Oncogene (1999) 18, 1313 ± 1324 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc Detailed methylation analysis of the glutathione S-transferase p (GSTP1) gene in prostate cancer

Douglas S Millar1, Kim K Ow2, Cheryl L Paul1, Pamela J Russell2, Peter L Molloy3 and Susan J Clark*,1,3

1Kanematsu Laboratories, Royal Prince Alfred Hospital, Missenden Road, Camperdown, NSW 2050, Australia; 2Oncology Research Centre, Prince of Wales Hospital, Randwick, NSW 2031, Australia; and 3CSIRO Division of Molecular Science, Sydney Laboratory, PO Box 184, North Ryde, NSW 1670, Australia

Glutathione-S-Transferases (GSTs) comprise a family of simultaneous regional increases in DNA methylation isoenzymes that provide protection to mammalian cells (Jones et al., 1992; Schmutte et al., 1996). Hyper- against electrophilic metabolites of carcinogens and methylated regions often harbour tumour suppressor reactive oxygen species. Previous studies have shown genes and other CpG island-containing genes such as that the CpG-rich promoter region of the p-class gene calcitonin, p15, p16, Rb, VHL, e-cadherin, ER, and GSTP1 is methylated at single restriction sites in the HIC1 (Baylin et al., 1998). In many cases hypermethy- majority of prostate cancers. In order to understand the lation of the CpG island genes has been correlated with nature of abnormal methylation of the GSTP1 gene in a loss of gene expression and it is proposed that DNA prostate cancer we undertook a detailed analysis of methylation provides an alternate pathway to gene methylation at 131 CpG sites spanning the promoter and deletion or mutation for the loss of tumour suppressor body of the gene. Our results show that DNA gene function. methylation is not con®ned to speci®c CpG sites in the Glutathione S-transferases (GSTs) are a family of promoter region of the GSTP1 gene but is extensive enzymes that catalyze intracellular detoxi®cation of a throughout the CpG island in prostate cancer cells. variety of electrophiles, including a number of Furthermore we found that both alleles are abnormally xenobiotics and carcinogens, by conjugation to methylated in this region. In normal prostate tissue, the glutathione (Rushmore and Pickett, 1993). Human entire CpG island was unmethylated, but extensive GSTs can be classi®ed into distinct families; ®ve of the methylation was found outside the island in the body of gene families encode cytosolic GSTs, alpha, mu, pi, the gene. Loss of GSTP1 expression correlated with sigma and theta), while single genes encode membrane- DNA methylation of the CpG island in both prostate bound forms of the enzyme (Hayes and Pulford, 1995). cancer cell lines and cancer tissues whereas methylation Among the isozymes, the pi class enzyme GSTP1-1 is outside the CpG island in normal prostate tissue the most widely distributed and has been well studied appeared to have no e€ect on gene expression. in cancer. Increased expression of GSTP1-1 has been reported in a number of cancer types, including colon Keywords: DNA methylation; bisulphite genomic (Mulder et al., 1995), stomach (Peters et al., 1990), sequencing; GSTP1; prostate cancer oesophagal (Ishioka et al., 1991), head and neck (Wang et al., 1997). An association between increased GSTP1- 1 expression and resistance to cytotoxic drugs has also been established with breast cancer cells (Batist et al., Introduction 1986). Conversely, immunohistochemical staining demonstrated a loss of GSTP1-1 expression in 88 of While some common genetic alterations have been 91 cancer specimens (Lee et al., 1994). The LNCaP identi®ed during prostate cancer progression (Isaacs et prostate cancer cell line that lacks GSTP1-1 protein al., 1995) and a susceptibility gene for prostate cancer was shown not to express GSTP1mRNA and to be has recently been identi®ed (Smith et al., 1996), the methylated at speci®c restriction sites in the 5' ¯anking molecular events leading to prostate cancer develop- region of the gene. In addition, in all 20 prostate ment are not well de®ned. Initiation of cancer involves carcinoma samples that were examined, methylation at multiple genetic events characterized by chromosomal a speci®c restriction site (BssHII) was observed, while translocations, deletions, ampli®cations and point matched normal prostate DNA was unmethylated (Lee mutations of critical genes (Knudson, 1986). In et al., 1994). Methylation analysis was carried out addition to these genetic changes, abnormal patterns using methylation sensitive restriction endonucleases of DNA methylation (epigenetic changes) have also and consequently was limited by the number of CpG been observed in a wide spectrum of human cancers sites in the promoter region that could be assayed. including widespread genomic hypomethylation and Loss of expression of GSTP1-1 has been con®rmed in two recent immunohistochemical studies (Cookson et al., 1997; Moskaluk et al., 1997). As hypermethylation in the 5' region of GSTP1 appears to be a frequent and early event in prostate *Correspondence: SJ Clark, CSIRO Division of Molecular Science, cancer development, we wished to examine the speci®c Sydney Laboratory, PO Box 184, North Ryde, NSW 1670, Australia Received 29 June 1998; revised 7 September 1998; accepted 7 changes in the pattern of methylation spanning the September 1998 gene in prostate cancer versus normal tissue. We used Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1314 bisulphite genomic sequencing (Clark et al., 1994; core promoter region (PCR1) was ampli®ed (Figure 1a Clark and Frommer, 1995; 1997) to determine the and 2). This region contains the NotI and SacII sites, methylation status of cytosine residues present within that were shown to correlate with the silencing of the four distinct regions spanning the GSTP1 gene. GSTP1 gene in prostate cell lines when methylated Speci®cally we wished to address whether the (Lee et al., 1994). Direct sequencing of the PCR1 hypermethylation (1) was con®ned to speci®c sites or product (Figure 3a) followed by Genescan analysis regions of the promoter, such as transcription factor (Figure 3b) was used to quantitate the methylation binding sites, or (2) encompassed the entire CpG island status. Figure 4 summarizes the extent of methylation region and the body of the gene, (3) was biallelic and at each CpG site in the core promoter region; CpG (4) correlated with gene inactivation in cancer cells. sites are numbered relative to the start of transcription. In DNA isolated from LNCaP cells all 38 CpG sites analysed (from CpG 728 to CpG +10, relative to the Results transcription start site) were fully methylated including the transcription factor binding sites. In contrast the The GSTP1 gene is approximately 4 kb in length, GSTP1-1 expressing cell line, Du145 was completely comprises 7 exons and 6 introns (Morrow et al., 1989; unmethylated (Figure 3d and 4) whereas PC3 which Cowell et al., 1988) and codes for a 715 base mRNA also expresses GSTP1-1 was undermethylated across (Figure 1a). The promoter of GSTP1 is located within this region (Figure 3c and 4). This is consistent with a 1.5 kb CpG island that also spans exons 1 ± 3 (Figure the population of PC3 cells containing a mixture of 1b). A region of about 150 base pairs encompassing the unmethylated (expressing) and methylated (nonexpres- transcription start site has previously been shown to sing) alleles (data not shown). While most CpG sites direct transcription when linked to a heterologous showed a similar low level of methylation in PC3 DNA reporter gene. The core region of the GSTP1 promoter (25 ± 50%), certain individual CpG sites (720 and contains two Sp1 binding sites, a consensus AP-1 site 714) were unmethylated (Figure 4). We also examined and a TATAA box, as shown in Figure 2. A negative two sublines of PC3 called PC-3M and PC-3MM2; regulatory element capable of suppressing GSTP1 these cell lines show greater metastatic potential and transcription also has been identi®ed (Mo€at et al., grow more aggressively (Pettaway et al., 1996). The 1996). DNA from these lines shows a similar pattern of methylation to PC3. Interestingly CpG site 720 remained unmethylated in all derivatives of PC3, and Methylation of the core promoter region of the GSTP1 the adjacent sites, 721 and 719, were also gene unmethylated in the PC3-M and PC3-MM2 sublines. Our ®rst aim was to determine the extent of methylation within the GSTP1 promoter region in Tumour samples In order to determine the methyla- the prostate cancer cell lines and tumour samples. tion of the core promoter region in prostate cancer tissue, that had Gleason scores ranging from Grade 4 ± Cell lines The prostate cancer cell lines we tested 8, DNA was isolated from six prostate cancer (C) included PC3 and Du145 that express GSTP1-1 and tissues. A matched sample of grossly normal (N) tissue LNCaP that does not express GSTP1-1 (Lee et al., was also processed for each prostate. Quantitative 1994). Following bisulphite treatment of the DNA the genomic sequencing of DNA from these grossly normal

