LC–MS Based Assay to Measure Intracellular Compound Levels in Mycobacterium Smegmatis: Linking Compound Levels to Cellular Potency☆

Journal of Microbiological Methods 94 (2013) 152–158

Contents lists available at SciVerse ScienceDirect

Journal of Microbiological Methods

journal homepage: www.elsevier.com/locate/jmicmeth

LC–MS based assay to measure intracellular compound levels in Mycobacterium smegmatis: Linking compound levels to cellular potency☆

Jyothi Bhat, Ashwini Narayan, Janani Venkatraman, Monalisa Chatterji ⁎

AstraZeneca India Pvt Ltd., Bellary Road, Hebbal, Bangalore 560024, India article info abstract

Article history: Dihydrofolate reductase (DHFR) plays a central role in maintaining cellular pool of tetrahydrofolic acid, a Received 11 March 2013 cofactor necessary for DNA, RNA and protein synthesis. The clinical validation of DHFR as antibacterial target Received in revised form 7 May 2013 was established by the success of trimethoprim (TMP). DHFR is also an attractive target for identifying Accepted 14 May 2013 anti-tuberculosis molecules however, due to observed weak cellular potency, no DHFR inhibitors have Available online 6 June 2013 been developed as drugs so far. TMP and its analogs have poor cellular potency on Mycobacterium tuberculosis and Mycobacterium smegmatis cells. We found a mutant strain of M. smegmatis,mc2155 to be sensitive to TMP Keywords: Permeability whereas wild type strain was not inhibited by TMP. We utilized this system to probe if poor or lack of activity Anti-infective agents of TMP is a consequence of poor intracellular compound levels. An LC–MS based method was developed for Antibiotic accumulation measuring TMP and rifampicin (RIF) in M. smegmatis. Using the assay, equivalent RIF levels were observed in Antimicrobial susceptibility both strains however, TMP was detected only in mc2155 cells, hence proving a positive correlation between Antimycobacterial agents potency and compound levels. To the best of our knowledge this is the ﬁrst time LC–MS method has been used to measure compound levels in mycobacterial cells. We propose it to be a valuable tool to understand the lack of potency or resistance mechanisms in antimycobacterial drug development. © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

1. Introduction class of therapeutic compounds, as evidenced by their use as anti- infective, anti-neoplastic, and anti-inﬂammatory drugs. Reduced folate cofactors are required for the synthesis of a variety DHFR is a very well-conserved protein, yet sufﬁciently divergent to of metabolites essential for cell viability. Most species can synthesize permit inhibitors that selectively target bacterial enzymes over mam- folates de novo while higher vertebrates and some bacteria are also malian. Indeed, DHFR was discovered as a result of the search for the able to utilize external preformed folates via the salvage pathway. therapeutic target of methotrexate, an anticancer drug (Huennekens, De novo synthesis of tetrahydrofolic acid starting from guanosine 1996). Trimethoprim, an important antibiotic, binds to bacterial triphosphate requires six enzymatic reactions (Hawser et al., 2006). DHFRs >100 fold tighter than it does to vertebrate DHFRs (Burchall Dihydrofolate reductase (DHFR) catalyzes conversion of dihydrofolate and Hitchings, 1965). The antimalarial agent pyrimethamine targets to THF and plays a central role in the maintenance of cellular pools of DHFR from Plasmodium falciparum (Appleman et al., 1988) but binds THF and its derivatives. THF is essential for purine and thymidylate weakly to mammalian enzyme. These species-selective agents exploit synthesis hence, for cell growth and proliferation. It has been shown the differences in the active site regions of the enzymes (Li et al., that mutant cells that completely lack DHFR require glycine, a purine 2000). Diaminopyrimidines e.g. TMP, brodimoprim, epiroprim, iclaprim and thymidine to grow (Ahmad et al., 1998; Urlaub and Chasin, are potent inhibitors of bacterial DHFR. In the mid-1970s TMP was used 1980). Inhibition of DHFR underlies the mechanism of action of several as monotherapy to treat urinary tract infections: however, it has been antibacterial, antimalarial and anticancer agents, such as methotrexate, used in combination with sulfamethaxazole (Dihydropteroate synthase trimethoprim, pyrimethamine (Appleman et al., 1988; Burchall and (DHPS) inhibitor) for the last three decades for the treatment of 23Hitchings, 1965; Gorlick and Bertino, 1999; Huennekens, 1996; uncomplicatedformsofurinarytractinfectionsaswellasprophylaxis Olliaro, 2000). The folate antagonists have proved to be an important and treatment of Pneumocystis carinii pneumonia in HIV patients (Kielhofner, 1990). Iclaprim is presently in phase III clinical development for skin and soft tissue infections. DHFR and other enzymes of the folate pathway are well conserved ☆ This is an open-access article distributed under the terms of the Creative Commons in Mycobacterium tuberculosis and other members of mycobacterial Attribution-NonCommercial-No Derivative Works License, which permits non-commercial genus. DHFR is an essential gene in M. tuberculosis, as well as, in use, distribution, and reproduction in any medium, provided the original author and source Mycobacterium smegmatis. However, no DHFR inhibitors have been are credited. ⁎ Corresponding author. Tel.: +91 806 621 3000; fax: +91 802 362 1213. developed for tuberculosis therapy. Obtaining potent cellular activity E-mail address: [email protected] (M. Chatterji). has been the challenge associated with DHFR inhibitors (Suling et al.,

