Pre-Clinical and Clinical Investigation of Pharmacokinetic and Pharmacodynamic Interactions between Darunavir, a Novel Protease Inhibitor, and Rosuvastatin

A dissertation submitted to the

Division of Research and Advanced Studies

of the University of Cincinnati

in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy (Ph.D.)

in the Department of Pharmaceutical Sciences

of the College of Pharmacy

2011

by

Divya Samineni

B.Pharm, Jawaharlal Nehru Technological University, Hyderabad, India 2004

M.S (Pharmaceutical Sciences), Creighton University, Omaha, NE, 2006

Committee Chair: Pankaj B.Desai, Ph.D.

ABSTRACT

Treatment of dyslipidemia in HIV-infected persons is commonly required with the use of

protease inhibitors (PIs) which may be restricted by drug-drug interactions between antiretroviral

agents and statins. We hypothesized that darunavir/ritonavir (DRV/rtv) modulate the

pharmacokinetics of rosuvastatin (RSV) when co-administered by altering its hepatic disposition.

The plausible genetic influence on the plasma exposure of RSV was also explored.

To investigate this hypothesis, we first conducted a clinical drug interaction study and

subsequently performed in vitro correlative/mechanistic analysis. In the open label, crossover

study, 12 healthy volunteers were randomized to receive either RSV 10 mg/day or DRV/rtv

600/100 mg (bid) and in combination for 7 days followed by a crossover to the other regimen for

7 more days. The fasting lipids were obtained at baseline and on days 7, 21 and 35 along with intensive PK sampling for 24 hours post-dose. The PK parameters such as Cmax, t1/2 and AUC0-τ were determined by non-compartmental analysis using WinNonLin 5.2. Statistical analyses were performed using Paired t test. Drug levels were compared with OATP1B1 c.521T > C, 388A>G,

BCRP c.421 C > A, MRP2 c. -24C>T, 1249G>A, 3972C>T single nucleotide polymorphisms

(SNPs) to investigate potential outliers in the drug interaction study. Next we assessed the influence of DRV on the activity of multidrug transporters OATP1B1, BCRP and Pgp in the transporter over-expressing CHO and MDCK cells and primary human hepatocyte cultures.

The AUC0-24 and Cmax of RSV before and after administration of DRV/rtv showed a significant

increase by1.48 fold ( P=0.003) and 2.44 fold (P<0.001) without a change in the t1/2 (P=0.176). I

However the AUC, Cmax, and t1/2 of DRV and RTV were unaltered. The total cholesterol increased by a median 4% (P=0.002) when RSV was given in combination than when given alone. Furthermore, we observed a trend toward lower plasma exposure of RSV in subjects with

OATP1B1 *1a/*15 than OATP1B1*1a/*1a genotypes. And no adverse events were attributable to the drug interaction. Our in vitro findings suggest that DRV/rtv led to an inhibition of

OATP1B1 (IC50 = 10 µM) and BCRP (IC50 = 77 µM) and an induction in Pgp activity (p≤ 0.05)

Co-administration of DRV/rtv significantly increased the plasma exposure of RSV and consequently led to a decline in the lipid-lowering effects of RSV. This study warrants large- scale interaction in HIV-infected population.

II

III

I dedicate this work to my parents for their endless love and encouragement. They were exemplary in teaching me that life is to be lived in joy and appreciation, that one really can do anything with hard work and dedication, and that true hope is not just humanistic optimism but consists in a genuine faith in God who supports you along the journey.

To my sisters who are my best friends, for their unwavering love, encouragement and support during my entire course of the study.

To my two really cute nephews, who added joy to our lives.

Most of all, to the Almighty, for granting me serenity, courage as well as wisdom throughout the process.

IV

ACKNOWLEDGEMENTS

I wish to acknowledge a number of people, who without their concern and support,

I would not have been able to finish this work.

First and foremost, I would like to express my deep sense of gratitude and appreciation to my

advisor and mentor Dr. Pankaj B. Desai, for providing me an opportunity to pursue PhD under

his direction and support. His wisdom and guidance have contributed to developing my

intellectual growth and scientific identity. His constant support and encouragement both in

professional and personal matters has made me accomplish my graduate education successfully.

Thank you for all the years of encouragement, insightful understanding, wonderful discussions, and belief in the final fruition of this work and most importantly for being a good friend.

I would like to thank Dr. Funmi Ajayi for serving in my dissertation committee and especially

for her courses, continual encouragement and great conversations. Her expertise in Clinical

Pharmacology, insights and careful attention to detail has helped me tremendously in my

dissertation writing.

And especially, I would like to thank Dr. Carl Fichtenbaum, for giving me this opportunity to work on the clinical trial and for serving in my dissertation committee. He was very generous with his time in supporting the clinical trial, sparing time for all the discussions and providing insightful suggestions in my research. More importantly for his strong encouragement in publishing a review paper in the Expert Opinion Journal.

V

I would like to thank Dr. Giovanni Pauletti, for serving in my dissertation committee. He was

generous in allowing me to work in his lab, and for training me in the experimental procedures

required for my dissertation work. His guidance in most facets of my work, and valuable

suggestions during the course of my research was immensely helpful. His input and expertise has

helped me to make the best of my research.

I would like to thank Dr. Larry Sallans for serving in my dissertation committee and for being a

wonderful collaborator. His expertise in mass spectrometry has helped me to expand my overall analytical technical abilities. He has always been kind, helpful and provided insightful ideas in my research.

I would also like to thank Dr. Sonia Sharma for her invaluable inputs in the protocol design for the clinical trial and Eva Moore, RN and Josette Robinson RN for their help with the clinical trial monitoring and handling of the patient samples. And more importantly for the exceptionally wonderful collaboration.

I would like to thank my current and previous labmates/friends, Nimita Dave, Ganesh

Palanisamy, Hari Krishna Ananthula, Jiraganya Bhongsatiern, Ganesh Mugundu, Fang Li,

Niresh Hariparsad and Rucha Sane for their friendship, assistance, and creating a great atmosphere to work in the lab.

I wish to thank all my colleagues/friends at the College of Pharmacy, most notably Amit

Kulkarni, Sarah Ibrahim, Amber Evans, Jody Ebanks, Rania Ibrahim, Jennifer Karr, Poonam

VI

Chopra, Kelly Smith, Gaurav Tolia, Shruthi Vaidyanathan and Ankit Mehta who listened to all my thoughts and doubts and for their help and encouragement throughout the process.

I would like to thank the Department of Pharmaceutical Sciences, the College of Pharmacy and the University of Cincinnati for providing me the opportunity and funding for my graduate studies. I would like to thank Dean Dr. Daniel Acosta,

Division Chair Dr. Gary Gudelsky, and graduate studies Director Dr. Gerald Kasting for their

support. I would also like to thank the administrative staff Marcie Silver, Donna Taylor, Paula

Shaw and Suzanne Ryan for their kindness, affection and support for past few years.

It is my extraordinary privilege to have had this opportunity to express my heartiest thanks to my parents and sisters whose support was indispensable and it would be redundant to express my gratitude for their patience, encouragement and inspiration. I am greatly indebted to them for

being my constant source of support morally, spiritually and financially. The completion of this

dissertation wouldn’t have been possible without the support and love from my family.

The clinical trial was funded by Tibotec, a subsidiary of Johnson & Johnson.

VII

TABLE OF CONTENTS

LIST OF FIGURES…………………………………………………………...... XI LIST OF TABLES……………………………………………………………………………………………………………………………. XIII LIST OF ABBREVIATIONS……………………………………………………...... XIV 1. CHAPTER ONE: INTRODUCTION……………………………………...... 1 1.1. HIV and ANTIRETROVIRAL THERAPY…………………………...... 1 1.1.1. PI containing background therapy…………………………………………………………….. 2 1.1.2. Adverse effects of PIs including dyslipidemias…………………………………………… 3 1.1.3. DRV…………………………………………………………………………………………………………… 3 1.1.4. Pharmacokinetics of DRV………………………………………………………………………….. 5 1.2. TREATMENT OF DYSLIPIDEMIAS…………………………………………………………………………….. 7 1.2.1. Lipid lowering agents and statins………………………………………………………………. 8 1.2.2. Mechanisms governing the pharmacological effects of statins and side effects………………………………………………………………………………………………… 9 1.2.3. Pharmacokinetics of Statins………………………………………………………………………. 11 1.2.3.1. Hepatic uptake and biliary excretion of statins………………………………….. 14 1.2.3.2. Cytochrome P450 Metabolism…………………………………………………………… 15 1.2.3.3. UDP glucuronosyl transferase-mediated lactonization of statins………………………………………………………………………………………………… 15 1.2.4. Pharmacology of RSV………………………………………………………………………………… 17 1.2.5. Pharmacokinetics of RSV…………………………………………………………………………… 19 1.3. CLINICALLY RELEVANT DRUG-DRUG INTERACTIONS WITH HMG-COA REDUCTASE INHIBITORS………………………………………………………………………… 20 1.3.1. Mechanism of interactions between PIs and statins…………………………………. 20 1.4. OVERVIEW OF CYP 450 ENZYMES…………………………………………………………………………… 22 1.4.1. Mechanism of Induction and Inhibition……………………………………………………… 23 1.4.2. Implications of DRV/rtv mediated CYP450 mediated Induction and Inhibition……………………………………………………………………………………………………. 27 1.5. OVERVIEW OF HEPATIC UPTAKE TRANSPORTERS, OATP1B1 AND OATP1B3………………………………………………………………………………………………………………….. 28 1.5.1. General Description…………………………………………………………………………………… 28 1.5.2. Substrate and Inhibitor selectivity……………………………………………………………… 28 1.5.3. Clinical significance of OATP1B1 and OATP1B1-mediated drug-drug interactions……………………………………………………………………………………………….. 30 1.5.4. Decision trees for OATP1B1 and OATP1B3 inhibitor and substrate interactions………………………………………………………………………………………………… 30 1.6. OVERVIEW OF EFFLUX TRANSPORTERS, BCRP AND MRP2………………………………………. 33 1.6.1. General Description…………………………………………………………………………………… 33 1.6.2. Substrate and Inhibitor selectivity……………………………………………………………… 34 1.6.3. Clinical significance of BCRP and MRP2-mediated drug-drug interactions……………………………………………………………………………………………….. 35 1.6.4. Decision trees for BCRP and MRP2 inhibitor and substrate interactions………………………………………………………………………………………………… 36 1.7. ROLE OF GENETIC POLYMOPRHISMS IN HEPATIC UPTAKE AND EFFLUX TRANSPORTERS ON PK AND PD OF STATINS…………………………………………………………………………………………………. 38 1.7.1. Pharmacogenomics of OATP1B1……………………………………………………………….. 39 1.7.2. Pharmacogenomics of BCRP………………………………………………………………………. 40 1.7.3. Pharmacogenomics of MRP2……………………………………………………………………… 41

VIII

2. CHAPTER TWO: HYPOTHESIS AND SPECIFIC AIMS……………………………………………………………. 42 2.1. HYPOTHESIS……………………………………………………………………………………………………………... 42 2.2. SPECIFIC AIM 1…………………………………………………………………………………………………………… 44 2.3. SPECIFIC AIM 2…………………………………………………………………………………………………………… 45 2.4. SPECIFIC AIM 3…………………………………………………………………………………………………………… 45 3. CHAPTER THREE: EXPERIMENTAL DESIGN AND METHODS………………………………………………… 47 3.1. SPECIFIC AIM 1: CLINICAL ASSESSMENT OF PK AND PD INTERACTION BETWEEN DRV/RTV AND RSV……………………………………………………………………………………………………… 47 3.1.1. Materials……………………………………………………………………………………………………… 47 3.1.2. Development and Validation of LC-MS/MS Method…………………………………….. 48 3.1.3. Assessment of drug-drug interaction between DRV and/or RTV on RSV in healthy volunteers……………………………………………………………………………………….. 51 3.2. SPECIFIC AIM 2: ASSESSMENT OF THE INFLUENCE OF DRV ON THE EXPRESSION AND ACTIVITY OF KEY PHASE 1 AND 2 ENZYMES……………………………………………………………………………………. 57 3.2.1. Materials……………………………………………………………………………………………………… 57 3.2.2. Primary cultures of human hepatocytes………………………………………………………. 58 3.2.3. Drug treatment……………………………………………………………………………………………. 59 3.2.4. Cell viability assessment by MTT assay………………………………………………………… 59 3.2.5. Protein assay……………………………………………………………………………………………….. 60 3.2.6. Quantitation of CYP3A activity…………………………………………………………………….. 60 3.2.7. Quantitation of MDR1 activity……………………………………………………………………… 61 3.2.8. Determination of enzyme/transporter specific mRNA levels……………………….. 62 3.2.9. Cell based receptor activation assays………………………………………………………….. 62 3.3. SPECIFIC AIM 3: TO EXAMINE THE EXTENT TO WHICH DRV AND/OR RTV MODULATE THE INFLUX AND EFFLUX HEPATIC DRUG TRANSPORTERS…………………………………………………………… 63 3.3.1. Materials……………………………………………………………………………………………………… 63 3.3.2. Inhibitory effect of DRV and RTV on BCRP-mediated Prazosin Uptake…………. 65 3.3.3. Inhibitory effect of DRV and RTV on OATP1B1-mediated RSV Uptake………….. 66 3.3.4. Determination of protein concentrations……………………………………………………… 67 3.3.5. Determination of kinetic parameters…………………………………………………………… 67 3.3.6. Statistical Analysis……………………………………………………………………………………….. 68 4. CHAPTER FOUR: RESULTS………………………………………………………………………………………………….. 69 4.1. SPECIFIC AIM 1: CLINICAL ASSESSMENT OF DRUG-DRUG INTERACTION BETWEEN DRV AND/OR RTV ON RSV IN HEALTHY VOLUNTEERS………………………………………………………………………. 69 4.1.1. LC-MS/MS method development for quantitation of RSV……………………………... 69 4.1.2. Drug-drug interaction between DVR/rtv and RSV in healthy volunteers……………………………………………………………………………………………………… 72 4.1.3. Association of OATP1B1, BCRP and MRP2 genotypes on fold change in RSV systemic exposure……………………………………………………………………………………………………….. 86 4.2. SPECIFIC AIM 2: TO ASSESS THE INFLUENCE OF DRV ON THE EXPRESSION AND ACTIVITY OF KEY PHASES 1 AND 2 ENZYMES……………………………………………………………………………………………. 91 4.2.1. Activation of PXR after chronic treatment with DRV and RTV…………………………. 92 4.2.2. Induction of CYP3A4, 2B6, 2C9, UGT 1A1, 1A3 and MDR1 transcripts by DRV.. 92 4.2.3. Quantitation of CYP3A activity………………………………………………………………………. 94 4.2.4. Quantitation of MDR1 activity……………………………………………………………………….. 95 4.3. SPECIFIC AIM 3: TO EXAMINE THE EXTENT TO WHICH DRV AND/OR RTV MODULATE THE INFLUX AND EFFLUX DRUG TRANSPORTERS……………………………………………………………………………. 96 4.3.1. Inhibitory effect of DRV and/or RTV on BCRP-mediated prazosin uptake……….. 97 4.3.2. Inhibitory effect of DRV and/or RTV on OATP1B1-mediated RSV uptake………… 102 5. CHAPTER FIVE: DISCUSSION………………………………………………………………………………………………… 108 5.1. CLINICAL ASSESSMENT OF PK/PD INTERACTION BETWEEN DRV/RTV AND RSV IN HEALTHY VOLUNTEERS…………………………………………………………………………………………………………………. 112 5.2. MODULATION OF DRUG METABOLIZING ENZYMES/TRANSPORTERS BY DRV………………… 116 IX

5.3. MODULATION OF HEPATIC INFLUX AND BILIARY/INTESTINAL EFFLUX TRANSPORTERS BY DRV AND/OR RTV……………………………………………………………………………………………………………….. 118 6. CHAPTER SIX: CONCLUSIONS AND FUTURE DIRECTIONS…………………………………………………….. 123 REFERENCES……………………………………………………………………………………………………………………………… 127

X

LIST OF FIGURES

1. The chemical structure of DRV ethanolate…………………………………………………………………… 6 2. Cholesterol-lowering action of Statins………………………………………………………………………….. 10 3. Lactonization of statins mediated by UDP-glucuronosyl transferase……………………………. 17 4. The metabolic pathways of RSV…………………………………………………………………………………… 18 5. Schematic representation of ligand mediated PXR activation and CYP3A 25 induction…………………………………………………………………………………………………………………….. 6. Decision tree for OATP Substrate………………………………………………………………………………… 31 7. Decision tree for OATP Inhibitor………………………………………………………………………………….. 32 8. Decision tree for BCRP substrate mediated drug-drug interactions……………………………… 36 9. Decision tree for BCRP inhibitor mediated drug-drug interactions………………………………. 37 10. Schematics of the Study Design…………………………………………………………………………………… 53 11. Typical chromatograms of (a) and (c) blank plasma samples; RSV (b) and d6 RSV (d) 70 spiked in human plasma sample………………………………………………………………………………….. 12. Calibration curve for the analyte RSV in human plasma, using RSV- d6 as the internal 71 standard (IS)...... 13. Steady-state RSV pharmacokinetics following administration of 10 mg daily doses for 7 75 days in the absence ((black circles, dotted line)) and in the presence (open squares, solid line) of DRV/RTV (600/100mg b.i.d) for 7 days…………………………………………………….. 14. Steady-state DRV pharmacokinetics following DRV/RTV (600/100 mg b.i.d.) for 7 days 77 in the absence (black circles, dotted line) and presence of RSV (10 mg daily) for 7 days (open squares, solid line)……………………………………………………………………………………………… 15. Steady-state RTV pharmacokinetics following DRV/RTV (600/100 mg b.i.d.) for 7 days 77 in the absence (black circles, dotted line) and presence of RSV (10 mg daily) for 7 days (open squares, solid line)……………………………………………………………………………………………. 16. Changes in Cholesterol with Exposure to Study Medications………………………………………. 82 17. Changes in Total Cholesterol………………………………………………………………………………………. 82 18. HDL-C Lipid Changes……………………………………………………………………………………………………. 83 19. Changes in LDL-C…………………………………………………………………………………………………………. 83 20. Changes in Triglycerides……………………………………………………………………………………………… 84 21. Changes in non-HDL-C………………………………………………………………………………………………….. 84 22. Subject 02406126C’s plasma concentration vs. time curves of RSV alone at day 21 and 88 with DRV/RTV at day 35……………………………………………………………………………………………… 23. Subject 02406146A’s plasma concentration vs. time curves of RSV alone at day 21 and 88 with DRV/RTV at day 35………………………………………………………………………………………………. 24. Association of OATP1B1*15 genotype with fold change in RSV exposure when co- 90 administered with DRV/RTV. (mean ± SD)…………………………………………………………………… 25. Fold change in hPXR activation in LS180 cells (N=3); p ≤ 0.05……………………………………… 92 26. Fold change in CYP3A4 mRNA expression in drug treated cells compared to control. 93 (n=3); p ≤ 0.05…………………………………………………………………………………………………………….. 27. Fold change in CYP2B6, CYP2C9, UGT1A1, UGT1A6 & MDR1 mRNA expression in drug 94 treated cells compared to control. (n=3); p ≤ 0.05………………………………………………………. 28. Fold change in CYP3A4 Activity assessed as the rate of testosterone 6β-hydroxylation 95 by drug treated cells compared to control. (n=3); p ≤ 0.05………………………………………….. 29. Fold change in MDR1 Activity measured as uptake of Rh123, in cultured human 96 hepatocytes following 72-hour treatment with rifampicin, DRV compared to control. (n=3); p ≤ 0.01……………………………………………………………………………………………………………. 30. Effect of DRV on BCRP activity, expressed as prazosin uptake, following 2h acute 98 treatment in MDCK-BCRP cells (Mean ± SD). (n=3)…………………………………………………….. 31. Effect of DRV (μM) on BCRP-mediated [3H]-prazosin uptake. The inhibition constant 98