Figure 1 Map of the GSTP1 gene. (a) The relative position and sizes of the 7 exons of the GSTP1 gene are shown. Solid bars indicate the regions ampli®ed from bisulphite-treated DNA, PCR1 to PCR4. (b) C+G density plot of the GSTP1 gene with positions of CpG dinucleotides above the line and GpC below the line. The scale is marked in base pairs Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1315

gggacctgggaaagagggaaaggcttccc tccccctgctctcagcatatgtgggg

gctcagagctcccagc cagaggactagaaaacagctc atggggccaa ctccagca

cagcatcaggcccgggctc

gctctgagcacctgctgtgtggcagtctct

ctgcaaatacatctccctcatctacaccaa

catgct gctggcagatcagggccagagct

Figure 2 Sequence pro®le of ampli®ed regions from GSTP1. The sequences ampli®ed for each PCR region are shown in panels. The sequence co-ordinates ampli®ed in brackets are shown. The corresponding introns/exons are marked on the side. Within the panels the primer sequences are shaded, exon sequences are boxed and individual CpG sites are numbered according to their position relative to the start site of transcription. In panel PCR1 binding sites for the transcription factors AP1 (solid underline) and Sp1 (dashed underline) are indicated. The transcription start site is shown by an arrow. The NotI site (N), and SacII site (S) are also indicated. In panel PCR2 the BstUI (B) sites are marked and underlined

prostate cells (2AN, BN, CN, DN, XN, WN) (Figure 10 ± 100% methylation. DNA from one patient (2AC), 3e and 4) demonstrated a lack of methylation at all who had a Gleason score of 8, was completely CpG sites across the core promoter region (PCR1). unmethylated. However, it was dicult to ensure that Similarly, no methylation was observed in this region the cancer tissue was homogeneous for cancer cells and from a patient with no known prostate cancer (data therefore the lack of methylation possibly was due to a not shown). Of the six prostate cancer samples high proportion of `contaminating' normal cells that analysed ®ve (BC, CC, DC, XC, WC) were extensively are unmethylated in this region. In all other cases methylated across the 38 CpG sites including all the where the promoter was methylated in the cancer transcription factor binding sites (Figure 3f and 4). tisssue, with Gleason scores ranging from 4 ± 7, the Methylation intensity however varied at each site from methylation was extensive across nearly all CpG sites. Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1316

Figure 3 Sequence and Genescan analysis of core promoter region. (a) Direct PCR sequence analysis of the population of PCR1 DNA ampli®ed from bisulphite-treated LNCaP DNA. The sequence is shown at the top of the panel and CpG site numbers are indicated. (b±f) Quantitative methylation determination by Genescan analysis (T and C tracks) of PCR1 DNA fragments obtained following bisulphite treatment of DNA. CpG site numbers are shown in the top of the panels and per cent methylation below each site. (b), LNCaP; (c), PC3; (d), DU145; (e), normal prostate; CN; (f), prostate cancer, CC

However speci®c di€erences in the intensity of Methylation outside the core promoter region of the methylation were observed, for example, CpG sites GSTP1 gene. 723, 722, 720 and 714 were unmethylated in XC, while all other CpG sites were fully methylated. It is Since we found that hypermethylation in the prostate interesting that some of these CpG sites were in the cancer cells was not limited to a few CpG sites in the same region that was undermethylated in many of the promoter region we decided to determine the extent of other cancer cells, in particular in all of the PC3 cell hypermethylation in the LNCaP and PC3 prostate cell lines. This may be indicative of a factor binding across lines and in two of the prostate cancer tissues (BC and the CpG rich sequence preventing methylation. CC). We expanded our study to include the rest of the Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1317