0167-7012/$ – see front matter © 2013 The Authors. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.mimet.2013.05.010 J. Bhat et al. / Journal of Microbiological Methods 94 (2013) 152–158 153

1998). Among diaminopyrimidines, epiroprim shows weak activity was performed using Agilent-1200series HPLC system (Agilent Technol- against M. tuberculosis (Dosso et al., 2001) and interestingly was ogies Inc., Santa Clara, USA) equipped with a temperature-controlled found to be synergistic in combination with INH in vitro. Epiroprim 96-well-plate autosampler. Mass spectrometry was performed using Ac- along with brodimoprim and dapsone (inhibitor of dihydropteroate curate Mass Q-TOF 6520 from Agilent (Agilent Technologies Inc., Santa synthetase) has significant activity on Mycobacterium leprae (Dhople, Clara, USA). 1999). Epiroprim also shows activity against Mycobacterium avium and Mycobacterium ulcerans, other pathogenic members of the myco- 2.2. Bacterial strains and growth bacterial genus (Dhople, 2000; Locher et al., 1996). WR99210, a triazine DHFR inhibitor has been reported to have significant in vitro activity M. smegmatis mc2155 and M. smegmatis ATCC607 strains were against M. tuberculosis (Gerum et al., 2002) however, under our exper- grown in Middlebrook 7H9 broth (BD Diagnostics, Sparks, MD) imental conditions the activity was found to be weak (data not shown). containing 10% ADC (Albumen-Dextrose-Catalase), 0.2% glycerol, and A recent HTS campaign identified NC00094221, a diaminoquinazoline 0.05% Tween 80 at 37 °C. Cloning and plasmid preparations were which inhibits M. tuberculosis DHFR activity and has MIC of 207 μM performed in Escherichia coli DH5α. Kanamycin was used for selection for wildtype laboratory strain H37Rv (Kumar et al., 2012). The weak at a concentration of 20 μg/ml. cellular potency of DHFR inhibitors might be due to lack of sufficient intracellular drug concentration or due to DHFR/folate biosynthesis path- 2.3. Cloning of M. tuberculosis dhfr gene in pMV261 way being less vulnerable. In this study, we want to understand if weak cellular activity is related to compound levels in the cell. M. smegmatis M. tuberculosis DHFR over-expression construct was generated mc2155 sensitivity to TMP provided us with a model system to address by amplifying the dhfr gene (500 bp in length) using the primers this question. Tdfr261F/Tdfr261R (Primer sequences are: Tdfr261F—ATCTGAATTCA Originally M. smegmatis mc2155 was identified as a high transforming TGGTGGGGCTGATC and Tdfr261R—AGATAAGCTTTCATGAGCGGTGGT mutant strain derived from the WT M. smegmatis (Snapper et al., 1990). AGCTG). M. tuberculosis genomic DNA was used as the template and Subsequent study demonstrated that the strain has changes in the cell high fidelity Taq DNA polymerase (Phusion, Finnzyme) was used for envelop namely, lack of polar glycolipids and differences in distribution amplification. The PCR fragment was cloned in pMV261 (EcoRI– of phospholipids and glycolipids among outermost and deeper layers HindIII sites) under the control of the Hsp60 constitutive promoter of cell envelope (Etienne et al., 2005). It is not absolutely established to obtain pBAN0406. The sequence of the cloned dhfr gene was whether the changes in cell envelope are responsible for high transfor- confirmed by sequencing (Microsynth, Switzerland). Vector pMV261 mation and other phenotypes e.g. smooth phenotype, lack of clumping and recombinant plasmid were transformed into M. smegmatis and greater uptake of chenodeoxycholate. The mechanism/s underlying mc2155 using electroporation (Wards and Collins, 1996). The strain these changes is/are not fully understood. over-expressing DHFR was used for MIC modulation studies. Most studies addressing compound accumulation in bacterial cells use either radioactive or fluorescent derivatives of the compounds. In 2.4. Minimal inhibitory concentration (MIC) measurement thisstudywehavedevelopedanLC–MS based assay to estimate the compound levels in cells. The assay provides the advantage of working MIC was determined by broth microdilution method and was with un-labeled molecule without compromising on sensitivity and defined as inhibitor concentration that led to >80% growth inhibition specificity. The LC–MS approach has not been reported previously with of the treated culture compared to untreated control. The experiment mycobacterial systems. A previous study with Pseudomonas aeruginosa was performed at cell densities of 105 cfu/ml and treated with various does use LC–MS assay (Cai et al., 2009) along with other methods. We drug concentrations in 96 well plates. The plates were incubated for have designed our assay to be more stringent with respect to discrimi- 72 h at 37 °C post drug treatment. The cell growth was monitored nating between non-specific compound binding to the cell versus by measuring absorbance at 600 nm. Control cultures were treated compound inside a cell. Using the assay we have demonstrated a positive with equivalent amount of DMSO as present in treated cultures. correlation between TMP potency and intracellular compound concentration. We believe that this assay will serve as a useful tool in under- 2.5. Preparation of cell extracts standing translation of enzyme inhibition to cellular potency, and resistance mechanisms. M. smegmatis mc2155 or ATCC607 were grown in 200 ml of media