XI

(IC50) was 366 μM (Mean ± SD). (n=3)………………………………………………………………………. 32. Effect of RTV on BCRP activity, expressed as prazosin uptake, following 2h acute 99 treatment in MDCK-BCRP cells (Mean ± SD). (n=3)…………………………………………………….. 33. Effect of RTV (μM) on BCRP-mediated [3H]-prazosin uptake. The inhibition constant 99 (IC50) was 24.2 μM (Mean ± SD). (n=3)………………………………………………………………………. 34. Effect of DRV/RTV (1 μM) on BCRP activity, expressed as prazosin uptake, following 2h 100 acute treatment in MDCK-BCRP cells (Mean ± SD). (n=3)…………………………………………… 35. Effect of DRV/RTV (1 μM) on BCRP-mediated [3H]-prazosin uptake. The inhibition 100 constant (IC50) was 83.0 μM (Mean ± SD). (n=3)……………………………………………………….. 36. Effect of DRV/RTV (25 μM) on BCRP activity, expressed as prazosin uptake, following 101 2h acute treatment in MDCK-BCRP cells (Mean ± SD). (n=3)………………………………………. 37. Effect of DRV/RTV (25 μM) on BCRP-mediated [3H]-prazosin uptake. The inhibition 101 constant (IC50) was 77.0 μM (Mean ± SD). (n=3)………………………………………………………… 38. Michaelis-Menten plot of the uptake of [3H] - RSV in human OATP1B1 expressing CHO 102 cells. (Mean ± SD). (n=3)……………………………………………………………………………………………… 39. Effect of DRV on OATP1B1 activity, expressed as RSV uptake, following 2 min acute 103 treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)………………………………………………….. 40. Effect of DRV on OATP1B1-mediated [3H]-RSV uptake. The inhibition constant (IC50) 104 was 15.2 μM (Mean ± SD). (n=3)…………………………………………………………………………………. 41. Effect of RTV on OATP1B1 activity, expressed as RSV uptake, following 2 min acute 104 treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)…………………………………………………. 42. Effect of RTV on OATP1B1-mediated [3H]-RSV uptake. The inhibition constant (IC50) 105 was 4.6 μM (Mean ± SD). (n=3)………………………………………………………………………………….. 43. Effect of DRV/rtv (1 μM) on OATP1B1 activity, expressed as RSV uptake, following 2 105 min acute treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)…………………………………. 44. Effect of DRV/ RTV (1 µM) on OATP1B1-mediated [3H]-RSV uptake. The inhibition 106 constant (IC50) was 4.1 μM (Mean ± SD). (n=3)………………………………………………………….. 45. Effect of DRV/ RTV (25 μM) on OATP1B1 activity, expressed as RSV uptake, following 2 106 min acute treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)………………………………….. 46. Effect of DRV/ RTV (25 µM) on OATP1B1-mediated [3H]-RSV uptake. The inhibition 107 constant (IC50) was 3.6 μM (Mean ± SD). (n=3)……………………………………………………………

XII

LIST OF TABLES

1. PI induced changes in lipid levels………………………………………………………………………………………………… 8

2. Pharmacokinetic properties of Statins……………………………………………………...... 13

3. CYP 450 –mediated metabolism and UGT- mediated- lactonization of Statins…………………………….. 16

4. Substrate specificities for OATP1B1 and OATP1B3 transporter proteins…………………………………….. 29

5. Substrate and Inhibitor Specificities for BCRP and MRP2 transporter proteins…………………………… 35

6. Primer Sequences for OATP1B1 (SLCO1B1 gene), BCRP (ABCG2 gene) and MRP2 (ABCC2 gene) 56 transporter SNPs…………………………………………………………………………………………………………………………

7. Baseline Characteristics of 12 Subjects enrolled in the study…………………………………………………….. 73

8. Steady state RSV Pharmacokinetics in individual subjects with and without DRV/r……………………. 76

9. Steady state DRV Pharmacokinetics in individual subjects with and without RSV……………………….. 78

10. Steady state RTV Pharmacokinetics in individual subjects with and without RSV………………………… 79

11. Median values of fasting lipids in mg/dL (25-75% interquartile ranges)……………………………………… 81

12. Median changes in fasting lipid levels and percentages of lipids (mg/dL)………………………………….. 81

13. Adverse Events observed on 16 subjects during multiple dosing of RSV (10 mg daily) alone or 86 DRV/rtv (600mg/100mg; b.i.d.) alone or when used in combination at these doses…………………..

14. Genetic Polymorphisms of OATP1B1, BCRP and MRP2 transporters…………………………………………… 89

XIII

LIST OF ABBREVIATIONS

AAG Alpha amino globulin ABCC2 ATP binding cassette transporter C2 ABCG2 ATP binding cassette transporter G2 AIDS Acquired Immuno Deficiency Syndrome ALT Alanine aminotransferase AP1 Atmospheric Pressure Ionization AST Aspartate amino transferases AUC Area under the concentration-time curve BCA Bicinchonic acid BCRP Breast cancer resistance protein BIC Bayesian Information Criteria BMI Body mass index CAR Constitutive Androstane Receptor CD4+T cells CD4-positive T lymphocytes CHD Coronary heart disease CHO Chinese hamster ovary CL/F Oral clearance Clint Intrinsic Clearance Cmax Maximum plasma drug concentration Cmin Minimum plasma drug concentration Cmoat Canalicular multispecific organic anion transporter CoQ10 Co-enzyme Q10 CPK Creatinine phosphokinases CsA Cyclosporine A CYP 450 Cytochrome P450 DAIDS Division of AIDS DMSO Dimethyl sulfoxide DRV Darunavir ELISA Enzyme linked immune-sorbent assay F Bioavailability

XIV

FDA Food and Drug Administration FTC Fumitremorgin-C FT-ICR Fourier Transform-Ion Cyclotron Resonance FXR Farnesoid X Receptor GCRC General Clinical Research Center GSH Glutathione GSTA2 Glutathione-S-transferase 2 GI Gastro Intestinal HAART Highly active antiretroviral therapy HDL-C High density lipoprotein cholesterol HIV Human Immunodeficiency Virus HMG-CoA 3-hydroxy-3-methylglutaryl CoA reductase HPLC High performance Liquid Chromatography

IC50 Inhibitor concentration that causes 50% reduction in enzyme activity IRB Institutional Review Board ka Absorption rate constant Kd Dissociation constant Ki Dissociation constant of the inhibitor binding to the enzyme km Michealis Menten constant LC-MS Liquid Chromatography Mass Spectrometry LDL-C Low density lipoprotein cholesterol LLOQ Lower limit of quantification LTQ-FT Linear Trap Quadruple-Fourier Transform MDCK Murine darby canine kidney MDR1 Multi-Drug Resistance 1 cMOAT Canalicular multispecific organic anion transporter MRM Multiple reaction monitoring mode mRNA Messenger Ribonucleic Acid MRP2 Multi-Drug Resistance Protein 2 MTT 3-[4, 5-dimethylthiazol-2-y] 2 5-diphenyl-tetrazolium bromide m/z Mass-by-charge ratio

XV

NCEP National cholesterol education program NME New molecular entity NNRTI Non-nucleoside reverse transcriptase inhibitors NRTI Nucleoside reverse transcriptase inhibitors OATP1B3 Organic Anion-Transporting Polypeptide-1B3 OATP-C Organic Anion-Transporting Polypeptide-C OATP-2 Organic Anion-Transporting Polypeptide2 PBMC Peripheral blood mononuclear cells PCR Polymerase chain reaction PD Pharmacodynamics P-gp P-glycoprotein PI Protease Inhibitor PK Pharmacokinetics Performance Of TMC114/RTV When evaluated in Treatment- POWER Experienced patients with PI resistance PXR Pregnane X Receptor Qh Hepatic blood flow QSAR Quantitative Structure-Activity Relationship Rh-123 Rhodamine 123 RSV Rosuvastatin RSV-d6 RSV-deuterated6 RT-PCR Reverse transcription polymerase chain reaction RTV Ritonavir RXR Retinoic Acid X Receptor SE Standard Error SNP Single nucleotide polymorphism SXR Steroid X Receptor TAM Tamoxifen TC Total cholesterol TG Triglycerides Tmax Time to the maximum plasma concentration UGT UDP glucuronosyl transferases

XVI

ULN Upper limit of normal UNAIDS United Nations Program on HIV and AIDS Vd Volume of distribution VDR Vitamin D Receptor VKORC1 Vitamin K Epoxide Reductase Complex subunit 1 Vmax Maximum reaction rate of enzymes WHO World Health Organization

XVII

1. CHAPTER ONE: INTRODUCTION

1.1. Human Immunodeficiency Virus and Antiretroviral Therapy

Human immunodeficiency virus (HIV) remains a global health problem of unprecedented dimensions claiming more than 25 million deaths for more than three decades. The

UNAIDS, a Joint United Nations Program on HIV/AIDS and the World Health Organization

(WHO) reported a global stabilization of the HIV epidemic, although with unacceptably high levels of new HIV infections and the acquired immune deficiency syndrome (AIDS) deaths. Despite significant progress in understanding this virus infection, it has reached pandemic proportions with more than 33 million cases worldwide, mostly being found in

Sub-Saharan Africa, the Indian subcontinent and the Far East, according to the UNAIDS

Report on the Global AIDS Epidemic 2010. In spite of a recent scaling up of treatment access worldwide, AIDS remains the largest infectious disease cause of mortality and a serious challenge to public health (Anderson et al., 2008).

Combination chemotherapy of active and mechanistically dissimilar antiretroviral drugs for the treatment of HIV/AIDS, commonly characterized as the highly active antiretroviral therapy (HAART) has markedly decreased morbidity and mortality and improved the overall prognosis in patients with HIV. However a significant portion (30-50%) of HIV- infected patients experience treatment failure regardless of the effectiveness of multiple combination therapy. Reasons for treatment failure include drug-related side effects, inadequate patient adherence, suboptimal drug exposure, and development of mutants with

1

amino acid substitutions that confer resistance to the administered drugs and a progressive cross resistance to other drugs of the same class (Montessori et al., 2004). This imposes the need for the discovery of new anti-HIV drugs which can potentially improve convenience, reduce toxicity and to provide antiviral activity against the growing number of drug resistant strains.

1.1.1. Protease Inhibitor containing background therapy

HIV-1 protease inhibitors (PIs) constitute one of the most important classes of antiretroviral agents constituting HAART (Tenore and Ferreira, 2009a). Since their inception in 1995, various PIs such as saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, lopinavir/ritonavir, atazanavir, fosamprenavir, tipranavir and darunavir were notorious in their contribution to the aforementioned success in the treatment of HIV. The PIs act by binding to the active site of the HIV protease enzyme either through direct competition or deformation of the protease active site resulting in blocking of the cleavage of viral poly- protein precursors thereby leading to the formation of immature non-infectious viral particles (Farady and Craik, 2010). Early clinical trials showed that systemic exposure to PIs was enhanced by co-administration with the CYP3A4 inhibitor ritonavir at low doses, typically, 100 to 200 mg per day, much lower than when originally used for treatment.

Ritonavir boosted PI regimens offer advantages such as reduced pill burden, improved adherence and increased efficacy against PI resistant mutations by achieving higher sustained exposure to the latter PI (Moyle and Back, 2001). They also play a key role in treating both HIV infected-naïve and treatment-experienced patients with antiretroviral

2

failure due to their high genetic barrier to resistance causing mutations and established long term efficacy. PI based therapies work efficiently as first-line therapies despite their adverse events including metabolic complications due to their limited potential to develop resistance.

1.1.2. Adverse effects of PIs including dyslipidemias

However, the benefits of HIV PIs are compromised by numerous undesirable side effects.

For example, the long term PI use is associated with clinical limitations such as increased susceptibility for drug-drug interactions and adverse side-effects including metabolic disturbances which include elevated levels of triglycerides and low-density lipoprotein cholesterol (LDL-C) and reduced levels of high-density lipoprotein cholesterol (HDL-C)

(Tenore and Ferreira, 2009b). For instance, treatment with PIs such as lopinavir/RTV

(Kaletra®) results in an abnormal increase in lipid levels when administered to both PI- naïve and experienced patients (Martinez et al., 2004). Similarly, in patients treated with either indinavir or RTV, elevations in total cholesterol and triglyceride levels were reported

(Manfredi and Chiodo, 2001). Hence, there is an ever increasing need to develop novel PIs that are active against drug resistant HIV strains, and have a reduced propensity for adverse effects such as abnormalities in lipid alterations and drug-drug interactions.

1.1.3. Darunavir

Darunavir (DRV), a next generation PI, received a fast-track approval in June 2006 by the

US FDA for the treatment of HIV infection in antiretroviral treatment-naïve and treatment-

3

experienced HIV patients co-administered with a boosting dose of ritonavir (RTV). It exhibits potent in vitro antiviral activity against both wild-type and a broad panel of multidrug resistant HIV-1 strains. DRV binds with greater affinity to the HIV-1 protease enzyme, as well as multi-drug resistant proteases. It exhibits a high potency against a wide range of laboratory strains and clinical isolates of wild-type and multidrug-resistant HIV and shows a limited potential to cause cell cytotoxicity (McKeage and Scott, 2010). The plasma half-life of DRV is 15 hours (Sekar et al., 2007b) and is relatively long compared to other novel PIs such as lopinavir (2-6 hours) (Cvetkovic and Goa, 2003) or atazanavir (6-7 hours)

(Le et al., 2005). The POWER 1 and POWER 2 trials investigated the efficacy and safety of darunavir/ritonavir (DRV/rtv) (600/100 mg twice daily) when given in triple class- experienced patients with PI resistance. The 48 week results revealed a significantly higher percentage of patients achieving HIV suppression <50 copies/ml for DRV/rtv compared with the investigator selected RTV-boosted control group (POWER 1: 53% vs. 18% control;

POWER 2: 39% vs. 7% control), respectively (Clotet et al., 2007). These studies formed the bases for the approval of DRV/rtv in the treatment of HIV-infected treatment- experienced adult patients. The ARTEMIS study compared the efficacy and safety of

DRV/rtv (800/100 mg qd) with lopinavir/RTV (800/200 mg total daily dose) with fixed background regimen in treatment-naive, HIV-1-infected patients. The results from this study at week 96 showed that more DRV/rtv (79%) than lopinavir/ritonavir (71%) patients had viral loads less than 50 copies/ml confirming superiority in its virological response (P =

0.012) (Mills et al., 2009). Hence, the US Department of Health and Human Services

(DHHS) recommends the use of DRV/rtv dosed once daily as a “preferred” PI for the first line treatment of HIV infection in adults.

4

Despite the improved efficacy against HIV, subjects treated with DRV/rtv experience dyslipidemia to a significant extent. For instance, in the ARTEMIS study, treatment-naïve patients randomized to receive either DRV/rtv arm (800/100 mg once-daily) or lopinavir/ritonavir (800/200 mg total daily dose q.d. or b.i.d.), experienced pronounced grade 2-4 elevations in total cholesterol (18 DRV/rtv vs. 28% lopinavir/ritonavir) and triglyceride (4 DRV/rtv vs. 13% lopinavir/ritonavir) levels albeit less frequently in the

DRV/rtv than in the lopinavir/ritonavir arm (Mills et al., 2009). Clotet et al reported that in

HIV patients randomized to DRV/rtv and investigator-selected RTV-boosted control PIs or

RTV-boosted lopinavir, subjects in DRV/rtv arm displayed significant gastro-intestinal (GI) disturbances and lipid abnormalities such as grade 3-4 elevations in triglycerides (>8·4 mmol/L; 15% DRV/rtv vs. 7% of control PI patients) and total cholesterol levels (>7·7 mmol/L; 7% DRV/rtv vs. 2% of control PI patients) in treatment-experienced patients from baseline to week 48 (Clotet et al., 2007). In addition, with the aging of the HIV-infected population due to improved survival rates, more individuals are expected to need treatment for dyslipidemia while receiving PIs such as DRV/rtv.

1.1.4. Pharmacokinetics of Darunavir

DRV, a peptidomimetic PI, contains a bis-tetrahydrofuranyl (bis-THF) moiety and sulfonamide isostere and is administered as its ethanolate salt [Fig. 1]. After oral administration of 600/100 mg twice daily dose, DRV is rapidly absorbed and peak plasma concentrations (Cmax) are achieved within 2.5 to 4 hours. The absolute bioavailability of

DRV (600 mg once daily) was increased to 82% in combination with RTV (100 mg twice

5

daily) compared with 37% when DRV was given alone in healthy volunteers.