Figure 4 Methylation pro®le covering the core promoter and exon 1. Bisulphite-treated DNA from each of the prostate cell lines or prostate tissue samples was ampli®ed (PCR1) and the level of methylation determined at each CpG site by Genescan analysis. The Gleason score of the cancer samples is 2AC (4+4); BC (3+3); CC (2+3); DC (2+2); XC (3+4); WC (3+3). CpG site numbers are shown on the left. The levels of DNA methylation are indicated as: 70%); + (1 ± 25%); ++ (26 ± 50%); +++ (51 ± 75%); ++++ (76 ± 100%); n, not determined because of sequence quality

3' end of the CpG island that extended into exon 2 and In addition regions of undermethylation were observed 3 (PCR2) as well as CpG sites in the body of the in the PC3 cell line derivatives between CpG sites +18 GSTP1 gene that encompassed intron 4 and exon 5 to +25 located in intron 1. A single CpG site 25 was (PCR3) and CpG sites in exon 7 and the 3' unmethylated in LNCaP; interestingly this site is untranslated region (PCR4), as shown in Figures 1 located in an Sp1 consensus sequence. CpG sites from and 2. 34 ± 54 were not subjected to sequence analysis. However, digestion with the restriction enzyme BstU1 Cell lines A 600 bp region containing 42 CpG sites (CGCG), that will only cut if CpG sites 52 and 53 are (13 ± 54) was ampli®ed (PCR2: Figure 2), following both methylated, demonstrated a concordance between bisulphite treatment of DNA from the prostate cell methylation at these sites and the methylation status of lines previously shown to be hypermethylated in the the sequences further upstream (Figure 5). This core promoter region. Figure 5 summarizes the indicates that the methylation pro®le in the prostate methylation data obtained by Genescan analysis, for cell lines extends through to the end of the CpG island. CpG sites 13 ± 33. The prostate cell lines LNCaP, PC3, We therefore extended our study to include CpG PC3-M and PC3-MM2 all showed extensive hyper- sites outside the CpG island region. We found that the methylation across the 21 CpG sites of the 3' CpG 7 CpG sites (68 ± 74) spanning intron 4 and exon 5 island. As for the core promoter, the degree of (PCR3) and the 8 CpG sites (96 ± 103) spanning exon 7 methylation ranged from 100% methylated in LNCaP and the 3' untranslated region (PCR4) (Figure 2) were to 10 ± 75% methylated in the PC3 cell line derivatives. essentially fully methylated in all the prostate cell lines Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1318

Figure 5 Methylation pro®le covering the GSTP1 gene beyond exon 1. Bisulphite-treated DNA from prostate cell lines or prostate tissues was ampli®ed using primers for PCR2, 3 or 4 as shown in Table 1 and the level of methylation at individual CpG sites determined by Genescan analysis. CpG site numbers are shown on the left; the extent of methylation is shown as in Figure 5. The lower panel shows restriction digests with BstUI of ampli®ed PCR2 DNA fragments from the cell lines or tissues shown. Pairs of tracks for each sample show undigested (U) or BstUI digested (D) PCR2 DNA. Arrows indicate sizes of expected bands before and after digestion; 602 bp uncut, 175, 390 and 37 bp BstUI digestion products

tested (Figure 5). In fact we found that the cell lines the exception of CpG sites (24 and 25) in the CC were even more heavily methylated outside the CpG sample, that were unmethylated (Figure 5). To examine island. CpG sites further downstream the PCR products were digested with BstUI. PCR2 DNA contains two BstUI Tumour samples Hypermethylation detected in the sites spanning CpGs 27 and 28 and CpGs 52 and 53 GSTP1 core promoter region of cancer samples BC (Figure 3). BstUI (CGCG) will only digest bisulphite- and CC, also was found to extend into the downstream treated and ampli®ed DNA if both CpG dinucleotides CpG island. All 21 CpG sites in the 3' end of the CpG in the recognition sequence are methylated. Digestion island (PCR2) were methylated from 50 ± 100%, with of DNA from the cell lines and tumour samples Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1319 demonstrated that the level of methylation at CpG sites CC. Methylation was symmetrical since both top and 52 and 53 was equivalent to that at CpG sites 27 and bottom strands were methylated across the CpG island. 28 (Figure 5). This indicates that the methylation Similar patterns of methylation were also observed for pro®le in the prostate cancer tissue also extends the cancer samples BC and DC (data not shown). through to the end of the CpG island. In contrast, the matched normal samples, that showed no Methylation of both alleles methylation in the core promoter of the GSTP1gene, also showed no methylation in the 3' end of CpG Complete methylation at most CpG sites in the core island (Figure 5). promoter region was found in the LNCaP cell line and As for the prostate cell lines we extended our study in one of the prostate cancer samples (WC) in which a to include CpG sites outside the CpG island region for nodule of tumour mass was clearly de®ned before two of the prostate tissue samples B and C. We found DNA extraction. Also in cancer sample, RC, the level that the CpG sites spanning intron 4 and exon 5 of methylation varied between 50 ± 75%; this sample (PCR3) and the CpG sites spanning exon 7 and the 3' contained a proportion of normal cells and immuno- untranslated region (PCR4) (Figure 2) also were histochemical analysis showed around a 50% reduction essentially fully methylated in the DNA from the in GSTP1-1 expression. This raised the possibility that prostate tissue (Figure 5). Similarly, we found that both alleles of the GSTP1 gene were methylated, or methylation in the body of the gene from the prostate alternatively that one allele was methylated and the cancer tissue, was substantially higher than in the CpG other deleted. To distinguish between these possibilities island region. In contrast to the CpG island that was requires the presence of a polymorphism to differenti- unmethylated in the normal prostate cells, we found ate the alleles. The only informative polymorphism we full methylation in the body of the GSTP1 gene, in have identi®ed so far lies just upstream of the region cells from the matched normal prostate (BN and CN) ampli®ed in PCR1; both patients B and D were (Figure 5) as well as from prostate cells that were heterozygous for this polymorphism. The sequence of disease free (data not shown). This result explains why the two allelic forms identi®ed is shown in Figure 7. the level of methylation in the body of the gene in the The polymorphism involves the CpG site 733 which is cancer samples was substantially higher than in the present in the published sequence of this region and CpG island region, since it re¯ects methylation of the absent in the variant sequence. The region spanning gene in both the cancer cells and any non-cancer cells this site was ampli®ed from bisulphite-treated cancer in the samples. DNA (BC and DC), clones isolated and sequenced. Approximately half of the clones (six of 13 for BC and eight of 15 for DC) were methylated in this region. Symmetrical methylation (Normal prostate DNA is unmethylated in this region In order to establish that methylation was symmetrical, (data not shown); therefore the unmethylated clones that is both strands methylated, we also analysed the presumably were derived from the normal contaminat- methylation of the bottom strand across the core ing prostate tissue). Figure 7 shows the methylation promoter. Figure 6 shows the methylation pattern pro®les of the methylated molecules. The methylated across the top and bottom strands of the core molecules from BC contained both polymorphisms: promoter from CpG sites 728 to 9, for cancer sample three clones of both the normal and variant alleles. The