in a 1 l flask with rotation at 200 rpm for 16 h. At OD600 of 0.3, the 2. Materials and methods culture was split into four different flasks (50 ml each in 250 ml flasks) namely — test, untreated control, wash control and process 2.1. Reagents control. Test flask was treated with the test compound and grown for another 4 h at 37 °C. Equal amount of DMSO was added for the All reagents and organic solvents were purchased from Sigma- untreated control, while equal amount of compound was added just Aldrich (St. Louis, MO. USA), except ammonium formate and acetoni- before harvesting for the wash control. At the end of 4 h treated trile which were purchased from Fluka and J.T.Baker respectively. cells and controls were harvested by centrifuging at 6000 g Gemini C-18 column (50 mm × 4.6 mm (5 mm × 110 Å)) was pro- for 10 min. Harvested cells were washed two times with 7H9 cured from Phenomenex Inc., Torrance, CA, USA. Reversed-phase HPLC media without ADC and once with Milli-Q-water. An equivalent

Table 1 MIC in Msm ATCC607, mc2155 and DHFR over-expression strains.

Compounds MIC (μg/ml)

Msm ATCC607 Msm mc2155 mc2155 + vector mc2155 + vector mc2155 + DHFR mc2155 + DHFR

Without Kan With Kan Without Kan With Kan

Trimethoprim >32–>256 4 4–84–8 >32 >32 Isoniazid 0.5–11–21–21–21–24 Rifampicin 16 4–84–84–88–16 8–16 154 J. Bhat et al. / Journal of Microbiological Methods 94 (2013) 152–158 concentration of compound (115 μg of TMP for both ATCC607 and overnight. Unlysed cell debris was removed by centrifuging at mc2155, 480 μg of RIF for ATCC607 and 240 μg of RIF for mc2155) 12500 g for 15 min. The supernatant was collected and 250 μlof was added just before extract preparation to the process control. water was added to every ml of the supernatant. This mixture was The washed cells were resuspended in 3 ml of methanol:chloroform: vortexed well, centrifuged at 12500 g for 20 min. The supernatant water (12:5:3), warmed at 65 °C for 20 min and stored at −20 °C was collected and dried using a vacuum manifold. The dried pellet

