form a paradigm on which to base explanations for this aberrant remodeling, the two-hit-hypothesis, originally postulated by Alfred Knudson, was applied in the context of PAH vascular remodeling. As in cancer, it was proposed that multiple (not necessarily genetic) hits must occur for PAH to develop.

The need for multiple hits in PAH While an abnormal PBF can serve as a hit, genetic alterations can serve as a predisposition to disease development and are therefore also consider a “hit”. BMPR2, a member of the transforming growth factor β receptor family has a significant role in PAH as mutations in the BMPR2 gene constitute approximately 80% of familial PAH cases. Although carriers of the mutation have a worse survival (in years from diagnosis), precise contribution of BMPR2 to disease development and progression remains unclear. A current hypothesis states that abnormal signaling by BMPR2 might lead to an imbalance in the TGF-β/BMP signaling, favoring TGF-β signaling. Moreover, as BMPR2 is expressed in both the lung vascular and heart tissue, impaired signaling has the potential to affect multiple organs in this disease.

BMP

BMP BMP TGF-β

TGF-β TGF-β

TGF-β TGF-β TGF-β

IMPAIRED BMPR2 SIGNALING IN PULMONARY ARTERIAL HYPERTENSION

Figure 3. Imbalance in BMPR2 signaling leads to favoring of TGF-B directed signaling. In context of PAH this could potentially be detrimental for both the lungs and heart. Understanding the implication of defective signaling as well as development of viable treatment targets for this pathway are of great interest. General introduction 13

Outline of this thesis Part I of this thesis will discuss the role of abnormal pulmonary blood flow in PAH. Chapter 1 2 will elaborate on the role of flow in PAH while trying to reconcile these with the cancer paradigm of PAH. A commonly performed surgical intervention which directly decreases lung vascular volume is the pulmonary lobectomy or the pneumonectomy. As this potentially could increase flow over the remaining lung vasculature we studied the lung vasculature from patients whom underwent major lung resection to determine the effects of an increased pulmonary blood flow on vascular remodeling (Chapter 3). These results are complemented by novel animal data describing lung vascular changes after left-pneumonectomy.

To improve our understanding of the disease and to test interventions we rely on the utilization of several animal models of PAH. The SU5416 (Sugen) + Hypoxia (SuHx) model is a well characterized animal model for PH displaying pulmonary vascular lesions that are similar to characteristic lesions observed in PAH. To assess whether hypoxia as a stimulus is a prerequisite for the development of these lesions, a novel animal model of PAH was characterized. Endothelial stress, induced by SU5416, is subjected to abnormal pulmonary blood flow due to left sided pneumonectomy. The aim of this study was to find additional evidence to support the two-hit hypothesis while offering an alternative to current PH animal models (Chapter 4). As an altered blood flow can be sensed by endothelial cells, understanding how ECs relay and react to these forces is of critical importance. To this end the effect of various flow profiles was investigated in an in-vitro setting using patient derived pulmonary endothelial cells. Findings from these experiments were applied as a possible intervention in an experimental animal model of PAH (Chapter 5).

Part II of this thesis will start to further elaborate on the role of BMPR2 and TGF-β in PAH, discussing current knowledge and possible therapeutic interventions (Chapter 6). In contrast to extensive work that has been performed describing the role of BMPR2 on the lung vasculature, effects of the BMPR2 mutations on the heart only recently started to gain some interest. Therefore, we investigated RV function in PAH patients with and without the BMPR2 mutation and combined in vivo measurements with molecular and histological analysis of human RV and left ventricular tissue. (Chapter 7).

It is known PH rat animal models differ in activated molecular pathways and in their eventual established phenotypes of disease. This makes it likely that TGF-β/BMP signaling will differ between PAH animal models. Therefore, to ensure translational capability of these studies, 14

we investigated lung and heart TGF-β/BMP axis of several established rat models of PAH or isolated right heart failure. Results were then compared to findings from human PAH patient heart- and lung tissue samples to be able to suggest optimal use of animal models. (Chapter 8). Reconciling paradigms of abnormal pulmonary blood flow and quasi-malignant cellular alterations in pulmonary 2 arterial hypertension

C.M. Happé • R. Szulcek • N.F. Voelkel • H.J. Bogaard

Journal of Vascular Pharmacology • 2016 16

Abstract

In pulmonary arterial hypertension (PAH) structural and functional abnormalities of the small lung vessels interact and lead to a progressive increase in pulmonary vascular resistance and right heart failure. A current pathobiological concept characterizes PAH as a ‘quasi-malignant’ disease focusing on cancer-like alterations in endothelial cells (EC) and the importance of their acquired apoptosis-resistant, hyper-proliferative phenotype in the process of vascular remodeling. While changes in pulmonary blood flow (PBF) have been long-since recognized and linked to the development of PAH, little is known about a possible relationship between an altered PBF and the quasi-malignant cell phenotype in the pulmonary vascular wall. This review summarizes recognized and hypothetical effects of an abnormal PBF on the pulmonary vascular bed and links these to quasi-malignant changes found in the pulmonary endothelium. Here we describe that abnormal PBF does not only trigger a pulmonary vascular cell growth program, but may also maintain the cancer-like phenotype of the endothelium. Consequently, normalization of PBF and EC response to abnormal PBF may represent a treatment strategy in patients with established PAH. Reconciling paradigms in PAH 17

1. Introduction

In severe forms of pulmonary arterial hypertension (PAH), a progressive increase in the pulmonary vascular resistance (PVR) leads to right heart pressure overload and right heart failure [1]. The increase in resistance is caused by vasoconstriction, narrowing, occlusion and 2 possible rarefaction of microvessels (diameter <80 μM) in the pulmonary circulation that culminates in the development of generic plexiform lesions [2]. Some of these characteristic histological findings were already described in the very first report of “endarteritis pulmonalis deformans” in 1865 by the Viennese physician Julius Klob [3]. Initially, sustained vasoconstriction was seen as the root cause of a disease that was then called primary pulmonary hypertension and later termed idiopathic PAH (IPAH), to describe the condition of PAH with unknown cause [4,5]. The typical histopathological changes in the vascular walls of pulmonary vessels in the pulmonary hypertensive lung, e.g. intimal thickening and fibrosis, media hyperplasia and formation of plexiform lesions were thought to be secondary to the chronic and sustained pulmonary vasoconstriction and consequently increased pulmonary blood flow (PBF). Yet, the overall modest success of vasodilator treatment continues to motivate many investigators to explore the details of the cellular and molecular aspects of the disease [6].

Over the past 20 years reports of phenotypic changes of lung vessel endothelial cells, exuberant monoclonal outgrowth and genetic abnormalities in pulmonary endothelial cells (ECs) have led to a paradigm shift where some investigators have applied concepts from cancer biology in order to explain the vasculopathy of PAH as a quasi-malignant disease [7–10]. This cancer-paradigm of PAH has led to extensive research and preclinical testing of anti-angiogenic drugs with tyrosine kinase inhibitors (TKIs) leading the way. Several compounds were successfully tested with positive outcomes in animal models of pulmonary hypertension (PH) but the translation of these findings to the clinic continues to be slow and entails several risks. A particular concern pertaining to the use of TKIs in patients with PAH is that they may have serious side-effects including cardiotoxicity and, to some extent, even promote the development of PH [11–14].

High shear stress triggered cellular injury and cell death, can be the driving force for a phenotypic switch of the cells in the pulmonary vascular wall, including the emergence of apoptosis- resistance and exuberant proliferation resulting in vascular occlusions and increased PVR [15–19]. Recent findings by our group underline the importance of dysfunctional EC shear- 18

responses in the disease progression, which are caused by increased pro-apoptotic signalling and consequent protein cleavage [20]. Therefore angioproliferative vascular remodeling and abnormal PBF are in all likelihood interrelated, whereby it is of interest to examine the mechanisms of such an interaction on the cellular level and attempt to reconcile the early pathophysiological concepts of vasoconstriction and increased shear stress with the current concept of exuberant cell growth. Further, it is desirable to examine whether molecular evidence supporting one or more hallmarks of cancer is sufficient to imply a quasi-malignant transformation, or could also represent a normal or excessive repair response to sustained cellular stress. Here we will review the effects of abnormal PBF on the pulmonary vascular bed and link these to quasi-malignant events by addressing several hallmarks of cancer that have been highlighted by Hanahan and Weinberg in their landmark papers [21,22].

2. Abnormal pulmonary blood flow and pulmonary arterial hypertension Fluid flow induced shear stress (tau, τ), assuming an inelastic, cylindrical and straight vessel, can be calculated by the Haagen-Poisseuille equation (τ = (mean flow velocity (u)/vessel diameter (d)) × kinetic viscosity (μ)). A modification of this formula is used because blood viscosity is not constant but affected by the vessel radius and flow velocity (Fåhræus–Lindqvist effect) [23]. These formulas can be used to calculate shear stress, expressed in dynes per cm2 (dyn/cm2). Additionally flow is characterized as laminar or turbulent by determination of the Reynolds number (flow velocity × fluid density × vessel diameter/fluid viscosity). EC are directly exposed to blood flow and mechanical forces, which shape EC structure and affect their function via mechanisms such as altered expression of shear stress responsive elements, structural and biochemical responses [24–27]. The healthy lung microcirculation is a low-pressure, high volume system characterized by low blood flow velocity to ensure proper gas exchange [28]. Abnormal alterations in this delicate equilibrium have been linked to the development of angioproliferative remodeling and PH, wherefore we introduce abnormal PBF as a collective term describing a change in blood flow profile, pulsatility, velocity and blood distribution in the lung vasculature.

The link between increased PBF and PH was already established in the early nineteen fifties. Paul Wood and others published on the effects of “pulmonary hypertension with reversed central shunt” (Eisenmenger’s syndrome) and acknowledged the importance of an early normalization of the PBF before irreversible damage to the lung circulation would occur [29– 31]. To determine whether shunt-reversal would be favorable, lung biopsies were deemed Reconciling paradigms in PAH 19

necessary to assess the severity of the vasculopathy. Examination of the lung vessels histology provided valuable insight into the vascular remodelling in the context of high PBF [32–34].

Today, several culture systems and animal models are available to study specific aspects of the diseases, such as the role of abnormal PBF. Patient derived pulmonary microvascular 2 endothelial cells (PMVECs), pulmonary artery endothelial cells (PAEC) and pulmonary artery smooth muscle cells (PASMCs) can be studied ex vivo under defined fluid flow/ shear conditions [18]. Thereby, valuable insight can be gained by properly designed flow experiments to determine effects of different types of shear stress (e.g. high/low, pulsatile and oscillatory shear stress) on cell monolayers. To investigate the flow dynamics in vivo multiple animal models are available. The chronic hypoxia and monocrotaline (MCT) models are well-described models of PH that are characterized by thickening of the media (smooth muscle cell layer) in the lung vasculature. These high flow models reveal that an increase in flow is not sufficient to induce the obliterative angiopathy observed in patients with PAH and in (rare cases of) congenital heart disease (CHD) with non-restrictive post-tricuspid shunts [29,35–38]. However, when the exposure to hypoxia or MCT is followed by a second stimulus (or “hit”), intimal obliteration develops in the lung vasculature and lesions that resemble the plexogenic alterations in the human PAH lungs. The “two-hit” hypothesis of tumorigenesis, originally formulated by Alfred Knudson, was proposed in the context of PAH in the late nineties, stating that both endothelial injury and changes in pulmonary artery hemodynamics must occur for neointimal lesions to arise [39–41]. Known examples of such double-hit models are the MCT + pneumonectomy (PNx) model and the Sugen-Hypoxia model (SuHx), which combines the vascular endothelial growth factor receptor (VEGFR)-blocker SU5416 and chronic hypoxia [19,42]. To date plexiform lesions have only been described in the SuHx model, thereby making this a unique model for PAH-like remodelling [43]. Additionally, variations to both models have been described [19,43–48].

3. Hallmarks of cancer in PAH: sustained cell growth One of the central hallmarks of cancer as described by Hanahan and Weinberg is sustained cell growth. In order to proliferate all normal cells require growth signals transmitted into the cell via transmembrane receptors and phosphorylation of their tyrosine kinase domains. In cancer cells growth signals can be initiated via autocrine and paracrine stimulation from stromal cells (such as fibroblasts and pericytes) and their increased production of growth factors and their associated receptors [22]. Caveolin-1 (CAV-1) a scaffolding protein that, among others, is one 20

of the regulators of cell proliferation is of interest in PH and in mechanobiology [49].

A recent study reported on the changes in CAV-1 in lung vessels of children with CHD accompanied by an increased PBF. Increased flow caused a loss of CAV-1 expression in ECs, but concurrently, increased CAV-1 expression in pulmonary artery smooth muscle cells (PASMC) [33]. The authors propose that loss of CAV-1 in ECs stimulates the enhanced expression of CAV-1 in SMCs. In vitro, overexpression of CAV-1 has been linked to proliferation of PASMCs most likely due to increased Ca2+ influx, which subsequently initiates proliferation [50,51]. In patients, a novel CAV-1 mutation has been associated with hereditary PAH. Reduced levels of CAV-1 in EC have been reported in IPAH patients [52]. Decreased levels of CAV-1 were reported to cause hyper-proliferation via eNOS hyper-activation and oxidative stress [53]. In turn, sustained activation of the MAPK cascade, a hallmark of the EC changes in PAH, has been shown to be sufficient to reversibly down-regulate CAV-1 mRNA and protein expression [54]. Shear also directly regulates eNOS via endothelin-1 receptor mediated phosphorylation at Ser1177 in PAECs and lowers the bioavailability of NO, known to increase SMC proliferation [55]. Reactive oxygen species (ROS), were shown in lung endothelium from rats that underwent PNx combined with MCT [44]. Resveratrol, an inhibitor of ROS, was shown to attenuate apoptosis in PMVECs stimulated by high shear stress and inhibits platelet derived growth factor (PDGF)-stimulated proliferation and cellular hypertrophy [56].

In HPMVECs shear stress resulted in a 10-fold upregulation of growth differentiation marker 15 (GDF-15) mRNA and increase in early growth response protein 1 (EGR-1) involved in both SMC and PMVEC proliferation [45,57]. Additionally, Egr-1 is able to up-regulate different effector proteins that cause EC and SMC proliferation, inflammation and dysregulated apoptosis [58]. Upregulation of fibroblast growth factor 2 (FGF2) induced by shear stress in a lamb model of chronic heart disease was linked to cell proliferation [59,60]. Additionally, increased levels of FGF2 were shown in EC of IPAH patients contributing to medial remodeling and disease progression [61]. Forkhead box transcription factor 1 (FoxO1) was recently shown to be partly inactivated in PH, thereby promoting pro-proliferative and inflammatory signaling [62]. Unfortunately, no link to increased shear stress has been made in this report, but high shear stress has been shown to increase FoxO1 phosphorylation (thus suppressing function) in human umbilical vein endothelial cells (HUVECs). Additional factors such as angiopoietin-1 (Ang-1) and VEGF, both reported to be up-regulated due to shear stress in PAH, are involved in FoxO1 phosphorylation [63]. Reconciling paradigms in PAH 21

4. Evasion of tumor suppressor function, apoptosis and replicative immortality Cancer cells exhibit powerful programs that inhibit cell proliferation [21]. Many of these programs depend on the actions of tumor suppressor genes. The majority of anti-proliferative signals are funneled through the tumor suppressors retinoblastoma protein (Rb) and p53 [22]. Inactivation of p53 promotes PH development and activation via Nutlin-3 can attenuate 2 and reverse experimental PH [64–66]. In bovine aortic ECs, p53 was shown to be regulated by shear stress in a time dependent manner and related to the magnitude of shear stress [67].

Rb is a known tumor suppressor involved in cell progression from the G1 to S state and is regulated by cyclin dependent kinases, cyclin complexes [68]. The Rb signaling circuit, guided by TGF-ß can be disrupted by loss of responsiveness through down-regulation or mutation of TGF-ß receptors [15]. Nishimura and colleagues found decreased protein expression of Rb in the MCT+PNx model of PH, which was restored by Simvastatin [69]. Activation of Erk1/2 by shear stress has been shown to keep Rb in a non-active phosphorylated state thereby promoting proliferation of osteoblasts. Erk1/2 phosphorylation is increased in PAH patients and PH animal models, implying that such a link could exist [70–72]. NAPDH-oxidase 4 (NOX- 4) can mediate TGF-ß1 induced Rb phosphorylation and was shown to be induced by high flow [44,73,74]. In addition to Rb, other regulators may hamper tumor suppressor function in PAH. These include altered expression of peroxisome proliferator-activated receptor gamma (PPARγ), CAV-1 and superoxide dismutase 2 (SOD2). PPARγ levels are decreased in the angio- obliterated lesions in patients with PAH and it has been suggested that loss of PPARγ can decrease tumor suppressor function in PAH ECs [75]. Reduction of expression of PPARγ has also been found in the SuHx model and lamb-shunt models, whereas treatment of mice with a PPARγ agonist prevented development of PH [76,77].

Further evidence of loss of tumor suppression function is the downregulation of CAV-1 in ECs under high shear conditions. A decrease in CAV-1 and 2 expression was also found in the plexiform lesions from PAH patients [18]. In addition to its role in tumor suppression, caveolin has also been implicated in regulation of proliferation and apoptosis by regulating Survivin [78,79]. Upregulation of Survivin (Birc5) was shown in sheared ovine PAECs after 3 days [59]. Among the functions of Survivin are inhibition of caspase-dependent apoptosis and caspase- independent cell death. Loss of CAV-1 has been reported to be associated with activation of signal transducer and activator of transcription 3 (STAT3), which is persistently activated in ECs from PAH patients [80]. Besides Survivin, BCL-2 and BCL-Xl (classified as oncogenes) are downstream effectors of STAT3 [81]. Administration of cell-permeable CAV-1 prevented 22

development of PH in the MCT rat model and SOD2 possibly also tumor suppressor, was found to be lowered in PAECs from lambs with increased PBF [82–84]. Archer et al. described a similar result in PASMC from fawn hooded rats with the addition that correction of SOD2 levels had a therapeutic effect [85].

5. Shear stimulated angiogenesis and growth factor signaling in PH In cancers, neovascularization is driven by angiogenesis due to activation of the “angiogenic switch” [22]. Disordered or “misguided” pro-angiogenic signaling is a key process in severe PAH and potent growth factors, such as VEGF, FGF, platelet derived growth factor (PDGF), TGF-ß, Angiopoietins and BMPs, contribute [59,60,86–89].

Increased levels of VEGF and VEGFR-2 are found in the plexiform lesions of PAH patients or patients with congenital heart disease [90,91]. Li et al. showed increased VEGF expression in PAEC under various shear stress conditions, which was mentioned as being associated with angiogenesis [92]. Paradoxically, blocking VEGFR (combined with a second hit) causes PAH in the SuHx model, which has been described as the “angiogenesis paradox” [93]. FGF2 increases due to shear and FGF2 levels are increased in the lungs from PAH patients contributing to the progression of PAH [60]. PDGFR-B transcription in PAEC is increased due to mechanical stretch, which was confirmed in the MCT model [94]. Additionally, Perros et al. showed that PDGF and PDGFR mRNA is over-expressed in the pulmonary arteries of PAH patients [95]. A fluid shear stress responsive element for PDGF-B has been identified in BAECs, but to date this has not been confirmed for the pulmonary endothelium [24]. Increased mRNA and protein levels of angiopoietin-2 (Ang-2) in the serum of PAH patients are linked to disease progression, EC damage and SMC proliferation [96]. Blocking of the angiotensin II receptor I (ATR1) via Losartan was shown to be beneficial in experimental PH, due to inhibition of the renin-angiogiotension-aldosteron (RAAS) system [97]. Using systemic ECs, ATR1 was also shown to be a shear stress dependent activator of ERK1/2 in ECs [98].

6. Invasion, migration and metastasis A critical hallmark of cancer is the formation of new tumors in other organs by primary cells via invasion, this process is called metastasis. The newly formed metastases arise as a mixture of cancer cells and benign cells of the host tissues [21,22]. Actual metastasis and/or invasion of cells have not been reported in the context of PAH. Reconciling paradigms in PAH 23

Endothelial progenitor cells (EPC) are specialized cells that are implied in vascular repair, specifically re-establishing the ECs monolayer after damage. EPC differentiation into mature ECs can be achieved by laminar shear stress, and EPCs are linked to cancer metastasis [99,100]. The involvement of EPCs in PAH has been proposed in the early 1990s and evidence is accumulating on the participation of EPCs in PH and Eisenmenger patients [101–105]. 2 While discussed here in the context of invasion, migration and metastasis, EPCs are also postulated to drive angio-proliferative PAH[106]. Reports have been made on the effects of shear stress on EPC proliferation and differentiation, speculating that links may exist, but to date none have been investigated or reported [107,108]. Besides EPCs, other cell types involved in metastasis and invasion such as pericytes and fibrocytes have been linked to PAH, but not to shear stress [109–112]. Endothelial-to-mesenchymal transition (EndoMT) likely a key process leading to pulmonary vascular remodeling is stimulated by TGF-β signaling, but inhibited by BMPR2 signaling. Recent studies have shown data in support of EndoMT in PAH and inhibition of EndoMT appears to be beneficial in animal models [113–115]. EndoMT is modulated by shear stress, in vitro in the systemic circulation, in an ERK5 dependent manner [116]. In this context pericytes are of interest as they are located specifically around capillaries, where their coverage increases in human PAH and give rise to smooth muscle-like cells and directly contribute to the vascular remodeling of distal pulmonary arteries [109]

7. Reprogramming of energy metabolism In cancer cells the reprogramming of energy metabolism is mainly due to upregulation of GLUT1, the receptor responsible for the uptake of glucose into the cytoplasm [117,118]. Otto Warburg observed that neoplastic cells change their energy metabolism under aerobic conditions from a mitochondria-dependent metabolism to glycolysis even when there is sufficient oxygen. This phenomenon is known as the Warburg effect and coincides with mitochondrial fragmentation, which are observed in cancer [119–122]. Evidence for deregulated mitochondrial metabolism in PAH has been found in both the lung and right ventricle (RV) [123–125]. PET scans using the glucose analogue tracer [18F] fluoro-deoxy-D-glucose showed a higher lung standardized uptake of IPAH patients and the MCT-rat model compared to controls, although results in PAH patients are mixed [126].

Although direct effects of shear stress effects on cell metabolism have been reported, few direct links have been established between metabolism and PAH [127,128]. Mitochondria and carnitine homeostasis were found to be deregulated in a lamb model for increased pulmonary blood and associated with decreased mitochondrial function and disrupted bioenergetics 24

[129,130]. This deregulation was associated with asymmetrical dimethylarginine mediated redistribution of eNOS to the mitochondria. Dimethylarginine deregulation has been observed in hypoxia-induced PH and patients with high pulmonary blood flow due to left-to-right shunt [131,132]. A link between CAV-1 and metabolic switching has been described in a CAV-1 null mouse model, where CAV-1 was suggested to directly affect mitochondrial oxidative metabolism [133]. An additional role for abnormal shear stress affecting EC metabolism via Krüppel-like-factor 2 (KLF2) has also been suggested [134,135]. Although the role of KLF2 in PAH is unclear, it has been shown to be affected in several animal models of PH [136]. Also, the recent ‘metabolic theory’ of PAH defines the metabolic alterations as a consequence of the phenotypic, cancer-like cellular changes defining mitochondria as common integrators and thereby interesting treatment targets in the pathogenesis of PAH [137]

8. Tumor-promoting inflammation Besides the established role of the immune system to permanently recognize and eliminate the vast majority of primary cancer cells that form tumors, new evidence shows a contributing role of the immune system to the development as well as maintenance of cancer [138,139]. The role of inflammation in PAH, both in vascular remodeling and disease susceptibility in context of PAH is well acknowledged, but not well understood [2,140].

While direct links between shear stress and inflammation are few in context of PH, it is well accepted that endothelial damage, due to altered shear stress, initiates an inflammatory response within the pulmonary vasculature [141]. Laminar shear stress is protective in the systemic circulation as lesions are predominantly found at areas where PBF is abnormal, such as curvatures and branch points. Shear directly activates shear-responsive genes, among which are nuclear factor-kappa B (NFκB), an important inflammation related transcription factor [24,142]. Further, it is known that PBF can influence leukocyte adhesion in the pulmonary vasculature [143]. Additionally, the occurrence of turbulent flow at bifurcations is suggested to be involved in formation of characteristic plexiform lesions found distally of bifurcations and branching points [7]. PBF affects polymorphonuclear leukocytes accumulation in dog lungs [145]. With regard to the systemic circulation the link between shear stress, increased flow and inflammation is a well-researched topic, these data may be translatable to the lung vasculature [142,146,147]. As anti-inflammatory treatments have yielded some success, this perspective might give additional opportunities to target disease development [2] Reconciling paradigms in PAH 25

9. Discussion and Perspectives

In this review we discussed that an altered PBF can account or synergize with the majority of cancer-like features observed in PAH (Figure 1). Current established therapies for PAH consist 2 of vasodilatory treatment, but cannot reverse the vascular changes. While more specific therapies aimed at targeting other aspects of the disease appear to be beneficial in animal models, the translation to the clinic has been rather unsuccessful so far [14,148]. The most promising treatment option Imatinib, successful in the treatment of acute myeloid leukemia, failed in PAH treatment trials [11]. While the therapeutic potential of TKIs are recognized, the possible side-effects are considerable [14,149–151].

Here we summarize the reported effects of an abnormal PBF flow and describe its role as an initiating and maintaining factor in pulmonary hypertension. Many different triggers can lead to an abnormal flow thereby causing vascular remodeling. Within a “two-hit hypothesis”, this can imply that one hit (e.g. high PBF/high shear) needs to coincide with an additional hit (e.g. a genetic predisposition, environmental factors) for PAH and characteristic lesions to develop [152]. Recently, shear by itself has been postulated to cause endothelial cell mutation, thereby introducing a second genetic hit [8,153]. Consequently, interventions aimed at restoring normal flow and appropriate vascular response to increased flow should be considered. Although not formally proven, PH can be alleviated after shunt repair surgery [154,155]. Also, two case reports described reversal of PAH in the native lung after single lung transplantation [156,157]. In the near future, it will be of importance to investigate the role of flow as a maintenance factor in PAH.

A subgroup of patients characterized by the occlusion of pulmonary vessels by largeor several smaller thrombi termed chronic-thromboembolic-pulmonary hypertension (CTEPH) might be able to provide valuable insight in the matter of shear stress. CTEPH is characterized by the occlusion of vessels by large or several smaller thrombi. Due to the reduction in number of patent vessels, flow is increased in the remaining non-occluded vessels, which causes remodeling of those vessels. In some cases CTEPH can be surgically alleviated via pulmonary endarterectomy (PEA) or less invasively via balloon pulmonary angioplasty (BPA) thus normalizing the blood flow [158,159]. It will be of interest to asses flow and shear dynamics after PEA over time. If increased flow is responsible for the maintenance of vascular abnormalities, a reversal of remodeling should be observable after PEA or BPA. Another 26

interesting perspective is the recent discovery of the involvement of microRNAs (miRs) in flow-dependent vascular remodeling and apoptosis [160]. Currently, several miRs have been linked to PH, but direct links with shear are few. The miR-21 is flow regulated and has been linked to PAH [161]. White et al. reported that the programmed cell death 4/Caspase-3 Axis was shown to be miR-21 responsive, and of particular interest in disease onset [162]. Also, interestingly, BMPR-II has been linked to miR-21 in various forms of cancer and miR-21 is down-regulated in IPAH patient lung tissue and serum [163,164]. Recently, miR-27b has also been linked to PAH secondary to CHD. Ma and colleagues linked upregulation of miR-27b with decreased NOTCH-1 signaling [165]. The miR-17-92 is known to be involved in BMPR-II expression and regulated via STAT3 and interleukin-6, this cluster has been shown to be shear stress inducible [160].

10. Summary and conclusion

For decades the concepts of the pathogenesis of severe PAH were solely based on vasoconstriction, the consequent increase in mechanical forces and their impact on pulmonary resistance vessels. However, increased blood pressures and flow alone left many pulmonary vascular diseases mechanistically unexplained. In particular the flow only models of chronic hypoxic vasoconstriction and pulmonary shunt could not satisfactory explain the phenomenon of pulmonary angio-obliterative disease, but only resemble parts of the vasculopathy.

Once the number of pulmonary arterioles has been reduced and the resistance to blood flow proximal to vascular obstructions has increased it is probable that shear stress contributes to the maintenance and progression of the lung vascular structural abnormalities. Thereby emphasizing that shear stress is one of the triggers leading to the evolution of a quasi- malignant vascular pathobiology.

Acknowledgements We acknowledge the support from the Dutch Lung Foundation (Longfonds, grant number 3.3.12.036) and the Netherlands CardioVascular Research Initiative: the Dutch Heart Foundation, Dutch Federation of University Medical Centers, the Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Sciences grant number 2012-08 awarded to the Phaedra consortium (www.phaedraresearch.nl). Reconciling paradigms in PAH 27

Figure 1: Schematic overview of types of abnormal flow and their effects on endothelial cell proliferation. While high flow can induce proliferation an additional “hit” is a prerequisite for development of intimal - or plexiform lesions. 28

References N.F. Voelkel, R.M. Tuder, Monoclonal endothelial cell proliferation is present in primary but not secondary pulmonary hypertension, J. Clin. Invest. 101 (1998) [1] N. Galiè, M. Humbert, J.-L. Vachiery, S. Gibbs, I. 927–934. doi:10.1172/JCI1910. Lang, A. Torbicki, et al., 2015 ESC/ERS Guidelines [10] P.R. Rai, C.D. Cool, J.A.C. King, T. Stevens, N. for the diagnosis and treatment of pulmonary Burns, R.A. Winn, et al., The Cancer Paradigm of hypertension, Eur. Respir. J. 46 (2015) 903–975. Severe Pulmonary Arterial Hypertension, Am. J. Respir. doi:10.1183/13993003.01032-2015. Crit. Care Med. 178 (2008) 558–564. doi:10.1164/ [2] M. Rabinovitch, C. Guignabert, M. Humbert, M.R. rccm.200709-1369PP. Nicolls, Inflammation and Immunity in the Pathogenesis [11]M.M. Hoeper, R.J. Barst, R.C. Bourge, J. Feldman, of Pulmonary Arterial Hypertension, Circ. Res. 115 A.E. Frost, N. Galié, et al., Imatinib Mesylate as Add- (2014) 165–175. doi:10.1161/CIRCRESAHA.113.301141. on Therapy for Pulmonary Arterial Hypertension [3] J. Klob, Endarteriitis pulmonalis deformans, Results of the Randomized IMPRES Study, Wochenblatt der kk Gesellschaft der Ärzte in Wien 21. Circulation. 127 (2013) 1128–1138. doi:10.1161/ (1865) 357–361. CIRCULATIONAHA.112.000765. [4] M. Humbert, O. Sitbon, A. Chaouat, M. Bertocchi, [12]M.Humbert,Impression,Sunset,Circulation. G. Habib, V. Gressin, et al., Survival in Patients With 127(2013)1098–1100.doi:10.1161/ Idiopathic, Familial, and Anorexigen-Associated CIRCULATIONAHA.113.001460. Pulmonary Arterial Hypertension in the Modern [13] C. Guignabert, L. Tu, M. Le Hiress, N. Ricard, C. Sattler, Management Era, Circulation. 122 (2010) 156–163. A. Seferian, et al., Pathogenesis of pulmonary arterial doi:10.1161/CIRCULATIONAHA.109.911818. hypertension: lessons from cancer, Eur. Respir. Rev. 22 [5] W.H. Organization, T. Strasser, S. Hatano, Primary (2013) 543–551. doi:10.1183/09059180.00007513. pulmonary hypertension : report on a WHO meeting, [14] L. Godinas, C. Guignabert, A. Seferian, F. Perros, Geneva, 15-17 October 1973, L’ Hypertension E. Bergot, Y. Sibille, et al., Tyrosine Kinase Inhibitors pulmonaire primitive : rapport d’une réunion de l’ OMS, in Pulmonary Arterial Hypertension: A Double-Edge Genève, 15-17 octobre 1973. (1975). http://www.who. Sword?, Semin. Respir. Crit. Care Med. 34 (2013) 714– int/iris/handle/10665/39094 (accessed December 8, 724. doi:10.1055/s-0033-1356494. 2015). [15] C.D. Cool, S.D. Groshong, J. Oakey, N.F. Voelkel, [6] C.A. Wagenvoort, Vasoconstriction and Medial Pulmonary hypertension: cellular and molecular Hypertrophy in Pulmonary Hypertension, Circulation. 22 mechanisms, Chest. 128 (2005) 565S–571S. (1960) 535–546. doi:10.1161/01.CIR.22.4.535. doi:10.1378/chest.128.6_suppl.565S. [7] C.D. Cool, J.S. Stewart, P. Werahera, G.J. Miller, [16] K. Dimopoulos, S.J. Wort, M.A. Gatzoulis, Pulmonary R.L. Williams, N.F. Voelkel, et al., Three-dimensional hypertension related to congenital heart disease: a call reconstruction of pulmonary arteries in plexiform for action, Eur. Heart J. 35 (2014) 691–700. doi:10.1093/ pulmonary hypertension using cell-specific markers. eurheartj/eht437. Evidence for a dynamic and heterogeneous process of [17]Y. Fan, A. Bergmann, Apoptosis-induced pulmonary endothelial cell growth, Am. J. Pathol. 155 compensatory proliferation. The Cell is dead. Long (1999) 411–419. doi:10.1016/S0002-9440(10)65137-1. live the Cell!, Trends Cell Biol. 18 (2008) 467–473. [8] M.A. Aldred, S.A. Comhair, M. Varella-Garcia, K. doi:10.1016/j.tcb.2008.08.001. Asosingh, W. Xu, G.P. Noon, et al., Somatic Chromosome [18]S. Sakao, L. Taraseviciene-Stewart, J.D. Lee, K. Wood, Abnormalities in the Lungs of Patients with Pulmonary C.D. Cool, N.F. Voelkel, Initial apoptosis is followed Arterial Hypertension, Am. J. Respir. Crit. Care Med. 182 by increased proliferation of apoptosis-resistant (2010) 1153–1160. doi:10.1164/rccm.201003-0491OC. endothelial cells, FASEB J. 19 (2005) 1178–1180. [9] S.D. Lee, K.R. Shroyer, N.E. Markham, C.D. Cool, doi:10.1096/fj.04-3261fje. Reconciling paradigms in PAH 29

[19] K. Okada, Y. Tanaka, M. Bernstein, W. Zhang, G.A. report, Surg. Gynecol. Obstet. 95 (1952) 213–219. Patterson, M.D. Botney, Pulmonary hemodynamics [30] P. Wood, The Eisenmenger Syndrome, Br. Med. J. 2 modify the rat pulmonary artery response to injury. A (1958) 755–762. neointimal model of pulmonary hypertension., Am. J. [31] P.E. Pool, J.H.K. Vogel, S.G. Blount Jr., Congenital Pathol. 151 (1997) 1019–1025. unilateral absence of a pulmonary artery: The [20] R. Szulcek, C.M. Happé, N. Rol, R.D. Fontijn, C. importance of flow in pulmonary hypertension, Am. 2 Dickhoff, K.J. Hartemink, et al., Delayed Microvascular J. Cardiol. 10 (1962) 706–732. doi:10.1016/0002- Shear-adaptation in Pulmonary Arterial Hypertension: 9149(62)90248-5. Role of PECAM-1 Cleavage, Am. J. Respir. Crit. Care Med. [32] T. Kulik, Pulmonary blood flow and pulmonary (2016). doi:10.1164/rccm.201506-1231OC. hypertension: Is the pulmonary circulation [21] D. Hanahan, R. Weinberg, The Hallmarks of flowophobic or flowophilic?, Pulm. Circ. 2 (2012) 327. Cancer, Cell. 100 (2000) 57–70. doi:10.1016/S0092- doi:10.4103/2045-8932.101644. 8674(00)81683-9. [33] N. Dereddy, J. Huang, M. Erb, S. Guzel, J.H. Wolk, [22] D. Hanahan, R.A. Weinberg, Hallmarks of Cancer: S.S. Sett, et al., Associated inflammation or increased The Next Generation, Cell. 144 (2011) 646–674. flow-mediated shear stress, but not pressure alone, doi:10.1016/j.cell.2011.02.013. disrupts endothelial caveolin-1 in infants with [23] R. Fåhræus, T. Lindqvist, The viscosity of the blood pulmonary hypertension, Pulm. Circ. 2 (2012) 492–500. in narrow capillary tubes, Am. J. Physiol. Content. 96 doi:10.4103/2045-8932.105038. (1931) 562–568. [34] J. Huang, Y. Liu, C. Yu, X. Lv, M. Du, Q. Wang, et al., [24] N. Resnick, T. Collins, W. Atkinson, D.T. Bonthron, Lung biopsy findings in previously inoperable patients C.F. Dewey, M.A. Gimbrone, Platelet-derived growth with severe pulmonary hypertension associated with factor B chain promoter contains a cis-acting fluid shear- congenital heart disease, Int. J. Cardiol. 151 (2011) 76– stress-responsive element., Proc. Natl. Acad. Sci. U. S. A. 83. doi:10.1016/j.ijcard.2010.04.094. 90 (1993) 4591–4595. [35] K. Grünberg, W.J. Mooi, A practical approach to [25] M.A. Gimbrone, P. Lelkes, Mechanical Forces and vascular pathology in pulmonary hypertension, Diagn. the Endothelium, CRC Press, 2003. Histopathol. 19 (2013) 298–310. [26] S. Chatterjee, A.-B. Al-Mehdi, I. Levitan, T. Stevens, [36] T.D.L. Cras, L.G. Fernandez, P.A. Pastura, V.E. A.B. Fisher, Shear stress increases expression of a Laubach, Vascular growth and remodeling in KATP channel in rat and bovine pulmonary vascular compensatory lung growth following right lobectomy, endothelial cells, Am. J. Physiol. - Cell Physiol. 285 (2003) J. Appl. Physiol. 98 (2005) 1140–1148. doi:10.1152/ C959–C967. doi:10.1152/ajpcell.00511.2002. japplphysiol.00479.2004. [27]K.G. Birukov, A.A. Birukova, S.M. Dudek, A.D. [37] I. Adatia, S.S. Kothari, J.A. Feinstein, Pulmonary Verin, M.T. Crow, X. Zhan, et al., Shear Stress-Mediated hypertension associated with congenital heart disease: Cytoskeletal Remodeling and Cortactin Translocation in Pulmonary vascular disease: the global perspective, Pulmonary Endothelial Cells, Am. J. Respir. Cell Mol. Biol. Chest. 137 (2010) 52S–61S. doi:10.1378/chest.09-2861. 26 (2002) 453–464. [38] M.G.J. Duffels, P.M. Engelfriet, R.M.F. Berger, R.L.E. [28] W.C. Aird, Phenotypic Heterogeneity of the van Loon, E. Hoendermis, J.W.J. Vriend, et al., Pulmonary Endothelium I. Structure, Function, and Mechanisms, arterial hypertension in congenital heart disease: Circ. Res. 100 (2007) 158–173. doi:10.1161/01. An epidemiologic perspective from a Dutch registry, RES.0000255691.76142.4a. Int. J. Cardiol. 120 (2007) 198–204. doi:10.1016/j. [29] W.H. Muller, J.F. Danimann, The treatment of certain ijcard.2006.09.017. congenital malformations of the heart by the creation of [39] A.G. Knudson, Hereditary cancer: Two hits revisited, pulmonic stenosis to reduce pulmonary hypertension J. Cancer Res. Clin. Oncol. 122 (1996) 135–140. and excessive pulmonary blood flow; a preliminary doi:10.1007/BF01366952. 30

[40] A.G. Knudson, Mutation and cancer: statistical vph.2010.03.005. study of retinoblastoma, Proc. Natl. Acad. Sci. U. S. A. [48] R.J. White, D.F. Meoli, R.F. Swarthout, D.Y. Kallop, 68 (1971) 820–823. I.I. Galaria, J.L. Harvey, et al., Plexiform-like lesions [41] N.F. Voelkel, C. Cool, S.D. Lee, L. Wright, M.W. and increased tissue factor expression in a rat model Geraci, R.M. Tuder, Primary Pulmonary Hypertension of severe pulmonary arterial hypertension, Am. J. Between Inflammation and Cancer, CHEST J. 114 Physiol. - Lung Cell. Mol. Physiol. 293 (2007) L583–L590. (1998) 225S–230S. doi:10.1378/chest.114.3_ doi:10.1152/ajplung.00321.2006. Supplement.225S. [49] R.O.D. Achcar, Y. Demura, P.R. Rai, L. Taraseviciene- [42] L. Taraseviciene-Stewart, Y. Kasahara, L. Alger, P. Stewart, M. Kasper, N.F. Voelkel, et al., Loss of caveolin Hirth, G.M. Mahon, J. Waltenberger, et al., Inhibition and heme oxygenase expression in severe pulmonary of the VEGF receptor 2 combined with chronic hypoxia hypertension, Chest. 129 (2006) 696–705. doi:10.1378/ causes cell death-dependent pulmonary endothelial cell chest.129.3.696. proliferation and severe pulmonary hypertension, FASEB [50] H.H. Patel, S. Zhang, F. Murray, R.Y.S. Suda, B.P. J. 15 (2001) 427–438. doi:10.1096/fj.00-0343com. Head, U. Yokoyama, et al., Increased smooth muscle [43] K. Abe, M. Toba, A. Alzoubi, M. Ito, K.A. Fagan, cell expression of caveolin-1 and caveolae contribute C.D. Cool, et al., Formation of Plexiform Lesions in to the pathophysiology of idiopathic pulmonary Experimental Severe Pulmonary Arterial Hypertension, arterial hypertension, FASEB J. 21 (2007) 2970–2979. Circulation. 121 (2010) 2747–2754. doi:10.1161/ doi:10.1096/fj.07-8424com. CIRCULATIONAHA.109.927681. [51] F.K. Kuhr, K.A. Smith, M.Y. Song, I. Levitan, J.X.-J. Yuan, [44] P. Dorfmüller, M.-C. Chaumais, M. Giannakouli, I. New mechanisms of pulmonary arterial hypertension: Durand-Gasselin, N. Raymond, E. Fadel, et al., Increased role of Ca2+ signaling, Am. J. Physiol. - Heart Circ. oxidative stress and severe arterial remodeling induced Physiol. 302 (2012) H1546–H1562. doi:10.1152/ by permanent high-flow challenge in experimental ajpheart.00944.2011. pulmonary hypertension, Respir. Res. 12 (2011) 119. [52] E.D. Austin, L. Ma, C. LeDuc, E.B. Rosenzweig, A. doi:10.1186/1465-9921-12-119. Borczuk, J.A. Phillips, et al., Whole Exome Sequencing [45] M.G. Dickinson, B. Bartelds, G. Molema, M.A. to Identify a Novel Gene (Caveolin-1) Associated Borgdorff, B. Boersma, J. Takens, et al., Egr-1 Expression With Human Pulmonary Arterial HypertensionClinical During Neointimal Development in Flow-Associated Perspective, Circ. Cardiovasc. Genet. 5 (2012) 336–343. Pulmonary Hypertension, Am. J. Pathol. 179 (2011) doi:10.1161/CIRCGENETICS.111.961888. 2199–2209. doi:10.1016/j.ajpath.2011.07.030. [53] F.R. Bakhshi, V. Shinin, M. Mao, Z. Chen, S. Comhair, [46] Chris M. Happe, Michiel A. De Raaf, Ingrid Schalij, S. Erzurum, et al., P67: Role of oxidative stress- Denielli Bos, Anton Vonk-Noordegraaf, Frances S. induced caveolin-1 S-nitrosylation, ubiquitination, De Man, et al., Pneumonectomy Combined With and degradation in endothelial cell dedifferentiation SU5416 Induces Severe Angio-Obliterative Pulmonary and idiopathic pulmonary arterial hypertension, Nitric Hypertension In Rats, in: B58 Exp. MODELS Pulm. Oxide. 31, Supplement 1 (2013) S42. doi:10.1016/j. Hypertens. II, American Thoracic Society, 2014: niox.2013.02.069. pp. A3336–A3336. http://www.atsjournals.org/ [54] J.A. Engelman, X.L. Zhang, B. Razani, R.G. Pestell, doi/abs/10.1164/ajrccm-conference.2014.189.1_ M.P. Lisanti, p42/44 MAP kinase-dependent and MeetingAbstracts.A3336 (accessed June 9, 2015). -independent signaling pathways regulate caveolin-1 [47] S. Sharma, S. Kumar, D.A. Wiseman, S. Kallarackal, gene expression. Activation of Ras-MAP kinase and S. Ponnala, M. Elgaish, et al., Perinatal changes in protein kinase a signaling cascades transcriptionally superoxide generation in the ovine lung: Alterations down-regulates caveolin-1 promoter activity, J. Biol. associated with increased pulmonary blood flow, Chem. 274 (1999) 32333–32341. Vascul. Pharmacol. 53 (2010) 38–52. doi:10.1016/j. [55] S. Kumar, P.E. Oishi, R. Rafikov, S. Aggarwal, Y. Hou, Reconciling paradigms in PAH 31