Figure 6 Symmetrical methylation. The top strand and the bottom strand of the core promoter region were separately ampli®ed from bisulphite-treated DNA of prostate cancer sample CC and the extent of methylation at each site determined by Genescan analysis. The per cent methylation (vertical axis) at each CpG site is shown above the line for the top strand and below the line for the bottom strand. *, indicate sites at which the sequence could not be quantitated Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1320

Figure 7 Bi-allelic methylation. The region immediately upstream of the core promoter was ampli®ed by PCR from bisulphite- treated DNA of prostate cancer samples BC and DC, and PCR fragments cloned and sequenced. (a) The sequence covering the polymorphism in the DNA (co-ordinates 933 ± 953 of the GSTP1 gene) from patients B and D. (b) The methylation status (+ or 7) at each CpG site in the di€erent cloned molecules. p, presence of polymorphism

methylated molecules from DC also contained both polymorphisms: three of the normal and ®ve of the variant allele. This data clearly demonstrates methyla- tion of both alleles of the GSTP1 gene in the tumour DNA of patients B and D. Both alleles were also present in the unmethylated clones isolated from the cancer tissue DNA as well as in clones isolated from normal DNA of patients B and D (not shown). There were small variations (mosaic patterns) in the methylation pro®les of individual clones at some sites, as commonly observed when individual mole- cules have been sequenced in cancer, disease and developmental systems (Stirzaker et al., 1997; Stoger et al., 1997; Warnecke et al., 1998a,b).