Fig. 1. LC–MS analysis of TMP and RIF treated cell extracts and controls. Extracted ion chromatogram contains TMP/RIF speciﬁc signals. A) Extracted ion chromatogram of TMP treated Msm mc2155 at m/z = 291–292. B) Extracted ion chromatogram of TMP treated Msm ATCC607 at m/z = 291–292. C) Extracted ion chromatogram of RIF treated Msm mc2155 at m/z = 823–824. D) Extracted ion chromatogram of RIF treated Msm ATCC607 at m/z = 823–824. In RIF treated extract in addition to RIF signal a small peak at RT = 8.14 was also observed. The ESI scan of this peak showed that it contained RIF signals along with signals corresponding to higher molecular mass (e.g. 923.43, 955.45, 977.44). These could not be attributed to any known adducts of RIF. J. Bhat et al. / Journal of Microbiological Methods 94 (2013) 152–158 155

Fig. 1 (continued). was re-dissolved in 300 μl of 10 mM ammonium formate (pH = 6.3) 2.6. Optimized LC–MS conditions for RIF and TMP and extracted with 600 μl of ethyl acetate. The organic layer was collected by centrifuging at 12500 g for 10 min and dried as before. The dried For analysis of TMP, an isocratic gradient with 10 mM ammonium pellets were reconstituted in HPLC buffer on the day of analysis. formate buffer (pH = 6.3) as mobile phase A and acetonitrile as 156 J. Bhat et al. / Journal of Microbiological Methods 94 (2013) 152–158 mobile phase B was used at a flow rate of 0.5 ml/min with a run time for the two strains served as a positive control for the assay. Prior to of 10 min. For RIF analysis, a binary gradient with 10 mM ammonium the estimation of cellular levels, TMP and RIF were subjected to formate (pH = 6.3) as solvent B and acetonitrile as solvent A was MS/MS and ESI fragmentation (TMP 291 > 230 and RIF 823.3 > 791) used. The gradient applied for separation was kept at 95% B for the to assess the fragmentation pattern. Under our experimental condi- first 2 min., and then decreased to 15% B in the next 8 min. This tions, TMP eluted at 4.6 min whereas RIF eluted at 8.6 min. Amount level was held for 5 min before increasing once again to 95% B during of TMP and RIF in the cell extracts was estimated using the standard the next 12 min. The flow rate was 0.5 ml/min with the run time of curve as described in Materials and methods section 2.6. 20 min. All the chromatographic measurements were performed at In every experiment, one culture was treated with the compound room temperature and the autosampler was maintained at 4 °C. The (10× of MIC concentrations for TMP or 5× of MIC concentrations for quantitation was achieved by MS detection in positive mode. The op- RIF) and continued to grow for another 4 h at 37 °C (test culture). timized MS parameters for TMP were — gas temperature of 350 °C, Untreated control, wash control and process control were processed gas flow of 8 l/min, and nebulizer gas pressure of 35 psi. Capillary in parallel. Wash control wherein equivalent amount of compound voltage was set at 3500 V, fragmentor voltage was 150 V, skimmer as test culture was added prior to harvesting, enabled estimation of voltage at 65 V and octopole RF peak voltage of 750 V. Data acquisi- the amount of drug non-specifically sticking to the cells post washing. tion range used was 200–500 m/z. For MS analysis of RIF, gas temper- While process control, wherein known amount of drug was added ature of 300 °C, gas flow of 10 l/min, and nebulizer gas pressure of after washing, enabled estimation of the relative recovery for each 40 psi was used. Capillary voltage was maintained at 3500 V, extraction. The approach of treating 107 cfu/ml cells with high dose fragmentor voltage was 150 V, skimmer voltage at 65 V and octopole of compound for a short duration (4 h) was followed to enable RF peak voltage of 750 V. For data acquisition, m/z range of 300–1000 detectable levels of compound, without triggering cell death. In com- was used. The lower limit of detection (S/N > 10) and lower limit of parison, MIC is determined by treating 105 cfu/ml cells for 72 h. quantitation (S/N > 30) was determined for both RIF and TMP. Representative chromatograms of various samples used in the Calibration curves were acquired by plotting the observed compound study are as shown in Fig. 1. For TMP, there were no significant concentration against the known concentration loaded. The concentra- drug levels in untreated controls and in wash controls showing that tions injected were in the range of 0.41–100 pmol