Administration of food increases the absorption and bioavailability of DRV and it is therefore required to be taken with food (Sekar et al., 2007a). DRV is highly bound (95%) to plasma proteins, predominantly to alpha amino globulin (AAG) and to a smaller extent with albumin. The volume of distribution of DRV when given alone was 88.1L, while it increased to 130 L in the presence of RTV (100 m twice daily) (Back et al., 2008b).

DRV primarily undergoes oxidative metabolism and is extensively metabolized in humans by cytochrome-P450 (CYP450) enzymes, mainly CYP3A4 to three oxidative metabolites.

These metabolites are biologically active against wild type virus, but their activity was less

(10-fold) than DRV. The proportion of unchanged DRV eliminated in feces was 41.2% and

7.7% in urine. The terminal elimination half-life (t1/2) of DRV in combination with RTV

(200/100 mg once daily) in healthy volunteers was reported to be 15 hours. Upon intravenous administration of DRV alone the mean systemic clearance was 32.8 L/h and this decreased to 5.9 L/h in the presence of low-dose RTV (100 mg twice daily).

Figure 1: The chemical structure of DRV ethanolate (Back et al., 2008b).

6

1.2. Treatment of Dyslipidemias

Dyslipidemias is an amendable risk factor that affects approximately 50% of persons with

HIV infection and is characterized by elevations in fasting levels of total cholesterol, low- density lipoprotein (LDL) and triglycerides and a decline in high-density lipoprotein (HDL) cholesterol levels, alone or in combination. Dyslipidemias are associated with the pathophysiology of atherosclerosis and an increased risk of coronary heart disease (CHD).

Mixed dyslipidemia is common in persons with CHD and studies showed that CHD is an important cause of morbidity and mortality in persons with HIV infection (Friis-Moller et al., 2003).

Approximately 50% of HIV infected persons develop dyslipidemias in the absence and presence of highly active antiretroviral therapy (HAART). Dyslipidemias may be coupled with insulin resistance, glucose intolerance and fat redistribution placing them at a greater risk for CHD (Carr et al., 1999; Heath et al., 2001). In the absence of HAART, a decline in the levels of total cholesterol (TC), LDL-C and HDL-C were observed in association with elevated concentrations of TG (Constans et al., 1994a; Grunfeld et al., 1992) which may be partially reversed upon the treatment with HAART (Riddler et al., 2003).

Unfortunately, two of the five classes of approved antiretroviral agents have been associated with dyslipidemia, insulin-resistance, fat redistribution disorders and elevated risk of CHD induced changes in lipid levels [Table 1] (Samineni and Fichtenbaum, 2010). Nucleoside

7

reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PI) class of compounds are

associated with significant metabolic abnormalities (da Silva and Barbaro, 2009).

Population Cholesterol TG HDL LDL

(mg/dL) (mg/dL) (mg/dL) (mg/dL)

HIV+ (n=43) 153 95 30 82 HIV- (n=129) 196 100 44 129 (Feingold et al., 1993)

PI naïve (n=17) 175 162 35 114 PI treated (n=38) 257 † 451 † 36 163 † (Behrens et al., 1999)

Before- During Before- During Before- During Before- During RTV (n=46) therapy therapy therapy therapy Indinavir (n=26) 178 →255 † 159→318 † 39 →39 108 →162 † Nelfinavir (n=21) 189 →220 † 195→177 35 →39 120 →151 † PI naïve (n=28) 162 →208 † 186→195 35 →46 † 96 →139 † (Periard et al., 185 →181 133→124 46 →42 104 →120 1999) † P<0.05

Table 1: PI induced changes in lipid levels. Adapted from Samineni and Fichtenbaum, 2010.

1.2.1. Lipid Lowering Agents and Statins

The National Cholesterol Education Program (NCEP) Expert Panel on Detection,

Evaluation, and Treatment of High Cholesterol in Adults recognized increased LDL-C

levels as the principal target of lipid-lowering therapy although elevated TG and low HDL-C

are important markers of increased risk for CHD (NCEP, 2001). Alterations in lifestyle

including diet and exercise are recommended as the first choice for most types of lipid

8

disorders. The key pharmacologic intervention for the majority of dyslipidemias typically is the use of 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase inhibitors (Statins).

Fibric acid derivatives are the preferred choice for the treatment of elevated triglyceride (>

500 mg/dL) levels and non-HDL-C levels when the use of statins alone was unsuccessful

(Dube et al., 2000). Alternative interventions for hypertriglyceridemia or mixed dyslipidemia include fish oil (omega-3 fatty acids), niacin and bile acid sequestrants. The use of fish oil has been tested in three studies in patients with HIV for lowering triglyceride levels with studies showing a 20-45% reduction in triglycerides (de et al., 2007). Niacin (2 grams daily dose) after 48 weeks of treatment led to a reduction in triglyceride levels by an average of 160 mg/dL in HIV- infected patients (Dube et al., 2006). The use of bile acid sequestrants is not preferred because of the lowering in efficacy of antiretroviral agents upon their binding to these agents.

1.2.2. Mechanisms governing the pharmacological effects of statins and side effects

Statins are used as a first-line therapy for the treatment of elevated LDL‐C levels or non–

HDL‐C levels when triglyceride levels are 200 – 500 mg/dL, as statins have modest effects on lowering triglyceride levels in persons with HIV infection (Dube et al., 2003a). Statins act by inhibiting the synthesis of mevalonate, a rate-limiting step in the biosynthesis of cholesterol, leading to a decline in the plasma LDL cholesterol levels [Fig. 2]. This leads to an increase in the LDL-receptors by transcriptional regulation to maintain intracellular cholesterol by homeostasis (Lennernas and Fager, 1997b).

9

Figure 2: Cholesterol-lowering action of Statins. Adapted from (Rodriguez and Davalos,

2008).

Brown and Goldstein et al reported that liver plays an important role in the biosynthesis of lipoprotein and catabolism of LDL (Brown and Goldstein, 1985). More than 50% of the total cholesterol production in the body is endogenous with liver being the primary site of synthesis. Hence, the site for the pharmacological action of statins is the liver (Gadbut et al.,

1995; Transon et al., 1996).

Most statins currently in the market possess a HMG-like moiety in their structure.

Simvastatin and lovastatin are administered as lactone pro-drugs and are transformed into the biologically active open acid form in the body whereas other newer statins are administered directly as their active open acid forms. Hence newer statins with HMG-

10

moieties are reported to have a higher affinity for HMG-CoA reductase with more potent inhibitory effects (Holdgate et al., 2003). Statins including simvastatin, pravastatin, fluvastatin, cerivastatin, atorvastatin and rosuvastatin are potent inhibitors of HMG-CoA reductase as they exhibit inhibition constants (Ki) in the ranges of 5-44 nM while the affinity constant (km) of HMG-CoA is 4 µM (Istvan, 2002b). However, statins users experience several adverse effects such as myalgia, headache, asthenia, abdominal pain, nausea including rhabdomyolysis. The detailed mechanism of action is still unknown and it could be due to a decline in cholesterol levels in the muscle cells leading to instability of the plasma membrane and cellular damage or a reduced CoQ10 level leading to reduced farnesyl pyrophosphate levels causing myotoxicity (Lalani et al., 2005). Cerivastatin was withdrawn from the U.S. and foreign markets due to the high incidence of rhabdomyolysis

(Staffa et al., 2002). In a recent study using data from the U.S, there were 0.15 cases of deaths reported resulting from rhabdomyolysis per million prescriptions for all statins combined (including cerivastatin) and 3.16 cases per million prescriptions for cerivastatin alone (White, 2002). This rather large number of cases of rhabdomyolysis for cerivastatin may be associated with its lipophilicity (McTaggart et al., 2001a; Negre-Aminou et al.,

1997)

1.2.3. Pharmacokinetics of Statins

Statins exhibit different pharmacokinetic profiles that are related to their physicochemical properties [Table 2]. Lactone pro-drugs such as simvastatin and lovastatin, are lipophilic, and hence have low IC50 values on HMG-CoA reductase when measured both in the hepatic

11

and non-hepatic experimental cell systems because they can easily cross the cell membrane via passive diffusion leading to non-specific tissue distribution (Shitara et al., 2006).

However, hydrophilic statins (i.e. pravastatin and rosuvastatin) have much higher IC50 values than simvastatin and lovastatin in the experimental non-hepatic cell systems except for rat and human hepatocytes, as they cannot easily cross the cell membrane (Shitara et al.,

2006). Conversely, they inhibit HMG-CoA reductase potently in rat and human hepatocytes leading to lower IC50 values, because these statins are taken up by hepatocytes via active transport systems. Among the currently marketed statins, rosuvastatin (RSV) has the lowest

IC50 on HMG-CoA reductase, as it accumulates in the liver via active transport systems. As liver is the main elimination site for all the statins, processes such as the hepatic uptake, biliary excretion and metabolism play significant roles in their clearances.

12

Simvastatin Lovastatin Pravastatin Fluvastatin Atorvastatin Pitavastatin RSV

(lactone) (lactone) (Open (Open acid) (Open acid) (Open acid) (Open acid)

acid)

40 mg 60 40 mg 40 mg 20 mg 40 mg 40 mg 2 mg 20 40 mg 80 mg mg mg ACID

Tmax (h) 1 4 3 1 0.43-2.1 0.5-1.5 1-2.5 1.2 5 5 4-5

Cmax (ng/mL) 6.9 3.1 2.7 45-66 53-370 200-440 13-67 41 6.1 19 39-50

T1/2 (h) 3.5 2.8 - 1.8-2.0 - 0.8-2.4 7.8-21 13 - 20 17

AUC (ng.h/mL ) 25 22 34 110-140 110-440 320-570 58-620 120 63 180 310-410

LACTONE

Tmax (h) 4 1 4 2 3 1.6 - 5.1 4.5

Cmax (ng/mL) 3.2 16 2.8 1.6 4.2 22 7.1

T1/2 (h) - 3.4 - - 8.3 12 21

AUC (ng.h/mL ) 20 47 28 3.3 47 170 110

Absorption (%) 60-80 30 34 98 30

Bioavailability <5 5 18 19-29 12 80 20 (%)

Table 2: Pharmacokinetic properties of Statins. Adapted from (Shitara and Sugiyama, 2006c).

13

1.2.3.1. Hepatic uptake and biliary excretion of statins

Studies showed correlation of the uptake of statins exclusively by the liver with their in vivo pharmacological effects. Statins such as pravastatin, cerivastatin, pitavastatin, RSV and atorvastatin are concentrated in the liver via active hepatic organic anionic transporter polypeptide (OATP) 1B1 (OATP-C) (Fujino et al., 2004; Hsiang et al., 1999; Lau et al.,

2006; Nakai et al., 2001; Schneck et al., 2004a; Shitara et al., 2003). Pitavastatin and RSV are also reported to be substrates of the active hepatic uptake transporter OATP1B3 (Hirano et al., 2004; Kitamura et al., 2008) and the results indicate that pitavastatin and RSV are primarily taken up into the liver via OATP1B1 with a minor contribution of OATP1B3.

OATP1B1 transporter is also involved in the hepatic uptake of lactone statins such as lovastatin and simvastatin (Hsiang et al., 1999), however, its contribution appears to be minimal, as these lipophilic statins are taken up into the liver by passive diffusion (Sirtori,

1993).

Studies showed that statin drugs are efficiently excreted into the bile via efflux transporters and then subsequently eliminated. Pravastatin is a substrate for multidrug resistance associated protein 2 (MRP2) transporter (Sasaki et al., 2002). Matsushima et al reported the role of P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and MRP2 in the biliary excretion of pravastatin and cerivastatin, however, their relative contributions are not known (Matsushima et al., 2005). Pitavastatin is also a substrate of efflux transporters such as BCRP and MRP2 with a minor contribution from P-gp (Fujino et al., 2002a; Fujino et al.,

14

2005). Hirano et al reported the role of a bile salt exporting pump (BSEP) in the elimination of pravastatin (Hirano et al., 2005).

1.2.3.2. Cytochrome P450 metabolism

Statins metabolized by CYP450 enzymes are predisposed to metabolism and mediate drug- drug interactions. The enzymes involved in the metabolism of statins are listed in [Table 3].

Statins such as simvastatin, lovastatin and atorvastatin are primarily metabolized by

CYP3A4 (Lennernas, 2003; Prueksaritanont et al., 2002a; Wang et al., 1991). CYP2C9 mediates the metabolism of fluvastatin (Transon et al., 1995). Pravastatin and RSV are minimally metabolized by CYP 450. Consequently are not susceptible to metabolism based drug–drug interactions (Hatanaka, 2000; White, 2002). Pitavastatin undergoes a minor degree of metabolism by CYP2C9. Hence, P450 -mediated metabolism does not play an important role in its elimination (Fujino et al., 2002). Cerivastatin metabolism is mediated majorly by CYP2C8 and to a smaller extent by CYP3A4 (Muck, 2000).

1.2.3.3. UDP glucuronosyl transferase-mediated lactonization of statins

Open acid form statins undergo glucuronidation by UDP glucuronosyl transferase (UGT)

1A1 and 1A3 followed by lactonization of the acyl glucuronide HMG-like moieties [Fig. 3,

Table 3]. Statins administered as lactone pro-drugs are converted to their open acid forms mediated by carboxy esterases and consequently eliminated into bile or urine or directly metabolized by CYP 450 to their lactone forms. Studies showed that gemfibrozil when

15

coadministered with simvastatin, the plasma levels of simvastatin acid increased while that of the lactone forms was reduced due to the inhibition of UGT and CYP 450 and hence the subsequent lactonization of simvastatin (Prueksaritanont et al., 2002b)

Statin CYP 450 Substrates UGT Substrates

(generic name)

Atorvastatin CYP3A4 UGT1A1, UGT 1A3

Cerivastatin CYP2C8, CYP3A4 UGT1A1, UGT 1A3

Fluvastatin CYP2C9, CYP3A4 UGT1A1, UGT 1A3

Lovastatin CYP3A4 UGT1A1, UGT 1A3

Pitavastatin CYP2C9 (minor) UGT1A1, UGT 1A3

Pravastatin No UGT1A1, UGT 1A3

RSV CYP2C9 (minor) UGT1A1, UGT 1A3

Simvastatin CYP3A4 UGT1A1, UGT 1A3

Table 3: CYP 450 – mediated metabolism and UGT- mediated- lactonization of Statins

16

Figure 3: Lactonization of statins mediated by UDP-glucuronosyl transferase. Adapted from

(Shitara and Sugiyama, 2006b).

1.2.4. Pharmacology of Rosuvastatin

Rosuvastatin calcium (RSV) is a synthetic compound administered as the calcium salt of the active hydroxy acid. Its chemical name is bis{(E)-7-[4-(4-fluorophenyl)-6-isopropyl-2-

[methyl(methylsulfonyl)amino] pyrimidin-5-yl](3R,5S )-3,5-dihydroxyhept-6-enoic acid} calcium salt [Fig. 4] (Watanabe et al., 1997). RSV comprises a dihydroxy heptenoic acid chain that mimics the HMG portion of the HMG-CoA enzyme and exhibits a tight and reversible binding to the HMG-CoA reductase (Istvan, 2002a). RSV is a relatively effective inhibitor of HMG-CoA reductase and a more potent blocker of hepatocyte sterol synthesis

17

compared to the currently available statins. It has the lowest 50% inhibitory constant (IC50) of 5.4 nM (McTaggart et al., 2001c). Studies showed that RSV significantly lowered LDL-

C (43% and 49%, respectively) to a greater magnitude than atorvastatin (35%), simvastatin

(37%), and pravastatin (28%) (White, 2002d). RSV demonstrated comparable reductions in high-density lipoprotein (HDL) 8% to 12% and lower triglycerides by 10% to 35% to existing statins (White, 2002c). The most frequently reported adverse events during RSV therapy include pharyngitis, pain, headache, flu syndrome, myopathy and myalgia (White,

2002b).

Rosuvastatin 5S-lactone N-desmethyl-rosuvastatin

Biliary excretion

Figure 4: The metabolic pathways of RSV.

18

1.2.5. Pharmacokinetics of Rosuvastatin

RSV is significantly less lipophilic than all of the currently available statins except pravastatin (McTaggart et al., 2001b). After an oral administration of single oral 20 mg dose of RSV, it is rapidly absorbed and the peak plasma concentrations (Cmax) are typically achieved within 5 hours (Martin et al., 2002). The rate of absorption of RSV is decreased by

20% with food, however, the extent of absorption is unchanged (White, 2002a). The mean volume of distribution for RSV at steady-state is 134 liters. RSV exhibits a reversible tight binding to plasma proteins (88%).

Approximately 90% of the plasma HMG-CoA reductase inhibitory activity is attributed to the parent compound, RSV. It undergoes minimal metabolism (less than 10%) by CYP2C9.

RSV is metabolized to N-desmethyl metabolite (active) and 5S-lactone (inactive) in cultured human hepatocytes [Fig. 4] (Martin et al., 2003). The N-desmethyl metabolite is sevenfold less potent than the parent drug, RSV and its formation is mediated by CYP2C9 and

CYP2C19. RSV was shown to minimally inhibit CYP2C9. It is primarily eliminated via the fecal route (90%) and only 10% is eliminated renally. About 72% of the absorbed dose is eliminated via biliary secretion and the remaining 28% via the kidneys. The plasma elimination half-life of RSV is approximately 20 hours (McTaggart et al., 2001a). As indicated earlier, it is a hydrophilic drug; RSV transport is facilitated into the liver by the organic anion transport polypeptide–1B1 (OATP1B1) which contributes to its low IC50.

19

1.3. Clinically relevant drug-drug interactions with HMG-CoA reductase Inhibitors

Studies showed that co-administration of cyclosporine alters the pharmacokinetics of statins such as simvastatin, lovastatin, pravastatin, fluvastatin, cerivastatin, atorvastatin, pitavastatin and RSV (Arnadottir et al., 1993; Asberg, 2003; Goldberg, 2002; Ichimaru et al., 2001;

Ichimaru et al., 2004; Olbricht et al., 1997; Regazzi et al., 1992; Simonson et al., 2004).