Expression of the GSTP1 gene Since DNA from one of the tumour samples examined, 2AC, showed no evidence of methylation of the CpG island region containing the core promoter, we assayed this and other samples for expression of GSTP1-1 by immunohistochemistry. The tumour samples which showed extensive methylation of the GSTP1 core promoter region were all negative for GSTP1-1 expression except in basement and some stromal cells, Figure 8 GSTP1-1 expression in prostate cancer. Sections of as shown for patient W in Figure 8. In contrast, the normal and cancer tissue from patient 2A (unmethylated GSTP1 DNA in tumour) and patient W (methylated DNA in tumour) tumour sample (2AC) which was unmethylated across were processed and stained using antibodies against GSTP1-1 as the GSTP1 core promoter region expressed GSTP1-1 described in Materials and methods Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1321 in the tumour cells at a level similar to that in normal prostate tissue the GSTP1 CpG island is completely tissue (Figure 8). This is consistent with the previously unmethylated. However, beyond the CpG island observed correlation between methylation at the region, from intron 4 to the 3' end of the GSTP1 restriction enzyme sites in promoter region of the gene, extensive methylation occurs in both normal and GSTP1 gene and silencing of its expression (Lee et al., prostate cancer tissues. 1994). Though GSTP1-1 expression was immunologi- We sequenced up to 82 consecutive CpG sites in the cally detectable in the 2AC tumour sample, enzymatic 1 kb CpG island region and found that the LNCaP activity has not been demonstrated, and the possibility prostate cell line, that does not express GSTP1-1, was that the expressed protein is an inactive mutated form fully methylated at essentially all 82 CpGs. Hyper- has not been excluded. methylation was found in both the top and bottom strands of the DNA. Similarly we found that of the six prostate cancer tissues we sequenced, ®ve samples were Non-CpG methylation in tumour DNA extensively methylated across the 82 CpG sites in the We have previously demonstrated that mammalian CpG island, while the matched normal prostate cells have the capacity to maintain methylation at samples were completely unmethylated. Beyond the CpNpG sites in addition to the much more extensively CpG island region spanning a further 2 kb downstream characterized and studied CpG dinucleotide (Clark et we found complete methylation at all CpG sites al., 1995). Sequencing of the tumour and cell line DNA sequenced in both the cancer and matched normal samples disclosed a level of non-CpG methylation that samples. Methylation outside the CpG island region was signi®cantly higher than the low-level random represents the normal state of the gene and appears to background of non-conversion or Genescan artefacts play no role in the regulation of GSTP1 expression. that give rise to apparent cytosine peaks (approxi- Overall the methylation pattern within individual mately 5 ± 10% by Genescan analysis). Because of cancer samples was largely consistent at each of the potential localized non-conversion we only scored a CpG sites examined. However, within the promoter cytosine as methylated if (i) the C/C+T ratio was 20% regions speci®c CpG sites were evident that were either or greater in Genescan analysis, (ii) the sequenced unmethylated or methylated to a much lower degree region was shown to convert eciently in other DNA than surrounding methylated sites. These include CpG samples and (iii) methylation at the same non-CpG sites 722 and 723 (XC), CpG 719 and CpG 720 sites was shown on repeat bisulphite reactions. Using (PC3 lines, XC and WC), CpG 714 (PC3, XC and these parameters non-CpG methylation was particu- WC), CpG 24 (PC3-M and PC3-MM2, CC) and CpG larly notable for DNAs which were essentially fully 25 (LNCaP, PC3-MM2, CC). Undermethylation at CpG methylated, such as the LNCaP cell line and these sites may re¯ect binding by speci®c proteins in primary tumour tissue samples, WC and XC. More- these regions, thus protecting the DNA from the action over the non-CpG methylation was speci®cally limited of DNA methyltransferase. It is also possible that some to CpNpG sites, predominantly at CpCpG sites where of these TpG (i.e. apparently unmethylated) sites could both the outer and inner cytosines residues were arise through genomic mutation of C to T which is methylated. A typical example is shown in Figure 3b greatly enhanced for methylated cytosines. However and f where approximately 30% of the outer C and such C to T mutations at CpG sites should lead to the 70% of the inner C (LNCaP DNA) or 30 and 50% appearance of CpA dinucleotides on the opposite respectively (BC DNA) at the CCG site corresponding strand, but there was no clear evidence of such to CpG site 721 showed methylation. Of interest is the mutations in the samples we studied.. The pro®le of ®nding of outer C methylation (30%) at the CpCpG methylation of the GSTP1 CpG island in the prostate (CpG 75) on the lower strand of the Sp1 site in the cancer cells is similar to the methylation pro®le of the promoter region of tumour DNA from patient sample Rb gene in retinoblastoma tumours where extensive CC (data not shown). methylation of the Rb CpG island is observed with localized undermethylated CpG sites that varied between tumour samples (Stirzaker et al., 1997). Discussion Therefore it appears that it is the extent of methylation which is important for silencing the gene Previous studies using methylation-sensitive restriction and not the speci®c CpG sites which are methylated enzymes demonstrated hypermethylation in prostate within the promoter region. cancer of CpG sites in the promoter region of the Immunostaining showed that extensive methylation GSTP1 gene (Lee et al., 1994). In order to determine if across the CpG island region correlated with loss of cancer-speci®c methylation was limited to speci®c CpG GSTP1-1 expression in the cancer tissue whereas residues or spread throughout the CpG rich promoter GSTP1-1 expression correlated with this region being region we undertook a detailed study of the completely unmethylated. The data are consistent with methylation pro®le of 131 CpG sites across the the original demonstration of loss of GSTP1-1 GSTP1 gene, encompassing the CpG rich promoter expression and methylation of speci®c promoter sites region, the body of the gene and 3' untranslated region. in a high proportion of prostate cancers (Lee et al., Our results show that not only is hypermethylation of 1994) and subsequent papers demonstrating loss of the GSTP1 promoter a common event in prostate expression by immunohistochemistry in 490% of cancer but that the cancer speci®c methylation is prostate cancers (Cookson et al., 1997; Moskaluk et extensive on both alleles of the gene and encompasses al., 1997). Loss of GSTP1-1 expression has previously the entire CpG island region spanning approximately been reported in low grade and stage prostate cancer 1 kb from the promoter region and across exons 1 ± 3 and even in pre-cancerous PIN (prostatic intra- of the GSTP1 gene. Moreover, we ®nd that in normal epithelial neoplasia) lesions. Among the tumour Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1322 samples we analysed, methylation of the GSTP1 gene mutation, might otherwise be expected to occur with was not detected in DNA of patient 2A. The Gleason signi®cant frequency. score of this tumour was 8 (4+4) while the Gleason In other methylation processes, such as X-inactiva- scores ranged from 4 ± 7 for the other patients where tion, early development and methylation of integrated the gene was methylated and silenced. Thus lack of adenoviral genomes, methylation is ®rst seen at a methylation of GSTP1 is not indicative of early stage limited number of sites and there is a progressive cancer; a similar lack of correlation with tumour grade expansion of the region methylated (Tommasi et al., was found by Cookson et al. (1997). It is possible that 1993, Warnecke et al., 1998a, b; Toth et al., 1990). tumours with an unmethylated GSTP1 gene represent a Recent studies of the E-cadherin gene have demon- di€erent class of prostate cancer and it would be strated a progressive incursion of methylation into the interesting to follow their outcome. promoter CpG island region from an upstream, Apparent methylation or lack of bisulphite conver- methylated Alu repeat sequence (Gra€ et al., 1997). sion also was consistently observed in this study at non Alu repeats were also noted in this report upstream of CpG sites, speci®cally at CpNpG sites; the most the GSTP1 CpG island but we have found no Alu common site of this CpNpG methylation being the repeats at the downstream CpG island boundary (data CpCpG trinucleotide. Of particular interest was the not shown). In addition, there was no obvious ®nding of methylation of the outer cytosine in the progression of methylation observed in the prostate triplet CpGpG in the Sp1site in LNCaP and BC DNA. cancer tissues we examined, however because of the We have previously shown that such a methylation elapsed time between the initial methylation events and pro®le can inhibit Sp1 from binding and suggested that isolation of the tumour samples it is dicult to this may be a mechanism to initiate hypermethylation distinguish whether a process of gradual methylation of CpG islands which are normally protected from spreading has occurred or whether the widespread methylation (Clark et al., 1997). The elevated level of methylation observed in the tumour cell DNA was non-CpG methylation in tumour DNA samples could established as a primary event. The investigation of the be dependent on the high level of CpG methylation in methylation pro®le in PIN lesions should help to the GSTP1 CpG island or alternatively may re¯ect a clarify how early the broad methylation of the CpG loss of control or speci®city of the methylation process island of the GSTP1 gene occurs and how closely the in the cancer cells. Evidence is accumulating that a loss loss of expression and promoter methylation are of normal regulation of DNA methylation (both de coupled. novo and maintenance activities) is common in cancer This detailed study of the methylation pro®le of the (Stirzaker et al., 1997; Baylin et al., 1998). Gross GSTP1 gene in both normal and prostate tissue has changes include extensive changes in regional levels of demonstrated that extensive hypermethylation of the methylation (both increased and decreased) (Laird and GSTP1 CpG island region is a common and Jaenisch, 1994) as well as elevated levels of DNA apparently early event in prostate cancer. Moreover methyltransferase (Melki et al., 1998; Lee et al., 1996). both copies of the GSTP1 gene appear to be silenced It has also recently been reported that colon cancer cell by methylation making this gene a unique target for lines can be grouped into two classes which di€er in the early detection of prostate cancer cells and for their capacity to methylate introduced retroviral potential therapy aimed at speci®c demethylation of genomes (Lengauer et al., 1997) this has been the GSTP1 gene. interpreted to indicate that while defects in mismatch repair systems are critical early events leading to cancer development, alterations to the regulation of DNA methylation may provide an alternate route. Materials and methods It is not clear whether the loss of GSTP1-1 expression has a causative role in prostate cancer Tumour samples and DNA isolation progression. Cookson et al. (1997) raise the possibility Fresh tumour tissue was isolated from un®xed tissue of that loss of GSTP1-1 expression may be a normal part patients undergoing radical prostatectomy. Slices about of di€erentiation of epithelial cells from which cancer 4 mm thick were snap frozen in liquid nitrogen and arises and not directly associated with cancer develop- histology was performed on adjacent slices to identify ment. Our sequencing data of normal prostate tissue regions of tumour and normal tissue. Samples from regions indicates, however, that this loss of expression in identi®ed as cancer and grossly normal tissue were isolated from the frozen slice using a punch and ground into a normal di€erentiation of epithelial cells is not powder under liquid nitrogen using a mortar and pestle. accompanied by promoter methylation. Since GSTP1- DNA was isolated using TrizolTM reagent (Gibco/BRL) 1 has an important role in the conjugation and according to the manufacturer's protocols. DNA was detoxi®cation of potential carcinogens it was proposed further treated with RNase A followed by proteinase K (Lee et al., 1994) that early loss of GSTP1-1 expression before phenol extraction and ethanol precipitation. could lead to increased susceptibility to carcinogens, Because of uncertainties in alignment of the cancer region promoting mutation and cancer development. It is also in adjacent slices of fresh tissue, further samples were possible that loss of expression is a bystander e€ect of obtained from formalin-®xed, paran-embedded tissue some other critical event in prostate cancer develop- (three samples, patients 2A, X and W). For this material, ment, such as methylation of a broader chromosomal the cored tissue (5 mm punches) from the grossly cancerous region and matched normal tissue from the same block were region or loss of a transcription factor which is trimmed of excess wax and placed in 5.6 M guanidinium necessary for maintenance of GSTP1-1 expression. hydrochloride, 0.5 M ammonium acetate, 1.3% sarkosyl, Silencing of both copies of the GSTP1 gene by DNA 50 mM proteinase K (Sigma), 100 mg/ml yeast tRNA. The methylation provides support for this latter hypothesis, samples were thoroughly homogenized with disposable 1.5 ml since silencing by other mechanisms, gene deletion or pestles and left for 48 h at 608C. After incubation the samples Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1323 were again homogenized, vortexed and spun in a microfuge bisulphite-treated genomic DNA, 200 mM of each of the for 2 min to pellet the cell debris. The supernatant was four dNTPs, 6 ng/ul of each of the primers, 1 ± 2 mM removed into a clean tube, phenol:chloroform extracted, MgCl2, 2 units AmpliTaq DNA polymerase (Perkin ethanol precipitated and resuspended in 50 mlof10mM Tris/ Elmer), and reaction bu€er consisting of 67 mM Tris/ 0.1 mM EDTA. Prior to DNA extraction, 5 mM sections from HCl, 16.6 mM ammonium sulphate, 1.7 mg/ml bovine the paran tissues were taken from the top and bottom of serum albumin and 10 mM B-mercaptoethanol in TE the cored sample for immunohistochemical analysis of bu€er (10 mM Tris/HCl [pH 8.8], 0.1 mM EDTA). The GSTP1-1 expression. strand-speci®c nested primers used for ampli®cation of DNA from the prostate tumour cell lines LNCaP, Du145, bisulphite-treated DNA are indicated in Table 1. The PC3 (ATCC) and PC3-M and PC3-MM2 (two metastatic cell primer sets ampli®ed methylated and unmethylated line derivatives of PC3) was prepared as previously described sequences without signi®cant PCR bias when tested on (Clark et al., 1995). control DNA, methylated to de®ned levels, as described in Warnecke et al. (1997). The location of the primers is indicated according to the GSTP1 sequence (GenBank Methylation analysis Accession number M24485). Bisulphite reaction conditions The bisulphite reaction was Direct PCR sequencing and quantitative genescan analysis carried out on 1 ± 2 mgofHindIII digested DNA for 16 h at For automated direct sequencing and Genescan analysis 558C under conditions described in Clark et al. (1994). The PCR products were reampli®ed using Biotinylated/M13 samples were puri®ed using Wizard DNA Clean-Up tailed primer pairs (Table 2). PCR ampli®cations and the System desalting columns (Promega), eluted in 50 mlof magnetic bead puri®cation of the biotinylated PCR H O and incubated with 5 mlof3M NaOH for 15 min at 2 products were performed as described in Paul and Clark 378C. The solutions were neutralized by addition of (1996). The direct PCR sequencing reactions were NH OAc, pH 7, to 3 M and the DNA was ethanol 4 performed using a PRISM Sequenase Dye Primer precipitated, dried, resuspended in 50 mlTE[10m Tris- M Sequencing Kit (PE/ABI) on an automated 373A DNA HCl (pH 8), 0.1 m EDTA] and stored at 7208C. M Sequencer (ABI). For quantitation by Genescan, the FAM PCR ampli®cation and primers PCR ampli®cations were M13(-21) Dye Primer (blue) was used for both C and T performed in 50 ml reaction mixtures containing 2 mlof sequencing reactions (or G and A reactions). Master mixes