for TMP and non-specific binding of the compound to the cells was minimal. In 8–125 pmol for RIF. The data was fitted to linear regression analysis. TMP treated M. smegmatis mc2155 extracts, the relative levels of Calibration curves were acquired by plotting the peak area against TMP was 11 fold higher compared to the wash control (Table 2). the nominal concentration of TMP and RIF using a linear plot. The Whereas in TMP treated ATCC607 cell extract, TMP could not be amount of drug present in the sample (x) was calculated using the detected. The treated and wash controls were comparable to formula Y = mx + C, where Y is the estimated concentration of the untreated sample (Fig. 2A). The process control behaved similarly drug, m is the slope of the calibration curve, C is a constant obtained for both strains with percentage recovery ranging from 1–6% for by the calibration curve. mc2155 and 1–13% for ATCC607. The scenario for RIF was different The criterion for accepting each back-calculated standard concen- from that of TMP, similar levels of the drug was found in treated tration was ±15% deviation from the known value and S/N ratio of cell extracts of both strains, in line with their equivalent MIC for more than 10. Limit of quantitation (S/N ratio of >30) of TMP is both strains (Fig. 2B). ~1.23 pmol and limit of detection (S/N ratio of >10) of TMP is Further to understand the kinetics of compound concentration in 0.41 pmol. For RIF both limit of quantitation and lower limit of detec- the cell, a time course study was performed by treating the cells tion was 8 pmol. with TMP for different durations (1, 2, and 4 h for mc2155; 4 and 8 h for ATCC607). Extract preparation and analysis of the extract 3. Results was done as above. Wash control, process control and untreated controls were used in each case. In the case of M. smegmatis mc2155 the 3.1. Potency of TMP on M. smegmatis strains amount of TMP steadily increased with the increase in time (Fig. 3). However, no TMP was detected in ATCC607 cells even 8 h post Antimicrobial activity of TMP was determined for two strains of treatment. M. smegmatis (ATCC607 and mc2155). MIC of TMP for M. smegmatis mc2155 was observed to be 4 μg/ml, while TMP was inactive on 4. Discussion ATCC607 strain. TMP is known to act by inhibition of DHFR enzyme, to confirm that DHFR is the target of TMP in M. smegmatis,andMICmodu- As reported in the literature, poor cellular activity was observed lation upon target over-expression was estimated. M. smegmatis mc2155 for diaminopyrimidines specifically TMP for mycobacterial strains. was transformed with the plasmid containing dhfr under the Hsp60 TMP did not show MIC against M. tuberculosis H37Rv (>256 μg/ml) constitutive promoter. MIC was estimated for M. smegmatis cells and M. smegmatis ATCC607 (>32 μg/ml). M. smegmatis mc2155, is transformed with vector or DHFR-expressing plasmid (Table 1). The an efficient plasmid-transformation (ept) mutant strain isolated MIC for M. smegmatis mc2155 containing vector was similar to the strain from wild-type ATCC607 (Snapper et al., 1990). As discussed above alone (4–8 μg/ml). However, the MIC for cells over-expressing DHFR in- the mutant strain was sensitive to TMP. M. smegmatis mc2155 has creasedbyatleast4fold(>32μg/ml) as compared to the vector control. been shown to have changes in the cell envelope specifically with re- The MIC values were not affected by the presence or absence of kanamy- spect to lipid composition of the cell envelope (Etienne et al., 2005). cin (Kan) in the media, kanamycin being the selection marker for the Taking the properties of M. smegmatis mc2155 into account, we over-expression plasmid. The MIC values for other inhibitors like isoniazid and RIF remained unaffected. The significant increase in MIC values for TMP in DHFR over-expressing strain indicates that TMP inhibits Table 2 DHFR in M. smegmatis. Amount of intracellular compounds detected. Amount of TMP Stdev Amount of RIF Stdev 3.2. TMP levels in M. smegmatis strains detected (pmol) detected (pmol) ATCC607 wash control 1.0 1.0 4.7 0.0 To understand the observed differential MIC of TMP between the ATCC607 treated 1 0.9 68 10.0 2 two strains of M. smegmatis, TMP was estimated in cell extracts of mc 155 wash control 2.0 2.9 0.5 0.0 mc2155 treated 23 8.4 68 14.0 treated and untreated cells by LC–MS. RIF, which has similar MICs J. Bhat et al. / Journal of Microbiological Methods 94 (2013) 152–158 157