S.A. Datar, et al., Tezosentan increases nitric oxide stress, FEBS Lett. 581 (2007) 673–680. doi:10.1016/j. signaling via enhanced hydrogen peroxide generation febslet.2007.01.028. in lambs with surgically induced acute increases in [64] S. Mizuno, H.J. Bogaard, D. Kraskauskas, A. pulmonary blood flow, J. Cell. Biochem. 114 (2013) 435– Alhussaini, J. Gomez-Arroyo, N.F. Voelkel, et al., p53 447. doi:10.1002/jcb.24383. Gene deficiency promotes hypoxia-induced pulmonary [56] L. Xia, F. Ding, J.-H. Zhu, G.-S. Fu, Resveratrol hypertension and vascular remodeling in mice, Am. J. 2 attenuates apoptosis of pulmonary microvascular Physiol. - Lung Cell. Mol. Physiol. 300 (2011) L753–L761. endothelial cells induced by high shear stress and doi:10.1152/ajplung.00286.2010. proinflammatory factors, Hum. Cell. 24 (2011) 127–133. [65] S. Jacquin, V. Rincheval, B. Mignotte, S. Richard, doi:10.1007/s13577-011-0031-2. M. Humbert, O. Mercier, et al., Inactivation of p53 [57] N. Nickel, D. Jonigk, T. Kempf, C.L. Bockmeyer, L. Is Sufficient to Induce Development of Pulmonary Maegel, J. Rische, et al., GDF-15 is abundantly expressed Hypertension in Rats, PloS One. 10 (2015). http://www. in plexiform lesions in patients with pulmonary arterial ncbi.nlm.nih.gov/pmc/articles/PMC4488287/ (accessed hypertension and affects proliferation and apoptosis of July 7, 2015). pulmonary endothelial cells, Respir. Res. 12 (2011) 62. [66] N. Mouraret, E. Marcos, S. Abid, G. Gary-Bobo, doi:10.1186/1465-9921-12-62. M. Saker, A. Houssaini, et al., Activation of Lung p53 [58] D.E. van der Feen, M.G. Dickinson, B. Bartelds, M.A.J. by Nutlin-3a Prevents and Reverses Experimental Borgdorff, H. Sietsma, M. Lévy, et al., Egr-1 identifies Pulmonary Hypertension, Circulation. 127 (2013) 1664– neointimal remodeling and relates to progression in 1676. doi:10.1161/CIRCULATIONAHA.113.002434. human pulmonary arterial hypertension, J. Heart Lung [67] K. Lin, P.-P. Hsu, B.P. Chen, S. Yuan, S. Usami, J.Y.-J. Transplant. 0 (n.d.). doi:10.1016/j.healun.2015.12.004. Shyy, et al., Molecular mechanism of endothelial growth [59] J. Tian, S. Fratz, Y. Hou, Q. Lu, A. Görlach, J. Hess, et arrest by laminar shear stress, Proc. Natl. Acad. Sci. 97 al., Delineating the angiogenic gene expression profile (2000) 9385–9389. doi:10.1073/pnas.170282597. before pulmonary vascular remodeling in a lamb model [68] G. Marsboom, S.L. Archer, Pathways of Proliferation: of congenital heart disease, Physiol. Genomics. 43 (2011) New Targets to Inhibit the Growth of Vascular Smooth 87–98. doi:10.1152/physiolgenomics.00135.2010. Muscle Cells, Circ. Res. 103 (2008) 1047–1049. [60] M. Izikki, C. Guignabert, E. Fadel, M. Humbert, L. Tu, doi:10.1161/CIRCRESAHA.108.188003. P. Zadigue, et al., Endothelial-derived FGF2 contributes [69] T. Nishimura, L.T. Vaszar, J.L. Faul, G. Zhao, G.J. to the progression of pulmonary hypertension in Berry, L. Shi, et al., Simvastatin Rescues Rats From Fatal humans and rodents, J. Clin. Invest. 119 (2009) 512– Pulmonary Hypertension by Inducing Apoptosis of 523. doi:10.1172/JCI35070. Neointimal Smooth Muscle Cells, Circulation. 108 (2003) [61] L. Tu, L. Dewachter, B. Gore, E. Fadel, P. Dartevelle, G. 1640–1645. doi:10.1161/01.CIR.0000087592.47401.37. Simonneau, et al., Autocrine Fibroblast Growth Factor-2 [70] T. Zarkowska, S. Mittnacht, Differential Signaling Contributes to Altered Endothelial Phenotype Phosphorylation of the Retinoblastoma Protein by G1/S in Pulmonary Hypertension, Am. J. Respir. Cell Mol. Biol. Cyclin-dependent Kinases, J. Biol. Chem. 272 (1997) 45 (2011) 311–322. doi:10.1165/rcmb.2010-0317OC. 12738–12746. doi:10.1074/jbc.272.19.12738. [62] R. Savai, H.M. Al-Tamari, D. Sedding, B. Kojonazarov, [71] G.-L. Jiang, C.R. White, H.Y. Stevens, J.A. Frangos, C. Muecke, R. Teske, et al., Pro-proliferative and Temporal gradients in shear stimulate osteoblastic inflammatory signaling converge on FoxO1 transcription proliferation via ERK1/2 and retinoblastoma protein, factor in pulmonary hypertension, Nat. Med. 20 (2014) Am. J. Physiol. - Endocrinol. Metab. 283 (2002) E383– 1289–1300. doi:10.1038/nm.3695. E389. doi:10.1152/ajpendo.00547.2001. [63] S. Chlench, N. Mecha Disassa, M. Hohberg, C. [72] M.T. Nasim, T. Ogo, H.M. Chowdhury, L. Zhao, C. Hoffmann, T. Pohlkamp, G. Beyer, et al., Regulation of Chen, C. Rhodes, et al., BMPR-II deficiency elicits pro- Foxo-1 and the angiopoietin-2/Tie2 system by shear proliferative and anti-apoptotic responses through the 32

activation of TGFβ-TAK1-MAPK pathways in PAH, Hum. ajplung.00428.2006. Mol. Genet. 21 (2012) 2548–2558. doi:10.1093/hmg/ [81] R. Mathew, Cell-Specific Dual Role of Caveolin-1 dds073. in Pulmonary Hypertension, Pulm. Med. 2011 (2011) [73] A. Sturrock, T.P. Huecksteadt, K. Norman, K. Sanders, 1–12. doi:10.1155/2011/573432. T.M. Murphy, P. Chitano, et al., Nox4 mediates TGF- [82] X. Sun, S. Sharma, S. Fratz, S. Kumar, R. Rafikov, β1-induced retinoblastoma protein phosphorylation, S. Aggarwal, et al., Disruption of Endothelial Cell proliferation, and hypertrophy in human airway smooth Mitochondrial Bioenergetics in Lambs with Increased muscle cells, Am. J. Physiol. - Lung Cell. Mol. Physiol. 292 Pulmonary Blood Flow, Antioxid. Redox Signal. 18 (2013) (2007) L1543–L1555. doi:10.1152/ajplung.00430.2006. 1739–1752. doi:10.1089/ars.2012.4806. [74] M. Mittal, M. Roth, P. Konig, S. Hofmann, E. Dony, [83] A. Bravard, L. Sabatier, F. Hoffschir, M. Ricoul, C. P. Goyal, et al., Hypoxia-Dependent Regulation of Luccioni, B. Dutrillaux, SOD2: A new type of tumor- Nonphagocytic NADPH Oxidase Subunit NOX4 in the suppressor gene?, Int. J. Cancer. 51 (1992) 476–480. Pulmonary Vasculature, Circ. Res. 101 (2007) 258–267. doi:10.1002/ijc.2910510323. doi:10.1161/CIRCRESAHA.107.148015. [84] J.-F. Jasmin, I. Mercier, J. Dupuis, H.B. Tanowitz, M.P. [75] S. Ameshima, H. Golpon, C.D. Cool, D. Chan, R.W. Lisanti, Short-Term Administration of a Cell-Permeable Vandivier, S.J. Gardai, et al., Peroxisome Proliferator- Caveolin-1 Peptide Prevents the Development of Activated Receptor Gamma (PPARγ) Expression Is Monocrotaline-Induced Pulmonary Hypertension and Decreased in Pulmonary Hypertension and Affects Right Ventricular Hypertrophy, Circulation. 114 (2006) Endothelial Cell Growth, Circ. Res. 92 (2003) 1162– 912–920. doi:10.1161/CIRCULATIONAHA.106.634709. 1169. doi:10.1161/01.RES.0000073585.50092.14. [85] S.L. Archer, G. Marsboom, G.H. Kim, H.J. Zhang, [76] J. Tian, A. Smith, J. Nechtman, R. Podolsky, S. P.T. Toth, E.C. Svensson, et al., Epigenetic Attenuation Aggarwal, C. Snead, et al., Effect of PPARγ inhibition of Mitochondrial Superoxide Dismutase 2 in on pulmonary endothelial cell gene expression: Pulmonary Arterial Hypertension A Basis for Excessive gene profiling in pulmonary hypertension, Cell Proliferation and a New Therapeutic Target, Physiol. Genomics. 40 (2009) 48–60. doi:10.1152/ Circulation. 121 (2010) 2661–2671. doi:10.1161/ physiolgenomics.00094.2009. CIRCULATIONAHA.109.916098. [77] G. Hansmann, R.A. Wagner, S. Schellong, V.A. [86] A. Al-Husseini, D. Kraskauskas, E. Mezzaroma, A. de J. Perez, T. Urashima, L. Wang, et al., Pulmonary Nordio, D. Farkas, J.I. Drake, et al., Vascular endothelial arterial hypertension is linked to insulin resistance and growth factor receptor 3 signaling contributes to reversed by peroxisome proliferator-activated receptor- angioobliterative pulmonary hypertension, Pulm. Circ. 5 gamma activation, Circulation. 115 (2007) 1275–1284. (2015) 101–116. doi:10.1086/679704. doi:10.1161/CIRCULATIONAHA.106.663120. [87] M. Humbert, G. Monti, M. Fartoukh, A. Magnan, [78] T.M. Williams, M.P. Lisanti, The caveolin proteins, F. Brenot, B. Rain, et al., Platelet-derived growth Genome Biol. 5 (2004) 214–214. factor expression in primary pulmonary hypertension: [79] V.A. Torres, J.C. Tapia, D.A. Rodríguez, M. Párraga, comparison of HIV seropositive and HIV seronegative P. Lisboa, M. Montoya, et al., Caveolin-1 controls cell patients, Eur. Respir. J. 11 (1998) 554–559. proliferation and cell death by suppressing expression [88] J. Zhou, P.-L. Lee, C.-I. Lee, S.-Y. Wei, S.H. Lim, T.-E. of the inhibitor of apoptosis protein survivin, J. Cell Sci. Lin, et al., BMP receptor-integrin interaction mediates 119 (2006) 1812–1823. doi:10.1242/jcs.02894. responses of vascular endothelial Smad1/5 and [80] F.A. Masri, W. Xu, S.A.A. Comhair, K. Asosingh, M. proliferation to disturbed flow, J. Thromb. Haemost. 11 Koo, A. Vasanji, et al., Hyperproliferative apoptosis- (2013) 741–755. doi:10.1111/jth.12159. resistant endothelial cells in idiopathic pulmonary [89] L. Long, M.L. Ormiston, X. Yang, M. Southwood, arterial hypertension, Am. J. Physiol. - Lung Cell. S. Gräf, R.D. Machado, et al., Selective enhancement Mol. Physiol. 293 (2007) L548–L554. doi:10.1152/ of endothelial BMPR-II with BMP9 reverses pulmonary Reconciling paradigms in PAH 33

arterial hypertension, Nat. Med. (2015). doi:10.1038/ 780–789. doi:10.1164/rccm.201203-0411OC. nm.3877. [98] B. Ramkhelawon, D. Rivas, S. Lehoux, Shear stress [90] R.M. Tuder, M. Chacon, L. Alger, J. Wang, L. activates extracellular signal-regulated kinase 1/2 via Taraseviciene-Stewart, Y. Kasahara, et al., Expression of the angiotensin II type 1 receptor, FASEB J. Off. Publ. Fed. angiogenesis-related molecules in plexiform lesions in Am. Soc. Exp. Biol. 27 (2013) 3008–3016. doi:10.1096/ severe pulmonary hypertension: evidence for a process fj.12-222299. 2 of disordered angiogenesis, J. Pathol. 195 (2001) 367– [99] D. Gao, D.J. Nolan, A.S. Mellick, K. Bambino, 374. K. McDonnell, V. Mittal, Endothelial Progenitor [91] R. Geiger, R.M. Berger, J. Hess, A.J. Bogers, H.S. Cells Control the Angiogenic Switch in Mouse Lung Sharma, W.J. Mooi, Enhanced expression of vascular Metastasis, Science. 319 (2008) 195–198. doi:10.1126/ endothelial growth factor in pulmonary plexogenic science.1150224. arteriopathy due to congenital heart disease, J. [100] M. Cheng, X. Guan, H. Li, X. Cui, X. Zhang, X. Li, Pathol. 191 (2000) 202–207. doi:10.1002/(SICI)1096- et al., Shear Stress Regulates Late EPC Differentiation 9896(200006)191:2<202::AID-PATH608>3.0.CO;2-D. via Mechanosensitive Molecule-Mediated Cytoskeletal [92] M. Li, K.R. Stenmark, R. Shandas, W. Tan, Rearrangement, PLoS ONE. 8 (2013) e67675. Effects of Pathological Flow on Pulmonary Artery doi:10.1371/journal.pone.0067675. Endothelial Production of Vasoactive Mediators and [101] R.M. Tuder, B. Groves, D.B. Badesch, N.F. Voelkel, Growth Factors, J. Vasc. Res. 46 (2009) 561–571. Exuberant endothelial cell growth and elements doi:10.1159/000226224. of inflammation are present in plexiform lesions of [93] N.F. Voelkel, J. Gomez-Arroyo, The Role of Vascular pulmonary hypertension., Am. J. Pathol. 144 (1994) Endothelial Growth Factor in Pulmonary Arterial 275–285. Hypertension. The Angiogenesis Paradox, Am. J. [102] T.M. Bull, H. Golpon, R.P. Hebbel, A. Solovey, C.D. Respir. Cell Mol. Biol. 51 (2014) 474–484. doi:10.1165/ Cool, R.M. Tuder, et al., Circulating endothelial cells in rcmb.2014-0045TR. pulmonary hypertension, Thromb. Haemost. 90 (2003) [94] Y. Tanabe, M. Saito, A. Ueno, M. Nakamura, K. 698–703. doi:10.1267/THRO03040698. Takeishi, K. Nakayama, Mechanical stretch augments [103] D. Farkas, D. Kraskauskas, J.I. Drake, A.A. PDGF receptor beta expression and protein tyrosine Alhussaini, V. Kraskauskiene, H.J. Bogaard, et al., CXCR4 phosphorylation in pulmonary artery tissue and smooth Inhibition Ameliorates Severe Obliterative Pulmonary muscle cells, Mol. Cell. Biochem. 215 (2000) 103–113. Hypertension and Accumulation of C-Kit+ Cells in Rats, [95] F. Perros, D. Montani, P. Dorfmüller, I. Durand- PLoS ONE. 9 (2014) e89810. doi:10.1371/journal. Gasselin, C. Tcherakian, J.L. Pavec, et al., Platelet- pone.0089810. derived Growth Factor Expression and Function in [104] D. Montani, F. Perros, N. Gambaryan, B. Idiopathic Pulmonary Arterial Hypertension, Am. J. Girerd, P. Dorfmuller, L.C. Price, et al., C-kit-positive Respir. Crit. Care Med. 178 (2008) 81–88. doi:10.1164/ cells accumulate in remodeled vessels of idiopathic rccm.200707-1037OC. pulmonary arterial hypertension, Am. J. Respir. Crit. Care [96] P. Kümpers, N. Nickel, A. Lukasz, H. Golpon, Med. 184 (2011) 116–123. doi:10.1164/rccm.201006- V. Westerkamp, K.M. Olsson, et al., Circulating 0905OC. angiopoietins in idiopathic pulmonary arterial [105] G.-P. Diller, S. van Eijl, D.O. Okonko, L.S. Howard, hypertension, Eur. Heart J. 31 (2010) 2291–2300. O. Ali, T. Thum, et al., Circulating Endothelial Progenitor doi:10.1093/eurheartj/ehq226. Cells in Patients With Eisenmenger Syndrome [97] F.S. de Man, L. Tu, M.L. Handoko, S. Rain, G. Ruiter, and Idiopathic Pulmonary Arterial Hypertension, C. François, et al., Dysregulated renin-angiotensin- Circulation. 117 (2008) 3020–3030. doi:10.1161/ aldosterone system contributes to pulmonary arterial CIRCULATIONAHA.108.769646. hypertension, Am. J. Respir. Crit. Care Med. 186 (2012) [106] Q. Felty, S. Sakao, N.F. Voelkel, Pulmonary Arterial 34

Hypertension: A Stem Cell Hypothesis, in: A. Firth, J.X.-J. Hautefort, C. Péchoux, H.J. Bogaard, et al., Endothelial- Yuan (Eds.), Lung Stem Cells Epithelium Vasc., Springer to-Mesenchymal Transition in Pulmonary Hypertension, International Publishing, Cham, 2015: pp. 289–306. Circulation. 131 (2015) 1006–1018. doi:10.1161/ http://link.springer.com/10.1007/978-3-319-16232- CIRCULATIONAHA.114.008750. 4_16 (accessed October 14, 2015). [116] J.-R.A.J. Moonen, E.S. Lee, M. Schmidt, M. [107] K. Yamamoto, T. Takahashi, T. Asahara, N. Ohura, Maleszewska, J.A. Koerts, L.A. Brouwer, et al., T. Sokabe, A. Kamiya, et al., Proliferation, differentiation, Endothelial-to-mesenchymal transition contributes to and tube formation by endothelial progenitor cells fibro-proliferative vascular disease and is modulated in response to shear stress, J. Appl. Physiol. 95 (2003) by fluid shear stress, Cardiovasc. Res. (2015) cvv175. 2081–2088. doi:10.1152/japplphysiol.00232.2003. doi:10.1093/cvr/cvv175. [108] X.-B. Gong, Y.-Q. Li, Q.-C. Gao, B.-B. Cheng, B.-R. [117] R.G. Jones, C.B. Thompson, Tumor suppressors Shen, Z.-Q. Yan, et al., Adhesion behavior of endothelial and cell metabolism: a recipe for cancer growth, Genes progenitor cells to endothelial cells in simple shear flow, Dev. 23 (2009) 537–548. doi:10.1101/gad.1756509. Acta Mech. Sin. 27 (2011) 1071–1080. doi:10.1007/ [118] R.J. DeBerardinis, J.J. Lum, G. Hatzivassiliou, s10409-011-0511-3. C.B. Thompson, The biology of cancer: metabolic [109] N. Ricard, L. Tu, M.L. Hiress, A. Huertas, C. Phan, reprogramming fuels cell growth and proliferation, R. Thuillet, et al., Increased Pericyte Coverage Mediated Cell Metab. 7 (2008) 11–20. doi:10.1016/j. by Endothelial Derived FGF-2 and IL-6 is a Source of cmet.2007.10.002. Smooth Muscle-Like Cells in Pulmonary Hypertension, [119] O. Warburg, On the origin of cancer cells, Science. Circulation. (2014) CIRCULATIONAHA.113.007469. 123 (1956) 309–314. doi:10.1161/CIRCULATIONAHA.113.007469. [120] O. Warburg, F. Wind, E. Negelein, THE [110] V.S. Nikam, R.T. Schermuly, R. Dumitrascu, N. METABOLISM OF TUMORS IN THE BODY, J. Gen. Physiol. Weissmann, G. Kwapiszewska, N. Morrell, et al., 8 (1927) 519–530. Treprostinil inhibits the recruitment of bone marrow- [121] S. Weinhouse, O. Warburg, D. Burk, A.L. Schade, derived circulating fibrocytes in chronic hypoxic On Respiratory Impairment in Cancer Cells, Science. 124 pulmonary hypertension, Eur. Respir. J. 36 (2010) 1302– (1956) 267–272. doi:10.1126/science.124.3215.267. 1314. doi:10.1183/09031936.00028009. [122] J. Ryan, A. Dasgupta, J. Huston, K.-H. Chen, S.L. [111] X. Xian, Pericytes limit tumor cell metastasis, Archer, Mitochondrial dynamics in pulmonary arterial J. Clin. Invest. 116 (2006) 642–651. doi:10.1172/ hypertension, J. Mol. Med. Berl. Ger. 93 (2015) 229– JCI25705. 242. doi:10.1007/s00109-015-1263-5. [112] H.W. van Deventer, D.A. Palmieri, Q.P. Wu, E.C. [123] G. Sutendra, S. Bonnet, G. Rochefort, A. McCook, J.S. Serody, Circulating fibrocytes prepare Haromy, K.D. Folmes, G.D. Lopaschuk, et al., Fatty the lung for cancer metastasis by recruiting Ly-6C+ Acid Oxidation and Malonyl-CoA Decarboxylase in the monocytes via CCL2, J. Immunol. Baltim. Md 1950. 190 Vascular Remodeling of Pulmonary Hypertension, Sci. (2013) 4861–4867. doi:10.4049/jimmunol.1202857. Transl. Med. 2 (2010) 44ra58–44ra58. doi:10.1126/ [113] H.-J. Seyfarth, S. Hammerschmidt, M. Halank, P. scitranslmed.3001327. Neuhaus, H.R. Wirtz, Everolimus in patients with severe [124] L.J. Rubin, Metabolic Dysfunction in the pulmonary hypertension: a safety and efficacy pilot trial, Pathogenesis of Pulmonary Hypertension, Cell Metab. Pulm. Circ. 3 (2013) 632–638. doi:10.1086/674311. 12 (2010) 313–314. doi:10.1016/j.cmet.2010.09.006. [114] J.D. Wessler, R.M. Steingart, G.K. Schwartz, B.- [125] S.L. Archer, Y.-H. Fang, J.J. Ryan, L. Piao, Metabolism G. Harvey, W. Schaffer, DRamatic improvement in and bioenergetics in the right ventricle and pulmonary pulmonary hypertension with rapamycin, Chest. 138 vasculature in pulmonary hypertension, Pulm. Circ. 3 (2010) 991–993. doi:10.1378/chest.09-2435. (2013) 144–152. doi:10.4103/2045-8932.109960. [115] B. Ranchoux, F. Antigny, C. Rucker-Martin, A. [126] L. Zhao, A. Ashek, L. Wang, W. Fang, S. Dabral, Reconciling paradigms in PAH 35

O. Dubois, et al., Heterogeneity in lung (18)FDG KLF2-Mediated Repression of PFKFB3, Arterioscler. uptake in pulmonary arterial hypertension: potential Thromb. Vasc. Biol. 35 (2015) 137–145. doi:10.1161/ of dynamic (18)FDG positron emission tomography ATVBAHA.114.304277. with kinetic analysis as a bridging biomarker for [135] X. Sun, M.W. Feinberg, Regulation of Endothelial pulmonary vascular remodeling targeted treatments, Cell Metabolism Just Go With the Flow, Arterioscler. Circulation. 128 (2013) 1214–1224. doi:10.1161/ Thromb. Vasc. Biol. 35 (2015) 13–15. doi:10.1161/ 2 CIRCULATIONAHA.113.004136. ATVBAHA.114.304869. [127] J.A. Frangos, L.V. McIntire, S.G. Eskin, Shear stress [136] A. Dungey, Characterization and Role induced stimulation of mammalian cell metabolism, of Krüppel-like Factor 2 in Models of Pulmonary Biotechnol. Bioeng. 32 (1988) 1053–1060. doi:10.1002/ Hypertension, Thesis, 2012. https://tspace.library. bit.260320812. utoronto.ca/handle/1807/32701 (accessed July 16, [128] E.A. Browning, S. Chatterjee, A.B. Fisher, Stop the 2015). Flow: A Paradigm for Cell Signaling Mediated by Reactive [137] R. Paulin, E.D. Michelakis, The Metabolic Theory of Oxygen Species in the Pulmonary Endothelium, Annu. Pulmonary Arterial Hypertension, Circ. Res. 115 (2014) Rev. Physiol. 74 (2012) 403–424. doi:10.1146/annurev- 148–164. doi:10.1161/CIRCRESAHA.115.301130. physiol-020911-153324. [138] A. Mantovani, P. Allavena, A. Sica, F. Balkwill, [129] S. Sharma, X. Sun, R. Rafikov, S. Kumar, Y. Hou, P.E. Cancer-related inflammation, Nature. 454 (2008) 436– Oishi, et al., PPAR-γ Regulates Carnitine Homeostasis 444. doi:10.1038/nature07205. and Mitochondrial Function in a Lamb Model of [139] G. Sethi, M.K. Shanmugam, L. Ramachandran, Increased Pulmonary Blood Flow, PLoS ONE. 7 (2012) A.P. Kumar, V. Tergaonkar, Multifaceted link between e41555. doi:10.1371/journal.pone.0041555. cancer and inflammation, Biosci. Rep. 32 (2012) 1–15. [130] S. Sharma, N. Sud, D.A. Wiseman, A.L. Carter, S. doi:10.1042/BSR20100136. Kumar, Y. Hou, et al., Altered carnitine homeostasis is [140] M. Rabinovitch, Molecular pathogenesis of associated with decreased mitochondrial function and pulmonary arterial hypertension, J. Clin. Invest. 122 altered nitric oxide signaling in lambs with pulmonary (2012) 4306–4313. doi:10.1172/JCI60658. hypertension, Am. J. Physiol. - Lung Cell. Mol. Physiol. [141] W. Tian, X. Jiang, R. Tamosiuniene, Y.K. Sung, J. 294 (2008) L46–L56. doi:10.1152/ajplung.00247.2007. Qian, G. Dhillon, et al., Blocking Macrophage Leukotriene [131] M. Gorenflo, C. Zheng, A. Pöge, M. Bettendorf, E. B4 Prevents Endothelial Injury and Reverses Pulmonary Werle, W. Fiehn, et al., Metabolites of the L-arginine-NO Hypertension, Sci. Transl. Med. 5 (2013) 200ra117– pathway in patients with left-to-right shunt, Clin. Lab. 47 200ra117. doi:10.1126/scitranslmed.3006674. (2001) 441–447. [142] N. Resnick, M.A. Gimbrone, Hemodynamic forces [132] S. Fratz, J.R. Fineman, A. Görlach, S. Sharma, P. Oishi, are complex regulators of endothelial gene expression., C. Schreiber, et al., Early Determinants of Pulmonary FASEB J. 9 (1995) 874–882. Vascular Remodeling in Animal Models of Complex [143] G.E. Kuhnle, W.M. Kuebler, J. Groh, A.E. Goetz, Congenital Heart Disease, Circulation. 123 (2011) 916– Effect of blood flow on the leukocyte-endothelium 923. doi:10.1161/CIRCULATIONAHA.110.978528. interaction in pulmonary microvessels., Am. J. Respir. [133] T. Shiroto, N. Romero, T. Sugiyama, J.L. Sartoretto, Crit. Care Med. 152 (1995) 1221–1228. doi:10.1164/ H. Kalwa, Z. Yan, et al., Caveolin-1 Is a Critical Determinant ajrccm.152.4.7551374. of Autophagy, Metabolic Switching, and Oxidative Stress [144] M.D. Botney, Role of Hemodynamics in Pulmonary in Vascular Endothelium, PLoS ONE. 9 (2014) e87871. Vascular Remodeling Implications for Primary Pulmonary doi:10.1371/journal.pone.0087871. Hypertension, Am. J. Respir. Crit. Care Med. 159 (1999) [134] A. Doddaballapur, K.M. Michalik, Y. Manavski, 361–364. T. Lucas, R.H. Houtkooper, X. You, et al., Laminar [145] B.A. Martin, J.L. Wright, H. Thommasen, J.C. Shear Stress Inhibits Endothelial Cell Metabolism via Hogg, Effect of pulmonary blood flow on the exchange 36

between the circulating and marginating pool of [154] J. Sandoval, J. Gaspar, H. Peña, L.E. Santos, J. polymorphonuclear leukocytes in dog lungs., J. Clin. Córdova, K. del Valle, et al., Effect of atrial septostomy Invest. 69 (1982) 1277–1285. doi:10.1172/JCI110567. on the survival of patients with severe pulmonary [146] R.J. Dekker, Prolonged fluid shear stress induces arterial hypertension, Eur. Respir. J. 38 (2011) 1343– a distinct set of endothelial cell genes, most specifically 1348. doi:10.1183/09031936.00072210. lung Kruppel-like factor (KLF2), Blood. 100 (2002) 1689– [155] C.A. Warnes, R.G. Williams, T.M. Bashore, J.S. 1698. doi:10.1182/blood-2002-01-0046. Child, H.M. Connolly, J.A. Dearani, et al., ACC/AHA [147] K.S. Cunningham, A.I. Gotlieb, The role of shear 2008 Guidelines for the Management of Adults With stress in the pathogenesis of atherosclerosis, Lab. Congenital Heart Disease: Executive SummaryA Report Invest. 85 (2004) 9–23. doi:10.1038/labinvest.3700215. of the American College of Cardiology/American Heart [148] L. Ciuclan, M.J. Hussey, V. Burton, R. Good, N. Association Task Force on Practice Guidelines (Writing Duggan, S. Beach, et al., Imatinib Attenuates Hypoxia- Committee to Develop Guidelines for the Management induced Pulmonary Arterial Hypertension Pathology via of Adults With Congenital Heart Disease) Developed Reduction in 5-Hydroxytryptamine through Inhibition in Collaboration With the American Society of of Tryptophan Hydroxylase 1 Expression, Am. J. Respir. Echocardiography, Heart Rhythm Society, International Crit. Care Med. 187 (2013) 78–89. doi:10.1164/ Society for Adult Congenital Heart Disease, Society for rccm.201206-1028OC. Cardiovascular Angiography and Interventions, and [149] D. Montani, E. Bergot, S. Günther, L. Savale, Society of Thoracic Surgeons, J. Am. Coll. Cardiol. 52 A. Bergeron, A. Bourdin, et al., Pulmonary arterial (2008) 1890–1947. doi:10.1016/j.jacc.2008.10.002. hypertension in patients treated by dasatinib, [156] N.T. Levy, H. Liapis, P.R. Eisenberg, M.D. Botney, Circulation. 125 (2012) 2128–2137. doi:10.1161/ E.P. Trulock, Pathologic regression of primary pulmonary CIRCULATIONAHA.111.079921. hypertension in left native lung following right single- [150] F. Perros, S. Günther, B. Ranchoux, L. Godinas, lung transplantation, J. Heart Lung Transplant. Off. Publ. F. Antigny, M.-C. Chaumais, et al., Mitomycin-Induced Int. Soc. Heart Transplant. 20 (2001) 381–384. Pulmonary Veno-Occlusive Disease: Evidence From [157] S. Deb, J. Yun, N. Burton, E. Omron, J. Thurber, Human Disease and Animal Models, Circulation. S.D. Nathan, Reversal of idiopathic pulmonary arterial (2015) CIRCULATIONAHA.115.014207. doi:10.1161/ hypertension and allograft pneumonectomy after CIRCULATIONAHA.115.014207. single lung transplantation, Chest. 130 (2006) 214–217. [151] J.A. Groeneveldt, S.J.M. Gans, H.J. Bogaard, doi:10.1378/chest.130.1.214. A. Vonk-Noordegraaf, Dasatinib-induced pulmonary [158] P.A. Thistlethwaite, K. Kaneko, M.M. Madani, arterial hypertension unresponsive to PDE- S.W. Jamieson, Technique and outcomes of pulmonary 5 inhibition, Eur. Respir. J. 42 (2013) 869–870. endarterectomy surgery, Ann. Thorac. Cardiovasc. Surg. doi:10.1183/09031936.00035913. Off. J. Assoc. Thorac. Cardiovasc. Surg. Asia. 14 (2008) [152] N.F. Voelkel, J. Gomez-Arroyo, A. Abbate, H.J. 274–282. Bogaard, M.R. Nicolls, Pathobiology of pulmonary [159] J.A. Feinstein, S.Z. Goldhaber, J.E. Lock, S.M. arterial hypertension and right ventricular Ferndandes, M.J. Landzberg, Balloon Pulmonary failure, Eur. Respir. J. 40 (2012) 1555–1565. Angioplasty for Treatment of Chronic Thromboembolic doi:10.1183/09031936.00046612. Pulmonary Hypertension, Circulation. 103 (2001) 10– [153] K.M. Drake, S.A. Comhair, S.C. Erzurum, R.M. Tuder, 13. doi:10.1161/01.CIR.103.1.10. M.A. Aldred, Endothelial Chromosome 13 Deletion [160] P. Neth, M. Nazari-Jahantigh, A. Schober, C. Weber, in Congenital Heart Disease–associated Pulmonary MicroRNAs in flow-dependent vascular remodelling, Arterial Hypertension Dysregulates SMAD9 Signaling, Cardiovasc. Res. 99 (2013) 294–303. doi:10.1093/cvr/ Am. J. Respir. Crit. Care Med. 191 (2015) 850–854. cvt096. doi:10.1164/rccm.201411-1985LE. [161] V.N. Parikh, R.C. Jin, S. Rabello, N. Gulbahce, K. Reconciling paradigms in PAH 37

White, A. Hale, et al., MicroRNA-21 integrates pathogenic signaling to control pulmonary hypertension results of a network bioinformatics approach, Circulation. 125 (2012) 1520–1532. [162] K. White, Y. Dempsie, P. Caruso, E. Wallace, R.A. McDonald, H. Stevens, et al., Endothelial 2 Apoptosis in Pulmonary Hypertension Is Controlled by a microRNA/Programmed Cell Death 4/Caspase-3 Axis, Hypertension. 64 (2014) 185–194. doi:10.1161/ HYPERTENSIONAHA.113.03037. [163] P. Caruso, M.R. MacLean, R. Khanin, J. McClure, E. Soon, M. Southgate, et al., Dynamic changes in lung microRNA profiles during the development of pulmonary hypertension due to chronic hypoxia and monocrotaline, Arterioscler. Thromb. Vasc. Biol. 30 (2010) 716–723. doi:10.1161/ATVBAHA.109.202028. [164] W. Qin, B. Zhao, Y. Shi, C. Yao, L. Jin, Y. Jin, BMPRII is a direct target of miR-21, Acta Biochim. Biophys. Sin. 41 (2009) 618–623. doi:10.1093/abbs/gmp049. [165] K. Ma, Q. Zhao, W. Chen, H. Zhang, S. Li, X. Pan, et al., Human lung microRNA profiling in pulmonary arterial hypertension secondary to congenital heart defect: microRNAs in PAH Secondary to Congenital Heart Defect, Pediatr. Pulmonol. (2015) n/a–n/a. doi:10.1002/ ppul.23181.

Vascular remodelling in the pulmonary circulation after 3 major lung resection

N. Rol • C.M. Happé • J.A.M. Beliën • F.S. de Man • N. Westerhof • A. Vonk-Noordegraaf • K. Grünberg • H.J. Bogaard

European Respiratory Journal • Research letter •2017 40

To the Editor:

Lung resection is a standard treatment in patients with clinical stages I and II and selected patients with stage IIIA nonsmall cell lung cancer [1]. Major lung resection (MLR), such as (bi) lobectomy or pneumonectomy, occasionally lead to pulmonary hypertension (PH). Several studies report an increase in pulmonary artery pressures in about one-third of these patients up to 5 years postoperatively [2–4]. The development of PH after MLR may be explained simply by the fact that total cardiac output flows through a smaller vascular bed. Because there are no reports in the literature of histological studies performed after MLR, it remains unknown whether flow-induced structural changes in the remaining lung vasculature lead to progressive increases in pulmonary vascular resistance.

The aim of the current study was to determine whether an altered pulmonary blood flow per se is associated with phenotypic changes in the lung vasculature akin to PH. For the study, human lung tissue from the contralateral lung was obtained at least 2 years after pneumonectomy, bilobectomy or lobectomy of the left upper lobe. Healthy control tissue was from people who died acutely due to a traumatic cause, and these have described in earlier histopathological studies [5, 6]. Samples were obtained from the biobank of VUmc, Amsterdam, The Netherlands. For animal studies, wall thickness measurements in the unilateral lung of rats 6 weeks post-pneumonectomy were compared with those of sham- operated animals.

Evaluation of vasculopathy was performed according to previously described patterns [7]. Immunohistochemical staining with Ki-67, histone H3 and cleaved caspase 3 was performed to determine proliferation and apoptosis of endothelial cells. For quantitative measurements, the thickness of the intimal and medial layers of arterioles (attached to four septal walls) was determined, and expressed as a percentage of the external diameter of these vessels. Vessels with an elliptical shape due to oblique sectioning were excluded.

Animal experiments were permitted by the Institutional Animal Care and Use of theVU University and conducted in accordance with the European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes, and the Dutch Animal Experimentation Act (FYS12-18, FYS13-01). Sprague–Dawley rats (n=4 per group) underwent either pneumonectomy or sham operation. The animals were part of an earlier study, as described previously [8]. Vascular remodeling after lung resection 41

Lung tissue specimens from 13 patients with MLR and six controls were obtained. Control subjects died at an age of 36±4 years old and were all male. MLR patients were 69±2 years, and 10 out of 13 were male. 10 MLR patients had a known history of smoking and the average survival after surgery was 4.8±0.9 years. The clinical history of four MLR patients was not available. Seven patients had received radiotherapy prior to MLR, three in combination with chemotherapy. 3

The predominant patterns observed in patients with MLR and absent in controls were thrombotic arteriopathy (46%) and nonselective intimal fibrosis (23%) (figure 1a).These patterns were not associated with the presence of inflammation. In half of the patients with thrombotic arteriopathy, vascular remodelling was mild with slight congestive features. In two patients, diffuse congestion was more prominent, and the last patient showed organising diffuse alveolar damage. All patients with nonspecific intimal fibrosis showed parenchymal intimal fibrosis, with involvement of the veins in two of these patients. Congestive vasculopathy was present both in patients with MLR and controls. In two patients with MLR, this was paired with intimal fibrosis in arterial, parenchymal and venous vessels, medial hyperplasia in bronchiolar arteries, and venous arterialisation. A very similar pattern was found in all controls with congestive structural changes. There was no conclusive diagnosis for the other two patients with MLR with congestive vasculopathy.

The number of endothelial cells positively staining for the proliferation marker Ki-67 was higher in the MLR group (p=0.01) (figure 1b), and did not correlate with inflammation (p=0.50). Histone H3 showed a similar pattern, although this was not statistically significant (p=0.18). No differences were found for cleaved caspase 3 (p=0.81) (figure 1b).

In the human pulmonary vasculature, the outer diameter of the arterioles ranged between 27 and 178 μm, with a mean distance of 69 and 76 μm in control and patients with MLR, respectively (p=0.33). There was no significant increase in the intima thickness in MLR lung tissue, but the media showed a tendency towards thickening (figure 1c). Thickening of the intimal and medial wall was not different in participants with and without inflammation. In rats, the outer diameter was 40±1.3 μm (sham) and 43±2.6 μm (MLR) (p=0.32). Both vascular layers showed a tendency towards thickening (figure 1d).

The small cohort and random selection of tissue blocks limits the generalisation ofour 42

findings. Other limitations are possible confounding factors, including differences inage, smoking history or cancer treatment. Thickening of the intima is often seen in older subjects [9] and smokers [10, 11]. Both features apply to patients undergoing MLR for lung cancer. Chemotherapy and radiotherapy are also associated with vascular, mostly intimal, remodelling [12, 13]. The increased presence of inflammation we found in patients with MLR was probably related to illness at the end of life. However, inflammation was not associated with vasculopathy patterns or proliferation, suggesting that these changes were not consequences of inflammatory activity. We observed increased Ki-67 staining in the MLR group without changes in cleaved caspase 3, indicating ongoing proliferation in the pulmonary vasculature. However, we could not link this observation to a greater intimal thickness.

We hypothesise that pulmonary hyperflow per se could induce remodelling in the pulmonary vasculature, even when no PH develops. Indeed, six of our patients with MLR showed thrombotic arteriopathy, while healthy controls did not present this predominant pattern. Intimal and medial thickness was not changed in human and rat lungs. Finally, patients with MLR showed increased proliferation, without changes in apoptosis. Surprisingly, we observed congestive arteriopathy in half of the control lung samples, indicating that these findings are common and probably nonspecific rather than related to hyperflow.

The findings in our focused study of 13 patients after MLR imply that vascular changes in PH are perhaps partially explained by altered pulmonary blood flow, but further research is needed in a larger cohort with more tissue samples, in order to study which additional stimuli are needed to induce PH. Vascular remodeling after lung resection 43

Figure 1: a) Type of arteriopathy in major lung resection (MLR) and control lung tissue scored quantitatively, p-values calculated with Fisher’s exact test. b) number of positively stained endothelial cells for Ki-67 and cleaved caspase 3. c) Intimal and medial wall thickness in human and d) rat, expressed as percentage of outer diameter of the vessel. Data are reported as box and whisker plots, minimum to maximum. For statistical analysis unpaired t-tests (parametric data) and Mann−Whitney tests (non-parametric data) were used. 44

References of pulmonary vascular remodelling in smokers andpatients with mild COPD. Eur Respir J 2002; 19: 632–638. 1 Manser R, Wright G, Hart D, et al. Surgery for early 12 Weintraub NL, Jones WK, Manka D. Understanding stage non-small cell lung cancer. Cochrane Database radiation-induced vascular disease. J Am Coll Cardiol Syst Rev 2005; CD004699. 2010;55: 1237–1239. 2 Deslauriers J, Ugalde P, Miro S, et al. Adjustments 13 Sanchez-Gonzalez PD, Lopez-Hernandez FJ, in cardiorespiratory function after pneumonectomy: Lopez-Novoa JM, et al. An integrative view of the results of the pneumonectomy project. J Thorac pathophysiological events leading to cisplatin Cardiovasc Surg 2011; 141: 7–15. nephrotoxicity. Crit Rev Toxicol 2011; 41: 803–821. 3 Foroulis CN, Kotoulas CS, Kakouros S, et al. Study on the late effect of pneumonectomy on right heart pressures using Doppler echocardiography. Eur J Cardiothorac Surg 2004; 26: 508–514. 4 Potaris K, Athanasiou A, Konstantinou M, et al. Pulmonary hypertension after pneumonectomy for lung cancer. Asian Cardiovasc Thorac Ann 2014; 22: 1072– 1079. 5 Overbeek MJ, Mouchaers KT, Niessen HM, et al. Characteristics of interstitial fibrosis and inflammatory cell infiltration in right ventricles of systemic sclerosis- associated pulmonary arterial hypertension. Int J Rheumatol 2010: 2010. 6 Overbeek MJ, Boonstra A, Voskuyl AE, et al. Platelet- derived growth factor receptor-beta and epidermal growth factor receptor in pulmonary vasculature of systemic sclerosis-associated pulmonary arterial hypertension versus idiopathic pulmonary arterial hypertension and pulmonary veno-occlusive disease: a case-control study. Arthritis Res Ther 2011; 13: R61. 7 Grünberg K, Mooi WJ. A practical approach to vascular pathology in pulmonary hypertension. Diagn Histopathol (Oxf) 2013; 19: 298–310. 8 Happe CM, De Raaf MA, Rol N, et al. Pneumonectomy combined with SU5416 induces severe pulmonary hypertension in rats. Am J Physiol Lung Cell Mol Physiol 2016; 310: L1088–L1097. 9 Wagenvoort CA, Wagenvoort N. Age changes in muscular pulmonary arteries. Arch Pathol 1965; 79: 524–528. 10 Chiu JJ, Chien S. Effects of disturbed flow on vascular endothelium: pathophysiological basis and clinical perspectives. Physiol Rev 2011; 91: 327–387. 11 Santos S, Peinado VI, Ramirez J, et al. Characterization Pneumonectomy combined with SU5416 induces severe 4 pulmonary hypertension in rats

C.M. Happé • M.A. de Raaf • N. Rol • I. Schalij • A. Vonk- Noordegraaf • N. Westerhof • N.F. Voelkel • F.S. de Man • H.J. Bogaard

American Journal of Physiology: Lung cellular and molecular physiology • 2016 46

ABSTRACT

Introduction: The SU5416+Hypoxia (SuHx) rat model a commonly used model of severe pulmonary arterial hypertension (PAH). Previous studies have shown that to induce PH in rats, administration of SU5416 alone is insufficient, but when administered together with a second hit such as hypoxia or immune modification, severe angioproliferative PH will ensue. Abnormal pulmonary blood flow (PBF) has since long been known to invoke pathological changes in the pulmonary vasculature. We tested the hypothesis that a combination of SU5416 administration and a left pneumonectomy (PNx) to induce an abnormal PBF in the contralateral lung is sufficient to induce severe PAH in rats. Disease progression over time was studied and compared with the SuHx model.

Methods: Sprague Dawley rats were subjected to standard SuHx protocol (SU5416 / 4 weeks of hypoxia) or SuPNx protocol (SU5416 + PNx). Comparisons between models were made at week 2 and 6 utilizing echocardiography to determine cardiac morphometry and function, and right ventricle (RV) catheterization to determine RV pressures and function. Tissue and molecular analysis was performed to examine pulmonary vascular remodeling, proliferation, apoptosis and inflammation.

Results: Both SuHx and SuPNx models displayed extensive obliterative vascular remodeling leading to an increased right ventricular systolic pressure at week 6. Similar inflammatory response in the lung vasculature of both models was observed alongside increased endothelial cell proliferation and apoptosis.

Conclusion: This study described the SuPNx model which features severe PAH at 6 weeks and could serve as an alternative to the SuHx model. Our study together with previous studies on experimental models of pulmonary hypertension shows that the typical histopathological findings of PAH, including obliterative lesions, inflammation, increased cell turnover and ongoing apoptosis represent a final common pathway of a disease that can evolve asa consequence of a variety of insults to the lung vasculature. Characterization of the Sugen Pneumonectomy model 47

Introduction

Pulmonary Arterial Hypertension (PAH) is a group of progressive diseases, characterized by obliteration of the small precapillary pulmonary vessels, termed angio-obliteration, resulting in increased pulmonary vascular resistance ultimately leading to right heart failure and death(31). The arterial changes are based on pathobiological mechanisms that are to some degree shared with cancer including hyperproliferative angiogenesis and altered endothelial cell biology(10, 25). At the same time it is well accepted that a disturbed blood flow may be important in the pathogenesis and pathobiology of PAH, in particular in those forms associated with congenital systemic to pulmonary shunts(3, 6) This concept is supported by animal 4 studies based on disturbed blood flow, such as the monocrotaline (MCT) + pneumonectomy rat model(21, 42) and the MCT + aorta-caval shunt rat model(6, 38). A concept of ‘wound healing gone awry’ can connect the concepts of quasi-malignancy and flow–dependent alterations in the development of PAH(39).

Recently, we have characterized the Sugen-Hypoxia (SuHx) model by performing longitudinal histology and telemetric monitoring of the Right Ventricular Systolic Pressure (RVSP)(5, 36). We showed partial reversibility of pulmonary hypertension and RV hypertrophy in this model after return to a normoxic environment and also that subsequent disease progression in the model was not dependent on remodeling of the lung vascular media. As such, hypoxia- induced changes in pulmonary artery smooth muscle cells seemed not required to maintain the obliterative vascular phenotype in rats with advanced SuHx induced PAH(5). It has been hypothesized that the exuberant lumen obliterating cell growth in the SuHx lung vasculature is not fully dependent on the mechanism driven by hypoxia. Changes in pulmonary blood flow velocity, first driven by hypoxic vasoconstriction and later by vascular obliteration, may play an additional causative role in the evolution of abnormal vascular cell phenotypes in the SuHx model.

The fact that hypoxia is not an obligatory secondary hit in SU5416 induced angio-obliterative PAH is exemplified by the development of other SU5416 mediated animal models that lack the stimulus of hypoxia, such as the Sugen Ovalbumin model(20). The aim of the present study was to evaluate whether the combination of VEGF receptor blockade by SU5416 and an increase in pulmonary blood flow velocity, is sufficient to induce lung vascular cell proliferation and severe angioobliterative pulmonary lesions. To achieve this, the hypoxic component of the SuHx model was substituted by a left pneumonectomy. 48

Materials and methods

All experiments were approved by the Institutional Animal Care and Use Committee of the VU University and were conducted in accordance with the European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes, and the Dutch Animal Experimentation Act. Male Sprague Dawley rats (n= 60, 6-8 weeks, Charles River, Sulzfeld, Germany) were housed in groups of 4 under controlled conditions (22°C, 12:12 h light/dark cycle). Food and water were available ad libitum in accordance with the animal care committee protocol (FYS12-18, FYS-13-01).

Rats were randomly divided between five groups: Control (Con), SU5416 (SU), Pneumonectomy (PNx), SU5416 + hypoxia (SuHx) and SU5416 +PNx (SuPNx) (fig1). The SuHx protocol was employed as previously described(5). Briefly, animals were injected with SU5416 (25 mg/kg, Tocris Bioscience, #3037, Bristol, United Kingdom) dissolved in carboxymethycellulose (CMC) and exposed to hypoxia (10%) for four weeks followed by re-exposure to normoxia. PNx animals underwent a left pneumonectomy (see supplement for detailed protocol). Two days following PNx-surgery an injection of SU5416 was administered (25 mg/kg).The Con-group received only the solvent CMC. Echocardiography was utilized at baseline (pre-hypoxia/pre- surgery), week two and week six to determine cardiac morphometry and function. Two and six weeks post-surgery/post-hypoxia animals were anesthetized and right ventricle (RV) and left ventricle (LV) pressure measurements via catheterization were performed. Animals were killed via exsanguination and organs were weighed and processed for analysis.

Thirty minutes prior to anaesthesia (Isoflurane; 4.0/2.5% induction/maintance; 1:1 O2/Air mix) and intubation (Teflon tube, 16 gauge) rats received an injection of buprenorphine analgesia (0,1 mg/kg). Rats were ventilated at a rate of 70/minute with a peak pressure of 10 cmH2O and placed in half supine position on a heating pad. The surgical site was shaved and cleaned with chlorhexidine digluconate in 70% ethanol (Addedpharma, Oss, Netherlands). Heart rate, saturation and carbon dioxide levels were (measured via pulse oximetry) and temperatures were monitored at all times during the surgery. Thoracotomy was performed by opening the third intercostal space. Ventilation was briefly interrupted for a maximum of 30 seconds to fix the left lung outside the chest cavity with the use of Q-tips. Bronchus, artery and veins were ligated and the lung was removed. The thorax was closed by suturing Characterization of the Sugen Pneumonectomy model 49

Figure'1

Injection$ CMC End$ experiment End$ experiment

Control

Pneumonectomy$ End$ experiment End$ experiment

Pneumonectomy 4

Injection$ SU5416$

(25$mg/kg) End$ experiment End$ experiment

Sugen

Injection$ SU5416$

(25$mg/kg) End$ experiment End$ experiment

hypoxia$ 10$ % hypoxia$ 10$ % normoxia SuHx

Pneumonectomy$ +$ SU5416$(25$mg/kg) End$ experiment End$ experiment

SuPNx

0 2 6$weeks Figure 1: Study design. 5 groups of n=6 per time-point (6 per time point). SuHx= SU5416+Hypoxia; SuPNx= SU5416+Pneumonectomy. n=6 animals per timepoint. 50

of the muscular and dermal layers. After cessation of isoflurane administration animals were extubated and received an additional injection of sterile saline (3 ml) and Carprofen (4.0 mg/ kg) subcutaneous (Rimdadyl, Pfizer, Capelle aan den IJssel, the Netherlands).

Echocardiography was utilized at baseline, week two and week six. Measurements (ProSound SSD-4000, 13-MHz linear transducer #UST-5542, Aloka, Tokyo, Japan) were performed on anesthetized, spontaneously breathing rats (2,0% isoflurane, 1:1 O2/Air mix). Time under anaesthesia was set to 15 minutes to minimise effects of isoflurane (12, 24). Measured parameters were pulmonary artery acceleration time (PAAT), right ventricular wall thickness (RVWT) and end diastolic diameter (RVEDD), cycle length (CL), tricuspid annular plane systolic excursion (TAPSE), cardiac output (CO), heart rate (HR) and stroke volume (SV). Non invasive estimation of RV systolic pressures (eRVSP) and total pulmonary vascular resistance (TPR) was performed as described previously (eRVSP= 142 x e(-11(paat/cl)) (TPR ≈ [mean PAP]/[cardiac output] = (0.61×[eRVSP]+ 2 mmHg)/[cardiac output]) (13, 15, 11, 2, 30, 41). Analysis was performed offline (Tomtec Imaging systems, Unterschleisscheim, Germany).

At the end of the study protocol, open-chest RV catheterization was performed under general anesthesia in all animals (2.5% isoflurane, 1:1 O2/air mix). Before the procedure, rats were intubated (Teflon tube, 16 gauge) and attached to a mechanical ventilator (Micro-Ventilator, UNO, Zevenaar, the Netherlands; ventilator settings: breathing frequency, 70 breaths per minute; pressures, 12/0 cm H2O; inspiratory/expiratory ratio, 1:1). RV pressures were recorded by use of a microtip pressure-volume conductance catheter (Millar Instruments, Houston, TX). Analyses were performed when steady state was reached over an interval of at least 10 seconds.

Lungs were weighed and the airways of the right middle lobe were filled with 0.5% low-melt agarose in saline under constant pressure of 25 mmHg and stored in formaline (#4169-30, Klinipath BV, Duiven, the Netherlands). The remaining lobes were stored in liquid nitrogen for further processing. The heart was perfused with tyrode solution, weighed, dissected, snap-frozen in liquid nitrogen and stored in -80°C. Transversally cut lung sections (4μm) were stained with elastica van Gieson for analysis of vascular dimensions for week two and six. The degree of vascular remodeling was determined by measuring 50 transversally cut vessels (outer diameter < 60 μm) and expressing thickness of the intima and media layer as a percentage of total vessel diameter. The percentage of vascular occlusion of these 50 Characterization of the Sugen Pneumonectomy model 51

vessels was categorized as 1. no evidence of luminal obstruction (open); 2. partial (<50%) luminal occlusion and 3. full luminal occlusion. Percentage of vessels occluded was calculated as (number of category 3 (occluded) vessels / 50).

Lungsections were deparaffinized and epitope retrieval was performed by immersing the slides in antigen unmasking solution (H3300, Vector Laboratories) for 40 minutes in a pressure cooker. Blocking steps with 1% bovine serum albumin were performed, before labeling with the primary antibody (PCNA , PC-10, sc-56),(Cleaved caspase 3, cell signaling, 9661),(CD08, sc-53063),(CD20, M-20, sc-7735),(CD68, abcam, ab31630)(1:250) O/N in 4ºC, except for negative control. Subsequent labeling with appropriate secondary antibody, anti-α-smooth- 4 muscle-actin – Cy3 (α-SMA, C6198, Sigma), Von Willebrand Factor (VWF, ab8822, Abcam) and 4’6-diamidino-2-phenylindole (DAPI, H-1200, Vector Labs) counterstaining followed. Image acquisition was performed on a ZEISS Axiovert 200M Marianas inverted microscope.