Table 1 PCR primers used on bisulphite-treated DNA PCR Primer Primer Sequencea Product Annealb Genomicc # Strand name type 5'?3' size (bp) 8C position 1 Top GST-9 Outer TTTGTTGTTTGTTTATTTTTTAGGTTT 346 45/50 967 ± 993 GST-11 Inner GGGATTTGGGAAAGAGGGAAAGGTTT 307 45/50 999 ± 1025 GST-12 Inner ACTAAAAACTCTAAACCCCATCCC 307 45/50 1280 ± 1303 GST-10 Outer AACCTAATACTACCTTAACCCCAT 346 45/50 1304 ± 1329 1b Bottom GST-B1 Outer AATCCTCTTCCTACTATCTATTTACTCCCTAAA 387 50/55 958 ± 990 GST-B2 Inner AAAACCTAAAAAAAAAAAAAAAACTTCCC 314 50/55 999 ± 1027 GST-B3 Inner TTGGTTTTATGTTGGGAGTTTTGAGTTTT 314 50/55 1285 ± 1313 GST-B4 Outer TTTTGTGGGGAGTTGGGGTTTGATGTTGT 387 45/50 1317 ± 1345 2 Top GST-13 Outer GGTTTAGAGTTTTTAGTATGGGGTTAATT 691 45/50 1287 ± 1315 GST-14 Inner TAGTATTAGGTTAGGGTTTT 603 45/50 1318 ± 1337 GST-15 Inner AACTCTAACCCTAATCTACCAACAACATA 603 45/50 1920 ± 1892 GST-16 Outer CAAAAAACTTTAAATAAACCCTCCTACCA 691 45/50 1978 ± 1950 3 Top GST-30 Outer GTTTTGTGGTTAGGTTGTTTTTTAGGTGTTAG 340 55/60 2346 ± 2376 GST-31 Inner GTTTTGAGTATTTGTTGTGTGGTAGTTTTT 265 40/45 2381 ± 2416 GST-32 Inner TTAATATAAATAAAAAAAATATATTACAA 265 40/45 2617 ± 2646 GST-33 Outer CAACCCCCAATACCCAACCCTAATACAAATACTC 340 55/60 2653 ± 2686 4 Top GST-26 Outer GGTTTTAGTTTTTGGTTGTTTGGATG 347 50/55 3845 ± 3869 GST-27 Inner TTTTTTTGTTTTTAGTATATGTGGGG 287 50/55 3874 ± 3899 GST-28 Inner ATACTAAAAAAACTATTTTCTAATCCTCTA 287 50/55 4161 ± 4132 GST-29 Outer CCAAACTAAAAACTCCAAAAAACCACTAA 347 50/55 4192 ± 4164 aBold letters indicate primer bases corresponding to cytosine/uracil conversions; bAnnealing temperature for cycles 1 ± 5/6 ± 25 respectively; cGenbank accession no. M24485