A Compound accumulation for quinolones and fluoroquinolones has fl 80000000 been extensively studied using the uorescence method in various bacteria e.g. P. aeruginosa, Staphylococcus aureus, E. coli, Streptococcus 70000000 pneumoniae,andBacteroides fragilis. Quinolone and fluoroquinolone ac- 60000000 cumulation has also been established by modified fluorescence method 50000000 in mycobacterium (Piddock and Ricci, 2001; Williams et al., 1998). Above approaches involve washing of drug treated cells with buffer 40000000 prior to cell lysis. It has been considered that washing of cells with 30000000 buffer might lead to leaching of compound from the cell. An alternate 20000000 methodology which avoids washing the cell is the silicon oil method. Area under the curve In this method, the treated drug cells are centrifuged through silicon 10000000 oil (Moreau et al., 1984; Li et al., 1994). Published results wherein the 0 two methodologies were compared show that higher levels of RIF and Wash control TMP Treated Wash control TMP Treated fluoroquinolones were detected by silicon oil method (Williams and ATCC607 mc2155 Piddock, 1998; Williams et al., 1998). B An HPLC based method for detection of linezolid cellular levels in 80000000 E. coli, Citrobacter freundii and Enterobacter aerogenes has been reported (Schumacher et al, 2007). Further LC–MS based detection was carried 70000000 out for ciprofloxacin accumulation in P. aeruginosa and compared with fl 60000000 the radioactive and uorescence methods (Cai et al., 2009). The major advantage of LC–MS is that it allows estimation of non-radioactive 50000000 and non-fluorescent native molecule. Also, the sensitivity and specifici- 40000000 ty is retained due to the use of mass spectrometry. The sensitivity can further improved by using a well defined HPLC method and infusing 30000000 matrix-effect-free chromatogram for the analysis. In this study, we

Area under curve 20000000 have developed and used an LC–MS assay to detect TMP levels in M. smegmatis. We have also followed washing of drug treated cells 10000000 with buffer prior to lysis. In addition we have included a wash control 0 to estimate the extent of non-specific binding. The use of the method wash control RIF treated wash control RIF treated might be challenging for compounds a) that are highly potent hence, ATCC607 mc2155 intracellular levels below the limit of detection, b) that are metabolized in the cell c) that are undetectable due to poor ionization or d) that have Fig. 2. Levels of TMP (A) and RIF (B) in Msm extracts. The cells are treated with 10 unsolvable matrix interference. times MIC concentration for TMP and 5 times MIC concentration for RIF. The cells We propose that the assay can be used for understanding intracellu- fi were washed to remove the non-speci c inhibitors that may be binding to the cell. lar concentration of compounds; for addressing questions related to The intracellular concentration was measured by lysing the cells and quantitating the amount of inhibitor by LC–MS. The wash controls were included to assess the amount drug accumulation, lack of cellular potency and resistance mechanism. of non-specific drug binding to the bacterial cells. In the future, we will like to adapt the methodology to M. tuberculosis. This study using surrogate M. smegmatis provides the sound validation for using LC–MS based method to detect compound levels in the cell. hypothesized that mc2155 and its wild type ATCC607 strains could have different levels of TMP in the cells. Funding The reported approaches used for assessing intracellular compound concentrations are radioactively labeled compound (e.g. rifampicin and No funding of any kind has been received. This data has been nalidixic acid) (Mortimer and Piddock, 1991; Williams and Piddock, generated as part of the routine discovery work of AstraZeneca India 1998) or utilizing the intrinsic fluorescence of quinolones (Piddock et Pvt Ltd. al., 1999; Piddock and Johnson, 2002; Ricci and Piddock, 2000, 2003).