A minimum of 30 randomly selected vessels per sample was acquired via Slidebook imaging analysis software (SlideBook 5.5, Intelligent Imaging Innovations) Proliferation (PCNA) and apoptotic activity (CC3) was quantified by counting smooth muscle cell – or endothelial cells with a positive (PCNA or CC3) signal. Both values are expressed as number of positive (+) cells per vessel. Inflammation was quantified in a similar fashion, with the exception that positive cells in the lesions surrounding the vessel were included.

All analyses were performed in a blinded fashion. All data were verified for normal distribution. A p-value <0,05 was considered significant. All data are presented as mean ±SEM. Parameters were analysed by two-way ANOVA with Bonferroni post-hoc testing (GraphPad Prism for Windows 5.01, San Diego CA).

Results

Effect of SU5416- or pneumonectomy after 2 and 6 weeks Results of the effects of SU5416- and pneumonectomy alone are summarized in supplemental tables I and II. All animals survived the surgical procedure. No adverse effects of SU5416 with regard to post-operative wound healing were observed. Right lung mass was found to be increased in the pneumonectomy group compared to control both after 2 and 6 weeks of initiation experiment. Lung CD68 (macrophage) counts were found to be increased in the SU- group compared to control at week 2 (supplement table I and II) suggesting an inflammatory reaction to VEGFR inhibition. For ease of interpretation the following results will only include comparisons between control versus SuHx and SuPNx.

Development of pulmonary hypertension in SuHx and SuPNx rats. RVSP and eRVSP were significantly elevated after two weeks in the SuHx model compared to Con, whereas no differences in RVSP were observed between SuPNx and control animals. However, six weeks after initiation of the protocol, both SuHx and SuPNx demonstrated

Figure 2: Pressure-volume measurements A: Right ventricle systolic pressure (RVSP); B: RV afterload (Ea); C:RV Contractility (end systolic elastance/Ees); D:RV stiffness (end diastolic stiffness/Eed) E: Coupling (Ees/Ea) ;Con= Control; SuHx= SU5416+Hypoxia ; SuPNx= SU5416+Pneumonectomy; * = p<0,05; ** = p<0,01; *** = p<0,001; †=p<0,05; ††=p<0,01. (* indicates differences between SuHx/SuPNx vs control / † indicates differences between SuHx vs SuPNx) Characterization of the Sugen Pneumonectomy model 53

an elevated RVSP compared to Con (fig2AB). RV afterload (Ea) was significantly increased in SuHx after two weeks. Ea was increased in both SuHx and SuPNx after 6 weeks (fig2C). RV Contractility (Ees) increased in SuHx and SuPNx at week two compared to Con and remained so in at week 6 (fig2D). SuHx RV stiffness (Eed) was increased at week two, while no differences between groups were observed at week 6 (fig2E).

Total pulmonary resistance (TPR) was increased in SuHx after week two and in both SuHx and SuPNx at week six, which was in accordance with the increased Ea (fig3A). No significant differences in cardiac output (CO) were observed between groups (fig3B). RV wall thickness (RVWT) and end diastolic diameter (RVEDD) were increased at week two in SuHx rats when 4 compared to both Con and SuPNx, whilst after six weeks, RVWT and RVEDD were increased in SuHx and SuPNx rats alike (fig3CD). Tricuspid annular plane excursion time (TAPSE) was decreased in SuHx at week two compared to Control animals. Both SuHx and SuPNx showed a decline in TAPSE at week 6 (fig3E). Pulmonary artery acceleration time / cycle length (PAAT/ CL) was reduced in both SuHx and SuPNx at week six compared to Control animals (fig 3F).

Figure 3: Echocardiography parameters A: Total pulmonary resistance (TPR); B: Cardiac output (CO); C: Right ventricle wall thickness (RVWT); D: Right ventricle end diastolic diameter (RVEDD); E: Tricuspid annular plane systolic excursion (TAPSE); F: Pulmonary artery acceleration time / cycle length (PAAT/CL); Con= Control; SuHx= SU5416+Hypoxia; SuPNx= SU5416+Pneumonectomy; * = p<0,05; ** = p<0,01; *** = p<0,001; ††=p<0,05. (* indicates differences between SuHx/SuPNx vs control / † indicates differences between SuHx vs SuPNx) 54

Right lung mass was increased at both time points in the SuPNx group, compared to Con and SuHx (fig4A). SuHx left lung mass was increased compared to Con at week two (Con: 16.8±.7 vs SuHx: 26.95±0.8; p < 0.01) and six (Con: 16.7±3 vs SuHx: 22.4±1.4; p < 0.01). At week two, the Fulton index in SuHx was higher when compared to Control and SuPNx animals. At week six both SuHx and SuPNx showed an increased Fulton index compared to Control animals (fig 4B). The hematocrit levels were increased in the SuHx model at week two (hypoxic period) (fig 4C). Bodymass of SuHx was lower compared to Con at week two. Both SuHx and SuPNx bodymass was decreased at week six compared to control (fig4D).

Figure 4: Lung mass, Fulton index, Hematocrit and Bodymass. A:Right and left lung mass. Left lung indicated by striped pattern; B: Fulton index (RV/LV+S)(%); C: Hematocrit (%); D: Bodymass (gr); EF: Con= Control; SuHx= SU5416+Hypoxia; SuPNx= SU5416+Pneumonectomy; *= p<0,05; **= p<0,01; ***= p<0,001; ††=p<0,01; †††=p<0,001. (* indicates differences between SuHx/SuPNx vs control / † indicates differences between SuHx vs SuPNx).

Increased intimal fraction accompanied by obliterative lesions in SuHx and SuPNx Vascular wall media fraction was already increased in SuPNx at week two, when compared to Con and SuHx, with similar elevated fractions of both SuHx and SuPNx at week six. In contrast, intimal fraction increased in the SuHx group at week two, with similar fractions between SuHx and SuPNx at week six (fig5AB). An increase in occlusive lesions was observed in both SuHx and SuPNx at week 2 and week 6. Overviews (40x magnification) of lung morphology reveal obliterative lesions in SuHx and SuPNx at week six (fig5DE). Characterization of the Sugen Pneumonectomy model 55

Figure 5: Vascular remodeling A: Media fraction thickness; B: Intima fraction thickness; C: vessels occluded (%); Con= Control; SuHx= SU5416+Hypoxia; SuPNx= SU5416+Pneumonectomy; *= p<0,05; **= p<0,01; ***= p<0,001; †=p<0,05; D: Overview (magnification 100x and 400x) of lung vasculature White arrows indicate occlusions. E: Examples of histology (Elastica van Gieson) of pulmonary vessels of control , SuHx and SuPNx. (* indicates differences between SuHx/SuPNx vs control / † indicates differences between SuHx vs SuPNx) 56

Increased proliferation, apoptosis and inflammation in both SuHx and SuPNx Markers of cell proliferation and pro-apoptotic signaling (as assessed by immunofluorescence) at week six indicated increased proliferation of endothelial cells (EC) in SuHx and smooth muscle cells (SMC) in both SuHx and SuPNx (compared to Control). The apoptotic signaling in both PH-models was similarly increased in ECs as well as SMCs compared to Con (fig 6AB). Cytotoxic T-cells (CD8), B-cells (CD20) and macrophage (CD68) count at- or near vessels was increased in both SuHx and SuPNx. Sugen increased CD68 compared to Con. The CD68 count was higher in SuPNx compared to SuHx (fig6E). Typical examples are shown (fig6BCDE). Characterization of the Sugen Pneumonectomy model 57

Con A 3 SuHx SuPNx * 2 *** ** ** ** PCNA 1 PCNA (+ cells/vessel) (+ PCNA 0 EC SMC

B 3 *** *** 2

1 *** *** CC3 (+ cells/vessel) CC3(+ 4 0 EC SMC Cleaved*Caspase*3

4 C * 3 *

CD08 1 CD08 (+ cells/vessel) CD08(+ 0

D 3 ** 2 *

CD20 1 CD20 (+ cells/vessel) CD20(+ 0

E 3 *** * 2 ** CD68 1 CD68 (+ cells/vessel) CD68(+ 0 Control SuHx SuPNx Figure 6: Proliferation and apoptotic activity week 6. A: PCNA positive-cell count in ECs and SMCs; B: CC3 positive- cell count in ECs and SMCs; Characterization of inflammation of at week 6 C: CD08 D: CD20 and E: CD68 positive cells at-or near vessel; *=p<0,05; **=p<0,01; ***=p<0,001; Scale bar = 10 µm. (* indicates differences between SuHx/SuPNx vs control / † indicates differences between SuHx vs SuPNx)indicates differences between SuHx/SuPNx vs control / † indicates differences between SuHx vs SuPNx) 58

Discussion

To our knowledge this study is the first full report on the combined lung vascular effects of left pneumonectomy and SU5416 in rats. In the current study, several important hallmarks of human PAH were detected in the rat model that combines PNx and one single injection of the VEGF receptor antagonist SU5416. These include severe pulmonary hypertension, angio-obliterative vascular lesions and increased rates of proliferation and pro-apoptotic signaling of lung endothelial and smooth muscle cells and RV dysfunction. The present study confirms that an abnormal pulmonary blood flow (PBF), combined with VEGF receptor blockade, is sufficient to establish severe PAH in rats. Additionally, our study supports the two-hit hypothesis of severe PAH, similar to previous studies in which PNx was paired with the administration of MCT(8, 43). Our study extends previous findings by Sakao et al., who showed that in cultured endothelial cells, SU5416 and shear stress act to promote apoptosis resistance and cell proliferation(29). Additionally, this is the first report of ongoing pro- apoptotic signaling in developed PAH in two animal models.

SU5416 combined with left pneumonectomy induces severe PH As determined by echocardiography and pressure-volume analysis of the RV, the combination of SU5416 and left PNx caused RV dysfunction. Measurements of RVEDD and RVWT confirmed increased RV hypertrophy and RV dimensions, which findings were confirmed by an increase in RV/LV+S. In addition, the systolic function of the RV was affected as shown by a significant decrease in TAPSE. We observed an increase in right lung mass in SuPNx which is possibly explained by compensatory lung growth, edema and/or influx of inflammatory cells after pneumonectomy(27, 28). The bodymass at week 6 is equally lowered in SuHx and SuPNx rats, although SuHx rats show a temporal more profound decline in bodymass in comparison to SuPNx rats in week two. This phenomenon is probably explained by a combination of hypoxia induced diuresis and anorexia which lowers bodymass(16).

The increased TPR in SuPNx model was associated with an increased pulmonary arteriolar mean wall thickness. The increased rates of proliferative and pro-apoptotic cells within and around the lung arterioles support the concept that apoptosis and proliferation are important factors promoting angioproliferation, the ongoing proliferation and proliferative activity in the pulmonary vasculature, in experimental models of pulmonary hypertension(14, 34). Increased proliferation, but not ongoing pro-apoptotic signaling has been reported before in an animal shunt model of PH(18), but in this model cell proliferation was restricted to Characterization of the Sugen Pneumonectomy model 59

the pulmonary vascular smooth muscle cells while no lumen obliteration was observed. Indeed, pneumonectomy combined with MCT induces neotintimal proliferation as does the combination of MCT with an abdominal aortacaval shunt(8, 22, 7). Inflammation, measured by presence of cytotoxic T-cells, B-cells and macrophages occurred in both SuHx and SuPNx models in comparison to control animals.

Comparison of SuHx versus SuPNx The SuHx model is a now frequently utilized model of severe angio-obliterative PAH(5). In comparison to the SuHx-model, the combination of pneumonectomy with VEGF receptor blockade showed several important differences in disease progression. Although the vascular 4 lesions in the SuPNx model are very similar to the SuHx-model, the hyperproliferation of endothelial cells and the resulting obliterative lesions as a consequence of disturbed flow in the SuPNx model, indicate that the endothelial dysfunction and injury do not necessarily require metabolic pathways activated by hypoxia. This might suggest that the hypoxic exposure within the SuHx protocol is important for disturbing the blood flow by its mechanical loss of vascular lumen and this (pulmonary hypoxic vasoconstriction) could explain why no effects of SU5416 are observed in the systemic vasculature. We do note that as a pneumonectomy alone can elicit a hypoxic pathway response it will be of future interest to characterize the hypoxic response in both models in more detail(17). SU5416, by itself, damages endothelial cells, but without a second hit does not cause angio-obliterative luminal changes(14).

It appears that inflammatory components are important, perhaps necessary, for the development of angio-obliterative lesions in animal models of severe PAH. Indeed, in the rat model which combines SU5416 and the allergic inflammatory ovalbumin, the angio- obliterative PH could be prevented by anti-CD20 (anti-B lymphocyte) monoclonal antibody treatment(19). Athymic rats, characterized by their lack of regulatory T-cells (Treg), develop angio-obliterative PH with evidence of inflammatory cell infiltration, when SU5416is administered(20, 35). Reconstitution of the Treg function after pulmonary vascular disease has developed reversed PAH and lung vessel inflammation(33). As the SuHx model is a well established and characterized animal model for PAH, subsequent studies characterizing the SuPNx model will have to show whether there are more similarities and-or differences between the models. This could include the exploration of the role of inflammation and of the immune disequilibrium in the pulmonary vascular remodeling that is triggered by increased pulmonary blood flow in the setting of an injured and inflamed endothelium. Also, vasoconstriction is a major factor that accounts for the increased PVR observed in the 60

SuHx model, and can be relieved by intravenous Fasudil(23). It will be of interest to asses the vasoconstrictive component of the SuPNx model in the future. Finally, further characterization beyond six weeks will also be of interest to investigate whether the disease progression leads to right heart failure and-or the development of plexiform lesions, as observed in SuHx animals at week 14(1).

A hypothetical explanation for the similarities between the SuHx and SuPNx models is that pneumonectomy (through a reduction in pulmonary vascular bed) and hypoxic exposure (through vasoconstriction) both exert their effects via an increased pulmonary blood flow velocity. We propose that abnormal PBF induced activation and injury of lung vascular endothelial cells can not be repaired when SU5416 impairs signaling via VEGF receptors, which is required for the homeostatic maintenance of lung vessels(40). Since VEGFR2 and VEGFR3 are both part of a mechanosensory complex in endothelial cells it can be argued that SU5416 interferes with this complex, thereby hampering EC mechanosensing (4, 37). A failure of normal adaptation to changes in PBF may be crucial in the development of pulmonary vascular remodeling. Indeed, recent findings indicate that late-stage inhibition of caspases can stabilize PECAM-1 levels thereby restoring endothelial shear-responsiveness in vitro, while in-vivo reverse remodeling was observed in the SuHx model (32).

Perspectives and conclusion In summary, we have shown that the combination of SU5416 and PNx causes severe angio- obliterative pulmonary hypertension associated with increased cell proliferation andpro- apoptotic signaling resulting in neointima and medial remodeling. Perhaps this SuPNx model can serve as an alternative model or complementary model of severe angio-obliterative PAH that can be employed to further study the detailed mechanisms underlying high pulmonary blood flow related vascular remodeling, including the study of endothelial mesenchymal transition and the specific interactions between apoptosis and proliferation of vascular wall cells(9, 26). Some of the advantages that SuPNx could offer over SuHx is that by design in the SuHx model, temporal exposure to hypoxia and reversal of hypoxic vasoconstriction and hemoconcentration upon return to normoxia results in a partial reversibility of pulmonary hypertension. This aspect of reversibility is reflected by some decrease in RVSP and RV hypertrophy after the hypoxic period and may complicate drug treatment studies when using the SuHx model. Because the SuPNx model lacks the element of hypoxic vasoconstriction and hemoconcentration, the RVSP after pneumonectomy increases gradually over time, which may favor the assessment of drug effects in preclinical trials. Characterization of the Sugen Pneumonectomy model 61

Our study together with previous studies on experimental models of pulmonary hypertension shows that the typical histopathological findings of PAH, including obliterative lesions, inflammation, increased cell turnover and ongoing apoptosis represent a final common pathway of a disease that can evolve as a consequence of a variety of insults to the lung vasculature

Acknowledgements

We acknowledge the support from the Dutch Lung Foundation (Longfonds, grant number 4 3.3.12.036) and the Netherlands CardioVascular Research Initiative: the Dutch Heart Foundation, Dutch Federation of University Medical Centers, the Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Sciences grant number 2012-08 awarded to the Phaedra consortium (www.phaedraresearch.nl) 62

References Life after corpse engulfment: phagocytosis of apoptotic cells leads to VEGF secretion and cell growth. FASEB J 18: 1716–1718, 2004. 1. Abe K, Toba M, Alzoubi A, Ito M, Fagan KA, Cool CD, 10. Guignabert C, Tu L, Le Hiress M, Ricard N, Sattler Voelkel NF, McMurtry IF, Oka M. Formation of Plexiform C, Seferian A, Huertas A, Humbert M, Montani D. Lesions in Experimental Severe Pulmonary Arterial Pathogenesis of pulmonary arterial hypertension: Hypertension. Circulation 121: 2747–2754, 2010. lessons from cancer. Eur Respir Rev Off J Eur Respir Soc 2. Chemla D, Castelain V, Humbert M, Hébert J-L, 22: 543–551, 2013. Simonneau G, Lecarpentier Y, Hervé P. New formula 11. Handoko ML, Man FS de, Happé CM, Schalij I, for predicting mean pulmonary artery pressure using Musters RJP, Westerhof N, Postmus PE, Paulus WJ, systolic pulmonary artery pressure. Chest 126: 1313– Laarse WJ van der, Vonk-Noordegraaf A. Opposite 1317, 2004. Effects of Training in Rats With Stable and Progressive 3. Chiu J-J, Chien S. Effects of disturbed flow on vascular Pulmonary Hypertension. Circulation 120: 42–49, 2009. endothelium: pathophysiological basis and clinical 12. Handoko ML, Schalij I, Kramer K, Sebkhi A, Postmus perspectives. Physiol Rev 91: 327–387, 2011. PE, van der Laarse WJ, wPaulus WJ, Vonk-Noordegraaf 4. Coon BG, Baeyens N, Han J, Budatha M, Ross TD, Fang A. A refined radio-telemetry technique to monitor right JS, Yun S, Thomas J-L, Schwartz MA. Intramembrane ventricle or pulmonary artery pressures in rats: a useful binding of VE-cadherin to VEGFR2 and VEGFR3 tool in pulmonary hypertension research. Pflugers Arch assembles the endothelial mechanosensory complex. J 455: 951–959, 2008. Cell Biol 208: 975–986, 2015. 13. Jones JE, Mendes L, Rudd MA, Russo G, Loscalzo J, 5. de Raaf MA, Schalij I, Gomez-Arroyo J, Rol N, Happé Zhang Y-Y. Serial noninvasive assessment of progressive C, de Man FS, Vonk-Noordegraaf A, Westerhof N, pulmonary hypertension in a rat model. Am J Physiol Voelkel NF, Bogaard HJ. SuHx rat model: partly reversible Heart Circ Physiol 283: H364–371, 2002. pulmonary hypertension and progressive intima 14. Kasahara Y, Tuder RM, Taraseviciene-Stewart L, Le obstruction. Eur Respir J 44: 160–168, 2014. Cras TD, Abman S, Hirth PK, Waltenberger J, Voelkel NF. 6. Dickinson MG, Bartelds B, Borgdorff MAJ, Berger RMF. Inhibition of VEGF receptors causes lung cell apoptosis The role of disturbed blood flow in the development and emphysema. J Clin Invest 106: 1311–1319, 2000. of pulmonary arterial hypertension: lessons from 15. Kato Y, Iwase M, Kanazawa H, Kawata N, Yoshimori Y, preclinical animal models. Am J Physiol - Lung Cell Mol Hashimoto K, Yokoi T, Noda A, Takagi K, Koike Y, Nishizawa Physiol 305: L1–L14, 2013. T, Nishimura M, Yokota M. Progressive development of 7. Dickinson MG, Bartelds B, Molema G, Borgdorff MA, pulmonary hypertension leading to right ventricular Boersma B, Takens J, Weij M, Wichers P, Sietsma H, Berger hypertrophy assessed by echocardiography in rats. Exp RMF. Egr-1 Expression During Neointimal Development Anim Jpn Assoc Lab Anim Sci 52: 285–294, 2003. in Flow-Associated Pulmonary Hypertension. Am J 16. Kim N, Voicu L, Hare GMT, Cheema-Dhadli S, Chong Pathol 179: 2199–2209, 2011. CK, Chan SKW, Bichet DG, Halperin ML, Mazer CD. 8. Dorfmüller P, Chaumais M-C, Giannakouli M, Response of the renal inner medulla to hypoxia: possible Durand-Gasselin I, Raymond N, Fadel E, Mercier O, defense mechanisms. Nephron Physiol 121: p1–7, 2012. Charlotte F, Montani D, Simonneau G, Humbert M, 17. Li D, Fernandez LG, Dodd-o J, Langer J, Wang Perros F. Increased oxidative stress and severe arterial D, Laubach VE. Upregulation of Hypoxia-Induced remodeling induced by permanent high-flow challenge Mitogenic Factor in Compensatory Lung Growth after in experimental pulmonary hypertension. Respir Res 12: Pneumonectomy. Am J Respir Cell Mol Biol 32: 185–191, 119, 2011. 2005. 9. Golpon HA, Fadok VA, Taraseviciene-Stewart L, 18. Li F, Xia W, Li A, Zhao C, Sun R. Long-term inhibition Scerbavicius R, Sauer C, Welte T, Henson PM, Voelkel NF. of Rho kinase with fasudil attenuates high flow induced Characterization of the Sugen Pneumonectomy model 63

pulmonary artery remodeling in rats. Pharmacol Res 55: Res 14: 157–182, 1988. 64–71, 2007. 28. Ravikumar P, Yilmaz C, Bellotto DJ, Dane DM, Estrera 19. Mizuno S, Farkas L, Husseini AA, Farkas D, Gomez- AS, Hsia CCW. Separating in vivo mechanical stimuli Arroyo J, Kraskauskas D, Nicolls MR, Cool CD, Bogaard for postpneumonectomy compensation: imaging and HJ, Voelkel NF. Severe Pulmonary Arterial Hypertension ultrastructural assessment. J Appl Physiol 114: 961–970, Induced by SU5416 and Ovalbumin Immunization. Am J 2013. Respir Cell Mol Biol 47: 679–687, 2012. 29. Sakao S, Tatsumi K. The Effects of Antiangiogenic 20. Nicolls MR, Mizuno S, Taraseviciene-Stewart L, Farkas Compound SU5416 in a Rat Model of Pulmonary Arterial L, Drake JI, Al Husseini A, Gomez-Arroyo JG, Voelkel NF, Hypertension. Respiration 81: 253–261, 2011. Bogaard HJ. New models of pulmonary hypertension 30. Selimovic N, Rundqvist B, Bergh C-H, Andersson B, based on VEGF receptor blockade-induced endothelial Petersson S, Johansson L, Bech-Hanssen O. Assessment cell apoptosis. Pulm Circ 2: 434–442, 2012. of pulmonary vascular resistance by Doppler 4 21. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson echocardiography in patients with pulmonary arterial GA, Botney MD. Pulmonary hemodynamics modify the hypertension. J Heart Lung Transplant Off Publ Int Soc rat pulmonary artery response to injury. A neointimal Heart Transplant 26: 927–934, 2007. model of pulmonary hypertension. Am J Pathol 151: 31. Simonneau G, Robbins IM, Beghetti M, Channick 1019–1025, 1997. RN, Delcroix M, Denton CP, Elliott CG, Gaine SP, Gladwin 22. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson MT, Jing Z-C, Krowka MJ, Langleben D, Nakanishi N, GA, Botney MD. Pulmonary hemodynamics modify the Souza R. Updated clinical classification of pulmonary rat pulmonary artery response to injury. A neointimal hypertension. J Am Coll Cardiol 54: S43–54, 2009. model of pulmonary hypertension. Am J Pathol 151: 32. Szulcek R, Happé CM, Rol N, Fontijn RD, Dickhoff 1019–1025, 1997. C, Hartemink KJ, Grünberg K, Tu L, Timens W, Nossent 23. Oka M, Homma N, Taraseviciene-Stewart L, Morris GD, Paul MA, Leyen TA, Horrevoets AJ, de Man FS, KG, Kraskauskas D, Burns N, Voelkel NF, McMurtry IF. Guignabert C, Yu PB, Vonk-Noordegraaf A, van Nieuw Rho Kinase–Mediated Vasoconstriction Is Important in Amerongen GP, Bogaard HJ. Delayed Microvascular Severe Occlusive Pulmonary Arterial Hypertension in Shear-adaptation in Pulmonary Arterial Hypertension: Rats. Circ Res 100: 923–929, 2007. Role of PECAM-1 Cleavage. Am. J. Respir. Crit. Care Med. 24. Plante E, Lachance D, Roussel E, Drolet M-C, Arsenault ( January 13, 2016). doi: 10.1164/rccm.201506-1231OC. M, Couet J. Impact of anesthesia on echocardiographic 33. Tamosiuniene R, Nicolls MR. Regulatory T cells and evaluation of systolic and diastolic function in rats. J Pulmonary Hypertension. Trends Cardiovasc Med 21: Am Soc Echocardiogr Off Publ Am Soc Echocardiogr 19: 166–171, 2011. 1520–1525, 2006. 34. Taraseviciene-Stewart L, Kasahara Y, Alger L, Hirth 25. Rai PR, Cool CD, King JAC, Stevens T, Burns N, Winn P, Mc Mahon G, Waltenberger J, Voelkel NF, Tuder RM. RA, Kasper M, Voelkel NF. The cancer paradigm of severe Inhibition of the VEGF receptor 2 combined with chronic pulmonary arterial hypertension. Am J Respir Crit Care hypoxia causes cell death-dependent pulmonary Med 178: 558–564, 2008. endothelial cell proliferation and severe pulmonary 26. Ranchoux B, Antigny F, Rucker-Martin C, Hautefort hypertension. FASEB J Off Publ Fed Am Soc Exp Biol 15: A, Péchoux C, Bogaard HJ, Dorfmüller P, Remy S, Lecerf 427–438, 2001. F, Planté S, Chat S, Fadel E, Houssaini A, Anegon I, Adnot 35. Taraseviciene-Stewart L, Nicolls MR, Kraskauskas S, Simonneau G, Humbert M, Cohen-Kaminsky S, Perros D, Scerbavicius R, Burns N, Cool C, Wood K, Parr JE, F. Endothelial-to-Mesenchymal Transition in Pulmonary Boackle SA, Voelkel NF. Absence of T Cells Confers Hypertension. Circulation 131: 1006–1018, 2015. Increased Pulmonary Arterial Hypertension and 27. Rannels DE, Rannels SR. Compensatory growth of Vascular Remodeling. Am J Respir Crit Care Med 175: the lung following partial pneumonectomy. Exp Lung 1280–1289, 2007. 64

36. Toba M, Alzoubi A, O’Neill KD, Gairhe S, Matsumoto Y, Oshima K, Abe K, Oka M, McMurtry IF. Temporal hemodynamic and histological progression in Sugen5416/hypoxia/normoxia-exposed pulmonary arterial hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. ( November 15, 2013). doi: 10.1152/ ajpheart.00728.2013. 37. Tzima E, Irani-Tehrani M, Kiosses WB, Dejana E, Schultz DA, Engelhardt B, Cao G, DeLisser H, Schwartz MA. A mechanosensory complex that mediates the endothelial cell response to fluid shear stress. Nature 437: 426–431, 2005. 38. van Albada ME, Bartelds B, Wijnberg H, Mohaupt S, Dickinson MG, Schoemaker RG, Kooi K, Gerbens F, Berger RMF. Gene expression profile in flow-associated pulmonary arterial hypertension with neointimal lesions. Am J Physiol Lung Cell Mol Physiol 298: L483– 491, 2010. 39. Voelkel NF, Gomez-Arroyo J, Abbate A, Bogaard HJ, Nicolls MR. Pathobiology of pulmonary arterial hypertension and right ventricular failure. Eur Respir J 40: 1555–1565, 2012. 40. Voelkel NF, Vandivier RW, Tuder RM. Vascular endothelial growth factor in the lung. Am J Physiol - Lung Cell Mol Physiol 290: L209–L221, 2006. 41. Westerhof N, Stergiopulos N, Noble MIM. Snapshots of Hemodynamics: An Aid for Clinical Research and Graduate Education. Springer Science & Business Media, 2010. 42. White RJ, Meoli DF, Swarthout RF, Kallop DY, Galaria II, Harvey JL, Miller CM, Blaxall BC, Hall CM, Pierce RA, Cool CD, Taubman MB. Plexiform-like lesions and increased tissue factor expression in a rat model of severe pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol 293: L583–590, 2007. 43. White RJ, Meoli DF, Swarthout RF, Kallop DY, Galaria II, Harvey JL, Miller CM, Blaxall BC, Hall CM, Pierce RA, Cool CD, Taubman MB. Plexiform-like lesions and increased tissue factor expression in a rat model of severe pulmonary arterial hypertension. Am J Physiol - Lung Cell Mol Physiol 293: L583–L590, 2007. Characterization of the Sugen Pneumonectomy model 65

Characterization of the Sugen Pneumonectomy model 67 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0,05 VALUE - P * 2,1 0,4 0,2 0,5 0,06 23,0 18,4 0,1 2,0 8,2 17,3 3,1 32,5 0,5 2,0 13,5 0,1 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± PNX 0,9 2,8 2,9 0,2 0,3 3,4 8,8 0,4 13,1 80,3 29,9 29,6 42,0 14,1 54,1 370,9 120,0 4 4,4 0,1 0,3 0,3 0,03 21,5 10,4 0,1 1,9 1,9 25,1 0,9 31,0 2,8 1,3 8,4 0,2 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± SU 1,0 3,0 3,2 0,2 0,3 2,1 0,4 16,9 64,4 26,9 23,5 52,3 10,1 12,8 41,9 384,7 143,0 CON= control ; SU= SU5416 ; PNx = pneumonectomy; Abbrevations: Estimated right right Estimated Abbrevations: pneumonectomy; = PNx ; SU5416 SU= ; control CON= 2 weeks 4,9 0,3 0,4 0,2 0,06 23,6 20,2 0,1 2,2 2,5 22,2 0,9 33,0 1,3 1,5 3,1 0,1 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± CON 1,0 2,3 3,2 0,2 0,3 3,1 7,9 0,3 13,7 88,2 24,6 25,4 55,6 10,5 24,2 409,0 101,0 PAAT/CL (mm) RVWT (mm) RVEDD TAPSE (mm) SV (ml) HR (bpm) CO (ml) (mmHg/ml.min) TPR (mmHg) eRVSP (mmHg) RVSP RV EES (mmHg/ml) (mmHg/ml) EED RV (mmHg/ml) EA RV Intima fraction (%) Media fraction (%) Right lung mass (gr) Fulton/RV/(LV+S) Table I - Characteristics of Sugen or Pneumonectomy versus control at 2 weeks: weeks: 2 at control versus Pneumonectomy or Sugen of Characteristics - I Table ventricle ventricle systolic pressure (eRVSP); Pulmonary artery acceleration time / cycle Right ventriclelength(PAAT/CL); wall thickness(RVWT); Right ventricle end diastolic diameter (RVEDD); Tricuspid annular plane systolic excursion (TAPSE); Stroke Volume (SV); Cardiac output (CO); pulmonary Total resistance (TPR); RV end-systolic pressure (ESP); RV Contractility (endsystolic elastance/Ees); D:RVstiffness (end diastolic stiffness/Eed);RV afterload; * = p<0,05; indicates differencevs. controlr 68 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0,05 0,05 VALUE - P * 2,2 0,2 1,1 0,4 0,03 23,0 11,9 0,1 2,1 2,3 11,8 0,7 24,4 1,6 8,2 12,5 0,1 0,1 0,1 0,1 0,2 0,2 0,2 0,1 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± PNX 1,4 4,9 2,7 0,2 0,4 1,8 0,3 0,1 0,3 0,1 0,4 0,6 0,4 0,3 12,5 69,7 31,7 25,2 31,0 12,2 21,2 43,9 383,0 101,5 3,9 0,3 0,9 0,6 0,04 42,0 15,6 0,0 4,0 6,3 11,0 0,8 47,7 1,5 2,4 4,8 0,1 0,1 0,1 0,2 0,2 0,2 0,2 0.1* ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± SU 1,2 4,4 2,7 0,2 0,3 2,6 0,2 0,1 0,2 0,2 0,6 0,6 0,4 0,9 11,8 72,9 24,4 24,0 33,9 12,0 16,7 30,5 333,0 112,3 6 weeks6 CON= control ; SU= SU5416 ; PNx = pneumonectomy; Abbrevations: Estimated right ventricle ventricle right Estimated Abbrevations: pneumonectomy; = PNx ; SU5416 SU= ; control CON= 3,5 0,2 0,8 0,5 0,05 8,0 19,9 0,1 4,0 4,5 10,0 0,9 52,9 0,1 2,8 2,2 0,0 0,1 0,1 0,1 0,2 0,2 0,1 0,1 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± CON 1,1 3,9 2,6 0,2 0,2 2,3 7,6 0,2 0,1 0,1 0,1 0,3 0,4 0,3 0,2 15,5 80,9 27,4 22,9 30,4 94,4 12,0 26,3 345,0 3 EC 3 S MC - - PAAT/CL (mm) RVWT RVEDD (mm) (mm) TAPSE (ml) SV HR (bpm) CO (ml) (mmHg/ml.min) TPR eRVSP (mmHg) RVSP (mmHg) (mmHg/ml) EES RV RV EED (mmHg/ml) RV EA (mmHg/ml) Intima fraction (%) Media (%) fraction (gr) Right lung mass Fulton/RV/(LV+S) PCNA EC PCNA SMC Cleaved caspase Cleaved caspase CD8 CD20 CD68 Table II - Characteristics of Sugen or Pneumonectomy versus control at 6 weeks: weeks: 6 at control versus Pneumonectomy or Sugen of Characteristics - II Table systolic pressure (eRVSP); Pulmonary artery acceleration time / cycle length (PAAT/CL); Right ventricle wall thickness (RVWT); Right ventricle end diastolic diameter (RVEDD); diameter diastolic end ventricle Right (RVWT); thickness wall Contractility ventricle RV Right (ESP); pressure (PAAT/CL); end-systolic length RV / cycle (TPR); time resistance pulmonary acceleration artery Total Pulmonary (CO); (eRVSP); output pressure Cardiac systolic (SV); Volume Stroke (TAPSE); excursion vs. control systolic plane difference indicates annular * = p<0,05; Tricuspid (PNCA); antigen cell nuclear Proliferating afterload; RV stiffness/Eed); diastolic (end stiffness D:RV elastance/Ees); systolic (end Loss of PECAM-1 causes delayed microvascular endothelial shear-adaptation in Pulmonary 5 Arterial Hypertension

R. Szulcek • C.M. Happé • N. Rol • R. Fontijn • K.J. Hartemink • K. Grünberg • L. Tu • W. Timens • G. Nossent • J.D. van Buul • M.A. Paul • E. Fadel • T.A. Leyen • A. Horrevoets • F.S. de Man • C. Guignabert • P.B. Yu • A. Vonk- Noordegraaf • G.P. van Nieuw Amerongen • H.J. Bogaard

American Journal of Respiratory Care and Critical Care Medicine • 2016

Loss of PECAM-1 in PAH 71

ABSTRACT

Introduction: Altered pulmonary hemodynamics and high fluid shear stress (HSS) have been associated with the development of pulmonary arterial hypertension (PAH). However, the exact role of HSS in PAH specific vascular remodeling is currently unclear. Therefore, we investigated the shear-responsiveness of primary lung endothelial cells (EC) cultured from PAH patient lung biopsies and explored the role of HSS as an acute trigger for endothelial injury.

Methods and Results: Pulmonary microvascular EC isolated from patients with diverse etiologies of Group I PAH (n=7) showed a delayed morphological shear-adaptation, with evidence of endothelial damage at sites of non-uniform shear profiles, whereas pulmonary 5 artery EC isolated from the same PAH patient lungs (n=3) adapted their morphology to shear similar to control EC (n=8). Decreased protein levels of the mechanosensor PECAM-1 were observed in PAH microvascular EC and appeared responsible for the defective shear- responsiveness, as silencing of PECAM-1 in control EC resembled the delayed shear- adaptation, whereas treatment of PAH EC with the broad caspase inhibitor Z-Asp improved PECAM-1 levels and normalized shear-responsiveness. These observations were consistent regardless of the specific disease etiology (idiopathic, associated, and heritable PAH with BMPR2 mutation).

Conclusion: Decreased PECAM-1 expression appears to be an intrinsic feature of microvascular endothelial dysfunction in PAH and suggests that the delayed morphological shear-adaptation promotes susceptibility to shear-induced endothelial injury in all forms of PAH. 72

Introduction

The term ‘pulmonary arterial hypertension’ (PAH) comprises a highly heterogeneous group of deadly lung diseases that occurs in idiopathic and heritable forms, but is more frequently associated with connective tissue disease, congenital heart disease, and exposure to drugs, toxins and hypoxia 1. The underlying mechanisms that give rise to PAH are poorly understood, but thought to entail the combination of multiple risk factors or ‘hits’, involving increased vulnerability to vascular injury or defective vascular repair 2,3. Together, these multiple hits facilitate the selective outgrowth of abnormal pulmonary vascular cells, including endothelial cells (EC) that comprise several hallmarks of cancer 4,5. The exuberant cellular growth culminates in characteristic occlusive pulmonary vascular remodeling and pre-capillary pulmonary hypertension 6, which eventually lead to right heart failure 7. A major focus of current research aims to understand the genetic and molecular basis for the EC phenotype shift and to evaluate anti-proliferative therapies to reverse remodeling and unburden the right ventricle 8–10. Despite recent advances in preclinical animal models, the multifactorial nature of PAH causes an enormous translational gap 11 leaving 3 year survival unacceptable low 12,13 and calling for a unifying mechanism.

Altered hemodynamics in the lung microvasculature were among the first recognized causes for the occlusive PAH remodeling 14, including high shear stress (HSS) and irregular blood flow patterns, which can be caused by an abnormal vasomotor tone 15, congenital heart disease 16 or chronic thromboembolic pulmonary hypertension 17. Nevertheless, HSS by itself appears insufficient to initiate PAH-like remodeling experimentally18–20 and clinically, as only 10% of patients with uncorrected atrial septal defects develop PAH 1. Consequently, HSS is seen as a pre-disposition that must synergize with some form of EC dysfunction or injury to cause remodeling21,22. While the exact nature of this ‘second hit’ remains elusive, experimentally blockade of vascular endothelial growth factor receptor 2 (VEGFR2) signaling has been frequently used23. VEGFR2 is mainly known for its function in vascular development 24, but also forms a shear-sensor complex with the two transmembrane proteins VE- cadherin and PECAM-1 25, which are of central importance for the formation of endothelial- specific cell-cell adhesions and signal transduction 26. VEGFR2 blockade may thereby cause dysfunction of EC shear-sensing, leaving the cells unable to adapt morphology and function to the increased mechanical force. While there is little evidence for the direct involvement of VEGFR2 inhibition in clinical PAH 27,28, it is conceivable that other mechanisms like toxins, infections, intrinsic defects and perhaps even genetic mutations interfere with ECshear- Loss of PECAM-1 in PAH 73

responsiveness, which could be the pivotal source for vascular injury. Yet, the effect of HSS on pulmonary EC from PAH patients has never been tested.

In this study we hypothesized that a defective responsiveness of pulmonary EC to alterations in fluid shear stress is an intrinsic component of EC dysfunction in PAH and explored the role of HSS as an acute trigger for EC injury.

Methods

Primary cell isolation Lobectomy tissue was used for control MVEC isolations. Pulmonary artery rings and peripheral microvascular tissue for the isolation of PAH EC were obtained from 5 clinically well characterized PAH Group I patients (familial, associated and iPAH cases) (Table 1). Primary lung EC showed typical growth patterns emerging into cobblestone monolayers and were positive for endothelial markers (Supplemental Figure E1). Cell isolation was based on the previously published protocol (18) and modified as specified in the online supplement. The study was approved by the IRB of the VU University Medical Center (VUmc, Amsterdam, The Netherlands) and consent was given.

No Surger mPAP (mmHg) Etiology Treatment Gender Age (yr) . y

1 69 assoc. PAH PDE5-I, ERA F 59 Obd

2* N.A. iPAH PDE5-I M 9 Ltx

3 65 iPAH PDE5-I, ERA, PGI2 F 54 Obd

4* N.A. assoc. PAH None M 32 Obd

5* 64 hPAH PDE5-I, ERA, PGI2 F 40 Ltx

6 43 iPAH PDE5-I, PGI2 F 42 Ltx

7 89 iPAH PDE5-I, ERA, PGI2 F 22 Ltx

Table 1: PAH patient characteristics for the isolation of pulmonary microvascular endothelial cells. Abbreviations: PAH=Pulmonary Arterial Hypertension; iPAH=idiopathic PAH; hPAH=heritable PAH with BMPR2 mutation; assoc. PAH=PAH associated with other disease (mostly scleroderma); mPAP=mean pulmonary artery pressure; Obd=obduction; Ltx=lung transplantation; *pulmonary artery cells isolated from the same patient lung; N.A.=not available. 74

Animals Sugen (SU5416, Tocris Bioscience, Bristol, UK) and Hypoxia (SuHx) mediated PAHlike vascular remodeling was induced as described previously (19). The treatment group received an intraperitoneal bolus injections of the pan-caspase inhibitor Z-Asp- 2,6-dichlorobenzoyloxymethylketone (2 mg/rat, Z-Asp, ALX-260-029, Enzo Life Science, Farmingdale, NY, USA) 3 times a week for 2 weeks starting at the normoxic period (20). The study was approved by the local animal welfare committee (VU-FYS 13-01, VUmc). For details refer to the supplement.

Shear stress Ibidi µ-slides (Integrated BioDiagnostics, Munich, Germany), with varying channel geometries (Figure S2, B and C), were used to apply laminar and non-uniform flow profiles.24 Cells were seeded with 40,000 cells/cm2 and allowed to attach. Thereafter unidirectional, pulsatile shear stress was gradually increased (2.5; 15; 21 dyn/cm2) in intervals of 24 h (Figure S2, A). Shear- adaptation, based on cell morphology and orientation, was quantified from phase-contrast images using Photoshop CS6 (Adobe, San Jose, CA, USA). Cells were defined shear-adapted when 75% of the cells elongated (twice as long as wide). Details in the online supplement.

RT-PCR, immunofluorescence, histology, Western blots, kits and reagents For Western blot analysis antibodies were used against PECAM-1 recognizing extracellular (MEM-05, Invitrogen, Carlsbad, CA, USA) or intracellular epitopes (C- 20, Santa Cruz Biotechnology, Dallas, TX, USA) in human samples and c-terminal epitopes in rats (Abbiotec, San Diego, CA, USA). The Image-iT™ LIVE Green Caspase Detection Kit (Molecular Probes, Eugene, OR, USA) and the DeadEnd™ Fluorometric TUNEL assay (Promega, Fitchburg, WI, USA) were used in accordance with manufacturer’s instructions. Z-Asp was applied in-vitro in a final concentration of 20 µM. Details are made available online.

Cell transfection and PECAM-1 silencing 20 pM siRNA pool against PECAM-1 (Santa Cruz) or non-targeting scRNA (scrambled, Santa Cruz) was transfected by electroporation. Refer to the online supplement for details.

Statistics Software, San Diego, CA, USA) and p-values ≤0.05 were considered significant. Dataare presented as mean ± SEM. Software, San Diego, CA, USA) and p-values ≤0.05 were considered significant. Data are presented as mean ± SEM. Loss of PECAM-1 in PAH 75

Results

Morphological shear-adaptation of MVEC, but not PAEC is delayed in PAH Pulmonary EC from different vascular beds and different etiologies were exposed to HSS to test the hypothesis that PAH EC have a defective shear-response (Figure 1). Control MVEC responded quickly to HSS, with 57.0±3.9% of cells acquiring an elongated morphology after 24 h and 35.6±6.0% of the cells aligning within a close angel of 30° to the axis of flow (Supplemental Figure E3). Shear-adaptation of PAH MVEC was diminished, as only 45.8±2.8% of the cells elongated after the first 24 h. The remaining PAH MVEC persisted in their non-adapted, cobblestone morphology, whereas PAH PAEC isolated from the same PAH lungs adapted with similar efficiency as control MVEC and thereby significantly faster (p=0.02) than their microvascular counterparts. After 72 h control MVEC and PAH PAEC had reached full shear-adaptation with 5 ≥75% of all cells elongated. In clear contrast, only 60.4±1.8% of the PAH MVEC had elongated at this point in time and did not reach full shear-adaptation until 120 h after shear onset.

Figure 1 - Morphological shear-adaptation of PAH MVEC is delayed. Representative phase-contrast images (scale 400 µm) of control MVEC, PAH MVEC and PAH PAEC after exposure to HSS for 24, 72 and 120 h. Arrow indicates direction of flow. Inlays show 1.5x magnifications (scale 200 µm).To the right, quantifications of shear- adaptation (nCtrl=8; nPAH=7 and nPAEC=3, 1-way ANOVA) presented as number of not shear-adapted cells. 76

Taken together, MVEC from iPAH, familial and associated Group I PAH patients presented with a delayed EC shear-adaptation with most pronounced morphological differences at 72 h after shear onset.

PECAM-1 protein levels are decreased in PAH MVEC To gain mechanistic insight in the delayed shear-adaptation of PAH MVEC, protein expression of the known shear-sensors VE-cadherin, PECAM-1 and VEGFR2 (15) was quantified in static cultures (Figure 2A). Of the three proteins PECAM-1 was significantly decreased (p=0.02) in PAH MVEC, whereas VE-cadherin and VEGFR2 levels were similar to control MVEC. To put the decreased PECAM-1 protein levels into context, expression and activation of PECAM-1 signaling mediators was investigated (supplemental Figure E4A). Phosphorylation of ERK1/2 was significantly increased, phosphorylation of SRCand caveolin-1 (CAV-1) levels were significantly decreased as reported previously (22, 23). In clear contrast, the PECAM-1 independent shear-responsive AMP-activated protein kinase (AMPKα) and protein kinase B (AKT) were not differentially expressed in PAH MVEC, wherefore we concluded that specifically PECAM-1 dependent signaling was altered.

Shear-dependent gene regulation is functional in PAH MVEC To elucidate whether the decreased PECAM-1 protein expression is caused by a transcriptional defect, gene expression of the three shear-sensor genes VE-cadherin, PECAM-1 and VEGFR2 was quantified (Figure 2B). Both PAH and control MVEC exhibited similar mRNA expression levels with no differences under static culture conditions. Furthermore, gene expression of the candidate shear-responsive genes was compared after 72 h HSS to test, whether defective shear-dependent activation is causative forthe delayed shear-response. Also here, PAH and control MVEC showed a similar increase in mRNA levels indicating an intact transcriptional shear response. Further, increased levels of BMPR2 and SMAD6 in control and PAH MVEC, suggested functional shear-induced BMP signaling (Supplemental Figure E4B). Interestingly, TGF-β1 expression in PAH MVEC was increased by 2-fold, which taken together with the slightly increased levels of SMAD7 and PAI1, suggested excessive TGF-β signaling in PAH MVEC after HSS challenge, which is in-line with the current understanding of imbalanced TGF/BMP-signaling in PAH (24). Loss of PECAM-1 in PAH 77

PECAM-1 inter-endothelial localization is disturbed in PAH MVEC The tested genes did neither explain the decreased PECAM-1 protein levels nor the altered PAH MVEC shear-response. Therefore, sub-cellular localization of PECAM-1 was assessed, as it is essential for its function (25) and to rule out posttranscriptional effects. Under static as well as HSS conditions (Figure 2C and D) PAH MVEC showed an intermittent distribution of PECAM-1 with areas entirely lacking the junctional protein, while control MVEC exhibited a uniform peripheral PECAM-1 staining in both culture conditions. Interestingly, VE-cadherin was found unaltered under the tested conditions, which showed that loss of cell material does not contribute to the diminished PECAM-1 levels in PAH MVEC. The side-by-side comparison further underlined the differences in morphological shear-adaptation and the summarized changes in PECAM-1 protein expression and localization suggested a central role for PECAM-1 in the delayed PAH shear-adaptation. 5

Figure 2 - PECAM-1 protein expression and inter-endothelial localization are disturbed in PAH MVEC. (A) Protein expression of the shear-sensors VE-cadherin, PECAM-1 and VEGFR2 in static control vs. PAH MVEC (nCtrl=6 and nPAH=7, unpaired student’s t-test). Representative Western blots are shown. Data normalized to total ERK1/2. (B) Relative mRNA expression of control and PAH MVEC under static culture conditions and after 72 h of HSS (nCtrl=3 and nPAH=3, 2-way ANOVA). (C) Representative PECAM-1 and VE-cadherin immunostaining of control and PAH MVEC under static culture conditions and (D) 72 h after HSS (scale 50 µm). Arrow heads highlight areas of low peripheral PECAM-1. Nuclei were counter-stained with Hoechst. Image intensities are not equal. Arrow represents direction of flow. 78

PAH MVEC are susceptible to injury at sites of non-uniform shear profiles Vascular branch points, which are characterized by non-uniform shear profiles, are critical loci for the vascular remodeling in PAH (26). We therefore hypothesized that the delayed PAH MVEC shear-adaptation has important implications at these sites (Figure 3). PAH MVEC showed severe cell loss when subjected to non-uniform flow, especially between 48 to 72 h after shear onset, when morphological shear adaptation was incomplete. Immunostaining revealed that PECAM-1 was partly lacking from these areas and specifically from sites of inter- endothelial gaps. PAH MVEC monolayers in areas characterized by laminar flow remained intact, but showed a non-shear-adapted morphology and patchy distribution of PECAM-1.