The mechanism of interaction is attributed to the inhibition of OATP1B1-mediated hepatic uptake. In a study performed by Schneck et al., an elevation in the plasma exposure of RSV was reported upon the co-administration of gemfibrozil. They further showed that this interaction was mediated due to the inhibition of OATP1B1 (Schneck et al., 2003).

However, in the case of interaction between cerivastatin and gemfibrozil, the mechanism of interaction is mainly due to the metabolism-dependent inhibition of CYP2C8 by gemfibrozil glucuronide (Shitara and Sugiyama, 2006a). Significant increases in the plasma exposure of simvastatin and lovastatin were observed upon their co-administration with a CYP3A4 inhibitor, itraconazole (Neuvonen et al., 1998; Neuvonen and Jalava, 1996), which is an anticipated interaction given that the statins are metabolized by CYP3A4.

1.3.1. Mechanism of interactions between Protease Inhibitors and Statins

The metabolism of all the currently marketed PIs is mediated by CYP3A4 and most of the

PIs are well known inhibitors of CYP3A4. Consequently, for statins which are metabolized by CYP3A4, co-administration of PIs can lead to significant increases in their plasma levels.

20

However, the extent of CYP3A4 inhibition by the PIs varies with the maximum effect caused by RTV or RTV-boosted PI combinations, followed by indinavir, nelfinavir, amprenavir and saquinavir (Fichtenbaum and Gerber, 2002). In subjects who were administered simvastatin (40 mg/day), atorvastatin (40 mg/day) or pravastatin (40 mg/day) along with the dual PI regimen saquinavir twice daily with RTV (SQV/rtv) (400 mg/400 mg), the PIs led to a dramatic increase in the area under the curve (AUC) of simvastatin acid

(active moiety of simvastatin) by 3000% and total atorvastatin (sum of atorvastatin and its active metabolites) by 79%. However, the AUC of pravastatin decreased by 59% in the presence of SQV/rtv (Fichtenbaum et al., 2002b). This could be due to the inhibition of

CYP3A4 by SQV and/or RTV as simvastatin and pravastatin are metabolized by CYP3A4 or due to the induction of UGT by RTV as pravastatin is majorly eliminated by UGT.

Pravastatin is also a substrate of the intestinal uptake transporter OATP1A2 and the aforementioned interaction with SQV/rtv could be due to the inhibition of OATP1A2 by

SQV and/or RTV (Shirasaka et al., 2010). In a study conducted by Aberg et al., the AUC of pravastatin decreased by 47% when given in combination with nelfinavir (Aberg et al.,

2006). Nelfinavir (1250 mg) when administered twice daily with either atorvastatin (10 mg once daily) or simvastatin (20 mg once daily), led to an increase in the AUC by 74% for atorvastatin and a 505% for simvastatin (Hsyu et al., 2001). Co-administration of lopinavir/rtv (400/100 mg twice-daily) led to a significant increase in the AUC and Cmax of

RSV (20 mg once daily) (Kiser et al., 2008a). This interaction may be due to the inhibition by lopinavir and/or RTV on BCRP at the level of absorption or by inhibiting OATP1B1 at the level of hepatic uptake of RSV. Sekar et al reported a significant increase in the AUC

21

and Cmax of pravastatin by 81% and 63% when co-administered along with DRV/rtv

(600/100 mg twice daily) (Back et al., 2008a).

1.4. Overview of Cytochrome (CYP) P450 enzymes

CYP 450 enzymes have an integral role in the biotransformation of many endogenous and exogenous substances including drugs by converting them to more polar and water soluble metabolites which are readily excreted from the body (Coon, 2005; Guengerich, 2006). The

CYP 450 family of heme monooxygenases encompasses phase 1 enzymes and are located on the endoplasmic reticulum of the liver (Nelson et al., 1996). They are also present in high concentrations in the enterocytes of small intestine and tissues such as kidneys, lung, brain etc. (Leucuta and Vlase, 2006b). These enzymes are classified by a 450 nm maximum absorption wavelength in their reduced state in the presence of carbon monoxide (Leucuta and Vlase, 2006a). Nearly 12 distinct CYP enzymes are present in the human liver and out of the 30 available isozymes; about 6 of them belonging to the families CYP 1, 2 and 3 are involved in the hepatic biotransformation (Leucuta and Vlase, 2006; Spatzenegger and

Jaeger, 1995).

The human CYP3A subfamily consists of CYP3A4, CYP3A5, CYP3A7 and CYP3A43 plays a predominant role in the metabolic elimination of drugs, endogenous molecules and xenobiotic compounds from the body. CYP3A4 is expressed in the liver (highly abundant,

~30%), small intestine (~80%), prostate, breast, gut and colon (Guengerich, 1999). CYP3A exhibits a 40-fold variation in its expression in liver and small intestine obtained from donor

22

tissues (Paine et al., 1997). It also exhibits a substantial interindividual variation in enzymatic activity. Among adults, CYP3A4 is the major CYP3A enzyme involved in the metabolism of >60% of all marketed drugs. As a fraction of the total CYP content, CYP3A4 is the most abundant isozyme expressed in the liver and small intestine (Lamba et al.,

2002b) (Ruzilawati et al., 2007). The CYP3A genes are located on chromosome 7q21-q22.1

(Itoh et al., 1992). The CYP3A enzymes CYP3A4, CYP3A5 and CYP3A7, have similar substrate affinities and are frequently expressed in the liver. CYP3A4 and CYP3A7 exhibit a contradictory pattern in their expression levels during development (Lacroix et al., 1997).

CYP3A7 is primarily expressed in the fetal liver up to 6 months of postnatal age, even though it is rarely expressed in adult hepatic and extra hepatic tissues (Stevens et al., 2003).

It plays an important role in the fetus for the metabolism of both endogenous substances (eg.

Steroids and retinoic acid) and xenobiotics from the maternal circulation (Rodriguez-Antona et al., 2005). Variabilities in its expression could lead to inter-individual variabilities in embryotoxicity and teratogenicity of different substances (Buratti et al., 2006). Conversely, the expression of CYP3A4/5 is very low during fetal life and reaches about half of the adult levels within a year after birth (de Wildt et al., 1999; Hines, 2007).

1.4.1. Mechanism of Induction and Inhibition

The mechanism of CYP3A4/5 induction is described as a slow regulatory process occurring at the transcriptional level thereby resulting in increased expression/activity of the protein.

The overall effect of CYP3A induction is an alteration in pharmacokinetics and pharmacodynamics (PK/PD) of substrate drugs (Dilger et al., 2000; Kolars et al., 1991).

23

This alteration in PK/PD is based on the duration of exposure to an inducer, protein localization and enzyme biosynthesis or degradation. CYP3A induction results in increased clearance and decreased efficacy/toxicity of the substrate or an increased toxicity due to reactive metabolite formation (Seeff, et al., 1986).

The transcription of CYP3A expression is regulated by an orphan nuclear receptor Pregnane

X receptor (PXR) (Lamba et al., 2002a) [Fig. 5]. When an exogenous or an endogenous ligand binds to the cytoplasmic PXR, it undergoes heterodimerization with 9-cis retinoic acid receptor (RXR) at the upstream promoter region of CYP3A gene. This complex is translocated to the nucleus of the cell, leading to an increased transcription of CYP3A gene

(Kliewer et al., 2002a, Baes et al., 1994; Willson and Kliewer, 2002). PXR ligands consist of drugs such as rifampicin, paclitaxel, nifedipine, phenobarbital, RTV, St. John’s Wort and endogenous compounds such as estradiol, corticosterone and bile acids. (Kliewer et al.,

2002). Additionally, the role of PXR in the regulation of additional phase 1 and 2 enzymes such as CYP2B6, CYP2C9, UDP-glucuronyltransferases (UGT) UGT1A1, 1A3, 1A4, 1A6, glutathione S-transferase A2 (GSTA2), and phase 3 enzymes/transporters namely P- glycoprotein (Pgp), multidrug-resistance-associated protein 2 (MRP2) and organic anion transporter polypeptide 2 (OATP2)) expression has been identified. (Burk et al., 2004;

Duanmu et al., 2002; Gardner-Stephen et al., 2004; Gerbal-Chaloin et al., 2001; Goodwin et al., 2001; Xie et al., 2003). Other nuclear receptors that are shown to mediate CYP3A induction include constitutive androstane receptor (CAR), vitamin D receptor (VDR) and farnesoid X receptor (FXR). Mechanisms such as increased mRNA stability or translational

24

efficiency and protein stabilization through posttranslational modifications may also lead to increased CYP3A expression (Lin and Lu, 2001).

Ligand Cytoplasm

RXR

PXR

PXR RXR

PXR RXR

CYP3A PXR -RE CYP3A4 enzyme

Drug Drug-OH

PXR- Pregnane X Receptor, RXR- Retinoid X Receptor, PXR-RE – Pregnane X Receptor

Response Elements

Figure 5: Schematic representation of ligand mediated PXR activation and CYP3A

induction

CYP3A inhibition is a frequent cause of clinically observed drug interactions, which requires tedious adjustments of dosing regimen and in some cases has led to market withdrawal of several drugs including terfenadine, mibefradil and cisapride (Lasser et al.,

25

2002). For example, inhibition of CYP3A led to severe rhabdomyolysis for statin drugs such as cerivastatin, atorvastatin and lovastatin (Madsen et al., 1996; Neuvonen and

Suhonen, 1995; Olkkola et al., 1993; Ozdemir et al., 1998; Wysowski and Swartz, 2005) and torsades de pointes or fatal ventricular arrhythmia upon co-administration of antifungals

(eg. ketoconazole) along with non-sedating anti-histamines terfenadine or astemizole

(Dresser et al., 2000).

CYP3A inhibition includes mechanisms involving reversible, quasi-irreversible and irreversible inhibition (Murray, 1997; Ortiz de Montellano, 1995; Vanden et al., 1995). The most frequent cause of drug-drug interaction involves reversible inhibition and occurs due to weak binding with the CYP enzymes (Lin and Lu, 2001). This type of inhibition can be further classified into competitive, non-competitive and mixed type of inhibition

(Rodriguez-Antona et al., 2002). In the case of mechanism based inhibition (irreversible), which exhibits a more potent and sustained inhibitory effect, the parent compound covalently binds to the catalytic active site of the enzyme leading to a metabolite intermediate that irreversibly inactivates the enzyme (Galetin and Houston, 2006; Polasek and Miners, 2006; Wang et al., 2005; Zhou et al., 2005). As it permanently inactivates CYP

450 enzymes, it is also called suicide inhibition. Several compounds may mediate their CYP3A4 inhibitory action via a combination of competitive and mechanism-based inactivation. For examples, the well-known CYP3A4 inhibitory activity of macrolide antibiotic, erythromycin, entails both competitive, albeit relatively weak, and potent irreversible inactivation of the enzyme. Conversely, it is a common practice to use low-dose

RTV, a typical pharmacoenhancement component, to achieve higher bioavailability when

26

included in highly active retroviral therapy, due to its potent and efficacious mechanism- based inhibition of CYP3A4 (Cooper et al., 2003).

1.4.2. Implications of DRV/rtv mediated CYP 450 induction/inhibition

Several studies have reported clinically significant drug-drug interactions with the combination of DRV/rtv. Studies showed that co-administration of ketoconazole with

DRV/rtv (400/100 mg bid) led to a significant increase in the AUC, Cmax and Cmin of ketoconazole (Sekar et al., 2008). RTV is the most potent CYP3A inhibitor among the clinically available PIs and is shown to increase the bioavailability of DRV by the significant inhibition of carbamate hydrolysis, isobutyl aliphatic hydroxylation, and aniline aromatic hydroxylation (Vermeir et al., 2009). In vitro studies with human liver microsomes revealed that pre-incubation of microsomes with RTV led to a significant increase in its inhibitory potency of CYP3A (von Moltke et al., 2000). RTV also inhibits other CYP 450 enzymes such as CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP 2D6 and

CYP2E1 (Preissner et al., 2010). RTV is commonly used as a pharmacokinetic booster in combination antiretroviral therapy typically at a dose of 100 to 200 mg per day, much lower than when originally used for treatment, due to its inhibition of CYP 3A4 activity.

27

1.5. Overview of Hepatic Uptake Transporters, OATP1B1 and OATP1B3

1.5.1. General Description

The SLCO genes encode human OATPs which belong to a superfamily of essential membrane transport proteins that facilitate the sodium-independent transport of a wide range of amphiphilic organic compounds. The solutes which are transported include bile acids, steroid conjugates, thyroid hormones, anionic peptides, numerous drugs and other xenobiotic substances (Tirona and Kim, 2002b). The members of this family are located on chromosome 12 and span from 30 to 310 kb in length and consist of 10 to 18 exons

(Pizzagalli et al., 2002). These are integral membrane proteins with 12 transmembrane domains and contain amino and carboxy terminals oriented in the cytoplasm (Tirona and

Kim, 2002a). The mechanism of transport appears to entail anion exchange by coupling the cellular uptake of substrate with the efflux of endogenous intracellular substances such as bicarbonate or reduced glutathione (GSH) as was shown in studies with OATP1B3

(Hagenbuch and Gui, 2008; Hagenbuch and Meier, 2003; Leuthold et al., 2009). Findings from several studies performed in vitro suggested that a lack of stimulation by a inwardly directed sodium gradient for the OATP transporters (Kullak-Ublick et al., 1997).

1.5.2. Substrate and Inhibitor Selectivity

OATP1B1 facilitates the transport of a diverse range of compounds such as bile acids; sulphate and glucuronate conjugates; thyroid hormones; peptides; and drugs such as methotrexate and HMG-CoA reductase inhibitors (Giacomini et al., 2010). OATP1B3 also

28

transports similar compounds such bile acids; monoglucuronosyl bilirubin;

bromosulphophthalein; steroid conjugates; the thyroid hormones T3 and T4; leukotriene C4;

and drugs such as methotrexate and rifampicin (Hagenbuch and Gui, 2008; Hsiang et al.,

1999; Konig, 2011; Leuthold et al., 2009). The substrate specificities of OATP1B1 and

OATP1B3 are listed in the Table 4.

Transporter Substrates Inhibitors Organs

OATP1B1/OATP-C, Bromosulphophthalein, Saquinavir, RTV, Hepatocytes OATP2, LST-1 oestrone-3-sulphate, lopinavir, rifampicin, (sinusoidal) (SLCO1B1) oestradiol-17β- cyclosporine glucuronide, statins, repaglinide, valsartan, olmesartan, bilirubin glucuronide, bilirubin, bile acids OATP1B3/OATP-8 Bromosulphophthalein, Rifampicin, Hepatocytes (SLCO1B3) cholecystokinin 8, cyclosporine, RTV, (sinusoidal) statins, digoxin, lopinavir fexofenadine, telmisartan glucuronide, telmisartan, valsartan, olmesartan, oestradiol- 17-β-glucuronide, bile acids

Table 4: Substrate specificities of OATP1B1 and OATP1B3. Adapted from: (Giacomini et

al., 2010).

29

1.5.3. Clinical Significance of OATP1B1 and OATP1B3 mediated drug-interactions

The transporters OATP1B1 and OATP1B3 are primarily expressed in the liver. The co- administration of cyclosporine led to a significant increase in the plasma concentration of statins such as simvastatin, lovastatin, pravastatin, fluvastatin, cerivastatin, atorvastatin, pitavastatin and RSV. However, the exact mechanism of interaction is not clearly ascertained as cyclosporine is an inhibitor of CYP3A4 and multiple transporters such as

Pgp. The interactions with pravastatin, pitavastatin and RSV may be mediated by the inhibition of the hepatic uptake transporter, OATP1B1 (Neuvonen, 2010; Shitara and

Sugiyama, 2006a), as they are not substrates of CYP3A4 and Pgp. In vitro studies performed using oocytes overexpressing OATP1B1 showed that gemfibrozil inhibited the uptake of

RSV with an IC50 value of 4 µM (Schneck et al., 2004b).

1.5.4. Decision trees for OATP1B1 and OATP1B3 inhibitor and substrate interactions

For the identification of OATP1B1 and OATP1B3 substrates, heterologous expression systems are considered. In addition, the criteria for establishing whether a new molecular entity is a substrate of an OATP, a detailed assessment of non-clinical (permeability, metabolism, tissue-to-plasma ratio in liver and other organs) and clinical data (dose linearity) should be completed to assess whether a pharmacokinetic study in humans is warranted [Fig 6] (Giacomini et al., 2010).

30

Is hepatic elimination an important route of elimination of new molecular entity? Clh > 0.3 Cltotal

Yes No

Does the compound have active hepatocytes uptake? Do the Hepatic clearance is not a drugs’ physiological properties (e.g. low passive permeability, sufficiently important high hepatic concentrations relative to other tissues, organic determinant of drug levels anion/charged at physiologic pH) support active liver uptake?

Yes Probably a poor or not substrate for OATPs

Investigate uptake transporters expressed in hepatocytes with inhibitors and/or transfected cell lines

If an OATP substrate, consider a clinical DDI study with single-dose rifampicin or cyclosporine as an inhibitor. Further consideration could be given to review clinical pharmacokinetics based on OATP genotyping

Figure 6: Decision tree for OATP Substrate. Adapted from (Giacomini et al., 2010)

To assess the inhibition potential of a new molecular entity towards OATPs, the uptake of a prototypical substrate such as oestradiol-17-β-glucuronide, a statin in a OATP1B1 or

OAT1B3 heterologous expression system is measured and the IC50 value is determined [Fig

7] (Giacomini et al., 2010).

31

Is the IC50 of the new molecular entity ≤10 times unbound Cmax?