10000000 Acknowledgments

8000000 The authors thank Naina Hegde for providing DHFR over-expression construct, Parvinder Kaur for M. tuberculosis MIC determination exper- Msm mc2155 6000000 iments, Prabhakar KR and internal reviewers for valuable inputs during Msm ATCC 607 the manuscript preparation. 4000000 References 2000000

Area Under Curve Ahmad, S.I., Kirk, S.H., Eisenstark, A., 1998. Thymine metabolism and thymineless death in prokaryotes and eukaryotes. Annu. Rev. Microbiol. 52, 591–625. 0 Appleman, J.R., Prendergast, N., Delcamp, T.J., Freisheim, J.H., Blakley, R.L., 1988. Kinet- 2 4 6 8 10 ics of the formation and isomerization of methotrexate complexes of recombinant – -2000000 Time of treatment in hours human dihydrofolate reductase. J. Biol. Chem. 263, 10304 10313. Burchall, J.J., Hitchings, G.H., 1965. Inhibitor binding analysis of dihydrofolate reductases from various species. Mol. Pharmacol. 1, 126–136. 2 • Fig. 3. Time dependent increase in TMP levels in Msm extracts. Msm mc 155 ( ) were Cai, H., Rose, K., Liang, L.H., Dunham, S., Stover, C., 2009. Development of a liquid chromatog- ■ treated for 1, 2 and 4 h and Msm ATCC607 ( ) was treated for 4 and 8 h. The intracel- raphy/mass spectrometry-based drug accumulation assay in Pseudomonas aeruginosa. lular TMP concentration was plotted against the time of treatment. In the case of Anal. Biochem. 385, 321–325. 2 mc 155 the TMP levels increased with increase in time. The graph is extrapolated to Dhople, A.M., 1999. In vitro activity of epiroprim, a dihydrofolate reductase inhibitor, 8 h from the available data up to 4 h. In ATCC607 extract no signiﬁcant levels of TMP singly and in combination with brodimoprim and dapsone, against Mycobacterium was observed even after 8 h of treatment. leprae. Int. J. Antimicrob. Agents 12, 319–323. 158 J. Bhat et al. / Journal of Microbiological Methods 94 (2013) 152–158