Figure 3 - The delayed PAH MVEC shear-adaptation facilitates endothelial injury at sites of non-uniform flow profiles. Representative side by side comparison of control and PAH MVEC shear-adaptation 48 h after application of uniform (laminar, inner branch) and non-uniform (bifurcation, outer branch) shear profiles (scale 400 µm). White areas indicate sites of severe cell loss. Arrows present general direction of flow. PECAM-1 (green) and nuclei (blue) were stained (scale 50 µm). Arrow heads indicate inter-endothelial gaps. Due to the channel geometry some auto- fluorescence and light scattering is recognizable. Loss of PECAM-1 in PAH 79

On the contrary, control MVEC adjusted their morphology to the different flow profiles and presented with an intact EC monolayer and homogenous inter- endothelial distribution of PECAM-1. Thus, EC with a delayed adaptation to shear are prone to injury induced by excessive shear rates and non-uniform shear profiles.

Silencing of PECAM-1 resembles delayed PAH MVEC shear-adaptation To determine, whether reduced PECAM-1 protein expression is sufficient to delay EC shear- adaptation similar to PAH MVEC, PECAM-1 was silenced in control MVEC (Figure 4A). PECAM-1 siRNA stably reduced protein expression by 50 to 70% to levels of PAH MVEC during the course of the experiment. PECAM-1 silenced MVEC exhibited a delayed shear-adaptation closely resembling PAH MVEC. The siRNA treated control MVEC did not reach full shear-adaptation until 120 h after shear onset, whereas scrambled controls showed full shear-adaptation at 5 72 h indicating that the decrease in PECAM-1 is causative for the altered shear-response

Inhibition of caspase-mediated PECAM-1 cleavage stabilizes protein levels and restores PAH MVEC shear-responsiveness in-vitro A previous study showed that cytosolic PECAM-1 cleavage is caspase-mediated, however the functional consequence remained widely unclear (27). PAH MVEC exhibited increased levels of active caspase compared to controls (Figure 4B), which is supported by a recent report showing increased caspase activity in human samples and an animal model of PAH (28). Interestingly, the high levels of active caspase were not related to increased apoptosis (Figure 4C). Therefore, caspase inhibition was tested as a means to stabilize PECAM-1 protein levels and thereby improve shear-responsiveness (Figure 4D). PAH MVEC treated with the pancaspase inhibitor Z-Asp showed an increase in full-length PECAM-1 (130 kDa) and decreased levels of its truncated cytoplasmic 28 kDa fragment, whereas PECAM-1 levels in control MVEC remained unaffected and their shear-response was diminished (Supplemental Figure E5). On the contrary, shear-responses of Z-Asp treated PAH MVEC were normalized to untreated control levels reaching full shear-adaptation 72 h after shear onset (Figure 4D and E), whereas non-treated PAH MVEC showed the typical delay in adaptation. Importantly, the effect of Z-Asp was independent from the etiology of PAH and restored shear-responsiveness in all samples. 80

Figure 4 - PECAM-1 silencing resembles delayed shear-adaptation, whereas stabilization of PECAM-1 normalizes shear-responsiveness in all forms of PAH. (A) Representative phase-contrast images (scale 400 µm) of control MVEC treated with either scrambled RNA (scMVEC) or siRNA against PECAM-1 (siPECAM-1) at 72 h after HSS. Inlays show 1.5x magnifications (scale 200 µm). To the right, representative Western blots for silencing efficiency. Blot intensities were quantified (cursive characters). ERK1/2 was loading control. (B) Representative immunostaining (scale 20 µm) of active caspases (green) in control and PAH MVEC. Cells were partly treated with the caspase inhibitor Z-Asp. Nuclei (blue) were counter stained with Hoechst. (C) Representative TUNEL staining (scale 20 µm). (D) Representative phase- contrast images of PAH MVEC with and without Z-Asp treatment after 72 h HSS. To the right, representative Western blots for full length PECAM-1 (130 kDa) and its truncated cytoplasmic fragment (28 kDa). ERK1/2 and GAPDH were loading controls. (E) Quantification of non-shear adapted cell fractions after 24, 72 and 120 h HSS (nCtrl=3; nPAH=3, unpaired student’s t-test). Loss of PECAM-1 in PAH 81

Stabilization of PECAM-1 by Z-Asp attenuates occlusive remodeling in-vivo Based on the presented in-vitro findings, Z-Asp was administered as an acute intervention to SuHx rats with established PAH to test PECAM-1 stabilization and restoration of the endothelial shear-response as a possible treatment target (Figure 5A). Two weeks repetitive treatment with Z-Asp significantly decreased cleaved caspase 3 isoforms (CC3, p=0.03), as a general marker of pro-apoptotic signaling in the SuHx model (29), and enhanced c-terminal PECAM-1 protein levels (p=0.01) (Figure 5B and C). The treatment reduced arterial elastance (Ea, p=0.03) and total pulmonary resistance (TPR, p=0.007) (Table 2), which was confirmed with histological staining showing a significantly decreased formation of occlusive lesions (p=0.04, Figure 5D). The attenuated occlusive remodeling was caused by a specific and significant reduction in intimal thickness (p=<0.0001) while the media remained thickened indicating endothelial-specific effect of caspase inhibition (Figure 5E). The in-vivo experiments confirm 5 the in-vitro findings showing a positive effect of caspase blockage on PECAM-1 levels and reversal of intimal remodeling in PAH lungs.

Parameter Vehicle Treatment p-‐Value

Lungs TPR 0.8±0.2 0.4±0.1 0.007 Lung mass (corr. TL) 50.0±5.0 50.0±8.0 n.s. RV RVSP (mmHg) 67.0±13.0 61.0±18.0 n.s. Ees (mmHg/mL) 129.8±47.8 114.2±60.2 n.s. Ea (mmHg/mL) 348.7±88.3 253.3±10 0.03 Eed (mmHg/mL) 0.4±0.2 0.4±0.2 n.s. Ees/Ea 3.2±1.8 3.9±1.8 n.s. RV mass (corr. TL) 12.0±2.5 11.0±2.0 n.s. Fulton (RV/(LV+S)) 0.5±0.1 0.5±0.1 n.s. CSA (µm2) 366.0±63.0 313.0±77.0 n.s. LV LV+S mass (corr. TL) 22.0±5.0 24.0±4.0 n.s. CSA (µm2) 223.0±41.0 207.0±65.0 n.s.

Table 2 - Characterization of SuHx rats.Abbreviations: TPR=Total Pulmonary Resistance; TL=; RVSP=Right ventricular systolic pressure; Ees=End systolic elastance; Ea=Arterial elastance; Eed=End diastolic stiffness; RV=Right ventricule; LV+S=Left ventricle and septum; CSA=Cardiomyocyte cross sectional area. 82

Figure 5 - Caspase inhibition stabilizes PECAM-1 levels and attenuates intimal thickening in SuHx rats. (A) Study design. SuHx rats were treated with vehicle or ZAsp after the hypoxic period and control animals, held under normoxic conditions were, vehicle treated (nctrl=5, nSuHx=8, nZ-Asp=12, 1-way ANOVA or unpaired student’s t-test). (B) Relative protein expression of active caspase 3 as a general marker for pro-apoptotic signaling and (C) c-terminal PECAM-1 in whole lung lysates. Representative blots are shown with β-actin as loading control. (D) Representative immunohistochemical staining for vWF (green), α-SMA (red) and nuclei (blue) on small peripheral lung vessels (outer diameter ≤60 µm, scale 20 µm). To the right corresponding quantification of vessels characterized by occlusive lesions. (E) Representative Elastic van Gieson staining (scale 20 µm) and associated quantifications of intimal and medial wall thickness. Loss of PECAM-1 in PAH 83

Discussion

We identified a novel dysfunction specific to the pulmonary microvascular endothelium of patients with diverse PAH etiologies, which manifests as a delayed morphological adaptation to HSS, facilitates susceptibility to shear-induced endothelial injury, and is caused by caspase- mediated cleavage of the shear sensor PECAM-1 (Figure 6). Importantly, we demonstrated that stabilization of PECAM-1 by caspase inhibition restored shear responsiveness in vitro and attenuated occlusive remodeling in vivo. Our findings support the notion that dysfunctional shear adaptation, shear-induced injury, and vascular remodeling are interrelated, making MVEC shear responsiveness a unifying determinant in several forms of PAH. 5

Figure 6 - Microvascular endothelial cell (MVEC) dysfunction contributes to pulmonary arterial hypertension (PAH) via defective shear responses and consequent shear-induced injury. The defective endothelial response toshear is an intrinsic dysfunction of the microvascular endothelium, wherefore high shear stress might be both a trigger and a maintenance factor for the vascular remodeling in PAH. We propose exuberant proapoptotic signaling and caspase-mediated cytoplasmic cleavage of platelet endothelial cell adhesion molecule-1 (PECAM-1) as cause for the disturbed signaling and delayed shear response. The endothelial shear adaptation can be normalized by prevention of PECAM-1 cleavage through caspase blockage with Z-Asp-2,6-dichlorobenzoyloxymethylketone (Z-Asp). Binding sites of the used PECAM-1 antibodies are depicted in blue. 84

Pulmonary EC dysfunction is a critical element in the pathogenesis of PAH, characterized by loss of vasodilator responses due to a progressive imbalance in favor of endogenous vasoconstrictors, such as serotonin and endothelin-1, which in turn affect the function of various other vascular cells, including smooth muscle cells, fibroblasts, and pericytes (30). Next to dysfunctional vasoconstrictor and growth factor secretion, loss of barrier function is believed to be a feature of endothelial dysfunction in PAH (31). PECAM-1 is an endothelial junction molecule that contributes to overall barrier integrity via homotypic binding (32). Temporal changes in PECAM-1 gene expression, relative protein amounts, and peripheral localization can impair cell–cell cohesion and wound healing capabilities (25, 33). Our findings are in line with these reports showing reduced protein levels and disrupted junctional organization of PECAM-1 in PAH MVEC.

In addition to endothelial barrier regulation and maintenance, PECAM-1 also functions as a scaffold protein that tethers signaling molecules and coordinates signaling in positive and negative feedback loops (25). Although altered PECAM-1 signaling in PAH remains to be fully defined, our data strongly implicate a central role for PECAM-1 in the defective EC shear response, as PECAM-1 silencing fully resembled the PAH MVEC shear phenotype. This is in accordance with extensive evidence suggesting PECAM-1 as direct transducer of mechanical forces (15) that couples fast temporal shear changes into EC and thereby mediates timing of NO-dependent vasodilation (34). However, to our knowledge this report represents the first evidence directly linking defective EC shear responsiveness to a human disease.

Further evidence for a central role of PECAM-1 in pulmonary pathology comes from PECAM-1 knockout mice that possessed context-dependent protective or deteriorating effects in inflammatory as well as other vascular disorders (35) and spontaneously developed lung disease resembling idiopathic pulmonary fibrosis (36), which in humans is associated with pulmonary hypertension (37).

In accordance with our findings, an abnormal EC phenotype suggestive for disturbed endothelial shear responses was early on identified in patients with congenital heart disease who developed PAH with severe vascular remodeling, but the exact role of this misadaptation remained unknown (8). Recent mathematical models have postulated that vascular remodeling in the lung and the increase in shear stress are interdependent and originate from small distal arteries and arterioles (38). By demonstrating that MVEC but not PAEC derived from the same PAH lung, exhibit marked defects in shear adaptation, we confirmed Loss of PECAM-1 in PAH 85

these data and highlight the importance of phenotypic endothelial heterogeneity in PAH (39). Yet, it remains impossible to determine whether delayed shear adaptation and diminished PECAM-1 levels are early contributors or later consequences in PAH, because the tested cells were derived from patients with end-stage disease.

Regardless of whether defective shear adaptation and PECAM-1 expression are early or late developments in PAH, our data suggest that these defects are common to all patients with PAH with the tested etiologies. Therefore, high blood flow velocity might not only be a necessary inducer of endothelial injury and trigger of pulmonary vascular remodeling but furthermore could maintain the vascular pathology. This notion is supported by reports of reversal of occlusive remodeling after normalization of pulmonary blood flow by single lung transplantation (40) and by animal studies showing that hemodynamic alteration by 5 pneumonectomy or hypoxia alone are insufficient to induce occlusive pulmonary vascular remodeling (11, 19). However, at this point it is unknown whether PECAM-1–deficient animals exhibit a greater propensity for PAH when subjected to hypoxia, pneumonectomy, left-to-right shunts, or other PAH risk factors that alter pulmonary hemodynamics.

The finding that gene expression and shear-dependent transcriptional regulation of PECAM-1 was normal, combined with the increased caspase activity in PAH MVEC, led us to the assumption that cleavage might cause the decreased PECAM-1 protein levels, as caspases get activated through post-translational modification via proteolysis. Our assumption was supported by previous findings of caspase-mediated cleavage of PECAM-1 (27) and increased caspase activity in human samples and animal models of PAH (28, 29). Here, onset of PAH-like vascular remodeling in SuHx rats was prevented by caspase inhibition, which was supposedly mediated by apoptosis blockade (12). By using caspase inhibition to restore PECAM-1 levels and thereby shear responsiveness in vitro and reverse established, occlusive remodeling in progressive PAH in vivo, we extended the previous observations and provide an alternative explanation. Furthermore, we showed that the proapoptotic signaling and increased caspase activity led to functional alterations in PAH MVEC but did not cause cell death. Thisis supported by data showing no causal relation between CC3 and cell apoptosis in the SuHx model (29). Mechanistically, the truncated part of PECAM-1 has been proven to exhibit enhanced binding affinity to γ-catenin and SHP-2 and thereby possibly cause competitive inhibition of PECAM-1 signaling (27). Interestingly, drugs like phosphodiesterase inhibitors that are clinically used for the treatment of PAH are also known to prevent cleavage of molecules like VE-cadherin (41). In summary, PAH MVEC function is impeded by caspase- 86

mediated protein alteration, truncation, and disruption of signaling. However, the cells seem to escape cell death by excessive proproliferative signaling, which challenges the idea of an antiapoptotic EC phenotype in end-stage PAH (31).

In conclusion, because of unknown systemic effects, we do not specifically recommend caspase inhibition as a new PAH treatment, although there have been clinical studies in which oral application of caspase inhibitors was well tolerated (42). To that end, our article is meant as a conceptual/mechanical study demonstrating that restoration of EC shear adaptation via stabilization of PECAM-1 attenuated intimal hyperplasia in PAH animals, which could embody an endothelium-specific treatment strategy for PAH. Additionally, we showed successful anticaspase application in cells from iPAH, familial, and associated PAH cases, which indicated a final, common mechanism.

Acknowledgements

The authors thank the Dutch Lung Foundation, Netherlands CardioVascular Research Initiative, the Dutch Heart Foundation, Dutch Federation of University Medical Centers, The Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Sciences. They also thank Jan van Bezu for technical support and Jeroen Kole for graphical input. Loss of PECAM-1 in PAH 87

References artery endothelial abnormalities in patients with congenital heart defects and pulmonary hypertension. A correlation of light with scanning electron microscopy 1. Simonneau G, Gatzoulis MA, Adatia I, Celermajer D, and transmission electron microscopy. Laboratory Denton C, Ghofrani A, Gomez Sanchez, Miguel Angel, investigation; a journal of technical methods and Krishna Kumar R, Landzberg M, Machado RF, Olschewski pathology. 1986;55:632–653. H, Robbins IM, Souza R. Updated clinical classification 12. Dickinson MG, Bartelds B, Borgdorff, Marinus A of pulmonary hypertension. J Am Coll Cardiol. J, Berger, Rolf M F. The role of disturbed blood flow in 2013;62:D34-41. the development of pulmonary arterial hypertension: 2. Botney MD. Role of hemodynamics in pulmonary lessons from preclinical animal models. Am J Physiol vascular remodeling: implications for primary Lung Cell Mol Physiol. 2013;305:L1-14. pulmonary hypertension. Am J Respir Crit Care Med. 13. Sakao S, Taraseviciene-Stewart L, Lee JD, Wood 1999;159:361–364. K, Cool CD, Voelkel NF. Initial apoptosis is followed 3. Yuan JX, Rubin LJ. Pathogenesis of pulmonary arterial by increased proliferation of apoptosis-resistant hypertension: the need for multiple hits. Circulation. endothelial cells. FASEB J. 2005;19:1178–1180. 2005;111:534–538. 5 14. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson 4. Rai PR, Cool CD, King, Judy A C, Stevens T, Burns N, GA, Botney MD. Pulmonary hemodynamics modify the Winn RA, Kasper M, Voelkel NF. The cancer paradigm of rat pulmonary artery response to injury. A neointimal severe pulmonary arterial hypertension. Am J Respir Crit model of pulmonary hypertension. Am J Pathol. Care Med. 2008;178:558–564. 1997;151:1019–1025. 5. Guignabert C, Tu L, Le Hiress M, Ricard N, Sattler 15. Taraseviciene-Stewart L, Kasahara Y, Alger L, Hirth C, Seferian A, Huertas A, Humbert M, Montani D. P, Mc Mahon G, Waltenberger J, Voelkel NF, Tuder RM. Pathogenesis of pulmonary arterial hypertension: Inhibition of the VEGF receptor 2 combined with chronic lessons from cancer. Eur Respir Rev. 2013;22:543–551. hypoxia causes cell death-dependent pulmonary 6. Voelkel NF, Gomez-Arroyo J, Abbate A, Bogaard endothelial cell proliferation and severe pulmonary HJ, Nicolls MR. Pathobiology of pulmonary arterial hypertension. FASEB J. 2001;15:427–438. hypertension and right ventricular failure. Eur Respir J. 16. Nicolls MR, Mizuno S, Taraseviciene-Stewart L, Farkas 2012;40:1555–1565. L, Drake JI, Al Husseini A, Gomez-Arroyo JG, Voelkel NF, 7. Tu L, Guignabert C. Emerging molecular targets Bogaard HJ. New models of pulmonary hypertension for anti-proliferative strategies in pulmonary arterial based on VEGF receptor blockade-induced endothelial hypertension. Handb Exp Pharmacol. 2013;218:409– cell apoptosis. Pulm Circ. 2012;2:434–442. 436. 17. Holmes K, Roberts OL, Thomas AM, Cross MJ. 8. Benza RL, Miller DP, Barst RJ, Badesch DB, Frost AE, Vascular endothelial growth factor receptor-2: structure, McGoon MD. An evaluation of long-term survival from function, intracellular signalling and therapeutic time of diagnosis in pulmonary arterial hypertension inhibition. Cell Signal. 2007;19:2003–2012. from the REVEAL Registry. Chest. 2012;142:448–456. 18. Tzima E, Irani-Tehrani M, Kiosses WB, Dejana E, 9. Sutendra G, Michelakis ED. Pulmonary arterial Schultz DA, Engelhardt B, Cao G, DeLisser H, Schwartz hypertension: challenges in translational research and a MA. A mechanosensory complex that mediates the vision for change. Sci Transl Med. 2013;5:208sr5. endothelial cell response to fluid shear stress. Nature. 10. HEATH D, WHITAKER W. The small pulmonary blood 2005;437:426–431. vessels in atrial septal defect. Br Heart J. 1957;19:327– 19. Voelkel NF, Gomez-Arroyo J. The Role of Vascular 332. Endothelial Growth Factor in Pulmonary Arterial 11. Rabinovitch M, Bothwell T, Hayakawa BN, Williams Hypertension: The Angiogenesis Paradox. Am J Respir WG, Trusler GA, Rowe RD, Olley PM, Cutz E. Pulmonary Cell Mol Biol. 2014. 88

20. van der Heijden, Melanie, van Nieuw Amerongen, signaling in the endothelium. Arterioscler Thromb Vasc Geerten P, van Bezu J, Paul MA, Groeneveld, A B Johan, Biol. 2013;33:2608–2617. van Hinsbergh, Victor W M. Opposing effects of the 29. Bakhshi FR, Mao M, Shajahan AN, Piegeler T, angiopoietins on the thrombin-induced permeability of Chen Z, Chernaya O, Sharma T, Elliott WM, Szulcek human pulmonary microvascular endothelial cells. PLoS R, Bogaard HJ, Comhair S, Erzurum S, van Nieuw ONE. 2011;6:e23448. Amerongen, Geerten P., Bonini MG, Minshall RD. 21. de Raaf, Michiel Alexander, Schalij I, Gomez-Arroyo Nitrosation-dependent caveolin 1 phosphorylation, J, Rol N, Happé C, de Man, Frances S, Vonk-Noordegraaf ubiquitination, and degradation and its association with A, Westerhof N, Voelkel NF, Bogaard HJ. SuHx rat idiopathic pulmonary arterial hypertension. Pulm Circ. model: partly reversible pulmonary hypertension 2013;3:816–830. and progressive intima obstruction. Eur Respir J. 30. Privratsky JR, Newman PJ. PECAM-1: regulator 2014;44:160–168. of endothelial junctional integrity. Cell Tissue Res. 22. Taraseviciene-Stewart L, Gera L, Hirth P, Voelkel 2014;355:607–619. NF, Tuder RM, Stewart JM. A bradykinin antagonist 31. Ilan N, Mohsenin A, Cheung L, Madri JA. PECAM-1 and a caspase inhibitor prevent severe pulmonary shedding during apoptosis generates a membrane- hypertension in a rat model. Can J Physiol Pharmacol. anchored truncated molecule with unique signaling 2002;80:269–274. characteristics. FASEB J. 2001;15:362–372. 23. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, 32. Rabinovitch M. Molecular pathogenesis of Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L. pulmonary arterial hypertension. J Clin Invest. Differential gene and transcript expression analysis of 2012;122:4306–4313. RNA-seq experiments with TopHat and Cufflinks. Nat 33. Upton PD, Morrell NW. TGF-beta and BMPR-II Protoc. 2012;7:562–578. pharmacology--implications for pulmonary vascular 24. Cicha I, Beronov K, Ramirez EL, Osterode K, Goppelt- diseases. Curr Opin Pharmacol. 2009;9:274–280. Struebe M, Raaz D, Yilmaz A, Daniel WG, Garlichs CD. 34. Guo X, Wang X. Signaling cross-talk between Shear stress preconditioning modulates endothelial TGF-beta/BMP and other pathways. Cell research. susceptibility to circulating TNF-alpha and monocytic 2009;19:71–88. cell recruitment in a simplified model of arterial 35. Zhu J, Yu P. Downregulation of‑ T cell lymphoma bifurcations. Atherosclerosis. 2009;207:93–102. invasion and metastasis‑inducing factor 1 induces 25. Szulcek R, Bogaard HJ, van Nieuw Amerongen, cytoskeletal rearrangement and inhibits the invasive Geerten P. Electric cell-substrate impedance sensing for capacity of gastric cancer cells. Mol Med Rep. the quantification of endothelial proliferation, barrier 2013;8:425–433. function, and motility. J Vis Exp. 2014. 36. Rygiel TP, Mertens AE, Strumane K, van der Kammen, 26. Cool CD, Stewart JS, Werahera P, Miller GJ, Rob, Collard JG. The Rac activator Tiam1 prevents Williams RL, Voelkel NF, Tuder RM. Three-Dimensional keratinocyte apoptosis by controlling ROS-mediated ERK Reconstruction of Pulmonary Arteries in Plexiform phosphorylation. J Cell Sci. 2008;121:1183–1192. Pulmonary Hypertension Using Cell-Specific Markers. 37. Tu L, Dewachter L, Gore B, Fadel E, Dartevelle P, The American Journal of Pathology. 1999;155:411–419. Simonneau G, Humbert M, Eddahibi S, Guignabert 27. Dekker RJ, van Soest S, Fontijn RD, Salamanca S, de C. Autocrine fibroblast growth factor-2 signaling Groot, Philip G, VanBavel E, Pannekoek H, Horrevoets, contributes to altered endothelial phenotype in Anton J G. Prolonged fluid shear stress induces a distinct pulmonary hypertension. Am J Respir Cell Mol Biol. set of endothelial cell genes, most specifically lung 2011;45:311–322. Krüppel-like factor (KLF2). Blood. 2002;100:1689–1698. 38. Sandoval Y, Atef M, Levesque L, Li Y, Anand-Srivastava 28. Walshe TE, dela Paz, Nathaniel G, D’Amore PA. The M. Endothelin-1 Signaling in Vascular Physiology and role of shear-induced transforming growth factor-β Pathophysiology. Curr Vasc Pharmacol. 2014;12:202– Loss of PECAM-1 in PAH 89

214. Eur J Clin Invest. 2013;43:64–71. 39. Engelman JA, Zhang XL, Razani B, Pestell RG, Lisanti MP. p42/44 MAP Kinase-dependent and -independent Signaling Pathways Regulate Caveolin-1 Gene Expression. J Biol Chem. 1999;274:32333–32341. 40. Budhiraja R, Tuder RM, Hassoun PM. Endothelial dysfunction in pulmonary hypertension. Circulation. 2004;109:159–165. 41. Privratsky JR, Paddock CM, Florey O, Newman DK, Muller WA, Newman PJ. Relative contribution of PECAM-1 adhesion and signaling to the maintenance of vascular integrity. J Cell Sci. 2011;124:1477–1485. 42. Gratzinger D, Canosa S, Engelhardt B, Madri JA. Platelet endothelial cell adhesion molecule-1 modulates endothelial cell motility through the small G-protein 5 Rho. FASEB J. 2003;17:1458–1469. 43. Bagi Z, Frangos JA, Yeh J, White CR, Kaley G, Koller A. PECAM-1 mediates NO-dependent dilation of arterioles to high temporal gradients of shear stress. Arterioscler Thromb Vasc Biol. 2005;25:1590–1595. 44. Woodfin A, Voisin M, Nourshargh S. PECAM-1: a multi-functional molecule in inflammation and vascular biology. Arterioscler Thromb Vasc Biol. 2007;27:2514– 2523. 45. Schenkel AR, Chew TW, Chlipala E, Harbord, Marcus W N, Muller WA. Different susceptibilities of PECAM- deficient mouse strains to spontaneous idiopathic pneumonitis. Exp. Mol. Pathol. 2006;81:23–30. 46. Smith JS, Gorbett D, Mueller J, Perez R, Daniels CJ. Pulmonary hypertension and idiopathic pulmonary fibrosis: a dastardly duo. Am J Med Sci. 2013;346:221– 225. 47. Postles A, Clark AR, Tawhai MH. Dynamic blood flow and wall shear stress in pulmonary hypertensive disease. Conf Proc IEEE Eng Med Biol Soc. 2014;2014:5671– 5674. 48. Deb S, Yun J, Burton N, Omron E, Thurber J, Nathan SD. Reversal of idiopathic pulmonary arterial hypertension and allograft pneumonectomy after single lung transplantation. Chest. 2006;130:214–217. 49. Nadaud S, Poirier O, Girerd B, Blanc C, Montani D, Eyries M, Imbert-Bismut F, Pacheco A, Vigne J, Tregouet D, Humbert M, Soubrier F. Small platelet microparticle levels are increased in pulmonary arterial hypertension. 90

Supplemental Material and Methods

Cell isolation and culture Lung specimen was collected during surgery or autopsy and several 1 cm3 pieces of peripheral lung tissue were removed by the pathologist on duty, immediately rinsed in collection buffer (4 mM KCL, 140 mM NaCl, 10 mM Hepes, 11 mM D-glucose, 105 U/L pen/ strep, pH 7.3), to remove as much blood as possible and stored at 4 °C. Within the next 24 hrs the overlying pleura and any visible vessels were removed and the microvascular tissue was mechanically homogenized for 5 min, digested in 10 mL of 0.3% collagenase type 2 (6700 U/mL, Sigma-Aldrich, St. Louis, MO, USA) in PBS, placed in a shaking water bath at 37 °C for 45 min and thereafter aspirated 12 times through a 14G cannula (Tebu-Bio, Le-Perray-en- Yvelines, France) to triturate clumps. The enzymatic digestion was stopped by addition of 6 mL isolation buffer (PBS, 0.1% bovine serum albumin, 2 mM EDTA, pH 7.4) and filtered through a 70 µm cell strainer (Falcon, Franklin Lakes, NJ, USA). The strainer was washed with 10 mL isolation buffer, the suspension centrifuged for 5 min at 226xg, the cell pellet was resuspended in 6 mL Endothelial Cell Medium (ECM) supplemented with 1% pen/strep, 1% endothelial cell growth supplement, 5% fetal calf serum (all purchased from ScienCell, Carlsbad, CA, USA) and seeded on a T25 culture flask (Greiner Bio One, Monroe, NC, USA) coated with fibronectin (5 ug/mL, Sigma-Aldrich). The isolates were kept at 37 °C under 5% CO2. Two days after isolation cells were washed twice with 5 mL isolation buffer to remove non-adherent cells and medium was refreshed with 6 mL ECM medium. Culture medium was renewed every other day. Cells between passage 4 and 6 were used for experiments.

Cell purification Purification was performed five to nine days after isolation, when endothelial islands had appeared, but were not yet overgrown by contaminating cells. Cultures were washed with 0.5 mM EDTA in HBSS and cells detached from the culture surface with 0.05% trypsin in EDTA/HBSS. Trypsin digestion was stopped with ECM medium and the cell suspension was centrifuged for 5 min at 226xg. The cell pellet was resuspended in ECM medium and incubated with magnetic microbeads coated with either anti-human PECAM-1 or anti-human VE- cadherin (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany), according to manufacturer’s instructions. The cell pellet was resuspended in 3 mL isolation buffer and passed through a 25 LS separation column placed in a QuadroMACS separator (Miltenyi). The column was washed three times with 3 mL isolation buffer to remove unlabeled cells, taken out from the magnetic field and the labeled cells were flushed out with isolation buffer onto a new Loss of PECAM-1 in PAH 91

LS column placed in the QuadroMACS. The washing procedure was repeated. Ultimately the column was removed from the magnetic field, placed on a T25 culture flask coated with 1% gelatin and the labeled cells were flushed onto the culture surface with 6 mL ECM medium. Magnetic separation was repeated when needed until a pure EC culture was established.

Shear stress The ibidi pump system (Integrated BioDiagnostics, Munich, Germany) was used for the application of uni-directional fluid flow with a pulse frequency of 60 Hz. The system is composed of two medium filled reservoirs, a computer controlled air pump and a special four-fold valve set. By alternating application of air pressure on one of the two reservoirs and permanent switching of the valves, a continuous medium flow was generated. Cells were seeded with 40,000 cells/cm2 in either a ibidi µ-slides I 0.6 luer for the application of laminar flow or in a 5 y-shaped ibidi µ-slides for the application of non-uniform flow profiles. Slides have been coated with fibronectin. After seeding, cells were allowed to attach for 24 hrs before the application of shear stress. Thereafter shear was gradually increased in intervals of 24 hrs from physiological 2.5 to high shear stresses of 15 and ultimately 21 dyn/cm2 . Phase-contrast images for the analysis of shear-adaptation were taken every 24 hrs at multiple locations within the slides.

Analysis of shear adaptation Analysis of shear adaptation was based on cell morphology (phase-contrast images) and carried out manually with the ruler tool of Photoshop CS6 (Adobe, San Jose, CA, USA). To prevent user bias, grid lines were superimposed on the phase-contrast images and only cells at the intersections were included in the analysis. To quantify adaptation, 100 cells per time- point and per condition were analyzed from at least three different loci of the monolayers. Cells were considered elongated, when their length to width ratio was >2, meaning the cell was twice as long as wide. Only if true, the orientation angle of this particular cell was determined in relation to the general direction of flow. Full shear adapted was defined as ≥75% of all cells elongated and a majority of 60% of all cells oriented within an angle of ≤30°.

Cell transfection Transfection was performed by electroporation with the 4D Nucleofactor X Unit andthe P5 Primary Cell 4D-Nucleofactor X kit both purchased from Lonza (Basel, Switzerland), according to the manufacturer’s instructions. Approximately 1 to 1.5 million cells, 80- 90% confluent were collected in ECM medium, centrifuged at 226xg for 5 min and resuspended in 100 uL nucleofector solution plus supplement (Lonza), according to manufacturer’s 92

instructions. Either 20 pmol of PECAM-1 siRNA (29445, Santa Cruz Biotechnology, Dallas, TX, USA) or scrambled control (37007, Santa Cruz) were added to the cell suspension. Electroporation was performed with program EH100. After electroporation 500µL basal ECM medium without supplements was added to the cuvette and incubated for 5 min at room temperature (RT). Cell suspension was transferred with the provided pipette to 2 mL complete ECM medium and seeded on a 10 cm2 culture well coated with fibronectin. Medium was refreshed the following day and the MVEC were seeded in the shear slides 48 to 72 hrs after transfection. For control of transfection efficiency, cells were lysed for Western blot before and three days after the application of shear stress.

Western blot For Western blot analysis antibodies were used against PECAM-1, recognizing extracellular (MEM-05, 1:500, 370700, Invitrogen, Carlsbad, CA, USA) or intracellular epitopes (C-20; 1:1000, 1505, Santa Cruz) in human samples and c-terminal epitopes in rats (1:200, 250590, Abbiotec). VE-cadherin (1:1000, 2500) and VEGFR2 (1:200, 2479) antibodies were purchased from Cell Signaling Technologies (Danvers, MA, USA). Cells were placed on ice, washed with ice cold PBS and scraped into lysis buffer (1 M Tris-HCl pH=8.0, 3 M NaCl, 3 M KCl, 500 mM EDTA- NaOH pH=8.0, 5% Igepal, 0.5% triton X-100) containing a phosphatase and protease inhibitor cocktail (Roch Diagnostics, Rotkreuz, Risch, Switzerland). Insoluble material was removed by centrifugation at 14,000xg for 5 min at 4 °C. Small lung pieces from rats (80-100 µg) were lysed in buffer containing phenylmethanesulfonylfluoride (PMSF), Radioimmunoprecipitation assay buffer (RIPA), phosphatase inhibitor cocktail 2 and 3 (P5726, P0044, Sigma-Aldrich), complete mini protease inhibitor (Roche) and homogenized by using a tissue lyser (Qiagen, Venlo, The Netherlands) Samples were boiled in loading buffer (NuPage LDS sample buffer and reducing agent) and loaded into precast 4-12% Bis-Tris NuPage gels (12x1mm). Gels and Western blot supplements were purchased from Life Technologies (Carlsbad, CA, USA). SDS-PAGE gel electrophoreses was performed and separated proteins were transferred to Amersham Hybond ECL nitrocellulose membranes (GE Healthcare, Little Chalfont, UK). Membranes were blocked with 5% bovine serum albumin (BSA, Sigma-Aldrich) in Trisbuffered saline (pH 7.6) with 0.1% tween (TBST) for 1 hr at RT, probed with the indicated primary antibodies, incubated overnight at 4 °C, washed three times with TBST and incubated with horseradish peroxidase (HRP) conjugated species-specific secondary antibodies (1:1000, Dako, Agilent Technologies, Santa Clara, CA, USA) in blocking buffer for 2 hrs at RT. Finally membranes were washed three times with TBST, incubated with Amersham ECL Prime Blotting Detection Reagent for 5 min at RT and visualized with the LAS-3000 (Fujifilm, Tokyo, Japan). Intensities were normalized Loss of PECAM-1 in PAH 93

to loading controls. Phosphorylated proteins were normalized to their total protein amount.

Immunofluorescence Immunofluorescence staining was performed with antibodies against PECAM-1 (1:40, 550389, BD Biosciences); VE-cadherin (1:400, 2500) and VEGFR2 (1:200, 2479) both from Cell Signaling Technologies; von Willebrand factor (1:40, 14014, Santa Cruz Biotechnology); CD34 (1:100, 6330, Abcam, Cambridge, UK); smooth muscle actin (1:50, M0851) and cytokeratin (1:50, MNF116) both purchased from Dako. Counterstaining for F-actin was done with rhodamine-phalloidin (1:100, Molecular Probes, Eugene, OR, USA) and nuclei with Hoechst 33342 (1 µg/mL, New England Biolabs, Ipswich, MA, USA). Cells were grown to confluence on fibronectin coated ibidi 8-well µ-slides and kept under confluent conditions forthree days to allow maturation of the endothelial junctions. The confluent cell layers were fixed 5 with 4% paraformaldehyde (Sigma-Aldrich) in HBSS, incubated for 15 min at RT, two times washed with PBS and membrane permeabelized for one minute with 0.05% Triton X-100 (Sigma-Aldrich) at RT. The permabelized samples were washed with PBS, blocked for 30 min at RT with 1% human serum albuminin (HSA, Sanquin, Amsterdam, The Netherlands) in PBS and probed overnight at 4 °C with the indicated primary antibodies in 0.1% HSA. Thereafter the samples were washed three times with PBS and incubated with FITC- or Cy3-conjugated speciesspecific secondary antibodies (1:1000, Invitrogen, Paisly, UK) plus rhodamine- phalloidin and Hoechst 33342 in 0.1% HSA for 2 hr at RT. The stained samples were washed three times with PBS and fixed with ibidi mounting medium. Imaging was performed with an Axiovert 200 Marianas inverted wide-field fluorescence microscope equipped with a 10, 20 and 40x air lens (Carl Zeiss Microscopy, Jena, Germany). Images were analyzed and prepared for presentation with Slidebook 5.5 (Intelligent Imaging Innovation, Denver, CO, USA). 94

RT-PCR Total RNA was isolated from static EC cultures and after 72 hours of HSS using the Aurum total RNA mini kit (Bio-Rad, Veenendaal, The Netherlands). For reverse transcription 0.5 µg of total RNA was used with a (dT)12-18 primer using a RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Landsmeer, The Netherlands), according to manufacturer’s instructions. PCR reactions were performed in 10 µl volumes using Fast SYBR Green Master Mix (Applied Biosystems, Bleiswijk, The Netherlands) on an 7900HT fast real-time PCR system (Applied Biosystems). Specificity of the amplification was checked by melt curve analysis. P0 levels were used for normalization.

PRIMER FORWARD SEQUENCE REVERSE SEQUENCE P0 TCGACAATGGCAGCATCTAC ATCCGTCTCCACAGACAAGG VEGFR2 CCATCTTTTGGTGGAATGGTG AGATGCCACAGACTCCCTGC VE-‐cadherin TGACGTGAACGACAACTGGC GACGCATTGAACAACCGATG PECAM1 CTGATGCCGTGGAAAGCAG GCATCTGGCCTTGCTGCTTAA eNOS GCGGCTGCATGACATTGAG TCGTCGCGGTAGAGATGGTC SMAD6 GCCACTGGATCTGTCCGATT GACATGCTGGCGTCTGAGAA SMAD7 GGAACGAATTATCTGGCCCC TATGCCACCACGCACCAGT PAI 1 TGTCATAGTCTCAGCCCGCA CCATCACTTGGCCCATGAA KLF2 AGTGGCATCTTCTCTCCCACC GGCCCTTATTTCTCACAAGGC TMBD GCATTACAGCTGGAGAAGACCC TTCTCCTCCCTCTAATCACCCC MCP-‐1 GCACAGATCTCCTTGGCCAC ATCTCAGTGCAGAGGCTCG BMPR2 GCCATCAAAGCCCAGAAGAG CACCTGATCCTGATTTGCCAT TGFbeta1 ACCATGCCAACTTCTGCCTC CAGGACCTTGCTGTACTGCGT

Supp Table 1: Primers used.

Animals All experiments were approved by the Institutional Animal Care and Use Committee of the VU University (FYS 13-01) and were conducted in accordance with the European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes, and the Dutch Animal Experimentation Act. Male Sprague Dawley rats (n=20, 101-125 grams, Charles River, Sulzfeld, Germany) were housed in groups of 4 under controlled circumstances (22°C, 12:12 hours light/dark cycle). Food and water were available ad libitum. Animals arrived one week prior to the experiment for acclimatization. Rats received a single subcutaneous bolus of Sugen (25 mg/kg-1) followed by a 4 weeks hypoxic and 2 weeks normoxic period. Open-chest right ventricular catheterization was performed at the end of the experiment (Millar Instruments, Houston, TX, USA). Loss of PECAM-1 in PAH 95

Echocardiography Measurements (ProSound SSD-4000, 13-MHz linear transducer #UST-5542, Aloka, Tokyo, Japan) were performed on anesthetized rats (2.5% isoflurane, 1:1 O2/Air mix). Rats were evaluated by echocardiography at week 0, 4 and 6 based on pulmonary artery acceleration time (PAAT), right ventricular wall thickness (RVWT), end diastolic diameter (RVEDD), cycle length (CL) and tricuspid annular plane systolic excursion (TAPSE), cardiac output (CO), total pulmonary resistance (TPR), PAAT/CL, heart rate (HR) and stroke volume (SV). Analysis was performed offline with the Tomtec Imaging systems (Unterschleisscheim, Germany).

Right ventricle pressure measurements At the end of the study protocol, open-chest RV catheterization was performed under general anesthesia in all animals (5% induction/2.5% maintenance, isoflurane, 1:1 5 O2/Air mix). Before the procedure, rats were intubated (Teflon tube, 16 gauge) and attached to a mechanical ventilator (Micro-Ventilator, UNO, Zevenaar, The Netherlands; ventilator settings: breathing frequency: 70 breaths per minute; pressures: 12/0cm H2O; inspiratory/expiratory ratio: 1:1). RV pressures were recorded by use of a microtip pressure-volume conductance catheter (Millar Instruments, Houston, TX, USA). Analyses were performed when steady state was reached over an interval of at least 30 seconds.

Lung histology and immunohistochemistry Lungs were weighed and airways of the right middle lobe were subsequently filled with 0.5% low-melt agarose in saline under constant pressure of 25 mmHg and stored in formalin (#4169-30, Klinipath BV, Duiven, The Netherlands) before embedding in paraffin. The heart was perfused with tyrode solution, weighed, dissected, snap-frozen in liquid nitrogen and stored in -80°C. Transversally cut lung sections (4 µm) were deparaffinized and stained with Elastica van Gieson (EvG) and hematoxylin-eosin (HE) for analysis of vascular dimensions. Analysis of vascular dimensions was done by random selection of at least 30 vessels (maximal outer diameter ≤ 60 µm) per tested animal. Thickness of intima and media were expressed as percentage of the total vessel diameter. For immunohistochemistry a minimum of 30 randomly selected vessels per animal were acquired (maximal outer diameter ≤ 60 µm). Lung sections were deparaffinized and epitope retrieval was performed by immersing the slides in antigen unmasking solution (H3300, Vector Laboratories, Burlingame, CA, USA) for 10 minutes in a pressure cooker. Blocking steps with 1% BSA were performed, before labeling α-smooth-muscleactin (α-SMA, C6198, Sigma), Von-Willebrand Factor (vWF, ab8822, Abcam) and nuclei (DAPI, H-1200, Vector Labs). Image acquisition was performed on a ZEISS Axiovert 96

200M Marianas inverted microscope. Cardiac cryosections (5 µm, Leica CM1850, Rijswijk, the Netherlands) were stained with H&E and picrosirius red for analysis of cardiomyocyte cross sectional area (CSA) and fibrosis, respectively. CSA was measured by randomly selecting a minimum of 20 transversally cut cardiomyocytes in the right ventricle and left ventricle and tracing the outside of the cell with image J analysis software (Version 1.45s, National Institute of Health). Fibrosis was expressed as percentage collagen positive tissue per area.

SupplementalFigure E1 Figures

A isolation: Microbead purification: 5 days 3 days 5 days

10 days

B VE-cadherin VEGFR2 vWF positive

CD34 SMA Cytokeratin negative

Figure E1: PAH MVEC were isolated with high specificity and purity. A) Representative phase-contrast images showing PAH MVEC at different time-points after isolation and purification with VE-cadherin labeled magnetic beads. B) Representative immunofluorescence staining of PAH MVEC for endothelial specific (positive) and nonspecific (negative) markers. Intensity of the staining was normalized to secondary antibody controls. Loss of PECAM-1 in PAH 97

Figure E2

A For the application of laminar flow profiles:

For the application of non-uniform flow profiles:

5 B

Figure: E2: Shear stress was increased gradually with different flow profiles. A) Ibidi µ-slides for the application of laminar or non-uniform flow profiles. B) After cells were seeded and allowed to attach for 24 h, shear stress was applied with 2.5 dyn/cm2 and increased step-wise from 15 to 21 dyn/cm2 in intervals of 24 h. Phase-contrast images were acquired every 24 h (dotted lines).

Figure E3: Microvascular, but not pulmonary artery endothelial cells from PAH patients, show a delayed adaptation to supra-physiological levels of fluid shear stress. Quantification of morphological shear-adaptation (nCtrl=8; nPAH=7 and nPAEC=3) presented as non-elongated and elongated subsets. The shear adapted cells have been further characterized by their angle of alignment towards the direction of flow (see insert for clarification). Statistical differences were calculated with 2-way ANOVA and bonferroni multiple comparison testing. 98

Figure E4 A

p E r k /E r k p A k t/A k t A M P K a

] 2 .0 ] 0 .8 ] 0 .8 . . . u u u . . .

a < 0 .0 0 0 1 a a [ [ [ 1 .5 0 .6 0 .6 y y y t t t i i i s s s n n n

e 1 .0 e 0 .4 e 0 .4 t t t n n n I I I

. . . 0 .5 0 .2 0 .2 m m m r r r o o o N N N 0 .0 0 .0 0 .0 C o n tro l P A H C o n tro l P A H C o n tro l P A H

p S r c /S r c C a v 1 P a x illin

] 2 .0 ] 8 .0 ] 8 .0 . . . u u u . 0 .0 3 . 0 .0 4 . a a a [ [ [ 1 .5 6 .0 6 .0 y y y t t t i i i s s s n n n

e 1 .0 e 4 .0 e 4 .0 t t t n n n I I I

. . . 0 .5 2 .0 2 .0 m m m r r r o o o N N N 0 .0 0 .0 0 .0 C o n tro l P A H C o n tro l P A H C o n tro l P A H

Figure E4: Protein levels of PECAM-1 dependent signaling mediators are altered, whereas transcriptional shear- responses are functional. A) Western blot quantifications of selected PECAM-1 signaling mediators (ERK, SRC, and CAV1) as well as PECAM-1 independent shear-adaptors (AMPK, AKT, and paxillin). Samples have been collected from confluent, static cell cultures (unpaired student’s t-test). B) Relative mRNA expression of control and PAH MVEC under static conditions and after 72 h HSS (2-way ANOVA, n=3). Data were normalized to P0 as housekeeping gene. Loss of PECAM-1 in PAH 99 Figure E5

250 kDa 150

100 75

37 25 5 25 20 ERK1/2 20 PECAM-1 c-terminus

Z-Asp (uM): 50 20 1 Ctrl Z-Asp (uM): 50 20 1 Ctrl

B control MVEC control MVEC + Z-Asp

Figure E5: Caspase inhibition in control MVEC decreases shear-responsiveness in a PECAM-1 independent manner. A) Representative Western blot for c-terminal PECAM-1 in control MVEC after the addition of the caspase inhibitor Z-Asp in different concentrations. ERK1/2 was loading control. B) Control MVEC were treated with Z-Asp (20 uM) and HSS was applied for 72 h. Representative phase-contrast images are shown (scale 400 µm).

TGF-β and BMPR2 signaling in PAH: Two black sheep 6 in one family

N. Rol • K.B. Kurakula • C.M. Happé • H,J, Bogaard • M.J. Goumans

International Journal of Molecular Sciences • 2018 102

ABSTRACT

Knowledge pertaining to the involvement of transforming growth factor β (TGF‐β) and bone morphogenetic protein (BMP) signaling in pulmonary arterial hypertension (PAH) is continuously increasing. There is a growing understanding of the function of individual components involved in the pathway, but a clear synthesis of how these interact in PAH is currently lacking. Most of the focus has been on signaling downstream of BMPR2, but it is imperative to include the role of TGF‐β signaling in PAH. This review gives a state of the art overview of disturbed signaling through the receptors of the TGF‐β family with respect to vascular remodeling and cardiac effects as observed in PAH. Recent (pre)‐clinical studies in which these two pathways were targeted will be discussed with an extended view on cardiovascular research fields outside of PAH, indicating novel future perspectives. TGF-β and BMPR2 signaling in PAH 103

Introduction

Pulmonary arterial hypertension (PAH) is a condition defined by an increase in mean pulmonary artery pressure and characterized by remodeling of the pulmonary vasculature [1]. Abnormalities in vessel functionality and responses to stressors culminate in aberrant growth of endothelial cells (ECs) and smooth muscle cells (SMCs), leading to vascular obstruction and the formation of plexiform lesions. The increased pulmonary vascular resistance enhances the load upon the right ventricle (RV). The RV will compensate with hypertrophy, which progresses to RV‐failure and death. Current available therapies for PAH mainly target vasoconstriction to reduce pressures and relieve the load, with some showing anti‐proliferative effects in vitro. These drugs decelerate, but do not stop disease progression [2,3].

The transforming growth factor‐β (TGF‐β) family plays a major role in the initiation and progression of PAH. TGF‐β is not only an important regulator of vascular remodelling and 6 inflammation in the lung, but also of hypertrophy and fibrosis in the heart [4–8]. Ofall receptors belonging to the TGF‐β family (Figure 1), the bone morphogenetic protein type 2 receptor (BMPR2) is the most relevant for PAH. Mutations in the BMPR2 gene were the first discovered and most studied mutations underlying hereditary PAH to date [9,10]. BMPR2 is closely entangled with other members of the TGF‐β family, but the roles of many of the ligands and receptors in the TGF‐β family are still underappreciated in PAH. Although bone morphogenetic protein (BMP) ligands and their receptors play an important role in disease progression and could function as therapeutic targets [11], agents effectively decreasing TGF‐ β1 activity, together with selective TGF‐β ligand traps open up new treatment possibilities [12–16].

Here, we give a comprehensive update on TGF‐β signaling in PAH, summarized in Table 1. Furthermore, we provide insights into current (pre)‐clinical studies targeting the TGF‐β pathway in other diseases that may be useful in designing therapeutic strategies for the deadly condition of PAH.