Table 2 PCR primers used for direct quantitative DNA sequencing of PCR products PCR Primer Primer Product Annealb Genomicc # Strand name type Sequencea 5'?3' size (bp) 8C position 1 Top GST-11 M13 TGTAAAACGACGGCCAGTGGGATTTGGGAAAGAGGGAA 307 45/50 1003 ± 1026 GST-12 Biotin BioACTAAAAACTCTAAACCCCATCCC 307 45/50 1288 ± 1313 1b Bottom GST-B2 M13 TGTAAAACGACGGCCAGTTGTTGGGAGTTTTGAGTTTT 314 50/55 999 ± 1027 GST-B3 Biotin BioAAAACCTAAAAAAAAAAAAAAAACTTCCC 314 50/55 1285 ± 1313 2 Top GST-14 M13 TGTAAAACGACGGCCAGTTAGTATTAGGTTA 603 45/50 1317 ± 1337 GST-15 Biotin BioAACTCTAACCCTAATCTACCAACAACATA 603 45/50 1920 ± 1892 3 Top GST-31 M13 TGTAAAACGACGGCCAGTGTTTTGAGTATTTGTTGTG 265 55/60 2381 ± 2410 GST-32 Biotin BioTTAATATAAATAAAAAAAATATATTTTACAA 265 55/60 2617 ± 2646 4 Top GST-27 M13 TGTAAAACGACGGCCAGTGTTTTTAGTATATGTGG 287 50/55 3874 ± 4132 GST-28 Biotin BioATACTAAAAAAACTATTTTCTAATCCTCTA 287 50/55 4161 ± 4164 aBold letters indicate primer bases corresponding to cytosine/uracil conversions. The M13 tail is underlined. bAnnealing temperature for cycles 1 ± 5/6 ± 25 respectively. cGenbank accession no. M24485 Methylation analysis of GSTP1 in prostate cancer DS Millar et al 1324 were prepared and sequencing reactions were performed as speci®c protein binding was blocked by 0.03% casein/ described in Paul and Clark (1996). Version 1.2 ± 2.1 of 0.05% Tween 20/PBS for 30 min at room temperature. The Genescan 672 Analysis Software (PE/ABI) was used to sections were incubated with primary rabbit anti-human preprocess the sequence gel ®le into Genescan format and GSTP1-1 polyclonal antibody (1 : 100 in 1% BSA/PBS) analyse the results data. The electrophoretograms show C overnight at 48C.Thesectionswerethenwashedin0.03% and T tracks superimposed and the blue colour of T tracks casein bu€er followed by incubation with secondary goat are altered to red to distinguish the peaks. The per cent anti-rabbit biotinylated antibody (Vector) at a concentra- methylation is calculated using peak height of C versus tion of 1 : 150 in PBS and the samples incubated for a peak height of C plus peak height of T for each position. further 40 min at room temperature. The sections were then washed in 0.03% casein bu€er as before and the tissue distribution of GSTP1-1 was visualized by colour develop- Immunohistochemical analysis ment in 0.05% diaminobenzidine/0.01% H2O2/PBS for Immunohistochemistry was performed on 4 mM sections cut 3 min (DAB, Sigma). Finally the sections were washed in from matched tissue cored from the normal and cancerous water, counterstained in haematoxylin, dehydrated in a regions of the paran block of each patient. Immunohis- series of alcohol washes and cleared in xylene. tochemical analysis was also carried out on the LNCaP and PC-3 cell lines. Sections of the paran embedded tissues were cut and placed on Superfrost Plus slides to dry Acknowledgements at 458C for 30 min. The sections were dewaxed in PC3 cell lines were kindly provided by Dr C Pettaway, MD Histochoice Clearing Agent (Amresco) and rehydrated in Anderson Medical Center. We thank Dr P Katelaris, S a graded series of alcohol washes down to water. Danieletto and A Lochhead for support in obtaining Endogenous peroxidase activity was quenched in 1.5% prostate tissue samples. This work has been supported by

H2O2/PBS for 10 min followed by washing in water. Non- a grant from the NSW Cancer Council. (RG/44/96).