Yes No

Is the AUC or Cmax of statin (e.g. RSV, pravastatin, pitavastatin) New molecular entity predicted to increase > 2 fold in presence of the new molecular probably not an in vivo entity using extrapolation (e.g. *R value > 2)? inhibitor of OATP

Yes No

Clinical DDI study with sensitive substrate (e.g. RSV, Clinical study may pravastatin, pitavastatin) not be needed

*R value is defined as 1+ (fu × Iin,max/IC50), in which Iin,maxis the estimated maximum inhibitor concentration at the inlet to the liver and is equal to: Imax + (Fa × Dose × ka/Qh). Imax is the maximum systemic plasma concentration of the inhibitor; Fa is the fraction of the dose of the inhibitor which is absorbed; ka is the absorption rate constant of the inhibitor; and Qh is the hepatic blood flow (1,500 ml per min).

Figure 7: Decision tree for OATP Inhibitor. Adapted from (Giacomini et al., 2010)

32

1.6. Overview of efflux transporters BCRP and MRP2

1.6.1. General Description

The BCRP transporter has only six transmembrane domains and hence is known as a half

ABC transporter (ATP Binding Cassette Transporter, ABCG2 gene) (Wakabayashi et al.,

2006). Several in vitro experiments, suggest that BCRP overexpression causes multidrug resistance in cancer cell lines. It is expressed in the tissues such as the GI tract, liver, kidney, brain endothelium, mammary tissue, testis and placenta (Doyle et al., 1998; Robey et al.,

2001). It plays a rate limiting role in the oral absorption and transport (eg. across the blood brain barrier, blood-testis barrier) of some compounds, which are the substrates for this transporter (Vlaming et al., 2009b). BCRP exhibits various physiological functions such as the extrusion of porphyrins from hematopoietic cells and hepatocytes, secretion of vitamin

B2 (riboflavin) and other vitamins (such as biotin and vitamin K) into breast milk (van

Herwaarden and Schinkel, 2006).

The MRP2 protein encoded by the gene ABCC2 also belongs to a superfamily of ABC

transporters and is also an important determinant of multi-drug resistance in tumor cells. It is

expressed in the apical (canalicular) part of the hepatocyte and plays an important role in the

biliary transport and mediates the transport of glucuronidated and sulfated salts (Jedlitschky

et al., 1996; Keppler, 2005). It was originally known as canalicular multispecific organic

anion transporter (cMOAT) due to its diverse substrate specificity (Taniguchi et al., 1996).

The family of human multidrug resistance proteins contains six members such as MRP1

33

(ABCC1), MRP2 (ABCC2, cMOAT), MRP3 (ABCC3), MRP4 (ABCC4), MRP5 (ABCC5)

and MRP6 (ABCC6). All the members of the MRP family are localized on the basolateral

membrane with the exception of MRP2 which is localized on the canalicular membrane. The

substrates include anticancer drugs such as vinblastine, glucuronic conjugates (e.g. bilirubin

diglucuronide), glutathione conjugates, leukotriene C4, uricosuric agents and antibiotics

(Jedlitschky and Keppler, 2002).

1.6.2. Substrate and Inhibitor Selectivities

BCRP plays a major role in the efflux of a diverse range of endogenous and exogenous

substrates across cellular membranes (Vlaming et al., 2009a) [Table 5]. Quantitative

structure activity relationship (QSAR) techniques revealed that one amine bonded to one

carbon of a heterocyclic ring; fused heterocyclic ring(s) and two substituents on a carbocyclic

ring of the fused heterocyclic ring(s) are important components for BCRP mediated drug interactions (Nicolle et al., 2009). Substrates of BCRP include protein kinase inhibitors such as imatinib; pitavastatin and phytoestrogens such as genistein, daidzein and coumestrol

(Enokizono et al., 2007; Hirano et al., 2005b)

In addition to many anionic conjugates, unconjugated amphiphilic anions are also transported by the MRP2 transporters. Some examples of the substrates transported include amphiphilic anions, conjugates of lipophilic compounds with glutathione, glucuronate, or sulfate, including cysteinyl leukotrienes, bilirubin glucuronosides, 17L-glucuronosyl estradiol, and sulfatolitho-cholyl-taurine as endogenous compounds (Konig et al., 1999b).

34

Transporter Substrates Inhibitors Organs

BCRP/MXR Mitoxantrone, Oestrone, Intestinal enterocytes, (ABCG2) methotrexate, 17β-estradiol, hepatocytes topotecan, fumitremorgin C (canalicular), kidney imatinib, irinotecan, proximal tubule, brain statins, sulphate endothelia, placenta, conjugates, stem cells, mammary porphyrins glands (lactating) MRP2/ABCC2, Glutathione and Cyclosporine, Hepatocytes cMOAT (ABCC2) glucuronide delaviridine, (canalicular), kidney conjugates, efavirenz, (proximal tubule, methotrexate, emtricitabine luminal), enterocytes etoposide, (luminal) mitoxantrone, valsartan, olmesartan, glucuronidated SN-38

Table 5: Substrate and Inhibitor Specificities for BCRP and MRP2 transporter proteins.

Adapted from: Giacomini et al., 2010.

1.6.3. Clinical significance of BCRP and MRP2 mediated drug-drug interactions

Recent studies have demonstrated that gefitinib increases the intracellular accumulation of

topotecan and results in increased cytotoxicity of anticancer agents; an interaction that is

likely mediated by the inhibition of the BCRP transporter function (Yanase et al., 2004).

Interactions between irinotecan and gefitinib were also previously reported (Koizumi et al.,

2004). The most substantial clinical effects are expected to be for drugs that have low

bioavailability and have narrow therapeutic index. Studies showed increased sulfasalazine

concentrations upon co-administration with indomethacin. The mechanism of this interaction

35

is due to increased sulfasalazine absorption from the small intestine by the inhibition of the

MRP2 transporter (Dahan and Amidon, 2010)

1.6.4. Decision trees for BCRP substrate and inhibitor mediated drug-drug interactions

In bi-directional transport assays, for BCRP overexpressing polarized epithelial cell lines, is the net flux of new molecular entity ≥2

Net flux ratio ≥ 2 Net flux ratio < 2

Is efflux significantly inhibited by 1 or more BCRP inhibitors? Poor or non-BCRP substrate

Yes No

Probably BCRP substrate Other efflux transporters are responsible for observed data

Complete an assessment of preclinical and clinical information to determine whether an in vivo DDI study is warranted

Figure 8: Decision tree for BCRP substrate mediated drug-drug interactions. Adapted from:

Giacomini et al., 2010.

A new molecular entity (NME) is deemed to be a potential BCRP substrate if the efflux ratio

(relative to positive control) (basal to apical (B-A) to apical to basal (A-B)) is ≥ 2 in an epithelial cell system that over-expresses BCRP. Additional confirmation that the NME may

36

be a BCRP substrate can be attained by the use of inhibitors and the flux ratio reductions should be greater than 50% (Giacomini et al., 2010). A NME is deemed to be a potential inhibitor [Fig. 9] if the net flux ratio of the BCRP probe substrate is reduced in the presence of the NME. Orally administered drugs which are utilized as in vitro efflux inhibitors present the challenge of taking into consideration both intestinal efflux and tissue efflux inhibition.

Zhang et al proposed that both the inhibitions need to be evaluated to determine in vivo inhibition, where [I]1 is the mean steady-state total Cmax at the maximum clinical dose, and

[I]2 is the theoretical maximal gastrointestinal concentration after oral administration of NME determined at its maximum clinical dose (mg) in a volume of 250 ml (Zhang et al., 2008).

Bi-directional transporter assay with a probe BCRP substrate in BCRP over-expressing cell lines.

Net flux ratio of a probe substrate decreases Net flux ratio of a probe substrate is not with increased concentrations of the affected with increased concentrations of the investigational drug investigational drug

Probably a P-gp inhibitor Poor or non-inhibitor

Determine Ki or IC50 of the inhibitor

[I]1/ IC50 (or Ki) ≥ 0.1 or [I]1/ IC50 (or Ki) < 0.1 or [I]2/ IC50 (or Ki) ≥ 10 [I]2/ IC50 (or Ki) < 10

An in vivo DDI study with a BCRP An in vivo DDI study with a BCRP substrate such as sulphasalazine or substrate such as sulphasalazine or RSV is recommended RSV may not be needed

Figure 9: Decision tree for BCRP inhibitor mediated drug-drug interactions. Adapted from:

Giacomini et al., 2010

37

1.7. Role of genetic polymorphisms in hepatic uptake and efflux transporters on PK/PD

of Statins

Several studies have documented alterations in inter-subject variability in the pharmacokinetics and pharmacodynamics of statins. Genomic variants associated with reduced functionality appear to significantly impair hepatic statin levels resulting in diminished lipid lowering efficacy. Studies have corroborated previously established role of genetic variations in the drug metabolizing enzymes and transporters associated with statin drug disposition. The extent of interaction with drug metabolizing enzymes and transporters is different across this class of compounds and is predominantly based on the drug’s hydrophobicity. The hydrophilic statins utilize active transport to get across biological membranes, whereas the more hydrophobic statins traverse via passive diffusion (Lennernas and Fager, 1997a). Hydrophobic statins are also better substrates for CYP metabolism and biliary excretion. Increased plasma concentrations of statins enhances the likelihood of adverse drug effects presented as myopathies including rhabdomyolysis (Morimoto et al.,

2004). However, as the biologic pathways that influence myopathies are yet to be determined, there is a dearth of association studies for the identification of candidate genes

(Laaksonen et al., 2006). This advocates the need for genome wide association studies in larger populations.

38

1.7.1. Pharmacogenomics of OATP1B1

Increased attention has been directed towards the role of solute carrier organic transporter

OATP1B1, which is largely responsible for active hepatic uptake of statins. Earlier studies

have assessed the role of two non-synonymous SNPs in OATP1B1, namely A388G

(OATP1B1 *1b) and T521C (OATP1B1 *5) in altering the plasma clearance of statins (Iwai

et al., 2004; Mwinyi et al., 2008). The OATP1B1*15 polymorphism exhibits variation at

388 A>G and 521 T>C positions. The frequencies of the OATP1B1 *1b allele in Caucasians,

African Americans, and Asians is approximately 40%, 75% and 60%, respectively (Tirona et

al., 2001b); Mwinyi et al., 2008(Nishizato et al., 2003). The frequencies of OATP1B1 *15 polymorphism is approximately 15%, 2% and 15% in Caucasians, African Americans, and

Asians, respectively (Tirona et al., 2001a); Mwinyi et al., 2008(Nishizato et al., 2003).

Nishizato et al investigated the association between OATP1B1 polymorphisms and the pharmacokinetics of pravastatin in Japanese subjects (Nishizato et al., 2003). The results showed that plasma concentration of pravastatin is higher in Japanese subjects with

OATP1B1*15. In subjects with *15/*15, the clearance is reduced compared to subjects with

OATP1B1 *b/*15 and OATP1B1 *b/*b even though the difference was statistically insignificant due to the small sample size. The OATP1B1 *b polymorphisms was shown to be associated with increased plasma clearance and reduced plasma concentrations compared to subjects with OATP1B1 *a/*a polymorphisms. However, this difference was not statistically significant and this may be associated with increased rate of hepatic uptake of statins (Tirona et al., 2001c)). Ho et al reported that the *15 variant was associated with a profound loss in the OATP1B1 activity which led to an impaired hepatic uptake of RSV (Ho

39

et al., 2006). The genomic impact on the disposition of compounds is frequently confounded

by numerous factors, such as involvement of multiple genes and number of allelic variants

and a clear correlation between genotype-phenotype is difficult to establish. However,

emerging evidence provides clear association of OATP1B1*15 (521T>C variant) on the

pharmacokinetics and efficacy of RSV. Some studies have also evaluated the effects of

T521C polymorphisms on lipid lowering response of statins and reported that the lipid

lowering effects of statins were decreased (Liao, 2007). Morimoto et al reported a correlation

between T521C polymorphisms and pravastatin and atorvastatin induced myopathy

(Morimoto et al., 2004).

1.7.2. Pharmacogenomics of BCRP

The interindividual differences in the intestinal expression and function of BCRP can

contribute to variability in drug bioavailability, exposure and pharmacological response of

statins. Several non-synonymous single nucleotide polymorphisms (SNPs) of the ABCG2

gene have been identified including ABCG2 34G>A (V12M) and 421C>A (Q141K). The

allele frequency of the 34 G>A SNP in European Americans and Asian Americans is approximately 2% and 15–20%. For the 421 C>A SNP which is more common, the allelic frequencies in European Americans and Asians are 14% and 35% (Zamber et al., 2003). In vitro studies have shown a reduction in efflux transport of the 421C > A variant, due to several factors such as low cellular expression, poor membrane sorting or altered activity of the BCRP protein (Mizuarai et al., 2004; Yanase et al., 2006). High RSV plasma concentrations and decreased clearance were observed in a study performed in healthy

40

volunteers for 421CA and 421AA groups than in the 421CC group (Zhang et al., 2006).

These findings are consistent with studies that confirmed the role of 421 C>A polymorphisms on diflomotecan pharmacokinetics (Sparreboom et al., 2004) or increased

risk of gefitinib-associated diarrhea (Cusatis et al., 2006). Hence, the BCRP polymorphims

are likely to have phenotypic associations for a number of drugs.

1.7.3. Pharmacogenomics of MRP2

MRP2 transporter is primarily expressed in the apical membrane of enterocytes, liver, and kidneys, and has shown to affect both absorption and elimination of drugs (Konig et al.,

1999a). In a study performed in 48 healthy Japanese subjects, C-24T (promoter), G1249A

(exon 10) and C3972 (exon 28) were frequently observed with an allele frequency of 18.8,

12.5 and 21.9%, respectively (Ito et al., 2001). G1249A is characterized by amino acid alterations from Val to Ile at 417, while C3972T is the synonymous mutation at codon 1324

(Ile1324Ile). The non-synonymous SNP at codon C2302T is associated with the Dubin–

Johnson syndrome (Konig et al., 1999a). Further studies are needed to elucidate the clinical impact of pharmacogenetic variability in MRP2.

41

2. CHAPTER TWO: SPECIFIC AIMS

2.1. Central Hypothesis:

The use of DRV with low-dose RTV is now established as a preferred approach to treat HIV strains that are resistant to first generation of PIs. Despite the improvement in overall antiretroviral efficacy, subjects treated with DRV/rtv do experience dyslipidemias, although the severity of the adverse effects may be somewhat lower relative to other PIs.

Additionally, since HIV is now considered a chronic ailment and with the aging HIV- infected population, many patients may also have age-related lipid imbalances, and are likely to need treatment for dyslipidemia while receiving PIs such as DRV and RTV.

Pharmacologic therapy with lipid-lowering agents, specifically HMG-CoA reductase inhibitors (statins) is recommended as a first-line therapy for the treatment of elevated low- density lipoprotein cholesterol (LDL-C) in HIV patients (Dube et al., 2003). Of various approved statins, however, only a few can be utilized in the HIV setting. Those drugs such as simvastatin and lovastatin that are exclusively metabolized by CYP3A4/5 are typically contraindicated in the presence of PIs since these enzymes are subjected to marked inhibition. For other statin drugs such as pravastatin, RSV, and pitavastatin that are minimally metabolized and are primarily cleared via biliary excretion, drug interactions may still result due to the impact of PIs on the activity and/or the expression of various influx/efflux drug transporters. Various PIs have a varying impact on the expression and activity of one or more biliary drug transporters such as OATP1B1, P-gp, BCRP and MRP2

(Dixit et al., 2007; Bachmeier et al., 2005). As such, the extent and the consequence of such

42

interactions are not easily predictable and need cautious clinical investigation. For instance, co-administration with lopinavir/ritonavir (400/100 mg twice-daily) did not significantly change pravastatin systemic exposure. However, when administered in combination with saquinavir/RTV (400/400 mg twice-daily), pravastatin AUC was reduced by 50%. Kiser et al reported a 2.1 fold increase in RSV AUC and a 4.7 fold increase in Cmax with attenuation of the LDL-lowering effects of RSV when given in combination with lopinavir/ritonavir

(400/100 mg twice-daily) (Kiser et al., 2002). Such pharmacokinetic interactions may have profound clinical impact as noted in a recent study where elevated risk of rhabdomyolysis was reported in patients with increased plasma concentrations of statins.

The pharmacokinetic interactions of DRV have not been comprehensively delineated. Its impact on multidrug transporters that affect the systemic absorption and clearance of therapeutic agents is not well understood. In one study, steady-state multiple dosing of

DRV/rtv (600/100 mg twice-daily) led to an 81% increase in the systemic exposure to pravastatin administered as a single 40 mg oral dose. A similar study noted only a 21% change in pravastatin AUC. Thus, while these studies raise concern that DRV and RTV administration may alter RSV pharmacokinetics, the extent and the mechanistic bases for the interaction may be different and needs to be delineated in a prospectively designed trial.

Thus, with these overall considerations, the goal of this dissertation research was to assess the potential clinical pharmacokinetic interactions between DRV/rtv and RSV and changes in the pharmacodynamic activity of RSV activity, as well as to discern the mechanism(s) of the postulated interaction via concurrently conducted correlative in vitro studies.

43

The central hypothesis of our study was DRV and/or RTV modulate the pharmacokinetics of

RSV by altering one or more pathways involved in its disposition.. To test the hypothesis, we pursued the following three specific aims.

2.2. Specific Aim 1: To investigate the effect of DRV, when given in combination

with a boosting dose of RTV, on the pharmacokinetics and pharmacodynamics of

RSV in healthy volunteers.

This aim was designed to evaluate the effects of DRV/rtv on the steady state plasma pharmacokinetics of RSV and also on the effect of RSV. In addition, the potential impact of

RSV on the steady state pharmacokinetics of DRV/rtv was examined to delineate if there drug-drug interactions were bidirectional. This study also included a pharmacodynamic assessment of HMG-CoA reductase inhibitor activity through the measurement of lipid levels. The study population were healthy HIV seronegative volunteers to avoid the unnecessary exposure of HIV-infected persons to a protease inhibitor combination that might not fully suppress viral replication. An exploratory objective was to assess the impact of genetic polymorphisms in transporters that contribute to RSV clearance such as

OATIP1B1, MRP2 and BCRP.

44

2.3. Specific Aim 2: To assess the influence of DRV on the expression and activity of

key phase 1 and 2 enzymes.