104

Figure 1. TGF‐β and BMP signaling. Receptors with evidence of mutations in pulmonary arterial hypertension (PAH) are underlined [17]. Abbreviations: ActRII, activin receptor type II; ALK, activing receptor‐like kinase; BMP, bone mor phogenetic protein; GDF, growth/differentiation factor; TGF, transforming growth factor. TGF-β and BMPR2 signaling in PAH 105

Table 1: Grey boxes indicate findings in tissue of pulmonary arterial hypertension patients; white boxes indicate find ings in experimental animal models. (a) Hypoxia-induced PH in rat, (b) monocrotaline-induced PH in rat, (c) Sugen hy poxia-induced PH in rat, (d) Schistosoma-induced PH in mice, (e) pulmonary artery banding in rats. Increases in Smad protein regard phosphorylation. Abbreviations: ActRII, Activin receptor type II; ALK1, activin receptor‐like kinase 1; ALK5, activin receptor‐like kinase 5; Cav1, caveolin‐1; CTGF, connective tissue growth factor; EC, endothelial cell; GDF, growth/differentiation factor; MAPKs, mitogen‐activated protein kinase; PAI‐1, plasminogen activator inhibitor‐1; SMC, smooth muscle cell; TGF‐β, transforming growth factor β; TGFBRII, TGF‐β receptor type II. 106

TGF‐β Signaling

Members of the TGF‐β family are widely expressed in diverse tissues and play an essential role throughout life, starting from gastrulation and the onset of body axis asymmetry to organ‐specific morphogenesis and adult tissue homeostasis [55–58]. At the cellular level, TGF‐β family members regulate fundamental processes important for tissue homeostasis and embryogenesis, such as cell proliferation, differentiation, apoptosis, migration, adhesion, cytoskeletal organization, extracellular matrix production, in a context‐ and cell type‐ dependent manner. Consistent with this pleiotropic activity, disrupted TGF‐β signaling is associated with several developmental disorders, cancer, auto‐immune, cardiovascular and fibrotic diseases [55–57,59,60].

The TGF‐β family members are subdivided into two functional groups: the TGF‐β group that comprises the three mammalian TGF‐β isoforms, activins, nodals and some growth and differentiation factors (GDFs) and the BMP group that includes all BMPs and most GDFs (Figure 1) [57,59]. TGF‐β family members form functional dimers, bind to heterotetrameric complex of type I and type II serine/threonine kinase transmembrane receptors and signal through both Smad‐dependent and Smad‐independent pathways [57,58,61,62] (Figure 2). In mammals, seven type I receptors, also known as activin receptor‐like kinases (ALKs), and five type II receptors have been reported so far. To control duration and intensity of TGF‐β signaling, agonists, antagonists, co‐receptors and intracellular signaling play key roles in ligand access and posttranslational modification of the receptors and downstream mediators in a cell‐ and context‐dependent manner [60,61,63]. TGF‐β is secreted in its latent form and needs to be proteolytically processed before being able to bind to signaling receptors [4]. This complex activation mechanism could open up new therapeutic targets. TGF‐β signals in most cells by binding to TβRII forming a complex with TβRI (or ALK5). Activins bind to activin receptor type IIA (ActRIIA) or ActRIIB in a complex with ALK4, while BMPs signal via BMP type II receptor (BMPRII), ActRIIA or ActRIIB, in combination with ALK1, 2, 3 or 6. Although TβRII/TβRI is the preferable high affinity signaling complex, in endothelial cells, TGF‐β can also signal through TβRII/ALK1/ALK5 [64,65].

Upon complex formation, the activated type I receptor kinase will transduce the signal from the membrane to the nucleus by phosphorylating Smad transcription factors [61]. Smads are divided into three major classes: receptor-regulated Smads (R-Smads), common mediator Smad (co-Smad) and the inhibitory Smads (I-Smads). R-Smads (Smad1, Smad2, Smad3, TGF-β and BMPR2 signaling in PAH 107

Smad5 and Smad8) function as direct substrates for specific type I receptor kinases. ALK4, -5 and -7 phosphorylate Smad2 and Smad3, whereas Smad1, Smad5 and Smad8 become phosphorylated by the BMP type I receptors ALK1, -2, -3 and -6 [66]. Upon phosphorylation, R-Smads form a complex with the co-Smad, Smad4, and translocate to the nucleus. In the nucleus, Smad complexes engage in cooperative interactions with DNA and other- DNA binding proteins such as FAST1, FAST2, Fos/Jun and ATF2 to mediate the transcription of specific target genes [60,67]. The two I-Smads, Smad6 and Smad7, first identified in 1997 as vascular Smads, can compete with and inhibit R-Smads for type I interaction preventing phosphorylation [61,68]. Furthermore, they can induce proteasomal degradation of the type I receptor by recruiting Smurf1/2 E3 ubiquitin ligases [55–57,59,60]. For a more extensive description of TGF-β signaling, we refer to recent reviews [58,69–77].

Figure 2. Proposed mechanism of TGF‐β signaling in the pathogenesis of pulmonary arterial hypertension. Abbrevi ations: ActRII, Activin receptor type II; AKT, protein kinase B; ALK1, activin receptor‐like kinase 1; CTGF, connective tissue growth factor; ERK, extracellular signal‐regulated kinases; GDF, growth/differentiation factor; JNK, c‐Jun N‐ter minal kinases; MAPK, mitogen‐activated protein kinase; PAI‐1, plasminogen activator inhibitor‐1; TGF‐β, transform ing growth factor β. TGFBRII, TGF‐β receptor type II. 108

Role of TGF-β Ligands in Pulmonary Arterial Hypertension The presence of different TGF‐β isoforms in the pulmonary vascular wall in the context of tissue remodeling in PAH was already described in 1994. Particularly, TGF‐β3 is highly upregulated in both medial and intimal layers of remodeled pulmonary vessels [20]. More recent studies report that the increased presence of active TGF‐β ligands co‐localizes with SMCs in pulmonary arterioles and a strong expression of TGF‐β1 in ECs and the interstitium of the plexiform lesions [46,79]. TGF‐β signaling can directly inhibit BMP‐Smad signaling in SMCs, and ligands from this side of the signaling balance can function as antagonists by competing for type II receptor binding [80,81]. Interestingly, pulmonary arterial ECs (PAECs) expressing a mutant BMPR2 release higher levels of TGF‐β into the medium, thereby accelerating SMC growth [82]. As the quiescent effect that TGF‐β typically has on SMC growth is impaired in PAH, the elevated TGF‐β levels cause medial hypertrophy [83–85]. TGF‐β-single nucleotide polymorphisms (SNP) on top of heterozygous BMPR2 mutation modulate the age of diagnosis and penetrance of familial PAH [45]. Other circulating ligands, such as activins and GDFs, are increased in PAH, as well, possibly stimulating cell growth and thereby contributing to pulmonary vascular remodeling [18,19,31–33,38]. The different animal models for pulmonary hypertension (PH) confirm the human pathology harboring more TGF‐β and activins in the serum, pulmonary arteries and the RV in hypoxia or monocrotaline (MCT)‐ induced PH in rats [12,22,23,26]. The imperative role of TGF‐β in PAH development is also illustrated by the dependency on this ligand in PAH associated with schistosomiasis in rats and required enhanced TGF‐β signaling in a mouse model of scleroderma‐related PH (SSc‐ PH).[24,86,87]. A recent study demonstrated that bone marrow‐derived thrombospondin‐1 causes Schistosoma‐ and hypoxia‐induced pulmonary hypertension via activation of TGF-β [88].

Endothelial‐to‐Mesenchymal Transition in Pulmonary Arterial Hypertension ECs can change their endothelial cobblestone morphology to a mesenchymal phenotype, a process referred to as endothelial-to-mesenchymal transition (EndoMT). In this process, ECs progressively lose their characteristics, i.e., cell-cell junctions and specific markers such as CD31, VE‐cadherin and CD34 and gain markers such as α‐SMA, collagen‐I and vimentin migrate and invade into the surrounding tissues [89,90]. Although EndoMT takes place during embryogenesis where the transition contributes to the development of the valves of the heart, it does not occur under normal physiological circumstances [91]. An imbalance in the TGF‐β/BMP axis and disturbed inflammation contribute to the induction of EndoMT [92]. EndoMT is stimulated by increased TGF‐β receptor signaling and attenuated by intact BMPR2 TGF-β and BMPR2 signaling in PAH 109

signaling [21,93]. This process has been reported in pathologies such as inflammatory bowel disease, chronic kidney disease, cardiac fibrosis and portal hypertension [89,94–96]. In vitro, TGF‐β-induced EndoMT in PAECs leads to higher migration rates, lower proliferation rates and decreased barrier integrity [92]. Both pre‐clinical and clinical studies demonstrate that EndoMT plays a role in the pathogenesis of PAH [90,97]. EndoMT is also detected in the pulmonary vasculature of systemic sclerosis‐ associated PAH patients [92]. This study additionally shows that in vitro-induced EndoMT leads to reduced barrier integrity of PAECs with the production of pro‐inflammatory cytokines such as IL‐6, IL‐8 and TNF‐α and high trans‐endothelial migration of immune cells. In the pulmonary vasculature of MCT rats, overexpression of Twist‐1 and VE‐cadherin and repression of p120‐catenin indicate the induction of EndoMT [21]. Rapamycin, an immunosuppressive drug, reverses experimental PH by inhibiting the migration of PAECs and reducing EndoMT markers. Ponatinib, a multi‐target tyrosine‐kinase inhibitor, attenuates TGF‐β-induced EndoMT in human pulmonary microvascular ECs [97]. 6 Receptors in Pulmonary Arterial Hypertension Besides BMPR2 mutations, rare variants in other TGF‐β receptor superfamily member genes are also associated with autosomal dominant familial PAH. Mutations in the type I receptor ALK1 and co‐receptor endoglin are found in hereditary hemorrhagic telangiectasia (HHT)- associated PAH [35,36]. The increased prevalence of (H)PAH in HHT1 and HHT2 could be explained by the involvement of arteriovenous malformations, caused by ALK1 and ENG mutations, in the pathophysiology in both diseases [98–100]. Interestingly, in idiopathic PAH (iPAH) mRNA and protein levels of ALK1 and endoglin are specifically increased in ECs, leading to enhanced Smad1/5 phosphorylation (pSmad1/5) when stimulated with TGF‐β, indicating a disturbed TGF‐β/BMP balance [19]. In mice carrying a kinase‐deficient TβRII in fibroblasts, the disturbed TGF‐β signaling leads to pulmonary vasculopathy with medial thickening and mildly elevated pulmonary artery pressures [42]. TGF‐β type III receptor (TβRIII) or β‐glycan, a co‐receptor acting as a reservoir of TGF‐β2 for the type I and II receptors, is downregulated in familial PAH [28]. The functional consequences of these changes for the pathogenesis of PAH are yet unknown.

Canonical TGF‐β Signaling in Pulmonary Arterial Hypertension In the pulmonary vasculature, Smad2 phosphorylation after TGF‐β receptor activation is increased, even though mRNA expression of Smad2 and Smad3 is decreased in whole lung lysates of PAH patients [27,39,45]. While pSmad2 (and not pSmad3) is likewise increased 110

in the lungs of mice exposed to hypoxia, rats experimentally exposed to MCT develop PH 2–4 weeks after MCT injection, showing contrasting results with regards to canonical TGF‐β signaling in the lung [25,31,46,101]. Some studies report increased pSmad2, while others show no change or even a decrease in Smad2 phosphorylation using Western blot analysis [12,37,43,46]. On the cellular, level increased Smad2 levels, driven by Activin A activation, are found in cultured SSc‐PAH fibroblasts, responsible for collagen production [102]. Transgenic mice carrying an SMC specific dominant‐negative BMPR2 gene do not show any alteration in Smad2 phosphorylation in lung tissue by Western blot analysis [103]. Although this could be due to technical differences between studies, it is possible that a BMPR2 mutation alone is not sufficient to regulate Smad2 phosphorylation. Upon translocation into the nucleus, pSmad2 binds to the promoter of specific target genes like plasminogen activator inhibitor (PAI)‐1, a well-acknowledged TGF‐β target gene [104]. Interestingly, mRNA and protein expression of PAI‐1 are decreased in iPAH, while circulating levels of PAI‐1 are increased in both primary (idiopathic) and secondary PAH [49,50]. The latter is likely linked to the widespread development of thrombosis with intraluminal thrombin deposition [105]. The two widely-used experimental PH rat models, MCT and SuHx (VEGF receptor inhibitor Sugen combined with hypoxia), show conflicting results compared to the human situation, with increased mRNA expression of PAI‐1 [12].

The co‐Smad, Smad4, forms an intracellular complex with the TGF‐β and BMP-mediated phosphorylated R‐Smads and is needed for nuclear translocation [60]. Mutations in Smad4, together with ACVRL1 (ALK1) and ENG are causative of the vascular disorder HHT [106]. Nasim et al. report two independent iPAH cases with a missense and splice site mutation in Smad4, but no differential protein expression was found in PAECs and SMCs of iPAH patients [39,47]. In contrast with these human findings, Smad4 is reduced in MCT-induced PH on both the mRNA and protein level [43,48]. Transcription of the I‐Smads, Smad6 and Smad7, is also reduced in lung tissue of these animals [48]. Differences in expression of I‐Smads in human PAH tissue have not been reported to date. However, it has been shown that Smad6 is suppressed by the prostanoid Iloprost, thereby enhancing the intensity and duration of the TGF‐β/Smad responses [107].

Non‐Canonical TGF‐β Signaling Downstream signaling of TGF‐β goes beyond phosphorylation of the Smad proteins. Activation of ERK, JNK/p38, Rho‐like GTPases and PI3K/Akt is involved in the non‐Smad pathway and also familiar in PAH research (Figure 2) [108–111]. Upregulation of these proteins in PAH has been TGF-β and BMPR2 signaling in PAH 111

shown before, although only a few in the context of disturbed TGF‐β signaling [13,51,112]. Besides BMPR2 mutations, caveolin 1 (CAV1) mutations are a rare cause of PAH, influencing both canonical and non‐canonical TGF‐β/BMP signaling [36,52,113].

Downstream Targets of TGF‐β in the Lung Several reports demonstrated that vascular thrombosis plays an essential role in the pathophysiology of iPAH. Indeed, anticoagulation treatment confers a survival benefit in iPAH patients [114,115], perhaps because in situ thrombosis of pulmonary vessels may contribute to the pathogenesis of this disease [116,117]. Transcriptional activity of PAI‐1 is elevated in patients with PAH along with other coagulation-associated genes. This increase in PAI‐1 activity may explain impaired fibrinolysis in iPAH patients [117,118]. In contrast, two other studies demonstrated no change in PAI‐1 activity in the serum of iPAH and chronic thrombo‐embolic pulmonary hypertension (CTEPH) patients at rest or after venous occlusion [119,120]. However, the same group reported later that there is an increase in PAI‐1 activity in female iPAH patients before and after venous occlusion [121]. The discrepancies between 6 these studies may be caused by the use of different assays, gender differences and a low sample size per group. Given the heterogeneity in PAH patients, more studies are warranted to unravel the true function of PAI‐1 in the pulmonary vasculature in PAH.

The inhibitor of DNA binding family of proteins (ID proteins) is a major downstream transcriptional target of BMP signaling [122]. In mammalian cells, four members of the Id family, Id1–4, have been identified so far. It has been reported that ID1, ID2 and ID3 are induced by BMPs in PAECs and SMCs through a canonical Smad‐dependent pathway [11,107,122,123]. In adult organs, ID4 is mostly expressed in testis, brain and kidney and left out of the scope of this review [124]. Interestingly, BMP9 strongly induces the expression of ID proteins in PAECs, while BMP4 and BMP6 increase the expression of ID proteins in SMCs [122,125]. Mutations in BMPR2 strongly reduced the expression of ID proteins in both PAECs and SMCs. Unexpectedly, the expression of ID proteins along with BMPR2 expression are also reduced in PAECs and SMCs of some iPAH patients. In line with these observations in cultured cells, the expression of ID proteins is attenuated in experimental MCT‐PH lungs, as well as in human lungs [48]. ID proteins also regulate the cell cycle and proliferation of SMCs in a BMP4-dependent manner [107,122]. Recently, BMP9 has been shown to selectively increase BMPR2, ID1 and ID3 proteins in endothelial cells in vitro and thereby decrease experimental PH in vivo, suggesting the potential involvement of these genes in PAH [11]. 112

TGF‐β Signaling in the Heart in Pulmonary Arterial Hypertension Survival of PAH patients is determined by the ability of the RV to adapt to the increased pressures in the pulmonary vasculature [126]. The challenged RV suffers from neurohormonal activation, capillary loss inflammation, apoptosis, oxidative stress and metabolic shifts leading to hypertrophy and fibrosis [127]. Cardiac fibrosis is related to increased TGF‐β signaling [128,129]. In rat, cardiac fibrosis induced by increased RV afterload, as seen in PH, is likely to be mediated through TGF‐β-induced connective tissue growth factor signaling (Figure 2) [53,54]. The beneficial effects of carvedilol (β‐blocker), iloprost (prostacyclin) and losartan (angiotensin receptor blocker) on RV function in animals are partly ascribed to attenuated TGF‐β-mediated fibrosis [53,54,130]. Furthermore, nintedanib, a tyrosine kinase inhibitor known to inhibit TGF‐β-mediated fibrosis, attenuated cardiac fibrosis in experimental pulmonary hypertension [131,132] Hemnes et al. showed an upregulation of the TGF‐β pathway in the RV of PAH patients by increased transcription of TGF‐β3 [29]. TGF‐β inhibition by either pan‐TGFβ antibodies or specifically binding to TGF‐β1 and TGF‐β3 showed lowering of RV systolic pressures and attenuated RV hypertrophy in MCT and SuHx rat models [12,133]. One of the few studies investigating downstream TGF‐β signaling in the heart in the context of PAH showed decreased phosphorylation of Smad2 in both RV and LV. This observation was independent of the presence of a BMPR2 mutation [40].

Therapeutic Interventions Relevant in PAH In 13 preclinical and nearly twenty phase I–III clinical trials, TGF‐β signaling is targeted to treat cancer and fibrotic diseases [72,77,134]. TGF‐β signaling can be targeted mainly in three different ways in clinical trials: specific antibodies, antisense oligonucleotides and receptor kinase inhibitors. As ECs and SMCs in PAH produce excessive amounts of TGF‐β, the use of these targets may decrease vascular remodeling through their inhibitory effect on these cells. In contrast to the clear role of TGF‐β signaling in tumorigenesis, vascular diseases are more complex with simultaneous up‐ and down-regulation of the pathway and interactions with the BMP pathway [72]. Beneficial effects of inhibiting TGF‐β ligands on pulmonary vascular and cardiac remodeling have previously been shown in experimental MCT- and hypoxia-induced rat PH models [12]. Targeting the ALK5 kinase with SD208, a drug known to suppress tumor metastasis in rodent models, ameliorated MCT-induced PH [135]. Beneficial anti‐remodeling effects of prostacyclin analogues, used in PAH treatment strategies, can partly be explained by TGF‐β inhibition [13,136]. How these effects in rat models can provide implications for the human disease are TGF-β and BMPR2 signaling in PAH 113

uncertain; besides increased availability of TGF‐β ligands, different regulation patterns are observed. As TGF‐β signaling is crucial for many physiological functions, prolonged inhibition of this signaling might lead to harmful side effects. Preclinical studies in PAH patient-derived cells could give valuable information about expected responses, illustrated by different effects in ECs and SMCs upon TGF‐β stimulation [19,83,84].

Conclusions In PAH, several mutations in components of the TGF‐β/BMP signaling pathway have been identified. However, most research over the years has focused on BMP signaling, in particular BMPR2. Enhanced expression of TGF‐β has been found systemically (i.e., in serum) and locally (i.e., in ECs and SMCs of the pulmonary vasculature) in PH patients and animal models. Furthermore, TGF‐β has been shown to be involved in proliferation, inflammation, angiogenesis and fibrosis in lungs in PAH. In addition, TGF‐β induces EndoMT, which is also involved in PAH, and as such, TGF‐β could be interesting as a treatment target. Inhibition of TGF‐β signaling, either directly or through targeting intermediates, may be a novel therapeutic 6 strategy in PAH.

TGF‐β signaling plays an essential role in vascular cells, immune cells and other cells such as epithelial cells in lungs. However, TGF‐β signaling is very complex, as there are numerous ligands and diverse receptors that exhibit distinct functions in a cell‐ and context-dependent manner through interaction with other proteins, thereby affecting multiple signaling cascades. This intricate pathway is crucial for vessel wall homeostasis in many diseases, including PAH. Therefore, a deeper understanding of this pathway is necessary for the development of safer and efficient therapies for PAH.

In conclusion, overactive TGF‐β signaling is an important regulator of pulmonary vascular remodelling in PAH, e.g., by balancing BMP signaling. TGF‐β inhibitors have entered clinical trials for treatment of cancer and fibrotic diseases with encouraging first clinical results. The future of specific TGF‐β inhibitors are promising and open new challenges in PAH research.

Funding We gratefully acknowledge the support from the Dutch Lung Foundation (5.2.17.198JO) and the Netherlands CardioVascular Research Initiative: The Dutch Heart Foundation, the Dutch Federation of University Medical Centers, the Netherlands Organisation for Health Research and Development and the Royal Netherlands Academy of Sciences (2012‐08). 114

References encoding a TGF‐β receptor, cause familial primary pulmonary hypertension. Nat. Genet. 2000, 26, 81–84. 10. Deng, Z.; Morse, J.H.; Slager, S.L.; Cuervo, N.; Moore, 1. Galie, N.; Humbert, M.; Vachiery, J.L.; Gibbs, S.; Lang, K.J.; Venetos, G.; Kalachikov, S.; Cayanis, E.; Fischer, I.; Torbicki, A.; Simonneau, G.; Peacock, A.; Vonk, N.A.; S.G.; Barst, R.J.; et al. Familial primary pulmonary Beghetti, M.; et al. 2015 ESC/ERS Guidelines for the hypertension (gene PPH1) is caused by mutations in the diagnosis and treatment of pulmonary hypertension: bone morphogenetic protein receptor‐II gene. Am. J. The Joint Task Force for the Diagnosis and Treatment Hum. Genet. 2000, 67, 737–744. of Pulmonary Hypertension of the European Society of 11. Long, L.; Ormiston, M.L.; Yang, X.; Southwood, M.; Cardiology (ESC) and the European Respiratory Society Graf, S.; Machado, R.D.; Mueller, M.; Kinzel, B.; Yung, (ERS): Endorsed by: Association for European Paediatric L.M.; Wilkinson, J.M.; et al. Selective enhancement of and Congenital Cardiology (AEPC), International Society endothelial BMPR‐II with BMP9 reverses pulmonary for Heart and Lung Transplantation (ISHLT). Eur. Heart J. arterial hypertension. Nat. Med. 2015, 21, 777–785. 2016, 37, 67–119. 12. Yung, L.M.; Nikolic, I.; Paskin‐Flerlage, S.D.; Pearsall, 2. Rich, S.; Kaufmann, E.; Levy, P.S. The effect of high R.S.; Kumar, R.; Yu, P.B. A Selective TGFβ Ligand Trap doses of calcium‐channel blockers on survival in primary Attenuates Pulmonary Hypertension. Am. J. Respir. Crit. pulmonary hypertension. N. Engl. J. Med. 1992, 327, Care Med. 2016, 134, A19307. 76–81. 13. Ogo, T.; Chowdhury, H.M.; Yang, J.; Long, L.; Li, X.; 3. Tantini, B.; Manes, A.; Fiumana, E.; Pignatti, Torres Cleuren, Y.N.; Morrell, N.W.; Schermuly, R.T.; C.; Guarnieri, C.; Zannoli, R.; Branzi, A.; Galie, N. Trembath, R.C.; Nasim, M.T. Inhibition of overactive Antiproliferative effect of sildenafil on human pulmonary transforming growth factor‐β signaling by prostacyclin artery smooth muscle cells. Basic. Res. Cardiol. 2005, analogs in pulmonary arterial hypertension. Am. J. 100, 131–138. Respir. Cell Mol. Biol. 2013, 48, 733–741. 4. Ten, D.P.; Arthur, H.M. Extracellular control of TGFβ 14. Zabini, D.; Granton, E.; Hu, Y.; Miranda, M.Z.; signalling in vascular development and disease. Nat. Weichelt, U.; Breuils Bonnet, S.; Bonnet, S.; Morrell, Rev. Mol. Cell. Biol. 2007, 8, 857–869. N.W.; Connelly, K.A.; Provencher, S.; et al. Loss of SMAD3 5. Ten, D.P.; Goumans, M.J.; Pardali, E. Endoglin in Promotes Vascular Remodeling in Pulmonary Arterial angiogenesis and vascular diseases. Angiogenesis 2008, Hypertension via MRTF Disinhibition. Am. J. Respir Crit. 11, 79–89. Care Med. 2018, 197, 244–260. 6. Liang, H.; Zhang, C.; Ban, T.; Liu, Y.; Mei, L.; Piao, X.; 15. Bellaye, P.S.; Yanagihara, T.; Granton, E.; Sato, S.; Zhao, D.; Lu, Y.; Chu, W.; Yang, B. A novel reciprocal Shimbori, C.; Upagupta, C.; Imani, J.; Hambly, N.; Ask, loop between microRNA‐21 and TGFβRIII is involved K.; Gauldie, J.; et al. Macitentan reduces progression in cardiac fibrosis. Int. J. Biochem. Cell. Biol. 2012, 44, of TGF‐β1‐induced pulmonary fibrosis and pulmonary 2152–2160. hypertension. Eur. Respir. J. 2018, 1701857. 7. Goumans, M.J.; Ten Dijke, P. TGF‐β signaling in control 16. Lu, A.; Zuo, C.; He, Y.; Chen, G.; Piao, L.; Zhang, J.; of cardiovascular function. Cold Spring Harb Perspect. Xiao, B.; Shen, Y.; Tang, J.; Kong, D.; et al. EP3 receptor Biol. 2017. deficiency attenuates pulmonary hypertension through 8. Goumans, M.J.; Zwijsen, A.; Ten Dijke, P.; Bailly, S. suppression of Rho/TGF‐β1 signaling. J. Clin. Investing. Bone morphogenetic proteins in vascular homeostasis 2015, 125, 1228–1242. and disease. Cold Spring Harb. Perspect. Biol. 2018, 10: 17. Garcia‐Rivas, G.; Jerjes‐Sanchez, C.; Rodriguez, D.; a031989. Garcia‐Pelaez, J.; Trevino, V. A systematic review of 9. Lane, K.B.; Machado, R.D.; Pauciulo, M.W.; Thomson, genetic mutations in pulmonary arterial hypertension. J.R.; Phillips, J.A., III; Loyd, J.E.; Nichols, W.C.; Trembath, BMC Med. Genet. 2017, 18, 82. R.C. Heterozygous germline mutations in BMPR2, 18. Selimovic, N.; Bergh, C.H.; Andersson, B.; Sakiniene, TGF-β and BMPR2 signaling in PAH 115

E.; Carlsten, H.; Rundqvist, B. Growth factors and 27. Rajkumar, R.; Konishi, K.; Richards, T.J.; Ishizawar, D.C.; interleukin‐6 across the lung circulation in pulmonary Wiechert, A.C.; Kaminski, N.; Ahmad, F. Genomewide hypertension. Eur. Respir. J. 2009, 34, 662–668. RNA expression profiling in lung identifies distinct 19. Gore, B.; Izikki, M.; Mercier, O.; Dewachter, L.; Fadel, signatures in idiopathic pulmonary arterial hypertension E.; Humbert, M.; Dartevelle, P.; Simonneau, G.; Naeije, and secondary pulmonary hypertension. Am. J. Physiol. R.; Lebrin, F.; et al. Key role of the endothelial TGF‐β/ Heart Circ. Physiol. 2010, 298, H1235–H1248. ALK1/endoglin signaling pathway in humans and rodents 28. Geraci, M.W.; Moore, M.; Gesell, T.; Yeager, M.E.; pulmonary hypertension. PLoS ONE 2014, 9, e100310. Alger, L.; Golpon, H.; Gao, B.; Loyd, J.E.; Tuder, R.M.; 20. Botney, M.D.; Bahadori, L.; Gold, L.I. Vascular Voelkel, N.F. Gene expression patterns in the lungs of remodeling in primary pulmonary hypertension. patients with primary pulmonary hypertension: A gene Potential role for transforming growth factor‐β. Am. J. microarray analysis. Circ. Res. 2001, 88, 555–562. Pathol. 1994, 144, 286–295. 29. Hemnes, A.R.; Brittain, E.L.; Trammell, A.W.; Fessel, 21. Ranchoux, B.; Antigny, F.; Rucker‐Martin, C.; J.P.; Austin, E.D.; Penner, N.; Maynard, K.B.; Gleaves, L.; Hautefort, A.; Pechoux, C.; Bogaard, H.J.; Dorfmuller, Talati, M.; Absi, T.; et al. Evidence for right ventricular P.; Remy, S.; Lecerf, F.; Plante, S.; et al. Endothelial‐to‐ lipotoxicity in heritable pulmonary arterial hypertension. mesenchymal transition in pulmonary hypertension. Am. J. Respir. Crit. Care Med. 2014, 189, 325–334. Circulation 2015, 131, 1006–1018. 30. Moreno‐Vinasco, L.; Gomberg‐Maitland, M.; 22. Wang, X.B.; Wang, W.; Zhu, X.C.; Ye, W.J.; Cai, H.; Wu, Maitland, M.L.; Desai, A.A.; Singleton, P.A.; Sammani, S.; 6 P.L.; Huang, X.Y.; Wang, L.X. The potential of asiaticoside Sam, L.; Liu, Y.; Husain, A.N.; Lang, R.M.; et al. Genomic for TGF‐β1/Smad signaling inhibition in prevention assessment of a multikinase inhibitor, sorafenib, in and progression of hypoxia‐induced pulmonary a rodent model of pulmonary hypertension. Physiol. hypertension. Life Sci. 2015, 137, 56–64. Genomics 2008, 33, 278–291. 23. Dong, L.; Li, Y.; Hu, H.; Shi, L.; Chen, J.; Wang, B.; 31. Yndestad, A.; Larsen, K.O.; Oie, E.; Ueland, T.; Smith, Chen, C.; Zhu, H.; Li, Y.; Li, Q.; et al. Potential therapeutic C.; Halvorsen, B.; Sjaastad, I.; Skjonsberg, O.H.; Pedersen, targets for hypoxia‐induced pulmonary artery T.M.; Anfinsen, O.G.; et al. Elevated levels of activin A in hypertension. J. Transl. Med. 2014, 12, 39. clinical and experimental pulmonary hypertension. J. 24. Graham, B.B.; Chabon, J.; Gebreab, L.; Poole, J.; Appl. Physiol. 2009, 106, 1356–1364. Debella, E.; Davis, L.; Tanaka, T.; Sanders, L.; Dropcho, 32. Nickel, N.; Kempf, T.; Tapken, H.; Tongers, J.; Laenger, N.; Bandeira, A.; et al. Transforming growth factor‐β F.; Lehmann, U.; Golpon, H.; Olsson, K.; Wilkins, M.R.; signaling promotes pulmonary hypertension caused Gibbs, J.S.; et al. Growth differentiation factor‐15 in by Schistosoma mansoni. Circulation 2013, 128, 1354– idiopathic pulmonary arterial hypertension. Am. J. 1364. Respir. Crit. Care Med. 2008, 178, 534–541. 25. Long, L.; Crosby, A.; Yang, X.; Southwood, M.; Upton, 33. Rhodes, C.J.; Wharton, J.; Howard, L.S.; Gibbs, J.S.; P.D.; Kim, D.K.; Morrell, N.W. Altered bone morphogenetic Wilkins, M.R. Red cell distribution width outperforms protein and transforming growth factor‐β signaling in rat other potential circulating biomarkers in predicting models of pulmonary hypertension: Potential for activin survival in idiopathic pulmonary arterial hypertension. receptor‐like kinase‐5 inhibition in prevention and Heart 2011, 97, 1054–1060. progression of disease. Circulation 2009, 119, 566–576. 34. Nickel, N.; Jonigk, D.; Kempf, T.; Bockmeyer, C.L.; 26. Ahmed, L.A.; Obaid, A.A.; Zaki, H.F.; Agha, A.M. Maegel, L.; Rische, J.; Laenger, F.; Lehmann, U.; Sauer, Role of oxidative stress, inflammation, nitric oxide and C.; Greer, M.; et al. GDF‐15 is abundantly expressed in transforming growth factor‐β in the protective effect plexiform lesions in patients with pulmonary arterial of diosgenin in monocrotaline‐induced pulmonary hypertension and affects proliferation and apoptosis of hypertension in rats. Eur. J. Pharmacol. 2014, 740, 379– pulmonary endothelial cells. Respir. Res. 2011, 12, 62. 387. 35. Eyries, M.; Coulet, F.; Girerd, B.; Montani, D.; 116

Humbert, M.; Lacombe, P.; Chinet, T.; Gouya, L.; Roume, 43. Zakrzewicz, A.; Kouri, F.M.; Nejman, B.; J.; Axford, M.M.; et al. ACVRL1 germinal mosaic with two Kwapiszewska, G.; Hecker, M.; Sandu, R.; Dony, E.; mutant alleles in hereditary hemorrhagic telangiectasia Seeger, W.; Schermuly, R.T.; Eickelberg, O.; et al. The associated with pulmonary arterial hypertension. Clin. transforming growth factor‐β/Smad2,3 signalling axis is Genet. 2012, 82, 173–179. impaired in experimental pulmonary hypertension. Eur. 36. Austin, E.D.; Loyd, J.E. The genetics of Respir. J. 2007, 29, 1094–1104. pulmonary arterial hypertension. Circ. Res. 2014, 115, 44. Yu, H.; Xu, M.; Dong, Y.; Liu, J.; Li, Y.; Mao, W.; Wang, 189–202. J.; Wang, L. 1,25(OH)2D3 attenuates pulmonary arterial 37. Ramos, M.F.; Lame, M.W.; Segall, H.J.; Wilson, D.W. hypertension via microRNA‐204 mediated Tgfbr2/Smad Smad signaling in the rat model of monocrotaline signaling. Exp. Cell Res. 2018, 362, 311–323. pulmonary hypertension. Toxicol. Pathol. 2008, 36, 45. Phillips, J.A., III; Poling, J.S.; Phillips, C.A.; Stanton, K.C.; 311–320. Austin, E.D.; Cogan, J.D.; Wheeler, L.; Yu, C.; Newman, 38. Jachec, W.; Foremny, A.; Domal‐Kwiatkowska, D.; J.H.; Dietz, H.C.; et al. Synergistic heterozygosity for Smolik, S.; Tomasik, A.; Mazurek, U.; Wodniecki, J. TGFβ1 SNPs and BMPR2 mutations modulates the age at Expression of TGF‐β1 and its receptor genes (TβR I, TβR diagnosis and penetrance of familial pulmonary arterial II, and TβR III‐βglycan) in peripheral blood leucocytes in hypertension. Genet. Med. 2008, 10, 359–365. patients with idiopathic pulmonary arterial hypertension 46. Ma, W.; Han, W.; Greer, P.A.; Tuder, R.M.; Toque, and Eisenmenger’s syndrome. Int. J. Mol. Med. 2008, H.A.; Wang, K.K.; Caldwell, R.W.; Su, Y. Calpain mediates 21, 99–107. pulmonary vascular remodeling in rodent models of 39. Richter, A.; Yeager, M.E.; Zaiman, A.; Cool, C.D.; pulmonary hypertension, and its inhibition attenuates Voelkel, N.F.; Tuder, R.M. Impaired transforming growth pathologic features of disease. J. Clin. Investing. 2011, factor‐β signaling in idiopathic pulmonary arterial 121, 4548–4566. hypertension. Am. J. Respir. Crit Care Med. 2004, 170, 47. Nasim, M.T.; Ogo, T.; Ahmed, M.; Randall, R.; 1340–1348. Chowdhury, H.M.; Snape, K.M.; Bradshaw, T.Y.; 40. van der Bruggen, C.E.; Happe, C.M.; Dorfmuller, P.; Southgate, L.; Lee, G.J.; Jackson, I.; et al. Molecular Trip, P.; Spruijt, O.A.; Rol, N.; Hoevenaars, F.P.; Houweling, genetic characterization of SMAD signaling molecules in A.C.; Girerd, B.; Marcus, J.T.; et al. Bone Morphogenetic pulmonary arterial hypertension. Hum. Mutat. 2011, 32, Protein Receptor Type 2 Mutation in Pulmonary Arterial 1385–1389. Hypertension: A View on the Right Ventricle. Circulation 48. Morty, R.E.; Nejman, B.; Kwapiszewska, G.; Hecker, 2016, 133, 1747–1760. M.; Zakrzewicz, A.; Kouri, F.M.; Peters, D.M.; Dumitrascu, 41. Thomas, M.; Docx, C.; Holmes, A.M.; Beach, S.; R.; Seeger, W.; Knaus, P.; et al. Dysregulated bone Duggan, N.; England, K.; Leblanc, C.; Lebret, C.; Schindler, morphogenetic protein signaling in monocrotaline‐ F.; Raza, F.; et al. Activin‐like kinase 5 (ALK5) mediates induced pulmonary arterial hypertension. Arterioscler. abnormal proliferation of vascular smooth muscle Thromb. Vasc. Biol. 2007, 27, 1072–1078. cells from patients with familial pulmonary arterial 49. Kouri, F.M.; Queisser, M.A.; Konigshoff, M.; Chrobak, hypertension and is involved in the progression of I.; Preissner, K.T.; Seeger, W.; Eickelberg, O. Plasminogen experimental pulmonary arterial hypertension induced activator inhibitor type 1 inhibits smooth muscle cell by monocrotaline. Am. J. Pathol. 2009, 174, 380–389. proliferation in pulmonary arterial hypertension. Int. J. 42. Derrett‐Smith, E.C.; Dooley, A.; Gilbane, A.J.; Biochem. Cell Biol. 2008, 40, 1872–1882. Trinder, S.L.; Khan, K.; Baliga, R.; Holmes, A.M.; Hobbs, 50. Welsh, C.H.; Hassell, K.L.; Badesch, D.B.; Kressin, A.J.; Abraham, D.; Denton, C.P. Endothelial injury in D.C.; Marlar, R.A. Coagulation and fibrinolytic profiles a transforming growth factor β‐dependent mouse in patients with severe pulmonary hypertension. Chest model of scleroderma induces pulmonary arterial 1996, 110, 710–717. hypertension. Arthritis Rheum. 2013, 65, 2928–2939. 51. Szulcek, R.; Happe, C.M.; Rol, N.; Fontijn, R.D.; TGF-β and BMPR2 signaling in PAH 117

Dickhoff, C.; Hartemink, K.J.; Grunberg, K.; Tu, L.; association with βglycan and formation of higher Timens, W.; Nossent, G.D.; et al. Delayed Microvascular order complexes with TGF‐β signalling receptors. Eur. J. Shear‐adaptation in Pulmonary Arterial Hypertension: Biochem. 2000, 267, 5550–5560. Role of PECAM‐1 Cleavage. Am. J. Respir. Crit. Care Med. 64. Goumans, M.J.; Valdimarsdottir, G.; Itoh, S.; 2016, 193, 1410–1420. Rosendahl, A.; Sideras, P.; Ten, D.P. Balancing the 52. Ma, L.; Chung, W.K. The role of genetics in pulmonary activation state of the endothelium via two distinct arterial hypertension. J. Pathol. 2017, 241, 273–280. TGF‐β type I receptors. EMBO J. 2002, 21, 1743–1753. 53. Friedberg, M.K.; Cho, M.Y.; Li, J.; Assad, R.S.; Sun, M.; 65. Oh, S.P.; Seki, T.; Goss, K.A.; Imamura, T.; Yi, Y.; Rohailla, S.; Honjo, O.; Apitz, C.; Redington, A.N. Adverse Donahoe, P.K.; Li, L.; Miyazono, K.; Ten, D.P.; Kim, biventricular remodeling in isolated right ventricular S.; et al., Activin receptor‐like kinase 1 modulates hypertension is mediated by increased transforming transforming growth factor‐β 1 signaling in the growth factor‐β1 signaling and is abrogated by regulation of angiogenesis. Proc. Natl. Acad. Sci. USA. angiotensin receptor blockade. Am. J. Respir. Cell Mol. 2000, 97, 2626–2631. Biol. 2013, 49, 1019–1028. 66. Kretzschmar, M.; Doody, J.; Massague, J. Opposing 54. Gomez‐Arroyo, J.; Sakagami, M.; Syed, A.A.; Farkas, BMP and EGF signalling pathways converge on the TGF‐β L.; Van, T.B.; Kraskauskas, D.; Mizuno, S.; Abbate, family mediator Smad1. Nature 1997, 389, 618–622. A.; Bogaard, H.J.; Byron, P.R.; et al. Iloprost reverses 67. Labbe, E.; Silvestri, C.; Hoodless, P.A.; Wrana, J.L.; established fibrosis in experimental right ventricular Attisano, L. Smad2 and Smad3 positively and negatively 6 failure. Eur. Respir. J. 2015, 45, 449–462. regulate TGF β‐dependent transcription through the 55. Heldin, C.H.; Miyazono, K.; Ten, D.P. TGF‐β signalling forkhead DNA‐binding protein FAST2. Mol. Cell 1998, 2, from cell membrane to nucleus through SMAD proteins. 109–120. Nature 1997, 390, 465–471. 68. Topper, J.N.; Cai, J.; Qiu, Y.; Anderson, K.R.; Xu, 56. Heldin, C.H.; Moustakas, A. Role of Smads in TGFβ Y.Y.; Deeds, J.D.; Feeley, R.; Gimeno, C.J.; Woolf, E.A.; signaling. Cell. Tissue Res. 2012, 347, 21–36. Tayber, O.; et al. Vascular MADs: Two novel MAD‐related 57. Goumans, M.J.; Liu, Z.; Ten, D.P. TGF‐β signaling in genes selectively inducible by flow in human vascular vascular biology and dysfunction. Cell Res. 2009, 19, endothelium. Proc. Natl Acad Sci USA. 1997, 94, 9314– 116–127. 9319. 58. Kurakula, K.; Goumans, M.J.; Ten, D.P. Regulatory 69. Hata, A.; Lieberman, J. Dysregulation of microRNA RNAs controlling vascular (dys)function by affecting biogenesis and gene silencing in cancer. Sci. Signal. TGF‐ss family signalling. EXCLI J. 2015, 14, 832–850. 2015, 8, re3. 59. Schmierer, B.; Hill, C.S. TGFβ‐SMAD signal 70. Euler, G. Good and bad sides of TGFβ‐signaling in transduction: Molecular specificity and functional myocardial infarction. Front. Physiol. 2015, 6, 66. flexibility. Nat. Rev. Mol. Cell Biol. 2007, 8, 970–982. 71. Cai, J.; Pardali, E.; Sanchez‐Duffhues, G.; Ten, D.P. 60. Shi, Y.; Massague, J. Mechanisms of TGF‐β signaling BMP signaling in vascular diseases. FEBS Lett. 2012, 586, from cell membrane to the nucleus. Cell 2003, 113, 1993–2002. 685–700. 72. Akhurst, R.J.; Hata, A. Targeting the TGFβ signalling 61. Hata, A.; Chen, Y.G. TGF‐β Signaling from Receptors pathway in disease. Nat. Rev. Drug Discov. 2012, 11, to Smads. Cold Spring Harb. Perspect. Biol. 2016, 8, 790–811. a022061. 73. Hinck, A.P.; Mueller, T.D.; Springer, T.A. Structural 62. Heldin, C.H.; Moustakas, A. Signaling Receptors for Biology and Evolution of the TGF‐β Family. Cold Spring TGF‐β Family Members. Cold Spring Harb. Perspect. Harb. Perspect. Biol. 2016, 8, a021907. Biol. 2016. 8, a022053. 74. Haque, S.; Morris, J.C. Transforming growth 63. Wong, S.H.; Hamel, L.; Chevalier, S.; Philip, A. Endoglin factor‐β: A therapeutic target for cancer. Hum. Vaccin. expression on human microvascular endothelial cells Immunother 2017, 13, 1741–1750. 118