References

Batist G, Tulpule A, Sinha B, Katki AG, Meyers CE and Melki JR, Warnecke P, Vincent PC and Clark SJ. (1998). Cowan KH. (1986). J. Biol. Chem., 261, 15544 ± 15549. Leukemia, 12, 311 ± 316. Baylin SB, Herman JG, Gra€ JR, Vertino PM and Issa J-P. Mo€at GJ, McLaren AW and Wolf CR. (1996). J. Biol. (1998). In: Advances in Cancer Research, Volume 72. Chem., 271, 1054 ± 1060. Vandewoude G and Klein G (eds). Academic Press: San Morrow CS, Cowan KH and Goldsmith ME. (1989). Gene, Diego, pp. 141 ± 196. 75, 3 ± 11. Clark S J and Frommer M. (1995).In: DNA and Nucleopro- Moskaluk CA, Duray PH, Cowan KH, Linehan M and tein Structure In Vivo. Saluz H and Wiebauer K (eds). RG Merino MJ. (1997). Cancer, 79, 1595 ± 1599. Landes Company: Austin, Texas, pp. 123 ± 132. Mulder TPJ, Verspaget HW, Sier CFM, Roelofs HMJ, Clark SJ, Harrison J and Frommer M. (1995). Nat. Genet., Ganesh S, Grioen G and Peters WHM. (1995). Cancer 10, 20 ± 27. Res., 55, 2696 ± 2702. Clark SJ and Frommer, M. (1997). In: Laboratory Methods Paul CL and Clark SJ. (1996). BioTechniques, 21, 126 ± 133. for the detection of mutations and polymorphisms in DNA. Peters WHM, Wornskamp NGM and Theis E. (1990). Taylor G (ed.). CRC Press: New York, pp. 151 ± 162. Carcinogenesis, 11, 1593 ± 1596. Clark SJ, Harrison J and Molloy PL. (1997). Gene, 195, 67 ± Pettaway CA, Pathak S, Greene G, Ramirez E, Wilson MR, 71. Killion JJ and Fidler IJ. (1996). Clin. Cancer Res., 2, Clark SJ, Harrison J, Paul, CL and Frommer, M. (1994). 1627 ± 1636. Nucleic Acids Res., 22, 2990 ± 2997. Rushmore TH and Pickett CB. (1993). J. Biol. Chem., 268, Cookson MS, Reuter VE, Linkov I and Fair WR. (1997). J. 11475 ± 11478. Urol., 157, 673 ± 676. Schmutte C, Yang AS, Nguyen TT, Beart RW and Jones PA. Cowell IG, Dixon KH, Pemble SE, Ketterer B and Taylor (1996). Cancer Res., 56, 2375 ± 2381. JB. (1988). Biochem. J., 255, 79 ± 83. Smith JR, Freije D, Carpten JD, Gronberg H, Xu JF, Isaacs Gra€ JR, Herman JG, Myohanen S, Baylin SB and Vertino SD, Brownstein MJ, Bova GS, Guo H, Bujnovszky P, PM. (1997). J. Biol. Chem., 272, 22322 ± 22329. Nusskern DR, Damber JE, Bergh A, Emanuelsson M, Hayes JD and Pulford DJ. (1995). Crit.Rev.Biochem.Mol. Kallioniemi OP, Walkerdaniels J, Baileywilson JE, Beaty Biol., 30, 445 ± 600. TH, Meyers DA, Walsh PC, Collins FS, Trent JM and Isaacs WB, Bova SG, Morton RA, Bussemakers MJG, Isaacs WB. (1996). Science, 274, 1371 ± 1374. Brooks JD and Ewing CM. (1995). Cancer Surveys, 23, Stirzaker C, Millar DS, Paul CL, Warnecke PM, Harrison J, 19 ± 31. Vincent PC, Frommer M and Clark SJ. (1997). Cancer Ishioka C, Kanamaru R, Shibata H, Konishi Y, Ishikawa A, Res., 57, 2229 ± 2237. Wakui A, Sato T and Nishihira T. (1991). Cancer, 67, Stoger R, Kajimura TM, Brown WT and Laird CD. (1997). 2560 ± 2564. Hum. Mol. Genet., 6, 1791 ± 1801. Jones PA, Rideout WM, Shen J-C, Spruck CH and Tsai C. Tommasi S, LeBon JM, Riggs AD and Singer-Sam J. (1993). (1992). Bioessays, 14, 33 ± 36. Somat. Cell Mol. Genet., 19, 529 ± 541. Knudson JAG. (1986). Annu. Rev. Genet., 20, 231 ± 251. Toth M, MuÈ ller U and Doer¯er W. (1990). J. Mol. Biol., 214, Laird PW and Jaenisch R. (1994). Hum. Mol. Genet., 3, 673 ± 683. 1487 ± 1495. Wang X, Pavelic ZP, Li Y, Gleich L, Gartside PS, Pavelic L, Lengauer C, Kinzler KW and Vogelstein B. (1997). Proc. Gluckman JL and Stambrook PL. (1997). Clin. Cancer Natl. Acad. Sci. USA, 94, 2545 ± 2550. Res., 3, 111 ± 114. Lee WH, Morton RA, Epstein JI, Brooks JD, Campbell PA, Warnecke PM, Stirzaker C, Melki JR, Millar DS, Paul CL Bova GS, Hsieh W-S, Isaacs WB and Nelson WG. (1994). and Clark SJ. (1997). Nucl. Acids Res., 25, 4422 ± 4426. Proc. Natl. Acad. Sci. USA, 91, 11733 ± 11737. Warnecke PM, Biniszkiewicz D, Jaenisch R, Frommer M LeePJ,WasherLL,LawDJ,BolandCR,HoronILand and Clark SJ. (1998a). Dev.Genet., 22, 111 ± 121. Feinberg AP. (1996). Proc. Natl. Acad. Sci. USA, 93, Warnecke PM, Mann J, Frommer M and Clark S. (1998b). 10366 ± 10370. Genomics, 51, 182 ± 190.