PIs have dual contrasting effects on the drug metabolism pathways. On one hand, DRV may induce enzyme expression; on the other hand it can exert inhibitory activity. For this purpose, we planned to employ primary human hepatocytes and human liver microsomes to assess its overall impact on the key enzymes such as CYP 3A4, 2C9 and UGTs. We also employed cell-based receptor assays to examine the PXR activation propensity of DRV.

PXR is an orphan nuclear receptor and is considered to be the master regulator of CYP3A4

(Goodwin et al., 2002), involved in regulating the transcription of numerous CYP/UGT isozymes and multidrug transporters such as P-gp (Xu et al., 2005).

2.4. Specific Aim 3: To examine the extent to which DRV and/or RTV modulate the

influx and efflux drug transporters that contribute to RSV disposition.

.

Among the OATP family transporters found on the basolateral membrane of the hepatocytes, OATP1B1 contributes predominantly to the hepatic uptake of RSV, with a small contribution from OATP1B3 (Kitamura et al., 2008). RSV is also a high affinity substrate for the efflux transporter BCRP localized on the liver canalicular cells and intestine. MRP2 has also been shown to contribute to the biliary elimination of RSV in sandwich-cultured rat hepatocytes (Jemnitz et al., 2010a). Pharmacokinetic interactions may therefore result from inhibition of RSV uptake into the liver by OATP1B1 or at the level of intestinal absorption/biliary excretion by BCRP and/or MRP2. In this study, we

45

focused on OATP1B1 as the hepatic uptake transporter for RSV and BCRP, MRP2 transporters responsible for its biliary clearance. In order to assess the drug-drug interaction between DRV and/or RTV and RSV in vitro, transfected cell lines over-expressing hepatic uptake (OATP1B1) and efflux transporters (BCRP, MRP2) were utilized to estimate the extent of inhibition of DRV and/or RTV on the uptake and/or efflux of RSV.

46

3. CHAPTER THREE: EXPERIMENTAL DESIGN AND METHODS

3.1. Specific Aim 1: Clinical Assessment of drug-drug interaction between DRV and/or

RTV on RSV in healthy volunteers.

3.1.1. Materials

3.1.1.1. Chemicals

RSV and RSV-d6 were obtained from Toronto Research Chemicals (Toronto, ON, Canada).

DRV and RTV were obtained from the NIH AIDS Research and Reference Reagent

Program (Maryland, USA). The HPLC-grade methanol, acetonitrile and ethyl acetate were purchased from Fisher Scientific (Santa Clara, CA). All other chemicals and reagents used were of the highest commercially available quality. TaqMan SNP assay components for each of the SNPs – OATP1B1 (c.521T > C, 388A>G), BCRP (c.421 C > A), MRP2 (c. -

24C>T, 1249G>A, 3972C>T) were procured from Applied Biosystems (Foster City, USA).

TaqMan Universal PCR Master Mix, and 384 well plates for PCR were procured from

Applied Biosystems (Foster City, USA)

3.1.1.2. Biologicals

The blank plasma samples for the determination of standard curves were obtained from

Hoxworth Blood Center (Cincinnati, OH).

47

3.1.2. Development and Validation of LC-MS/MS Method

3.1.2.1. Stock Solution and Calibration Standards

Stock solution of RSV was prepared by dissolving 1 mg of RSV in DMSO (1 mg/mL).The standard solutions were prepared in methanol. The Internal standard stock solutions of

RSV-d6 were also prepared similarly in methanol. The calibration standards were prepared by spiking appropriate volumes in plasma to yield final concentrations ranging from 0.5 to100 ng/ml for RSV. The standard curve of the assay for both DRV and RTV ranged from

5 to 10,000 ng/ml or both DRV and RTV with a LLOQ of 5.0 ng/ml for both the analytes.

All stock solutions and plasma standards were stored at −20oC until analysis.

3.1.2.2. Plasma Sample Processing

3.1.2.2.1. Rosuvastatin in Plasma

The blood samples were placed in a water bath immediately after collection, at 4ºC approximately and were centrifuged within 25 minutes of collection. Then, 2 mL of plasma was transferred into a pre-labeled tight-seal screw cap specimen storage tube and stored in a

-70º C freezer until analysis. RSV, and its internal standard, RSV-d6, were extracted from the human plasma using liquid-liquid extraction with ethyl acetate. The organic phase was separated by centrifugation and evaporated to dryness and the samples were reconstituted in

200 µl of methanol. Aliquots were analyzed using Thermo Scientific LTQ-FT™ liquid

48

chromatography/tandem mass spectrometer (LC/MS/MS) with electrospray source in the positive ion mode. The lower limit of quantification (LLOQ) was 0.2 ng/ml for RSV.

Method verification and confidence was established using blind quality control samples verified by reacquiring and analyzing the standards at the end of the sequence. Three concentration levels (1, 5, and 50 ng/mL) were prepared and the samples were run in triplicates. The lower nominal concentration of 1 ng/mL yielded a mean observed value of

1.4±0.1 (SD, n=3), with a CV of 3.8 % and an overall bias of 29 %. The nominal concentration of 5 ng/mL yielded a mean observed value of 3.8 ± 0.2 (SD, n=3), with a CV of 7.1 % and an overall bias of -25 %. The QCs of the higher concentration of 50 ng/mL were quantified at 43 ± 13 ng/mL (SD, n=3), with a CV of 1.9 % and an overall bias of

-0.4 % respectively.

3.1.2.2.2. Darunavir/ritonavir in Plasma

The analyses for DRV/rtv assays were performed at Johnson & Johnson Pharmaceutical

Research and Development Unit, Belgium. A validated- LC-MS/MS method was utilized for measuring DRV/rtv plasma concentrations. The drugs along with their respective internal standards were extracted from the human plasma using 0.01 M ammonium acetate and methanol (50:50) followed by centrifugation. Samples collected from the supernatant were analyzed using Triple Quadruple Mass Spectrometer API-4000 with Turbo-Ionspray™

Interface used in the positive ion-mode operated under the multiple reaction-monitoring modes (MRM). Precision and accuracy in quality controls were 13.6, 240 and 7,680 ng/ml and the reported accuracies were within 10% of the nominal concentrations.

49

3.1.2.3. LC-MS/MS Conditions

The HPLC separation for the analysis was performed using a Thermo Scientific® Surveyor

MS™ pump and Micro AS auto sampler. A partial-loop injection placed 5 μl of the sample onto a Waters® XBridge™ C18, 5 μM, and 2.1 x 100 mm column. Samples were eluted isocratically for the first five minutes by 50 : 50 water : acetonitrile with 0.1% HCOOH.

This step was followed by a minute quick gradient to 50:50 isopropanol: methanol that was held for an additional 5.33 minutes to wash non-polar material in the sample from the column. Then a quick minute gradient back to 50:50 water: acetonitrile 0.1% HCOOH was performed and held for 3.67 minutes for reconditioning the column for the next analysis.

The auto sampler tray was set at 10°C.

Analyses of RSV and the internal standard was performed using a Thermo Scientific LTQ-

FT™ with electrospray source. The source voltage was held at 5 kV with a capillary temperature of 275°C. Sheath Gas was set to 18 and Aux Gas set to 5. Collision induced dissociation (CID) isolation widths were set to 2.0 and the normalized collision energy was set to 30. All data was acquired in the positive ion mode. High mass accuracy measurements was performed in the Fourier transform ion cyclotron resonance (FT-ICR) portion of the

LTQ-FT™ with the resolution set at 25,000. The FT-ICR data provided verification and could be used to quantitate metabolites from previously acquired data should the need arise.

Quantitation using the tandem mass spectrometry data was collected in the linear ion trap simultaneously to the FT-ICR data collection. RSV was quantitated using the m/z 446.15 product ion from the protonated parent, m/z 482.18. The internal standard, d6-RSV was

50

quantitated using the m/z 452.19 product ion formed under collision-induced dissociation of the parent, m/z 488.21. The LC-MS/MS method developed offers the simultaneous determination of RSV and its internal standard RSV-d6 in a single run.

3.1.2.4. Data Analysis: Calibration Curves and Weighting

Thermo Scientific® Xcalibur™ 2.0 software was utilized to perform data analysis. The calibration standards were extracted and analyzed in duplicates. Calibration curves were generated daily based on the peak area ratios of the RSV to IS versus the concentration of

RSV respectively. A quadratic fit with 1/x2 weighting was used to fit the data.

3.1.3. Assessment of drug-drug interaction between DRV and/or RTV on RSV in

healthy volunteers

3.1.3.1. Subjects

A randomized, phase I, three period, open-label, controlled drug interaction study was performed to determine the effects of DRV and RTV on the pharmacokinetics and pharmacodynamics of RSV. The study was reviewed and approved by the University of

Cincinnati Institutional Review Board. And all the subjects signed informed consent. All participating subjects were HIV- seronegative men and non-pregnant women, to circumvent the suboptimal combinations of antiretroviral therapy to HIV-infected individuals because of the risk of developing drug resistance. The excluded subjects were the ones who tested

51

positive for HIV (tested using ELISA) or in urine pregnancy test, had renal (creatinine clearance ≤ 60 mL/min) or hepatic insufficiency (total bilirubin ≥1.1x ULN, alanine aminotransferase or aspartate aminotransferase ≥ 1.25 x ULN). Subjects with history or evidence of current use of alcohol, barbiturate, amphetamine, recreational or narcotic drug, concomitant medication, including investigational, prescription, and over-the-counter products and dietary supplements were excluded from the study. Cigarette smokers or the subjects who consumed tobacco products weren’t allowed to change their status during the length of the trial. Trial medications were discontinued in subjects who experienced grade 2 rashes. Based on power analysis, 12 healthy HIV seronegative men and women of age ≥ 18 and ≤ 60 years and who weighed > 50 kg and a Body Mass Index (BMI) ≥ 18.0 and ≤ 35.0 kg/m2 were required to participate in the study. Any subjects who failed to complete the trial or obtain necessary samples were replaced. Accrual took place from September 2008 through February 2009.

3.1.3.2. Study Design

The study subjects were randomized to either of the two treatment arms and the subjects made visits to the GCRC as per the following schematic [Fig.10]. RSV 10 mg daily was given to the subjects in arm 1 daily in the morning for 7 days. These subjects had intensive steady-state pharmacokinetic sampling on day 7. For RSV analysis, the blood samples were collected before dosing and at 0, 1, 2, 4, 8, 12, 24, 48 and 72 hours after the dose is administered. Following a 7-day washout period, subjects were administered DRV/rtv

600/100mg twice daily. Intensive pharmacokinetic sampling on day 21 (steady-state) was

52

again performed on these subjects for DRV/rtv analysis before dosing and at 0, 1, 2, 4, 8, 12,

48 and 72 hours after the dose is administered. After a 7-day washout period, RSV and

DRV/rtv were co-administered starting on day 29. Intensive pharmacokinetic sampling was performed on day 35 (steady-state) for DRV/rtv and RSV analysis prior to dosing and at 0,

1, 2, 4, 8, 12, 24, 48 and 72 hours post-dose. The treatment sequence was reversed in subjects randomized to arm 2: DRV/rtv alone, RSV alone and DRV/RTV along with RSV with pharmacokinetic sampling and washout similar to arm 1. All the study medications were administered with food throughout the study.

Figure10: Schematic of the Study Design

3.1.3.3. Pharmacokinetic Analysis

The steady-state AUC[0,τ] for RSV, DRV and RTV were quantified by calculating the AUC of the drugs from pre-dose to end of the dosing interval The AUC [0,τ] was determined employing the linear trapezoidal rule by non-compartmental analysis using WinNonLin 5.2 53

(Pharsight Inc., Corporation, Mountain View, CA). The oral systemic clearance (CLS/F) was determined as dose divided by AUC [0,τ]. The time to peak plasma concentration Cmax, time to Cmax (Tmax) and Cmin were determined visually. The terminal elimination half-lives (t1/2) were calculated as 0.693/λz, where λz is the terminal elimination rate constant. The steady- state pharmacokinetic parameters of RSV alone or DRV or RTV alone were obtained on days 7-10, or 21-24 and following the co-administrations of DRV/rtv and RSV at steady- state were obtained on days 35-38. The steady-state AUC was determined over a 24 hour period (AUC0-24hr) for RSV and over a 12 hour period for DRV and RTV.

3.1.3.4. Lipid Measurements

The fasting lipid levels such as total cholesterol, triglycerides, high density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) were measured at baseline, and on days 7, 21, 35 and 45 using spectrophotometry at the local Quest

Diagnostics laboratory.

3.1.3.5. DNA Isolation and Quantitation

A separate blood sample for genetic analysis with explicit consent of each subject was obtained and peripheral blood mononuclear cells (PBMCs) were isolated from these samples employing ficoll-1077 density gradient. Isolated PBMCs were then placed in 2 ml tubes containing EDTA and frozen at -700C. For DNA isolation the samples were thawed and centrifuged for 5 minutes and the supernatant was separated from the sample. After washing with PBS, the samples were re-centrifuged for 5 minutes and the supernatant was removed. 54

Lysis buffer followed with proteinase K and protein precipitate were added to the samples after the centrifugation step and vortexed. The samples were centrifuged for a further 5 minutes. After this step, the supernatant was emptied into a new 1.5 mL tube containing isopropanol and glycogen. After thorough mixing, the samples were centrifuged for 1 minute, supernatant was discarded and then the samples were washed with 100% ethanol.

The sample was re-centrifuged again for 1 minute, supernatant was discarded and the samples were dried at room temperature for 20 minutes. To the dried samples, hydration solution was added. The purity of isolated DNA for each sample was quantitated using the

Nano Drop spectrophotometer (Nano Drop Technologies) utilizing a 260/280 nm ratio to evaluate the DNA purity. The ratio of 260/280 was between1.8-2.0 for all the samples.

3.1.3.6. Polymerase Chain Reaction (PCR)

For TaqMan assays, 7 µL of 5 ng/µL of DNA was used to obtain a genotype. The samples were diluted down to 5 ng/µL. The diluted samples were placed in a 384 well plate along with a Master Mix for PCR analysis. The master mix contained the assay, the probe and water. 7µL of sample was placed into the 384 well plates and then dried at 95°C. 5 µL of the Master Mix was then dispensed into the plate and the PCR was run at TAQMAN 58

(usually the optimal temperature for a TaqMan). After the completion of PCR, the plate was read on the AB 7900 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA).

The AB 7900 completed a post read and the software picked up the fluorescent dyes, the

VIC and FAM of the assay and reported the results.

55

3.1.3.7. SNP analysis of OATP1B1, BCRP and MRP2

We genotyped for OATP1B1 c.521T > C, 388A>G, BCRP c.421 C > A, MRP2 c. -24C>T,

1249G>A, 3972C>T variants (63396T>C, -24381A>C, -25385C>T) that have been

previously known to modulate the activity of these transporters using TaqMan SNP

chemistry with the following primers [Table 6] (Mwinyi et al., 2008, Yanase et al., 2006,

Niemi et al., 2006).

Gene SNP Forward Primer 5’-3’ Reverse Primer 3’-5’

SLCO1B1 521T>C CAGCATAAGAATGGACTAATACACC TGGACCAATCATTGCTATTG

SLCO1B1 388A>G GGGGAAGATAATGGTGCAAA CGGCAGGTTTATCATCCAGT

ABCG2 421 C>A GTTGTGATGGGCACTCTGATGGT CAAGCCACTTTTCTCATTGTT

ABCC2 1249 G>A TGGAGGCAAGAAGTCACAGT GATTACAAGCACCATCACCC

ABCC2 24 C>T CCTTTACGGAGAACATCAGA TTTGCATTACATTTCCCAGA

Table 6: Primer Sequences for OATP1B1 (SLCO1B1 gene), BCRP (ABCG2 gene) and

MRP2 (ABCC2 gene) transporter SNPs.

3.1.3.8. Statistical Analyses

The sample size calculation to assess this drug-interaction was based upon a two-sided

paired t-test, with >95% power for RSV AUC[0-24hr] and Cmax, such that the 90% confidence

interval for the geometric least square (GLS) means ratio would be contained within the

interval 0.7 to 1.5. A paired t-test was used to compare the log transformed steady-state

56

AUC(0-τ), CLs/F, Cmax, Tmax and Cmin results for RSV alone or DRV/rtv alone. 90% confidence intervals and GLS means were determined for RSV, DRV and RTV PK parameters. Wilcoxon signed rank test was used to compare elimination half-lives. All the statistical analyses were performed using JMP®8.0 and the P-values < 0.05 were considered statistically significant.

The analyses for the secondary endpoints which included the changes in lipid levels from baseline to the exposure to DRV/rtv, RSV or the combination at day 7 or 21 and day 35 were performed using SAS for PC 9.1.3. Non-parametric paired tests were utilized to make multiple comparisons.

3.2. Specific Aim 2: Assessment of the influence of DRV on the expression and activity

of key phase 1 and 2 enzymes.

3.2.1. Materials

3.2.1.1. Chemicals

DRV and RTV were obtained from NIH AIDS Research & Reference Reagent Program.

All PCR-reagents, fetal bovine serum and dimethylsulfoxide (DMSO) were obtained from

Fisher Scientific (Hampton, NH). ECL detection system for western blotting was obtained from GE Healthcare (Amersham Biotech, Piscataway, NJ). Enzyme specific antibodies for

CYP3A4 and P-gp were obtained from BD Biosciences (Gentest Corp, Woburn, MA).

57

William’s E medium was obtained from Caisson Labs Inc. (Rexburg, ID). The HPLC-grade methanol, acetonitrile, hexane and butanol were purchased from Fisher Scientifics (Santa

Clara, CA). All other chemicals and reagents used were of the highest commercially available quality.

3.2.1.2. Biologicals

Plated primary human hepatocytes were obtained from the Liver Tissue Procurement and

Distribution System (Pittsburgh, PA) and were isolated from lobes of liver from 3 separate donors.

3.2.2. Primary Cultures of Human Hepatocytes

Hepatocytes were cultured and maintained in Williams' Medium E (Bio Whittaker,

Walkersville, MD). For the determination of CYP3A4 activity and immunoreactive protein levels, cells were plated in T-25 cm2 flasks. Cells were plated in collagen-coated 6-well plates (1 x 106 cells/well) for RT-PCR analysis of CYP3A4-specific messenger RNA

(mRNA). Plates containing cells coated with collagen in a 24-well format (1.25 x 105) was used for the determination of 3-[4, 5-dimethylthiazol-2-y] 2, 5-diphenyl-tetrazolium bromide

(MTT) assay.