75. Xu, X.; Zheng, L.; Yuan, Q.; Zhen, G.; Crane, J.L.; Zhou, cytokines. Am. J. Physiol. Lung Cell. Mol. Physiol. 2012, X.; Cao, X. Transforming growth factor‐β in stem cells 302, L604–L615. and tissue homeostasis. Bone Res. 2018, 6, 2. 85. Liu, Y.; Cao, Y.; Sun, S.; Zhu, J.; Gao, S.; Pang, 76. Robertson, I.B.; Rifkin, D.B. Regulation of the J.; Zhu, D.; Sun, Z. Transforming growth factor‐β1 Bioavailability of TGF‐β and TGF‐β‐Related Proteins. upregulation triggers pulmonary artery smooth muscle Cold Spring Harb. Perspect. Biol. 2016, 8, a022103. cell proliferation and apoptosis imbalance in rats with 77. Caja, L.; Dituri, F.; Mancarella, S.; Caballero‐Diaz, hypoxic pulmonary hypertension via the PTEN/AKT D.; Moustakas, A.; Giannelli, G.; Fabregat, I. TGF‐β and pathways. Int J. Biochem. Cell Biol. 2016, 77, 141–154. the Tissue Microenvironment: Relevance in Fibrosis and 86. Graham, B.B.; Kumar, R. Schistosomiasis and the Cancer. Int J. Mol. Sci. 2018, 19, 1294. pulmonary vasculature (2013 Grover Conference 78. Kurakula, K.; Goumans, M.J.; Ten, D.P. Regulatory series). Pulm. Circ. 2014, 4, 353–362. RNAs controlling vascular (dys)function by affecting 87. Gilbane, A.J.; Derrett‐Smith, E.; Trinder, S.L.; Good, TGF‐ss family signalling. EXCLI J. 2015, 14, 832–850. R.B.; Pearce, A.; Denton, C.P.; Holmes, A.M. Impaired 79. Jonigk, D.; Golpon, H.; Bockmeyer, C.L.; Maegel, L.; bone morphogenetic protein receptor II signaling in a Hoeper, M.M.; Gottlieb, J.; Nickel, N.; Hussein, K.; Maus, transforming growth factor‐β‐dependent mouse model U.; Lehmann, U.; et al. Plexiform lesions in pulmonary of pulmonary hypertension and in systemic sclerosis. arterial hypertension composition, architecture, and Am. J. Respir. Crit. Care Med. 2015, 191, 665–677. microenvironment. Am. J. Pathol. 2011, 179, 167–179. 88. Kumar, R.; Mickael, C.; Kassa, B.; Gebreab, L.; 80. Upton, P.D.; Davies, R.J.; Tajsic, T.; Morrell, N.W. Robinson, J.C.; Koyanagi, D.E.; Sanders, L.; Barthel, Transforming growth factor‐β(1) represses bone L.; Meadows, C.; Fox, D.; et al. TGF‐β activation by morphogenetic protein‐mediated Smad signaling in bone marrow‐derived thrombospondin‐1 causes pulmonary artery smooth muscle cells via Smad3. Am. J. Schistosoma‐ and hypoxia‐induced pulmonary Respir. Cell Mol. Biol. 2013, 49, 1135–1145. hypertension. Nat. Commun. 2017, 8, 15494. 81. Aykul, S.; Martinez‐Hackert, E. Transforming Growth 89. Frid, M.G.; Kale, V.A.; Stenmark, K.R. Mature vascular Factor‐β Family Ligands Can Function as Antagonists by endothelium can give rise to smooth muscle cells via Competing for Type II Receptor Binding. J. Biol. Chem. endothelial‐mesenchymal transdifferentiation: In vitro 2016, 291, 10792–10804. analysis. Circ. Res. 2002, 90, 1189–1196. 82. Yang, X.; Long, L.; Reynolds, P.N.; Morrell, N.W. 90. Arciniegas, E.; Frid, M.G.; Douglas, I.S.; Stenmark, Expression of mutant BMPR‐II in pulmonary endothelial K.R. Perspectives on endothelial‐to‐mesenchymal cells promotes apoptosis and a release of factors that transition: Potential contribution to vascular remodeling stimulate proliferation of pulmonary arterial smooth in chronic pulmonary hypertension. Am. J. Physiol. Lung muscle cells. Pulm. Circ. 2011, 1, 103–110. Cell. Mol. Physiol. 2007, 293, L1–L8. 83. Morrell, N.W.; Yang, X.; Upton, P.D.; Jourdan, K.B.; 91. Kruithof, B.P.; Duim, S.N.; Moerkamp, A.T.; Morgan, N.; Sheares, K.K.; Trembath, R.C. Altered Goumans, M.J. TGFβ and BMP signaling in cardiac growth responses of pulmonary artery smooth cushion formation: Lessons from mice and chicken. muscle cells from patients with primary pulmonary Differentiation 2012, 84, 89–102. hypertension to transforming growth factor‐β(1) and 92. Good, R.B.; Gilbane, A.J.; Trinder, S.L.; Denton, C.P.; bone morphogenetic proteins. Circulation 2001, 104, Coghlan, G.; Abraham, D.J.; Holmes, A.M. Endothelial 790–795. to Mesenchymal Transition Contributes to Endothelial 84. Davies, R.J.; Holmes, A.M.; Deighton, J.; Long, L.; Dysfunction in Pulmonary Arterial Hypertension. Am. J. Yang, X.; Barker, L.; Walker, C.; Budd, D.C.; Upton, P.D.; Pathol. 2015, 185, 1850–1858. Morrell, N.W., BMP type II receptor deficiency confers 93. Diez, M.; Musri, M.M.; Ferrer, E.; Barbera, J.A.; resistance to growth inhibition by TGF‐β in pulmonary Peinado, V.I. Endothelial progenitor cells undergo an artery smooth muscle cells: Role of proinflammatory endothelial‐to‐mesenchymal transition‐like process TGF-β and BMPR2 signaling in PAH 119

mediated by TGFβRI. Cardiovasc. Res. 2010, 88, 502– pathway in systemic sclerosis. J. Autoimmun. 2011, 36, 511. 181–188. 94. Zeisberg, E.M.; Tarnavski, O.; Zeisberg, M.; Dorfman, 103. Yasuda, T.; Tada, Y.; Tanabe, N.; Tatsumi, K.; West, J., A.L.; McMullen, J.R.; Gustafsson, E.; Chandraker, A.; Rho‐kinase inhibition alleviates pulmonary hypertension Yuan, X.; Pu, W.T.; Roberts, A.B.; et al. Endothelial‐to‐ in transgenic mice expressing a dominant‐negative type mesenchymal transition contributes to cardiac fibrosis. II bone morphogenetic protein receptor gene. Am. J. Nat. Med. 2007, 13, 952–961. Physiol. Lung Cell. Mol. Physiol. 2011, 301, L667–L674. 95. He, J.; Xu, Y.; Koya, D.; Kanasaki, K. Role of the 104. Ha, H.; Oh, E.Y.; Lee, H.B. The role of plasminogen endothelial‐to‐mesenchymal transition in renal fibrosis activator inhibitor 1 in renal and cardiovascular diseases. of chronic kidney disease. Clin. Exp. Nephrol. 2013, 17, Nat. Rev. Nephrol. 2009, 5, 203–211. 488–497. 105. Hassell, K.L., Altered hemostasis in 96. Kitao, A.; Sato, Y.; Sawada‐Kitamura, S.; Harada, K.; pulmonary hypertension. Blood Coagul. Fibrinolysis Sasaki, M.; Morikawa, H.; Shiomi, S.; Honda, M.; Matsui, 1998, 107–117. O.; Nakanuma, Y. Endothelial to mesenchymal transition 106. Gallione, C.J.; Richards, J.A.; Letteboer, T.G.; via transforming growth factor‐β1/Smad activation is Rushlow, D.; Prigoda, N.L.; Leedom, T.P.; Ganguly, A.; associated with portal venous stenosis in idiopathic Castells, A.; Ploos van Amstel, J.K.; Westermann, C.J.; et portal hypertension. Am. J. Pathol. 2009, 175, 616–626. al. SMAD4 mutations found in unselected HHT patients. 97. Kang, Z.; Ji, Y.; Zhang, G.; Qu, Y.; Zhang, L.; Jiang, J. Med. Genet. 2006, 43, 793–797. 6 W. Ponatinib attenuates experimental pulmonary 107. Yang, J.; Li, X.; Al‐Lamki, R.S.; Southwood, M.; arterial hypertension by modulating Wnt signaling and Zhao, J.; Lever, A.M.; Grimminger, F.; Schermuly, R.T.; vasohibin‐2/vasohibin‐1. Life Sci. 2016, 148, 1–8. Morrell, N.W. Smad‐dependent and smad‐independent 98. Vorselaars, V.; Velthuis, S.; van Gent, M.; induction of id1 by prostacyclin analogues inhibits Westermann, C.; Snijder, R.; Mager, J.; Post, M., proliferation of pulmonary artery smooth muscle cells in Pulmonary Hypertension in a Large Cohort with vitro and in vivo. Circ. Res. 2010, 107, 252–262. Hereditary Hemorrhagic Telangiectasia. Respiration 108. Pardali, E.; Goumans, M.J.; ten Dijke, P., Signaling by 2017, 94, 242–250. members of the TGF‐β family in vascular morphogenesis 99. Mahmoud, M.; Borthwick, G.M.; Hislop, A.A.; Arthur, and disease. Trends Cell. Biol. 2010, 20, 556–567. H.M. Endoglin and activin receptor‐like‐kinase 1 are co‐ 109. Zhang, Y.E. Non‐Smad pathways in TGF‐β signaling. expressed in the distal vessels of the lung: Implications Cell Res. 2009, 19, 128–139. for two familial vascular dysplasias, HHT and PAH. Lab. 110. Zhang, Y.E. Non‐Smad Signaling Pathways of the Invest. 2009, 89, 15–25. TGF‐β Family. Cold Spring Harb. Perspect. Biol. 2016. 9, 100. Trembath, R.C.; Thomson, J.R.; Machado, R.D.; a022129. Morgan, N.V.; Atkinson, C.; Winship, I.; Simonneau, G.; 111. Awad, K.S.; Elinoff, J.M.; Wang, S.; Gairhe, S.; Galie, N.; Loyd, J.E.; Humbert, M.; et al. Clinical and Ferreyra, G.A.; Cai, R.; Sun, J.; Solomon, M.A.; Danner, molecular genetic features of pulmonary hypertension R.L., Raf/ERK drives the proliferative and invasive in patients with hereditary hemorrhagic telangiectasia. phenotype of BMPR2‐silenced pulmonary artery N. Engl. J. Med. 2001, 345, 325–334. endothelial cells. Am. J. Physiol Lung Cell. Mol. Physiol. 101. Upton, P.D.; Morrell, N.W. The transforming growth 2016, 310, L187–L201. factor‐β‐bone morphogenetic protein type signalling 112. Lambers, C.; Roth, M.; Zhong, J.; Campregher, pathway in pulmonary vascular homeostasis and C.; Binder, P.; Burian, B.; Petkov, V.; Block, L.H. The disease. Exp. Physiol. 2013, 98, 1262–1266. interaction of endothelin‐1 and TGF‐β1 mediates 102. Takagi, K.; Kawaguchi, Y.; Kawamoto, M.; Ota, Y.; vascular cell remodeling. PLoS ONE 2013, 8, e73399. Tochimoto, A.; Gono, T.; Katsumata, Y.; Takagi, M.; Hara, 113. Razani, B.; Zhang, X.L.; Bitzer, M.; von, G. G.; M.; Yamanaka, H. Activation of the activin A‐ALK‐Smad Bottinger, E.P.; Lisanti, M.P. Caveolin‐1 regulates 120

transforming growth factor (TGF)‐β/SMAD signaling pulmonary arterial smooth muscle cells. Am. J. Physiol through an interaction with the TGF‐β type I receptor. J. Lung Cell. Mol. Physiol. 2013, 305, L312–L321. Biol. Chem. 2001, 276, 6727–6738. 123. Yang, J.; Davies, R.J.; Southwood, M.; Long, L.; Yang, 114. Olsson, K.M.; Delcroix, M.; Ghofrani, H.A.; Tiede, X.; Sobolewski, A.; Upton, P.D.; Trembath, R.C.; Morrell, H.; Huscher, D.; Speich, R.; Grunig, E.; Staehler, G.; N.W., Mutations in bone morphogenetic protein type Rosenkranz, S.; Halank, M.; et al. Anticoagulation and II receptor cause dysregulation of Id gene expression survival in pulmonary arterial hypertension: Results in pulmonary artery smooth muscle cells: Implications from the Comparative, Prospective Registry of Newly for familial pulmonary arterial hypertension. Circ. Res. Initiated Therapies for Pulmonary Hypertension 2008, 102, 1212–1221. (COMPERA). Circulation 2014, 129, 57–65. 124. Riechmann, V.; van Cruchten, I.; Sablitzky, F. The 115. Preston, I.R.; Roberts, K.E.; Miller, D.P.; Sen, G.P.; expression pattern of Id4, a novel dominant negative Selej, M.; Benton, W.W.; Hill, N.S.; Farber, H.W. Effect helix‐loop‐helix protein, is distinct from Id1, Id2 and Id3. of Warfarin Treatment on Survival of Patients With Nucleic Acids Res. 1994, 22, 749–755. Pulmonary Arterial Hypertension (PAH) in the Registry to 125. Upton, P.D.; Davies, R.J.; Trembath, R.C.; Morrell, Evaluate Early and Long‐Term PAH Disease Management N.W. Bone morphogenetic protein (BMP) and activin (REVEAL). Circulation 2015, 132, 2403–2411. type II receptors balance BMP9 signals mediated by 116. Hoeper, M.M.; Sosada, M.; Fabel, H. Plasma activin receptor‐like kinase‐1 in human pulmonary coagulation profiles in patients with severe primary artery endothelial cells. J. Biol. Chem. 2009, 284, pulmonary hypertension. Eur. Respir. J. 1998, 12, 1446– 15794–15804. 1449. 126. van de Veerdonk, M.C.; Kind, T.; Marcus, J.T.; 117. Johnson, S.R.; Granton, J.T.; Mehta, S. Thrombotic Mauritz, G.J.; Heymans, M.W.; Bogaard, H.J.; Boonstra, arteriopathy and anticoagulation in pulmonary A.; Marques, K.M.; Westerhof, N.; Vonk‐Noordegraaf, A. hypertension. Chest 2006, 130, 545–552. Progressive right ventricular dysfunction in patients with 118. Eisenberg, P.R.; Lucore, C.; Kaufman, L.; Sobel, B.E.; pulmonary arterial hypertension responding to therapy. Jaffe, A.S.; Rich, S. Fibrinopeptide A levels indicative of J. Am. Coll. Cardiol. 2011, 58, 2511–2519. pulmonary vascular thrombosis in patients with primary 127. Naeije, R.; Manes, A. The right ventricle in pulmonary hypertension. Circulation 1990, 82, 841– pulmonary arterial hypertension. Eur. Respir. Rev. 2014, 847. 23, 476–487. 119. Huber, K.; Beckmann, R.; Frank, H.; Kneussl, M.; 128. Bogaard, H.J.; Abe, K.; Vonk, N.A.; Voelkel, N.F. The Mlczoch, J.; Binder, B.R., Fibrinogen, t‐PA, and PAI‐1 right ventricle under pressure: Cellular and molecular plasma levels in patients with pulmonary hypertension. mechanisms of right‐heart failure in pulmonary Am. J. Respir. Crit. Care Med. 1994, 150, 929–933. hypertension. Chest 2009, 135, 794–804. 120. Olman, M.A.; Marsh, J.J.; Lang, I.M.; Moser, K.M.; 129. Khan, R.; Sheppard, R. Fibrosis in heart disease: Binder, B.R.; Schleef, R.R. Endogenous fibrinolytic system Understanding the role of transforming growth factor‐β in chronic large‐vessel thromboembolic pulmonary in cardiomyopathy, valvular disease and arrhythmia. hypertension. Circulation 1992, 86, 1241–1248. Immunology 2006, 118, 10–24. 121. Christ, G.; Graf, S.; Huber‐Beckmann, R.; Zorn, G.; 130. Okumura, K.; Kato, H.; Honjo, O.; Breitling, S.; Lang, I.; Kneussi, M.; Binder, B.R.; Huber, K. Impairment Kuebler, W.M.; Sun, M.; Friedberg, M.K. Carvedilol of the plasmin activation system in primary pulmonary improves biventricular fibrosis and function in hypertension: Evidence for gender differences. Thromb. experimental pulmonary hypertension. J. Mol. Med. Haemost. 2001, 86, 557–562. 2015, 93, 663–674. 122. Yang, J.; Li, X.; Li, Y.; Southwood, M.; Ye, L.; Long, 131. Wollin, L.; Wex, E.; Pautsch, A.; Schnapp, G.; L.; Al‐Lamki, R.S.; Morrell, N.W. Id proteins are critical Hostettler, K.E.; Stowasser, S.; Kolb, M. Mode of action downstream effectors of BMP signaling in human of nintedanib in the treatment of idiopathic pulmonary TGF-β and BMPR2 signaling in PAH 121

fibrosis. Eur. Respir. J. 2015, 45, 1434–1445. 132. Rol, N.; de Raaf, M.A.; Sun, X.; Kuiper, V.P.; da Silva Goncalves Bos, D.; Happe, C.; Kurakula, K.; Dickhoff, C.; Thuillet, R.; Tu, L.; et al. Nintedanib improves cardiac fibrosis but leaves pulmonary vascular remodeling unaltered in experimental pulmonary hypertension. Cardiovasc. Res. 2018. 133. Megalou, A.J.; Glava, C.; Oikonomidis, D.L.; Vilaeti, A.; Agelaki, M.G.; Baltogiannis, G.G.; Papalois, A.; Vlahos, A.P.; Kolettis, T.M. Transforming growth factor‐β inhibition attenuates pulmonary arterial hypertension in rats. Int. J. Clin. Exp. Med. 2010, 3, 332–340. 134. de Gramont, A.; Faivre, S.; Raymond, E. Novel TGF‐β inhibitors ready for prime time in onco‐immunology. Oncoimmunology 2017, 6, e1257453. 135. Zaiman, A.L.; Podowski, M.; Medicherla, S.; Gordy, K.; Xu, F.; Zhen, L.; Shimoda, L.A.; Neptune, E.; Higgins, L.; Murphy, A.; et al. Role of the TGF‐β/Alk5 6 signaling pathway in monocrotaline‐induced pulmonary hypertension. Am. J. Respir. Crit. Care Med. 2008, 177, 896–905. 136. Schermuly, R.T.; Yilmaz, H.; Ghofrani, H.A.; Woyda, K.; Pullamsetti, S.; Schulz, A.; Gessler, T.; Dumitrascu, R.; Weissmann, N.; Grimminger, F.; et al. Inhaled iloprost reverses vascular remodeling in chronic experimental pulmonary hypertension. Am. J. Respir. Crit. Care Med. 2005, 172, 358–363.

Bone Morphogenetic Protein Receptor Type 2 Mutation in Pulmonary Arterial 7 Hypertension

C.M. Happé • C.E.E van der Bruggen • P. Dorfmuller • P.Trip • O.A. Spruijt • N. Rol • F.P. Hoevenaars • A.C. Houweling • B. Girerd • J.T. Marcus • O. Mercier • M. Humbert • M.L. Handoko • J. van der Velden • A. Vonk Noordegraaf • H.J. Bogaard • M.J. Goumans • F.S. de Man

Circulation • 2016 124

Clinical perspective

A subset of pulmonary arterial hypertension (PAH) patients has a mutation in the bone morphogenetic protein receptor 2 (BMPR2) gene. Despite increased knowledge of the consequences of the BMPR2 mutation on the pulmonary vasculature, only little is known about the effect of a BMPR2 mutation on right ventricular (RV) function and adaptation in PAH patients. In the present study, we provide evidence that PAH patients carrying a BMPR2 mutation have decreased RV function in comparison with PAH patients without the BMPR2 mutation at presentation, despite a similar afterload. Using a translational approach, we could demonstrate that there are no alterations in transforming growth factor β and bone morphogenetic protein signaling in the cardiomyocytes of PAH patients with or without mutation.

Furthermore, our data indicate that RV and left ventricular adaptation is not different between BMPR2 mutation carriers and noncarriers. Our results raise the question whether clinical status and time to death or lung transplantation in BMPR2 mutation carriers could be improved by using the RV as a therapeutic target. Furthermore, our results provide rationale for closely monitoring RV function in BMPR2 mutation carriers in PAH referral centers and subsequently timely referral for lung transplantation. Further therapeutic studies targeting the disturbed transforming growth factor β/bone morphogenetic protein pathway will reveal the clinical implications of this disturbed balance in the RV of PAH patients. BMPR2 in PAH: A view on the right ventricle 125

Abstract

Background: The effect of a mutation in the bone morphogenetic protein receptor 2 (BMPR2) gene on right ventricular (RV) pressure overload in patients with pulmonary arterial hypertension is unknown. Therefore, we investigated RV function in patients who have pulmonary arterial hypertension with and without the BMPR2 mutation by combining in vivo measurements with molecular and histological analysis of human RV and left ventricular tissue.

Methods and results: In total, 95 patients with idiopathic or familial pulmonary arterial hypertension were genetically screened for the presence of a BMPR2 mutation: 28 patients had a BMPR2 mutation, and 67 patients did not have a BMPR2 mutation. In vivo measurements were assessed using right heart catheterization and cardiac MRI. Despite a similar mean pulmonary artery pressure (noncarriers 54±15 versus mutation carriers 55±9 mm Hg) and pulmonary vascular resistance (755 [483-1043] versus 931 [624-1311] dynes·s(-1)·cm(-5)), mutation carriers presented with a more severely compromised RV function (RV ejection fraction: 37.6±12.8% versus 29.0±9%: P<0.05; cardiac index 2.7±0.9 versus 2.2±0.4 L·min(-1)·m(-2)). Differences continued to exist after treatment. To investigate the roleof transforming growth factor β and bone morphogenetic protein receptor II signaling, human RV and 7 left ventricular tissue were studied in controls (n=6), mutation carriers (n=5), and noncarriers (n=11). However, transforming growth fvactor β and bone morphogenetic protein receptor II signaling, and hypertrophy, apoptosis, fibrosis, capillary density, inflammation, and cardiac metabolism, as well, were similar between mutation carriers and noncarriers.

Conclusion: Despite a similar afterload, RV function is more severely affected in mutation carriers than in noncarriers. However, these differences cannot be explained by a differential transforming growth factor β, bone morphogenetic protein receptor II signaling, or cardiac adaptation. 126

Introduction

Pulmonary arterial hypertension (PAH) is a rapidly progressive and lethal disease, characterized by an increase in resistance of the pulmonary arterioles, causing an increased right ventricular (RV) afterload. 1–3 The RV adapts to this increased load via several compensatory mechanisms but these are not sufficient to prevent progression to RV dysfunction and failure, which is the predominant cause of death in PAH. 4 Intriguingly, this clinical observation suggests that the response to rather than the amount of pressure overload determines the fate of the RV in PAH-patients.

Patients with PAH may have an underlying genetic predisposition, in particular a mutation in the bone morphogenetic protein receptor type 2 (BMPR2) gene. 5–11 BMPR2 mutations are an autosomal dominant cause of PAH with reduced penetrance (14% in men, 42% in women) clinically characterized by a younger age and a more severe hemodynamic compromise at presentation compared to idiopathic PAH patients. 10,12–15 The bone morphogenetic protein receptor II (BMPRII) encoded by the BMPR2 gene belongs to the transforming growth factor β (TGF-β) superfamily and mutations have been shown to result in a disturbed BMP/ TGF-β balance. 16–18 Decreased BMPRII activity leads to an overactivated TGF-β signaling, which stimulates vasculogenesis, intimal hyperplasia and medial smooth muscle growth in the pulmonary vasculature. 19,20 In addition, growing evidence suggests a key role for TGF-β signaling in the response to pressure overload of the heart. 21–23

While TGF-β signaling is necessary to protect the heart against uncontrolled matrix degradation and dilatation, excessive TGF-β signaling might be detrimental due to maladapted hypertrophy and myocardial dysfunction, as previously described in left heart failure. 21–23 Furthermore, a recent study by Hemnes et al. showed that the RV hypertrophic response was disturbed in pulmonary hypertensive mice carrying a BMPR2 mutation. 24 However, whether RV function and adaptation in PAH-patients carrying a BMPR2 mutation differs from PAH- patients without identified BMPR2 mutation remains currently elusive. Therefore, the aim of this study was two-fold: 1) to determine the effects of a BMPR2 mutation on RV function in PAH patients and 2) to compare the histological and morphological characteristics of RV tissue samples from PAH-patients with and without a BMPR2 mutation.

BMPR2 in PAH: A view on the right ventricle 127

Methods

Study population Clinical study: We retrospectively reviewed PH patients seen at the VU University Medical Center (Amsterdam, the Netherlands) between March 1995 and October 2014. Patients were eligible for this study when the results from BMPR2 mutation analysis were available. In total, 123 PAH-patients were genetically screened for the presence of a BMPR2 mutation. After the exclusion of 28 patients, 95 patients were included in this study. 28 patients were carriers of a BMPR2 mutation (mutation carriers) and no BMPR2 mutation was identified in 67 sporadic PAH patients (non-carriers). Patients with a family history of PAH withno evidence of a BMPR2 mutation (n=3) or patients with a genetic mutation linked to pulmonary hypertension other than the BMPR2 mutation (n=5) were excluded from the analysis to avoid the risk of misclassification in the BMPR2 non-carriers group.

Figure 1 - Schematic overview of study populations. PH: pulmonary hypertension; IPAH: idiopathic pulmonary arterial hypertension, HPAH; hereditable pulmonary arterial hypertension, BMPR2: bone morphogenetic protein receptor 2, RHC: right heart catheterization, MRI: magnetic resonance imaging. 128

For comparison a group of 15 control subjects without PAH family history was included in this study. Controls were selected from referred patients suspected with PAH but in whom the condition was ruled out after right heart catheterization (RHC). A subset of patients was eligible for treatment response analysis. (Figure 1). Patients were diagnosed with idiopathic PAH according to current clinical guidelines, by means of RHC and by ruling out all associated conditions of PH by a multidisciplinary team. 25 All genetically tested patients signed written informed consent and received genetic counseling. Because the MRI and RHC data were obtained for clinical purposes and analyzed retrospectively, the Medical Ethics Review Committee of the VU University Medical Center did not consider this study to fall within the scope of the Medical Research Involving Human Subjects Act. Therefore, no additional approval was acquired.

Cardiac tissue samples Explanted RV and LV tissue samples were collected from PAH patients undergoing heart/ lung transplantation in the French Referral Centre for Pulmonary Hypertension (Université Paris-Sud, France) (mutation carriers n=5, non-carriers n=11). Control RV and LV tissue was obtained from non-failing donors (n=6). Human cardiac tissue collection and use by collaborating universities (VU Medical Center, Amsterdam) was approved by the Human Research Ethics Committee of the Université Paris-Sud - Inserm U999 (ID RBC 2008-A00485- 50). Written informed consent was obtained. All samples were stored in paraffin.

Genetic analysis of the BMPR2 gene Genomic DNA was extracted from peripheral blood samples after the patients gave informed consent. The coding sequences and the surrounding splice sites of the BMPR2 gene were amplified by polymerase chain reaction (PCR). PCR amplification was performed usinga PE9700 thermocycles (Applied Biosystems, Forster City, CA, USA). Sequencing reactions were performed using the Big Dye Terminator system (Applied Biosystems, Forster City, CA, USA) and run on an ABI 3100XL or ABI3730 genetic analyzer (Applied Biosystems, Forster City, CA, USA). To detect deletions and duplications of one or more exons MLPA analysis was performed using MLPA kit P093-A (MRC-Holland, Amsterdam, The Netherlands).

Hemodynamic measurements A 7-F balloon-tipped Swan Ganz catheter (131HF7, Baxter Healthcare Corp., Irvine, CA, USA) was inserted via the jugular or femoral vein and brought into position under local anesthesia during continuous electrocardiographic monitoring. The following variables were BMPR2 in PAH: A view on the right ventricle 129

recorded: mean pulmonary artery pressure (mPAP), right atrial pressure (RAP), pulmonary arterial wedge pressure (PAWP), mixed venous oxygen saturation (SvO2) and heart rate (HR). PVR was calculated via the following formula: 80*(mPAP-PAWP)/cardiac output (CO). CO was determined by either the Fick method or thermodilution and stroke volume (SV) was calculated as CO divided by HR. Both CO and SV were indexed for body surface area (BSA), shown as respectively cardiac index (CI) and SV index (SVI).

Cardiac magnetic resonance imaging Cardiac magnetic resonance imaging (MRI) was performed on a Siemens 1.5-Tesla Avanto or 1.5-Tesla Sonato scanner (Siemens Medical Solutions, Erlangen, Germany), equipped with a 6-element phased-array coil. A stack of short-axis images were obtained at breath-hold per slice, with a slice thickness and interslice gap of 5 mm, fully covering both ventricles from base to apex.

On end-diastolic images (first cine after R-wave trigger) and end-systolic images (cine with visually the smallest cavity area), endocardial and epicardial contours were manually drawn using MASS software (Department of Radiology, Leiden University Medical Center, Leiden, 7 The Netherlands) to obtain RV end-diastolic volume (RVEDV), RV end-systolic volume (RVESV) and RV mass. Volume measurements and RV mass were indexed for BSA. Papillary muscles and trabeculae were included in RV mass. RV ejection fraction (RVEF) is calculated as (RVEDV- RVESV)/RVEDV*100%.

Histology and morphometry Paraffin embedded cardiac sections (5μm) were histochemically stained with Hematoxylin- Eosin (HE) and Picrosirius Red using standard methods. Analysis of the cross sectional area (CSA) was performed by randomly selecting 20 transversally cut cardiomyocytes (CMC) in RV and LV (40x magnification) and tracing the exterior of the cell with image analysis software. (Image J 1.45S, National institute of Health, USA). Collagen content was expressed asa percentage collagen positive tissue-area per total field of view, as measured in 5 randomly selected fields (40x magnification).

Immunofluorescent staining was performed using standard methods. Briefly, sections were deparaffinized followed by epitope retrieval with antigen unmasking solution (H3300, Vector Laboratories, USA). Blocking steps with 3% H2O2 for endogenous peroxidase and 1% bovine serum albumin (BSA) were performed before labeling with the primary antibodies O/N; 130

phosphorylated (p) SMAD1,5,8 (CS9511, 1:200), p-SMAD2 (CS8828s, 1:100), Von Willebrand Factor (VWf) (used for capillary density analysis) (A0082, DAKO, 1:100) , CD45+ (used for inflammation analysis) (M0701, DAKO, 1:200). Subsequent labeling with appropriate FITC- conjugated secondary antibody followed VWf and CD45 labeling. Both p-SMAD1,5,8 and p-SMAD2 sections were labeled with appropriate HRP-conjugated secondary antibodies followed by tyramide signal amplification (TSA) (NEL700A001KT, Perkin Elmer, USA). All sections were counterstained with wheat germ agglutinin (W32464, Life technologies, USA) and 4’,6-diamidino-2 phenylindole (DAPI) (H-1200, Vector labs, USA). Image acquisition was performed on a ZEISS Axiovert 200M Marianas inverted microscope. A minimum of 5 fields per section was randomly acquired for analysis. Slidebook 5.5 imaging analysis software (Intelligent Imaging Innovations, Denver, CO) was used to quantify for positive p-SMAD1,5,8 and p-SMAD2 nuclei and expresses as total number of p-SMAD-positive nuclei vs. total nuclei count. CD45+ cells positive cells were expressed as number of positive cells per area. Capillaries (VWF staining) and CMC were semi-automatically counted and expressed as a number of capillaries per CMC.

RNA analysis RNA was isolated from paraffin embedded RV and LV tissues according to the manufacturer’s protocol (73504, Qiagen, Venlo, The Netherlands) followed by purification (74204, Qiagen, Venlo, The Netherlands). Subsequently RNA concentration and purity was assessed using a Nanodrop spectrophotometer (Nanodrop 1000, Thermo Scientific, Breda, The Netherlands). Equal concentrations of RNA of all individual samples was reversely transcribed and amplified (3312-48, NuGEN, Leek, The Netherlands). Differential gene expression was assessed by qRT- PCR using Takyon PCR mastermix (UF-LSMT-B0705, Eurogentec, Maastricht, The Netherlands) and the CFX96 Touch detection system (Bio-Rad, Veenendaal, The Netherlands). Relative levels of gene expression were obtained using 18s rRNA as reference gene. Data is shown as fold change ± standard error of the mean (SEM). Target genes, primers sequences and annealing temperatures are shown in table 1. BMPR2 in PAH: A view on the right ventricle 131

Genes Forward primer 5ʹ–3ʹ Reverse primer 5ʹ–3ʹ T (°C) Bmpr2 GTCCTGGATGGCAGCAGTAT CCAGCGATTCAGTGGAGATGA 55 Tgfbr1 AAGAACGTTCGTGGTTCCGT CTGACACCAACCAGAGCTGA 55 Fas TTGGTGGACCCGCTCAGTA TGATGTCAGTCACTTGGGCA 55 Caspase 3 CTCTGGTTTTCGGTGGGTGT CGCTTCCATGTATGATCTTTGGTT 55 Anp GCAGGATGGACAGGATTGGAG CTTGTCCTCCCTGGCTGTTAT 60 Glut1 TTGGCTCCGGTATCGTCAAC GGCCACGATGCTCAGATAGG 55 Hexokinase 2 CCTGAGGACATCATGCGAGG TGGACTTGAATCCCTTGGTCC 55 Fabp3 CGCCTGCTCTCTTGTAGCTT GTGGTAGGCTTGGTCATGCT 63 Hexokinase 1 CGCAGCTCCTGGCCTATTAC GAGCCGCATGGCATAGAGAT 63 CD36 CTGAGGACTGCAGTGTAGGAC TCACAAATCAACAGCAAGACATGA 63 Cpt1b GGAGCCCTCTCATGGTGAAC CGGTCCAGTTTACGGCGATA 55 Cpt2 CTCCAAGTACCATGGCCAGC CCGCAGAGCAAACAAGTGTC 55

Table 1 - Primers used. Abbreviations: Bmpr2, bone morphogenetic protein receptor 2; Tgfbr1, transforming growth factor beta receptor 1; Fas, Fas cell surface death receptor; ANP, atrial natriuretic peptide; Glut1, glucose transporter 1; Fabp3, fatty acid binding protein 3; cpt, carnitine palmitoyltransferase. 7 Statistical analysis Statistical analyses was performed using Prism 5 for Windows (GraphPad Software Inc, San Diego, CA). The data are presented as means ± SEM or median (25-75%), dependent on normal distribution. Normal distribution was tested using the D’Agostino and Pearson omnibus normality test. Values of p<0.05 were considered significant. Differences in patient characteristics, hemodynamics, RV function and RV histology were tested using aone- way ANOVA or Kruskal-Wallis test with proper post-hoc comparison, depending on normal distribution. To compare categorical variables, a chi-squared test was used. Linear regression analysis was used to correct differences in RV function for PVR. Treatment response analysis was performed using a two-way analysis of variance with Bonferroni’s multiple comparison test. Cross sectional area was analyzed using multilevel analysis to correct for nonindependence of successive measurements per patients (MLwiN 2.02.03, Center for Multilevel Modeling, Bristol, UK). 132

Controls PAH - Non-carrie rs PAH - Mutation carrie rs P-value p=1 5 n=6 7 n=2 8

Ge ne ral characte ristics Age (years) 47±15 49±16 42±14 0.05 Male (%) 20 26 20 0.49 6MWD (%pred) - 69.8±26.1 73.4±14.0 0.62 Follow-up time (years) - 1.9 (1.0-4 .7) 1.2 (0.8-5 .1) 0.34 Hemodynamics HR (beats/min) 78±14 77±12 86±17 <0.05 mPAP (mmHg) 14±2 54±15 55±9 0.64 mRAP (mmHg) 4 (3-5) 7 (4-12) 7 (5-10) 0.95

SvO2 (%) 75±6 65±9 63±7 0.32 PAWP (mmHg) 8 (5-11) 10 (7-13) 9 (7-11) 0.55 PVR (dynes*s/cm5) 69 (49-80) 755 (483-10 43 ) 931 (624-13 11 ) 0.11 CI (l/min/m2) 4.1±1.1 2.7±0.9 2.2±0.4 <0.01 SVI (ml/m2) 52.7±12.7 34.5±11.2 26.4±7.8 <0.01 Cardiac MRI RVEDVI (ml/m²) 63.8±12.7 77.4±20.1 79.3±21.4 0.74 RVESVI (ml/m²) 25.4±8.4 51.3±21.0 57.0±19.2 0.33 RVEF (%) 62.0±7.4 37.6±12.8 29.0±9.0 0.01 RV mass index (g/m²) 21.6±3.9 54±17 51±11 0.08 LVEDVI (ml/m²) 57.4±11.3 45.4±13.1 40.0±12.9 0.14 LVESVI (ml/m²) 16.1 (15.6-18.0) 15.5 (10.7-20.8) 17.9 (9.2) 0.89 LVEF (%) 69.3±10.9 63.9±10.7 61.1±10.9 0.36 LV mass index (g/m2) 56.2±8.6 55.9±13.4 54.5±9.7 0.90

Table 2 - Patient characteristics. Data are presented as mean±SD or median (25-75%), dependent on normal distribution. 6MWD: 6 minute walk distance, HR: heart rate; mPAP: mean pulmonary artery pressure; mRAP: mean right atrial pressure; SvO2: mixed venous oxygen saturation; PAWP: pulmonary arterial wedge pressure; PVR: pulmonary vascular resistance; CI: cardiac index; SVI: stroke volume index; RVEDVI: right ventricular end-diastolic volume index; RVESVI: right ventricular end-systolic volume index; RVEF: right ventricular ejection fraction; LVEDVI: left ventricular end-diastolic volume index; LVESVI: left ventricular end-systolic volume index; LVEF: ejection fraction. P-value: comparison mutation carriers-non-carriers. BMPR2 in PAH: A view on the right ventricle 133

Results

Patient characteristics Clinical characteristics of patients seen at the VU University Medical Center are presented in Table 2 and supplementary Table 1. No differences between carriers and non-carriers were found in gender or 6 minute walking distance (6MWD). Mutation carriers tended to present at a younger age compared to non-carriers.

Patient Mutation Location Nucleotide Change Amino Acid Change 1 Intron 1 c.76+2T>C 2 Exon 1 c.168delG p.Thr57fs 3 Exon 3 c.350G>C p.Cys117Ser 4 Exon 3 c.350G>C p.Cys117Ser 5 Exon 3 c.399delT p.Pro133fs 6 Exon 3 c.399delT p.Pro133fs 7 Exon 5 c.619dupG p.Glu207fs 8 Exon 5 c.619dupG p.Glu207fs 7 9 Exon 6 c.637C>T p.Arg213X 10 Exon 6 c.690delA p.Val231fs 11 Exon 10 c.1281A>T p.Glu427Asp 12 Exon 11 c.1454A>G p.Asp485Gly 13 Exon 11 c.1454A>G p.Asp485Gly 14 Exon 11 c.1454A>G p.Asp485Gly 15 Exon 11 c.1454A>G p.Asp485Gly 16 Exon 11 c.1471C>T p.Arg491Trp 17 Exon 11 c.1471C>T p.Arg491Trp 18 Exon 11 c.1525G>T p.Glu509X 19 Exon 12 c.1978G>T p.Glu660X 20 Exon 12 c.2413dupA p.Thr805fs 21 Exon 12 c.2752C>T p.Gln918X 22 Exon 12 c.2752C>T p.Gln918X 23 Exon 12 c.2752C>T p.Gln918X 24 Exon 12 c.2695C>T p.Arg899X 25 Deletion of exon 1 Large rearrangement 26 Deletion of exon 4 to 12 Large rearrangement 27 Deletion of exon 10 to 13 Large rearrangement 28 Duplication of exon 8 Large rearrangement Table 3 - Details of BMPR2 mutations 134

Effects of BMPR2 mutations on RV function To investigate whether BMPR2 mutations affect the RV, we first compared baseline hemodynamics of mutation carriers to non-carriers as presented in Table 2 and highlighted in Figure 2. Time between RHC and MRI at baseline was 11±22 days in mutation carriers (79% within 7 days) and 10±30 days in non-carriers (82% within 7 days). Both measurements were obtained before the start of PAH specific medication. SVI and CI were lower in mutation carriers compared to non-carriers, while no differences were found in mPAP, mRAP and SvO2.

Interestingly, CMR analysis showed that despite the similar afterload, RVEF was lowerin BMPR2 mutation carriers. RV volumes and RV mass were similar between groups. Also when corrected for PVR, RVEF remained significantly lower in BMPR2 mutation carriers to non- carriers (p=0.028).

Figure 2 - Hemodynamic measurements and cardiac function at baseline.mPAP: mean pulmonary artery pressure, PVR: pulmonary vascular resistance, HR: heart rate, CI: cardiac index, SVI: stroke volume index, RVEF: right ventricular ejection fraction. Hemodynamic measurements: controls: n=15, non-carriers: n=65, carriers n=28. RVEF: controls n=15, non-carriers: n=40, carriers n=21. Data are presented as mean±SEM. Controls vs. non-carriers or carriers: *: p<0.05, **: p<0.01, ***: P<0.001, non-carriers vs. carriers: #: p<0.05 BMPR2 in PAH: A view on the right ventricle 135

Effects BMPR2 mutations on TGF-β/BMP signaling, RV adaptation and cardiac metabolism To investigate whether the differences observed in the clinical data could be explained by differences in TGF-β or BMP signaling in cardiomyocytes, immunofluorescent stainings and RNA analyses were performed in LV and RV tissue obtained from controls, mutation carriers and non-carriers. Hemodynamic characteristics of tissue samples donors can be observed in Table 4. Tissue samples of mutation carriers and non-carriers were matched on pulmonary vascular resistance (PVR) in order to avoid load-dependent differences.

Controls PAH -Non-carriers PAH - Mutation carriers P-value n=6 n=11 n=5

Age at death/transplantation (years) 67 (46-83) 31 (21-39)** 44 (29-54) 0.07 Male (%) 83 18* 40 0.03 NYHA class (I/II/III/IV) - 0/25/25/50 0/40/60/0 0.16 mPAP (mmHg) - 68 (47-94) 57 (55-61) 0.57 PVR (dynes*s/cm⁵) - 1200 (774-1974) 1424 (1290-1600) 0.57 CI (l/min/m²) - 1.7 (1.5-2.8) 1.5 (1.4-1.8) 0.21 Heart weights (g) 465 (453-553) 403 (330-500) 360 (283-450) 0.07 Cause of death Cerebral hemorrhage 2 Accident 2 Pneumonia 1 Acute respiratory distress syndrome 1 7 Table 4 - Cardiac tissue samples – Patient characteristics RV tissue samples: Data are presented as mean±SD or median (25-75%), dependent on normal distribution. NYHA class: New York Heart Association Functional class, mPAP: mean pulmonary arterial pressure, PVR: pulmonary vascular resistance, CI: cardiac index. P-value: comparison mutation carriers-non-carriers. Comparison to controls: *: p<0.05

TGF-β/BMP signaling To assess BMP signaling, the first downstream effector of the BMP signaling cascade was stained, phosphorylated SMAD1,5,8 (p-SMAD1,5,8) (Figure 3A). No difference was observed in p-SMAD1,5,8 expression in RV tissue of PAH and controls or between BMPR2 mutation carriers and non-carriers. However, expression of p-SMAD1,5,8 was significantly reduced in LV tissue of PAH-patients in comparison to controls, although again no difference was found between BMPR2 mutation carriers and non-carriers. To assess TGF-β activity, the expression of phosphorylated SMAD2 (p-SMAD2) was determined (Figure 3B). Expression of p-SMAD2 was significantly reduced in PAH in comparison in both RV and LV tissue. However, no differences in p-SMAD2 activity were observed between BMPR2 mutation carriers and non-carriers. No differences were observed in RNA expression of BMPR2 and the TGF-β type I receptor (TβRI) (Figure 4A), indicating that TGF-β and BMP activity is similar in cardiomyocytes in BMPR2 mutation carriers and non-carriers. 136

Figure 3 - Percentage of a) p-SMAD1,5,8 activated nuclei per total nuclei in the left ventricle (LV) and right ventricle (RV), b) percentage of p-SMAD2 activated nuclei per total nuclei in the LV and RV. Controls n=6, non-carriers n=11, carriers n=5. Control values are normalized to 100%. Data are presented as mean±SEM. *: p<0.05, **: p<0.01, ***: P<0.001 BMPR2 in PAH: A view on the right ventricle 137

Figure 4 - RNA expression of RV a) the TGF-β/BMP axis, b) hypertrophy and c) apoptosis and LV d) TGF-β/BMP axis, e) hypertrophy and f) apoptosis. BMPR2: Bone Morphogenetic Protein Receptor 2, TGF-βR1: Transforming Growth Factor – β1 Receptor 1, ANP: atrial natriuretic peptide, FAS: Fas Cell Surface Death Receptor, CASP3: Caspase 3. Controls n=6, non-carriers n=11, carriers n=5. Data are presented as mean±SEM. Control values are normalized to 1, presented as the dotted line. *: p<0.05, **: p<0.01. 138

Figure 5 - Percentage of a) Cross sectional area and b) fibrosis in both the LV and RV. Control values are normalized to 100%. Controls n=6, non-carriers n=11, carriers n=5. Data are presented as mean±SEM. *: p<0.05, **: p<0.01, ***: P<0.001 BMPR2 in PAH: A view on the right ventricle 139

RV adaptation To obtain more insight into the mechanisms of RV and LV adaptation, morphological characteristics of both non-carriers and mutation carriers were assessed. RV hypertrophy and LV atrophy was observed in all PAH-patients in comparison to controls, without differences between mutation carriers and non-carriers (Figure 5A). In line with these data, increased expression of ANP was observed in PAH-patients compared to controls, while expression was similar in carriers and non-carriers (Figure 4B). RV fibrosis was increased in PAH-patients in comparison to control (Figure 5B). However, no differences were observed in RV fibrosis, capillary density, or CD45 expression in both RV and LV tissue of mutation carriers and non- carriers. (Figure 5B, 6). In addition, apoptotic rate (expression of caspase 3 and fas cell surface death receptor) was increased in PAH-patients to controls, but similar in between carriers and non-carriers (Figure 4C).

Cardiac metabolism To determine whether changes in metabolism may explain the differences in RV function between mutation carriers and non-carriers, we subsequently assessed RNA expression of key-components of glucose metabolism (GLUT1, hexokinase 1/2) and fatty acid oxidation 7 (fatty acid binding protein 3 (FABP3), CD36, carnitine palmitoyltransferase 1/2). Although significant increases in expression of GLUT 1, FABP3 and CPTB1 were observed in PAH tissue in comparison to control, no differences were identified between mutation carriers and non- carriers. (Figure 7) 140

Figure 6 - Percentage of a) CD45 expression and b) capillary density in both LV and RV. Control values are normalized to 100%. Controls n=6, non-carriers n=11, carriers n=5. Data are presented as mean±SEM. BMPR2 in PAH: A view on the right ventricle 141

Figure 7 - RNA expression of metabolic markers. GLUT1: glucose transporter 1; HK2: hexokinase 2, HK1: hexokinase 1, FABP3: fatty acid binding protein 3, CPT: carnitine palmitoyltransferase. Controls n=6, non-carriers n=11, carriers n=5. Data are presented as mean±SEM. Control values are normalized to 1, presented as the dotted line. *: p<0.05. 142

Discussion

By combining in vivo measurements of RV function with molecular and histological analyses of unique RV and LV tissue of PAH patients and controls, we were able to demonstrate that:

1. Despite a similar afterload, RV function is more severely compromised in BMPR2 mutation carriers than in noncarriers. Differences continue to exist after PAH-specific treatment. 2. TGF-β and BMP signaling is similar in LV and RV cardiomyocytes of BMPR2 mutation carriers and noncarriers. 3. The amount of RV hypertrophy, LV atrophy, fibrosis, apoptosis, inflammation, capillary density, and cardiac metabolism is similar between BMPR2 mutation carriers and noncarriers, indicating an equal RV and LV adaptation.

Impaired RV Function in BMPR2 Mutation Carriers Previous large retrospective studies have demonstrated the increased hemodynamic burden in PAH patients carrying a BMPR2 mutation, accompanied by a shorter time to death orlung transplantation.13,14,26–28 Until now, differences in survival and disease severity were mainly explained by a more severe pulmonary vascular involvement, leading to a more severe and faster disease trajectory. However, combining the fact that RV function is the main determinant of prognosis and disease severity and that the BMPR2 gene is also expressed in the RV, it can be speculated that RV function plays a role in the differential clinical phenotypes of mutation carriers and noncarriers.4,9,29,30 Accordingly, a recent study by Brittain et al27 revealed an out-of-proportion RV dysfunction in HPAH patients at baseline. However, these differences should be interpreted with caution, as the afterload of mutation carriers was significantly higher in comparison with noncarriers.

An interesting finding in our present study is the comparable afterload of BMPR2 mutation carriers and noncarriers, suggesting a distinct clinical phenotype of BMPR2 mutation carriers in the Netherlands. A possible explanation is the relatively high percentage of cytoplasmic tail mutation carriers in our cohort, which is 25%, in comparison with 13% in the French PAH registry.31 Because cytoplasmic tail mutation carriers present hemodynamically similarly to noncarriers, this may have contributed to the observed phenotype of our patient cohort. Despite these similarities, we observed a decreased RV function in mutation carriers. This reduction was not explained by differences in PVR or a more severe state of disease at presentation. These findings suggest a negative effect of BMPR2 mutations on RV function in PAH patients. BMPR2 in PAH: A view on the right ventricle 143

TGF-β/BMP Balance in PAH Significant progress in the knowledge about the role of TGF-β in the response to pressure overload has been achieved by studies in left heart failure. Although it is known that TGF-β is associated with maladaptive hypertrophy, inflammation, and fibrosis in various models and diseases, the studyof Koitabashi et al was the first to show that TGF-β plays a central role in the cardiac maladaptive response to pressure overload.32–36 However, because the LV has a different embryological origin and the amount of pressure overload in right and left heart failure is not comparable, these results cannot be directly extrapolated.37,38

Until recently, little was known about the effects of BMPR2 mutations on RV adaptation in PAH. First, Megalou et al39 showed the importance of TGF-β in the hypertrophic response in the myocardium of pulmonary hypertensive monocrotaline rats, and, more recently, Hemnes et al24 demonstrated impaired hypertrophy attributable to an altered cardiac energy metabolism in the RV of a transgenic mice model expressing mutant BMP receptor II. However, the effects of BMPR2 mutations in human cardiomyocytes remain elusive. Therefore, we studied the TGF-β/BMP signaling in cardiomyocytes of PAH patients with and without BMPR2 mutation and characterized hypertrophy, capillarization, inflammation, and fibrosis. Surprisingly, our study did not reveal any differences in either TGF-β or BMP signaling 7 between carriers and noncarriers, although it corresponds to a previous study of Atkinson et al,16 in which they show a decreased BMP receptor II receptor expression in the pulmonary vasculature of both mutation carriers and noncarriers. Interestingly, we were able to demonstrate significant differences in BMPR2 expression and metabolic adaptation between noncarriers and controls, suggesting a potential dysfunctional compensatory signaling underlying the functional differences between mutation carriers and noncarriers. We were not able to confirm the previous observed RV maladaptive response in BMPR2 mice in our human RV tissue. One explanation might be the difference between rodents and human cardiac physiology. Another explanation could be the end-stage right heart failure of the patient samples used for our histomorphological analysis of the RV. There may be important differences in myocardial structure of failing and adapting RV, but, because of the inherent difficulties of obtaining biopsies (reported high complication rates) from adapted patients, this is problematic to assess.

Study Limitations We were only able to include a small number of RV and LV tissue samples of PAH patients and controls. This may have limited our statistical power to identify differences between mutation carriers and noncarriers. However, we were able to confirm known differences in hypertrophy, fibrosis, and cardiac metabolism, which were described previously in animal models.40–42 These findings suggest that, although the number of subjects was small, it was sufficient to identify differences between PAH and 144

control subjects.

Clinical Implications Although a direct relation between RV function and a BMPR2 mutation was not revealed in this study, our findings suggest that BMPR2 mutations lead to an impaired RV function in symptomatic PAH. Our results raise the question whether clinical status and time to death or lung transplantation in BMPR2 mutation carriers could be improved by using the RV as a therapeutic target. Furthermore, our results provide rationale for closely monitoring RV function in BMPR2 mutation carriers in PAH referral centers and subsequently timely referral for lung transplantation. Further therapeutic studies targeting the disturbed TGF-β/BMP pathway will reveal the clinical implications of this disturbed balance in the RV of PAH patients.

Conclusions We demonstrated that PAH patients carrying a BMPR2 mutation have a decreased RV function in comparison with PAH patients without BMPR2 mutation at presentation, which persisted after PAH- specific treatment. We revealed that there are no alterations in TGF-β- and BMP-induced SMAD phosphorylation in the cardiomyocytes of PAH patients with or without mutation. Furthermore, we demonstrated that RV and LV adaptation is not different between BMPR2 mutation carriers and noncarriers.

Acknowledgements We thank Florent Soubrier and David Montani for their help assessing genetic and clinical data of RV tissue patients in this article. Furthermore, we thank Frank Oosterveer and Mariëlle van de Veerdonk for their help assessing RHC data and the analysis of cMRI data.