Dhople, A.M., 2000. Antimicrobial activities of dihydrofolate reductase inhibitors, used Olliaro, P., 2000. Mode of action and mechanisms of resistance for antimalarial drugs. singly or in combination with dapsone, against Mycobacterium ulcerans.J.Antimicrob. Pharmacol. Ther. 89, 207–219. Chemother. 47, 93–96. Piddock, L.J.V., Johnson, M.M., 2002. Accumulation of 10 fluoroquinolones by wild-type Dosso, M., Ouattara, L., Cherif, A.M., Bouzid, S.A., Haller, L., Fernex, M., 2001. Experimen- or efflux mutant of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 46, tal in vitro efficacy study on the interaction of epiroprim plus isoniazid against 813–820. Mycobacterium tuberculosis. Chemotherapy 47, 123–127. Piddock, L.J.V., Ricci, V., 2001. Accumulation of five fluoroquinolones by Mycobacterium Etienne, G., Laval, F., Villeneuve, C., Dinadayala, P., Abouwarda, A., Zerbib, D., Galamba, A., tuberculosis H37Rv. J. Antimicrob. Chemother. 48, 787–791. Daffé, M., 2005. The cell envelope structure and properties of Mycobacterium Piddock, L.J.V., Jin, Y.F., Ricci, V., Asuquo, A.E., 1999. Quinolone accumulation by Pseudomonas smegmatis mc2155: is there a clue for the unique transformability of the strain? aeruginosa, Staphylococcus aureus and Escherichia coli. J. Antimicrob. Chemother. 43, Microbiology 151, 2075–2086. 61–70. Gerum, A.B., Ulmer, J.E., Jacobus, D.P., Jensen, N.P., Sherman, D.R., Sibley, C.H., 2002. Ricci, V., Piddock, L.J.V., 2000. Accumulation of norfloxacin by Bacteroides fragilis. Novel Saccharomyces cerevisiae screen identifies WR99210 analogues that inhibit Antimicrob. Agents Chemother. 44, 2361–2366. Mycobacterium tuberculosis dihydrofolate reductase. Antimicrob. Agents Chemother. Ricci, V., Piddock, L.J.V., 2003. Accumulation of garenoxacin by Bacteroides fragilis com- 46, 3362–3369. pared with that of five fluoroquinolones. J. Antimicrob. Chemother. 52, 605–609. Gorlick, R., Bertino, J.R., 1999. Clinical Pharmacology and Resistance to Dihydrofolate Schumacher, A., Trittler, R., Bohnert, J.A., Kümmerer, K., Pagès, J.M., Kern, W.V., 2007. Reductase Inhibitors. In: Jackman, A.L. (Ed.), Humana Press Inc., Totowa, New Jersey, Intracellular accumulation of linezolid in Escherichia coli, Citrobacter freundii and pp. 37–57. Enterobacter aerogenes: role of enhanced efflux pump activity and inactivation. Hawser, S., Lociuro, S., Islam, K., 2006. Dihydrofolate reductase inhibitors as antibacterial J. Antimicrob. Chemother. 59, 1261–1264. agents. Biochem. Pharmacol. 71, 941–948. Snapper, S.B., Melton, R.E., Mustafa, S., Kieser, T., Jacobs Jr., W.R., 1990. Isolation and Huennekens, F.M., 1996. In search of dihydrofolate reductase. Protein Sci. 5, 1201–1208. characterization of efficient plasmid transformation mutants of Mycobacterium Kielhofner, M.A., 1990. Trimethoprim–sulfamethoxazole: pharmacokinetics, clinical smegmatis. Mol. Microbiol. 4, 1911–1919. uses, and adverse reactions. Tex. Heart Inst. J. 17, 86–93. Suling, W.J., Reynolds, R.C., Barrow, E.W., Wilson, L.N., Piper, J.R., Barrow, W.W., 1998. Kumar, A., Zhang, M., Zhu, L., Liao, R.P., Mutai, C., Hafsat, S., Sherman, D.R., Wang, M.W., Susceptibilities of Mycobacterium tuberculosis and Mycobacterium avium complex 2012. High-throughput screening and sensitized bacteria identify an M. tuberculosis to lipophilic deazapteridine derivatives, inhibitors of dihydrofolate reductase. dihydrofolate reductase inhibitor with whole cell activity. J. Antimicrob. Chemother. 42, 811–815. Li, X.Z., Livermore, D.M., Nikaido, H., 1994. Role of efflux pump(s) in intrinsic resistance Urlaub, G., Chasin, L.A., 1980. Isolation of Chinese hamster cell mutants deficient in of Pseudomonas aeruginosa: resistance to tetracycline, chloramphenicol, and dihydrofolate reductase activity. Proc. Natl. Acad. Sci. U. S. A. 77, 4216–4220. norfloxacin. Antimicrob. Agents Chemother. 38, 1732–1741. Wards, B.J., Collins, D.M., 1996. Electroporation at elevated temperatures substantially Li, R., Sirawaraporn, R., Chitnumsub, P., Sirawaraporn, W., Wooden, J., Athappilly, F., improves transformation efficiency of slow-growing mycobacteria. FEMS Microbiol. Turley, S., Hol, W.G., 2000. Three-dimensional structure of M. tuberculosis Lett. 145, 101–105. dihydrofolate reductase reveals opportunities for the design of novel tuberculosis Williams, K.J., Piddock, L.J.V., 1998. Accumulation of rifampicin by Escherichia coli and drugs. J. Mol. Biol. 295, 307–323. Staphylococcus aureus. J. Antimicrob. Chemother. 42, 597–603. Locher, H.H., Schlunegger, H., Hartman, P.G., Angehrn, P., Then, R.L., 1996. Antibacterial Williams, K.J., Chung, G.A.C., Piddock, L.J.V., 1998. Accumulation of norfl oxacin by activities of epiroprim, a new dihydrofolate reductase inhibitor, alone and in Mycobacterium aurum and Mycobacterium smegmatis. Antimicrob. Agents Chemother. combination with dapsone. Antimicrob. Agents Chemother. 40, 1376–1381. 42, 795–800. Moreau, N., Lacroix, P., Fournel, L., 1984. Antibiotic uptake by bacteria as measured by partition in polymer aqueous phase systems. Anal. Biochem. 141, 94–100. Mortimer, P.G.S., Piddock, L.J.V., 1991. A comparison of methods used for measuring the accumulation of quinolones by Enterobacteriaceae, Pseudomonas aeruginosa and Staphylococcus aureus. J. Antimicrob. Chemother. 28, 639–653.