58

3.2.3. Drug Treatment

Stocks of drug solutions (1000x) were prepared in DMSO and were diluted prior to use.

After forty eight hours of isolation and plating, hepatocytes were treated with the drug free medium, the vehicle that contained 0.1% DMSO, DRV (0.5, 1, 5, 10 and 25 μM), or rifampicin (10 μM), for 72 hours. Drug-containing medium was replaced every 24 hours throughout the 72-hour period.

3.2.4. Cell Viability Assessment by MTT Assay

Cell viability was assessed at the end of drug treatment by using the MTT assay as reported earlier. Briefly, cells were incubated for four hours at 37°C with 50 μl (10% v/v) of 5 mg/ml

MTT. The media was then completely replaced from the plate with 200 μl of DMSO to extract the formed MTT formazan crystals. A 100 μl aliquot from each well was transferred to a 96-well plate and absorbance of the formed formazan MTT was determined using

Spectra Max 250 spectrophotometer (Molecular Devices Corp., Sunnyvale, CA) at a wavelength of 540 nM. The samples were diluted with DMSO to obtain a linear reading in the reported absorbance values

59

3.2.5. Protein Assay

Microsomal protein levels for western blotting were determined using Bio-Rad protein assay reagents (Bio-Rad Laboratories, CA) based on method of Lowry(LOWRY et al., 1951).

Standard curves were generated using bovine serum albumin (BSA) at concentrations 0,

0.125, 0.25, 0.5, 0.75, and 1.0 mg/ml. 5 μl of standard reagents and samples were added in duplicates into a 96-well plate. 25 μl of reagent A´ (containing1 part of reagent S and 50 parts of reagent A) was then added to each well. Then to each well, 200 μl of reagent B was added. The plate was the incubated for 15 minutes and absorbance was measured at a wavelength of 750 nm using Spectra Max 250 spectrophotometer (Molecular Devices Corp.,

Sunnyvale, CA) and the data was analyzed using SoftMax Pro v4.6 software.

3.2.6. Quantitation of CYP3A4 Activity

Forty-eight hours after isolation and plating, hepatocytes were treated with the vehicle, which contained the same amount of DMSO (0.1%), DRV (0.5, 1, 5, 10 and 25 µM), rifampin (10 µM) for 72 hours At the end of the 72-hour drug treatment period, the drug- containing medium and the cells were incubated in drug-free medium for 4 hours. Cells were exposed to 250 µM of testosterone in William's E medium (1 mL/well) for 30 minutes. At the end of 30 min incubation, this medium was collected. The rate of formation of 6ß- hydroxytestosterone from testosterone catalyzed by CYP3A4 was determined to assess the enzyme activity. To the above medium, 25 µL of 11 - hydroxyprogesterone (1 µg/10 µL) was added, as an internal standard for quantitation using HPLC. Samples (1 mL) were

60

extracted using 2.5 mL of dichloromethane and dried under nitrogen. The residue was then reconstituted in mobile phase (60:40 v/v methanol/water) and 6ß-hydroxytestosterone levels were determined. Samples were separated using a C18 µ - bondapak column (3.9 x 30 mm) with a Waters 510 pumps with a Waters 486 UV/VIS detector at a wavelength (λ) of 254 nm. The samples were run with a 60:40 methanol/water mobile phase at a flow rate of 1 mL/min. The total run time was 30 minutes, with 6ß-hydroxytestosterone, 11 - hydroxyprogesterone (internal standard), and testosterone eluting at 7.9, 11.2, and 16.4 minutes, respectively.

3.2.7. Quantitation of P-gp Activity

For the assessment of the P-gp inductive activity, cells were treated with DRV at a concentration range of 0.5, 1, 5, 10 and 25 µM for 72 hrs. The prototypical P- gp inducer rifampicin was used as a positive control. Drug-containing medium was then removed and cells incubated in drug-free medium for 1 hour. The plates were then divided into two groups. One group of cells received CsA (25 μM) and incubated for 30 min; the other group remained in drug-free medium during this period. Both groups of cells were then treated with Rh123 (20 μM) for 2 hours. The Rh123-containing medium was then discarded and the cells were washed three times with fresh medium. The cells were washed again with cold

PBS three times and lysed with Reporter Lysis Buffer (RLB) for 30 min. Rh123 in the lysate was then quantified by fluorescence measurement at 485/530 nm (excitation/emission). The change in Rh123 levels relative to control (0.2% DMSO) were plotted against drug concentrations.

61

3.2.8. Determination of Enzyme/Transporter-Specific mRNA Levels

TRIzol reagent was employed to isolate total cellular RNA from control and drug-treated hepatocytes. Purified RNA concentration was determined by a spectrophotometer using the

260/280 nm absorbance ratio (ratio of 1.8 to 2.0). TaqMan reverse transcription reagents

(Applied Biosystems) were used to reverse-transcribe total RNA (0.5 μg) into cDNA using according to the manufacturer's instructions. The generated cDNA was used for real-time quantitative PCR (qPCR) analysis and qPCR assays were carried out using gene-specific primers. The real-time reaction contained 10 μl of 2× TaqMan Universal PCR Master Mix

(Applied Biosystems), 10 ng of RNA equivalent cDNA, and primers (200 nM) and probes

(100 nM) in a final volume of 20 μl and GAPDH as the endogenous control The reactions were conducted as follows: 95°C hot start for 10 min, followed by 40 cycles at 95°C for 15 s and then 60°C for 60 s. Amplification products were detected using SYBR green I and samples were analyzed in duplicates. The mRNA levels of each test gene were normalized to GAPDH, according to the following formula: CT (test gene) - CT (GAPDH) =ΔCT.

Subsequently, the relative mRNA levels of each gene were calculated using the ΔΔCT method: ΔCT (test gene) -ΔCT (test gene in the DMSO control) =ΔΔCT (test gene) and the fold-changes of mRNA levels were expressed as the relative expression 2-ΔΔCT.

3.2.9. Cell based receptor activation assay

LS180 cells were used for this assay. These cells were seeded into 24-well plates at a seeding density of 2 × 105 cells/well. Following 24 hrs of cell plating, transfection was

62

performed overnight using Lipofectamine and Plus reagent, as per the manufacturer's protocol. The transfection mixture included 100 ng of human PXR expression vector (pSG5- humanPXR), 400 ng of luciferase reporter gene construct (XREM-CYP3A4 -tk-luc), and

400 ng of pCH110 (an expression vector containing β-galactosidase cDNA under T7 promoter). After overnight transfection, the plasmid-containing media was removed and fresh DRV (10 µM) or DMSO-containing (control) media was added and incubated for a 48 hr period. The concentration of DMSO (0.1% v/v) was kept constant in the drug and the

DMSO containing samples and rifampin (10 μM) was employed as a positive control. After the 48 hr period, the cell layers were subjected to twice washing with ice-cold PBS (pH 7.4), followed with cell scraping and 200 μl aliquots were collected in a reporter lysis buffer provided with the β-galactosidase assay system (Promega). For the determination of luciferase activity, ten microliters of the cell lysate was used with a Luciferase Assay

System (Promega). 50 μl of cell lysate was used to determine the β-galactosidase activity and the resultant activity was used as an endogenous control for the Luciferase activity and expressed as fold activation with respect to the solvent (0.2% DMSO)-treated controls.

3.3. Specific Aim 3: To examine the extent to which DRV and/or RTV modulate the

influx and efflux hepatic drug transporters.

3.3.1. Materials

63

3.3.1.1. Chemicals

RSV calcium salt was obtained from Toronto Research Chemicals, Toronto, ON, Canada).

DRV and RTV were obtained from NIH AIDS Research & Reference Reagent Program

(Germantown, MD). [3H] Prazosin (70 Ci/mmol) and [3H(G)] RSV calcium (10 Ci/mmol) were obtained from American Radiolabeled Chemicals (St. Louis, MO). Fetal bovine serum and dimethylsulfoxide (DMSO) were obtained from Fisher Scientific (Hampton, NH).

Rhodamine 123, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) and

Cyclosporine A were purchased from Sigma-Aldrich (St. Louis, MO). Fumitremorgin–C

(FTC) was purchased from Alexis Biochemicals (San Diego, CA). All other chemicals and reagents used were of the highest commercially available quality.

3.3.1.2. Biologicals

The OATP1B1 transporter expressing and vector transfected CHO cells were kindly donated by Dr. Bruno Stieger, Division of Clinical Pharmacology and Toxicology, University

Hospital Zurich, Zurich, Switzerland. Plated primary human hepatocytes were obtained from the Liver Tissue Procurement and Distribution System (Pittsburgh, PA) and were isolated from lobes of liver from 3 separate donors.

64

3.3.2. Inhibitory effect of DRV and RTV on BCRP-mediated Prazosin Uptake

Stably transfected Madin-Darby Canine Kidney (MDCK) cells with the human ABCG2

2 (MDCK BCRP) gene were seeded at 500,000 cells/cm on 12 well plates. These cells were maintained in high-glucose DMEM supplemented with 10% fetal bovine serum, 0.1 mM non-essential amino acids, 2 mM L-glutamine solution, pencillin/streptomycin (100 IU/ml), and incubated at 37º C in a humidified 5% CO2, 95% air atmosphere.

For assessment of BCRP function, uptake of [3H]- prazosin (1.0Ci/μl, 10 μl), a well-known

BCRP substrate, was carried out. After 48 hours of culture, briefly the cells were pre- incubated for 15 minutes with the inhibitors DRV (at concentrations of 1, 5, 10, 25, 50, 75,

100, 250 and 500 μM) or RTV (at concentrations of 1, 5, 10, 25, 50, 75, 100, 250 and 500

μM) or fumitremorgin C (FTC; 10 μM), a specific BCRP inhibitor. The effects of RTV (1 and 25 μM) in combination with the aforementioned concentrations of DRV were also determined. The uptake was initiated by the addition of [3H]- prazosin and was terminated after 2 hours by the addition of ice cold HBSS. Cells were then lysed by the addition of 700

μl of 1 N NaOH. 62 μl of 10N HCL was added to each well at the end of 24 hrs to neutralize pH. 100 μl aliquots were taken from each well and the radioactivity in these samples was determined by liquid scintillation counting. A 25 μl aliquot of the cell lysate was used to determine protein concentrations by the method of Lowry et al (1951), with bovine serum albumin as the standard. The uptake of radiolabeled prazosin was normalized to the amount of protein and expressed as the uptake volume (microliters per milligram of protein), determined as the amount of radioactivity associated with the cells (disintegrations per

65

minute per milligram of protein). IC50 values were determined from the GraphPad Prism version 5.00 for Windows, GraphPad Software (San Diego, California, USA) by plotting the log inhibitor concentrations against the net uptake rate and nonlinear regression analysis using Inhibitory effect model, using the following equation:

66

were then lysed by the addition of 700 μl of 1 N NaOH. 62 μl of 10N HCL was added to each well at the end of 24 hrs to neutralize pH. 100 μl aliquots were taken from each well and the radioactivity in these samples was determined by liquid scintillation counting. A 25

μl aliquot of the cell lysate was used to determine protein concentrations by the method of

Lowry et al (1951), with bovine serum albumin as the standard. The uptakes of radiolabeled

RSV were performed in triplicate and evaluated as described above. IC50 values were determined by plotting the log inhibitor concentrations against the net uptake rate and nonlinear regression analysis using Inhibitory effect model.

3.3.4. Determination of Protein Concentration

Total protein was determined using the calorimetric Pierce BCA protein assay kit (Thermo

Scientific, Rockford, IL) with quantification at 562 nm using the Kinetic Vmax Microplate

Reader (Molecular Devices Corp., Menlo Park, CA). The standard curve and data were analyzed with SoftMax Pro v4.6.

3.3.5. Determination of Kinetic Parameters

Kinetic analysis for the uptake of RSV was performed in a substrate concentration range of

0.005 µM to 50 µM. Prior to the initiation of these experiments, the linearity of cellular uptake over time was determined for the CHO cells. Cellular uptake rates were determined by normalization for incubation time and protein content. Kinetic parameters, Km and Vmax,

67

were calculated using the Michaelis-Menten equation V = Vmax x S/ ( Km + S) and Graph Pad

Prism version 5.00 for Windows, Graph Pad Software, San Diego California USA.

3.3.6. Statistical Analysis

All statistical analyses were conducted using JMP® for Windows v9.1. Data were reported as mean ± SD. The difference in the fold change in BCRP, P-gp and OATP1B1 activity between untreated vehicle control and treated groups were analyzed using ANOVA, followed by Tukey’s test to compare the mean values of observations from control and drug treatments. A p<0.05 was determined to be statistically significant.

68

4. CHAPTER FOUR: RESULTS

4.1. Specific Aim 1: Clinical Assessment of drug-drug interaction between DRV and/or

RTV on RSV in healthy volunteers.

In this specific aim, clinical evaluation of the postulated interaction of DRV when given with RTV on the RSV PK following steady-state administration of these compounds was carried out. This was an open-label, randomized trial conducted in healthy volunteers.

4.1.1. LC-MS/MS method development for quantitation of RSV

4.1.1.1. Chromatography

The chromatographic conditions including the mobile phase composition, elution conditions for the gradient, range of assay concentrations, use of internal standard and extraction procedure and recovery were optimized to achieve specificity and high sensitivity for the compounds. Typical chromatograms for a blank plasma spiked with RSV and d6- RSV are shown in [Fig. 11]. The total chromatographic run time was 16 minutes. The retention times for RSV and d6- RSV were 2.26 and 2.27 minutes, respectively. No interference peaks were observed for either the analyte or the internal standard in plasma samples. The mass transitions monitored for RSV and the internal standard, d6- RSV were m/z 482.18 →

446.15 and m/z 488.21 → 452.19, respectively.

69

a

b

c

d

Figure11. Typical chromatograms of (a) and (c) blank plasma samples; RSV (b) and d6-

RSV (d) spiked in human plasma samples

4.1.1.2. Linearity of Calibration Curves

The linear regression of the peak area ratios versus concentrations was fitted over the concentration range of 0.5 to 100 ng/ml for RSV in human plasma. Each calibration curve was run in duplicate and a representative plot is shown in [Fig.12]. The plots of RSV/ d6-

RSV peak area ratios versus concentrations (range 0.5 to 100 ng/mL) were fitted employing

70

regression analysis. The mean curve was fitted employing quadratic weighting using a weighing index of 1/X2 with an overall fit of R2 = 0.9956.

Rosuvastatin

12 Y = 0.0280883+0.0969224*X+0.000151539*X^2 R^2 = 0.9956 10

8

6 Area Ratio 4

2

0 0 20 40 60 80 100 ng/ml

Figure 12: Calibration curve for the analyte RSV in human plasma, using RSV- d6 as the internal standard (IS).

The standard curve of the assay ranged from 5 to10,000 ng/ml for both DRV and RTV with a LLOQ of 5.0 ng/ml for both the analytes. Precision and accuracy were measured in quality controls at 13.6, 240 and 7,680 ng/ml and all accuracies were within 10% of the nominal concentrations. The correlation coefficients of the calibration curves for DRV and RTV were r2= 0.99

71

4.1.2. Drug-drug interaction between DRV and/or RTV on RSV in healthy volunteers

The pharmacokinetic interactions of DRV have not been clearly delineated. Sekar et al reported an 81% increase in the systemic exposure of pravastatin (40 mg single oral dose) when administered in combination with steady-state dosing of DRV/rtv (600/100 mg twice- daily) (Sekar et al., 2007). This raises the possibility of a similar interaction with RSV which led to the current study in which we investigated the potential pharmacokinetic interactions between DRV/rtv and RSV and changes in pharmacodynamic activity of RSV measured by changes in circulating lipid levels.

4.1.2.1. Demographics of enrolled subjects

Of the 20 subjects screened for the study, 12 of them completed all three phases of the study.

Elevated triglyceride levels were observed during screening in one subject and hence the subject did not qualify to participate further. Two subjects were screened but elected not to participate further. Out of 17 subjects randomized to the study treatment, 1 subject withdrew consent due to the absence for the baseline visit. Another subject was withdrawn after day 7 due to the failure of compliance with the study guidelines. Additionally, 3 subjects reported adverse skin rashes and were withdrawn from the study based on the instructions in the study protocol. Thus, 12 subjects completed all the 3 phases of the study. 6 of the 12 enrolled study subjects were females. 91.7% of the subjects were Caucasian and of non-

Hispanic origin and the remaining 8.3% were Asian. The median (25-75% inter-quartile

72

range) age and body mass index (BMI) of the enrolled subjects was 25 years (23-49 years) and 27.9 kg/m2 (24.2-30.5 kg/m2) respectively [Table 7].

Median Age 25 years 25-75% interquartiles (23-49) Gender Female 50% Male 50% Body Mass Index 27.9 25-75% interquartiles (24.2-30.5) Race/Ethnicity White, non-hispanic 91.7% Asian 8.3% Median Cholesterol 202 mg/dL 25-75% interquartiles (148-212) Median HDL-C 48 mg/dL 25-75% interquartiles (42-58) Median LDL-C 108 mg/dL 25-75% interquartiles (89-133) Median Triglycerides 99 mg/dL 25-75% interquartiles (54-181) Median non-HDL-C 141 mg/dL 25-75% interquartiles (101-161)

Table 7: Baseline Characteristics of 12 Subjects enrolled in the study.

4.1.2.2. Pharmacokinetic Analyses

Parameters measuring the steady-state pharmacokinetics of RSV alone or DRV/RTV alone and the combination were calculated using WinNonLin 5.2 (Pharsight Inc., Corporation,

Mountain View, CA). The steady-state mean concentration versus time profiles of RSV in the presence and the absence of steady-state DRV/rtv dosing were plotted. [Fig. 13]. The individual and mean pharmacokinetic parameters for RSV are listed in [Table 8]. Upon the co-administration of DRV/rtv, there was a significant increase in the AUC [0-24hr] and Cmax of

73

RSV. All 12 subjects demonstrated an increase in the Cmax of RSV (treatment ratios ranged from 1.1 to 8.2 fold) and 11 out of 12 subjects experienced an increase in the AUC[0-24hr] (1.1 to 2.4 fold) of RSV in the presence of DRV/rtv. The Cmax values (geometric means) increased by approximately 2.4 fold (P < 0.001; 90% confidence interval, 1.6 - 3.6 fold) and those of AUC[0-24hr] increased by 1.5-fold (P =0.03; 90% confidence interval, 1.0 - 2.1 fold).