Sources of Funding Drs van der Bruggen, Happé, Spruijt, Rol, Vonk Noordegraaf, Bogaard, Goumans, and de Man were supported by the Netherlands CardioVascular Research Initiative: the Dutch Heart Foundation, Dutch Federation of University Medical Centers, the Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Arts and Sciences (CVON 2012-08). Dr de Man received a VENI grant from the Netherlands Organization for Scientific Research (NWO: 916.14.099), and is further supported by L’Oreal/Unesco for Women in Science and Netherlands Institute for Advanced Studies (NIAS), the American Thoracic Society (ATS: Jerry Wojciechowski Memorial Pulmonary Hypertension Research Grant), and the European Respiratory Society. BMPR2 in PAH: A view on the right ventricle 145

References R, Phillips JA, Loyd JE. Mutation in the gene for bone morphogenetic protein receptor II as a cause of primary pulmonary hypertension in a large kindred. N Engl J 1. Humbert M, Sitbon O, Chaouat A, Bertocchi M, Habib Med. 2001;345:319–324. G, Gressin V, Yaïci A, Weitzenblum E, Cordier J-F, Chabot 9. Thomson JR, Machado RD, Pauciulo MW, Morgan NV, F, Dromer C, Pison C, Reynaud-Gaubert M, Haloun Humbert M, Elliott GC, Ward K, Yacoub M, Mikhail G, A, Laurent M, Hachulla E, Cottin V, Degano B, Jaïs X, Rogers P, Newman J, Wheeler L, Higenbottam T, Gibbs JS, Montani D, Souza R, Simonneau G. Survival in patients Egan J, Crozier A, Peacock A, Allcock R, Corris P, Loyd JE, with idiopathic, familial, and anorexigen-associated Trembath RC, Nichols WC. Sporadic primary pulmonary pulmonary arterial hypertension in the modern hypertension is associated with germline mutations of management era. Circulation. 2010;122:156–163. the gene encoding BMPR-II, a receptor member of the 2. Simonneau G, Gatzoulis MA, Adatia I, Celermajer TGF-beta family. J Med Genet. 2000;37:741–745. D, Denton C, Ghofrani A, Gomez Sanchez MA, Krishna 10. Soubrier F, Chung WK, Machado R, Grünig E, Aldred Kumar R, Landzberg M, Machado RF, Olschewski H, M, Geraci M, Loyd JE, Elliott CG, Trembath RC, Newman Robbins IM, Souza R. Updated clinical classification JH, Humbert M. Genetics and genomics of pulmonary of pulmonary hypertension. J Am Coll Cardiol. arterial hypertension. J Am Coll Cardiol. 2013;62:D13– 2013;62:D34–41. 21. 3. Runo JR, Loyd JE. Primary pulmonary hypertension. 11. Machado RD, Eickelberg O, Elliott CG, Geraci MW, Lancet. 2003;361:1533–1544. Hanaoka M, Loyd JE, Newman JH, Phillips JA, Soubrier 4. van de Veerdonk MC, Kind T, Marcus JT, Mauritz F, Trembath RC, Chung WK. Genetics and genomics of G-J, Heymans MW, Bogaard H-J, Boonstra A, Marques pulmonary arterial hypertension. J Am Coll Cardiol. KMJ, Westerhof N, Vonk-Noordegraaf A. Progressive 7 2009;54:S32–42. right ventricular dysfunction in patients with pulmonary 12. Girerd B, Montani D, Eyries M, Yaici A, Sztrymf B, arterial hypertension responding to therapy. J Am Coll Coulet F, Sitbon O, Simonneau G, Soubrier F, Humbert Cardiol. 2011;58:2511–2519. M. Absence of influence of gender and BMPR2 mutation 5. Cogan JD, Pauciulo MW, Batchman AP, Prince MA, type on clinical phenotypes of pulmonary arterial Robbins IM, Hedges LK, Stanton KC, Wheeler LA, Phillips hypertension. Respir Res. 2010;11:73. JA, Loyd JE, Nichols WC. High frequency of BMPR2 13. Rosenzweig EB, Morse JH, Knowles JA, Chada KK, exonic deletions/duplications in familial pulmonary Khan AM, Roberts KE, McElroy JJ, Juskiw NK, Mallory arterial hypertension. Am J Respir Crit Care Med. NC, Rich S, Diamond B, Barst RJ. Clinical implications 2006;174:590–598. of determining BMPR2 mutation status in a large 6. Deng Z, Morse JH, Slager SL, Cuervo N, Moore KJ, cohort of children and adults with pulmonary arterial Venetos G, Kalachikov S, Cayanis E, Fischer SG, Barst hypertension. J Heart Lung Transplant Off Publ Int Soc RJ, Hodge SE, Knowles JA. Familial primary pulmonary Heart Transplant. 2008;27:668–674. hypertension (gene PPH1) is caused by mutations in 14. Sztrymf B, Coulet F, Girerd B, Yaici A, Jais X, Sitbon O, the bone morphogenetic protein receptor-II gene. Am Montani D, Souza R, Simonneau G, Soubrier F, Humbert J Hum Genet. 2000;67:737–744. M. Clinical outcomes of pulmonary arterial hypertension 7. International PPH Consortium, Lane KB, Machado RD, in carriers of BMPR2 mutation. Am J Respir Crit Care Pauciulo MW, Thomson JR, Phillips JA, Loyd JE, Nichols Med. 2008;177:1377–1383. WC, Trembath RC. Heterozygous germline mutations 15. Larkin EK, Newman JH, Austin ED, Hemnes AR, in BMPR2, encoding a TGF-beta receptor, cause Wheeler L, Robbins IM, West JD, Phillips JA, Hamid familial primary pulmonary hypertension. Nat Genet. R, Loyd JE. Longitudinal Analysis Casts Doubt on the 2000;26:81–84. Presence of Genetic Anticipation in Heritable Pulmonary 8. Newman JH, Wheeler L, Lane KB, Loyd E, Gaddipati Arterial Hypertension. Am J Respir Crit Care Med. 146

2012;186:892–896. heritable pulmonary arterial hypertension. Am J Respir 16. Atkinson C, Stewart S, Upton PD, Machado R, Crit Care Med. 2014;189:325–334. Thomson JR, Trembath RC, Morrell NW. Primary 25. Galiè N, Humbert M, Vachiery J-L, Gibbs S, Lang I, pulmonary hypertension is associated with reduced Torbicki A, Simonneau G, Peacock A, Vonk Noordegraaf pulmonary vascular expression of type II bone A, Beghetti M, Ghofrani A, Gomez Sanchez MA, morphogenetic protein receptor. Circulation. Hansmann G, Klepetko W, Lancellotti P, Matucci M, 2002;105:1672–1678. McDonagh T, Pierard LA, Trindade PT, Zompatori M, 17. Akhurst RJ. TGF beta signaling in health and disease. Hoeper M. 2015 ESC/ERS Guidelines for the diagnosis Nat Genet. 2004;36:790–792. and treatment of pulmonary hypertension: The 18. Machado RD, Pauciulo MW, Thomson JR, Lane KB, Joint Task Force for the Diagnosis and Treatment of Morgan NV, Wheeler L, Phillips III JA, Newman J, Williams Pulmonary Hypertension of the European Society of D, Galiè N, Manes A, McNeil K, Yacoub M, Mikhail G, Cardiology (ESC) and the European Respiratory Society Rogers P, Corris P, Humbert M, Donnai D, Martensson (ERS): Endorsed by: Association for European Paediatric G, Tranebjaerg L, Loyd JE, Trembath RC, Nichols WC. and Congenital Cardiology (AEPC), International Society BMPR2 Haploinsufficiency as the Inherited Molecular for Heart and Lung Transplantation (ISHLT). Eur Respir J. Mechanism for Primary Pulmonary Hypertension. Am J 2015;46:903–975. Hum Genet. 2001;68:92–102. 26. Kabata H, Satoh T, Kataoka M, Tamura Y, Ono T, 19. Morrell NW. Pulmonary hypertension due to BMPR2 Yamamoto M, Huqun null, Hagiwara K, Fukuda K, mutation: a new paradigm for tissue remodeling? Proc Betsuyaku T, Asano K. Bone morphogenetic protein Am Thorac Soc. 2006;3:680–686. receptor type 2 mutations, clinical phenotypes and 20. Stacher E, Graham BB, Hunt JM, Gandjeva A, outcomes of Japanese patients with sporadic or Groshong SD, McLaughlin VV, Jessup M, Grizzle WE, familial pulmonary hypertension. Respirol Carlton Vic. Aldred MA, Cool CD, Tuder RM. Modern age pathology 2013;18:1076–1082. of pulmonary arterial hypertension. Am J Respir Crit 27. Brittain EL, Pugh ME, Wheeler LA, Robbins IM, Care Med. 2012;186:261–272. Loyd JE, Newman JH, Larkin EK, Austin ED, Hemnes AR. 21. Dobaczewski M, Chen W, Frangogiannis NG. Shorter survival in familial versus idiopathic pulmonary Transforming growth factor (TGF)-β signaling in cardiac arterial hypertension is associated with hemodynamic remodeling. J Mol Cell Cardiol. 2011;51:600–606. markers of impaired right ventricular function. Pulm 22. Koitabashi N, Danner T, Zaiman AL, Pinto YM, Rowell Circ. 2013;3:589–598. J, Mankowski J, Zhang D, Nakamura T, Takimoto E, Kass 28. Evans JDW, Girerd B, Montani D, Wang X-J, Galiè N, DA. Pivotal role of cardiomyocyte TGF-β signaling in the Austin ED, Elliott G, Asano K, Grünig E, Yan Y, Jing Z-C, murine pathological response to sustained pressure Manes A, Palazzini M, Wheeler LA, Nakayama I, Satoh overload. J Clin Invest. 2011;121:2301–2312. T, Eichstaedt C, Hinderhofer K, Wolf M, Rosenzweig EB, 23. Rosenkranz S. TGF-beta1 and angiotensin Chung WK, Soubrier F, Simonneau G, Sitbon O, Gräf S, networking in cardiac remodeling. Cardiovasc Res. Kaptoge S, Di Angelantonio E, Humbert M, Morrell NW. 2004;63:423–432. BMPR2 mutations and survival in pulmonary arterial 24. Hemnes AR, Brittain EL, Trammell AW, Fessel hypertension: an individual participant data meta- JP, Austin ED, Penner N, Maynard KB, Gleaves L, analysis. Lancet Respir Med. 2016;4:129–137. Talati M, Absi T, Disalvo T, West J. Evidence for right 29. Wolferen SA van, Marcus JT, Boonstra A, Marques ventricular lipotoxicity in YM, Rowell J, Mankowski J, KMJ, Bronzwaer JGF, Spreeuwenberg MD, Postmus PE, Zhang D, Nakamura T, Takimoto E, Kass DA. Pivotal Vonk-Noordegraaf A. Prognostic value of right ventricular role of cardiomyocyte TGF-β signaling in the murine mass, volume, and function in idiopathic pulmonary pathological response to sustained pressure overload. J arterial hypertension. Eur Heart J. 2007;28:1250–1257. Clin Invest. 2011;121:2301–2312. 30. Vonk-Noordegraaf A, Haddad F, Chin KM, Forfia PR, BMPR2 in PAH: A view on the right ventricle 147

Kawut SM, Lumens J, Naeije R, Newman J, Oudiz RJ, Nat Genet. 2004;36:790–792. Provencher S, Torbicki A, Voelkel NF, Hassoun PM. Right 37. Voelkel NF, Quaife RA, Leinwand LA, Barst RJ, heart adaptation to pulmonary arterial hypertension: McGoon MD, Meldrum DR, Dupuis J, Long CS, Rubin physiology and pathobiology. J Am Coll Cardiol. LJ, Smart FW, Suzuki YJ, Gladwin M, Denholm EM, Gail 2013;62:D22–33. DB, National Heart, Lung, and Blood Institute Working 31. Girerd B, Coulet F, Jaïs X, Eyries M, Van Der Bruggen Group on Cellular and Molecular Mechanisms of Right C, De Man F, Houweling A, Dorfmuller P, Savale L, Sitbon Heart Failure. Right ventricular function and failure: O, Vonk-Noordegraaf A, Soubrier F, Simonneau G, report of a National Heart, Lung, and Blood Institute Humbert M, Montani D. CHaracteristics of pulmonary working group on cellular and molecular mechanisms arterial hypertension in affected carriers of a mutation of right heart failure. Circulation. 2006;114:1883–1891. located in the cytoplasmic tail of bmprii. Chest [Internet]. 38. Rain S, Handoko ML, Vonk Noordegraaf A, Bogaard 2014 [cited 2015 Feb 26];Available from: http://dx.doi. HJ, van der Velden J, de Man FS. Pressure-overload- org/10.1378/chest.14-0880 induced right heart failure. Pflüg Arch Eur J Physiol. 32. Ying X, Lee K, Li N, Corbett D, Mendoza L, 2014;466:1055–1063. Frangogiannis NG. Characterization of the Inflammatory 39. Megalou AJ, Glava C, Oikonomidis DL, Vilaeti A, and Fibrotic Response in a Mouse Model of Cardiac Agelaki MG, Baltogiannis GG, Papalois A, Vlahos AP, Pressure Overload. Histochem Cell Biol. 2009;131:471– Kolettis TM. Transforming growth factor-β inhibition 481. attenuates pulmonary arterial hypertension in rats. Int 33. Koitabashi N, Danner T, Zaiman AL, vPinto 40. Piao L, J Clin Exp Med. 2010;3:332–340. Fang Y-H, Cadete VJJ, Wietholt C, Urboniene D, Toth PT, Marsboom G, Zhang HJ, Haber I, Rehman J, Lopaschuk 7 GD, Archer SL. The inhibition of pyruvate dehydrogenase kinase improves impaired cardiac function and electrical remodeling in two models of right ventricular hypertrophy: resuscitating the hibernating right ventricle. J Mol Med Berl Ger. 2010;88:47–60. 41. Fang Y-H, Piao L, Hong Z, Toth PT, Marsboom G, Bache-Wiig P, Rehman J, Archer SL. Therapeutic inhibition of fatty acid oxidation in right ventricular hypertrophy: exploiting Randle’s cycle. J Mol Med Berl Ger. 2012;90:31–43. 42. Sutendra G, Dromparis P, Paulin R, Zervopoulos S, Haromy A, Nagendran J, Michelakis ED. A metabolic remodeling in right ventricular hypertrophy is associated with decreased angiogenesis and a transition from a compensated to a decompensated state in pulmonary hypertension. J Mol Med Berl Ger. 2013;91:1315–1327. 34. Dobaczewski M, Chen W, Frangogiannis NG. Transforming Growth Factor (TGF)-β signaling in cardiac remodeling. J Mol Cell Cardiol. 2011;51:600–606. 35. Rosenkranz S. TGF-beta1 and angiotensin networking in cardiac remodeling. Cardiovasc Res. 2004;63:423–432. 36. Akhurst RJ. TGF beta signaling in health and disease.

Bone Morphogenetic Protein Receptor Type 2 Mutation in Pulmonary Arterial 7 Hypertension

supplemental data 150

PAH – Non-carriers PAH - Mutation carriers n=67 n=28 Caucasian (%) 90.0 93.0 Asian (%) 3.0 4.0 Asian-Caucasian (%) 1.5 0.0 Carribean (%) 1.5 0.0 African Carribean (%) 1.5 0.0 Hindustanian Carribean (%) 3.0 0.0 North-African (%) 0.0 4.0

SUPPLEMENTAL TABLE 1 - Clinical study - Ethnicities BMPR2 in PAH: A view on the right ventricle 151

Non-carriers Mutation carriers P-interaction Baseline FU Baseline FU Hemodynamics n=54 n=25 HR 78±13 76±14 87±17† 81±15 ns (beats/min) mPAP 55±17 47±17* 56±10 49±13* ns (mmHg) mRAP 7 (4-11) 5 (3-9)* 7 (5-11) 5 (3-6)* ns (mmHg) SvO2 67±8 70±8 63±7 69±11* ns (%) PAWP 10±5 10±3 9±4 7±3 ns (mmHg) PVR 723 (466-1010) 405 (232-619)* 972 (608-1311) 585 (484-795)* ns (dynes*s/cm⁵) CI 2.7±0.9 3.4±1.2* 2.1±0.4† 2.8±0.6* ns (l/min/m²) SVI 35.1±11.9 44.8±15* 25.5±7.7† 36.2±13.8* ns (ml/m²) 7 Cardiac MRI n=39 n=20 RVEDVI 79±21 80±22 89±38 79±27 ns (ml/m²) RVESVI 54±21 58±20 62±38 47±26 ns (ml/m²) RVEF 34±12 29±10 35±14 43±13* ns (%) RV mass index 58±17† 48±11 53±24 52±22 0.05

SUPPLEMENTAL TABLE 2 - Treatment response. Data are presented as mean±SD or median (25-75%), dependent on normal distribution. HR: heart rate; mPAP: mean pulmonary artery pressure; mRAP; mean right atrial pressure; SvO2: mixed venous oxygen saturation; PAWP: pulmonary arterial wedge pressure; PVR: pulmonary vascular resistance; CI: cardiac index; SVI: stroke volume index; RVEDVI: right ventricular end-diastolic volume index; RVESVI: right ventricular end-systolic volume index; RVEF: right ventricular ejection fraction. *p<0.05 treatment vs. baseline, †p<0.05 baseline non-carriers vs. baseline mutation carriers. 152

Non-carriers Carriers P-value n=54 n=26

Prostanoids 15% 23% 0.36

PDE5-inhibitors 11% 8% 0.63

ERAs 23% 4% 0.11

Calcium-channel blockers 4% 0% 0.32

Combination therapy 39% 50% 0.35

Triple therapy 9% 8% 0.82

Unknown (study 2% 4% 0.97 medication)

SUPPLEMENTAL TABLE 3 - PAH-specific therapy at follow-up. PAH=pulmonary arterial hypertension; PDE5-inhibitors: phospodiesterase type 5 inhibitors; ERAs: endothelin receptor antagonists. The BMP Receptor 2 in pulmonary arterial hypertension:

when and where the animal model matches 8 the patient

C.M. Happé • K Kurakula • X.S. Sun • D. Bos • N. Rol • C. Guignabert • L. Tu • I. Schalij • K.C. Wiesmeijer • O. Tura-Ceide • A. Vonk Noordegraaf • F.S. de Man • H.J. Bogaard • M.J. Goumans

Cells • 2020

BMP receptor 2 in pulmonary arterial hypertension 155

Introduction

Mutations in the BMPR2 gene were the first genetic perturbations implicated inthe pathophysiology of pulmonary arterial hypertension (PAH) and are still responsible for most cases of hereditary PAH (hPAH) to date [1,2,3]. PAH patients with a BMPR2 mutation present at a younger age with a more severe phenotype and an increased risk of death [4]. Aside from mutations in the BMPR2 gene, other genes related to BMPR2 signaling such as ALK1, CAV1, ENG, SMAD4, SMAD8, SMAD9, BMPR1 and BMP9 are implicated in hPAH, albeit less frequently [5,6,7,8,9,10]. Furthermore, aberrant BMPR2 signaling has been described in non- hereditary subtypes of PAH, although descriptions of defective BMPR2 expression in human tissue remain relatively scarce [11]. Reduced or absent BMPR2 expression was observed in the lung vasculature of patients with idiopathic PAH (iPAH, then called primary pulmonary hypertension) and hPAH. Decreased levels of BMPR2 were also observed in blood-outgrowth endothelial cells (BOECs) from hPAH and iPAH patients [12,13]. Levels of phosphorylated Smad 1/5/8 (pSmad) were altered in pulmonary artery endothelial cells (PAEC) of iPAH patients compared to controls, indicative of altered BMP signaling [14]. Dewachter et al. showed a lower mRNA expression of BMPR2 in whole lung lysates from hPAH. In both hPAH and iPAH, BMPR2 mRNA expression was lower in isolated pulmonary artery smooth muscle cells (PASMCs). The reduced BMPR2 mRNA expression was not observed in isolated PAEC 8 from iPAH and hPAH patients. In the same study, reduced BMPR2 protein (molecular weight 75kDa) was observed in whole lung lysates of patients with hPAH but not iPAH patients [11]. Together, these findings put aberrant BMPR2 signaling at the center of the pathobiology of many if not most forms of PAH. However, the number of studies assessing BMPR2 expression in the PAH lung remains limited and the methodology used to study BMPR2 expression varied among studies.

It is currently hypothesized that a decrease in BMPR2 signaling leads to a disturbance in the TGF-β/BMP balance favoring the activation of the TGF-β signaling pathway [15]. Increased TGF-β signaling can result in pro-proliferative and anti-apoptotic responses in PAECs and PASMCs, and increased inflammatory cytokine and chemokine production [16,17,18,19]. Although the BMP receptors typically phosphorylate Smad1/5/8 and TGFβ receptors Smad2/3, depending on the cell type and the genetic disorder, TGFβ can induce pSmad 1/5/8, albeit with a different affinity and kinetics when compared to BMP ligands. [20,21,22] Restoring BMPR2 signaling is therefore of interest from a treatment perspective, to stop the progression of the disease. Although, in several translational studies, drugs were tested that 156

were hypothesized to restore the TGF-β/BMP balance and reverse experimentally induced pulmonary hypertension (PH), basic characterization of BMPR2 expression and activity in the most commonly used PH animal models is currently still very limited [23,24,25]. The two most used animal models for PAH preclinical research are the monocrotaline (MCT) and sugen–hypoxia (SuHx) rat models. MCT is an alkaloid derived from the seeds of Crotalaria spectabilis. Once injected, MCT is metabolized in the liver into its active form and induces PAEC damage followed by the induction of pulmonary hypertension [26]. The SuHx model depends on a single injection of the vascular endothelial growth factor receptor inhibitor sugen to induce PAEC damage combined with a 4-week hypoxic (10% of oxygen) stimulus [27]. Because both the MCT and SuHx rat models rely on chemically and hypoxia-induced hits for the subsequent development of PAH, in the following weeks rather than decades, it is likely that the BMP signaling pathway in experimentally induced PAH acts differently than observed in the human disease, and might even vary between models. Since in translational research, using the most representative animal model to test new compounds is crucially important, the aim of this study was to describe BMPR2 receptor expression and downstream signaling in the MCT and SuHx rat model for experimentally induced PAH and to compare these findings to altered BMPR2 signaling in the lungs of iPAH and hPAH patients. Additionally, we will compare the expression levels in whole lung lysates, as determined by Western blot, vs. vascular expression only. BMP receptor 2 in pulmonary arterial hypertension 157

Methods

Patient tissue samples and animal experiments Human lung tissue samples were obtained from hPAH (n = 7) and iPAH (n = 7) patients upon autopsy. Control lung tissue samples (n = 8) were obtained from patients who had died from non-pulmonary causes (cancer, suicide) as previously reported [28]. The usage of samples was approved by the Institutional Review Board of the VU University Medical Center (Approval number: VUMC BUP 2013-5B) and Comite de ´Protection des Personnes (CPP) Ile-de-France VII, Paris (Approval number: 2018-A01252-53). All the samples were formalin fixed and paraffin embedded according to common tissue-processing protocols. Animal experiments were approved by the animal welfare committee of the VU university and were conducted in accordance with the European convention for the protection of vertebrate animals used for experimental and other scientific purposes. Male Wistar rats (MCT model n = 8/control n = 5) and male Sprague Dawley rats (SuHx model n = 8/control n = 5) (Charles River, The Netherlands) were housed in groups of 3–4 under controlled conditions (22 degrees, 12:12 h light/dark cycle). Food and water were available ad libitum.

Study design The rats were randomly divided in three groups: control (CON), SuHx and MCT, and the results 8 were compared to both iPAH and hPAH. Control group consisted of a 50/50 mix of Wistar and Sprague Dawley rats. The SuHx protocol was followed as described previously [29]. Briefly, the Sprague Dawley animals were injected with SU5416 (25 mg/kg s.c.), Tocris Bioscience, #3037, Bristol, United Kingdom, dissolved in carboxymethylcellulose (CMC)) and exposed to hypoxia (10%) for four weeks followed by re-exposure to normoxia for 6 weeks. Wister rats received a single dose of monocrotaline (60 mg/kg s.c.) to initiate the development of PAH. The CON group received a single shot of the solvent CMC (SuHx) or sterile saline (MCT). Experiments were terminated 4 weeks post-MCT injection or 6 weeks post hypoxia. The timing of the end- experiments was chosen to ensure the full development of PAH and end-stage pulmonary vascular remodeling [29,30]. The animals were killed via exsanguination and the organs were weighed and processed for analysis.

Right ventricle pressure measurements Prior to the termination of the experiment, open-chest right ventricle (RV) catheterization was performed under general anesthesia in all animals (3.0% isoflurane, 1:1 O2/air mix) as described previously elsewhere [31]. The catheter was inserted through the RV wall. The 158

rats were intubated (Teflon tube, 16 gauge) and attached to a mechanical ventilator (Micro- Ventilator, UNO, Zevenaar, The Netherlands; ventilator settings: breathing frequency, 70 breaths per minute; pressures, 12/0 cm H2O; inspiratory/expiratory ratio, 1:1). RV pressures were recorded using a microtip pressure–volume conductance catheter (Millar Instruments, Houston, TX, USA). Analyses were performed when a steady state was reached over an interval of at least 10 s.

Histology and morphometry. The lungs were weighed and the airways of the right middle lobe were filled with 0.5% low- melt agarose in saline under constant pressure of 25 mmHg and stored in formalin (#4169-30, Klinipath BV, Duiven, The Netherlands). The remaining lobes were stored in liquid nitrogen for future processing. The heart was perfused with tyrode solution, weighed, dissected, snap- frozen in liquid nitrogen and stored in −80 °C. Transversally cut lung sections (4 μm) were stained with Elastica van Gieson (EvG) for the analysis of vascular dimensions. The degree of vascular occlusion was expressed by the percentage of occluded vessels determined on a minimum of 30 vessels per animal per group [31]

Western Blot RIPA lysis buffer (89900, Thermofisher scientific, Breda, The Netherlands) with protease inhibitors (PMSF, Thermofisher scientific/complete mini protease inhibitor cocktail, Sigma- Aldrich, Zwijndrecht, The Netherlands) were added to the lung tissue and homogenized with a tissue lyser (Qiagen, Venlo, The Netherlands). Protein concentration was quantified by protein assay kit (Thermo Scientific, Pierce Biotechnology, Rockford, IL, USA). The samples (10 µg) were separated on a gradient gel (Bis-Tris 4–12% gel, Life technologies). XCell blot module was used for protein transfer from the gel to an ECL membrane (Hybond ECL Nitrocellulose Membrane, GE Healthcare). Primary antibody for BMPR2 (1:1000, MA5-15827, Thermo scientific, Breda, The Netherlands)/phospho-Smad 1/5/8 (#12656, Cell Signaling, Leiden, The Netherlands)) diluted in phosphate buffered saline with bovine serum albumin (5%) (PBS-A) was incubated overnight at 4 °C. Appropriate secondary antibody (1:4000, Polyclonal rabbit anti-mouse, Z0259, DAKO) diluted in PBS-A was incubated for one hour. The blots were re- incubated with β-actin (1:50000, A3854, Sigma) or GAPDH diluted in PBS for one hour to correct for unequal loading. An internal control composed of a mix of protein supernatants from all groups was used to correct for inter-blot variation. BMP receptor 2 in pulmonary arterial hypertension 159

Immunofluorescent staining and quantitative analysis After deparaffinization and hydration, epitope retrieval was performed by immersing the slides in antigen unmasking solution (H3300, Vector Laboratories) for 20 min. Blocking steps with 1% bovine serum albumin were performed for 90 min, before incubating the sections with primary antibodies BMPR2 (MA5-15827, Thermo scientific or 612292, BD Biosciences, 1:50) and phospho-Smad 1/5/8 (#12656, Cell Signaling, 1:50) overnight at 4 °C. For the negative controls, the primary antibody was omitted to account for the nonspecific binding of the secondary antibody. Labeling with appropriate secondary antibody conjugated to Cy5 followed for 90 min. Additional overnight staining with pre-conjugated anti-actin α-smooth- muscle-actin—Cy3 (α-SMA, C6198, Sigma), Von Willebrand Factor FITC (VWF, ab8822, Abcam) was performed before a 10 min incubation with 4’6-diamidino-2-phenylindole (DAPI, H-1200, Vector Labs) prior to sealing. Image acquisition was performed on a ZEISS Axiovert 200M Marianas inverted microscope. All the BMPR2 and psmad 1/5/8 images were acquired in a single session. Exposure time for the protein of interest was determined automatically by software (Slidebook 6, Intelligent imaging innovations) once and used for all subsequent slides. The negative control was used to determine and set a low signal threshold. Figures were assembled using an Adobe Illustrator (AI, version 23.03).

BMPR2 expression was determined per high power field (at 400X) and corrected for vessel area by assigning a region of interest (ROI) using FIJI software [32]. ROI was created by 8 manually drawing the vessel circumference subtracted by vessel lumen (if applicable). The average intensity of the BMPR2 signal in ROI was used to quantify the expression per vessel. A minimum of 20 vessels per section were measured. Only the vessels in rats ranging from a 50–100 um diameter were included for analysis.

Statistical Analysis All analyses were performed in a blinded fashion. All data were verified for normal distribution. A p-value <0,05 was considered significant. All data are presented as mean ±SEM. Parameters were analyzed by two-way ANOVA with Bonferroni post-hoc testing (GraphPad Prism for Windows 6, San Diego CA). 160

Results

BMPR2 levels are not decreased in whole lung lysates of iPAH and hPAH patients We first analyzed the protein levels of BMPR2 and pSmad 1/5/8 in whole lung homogenates of samples derived from human PAH patients and controls subjects. Western blot analysis showed that BMPR2 was similar in iPAH and hPAH compared to control lung tissues (Figure 1A). In contrast, semi-quantitative analysis of the expression of BMPR2 in lung vessels by immunofluorescence (IF) revealed the reduced expression of the receptor in the vessels of both iPAH and hPAH patients, compared to the control, regardless of the mutational status (p ≤ 0.05) (Figure 1B,C). A Ctrl Ctrl Ctrl iPAH iPAH XXX iPAH hPAH hPAH hPAH hPAH

BMPR2

GAPDH B

C Control iPAH hPAH

MERGE α-SMA BMPRII DAPI BMPR2 (human)

10 μm 10 μm 10 μm

Figure 1 Western blot analysis of BMPR2 protein expression in the whole lung homogenates of idiopathic PAH (iPAH) and hereditary PAH (hPAH). (A): BMPR2 expression in the whole lung homogenates. xxx = non-relevant sample. (B): BMPR2 expression corrected for the vessel area. (C): Typical examples of vessels are shown. Green = BMPR2; red = smooth-muscle-actin (α-SMA); blue = nuclei. ** = p < 0.01 / *** = p < 0.001. BMP receptor 2 in pulmonary arterial hypertension 161

Decreased Levels of pSmad 1/5/8 in the Lung Vasculature of iPAH and hPAH Patients Since the BMP Smad1/5/8 are considered to reflect BMP signaling and downstream events, we determined the levels of pSmad1/5/8 in the cell lysates of primary pulmonary micro vascular endothelial cells, following stimulation with BMP9 by Western blot. Like in several cell types, the levels of pSmad1/5/8 are increased, following stimulation with BMP9 in human pulmonary micro vascular endothelial cells (Figure S1). Analyzing the levels of phosphorylated Smad 1/5/8 protein in the whole lung homogenates of the control, iPAH and hPAH groups showed no significant differences (Figure 2A). However, there was a clear reduction in the expression of vascular pSmad 1/5/8 when comparing both iPAH and hPAH to the control vessels (p < 0.05) (Figure 2B,C).

A Ctrl Ctrl Ctrl iPAH iPAH iPAH iPAH hPAH hPAH hPAH hPAH

p-SMAD 1/5/8

GAPDH B ) . ) 6 u 1.5 . a ) n a e ( o r H

i a s n D

l s o P i e e s r A s * * s p s

G 4 1.0 e

x e r r 8 e v

p o f r x

o e d f

e 15 8 t d c D e t e 15 8

A 2 0.5 c r r D e M r o A r S c ( o p M c ( S 0 p 0.0 CONTROL iPAH hPAH CONTROL iPAH hPAH C Control iPAH hPAH (human) MERGE MERGE

pSmad1/5/8 SMA autoﬂu 100 μm 100 μm 100 μm pSMAD1/5/8

Figure 2 Analysis of Smad 1/5/8/ phosphorylation in whole lung homogenates. A: pSmad 1/5/8 in whole lung homogenates B: pSmad 1/5/8 expression corrected for vessel area. C: Typical examples of vessels are shown. Red = pSmad 1/5/8; White= smooth-muscle-actin; blue = nuclei. autoflu=autofluroscence. * = p<0.05. 162

Development of PAH in animal models Next, we sought to compare BMPR2-Smad signaling in human PAH with PAH induced in rats. Therefore, we first confirmed the development of PAH in our animal models by the increase in right ventricle systolic pressure (RVSP), increased RV hypertrophy (RV/LV+S) and increased vascular remodeling (Fig 3).

BMPR2 expression is increased in MCT and SuHx lung vasculature Whole lung BMPR2 protein expression was lowered in MCT (p<0,05) but unaltered in SuHx models. Using IF quantification, corrected for vessel area, we observed a notable increase in expression of BMPR2 in both the MCT and SuHx lung vasculature. The BMPR2 downstream target pSmad 1/5/9 was significantly decreased in whole lung homogenates of the MCT, but not the SuHx model. IF showed a decrease in vascular pSmad 1/5/9 in both models (Fig 4).

A B C

CONTROL MCT SUHX

Figure 3 Characteristics of PAH animal model with A: RVSP = right ventricle systolic pressure, B: Fulton index (RV/ LV+S) and C: vascular remodeling. Typical examples of vessel remodeling are shown below (EvG staining, 400x magnification). *= p<0.05 BMP receptor 2 in pulmonary arterial hypertension 163

BMPR2 expression is increased in MCT and SuHx lung vasculature Whole lung BMPR2 protein expression level was reduced in MCT (p<0,05) but did not change in the SuHx model when compared to control (Fig 4A). Using IF quantification corrected for vessel area, we observed a notable increase in the expression of BMPR2 in both the MCT and SuHx lung vasculature (Fig 4B, E). The ratio of pSmad 1/5/8 versus total Smad 1/5/8, indicating BMPR2 activation, was similar in whole lung homogenates of MCT rats and SuHx rats (Fig 4C). However, the ratio of pSmad 1/5/8 versus β-actin is reduced in whole lung homogenates of MCT rats (data not shown) indicating that reduced levels of pSmad1/5/8 is due to reduced total Smad levels and not due to impaired receptor activation/signaling. IF analysis demonstrated reduced expression of vascular pSmad 1/5/8 in both PAH models (Fig 4D-F). As we opted to use both Wistar and Sprague-Dawley rats in our control group we tested for statistical difference of whole lung lysate BMPR2 protein expression between both strains. No difference in BMPR2 protein expression was observed in separate control group analysis (data not shown).

8 164

Figure 4 BMPR2 and pSmad 1/5/9 protein expression in whole lung) homogenates vs. IF analysis (ABCD). Typical im- . 2.0 a 80 u e A B . r a ) a munofluorescent samples are shown (E) green = pSmad 1/5/9 or BMPR2; red = smooth-muscle-actin;*** ** blue = nuclei. n l n i

t * e o i io n c 1.5 s s s 60 s a - s * = p<0.05 / ** = p<0.01 / ***= p<0. s e b e e v

r r

r r p p o o f x x f

e e 1.0 40 d

d e 2 2 e t t c R R c e P e P r r r r M

M 0.5 20 o o B B c c ( (

0.0 0 CONTROL MCT SUHX CONTROL MCT SUHX

MCT MCT MCT MCT Ctrl Ctrl SuHx SuHx SuHx SuHx SuHx Ctrl Ctrl Ctrl

BMPR2

ß C D 1.5 1.5 a 1/ 5/8

d a

a * * l e m s s

1.0

s 1.0 l e a t v

o r t

o r f

o f d

e d 0.5

t 0.5 e c t e c r r e r o r c o c 0.0 0.0 pSMAD 1/5/ 8 expression (a.u.) CONTROL MCT SUHX pSMAD 1/5/ 8 expression (a.u.) CONTROL MCT SUHX

MCT MCT MCT Ctrl Ctrl SuHx SuHx SuHx SuHx SuHx Ctrl Ctrl Ctrl

p-smad 1/5/8

t-smad 1/5/8

E Control MCT SuHx

MERGE DAPI α-SMA BMPRII BMPR2 (rat)

50 μm 50 μm 50 μm F Control MCT SuHx (rat)

MERGE MERGE DAPI α-SMA pSMAD1/5/8 pSMAD1/5/8

50 μm 50 μm 50 μm

Figure 4. BMPR2 and pSmad 1/5/8 protein expression in whole lung homogenates vs. immunofluorescence. A-B: Analysis of protein expression by Western Blot and C-D: immunofluorescence. E: Typical examples are shown. Green = pSmad 1/5/8 or BMPR2; red = smooth-muscle-actin (α-SMA); blue = nuclei. * = p<0.05 / ** = p<0.01 / ***= p<0.001 BMP receptor 2 in pulmonary arterial hypertension 165

Discussion

This study describes the expression levels of BMPR2 and its downstream signaling component pSmad 1/5/8 in lung tissue and more specifically in the lung vasculature of PAH patients as well as in two established animal models of PAH. We confirmed reduced protein expression of BMPR2 and its downstream signaling component pSmad 1/5/8 in both hPAH and iPAH, but surprisingly, both the MCT and SuHx rat model for experimentally induced PAH showed increased vascular expression of BMPR2 in end stage disease. Downstream BMPR2 activity, as assessed by pSmad 1/5/8 expression, was decreased in the lung vasculature of both PAH models, consistent with the patient situation.

Disturbed BMP signaling in iPAH and hPAH Analysis of IF images showed a reduced vascular expression of BMPR2 in both iPAH and hPAH, which is in concordance with a previous report of reduced expression of BMPR2 in hPAH and iPAH determined by immunohistochemistry (IHC)[13]. While reduced BMPR2 expression in whole lung tissue samples from hPAH but not iPAH was reported in a previous study using western blot analysis[11], we did not observe a difference in BMPR2 expression in hPAH/ iPAH vs control in this study. An explanation for our findings perhaps lies in different type of mutations that allow for BMPR2 protein to be formed but incorrectly expressed or unable 8 to induce Smad 1/5/8 phosphorylation. Another possible explanation is that we detected 115kDa protein of BMPR2 (predicted BMPR2 size is 115kDa) whereas in the other study reported 75kDa protein of BMPR2. Of note, we confirmed the specificity of the BMPR2 antibody by 1) knock-down studies using BMPR2 shRNAs in PAECs and PASMCs, 2) using a different BMPR2 antibody, and 3) using BMP9 stimulated PAEC lysates.

Previous studies showed that missense mutations in the ligand-binding domain by cysteine substitutions impair BMP signaling by mutant receptor mislocalisation in the cytosol[33]. Furthermore, as autopsy material was used, it is possible that the cause and time of death may have inferred with BMPR2 signaling in non-vascular cells (e.g. epithelial or macrophage). The phosphorylation of Smad 1/5/8 was decreased in the vasculature of both iPAH and hPAH lungs suggesting that even in the absence of a BMPR2 mutation, BMP signaling is reduced. This observation is in line with another study showing reduced number of Smad 1/5 positive cells by IHC in the vascular intimal and medial layer of iPAH and hPAH[34]. Richter and colleagues found the expression of phosphorylated Smad 1/5/8 in luminal endothelial cells 166

in plexiform lesions, but pSmad1/5/8 was not present in core endothelial cells. Unfortunately the IHC data was not quantified-[14].

Remarkably, using IF we observed increased levels of BMPR2 in the lung vasculature of MCT and SuHx rats, while protein levels in whole lung lysates were only reduced in the MCT model. Previously Ramos et al[35]. reported reduced levels of BMPR2 protein by western blot analysis using whole lung lysates 14 days after MCT injection. Others have described a brief initial increase in BMPR2 protein expression two days after MCT injection, witha subsequent decrease in BMPR2 protein levels after seven and twenty-one days[36–38] in whole lung homogenates by Western blot analysis. Impaired BMP signal transduction was confirmed in our study by reduced pSmad 1/5/8 expression in both MCT and SuHx. A recent study assessing the increase of BMPR2 signaling upon BMP9 stimulation, observed reduced levels of BMPR2 and pSmad 1/5/8 in the MCT model. For SuHx, only a reduction in the expression of pSmad 1/5/8 was reported[39]. Other additional studies have also reported decreases in protein expression of pSmad 1/5/8[35,40]. In contrast to these and our studies, one study reported augmented Smad1 signaling[35]. One difference in the methodological setup between this study and ours is the time post-MCT injection when the analysis was performed (14 vs. 28 days post-MCT). Since BMPR2 expression varies over the course of disease progression in the MCT model, the time difference is likely to explain the difference in Smad1 signaling[37]. Our study opted for prolonged disease development before analysis of the experimental PAH models as at that time-point it more closely resembles human end- stage disease. One explanation for the seemingly normal vascular BMPR2 expression in the SuHx model might be the role of vascular endothelial growth factor receptor 3 (VEGFR3). Blocking of VEGFR3 by Sugen contributes to the vascular remodeling observed in the SuHx model, but recently VEGFR3 has also been linked to BMPR2 and PAH[41,42]. Hwangbo et al. propose a VEGFR3-BMPR2 interaction that is crucial for receptor endocytosis and subsequent induction of phosphorylation of Smads[43]. Inhibition of endocytosis by blocking VEGFR3 by Sugen might therefore result in an increased BMPR2 vascular expression observed in PAH.

Analyzing vessels in more detail showed that in both MCT and SuHx animals, pSmad 1/5/8 is reduced while BMPR2 expression is increased. This increase in BMPR2 levels might be a feedback mechanism to restore endogenous BMP signaling and prevent disease progression, a process that has failed in end-stage lung tissue of iPAH patients. It could also imply differences in BMPR2 and-or the type I receptor kinase activity[15] orthe presence of inhibitors preventing BMPs to bind to the receptor[15,44]. While our study BMP receptor 2 in pulmonary arterial hypertension 167

was able to distinguish between vascular vs. non-vascular expression of BMP signaling, it will be worthwhile to differentiate between the different vascular cell types. Even within the population of endothelial cells, the expression of phosphorylated Smad 1/5/8 was shown to differ upon location within a plexiform lesion[14]. In addition, characterization of BMP signaling throughout disease development might give more insight into the role of BMP signaling in vascular remodeling in PAH. Perros et al. recently published their findings from a novel BMPR2 mutant rat model aimed to specifically model hPAH. These BMPR2 mutated rats spontaneously develop PAH between six and twelve months of age. Whole lung BMPR2 and pSmad 1/5/8 protein expression was lowered by fifty percent as measured by western blot analysis[45]. Analyzing the lung vascular BMPR2 and pSmad 1/5/8 expression in this novel model would inform us if expression is indeed similar to human disease.

Interventions aimed to restore the TGF-β/BMP balance in experimental PAH Inhibition of lysosomal degradation of BMPR2 by chloroquine prevented the progression of PAH in the monocrotaline (MCT) model[46,47]. Restoration of downregulated BMPR2 signaling via targeted gene delivery of BMPR2 revealed therapeutic potential in the MCT model[36]. Sildenafil, a phosphodiesterase type 5 inhibitor currently registered for the treatment of PAH, was demonstrated to restore MCT induced PH in association with increased whole lung pSmad 1/5/8 expression[48]. Using laser dissection microscopy, Mcmurtry et al. showed decreased BMPR2 mRNA expression in the MCT lung vasculature. Additionally, they showed 8 a gradient in lung vascular BMPR2 mRNA expression with distal vessels having to highest expression levels compared to mid or proximal vessels. Gene therapy with BMPR2 distributed BMPR2 to resistance PAs but did not ameliorate PAH in the MCT model[38]. Further, in a study assessing the effect of a selective TGF-β ligand trap, decreased levels of BMPR2 mRNA in SuHx and MCT lungs were unaffected by this treatment despite effective reversal of PH[49]. Post or propter activation of BMPR2, FK506 (known as tacrolimus) reversed established PAH in the SuHx and MCT models[24,50]. In another study, selective enhancement of BMPR2 signaling using BMP9 was shown to reverse disease in the MCT and SuHx model. In this study, whole lung pSmad 1/5 was reduced before treatment in both the MCT and SuHx model, while only in the MCT model lower whole lung BMPR2 protein expression was reported[39]. A multitude of other studies investigating compounds targeting BMPR2 signaling regulation, protein processing regulation, translational regulation, transcriptional regulation and genetic based therapies were performed or are currently ongoing[51–53].

The aim of this study was to give insights in the translational capability of two animal models 168

commonly used to study new treatment modalities for PAH. Focusing on the BMPR2 signaling pathway as the main driver of the disease, both animal models only partly recapitulate the human situation. This study reconfirmed and add to the still limited body of evidence describing decreased vascular BMPR2 expression in PAH. Our contrasting findings of increased BMPR2 observed in the SuHx and MCT lung vasculature emphasizes the inadequacy of using whole lung lysates. We propose for future studies to not use whole lung lysates to determine BMPR2 levels but more suitable techniques such as IF or IHC, which will allow to take into account the spatial localization of BMPR2 expression. Since expression levels of BMPR2 are different in both MCT and SuHx models compared to hPAH or iPAH, this should be taken into consideration when performing preclinical studies using a candidate compound to target BMPR2 or its downstream signaling component. ¬

In conclusion, our findings confirm decreased BMPR2 receptor expression and downstream signaling activity in the lung vasculature of patients with idiopathic and hereditary PAH. At the same time, our study indicates that whole lung lysates are not representative of vascular BMPR2 and pSmad 1/5/8 expression in the lung. Finally, despite an increased BMPR2 expression in the lung vasculature, PAH developed in the MCT and SuHx rat models and the downstream BMPR2 signaling activity resemble that of human PAH (fig 5.).

Funding This work was supported by the Dutch CardioVascular Alliance (DCVA): the Dutch Heart Foundation, Dutch Federation of University Medical Centers, the Netherlands Organization for Health Research and Development, and the Royal Netherlands Academy of Sciences Grant 2012-08 and 2018-2023 awarded to the Phaedra consortium (http://www.phaedraresearch. nl). We also acknowledge support for KK by the Dutch Lung Foundation (Longfonds) grant number-5.2.17.198J0 and by the Leiden University Foundation grant (W18378-2-32).

Acknowledgments We thank Prof. Peter ten Dijke for critical reading of the manuscript and providing valuable feedback. The authors also thank Prof. Marc Humbert, Prof. Elie Fadel, and their clinical and surgical teams for their expertise and support. BMP receptor 2 in pulmonary arterial hypertension 169

iPAH/hPAH Rat model MCT SUHX

8 Figure 5. Schematic overviews summarizing imaging results of this study. While BMPR2 protein expression is decreased in PAH along with decreased pSMAD 1/5/8 signaling, animal BMPR2 expression is increased in the lung vasculature 170

References mutation. Am. J. Respir. Crit. Care Med. 2010, 181, 851– 861, doi:10.1164/rccm.200908-1284OC. 8. Shintani, M.; Yagi, H.; Nakayama, T.; Saji, T.; Matsuoka, 1. Simonneau, G.; Gatzoulis, M.A.; Adatia, I.; Celermajer, R. A new nonsense mutation of SMAD8 associated with D.; Denton, C.; Ghofrani, A.; Gomez Sanchez, M.A.; pulmonary arterial hypertension. J. Med. Genet. 2009, Krishna Kumar, R.; Landzberg, M.; Machado, R.F.; 46, 331–337, doi:10.1136/jmg.2008.062703. et al. Updated Clinical Classification of Pulmonary 9. Drake, K.M.; Dunmore, B.J.; McNelly, L.N.; Morrell, Hypertension. J. Am. Coll. Cardiol. 2013, 62, N.W.; Aldred, M.A. Correction of Nonsense BMPR2 and doi:10.1016/j.jacc.2013.10.029. SMAD9 Mutations by Ataluren in Pulmonary Arterial 2. Thomson, J.R.; Machado, R.D.; Pauciulo, M.W.; Hypertension. Am. J. Respir. Cell Mol. Biol. 2013, 49, Morgan, N.V.; Humbert, M.; Elliott, G.C.; Ward, K.; 403–409, doi:10.1165/rcmb.2013-0100OC. Yacoub, M.; Mikhail, G.; Rogers, P.; et al. Sporadic 10. Pousada, G.; Baloira, A.; Fontán, D.; Núñez, M.; primary pulmonary hypertension is associated with Valverde, D. Mutational and clinical analysis of the ENG germline mutations of the gene encoding BMPR-II, a gene in patients with pulmonary arterial hypertension. receptor member of the TGF-β family. J. Med. Genet. BMC Genet. 2016, 17, doi:10.1186/s12863-016-0384-3. 2000, 37, 741–745, doi:10.1136/jmg.37.10.741. 11. Dewachter, L.; Adnot, S.; Guignabert, C.; Tu, L.; 3. Lane, K.B.; Machado, R.D.; Pauciulo, M.W.; Thomson, Marcos, E.; Fadel, E.; Humbert, M.; Dartevelle, P.; J.R.; Phillips, J.A.; Loyd, J.E.; Nichols, W.C.; Trembath, Simonneau, G.; Naeije, R.; et al. Bone morphogenetic R.C. Heterozygous germline mutations in BMPR2, protein signalling in heritable versus idiopathic encoding a TGF-β receptor, cause familial primary pulmonary hypertension. Eur. Respir. J. 2009, 34, 1100– pulmonary hypertension. Nat. Genet. 2000, 26, 81–84, 1110, doi:10.1183/09031936.00183008. doi:10.1038/79226. 12. Lavoie, J.R.; Ormiston, M.L.; Perez-Iratxeta, C.; 4. Evans, J.D.W.; Girerd, B.; Montani, D.; Wang, X.-J.; Courtman, D.W.; Jiang, B.; Ferrer, E.; Caruso, P.; Galiè, N.; Austin, E.D.; Elliott, G.; Asano, K.; Grünig, E.; Southwood, M.; Foster, W.S.; Morrell, N.W.; et al. Yan, Y.; et al. BMPR2 mutations and survival in pulmonary Proteomic Analysis Implicates Translationally Controlled arterial hypertension: an individual participant data Tumor Protein as a Novel Mediator of Occlusive Vascular meta-analysis. Lancet Respir. Med. 2016, doi:10.1016/ Remodeling in Pulmonary Arterial Hypertension. S2213-2600(15)00544-5. Circulation 2014, 129, 2125–2135, doi:10.1161/ 5. Austin, E.D.; Ma, L.; LeDuc, C.; Rosenzweig, E.B.; CIRCULATIONAHA.114.008777. Borczuk, A.; Phillips, J.A.; Palomero, T.; Sumazin, P.; 13. Atkinson, C. Primary Pulmonary Hypertension Kim, H.R.; Talati, M.H.; et al. Whole Exome Sequencing Is Associated With Reduced Pulmonary Vascular to Identify a Novel Gene (Caveolin-1) Associated Expression of Type II Bone Morphogenetic Protein With Human Pulmonary Arterial HypertensionClinical Receptor. Circulation 2002, 105, 1672–1678, Perspective. Circ. Cardiovasc. Genet. 2012, 5, 336–343, doi:10.1161/01.CIR.0000012754.72951.3D. doi:10.1161/CIRCGENETICS.111.961888. 14. Richter, A.; Yeager, M.E.; Zaiman, A.; Cool, C.D.; 6. Wang, G.; Fan, R.; Ji, R.; Zou, W.; Penny, D.J.; Varghese, Voelkel, N.F.; Tuder, R.M. Impaired Transforming Growth N.P.; Fan, Y. Novel homozygous BMP9 nonsense Factor-β Signaling in Idiopathic Pulmonary Arterial mutation causes pulmonary arterial hypertension: a Hypertension. Am. J. Respir. Crit. Care Med. 2004, 170, case report. BMC Pulm. Med. 2016, 16, 17, doi:10.1186/ 1340–1348, doi:10.1164/rccm.200311-1602OC. s12890-016-0183-7. 15. Morrell, N.W.; Bloch, D.B.; ten Dijke, P.; Goumans, 7. Girerd, B.; Montani, D.; Coulet, F.; Sztrymf, B.; Yaici, M.-J.T.H.; Hata, A.; Smith, J.; Yu, P.B.; Bloch, K.D. Targeting A.; Jaïs, X.; Tregouet, D.; Reis, A.; Drouin-Garraud, V.; BMP signalling in cardiovascular disease and anaemia. Fraisse, A.; et al. Clinical outcomes of pulmonary arterial Nat. Rev. Cardiol. 2016, 13, 106–120, doi:10.1038/ hypertension in patients carrying an ACVRL1 (ALK1) nrcardio.2015.156. BMP receptor 2 in pulmonary arterial hypertension 171

16. Nasim, M.T.; Ogo, T.; Chowdhury, H.M.; Zhao, L.; e31756, doi:10.7554/eLife.31756. Chen, C.; Rhodes, C.; Trembath, R.C. BMPR-II deficiency 24. Spiekerkoetter, E.; Tian, X.; Cai, J.; Hopper, R.K.; elicits pro-proliferative and anti-apoptotic responses Sudheendra, D.; Li, C.G.; El-Bizri, N.; Sawada, H.; through the activation of TGFβ-TAK1-MAPK pathways Haghighat, R.; Chan, R.; et al. FK506 activates BMPR2, in PAH. Hum. Mol. Genet. 2012, 21, 2548–2558, rescues endothelial dysfunction, and reverses doi:10.1093/hmg/dds073. pulmonary hypertension. J. Clin. Invest. 2013, 123, 17. Soon, E.; Crosby, A.; Southwood, M.; Yang, 3600–3613, doi:10.1172/JCI65592. P.; Tajsic, T.; Toshner, M.; Appleby, S.; Shanahan, C.M.; 25. Nickel, N.P.; Spiekerkoetter, E.; Gu, M.; Li, C.G.; Bloch, K.D.; Pepke-Zaba, J.; et al. BMPR-II Deficiency Li, H.; Kaschwich, M.; Diebold, I.; Hennigs, J.K.; Kim, Promotes Pulmonary Hypertension via Increased K.-Y.; Miyagawa, K.; et al. Elafin Reverses Pulmonary Inflammatory Cytokine Production. Am. J. Respir. Crit. Hypertension via Caveolin-1–Dependent Bone Care Med. 2015, doi:10.1164/rccm.201408-1509OC. Morphogenetic Protein Signaling. Am. J. Respir. Crit. 18. Upton, P.D.; Morrell, N.W. The transforming Care Med. 2015, 191, 1273–1286, doi:10.1164/ growth factor-β–bone morphogenetic protein type rccm.201412-2291OC. signalling pathway in pulmonary vascular homeostasis 26. Kay, J.M.; Harris, P.; Heath, D. Pulmonary and disease. Exp. Physiol. 2013, 98, 1262–1266, hypertension produced in rats by ingestion of doi:10.1113/expphysiol.2012.069104. Crotalaria spectabilis seeds. Thorax 1967, 22, 176–179, 19. Dorfmüller, P.; Perros, F.; Balabanian, K.; Humbert, doi:10.1136/thx.22.2.176. M. Inflammation in pulmonary arterial hypertension. 27. Taraseviciene-Stewart, L.; Kasahara, Y.; Alger, L.; Eur. Respir. J. 2003, 22, 358–363, doi:10.1183/090319 Hirth, P.; Mahon, G.M.; Waltenberger, J.; Voelkel, N.F.; 36.03.00038903. Tuder, R.M. Inhibition of the VEGF receptor 2 combined 20. Goumans, M.-J.; Valdimarsdottir, G.; Itoh, S.; with chronic hypoxia causes cell death-dependent Rosendahl, A.; Sideras, P.; ten Dijke, P. Balancing the pulmonary endothelial cell proliferation and severe activation state of the endothelium via two distinct TGF- pulmonary hypertension. FASEB J. 2001, 15, 427–438, 8 beta type I receptors. EMBO J. 2002, 21, 1743–1753, doi:10.1096/fj.00-0343com. doi:10.1093/emboj/21.7.1743. 28. Overbeek, M.J.; Mouchaers, K.T.B.; Niessen, H.M.; 21. Gore, B.; Izikki, M.; Mercier, O.; Dewachter, L.; Hadi, A.M.; Kupreishvili, K.; Boonstra, A.; Voskuyl, Fadel, E.; Humbert, M.; Dartevelle, P.; Simonneau, G.; A.E.; Belien, J.A.M.; Smit, E.F.; Dijkmans, B.C.; et al. Naeije, R.; Lebrin, F.; et al. Key Role of the Endothelial Characteristics of Interstitial Fibrosis and Inflammatory TGF-β/ALK1/Endoglin Signaling Pathway in Humans and Cell Infiltration in Right Ventricles of Systemic Rodents Pulmonary Hypertension. PLoS ONE 2014, 9, Sclerosis-Associated Pulmonary Arterial Hypertension e100310, doi:10.1371/journal.pone.0100310. Available online: https://www.hindawi.com/journals/ 22. Davies, R.J.; Holmes, A.M.; Deighton, J.; Long, L.; ijr/2010/604615/abs/ (accessed on Apr 20, 2019). Yang, X.; Barker, L.; Walker, C.; Budd, D.C.; Upton, P.D.; 29. de Raaf, M.A.; Schalij, I.; Gomez-Arroyo, J.; Rol, Morrell, N.W. BMP type II receptor deficiency confers N.; Happé, C.; de Man, F.S.; Vonk-Noordegraaf, A.; resistance to growth inhibition by TGF-β in pulmonary Westerhof, N.; Voelkel, N.F.; Bogaard, H.J. SuHx rat artery smooth muscle cells: role of proinflammatory model: partly reversible pulmonary hypertension and cytokines. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2012, progressive intima obstruction. Eur. Respir. J. 2014, 44, 302, L604–L615, doi:10.1152/ajplung.00309.2011. 160–168, doi:10.1183/09031936.00204813. 23. Ramachandran, A.; Vizán, P.; Das, D.; Chakravarty, 30. Handoko, M.L.; Man, F.S. de; Happé, C.M.; Schalij, P.; Vogt, J.; Rogers, K.W.; Müller, P.; Hinck, A.P.; Sapkota, I.; Musters, R.J.P.; Westerhof, N.; Postmus, P.E.; Paulus, G.P.; Hill, C.S. TGF-β uses a novel mode of receptor W.J.; Laarse, W.J. van der; Vonk-Noordegraaf, A. Opposite activation to phosphorylate SMAD1/5 and induce Effects of Training in Rats With Stable and Progressive epithelial-to-mesenchymal transition. eLife 2018, 7, Pulmonary Hypertension. Circulation 2009, 120, 42–49, 172

doi:10.1161/CIRCULATIONAHA.108.829713. ajplung.00309.2006. 31. Happé, C.M.; de Raaf, M.A.; Rol, N.; Schalij, I.; Vonk- 39. Long, L.; Ormiston, M.L.; Yang, X.; Southwood, M.; Noordegraaf, A.; Westerhof, N.; Voelkel, N.F.; de Man, Gräf, S.; Machado, R.D.; Mueller, M.; Kinzel, B.; Yung, F.S.; Bogaard, H.J. Pneumonectomy combined with L.M.; Wilkinson, J.M.; et al. Selective enhancement of SU5416 induces severe pulmonary hypertension in endothelial BMPR-II with BMP9 reverses pulmonary rats. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2016, 310, arterial hypertension. Nat. Med. 2015, doi:10.1038/ L1088–L1097, doi:10.1152/ajplung.00023.2016. nm.3877. 32. Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, 40. Harper, R.L.; Reynolds, A.M.; Bonder, C.S.; Reynolds, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, P.N. BMPR2 gene therapy for PAH acts via Smad and C.; Saalfeld, S.; Schmid, B.; et al. Fiji: an open-source non-Smad signalling. Respirology 2016, 21, 727–733, platform for biological-image analysis. Nat. Methods doi:10.1111/resp.12729. 2012, 9, 676–682, doi:10.1038/nmeth.2019. 41. Al-Husseini, A.; Kraskauskas, D.; Mezzaroma, E.; 33. Rudarakanchana, N.; Flanagan, J.A.; Chen, H.; Upton, Nordio, A.; Farkas, D.; Drake, J.I.; Abbate, A.; Felty, P.D.; Machado, R.; Patel, D.; Trembath, R.C.; Morrell, N.W. Quentin; Voelkel, N.F. Vascular endothelial growth factor Functional analysis of bone morphogenetic protein type receptor 3 signaling contributes to angioobliterative II receptor mutations underlying primary pulmonary pulmonary hypertension. Pulm. Circ. 2015, 5, 101–116, hypertension. Hum. Mol. Genet. 2002, 11, 1517–1525. doi:10.1086/679704. 34. Yang, X. Dysfunctional Smad Signaling Contributes 42. Hwangbo, C.; Lee, H.-W.; Kang, H.; Ju, H.; Wiley, D.S.; to Abnormal Smooth Muscle Cell Proliferation Papangeli, I.; Han, J.; Kim, J.-D.; Dunworth, W.P.; Hu, X.; in Familial Pulmonary Arterial Hypertension. et al. Modulation of Endothelial Bone Morphogenetic Circ. Res. 2005, 96, 1053–1063, doi:10.1161/01. Protein Receptor Type 2 Activity by Vascular Endothelial RES.0000166926.54293.68. Growth Factor Receptor 3 in Pulmonary Arterial 35. Ramos, M.F.; Lamé, M.W.; Segall, H.J.; Wilson, D.W. Hypertension. Circulation 2017, 135, 2288–2298, Smad Signaling in the Rat Model of Monocrotaline doi:10.1161/CIRCULATIONAHA.116.025390. Pulmonary Hypertension. Toxicol. Pathol. 2008, 36, 43. Lee, H.-W.; Jin, S.-W. VEGFR3 as a novel modulator for 311–320, doi:10.1177/0192623307311402. PAH. Oncotarget 2017, 8, 84610–84611, doi:10.18632/ 36. Reynolds, A.M.; Holmes, M.D.; Danilov, S.M.; oncotarget.21295. Reynolds, P.N. Targeted gene delivery of BMPR2 44. Goumans, M.-J.; Zwijsen, A.; Dijke, P. ten; Bailly, S. attenuates pulmonary hypertension. Eur. Respir. J. 2012, Bone Morphogenetic Proteins in Vascular Homeostasis 39, 329–343, doi:10.1183/09031936.00187310. and Disease. Cold Spring Harb. Perspect. Biol. 2018, 10, 37. Long, L.; Crosby, A.; Yang, X.; Southwood, M.; a031989, doi:10.1101/cshperspect.a031989. Upton, P.D.; Kim, D.-K.; Morrell, N.W. Altered Bone 45. Hautefort Aurélie; Mendes-Ferreira Pedro; Sabourin Morphogenetic Protein and Transforming Growth Jessica; Manaud Grégoire; Bertero Thomas; Rucker- Factor- Signaling in Rat Models of Pulmonary Martin Catherine; Riou Marianne; Adão Rui; Manoury Hypertension: Potential for Activin Receptor-Like Boris; Lambert Mélanie; et al. Bmpr2 Mutant Rats Kinase-5 Inhibition in Prevention and Progression of Develop Pulmonary and Cardiac Characteristics of Disease. Circulation 2009, 119, 566–576, doi:10.1161/ Pulmonary Arterial Hypertension. Circulation 2019, 139, CIRCULATIONAHA.108.821504. 932–948, doi:10.1161/CIRCULATIONAHA.118.033744. 38. McMurtry, M.S.; Moudgil, R.; Hashimoto, K.; 46. Long, L.; Yang, X.; Southwood, M.; Lu, J.; Marciniak, Bonnet, S.; Michelakis, E.D.; Archer, S.L. Overexpression S.J.; Dunmore, B.J.; Morrell, N.W. Chloroquine Prevents of human bone morphogenetic protein receptor Progression of Experimental Pulmonary Hypertension 2 does not ameliorate monocrotaline pulmonary via Inhibition of Autophagy and Lysosomal Bmpr- arterial hypertension. Am. J. Physiol.-Lung Cell. II Degradation. Circ. Res. 2013, doi:10.1161/ Mol. Physiol. 2007, 292, L872–L878, doi:10.1152/ CIRCRESAHA.111.300483. BMP receptor 2 in pulmonary arterial hypertension 173

47. Dunmore, B.J.; Drake, K.M.; Upton, P.D.; Toshner, M.R.; Aldred, M.A.; Morrell, N.W. The lysosomal inhibitor, chloroquine, increases cell surface BMPR-II levels and restores BMP9 signalling in endothelial cells harbouring BMPR-II mutations. Hum. Mol. Genet. 2013, 22, 3667–3679, doi:10.1093/hmg/ddt216. 48. Yang Jun; Li Xiaohui; Al-Lamki Rafia S.; Wu Changxin; Weiss Astrid; Berk Joachim; Schermuly Ralph T.; Morrell Nicholas W. Sildenafil Potentiates Bone Morphogenetic Protein Signaling in Pulmonary Arterial Smooth Muscle Cells and in Experimental Pulmonary Hypertension. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 34–42, doi:10.1161/ATVBAHA.112.300121. 49. Yung, L.-M.; Nikolic, I.; Paskin-Flerlage, S.D.; Pearsall, R.S.; Kumar, R.; Yu, P.B. A Selective TGFβ Ligand Trap Attenuates Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 2016, doi:10.1164/rccm.201510-1955OC. 50. Spiekerkoetter, E.; Sung, Y.K.; Sudheendra, D.; Scott, V.; Del Rosario, P.; Bill, M.; Haddad, F.; Long- Boyle, J.; Hedlin, H.; Zamanian, R.T. Randomised placebo-controlled safety and tolerability trial of FK506 (tacrolimus) for pulmonary arterial hypertension. Eur. Respir. J. 2017, 50, doi:10.1183/13993003.02449-2016. 51. Orriols, M.; Gomez-Puerto, M.C.; ten Dijke, P. BMP 8 type II receptor as a therapeutic target in pulmonary arterial hypertension. Cell. Mol. Life Sci. 2017, 74, 2979– 2995, doi:10.1007/s00018-017-2510-4. 52. Kurakula, K.; Sun, X.-Q.; Happé, C.; Bos, D. da S.G.; Szulcek, R.; Schalij, I.; Wiesmeijer, K.C.; Lodder, K.; Tu, L.; Guignabert, C.; et al. 6-mercaptopurine, an agonist of Nur77, reduces progression of pulmonary hypertension by enhancing BMP signalling. Eur. Respir. J. 2019, 1802400, doi:10.1183/13993003.02400-2018. 53. Van der Feen, D.E.; Kurakula, K.; Tremblay, E.; Boucherat, O.; Bossers, G.P.; Szulcek, R.; Bourgeois, A.; Lampron, M.-C.; Habbout, K.; Martineau, S.; et al. Multicenter Preclinical Validation of BET Inhibition for the Treatment of Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med. 2019, doi:10.1164/ rccm.201812-2275OC.

9 Summary and future perspectives

C.M. Happé 176

Summary and future perspectives

Pulmonary hypertension (PH) is a disease that is characterized by an increased blood pressure in the pulmonary vascular system. In a clinical classification of the disease different forms of PH can be distinguished on the basis of causes and mechanisms of disease development. Pulmonary arterial hypertension (group 1) is defined by an increase in mean pulmonary artery pressure of ≥ 25 mmHg combined with a pulmonary wedge pressure ≤ 15 mmHg1. While this form is associated with heritable factors, drug and toxins), and several other associated diseases, a small group of PAH cases remains idiopathic of nature. Common in the disease is that the dense vascular network in the lungs is affected due to multiple factors or “hits” leading to loss of pulmonary vascular radius and rarefaction of the pulmonary vessels2. Following this decrease in functional lung vascular volume, increased pulmonary vascular resistance (PVR) leads to an increased right ventricular (RV) afterload. While the RV can adapt to cope with the increased load, ultimately RV failure develops culminating into the death of the patient.

Similarities in pathology between cancer and pulmonary arterial hypertension A current pathobiological concept characterizes PAH as a quasi-malignant disease. This concept is supported by endothelial cell properties described as cancer like alteration such as apoptosis resistance and hyper-proliferation3,4. In chapter 2 we reviewed the current literature regarding the similarities between the pathologies of cancer and pulmonary arterial hypertension (PAH). By using the the famous “hallmarks of cancer” established by Hanahan and Weinberg as a framework, we assessed parallels and differences between the two diseases5. For decades the treatment of severe PAH was solely based on targeting the vasoconstrictive properties of the vessels. The impact of an increased blood pressure and flow on pulmonary vasculature in PAH is still incompletely understood. In the review we described how abnormal pulmonary blood flow (PBF) can contribute to the initiation and maintenance of the vascular pathobiology. We concluded that an abnormal PBF, be it high shear stress or abnormal flow, can at least partially account for the quasi malignant phenotype of endothelial cells. Consequently, normalization of the abnormal PBF and increased understanding of the endothelial cells response could offer potential treatment targets. Further elucidation of the complicated interplay between endothelial cell signaling and an abnormal blood flow remains imperative for the development of targeted treatments. Summary and perspectives 177

Abnormal blood flow and vascular remodeling As a third of the population of patients undergoing major lung resection (MLR) develop pulmonary hypertension post-operatively, the sudden increase of cardiac output trough the remaining vascular bed could account for vascular changes thereby increasing pulmonary vascular resistance6–8. In chapter 3 we therefore investigated whether altered pulmonary blood flow is associated with vascular changes comparable to PH. By examining lung tissues from patients whom underwent MLR, we evaluated the appearance of proliferative and apoptosis markers in the lung vascular bed. We found indications that the vascular changes can possibly be explained by an altered PBF. Future studies with a larger cohorts and additional tissue samples are needed to strengthen these conclusions. Another important future study would be to investigate the effects of an abnormal pulmonary blood flow on vascular rarefaction in the lung. As much of our current understanding is based on the analysis of 2D histopathological tissues, the possible presence of rarefaction can only be proven using 3D imaging techniques. The effects of an increased PBF combined with an additional hit were investigated in chapter 4. The Sugen-Hypoxia rat model (SuHx) of PAH was used as the basis as it was already shown that the hypoxic hit in this model is replaceable9,10. Animals subjected to both a pneumonectomy and SU5416 developed severe PAH over the course of 6 weeks. Angio-obliteration together with increased rates of apoptotic and proliferative signaling were observed. Findings obtained from this model added to the body of evidence supporting that PAH can evolve as a consequence of a variety of insults to the lung vasculature, while supporting the hypothesis that an abnormal PBF can serve as a hit. Aside from the main findings in this study an impressive growth of the contralateral lung after pneumonectomy 69 was observed in the control group. While these animals experienced a slight increase in pulmonary pressures, hemodynamics then normalized over time. This compensatory growth could be explored in future studies to study regeneration of the lung microvasculature in context of PAH11.

Caspase mediated shear response of pulmonary endothelial cells In Chapter 5 we investigated the role of a high PBF on endothelial dysfunction inPAH. Our research showed that lung vascular endothelial cells isolated from multiple patients have an inherent delayed morphological adaptation to shear. Delayed shear adaptation was mechanistically explained by caspase mediated cleavage of the shear sensor Platelet Endothelial Cell Adhesion Molecule 1 (PECAM-1). Treatment by means of caspase inhibition with Z-Asp reversed disease progression in SuHx animals. Given these results future studies aimed at caspase (and apoptosis) inhibition could be initiated. The cellular selectiveness of 178

such treatment would be of vital importance as inhibition of apoptosis might carry the long term risk of developing cancer. Mechanistically it will therefore be of importance to determine how defective PECAM signaling drives the molecular signaling in the sick PAH endothelial cell, so perhaps more specific targets can be discovered.

TGF-β and BMPR2 in PAH Chapter 6 provides a detailed overview of the disturbed signaling of receptors of the TGF-β family in PAH. It is well established that overactive TGF-β family signaling has a role in PAH which offers promising options for treatment12. (Non)-Canonical TGF- β signaling and its downstream targets are discussed specifically for their role in the lung vascular remodeling and right ventricle adaptation in PAH. As BMP signaling has had the majority focus over the years, mainly due to findings of BMPR2 mutations in hereditary PAH, interest in the role of TGF- β and possible treatments are emerging13,14. As aberrant TGF-β family signaling is hypothesized to lead to unfavorable cardiac adaptation we studied the consequences of BMPR2 mutations for RV adaptation in PAH in chapter 7. We demonstrated that PAH patients harboring a BMPR2 mutation have a diminished RV function compared to PAH patients who are non-carriers. Future studies should clear up whether PAH patients with an BMPR2 mutation can benefit from closer monitoring of RV function, while development ofRV targeted therapeutics is of essence once specific targets have been found.

Restoring the TGF-β superfamily signaling could be of interest and as new treatment options are emerging, it is of utmost importance that the animal models used to test our hypotheses reflect the pathology observed in human disease. Therefore, in Chapter 8 two commonly used animal models of PAH were evaluated. We investigated BMPR2 expression and its downstream Smad targets. We assessed the whole lung protein expression via Western blot analysis and localized vascular expression via immunofluorescence staining. We found that the monocrotaline (MCT) and SuHx models of PAH express altered BMPR2, but in a different way as previously observed in human disease. Remarkably, we found that protein expression of the downstream signal transduction via Smads was similarly affected when comparing models th PAH/ As a large repertoire of regulatory mechanisms exist which can modulate Smad signaling, future studies should be conducted to properly asses the signaling cascade. Currently there are multiple models of (isolated) RV dysfunction and failure in rats, from which it would also be of interest to characterize the TGF-β superfamily signaling pathway.

Summary and perspectives 179

References 10. Mizuno S, Farkas L, Alhussaini A, Farkas D, Gomez- Arroyo J, Kraskauskas D, Nicolls MR, Cool CD, Bogaard HJ, Voelkel NF. Severe Pulmonary Arterial Hypertension 1. Galiè N, Humbert M, Vachiery J-L, Gibbs S, Lang I, Induced by SU5416 and Ovalbumin Immunization. Torbicki A, Simonneau G, Peacock A, Noordegraaf AV, Am J Respir Cell Mol Biol [Internet]. 2012 [cited 2012 Beghetti M, Ghofrani A, Sanchez MAG, Hansmann G, Aug 27];Available from:http://ajrcmb.atsjournals.org/ Klepetko W, Lancellotti P, Matucci M, McDonagh T, content/ early/2012/07/25/rcmb.2012-0077OC Pierard LA, Trindade PT, Zompatori M, Hoeper M. 2015 11. Paisley D, Bevan L, Choy KJ, Gross C. The ESC/ERS Guidelines for the diagnosis and treatment of pneumonectomy model of compensatory lung growth: pulmonary hypertension. Eur Respir J. 2015;46:903– Insights into lung regeneration. Pharmacol Ther. 975. 2014;142:196–205. 2. Hopkins N, McLoughlin P. The structural basis of 12. Goumans M-J, Liu Z, ten Dijke P. TGF-β signaling in pulmonary hypertension in chronic lung disease: vascular biology and dysfunction. Cell Res. 2009;19:116– remodelling, rarefaction or angiogenesis? J Anat. 127. 2002;201:335–348. 13. Lane KB, Machado RD, Pauciulo MW, Thomson 3. Voelkel NF, Cool C, Lee SD, Wright L, Geraci MW, JR, Phillips JA, Loyd JE, Nichols WC, Trembath RC. Tuder RM. Primary pulmonary hypertension between Heterozygous germline mutations in BMPR2, encoding inflammation and cancer. Chest. 1998;114:225S-230S. a TGF-β receptor, cause familial primary pulmonary 4. Rai PR, Cool CD, King JAC, Stevens T, Burns N, Winn RA, hypertension. Nat Genet. 2000;26:81–84. Kasper M, Voelkel NF. The Cancer Paradigm of Severe 14. Yung L-M, Nikolic I, Paskin-Flerlage SD, Pearsall Pulmonary Arterial Hypertension. Am J Respir Crit Care RS, Kumar R, Yu PB. A Selective TGFβ Ligand Trap Med. 2008;178:558–564. Attenuates Pulmonary Hypertension. Am J Respir Crit 5. Hanahan D, Weinberg RA. Hallmarks of Cancer: The Care Med [Internet]. 2016 [cited 2016 May 1];Available Next Generation. Cell. 2011;144:646–674. from: http://www.atsjournals.org/doi/abs/10.1164/ 6. Deslauriers J, Ugalde P, Miro S, Deslauriers DR, Ferland rccm.201510-1955OC S, Bergeron S, Lacasse Y, Provencher S. Long-Term Physiological Consequences of Pneumonectomy. Semin Thorac Cardiovasc Surg. 2011;23:196–202. 69 7. Foroulis CN, Kotoulas CS, Kakouros S, Evangelatos G, Chassapis C, Konstantinou M, Lioulias AG. Study on the late effect of pneumonectomy on right heart pressures using Doppler echocardiography. Eur J Cardio-Thorac Surg Off J Eur Assoc Cardio-Thorac Surg. 2004;26:508– 514. 8. Potaris K, Athanasiou A, Konstantinou M, Zaglavira P, Theodoridis D, Syrigos KN. Pulmonary hypertension after pneumonectomy for lung cancer. Asian Cardiovasc Thorac Ann. 2014;22:1072–1079. 9. Taraseviciene-Stewart L, Kasahara Y, Alger L, Hirth P, Mahon GM, Waltenberger J, Voelkel NF, Tuder RM. Inhibition of the VEGF receptor 2 combined with chronic hypoxia causes cell death-dependent pulmonary endothelial cell proliferation and severe pulmonary hypertension. FASEB J. 2001;15:427–438.

Nederlandse Samenvatting List of publications Dankwoord 10 Curriculum Vitae

C.M. Happé 182

Nederlandse samenvatting

Pulmonale arteriële hypertensie (PH) is een ziekte die wordt gekenmerkt door progressieve vernauwing van de bloedvaten in de long. Door de vernauwing van de bloedvaten ontstaat er een verhoogde werkdruk voor de rechter hartkamer. De rechter hartkamer heeft als functie zuurstofarm bloed door de longen te pompen. De linker hartkamer pompt dit zuurstofrijke bloed daarna door het gehele lichaam. Deze bloedsomlopen worden ook wel de kleine en grote bloedsomloop genoemd.

Veranderingen in de longvaatjes spelen een belangrijke rol in het ontstaan van pulmonale hypertensie. De cellen van een bloedvat die in direct contact staan met het bloed zijn de endotheelcellen. Sinds 1950 weten we al dat een abnormale bloedstroom door de longen kan leiden tot schade en verandering van deze endotheelcellen. Door de aangedane schade zien we dat bloedvaatjes in de longen dichtgroeien en mogelijk zelfs verdwijnen. Een abnormale bloedstroom alleen is echter niet genoeg om de vaatverandering bij PH te verklaren. Er zijn aanwijzingen dat de progressieve vernauwing in de vaten ontspoord door een 2e trigger (second hit).

Genetische mutaties van het BMPR2 gen worden gevonden in 80% van de erfelijke vormen van PH. BMPR2 is een onderdeel van de TGF-beta receptor familie, welke verantwoordelijk is voor de aansturing van vele cellulaire processen zoals celdeling (proliferatie) en celdood (apoptose). PH-patiënten met een BMPR2 mutatie hebben een slechtere prognose dan patiënten zonder mutaties. Aangezien het BMPR2 gen te vinden is in zowel de longen als het hart, ligt het voor de hand dat defecten in dit gen een centrale rol hebben in het onstaan van ziekte.

Om meer inzicht te krijgen in het ontstaan van schade aan de bloedvaten in de long door een abnormale bloedstroom kijken we in deel 1 van dit proefschrift naar de effecten hiervan. In deel 2 van dit proefschrift gaan we in op het effect van een defect BMPR2 gen in pulmonale hypertensie.

Deel 1: De rol van een abnormale bloedstroom in pulmonale hypertensie

In hoofdstuk 2 vergelijken we middels een literatuuroverzicht het ontstaan van pulmonale hypertensie door een abnormale bloedstroom met het ontstaan van kanker. Het ontstaan 183

van kanker is door Hanahan en Weinberg beschreven als een proces dat faalt op meerdere punten, de zogenaamde “Hallmarks of cancer”. Aan de hand van deze hallmarks is systematisch gezocht naar literatuur naar overeenkomsten van deze verschijnselen met de ziekte PH. Het blijkt dat een abnormale bloedstroom door de longen een rol heeft in een aanzienlijk deel van de hallmarks (zoals resistentie tegen celdood, ongeremde proliferatie en alteratie van cellulair metabolisme).

Hoofdstuk 3 beschrijft de effecten van een pneumonectomie of lobectomie (het chirurgisch verwijderen van een (deel) van de long) op de longvaten in de resterende long. Door de verwijdering van de long ontstaat er een plotse verhoging van de bloedstroom over de contralaterale long. Door het bestuderen van longweefsel, verkregen door autopsie, probeerde we inzicht te krijgen in de veranderingen in de bloedvaatjes. Het bleek dat veranderingen in de longvaten mogelijk deels verklaard worden door een abnormale bloedstroom in de longen. Gezien het kleine patiënten aantal beschikbaar voor deze studie zijn er in de toekomst studies met grotere aantallen patiënten nodig.

Om nieuwe therapieën te ontwikkelen en een ziekteproces te bestuderen zijn diermodellen vooralsnog van groot belang. In hoofdstuk 4 karakteriseren we een nieuw diermodel voor PH. Door het verwijderen van de linkerlong bij een rat verhogen we de bloedstroom in de overgebleven long. Daarnaast injecteren we een middel wat endotheel schade veroorzaakt. Door deze combinatie van “hits” ontwikkelde de dieren binnen enkele weken ernstige PH. We vonden verhoogde celdeling en resistentie tegen celdood van endotheel cellen in de long. Dit had tot gevolg dat de longvaten volledig dichtgroeide. 109 In hoofdstuk 5 werden endotheelcellen onderzocht die zijn geïsoleerd uit de longen van overleden of getransplanteerde PH patiënten. Deze cellen worden gekweekt op een plaat en vormen zo een eencellige laag. Door het gebruik van een vloeistofpomp is het mogelijk om stroming te creëren over deze cellen. De effecten van verschillende vormen van een abnormale bloedstoom op endotheelcellen kon zodoende worden onderzocht. Hieruit bleek dat de endotheelcellen van PH patiënten vertraagd adapteren aan een verhoogde bloedstroom. PECAM-1, een bloedstroom sensor op de endotheelcel, lijkt hierin een centrale rol te spelen. Normalisatie van de respons kon worden bereikt door het middel Z-Asp, een apoptose inhibitor die tevens schade aan PECAM-1 kan voorkomen. 184

Deel 2: De rol van BMPR2 en TGF-beta in pulmonale hypertensie

In hoofdstuk 6 wordt de rol van de TGF-beta in pulmonale hypertensie beschreven. De TGF- beta familie is een groep van regulator eiwitten die in verschillende biologische processen een belangrijke rol spelen. We bespreken effecten van TGF-beta familie op het hart en de vaatverandering in de long. Ook behandelen we recente preklinische studies en worden toekomstige perspectieven doorgenomen.

Hoofdstuk 7 onderzoekt de effecten van een BMPR2 mutatie op de rechter hartkamer nadat deze wordt blootgesteld aan een hogere werkdruk. Door het combineren van MRI data met histologische en moleculaire analyses onderzochten we of er verschillende adaptatie mechanismen spelen patiënten met een BMPR2 mutatie versus patiënten zonder een mutatie. We rapporteren dat ondanks een gelijke werkdruk is de functie van de rechter hartkamer meer is aangedaan bij patiënten met een BMPR2 mutatie. Er werden geen verschillen gevonden in TGF-beta en BMPR2 regulatie in de hartspiercellen.

In hoofdstuk 8 komen we wederom terug bij de diermodellen. Binnen het PH onderzoek hebben we de beschikking over meerdere diermodellen. Hier onderzochten we de expressie van TGF-beta en BMPR2 in 2 veelgebruikte diermodellen. Dit met als doel om het meest accurate diermodel te vinden en zo translatie van data naar de humane situatie te verbeteren. BMPR2 receptor expressie is verminderd in de longvaten van patiënten met idiopathische en erfelijke PH. Bij de diermodellen konden we deze resultaten niet repliceren maar waren downstream targets van deze receptoren wel gelijk aangedaan. 185

Publications

Opposite effects of training in rats with stable and progressive pulmonary hypertension. ML Handoko • FS de Man • CM Happé • I Schalij • RJ Musters • N Westerhof • PE Postmus • WJ Paulus • WJ van der Laarse • A Vonk-Noordegraaf. Circulation. 2009

Histone deacetylase inhibition with trichostatin A does not reverse severe angioproliferative pulmonary hypertension in rats. MA De Raaf • AA Hussaini • J Gomez-Arroyo • D Kraskaukas • D Farkas • CM Happé • NF Voelkel NF • Bogaard HJ. Pulmonary Circulation. 2014

MA de Raaf • I Schalij • J Gomez-Arroyo • N Rol • CM Happé • FS de Man • A Vonk- Noordegraaf • N Westerhof • NF Voelkel • Bogaard HJ. SuHx rat model: partly reversible pulmonary hypertension and progressive intima obstruction. Eur Respir J. 2014

Intravenous iron therapy in patients with idiopathic pulmonary arterial hypertension and iron deficiency. G Ruiter • E Manders • CM Happé • I Schalij • H Groepenhoff • LS Howard • MR Wilkins• HJ Bogaard • N Westerhof • WJ van der Laarse • FS de Man • A Vonk-Noordegraaf. Pulmonary Circulation. 2015

Left ventricular outflow tract gradient is associated with reduced capillary density in hypertrophic cardiomyopathy irrespective of genotype. A Güçlü • CM Happé • S Eren • IH Korkmaz • HW Niessen • P Klein • M van Slegtenhorst • AF Schinkel • M Michels • AC van Rossum • T Germans • J van der Velden. Eur J Clin Invest. 2015 109 Nebivolol for improving endothelial dysfunction, pulmonary vascular remodeling, and right heart function in pulmonary hypertension. F Perros • B Ranchoux • M Izikki • S Bentebbal • CM Happé • F Antigny • P Jourdon • P Dorfmüller • F Lecerf • E Fadel • G Simonneau • M Humbert • HJ Bogaard • S Eddahibi. J Am Coll Cardiol. 2015

Reconciling paradigms of abnormal pulmonary blood flow and quasi-malignant cellular alterations in pulmonary arterial hypertension. CM Happé • R Szulcek • NF Voelkel • HJ Bogaard. Vascul Pharmacol. 2016

Pneumonectomy combined with SU5416 induces severe pulmonary hypertension in rats.CM Happé • MA de Raaf • N Rol • I Schalij • A Vonk-Noordegraaf • N Westerhof • NF Voelkel • FS 186

de Man • HJ Bogaard. Am J Physiol Lung Cell Mol Physiol. 2016

Bone Morphogenetic Protein Receptor Type 2 Mutation in Pulmonary Arterial Hypertension, A view on the right ventricle. CM Happé • CEE van der Bruggen • P Dorfmüller • P Trip • OA Spruijt • N Rol • F Hoevenaars • A Houweling • B Girerd • JT Marcus • O Mercier • M Humbert • ML Handoko • J van der Velden • A Vonk-Noordegraaf • HJ Bogaard • MJ Goumans • FS de Man. Circulation. 2016

Delayed Microvascular Shear-adaptation in Pulmonary Arterial Hypertension: Role of PECAM-1 Cleavage. R Szulcek R • CM Happé • N Rol • RD Fontijn • C Dickhoff • KJ Hartemink • K Grünberg • L Tu • W Timens • GD Nossent • MA Paul • TA Leyen • AJ Horrevoets • FS de Man • C Guignabert • PB Yu • A Vonk-Noordegraaf • GP van Nieuw Amerongen • HJ Bogaard . Am J Respir Crit Care Med. 2016

Vascular remodeling in the pulmonary circulation after major lung resection. N Rol N •CM Happé • JAM Beliën • FS de Man • N Westerhof • A Vonk-Noordegraaf • HJ Bogaard • K Grünberg. Eur Respir J. 2017

Renal Denervation Reduces Pulmonary Vascular Remodeling and Right Ventricular Diastolic Stiffness in Experimental Pulmonary Hypertension. DSG Bos• CM Happé • I Schalij • W Pijacka • JFR Paton • C Guignabert • L Tu • R Thuillet • HJ Bogaard • AC van Rossum • A Vonk-Noordegraaf • FS de Man • ML Handoko. JACC Basic Transl Sci. 2017

B Kojonazarov • T Novoyatleva • M Boehm • CM Happé • Z Sibinska • X Tian • A Sajjad • H Luitel • P Kriechling • G Posern • SM Evans • F Grimminger • HA Ghofrani • N Weissmann • HJ Bogaard • W Seeger • RT Schermuly. p38 MAPK Inhibition Improves Heart Function in Pressure-Loaded Right Ventricular Hypertrophy. Am J Respir Cell Mol Biol. 2017

Levosimendan Prevents and Reverts Right Ventricular Failure in Experimental Pulmonary Arterial Hypertension. MS Hansen • A Andersen • S Holmboe • JG Schultz • S Ringgaard • U Simonsen • CM Happé • HJ Bogaard • JE Nielsen-Kudsk. J Cardiovasc Pharmacol. 2017

Nintedanib improves cardiac fibrosis but leaves pulmonary vascular remodelling unaltered in experimental pulmonary hypertension. N Rol • MA de Raaf • XS Sun • VP Kuiper • DSG Bos • CM Happé • KB Kurakula • C Dickhoff • R Thuillet • L Tu • C Guignabert • I Schalij • K Lodder 187

• X Pan • FE Herrmann • GP van Nieuw Amerongen • P Koolwijk • A Vonk-Noordegraaf • FS de Man • L Wollin • MJ Goumans • R Szulcek • HJ Bogaard. Cardiovascular Research 2019

6-mercaptopurine, an agonist of Nur77, reduces progression of pulmonary hypertension by enhancing BMP signalling. KB Kurakula • XS Sun • CM Happé • DSG Bos • R Szulcek • I Schalij • KC Wiesmeijer • K Lodder • L Tu • C Guignabert • CJM de Vries • FS de Man • A Vonk Noordegraaf • P ten Dijke • MJ Goumans • HJ Bogaard. European Respiratory Journal 2019

The BMP receptor 2 in pulmonary arterial hypertension. When and where the animal model matches the patient. CM Happé • KB Kurakula • XS Sun • DSG Bos • Rol N • C Guignabert • S Andersen • J Schultz • I Schalij • K Wiesmeijer • A Vonk-Noordegraaf • FS de Man • MJ Goumans • HJ Bogaard • Cells. 2020

109 188

Poster and oral presentations

2012 ERS (European Respiratory Society), Wenen , Oostenrijk. Poster presentation.

2013 ERS (European Respiratory Society), Barcelona, Spain. Poster presentation. vPneumonectomy combined with SU5416 as a novel animal model of PAH. 2014 ATS (American thoracic society), San Diego, United States of America. Poster presententation. Pneumonectomy combined with SU5416 induces severe angio-obliterative pulmonary hypertension in rats.

GSK 2nd Scientific seminar on pulmonary hypertension, Amsterdam, The Netherlands. Oral presentation. The Suhx model of pulmonary hypertension 2015 ERS (European Respiratory Society), Amsterdam, The Netherlands. Poster presentation. Caspase inhibition stabilizes progressive vascular remodeling in established Pulmonary Hypertension.

EB (Experimental Biologyy), Boston, United States of America. Poster presentation. Acute caspase inhibition attenuates progressive vascular remodeling in established Pulmonary Arterial Hypertension.

AHA (American Heart Association), Orlando, United States of America. Poster presentation. Characterization of TGFβ/BMP-axis in multiple animal models of PH. 2016 ATS (American thoracic society), San Francisco, United States of America. Poster presentation. Characterization of TGF-β/BMP-axis in rat models of PH 189

Dankwoord

Dankwoord:

Tot slot rest mij niets dan mij dank uit te spreken aan iedereen die in de afgelopen jaren heeft bijgedragen aan de totstandkoming van dit proefschrift. Ik kijk met veel plezier terug op de afgelopen jaren mede door een geweldige groep collega’s, vrienden en familie.

Het spreekwoordelijke balletje is gaan rollen op 31 oktober 2007 met een mailtje met de titel “meewerken aan onderzoek op afdeling longziekten”. Ik had destijds de wens om een langlopende stage te doen. Nu bijna 13 jaar later kunnen we concluderen dat dit wel goed gekomen is. Prof. dr. A Vonk Noordegraaf, beste Anton, bedankt voor al het vertrouwen vanaf het eerste moment. Je enthousiasme voor de wetenschap en je toewijding naar je patiënten zijn inspirerend. Ik hoop ook in de kliniek nog veel van je kennis op te kunnen steken.

Beste Louis en Frances. Bij jullie ben ik gestart als stagiair en mocht ik meewerken aan het excercise project. Ook in de periode van mijn afwezigheid waardeerde ik jullie bezoeken enorm. Daarna waren jullie er ook om me direct weer in het zadel te helpen. Louis; dank dat je mij toentertijd wilde begeleiden en mij direct overal bij betrok. Ik heb enorm veel van je mogen leren. Frances; fantastisch dat jij nu mijn co-promotor bent. Bedankt voor je begeleiding met als hoogtepunt toch wel de publicatie in Circulation en daaropvolgende champagne bij Mahler! Een close second is het AHA-congres in Orlando waar we met zijn allen in een familiehuis zaten. Veel dank voor al je kritische commentaren en adviezen gedurende het hele promotietraject! 109

Prof. dr. Harm-Jan Bogaard. HJ, allereerst dank voor het vertrouwen. Ik geloof dat we elkaar net 5 minuten kende voordat het rond was dat ik bij jou als PhD-student kon starten. Als promotor sta je altijd klaar voor een korte vraag of overleg. Je razendsnelle scherpe commentaren op manuscripten en abstracts, vaak ook laat in de avond of vroege ochtend, zijn kenmerkend voor je toewijding aan het onderzoek en in de begeleiding van je PhD-studenten. Met je humor en enthousiasme weet je iemand ook altijd weer te motiveren als het even tegenzit. Nu als arts hoop ik ook in de toekomst nog veel van je te kunnen leren!

Aan alle collega’s van de CVON-PHAEDRA. Bedankt voor de mooie samenwerking en de gezellige PHAEDRA-weekenden! A special thanks to Babu, we have collaborated a lot in the 190

last few years, with some nice papers to show for. I wish you all the best in your future career! Marie-José, bedankt voor je begeleiding in de afgelopen jaren.

To our French colleagues. Christophe Guignabert and Ly Tu. Thank you for your contributions especially to the last chapter in this thesis. Peter Dorfmüller, thank you for providing us with the invaluable cardiac tissue sections and knowledgeable contributions needed for the work in chapter 7.

Aan alle oud-collega’s van kamer MF B-157: Loek, Louise, Aref, Deni, Bea, Xiaoqing en Alexander. Ik heb het altijd getroffen met de collega’s op de kamer. Thanks for the good times on and off work!. Michiel. Dank voor al je hulp en adviezen, zeker in het begin met het sugen- pneumonectomy project. Zonder jouw hulp had ik nooit zo’n vliegende start kunnen maken. Ilse, we kennen elkaar als sinds de CVR-master en later ook als collega’s bij de afdeling fysiologie. Mooi om te zien hoe je je nu doorontwikkeld bij MRC! De etentjes om even bij te praten houden we erin! Melissa! Op het werk maar vooral daarbuiten was het altijd gezellig met de etentjes en festivals. Snel weer eens een keer doen! Diederik, ook jij bedankt voor alle mooie momenten open buiten het werk! Jose. You really brought a breath of fresh air to the lab with your visit and enthousiasm for all things science related. Thanks for the good times both on- and off work (Mahler!). I hope we get to collaborate again in the near future. Ingrid en Sylvia als stille kracht in het lab. Bedankt voor alle organisatorische en experimentele ondersteuning in de afgelopen jaren. Max, qua projecten hebben we nooit samengewerkt, maar je aanwezigheid in het lab zorgde altijd voor de nodige sfeer! Tevens mijn dank aan Jan, Michel, Aimée, Ruud en Duncan voor alle ondersteuning in het werk. Aan alle andere collega’s van het fysiologe lab: Jolanda, Pieter, René, Geerten, Dop, Alice, Ed, Willem, Michiel, en Coen, Josien, Dimitar, Rick, Erik, Rob, Robert, Josine, Mark, Paul, Phat, Jisca, Rio, Igor, Manon, Joanna, Vasco, Dimitar, Zeineb, Maike, Leo en Jeroen. Dank voor mooie tijd bij de fysiologie als onderzoeker uit de PH-groep. Aan Rika, Carla en Jerry. Dank voor jullie ondersteuning bij alle experimenten in de afgelopen jaren.

Aan mijn (oud)-collega’s van de PH en longoncologie: Gerrina, Pia, Bart, Jurjan, Anna, Adinda, Eva, Joanne, Jelco, Anna-Larissa, Natalia, Liza en Eveline. Dank voor de fijne samenwerking! Aan Ella, Anny en Irma, dank voor alle administratieve ondersteuning vanuit het longsecretariaat.

Onno. De man met een eigen dans en de relaxedheid zelve. We kennen elkaar sinds de 191

introductie toen we gelijktijdig startte met ons promotietraject. Daarna vaste kamergenoot bij overnachtingen op het congres, cursus of skireis. Dank voor alle mooie momenten ook naast het werk met de borrels, roadtrips en fietstourtjes maar bovenal ook voor je support in de afgelopen jaren. Mooi om nu ook weer te kunnen samenwerken in de kliniek.

Paul! Via de klinische onderzoekers van de PH-groep leerde ik je kennen bovenal als een enorme gangmaker zowel op het werk als daarbuiten. Je tomeloze energie en overtuiging waarmee je alles benaderd is bewonderenswaardig. De vele stapavonden, festivals en congressen zijn stuk voor stuk mooie herinneringen. Ook jij bedankt voor al je support door de jaren heen. Snel weer een keer sushi?

Cathelijne, vanaf het begin in Barcelona is het eigenlijk non-stop lachen geweest (behoudens die ene traan in het lab met dank aan enkele experimenten uit hoofdstuk 7). Ik heb je door de jaren heen enorm gewaardeerd als collega maar nog meer daarbuiten. Door de gedeelde voorliefde voor de singer-songwriters zijn we al naar menig concert geweest. Tel daarbij op alle mooie feestjes en roadtrips en ik kijk nu al uit naar meer. Tokyo 2021? Veel succes met je opleiding tot longarts in Eindhoven!

Nina. Fantastisch de we op dezelfde dag onze promotie doen. Ik heb vele goede herinneringen aan onze tijd op en vooral ook naast het werk. Van de dag afsluiten bij de Basket of de Blauwe Engel tot alle avonden stappen of uit eten. Het voelt als een grote eer dat ik je paranimf mag zijn! Ik kijk ernaar uit om straks weer met je samenwerken op de zaal op 5C.

Inge, Jennie en Marleen. Het ZIGMA-programma is een prachtige kans voor zij-instromers om 109 zich door te ontwikkelen als clinicus en onderzoeker. Met recht een programma waar jullie trots op mogen zijn. Aan alle ZIGMA-collegae van cohort 2016! Om als 30-jarige weer in de schoolbanken plaats te nemen tussen een jongere generatie was echt even wennen. Gelukkig helpen jullie mij altijd feilloos te herinneren dat ik niet meer de jongste ben. Dank hiervoor en bedankt voor de leerzame en bovenal gezellige tijd. Jullie houden me jong. Succes allemaal in jullie verdere carrière!

De bakermat. Aan al mijn Hoornse vrienden; Jasper en Jenneke, Rob en Stephanie, Tom en Ashley, Bibi en Anne, Wouter en Manon, Danny en Suus, Lennart en Nancy, Frank, Sander en Renskel, Terence en Jessica, Menno en Miranda, Floor en Rick. Bedankt voor al het meeleven en interesse voor het onderzoek. 192

Rogier. Al sinds de middelbare school onafscheidelijk. Onwijs mooi dat je naast mij staat als paranimf en binnenkort ook zelf mag promoveren. Mooi dat je volgend jaar mag starten met de MDL-opleiding en het toch geen dermatologie is geworden. Je mag mij eeuwig dankbaar zijn. Veel succes en voorspoed met de laatste loodjes van je promotietraject. Nicolien. Ook jij bedankt voor alle steun in de afgelopen jaren. Jullie huis staat altijd open voor een bezoek. In het verlengde hiervan ook mijn dank aan jullie ouders Pieter & Katri en Guus & Mirjam.

Patrick. Wat mooi dat jij naast me staat als paranimf. Ondanks dat we allebei totaal iets anders doen heb je altijd interesse in mijn onderzoek gehad. De F1-weekenden en onze trip naar Spanje waren welkome afleidingen van het werk! Bedankt voor die momenten. Ik ben blij en trots op je dat je je weg hebt kunnen vinden in je werk en met je nieuwe huis! Keep it going!

Han, Jos & Gerda en Larissa. Buiten het onderzoek en werk is het altijd fijn om even tot rust te kunnen komen bij de familie. Bedankt voor jullie interesse en aanmoediging in de afgelopen jaren. Lieve Omi, dank voor uw interesse in het onderzoek en de (financiële) steun, ik waardeer onze wekelijkse gesprekken altijd zeer!

Lieve mam, nu het boekje dan eindelijk af is draag ik dit op aan jou en pa. Zonder jou en papa had ik dit nooit kunnen doen. Jullie zijn de basis geweest voor alles wat ik heb mogen bereiken. Hierin heb ik mij altijd gesteund gevoeld door het vertrouwen en de mogelijkheden die jullie mij hebben geboden om te gaan studeren. Dank voor alles

Pap en Joeri. Wat had ik jullie graag op de voorste rijen bij mijn promotie gezien. Ik hoop dat jullie vanaf boven met gepaste trots meekijken. 193

Curriculum Vitae

Christiaan Maurice Happé was born in Purmerend, The Netherlands on November 29th, 1985. In 2004 he completed secondary school (VWO) at the Oscar Romero in Hoorn. He graduated his studies in Biomedical Sciences in 2008. During his time as a student he developed an interest in research while working as an intern under supervision of dr. M.L. Handoko and Dr. Frances de Man focusing on effects of training on pulmonary hypertension. In 2010 he worked under supervision of dr. G. Ruiter studying effects of iron defiency in pulmonary hypertension. During the Cardiovascular Research Master program he started his work as a PhD-student at the department of Pulmonary Diseases, VU University Medical Center in Amsterdam under the supervision of prof. dr. A. Vonk-Noordegraaf, prof. dr. HJ. Bogaard and Dr. FS. Handoko-de Man.

On August 18th 2016 he started his training as a medical student at the VU University Medical Center and recieved his MD degree in June 2020. In July he started as ANIOS at the department of Pulmonary diseases at the Amsterdam University Medical Center.

109 194