The median Tmax values of RSV showed a decline from 4 hrs to 3 hrs (P=0.09) and there was a 1.4 fold (P=0.04) increase in the Cmin values. The total apparent oral clearance (CLS/F) for

RSV exhibited a non-significant decrease by 0.7 fold (P= 0.06) in the presence of DRV/rtv.

No significant change in the arithmetic mean half-lives of RSV (14.5 and 17.0 hrs; P=0.23) were observed in the absence and the presence of DRV/rtv, respectively [Table 9, 10].

However, substantial inter-subject variability was observed in the presence and the absence of the co-administered drug. In contrast to the observed changes in RSV pharmacokinetics, there were no significant changes apparent in the steady-state pharmacokinetics of DRV or

RTV pharmacokinetics in the presence of steady-state dosing of RSV [Figs. 14, 15]. The

Cmin values decreased non-significantly by 0.8 fold (P=0.19) for DRV and 0.7 fold for RTV

(P=0.19).

74

Figure 13: Steady-state RSV pharmacokinetics following administration of 10 mg daily doses for 7 days in the absence ((black circles, dotted line)) and in the presence (open squares, solid line) of DRV/RTV (600/100mg b.i.d) for 7 days.

75

Table 8: Steady state RSV Pharmacokinetics in individual subjects with and without

DRV/r

76

Figure 14 Steady-state DRV pharmacokinetics following DRV/RTV (600/100 mg b.i.d.) for

7 days in the absence (black circles, dotted line) and presence of RSV (10 mg daily) for 7 days (open squares, solid line).

Figure 15: Steady-state RTV pharmacokinetics following DRV/RTV (600/100 mg b.i.d.) for

7 days in the absence (black circles, dotted line) and presence of RSV (10 mg daily) for 7 days (open squares, solid line).

77

Subject id Before RSV After Before RSV After RSV Before After Before After Cmax (ng/mL) RSV AUC0 – τ AUC0 – τ RSV RSV RSV RSV Cmax (ng*hr/mL) (ng*hr/mL) t1/2 (hrs) t1/2 Cmin Cmin (ng/mL) (hrs) (ng/mL) (ng/mL) 0245498k 5680 4070 45400 32035 16.5 8.7 2860 1170 0246025H 6650 4980 53570 39450 26.3 15.7 2540 1760 0246046C 7020 6760 74455 59765 9.3 20.2 4800 4150 0246050C 11400 10400 88245 92305 7.7 7.7 4270 4620 0246069G 7790 8040 66660 69980 25.4 7.7 3890 4420 0246070A 9250 5460 60940 42070 7.8 7.6 3050 1680 0246093E 6610 8020 45675 49200 8.1 5.5 1770 2360 0246094C 7430 10000 69965 82810 7.2 13.2 4580 5100 0246125F 8330 6960 63835 69340 10 6.8 3070 3640 0246126C 8890 6160 60905 52645 14.3 14.6 3290 2570 0246141L 7630 5440 64310 44865 35 75.3 4130 2480 0246146A 5550 5270 49245 43035 15.3 11.6 2200 2230 Arithmetic 7686 6797 61934 56458.33 15.3 16.2 Mean, AM (9.5 to (4.1 to (90% CI) 21.0) 28.4) 3371 3015 Arithmetic 1636 1987 12490 18620 9.1 19.1 Std. Deviation 965 1310 Geometric 7536 6544 60805(55826 53810(46166 3235 2744 Mean, GM (6775 to 8383) (5641 to to 66836) to 62318) (2759 to (2157 to (90% CI) 7591) 3794) 3492)

Geometric 1.2 1.3 1.2 1.4 1.4 1.6 Std. Deviation Fold 0.9 (p=0.12) 0.9 (p=0.11) Wilcoxon Test 0.8(P=0.19) change in (p=0.34) GM; After RSV vs Fold Change in AM Before is 1.1 RSV 90% CI 0.7 to 1.0 0.7 to 1.0 0.6 to 1.1

Table 9: Steady state DRV Pharmacokinetics in individual subjects with and without RSV

78

Subject id Before After RSV Before RSV After RSV Before After Before After RSV RSV Cmax AUC0 – τ AUC0 – τ RSV RSV RSV Cmin (ng/mL) Cmax (ng/mL) (ng*hr/mL) (ng*hr/mL) T1/2 T1/2 (hrs) Cmin (ng/mL) (hrs) (ng/mL)

0245498k 206 365 1581 2752 13.1 21.4 87 96 0246025H 1280 572 9171 4753 2.3 5.8 213 194 0246046C 1040 1090 6658 7164 6.3 9.8 382 205 0246050C 882 938 5802 7036 3.0 6.1 110 196 0246069G 1570 368 11627 2694 6.8 8.5 511 27 0246070A 1600 804 8219 5588 4.0 7.3 206 175 0246093E 631 508 3949 3644 3.1 4.7 83 131 0246094C 924 1040 7279 6884 5.4 7.5 279 275 0246125F 767 925 4615 6274 4.0 11.7 115 183 0246126C 1400 324 6691 2951 10.1 12.1 179 168 0246141L 3290 1930 16792 10379 9.6 8.4 405 256 0246146A 627 394 4475 2971 10.5 7.7 186 111 Arithmetic 1185 771 7238 5258 6.5 (4.3 9.2 (6.4 to 230 168 Mean, AM to 8.8) 12.1) (90% CI) Arithmetic 783 462 3992 2394 3.5 4.4 138 69 Std. Deviation Geometric 980 666 6253 (4722 to 4780 (3752 194 148 Mean, GM (690 to (498 to 890) 8267) to (142 to 266) (107 to 204) (90% CI) 1391) 6063)

Geometric 2.0 1.7 1.2 1.4 1.8 1.9 Std. Deviation Fold 0.7 (p=0.06) 0.8 (p=0.06) WILCOXON TEST 0.8 ( p= 0.19) change in (P=0.11) GM; After Fold change in AM is RSV vs. 1.4 Before RSV 90% CI 0.5 to 0.9 0.6 to 1.0 0.5 to 1.2

Table 10: Steady state RTV Pharmacokinetics in individual subjects with and without RSV

79

4.1.2.3. Pharmacodynamics of RSV

The secondary endpoints for our drug-drug interaction study were the changes in total cholesterol, triglyceride, LDL-cholesterol and HDL-cholesterol levels from baseline to the exposure to DRV/rtv, RSV or their combination at days 7 or 21 and 35. The median lipid values and their changes with exposure to study medications are listed in [Table 11, 12]

[Fig. 16-21]. DRV/rtv treatment resulted in a reduction in HDL-C by a median of 20% (95%

CI, -4 to -29%, P=0.007) and an increase in non-HDL-C by a median 12% (95% CI, -3.8 to

15.4%, P=0.02). RSV administration alone led to a reduction in total cholesterol by a median of 30% (95% CI, -26 to -36%, P= 0.001). The LDL-C and non-HDL-C values decreased by a median of 40% (95% CI, -24.5 to -52.0%, P= 0.001) and 43% (95% CI, -34.2 to -54.8%, P= 0.001). The co-administration of DRV/rtv with RSV compared to the RSV alone resulted in an increase in the total cholesterol by a median of 4% (95% CI, 3 to 15%,

P=0.002) (mean increase was 10%, P=0.007). The LDL-C levels declined by a median of

10% non-significantly, although the HDL-C levels lowered significantly by a median 11%

(95% CI, -21 to -4%, P=0.01). The administration of RSV alone showed a decline of 37% for triglycerides compared to all three drugs (95% CI, -51.7 to -9.6%, p=0.001) and the mean difference was 56% higher when all three drugs were administered. The non-HDL-C values increased by a median 16.3% for the combinations when compared to RSV alone

(95% CI, 9.6 to 25%, P=0.001).

80

Parameter Baseline Darunavir/ritonavir RSV Darunavir/ritonavir + RSV Cholesterol 202 192 151 159 (148-212) (172-221) (114-163) (138-168) HDL-C 48 44 47 43 (42-58) (34-50) (43-51) (37-47) LDL-C 108 115 85 80 (89-133) (85-148) (55-96) (69-101) Triglycerides 99 114 78 123 (54-181) (80-230) (39-118) (66-175) non-HDL-C 141 152 104 114 (101-161) (118-172) (67-115) (89-124)

Table 11 – Median values of fasting lipids in mg/dL (25-75% interquartile ranges).

Parameter Baseline Baseline → Baseline RSV vs All Baseline → → RSV Darunavir/ritonavir → All Drugs RSV drugs vs Baseline → a All Drugs Cholesterol -49 (-30%)* 11 (5%) -33 (-23%)* -7 (4%)* 11 (10%)*

HDL-C -1 (-2%) -8 (-20%)* -7 (-16%)* 6 (-11%)* -6 (-13%)*

LDL-C -32 (-40%)* 2 (3%) -25 (-30%)* -9 (-10%) 5 (12%)

Triglycerides -43 (-8%) 17 (14%) 8 (3%) 44 (-37%)* 54 (56%)*

non-HDL-C -41 (-43%)* 19 (12%)* -26(-26%)* 15 (16%)* 16 (24%)*

Table 12 – Median changes in fasting lipid levels and percentages of lipids (mg/dL)

*P<0.05

81

a Median values of lipid levels at different time points.

Figure 16: Change in Cholesterol with Exposure to Study Medicationsa

* *

Figure 17: Total Cholesterola aBox plots represent 25-75% interquartile ranges with the whisker plots representing minimum and maximum ranges. The thick horizontal line represents median value. *P ≤

0.05, compared to baseline.

82

* *

Figure 18: HDL-C Lipid Changesa a Box plots represent 25-75% interquartile ranges with the whisker plots representing minimum and maximum ranges. The thick horizontal line represents median value. *P ≤

0.05, compared to baseline.

* *

Figure 19: Changes in LDL-Ca a Box plots represent 25-75% interquartile ranges with the whisker plots representing minimum and maximum ranges. The thick horizontal line represents median value. *P ≤

0.05, compared to baseline.

83

Figure 20: Changes in Triglyceridesa a Box plots represent 25-75% interquartile ranges with the whisker plots representing minimum and maximum ranges. The thick horizontal line represents median value.

* *

Figure 21: Changes in non-HDL-Ca a Box plots represent 25-75% interquartile ranges with the whisker plots representing minimum and maximum ranges. The thick horizontal line represents median value. *P ≤

0.05, compared to baseline.

84

4.1.2.4. Safety and Tolerability

Safety analyses were conducted on all 16 subjects who were exposed to DRV/rtv and RSV

[Table 13]. 2004 DAIDS grading table was used to grade all the clinical and laboratory adverse effects. The most frequently reported adverse events were grade I nausea, headache, diarrhea, sinus congestion, muscle weakness and stomach upset during DRV/rtv and RSV monotherapy or with the combination. Five subjects reported grade I GI intolerance, three subjects had grade I headache and one subject experienced grade I muscle weakness associated with respiratory illness and fatigue. During all the three phases of the study, three subjects encountered grade I elevations in AST levels. Two subjects reported grade I elevations in CPK levels with RSV. Three subjects who experienced grade II skin rash with

DRV/rtv alone withdrew from the study and that resolved within 7 days off drug.

85

Event Rosuvastatin alone Darunavir/ritonavir alone Darunavir/ritonavir + Rosuvastatin Clinical Grade Grade Grade Grade Grade Grade Grade Grade Grade Symptoms 1 2 3 or 4 1 2 3 or 4 1 2 3 or 4 Nausea 1 1 Headache 1 1 Diarrhea 4 Muscle weakness 1 Sore throat 1 Sinus congestion 1 Break through Menses 1 Skin Rash 3 Stomach upset 1 Laboratory adverse events ALT elevationsa AST elevationsb 1 2 1 Low Hemoglobin 1 Elevated CPKc 1

Table 13 - Adverse Events observed on 16 subjects during multiple dosing of RSV (10 mg

daily) alone or DRV/rtv (600mg/100mg; b.i.d.) alone or when used in combination at these

doses.

aALT, alanine aminotransferase; bAST, aspartate aminotransferase; cCPK, creatine phosphokinase

4.1.3. Association of OATP1B1, BCRP and MRP2 genotypes with fold change in RSV

systemic exposure

In the recently completed clinical trial that evaluated the effects of DRV plus RTV on the

steady state pharmacokinetics and pharmacodynamics of RSV in healthy volunteers (n =

86

12). Overall, RSV systemic exposure (area under the plasma concentration time curve over a 24 hour dosing interval, AUC0 – 24, and Cmax) increased with co-administration of

DRV/RTV. The mean elimination half-life of RSV did not change significantly (P =0.24).

However, as evident in Table 7, there was marked inter-subject variability in the pharmacokinetics of RSV and in the extent of changes in Cmax, which ranged from 1.12 to

8.18 fold (mean, 2.4 fold) and in the AUC0 – τ (range; 1.12 to 2.40 fold; mean 1.5 fold). In one subject (0246126C) AUC remained essentially unchanged with or without DRV/RTV.

Likewise, subject 0246146A showed minimal changes. Therefore, these two subjects can be considered outliers.

Based on the mechanism of hepatic uptake and biliary/intestinal efflux of RSV, we hypothesized that this interaction results from the inhibition of OATP-C (OATP1B1) and/or

BCRP and MRP2 transporters by DRV and/or RTV. Furthermore, the observed variability among subjects may be related to the genetic variants of these transporters known to impact clinical pharmacokinetics of substrates, including RSV. Thus, based on the clinical relevance of low function alleles, we genotyped study subjects for OATP1B1 c.521T > C,

388A>G, BCRP c.421 C > A, MRP2 c. -24C>T, 1249G>A, 3972C>T variants (63396T>C, -

24381A>C, -25385C>T) g TaqMan SNP genotyping assays (Mwinyi et al., 2008, Yanase et al., 2006, Niemi et al., 2006). Since the study size (n = 12) is small, this genetic analysis is considered to be an exploratory aim, pursued mainly to gain insights into the underlying reasons for the above-indicated outliers. The individual RSV plasma concentration versus time curves with and without DRV/RTV for the subjects 0246126C and 0246146A are shown in [Figs. 22, 23].

87

0246126C

Figure 22: Subject 02406126C’s plasma concentration vs. time curves of RSV alone at

day 21 and with DRV/RTV at day 35.

0246146A

Figure 23: Subject 02406146A’s plasma concentration vs. time curves of RSV alone at

day 21 and with DRV/RTV at day 35.

88

The results from the TaqMan SNP genotyping assay revealed that the aforementioned 2 outlier subjects (0246126C and 0246146A) in our drug interaction study were heterozygous for the OATP*15 SNP [Table 14]. The OATP1B1*15 polymorphism exhibits variation at

388 A>G and 521 T>C positions. Both had relatively plasma Cmax and AUC[0-24hr] of RSV and the fold change in these values due to the co-administration of DRV plus RTV was minimal [Fig. 24]. This strongly suggests a possible association between OATP1B1*15 variant and RSV pharmacokinetics. However, the significance testing for our genotypic findings performed using Wilcoxon signed-rank test revealed no significant differences in the fold changes in the AUC[0-24hr] (P=0.39) and Cmax (P=0.91) of RSV when administered alone and in combination for OATP1B1 wild type vs. *15 variants.

Subject OATP1B1 BCRP MRP2

*1B (388 *5 (521T>C) *15 (388 A>G, 421 (C>A) 1249 (G>A) 24 (C>T) A>G) 521 T>C) 25H AG TT AG, TT CC GA CC 46C AG TT AG, TT CA GG CC 50C AA TT AA, TT CC GG CC 69G AA TT AA, TT CC GG CC 94C AA TT AA, TT CC GA CC 70A AA TT AA, TT CC GG CC 98K AA TT AA, TT CA GA CC 93E AA TT AA, TT CC GG CC 126C AG TC AG, TC CA GG CT 141L AA TT AA, TT CA GG CC 146A AG TC AG, TC CC GG CT 125F AA TT AA, TT CC GG CC

Table 14: Genetic Polymorphisms of OATP1B1, BCRP and MRP2 transporters

89

6 *15 non-carriers 5

4

*15 3 *15 non-carriers *15 heterozygous heterozygous 2

1

Fold Change in RSV Systemic Exposure RSV in Change Fold 0 Cmax AUC

Figure 24. Association of OATP1B1*15 genotype with fold change in RSV exposure when co-administered with DRV/rtv (mean ± SD). P=0.39 for AUC[0-24hr] and P=0.91 for Cmax

Our findings are in agreement with the previously reported observation that in individuals with OATP1B1*15 variant, the disposition of statin drugs such as RSV and pravastatin is altered. For instance Ho et al reported that the *15 variant was associated with a profound loss in the OATP1B1 activity which led to an impaired hepatic uptake of RSV (Ho et al.,

2006). Because pravastatin, like RSV, is relatively hydrophilic compared with other statins, it is not substantially metabolized by CYP 450 enzymes and an active transport mechanism by OATP1B1 majorly mediates its hepatic accumulation (Hsiang et al., 1999).

Consequently, OATP1B1*15 polymorphism was associated with lower systemic clearance and higher plasma concentrations of pravastatin than that in subjects with the reference variant (Nishizato et al., 2003). The genomic impact on the disposition of compounds is frequently confounded by numerous factors, such as involvement of multiple genes and number of allelic variants and a clear correlation between genotype-phenotype is difficult to

90

establish. However, emerging evidence provides clear association of OATP1B1*15

(521T>C variant) on the pharmacokinetics and efficacy of RSV. Indeed our findings add to the growing evidence of the clinical significance of this variant. A comparison of individuals with consensus sequences of BCRP and MRP2 with those that had a loss of function variants did not reveal considerable difference in RSV PK. Thus, based on this exploratory aim it appears that OATP1B1 polymorphisms, but not BCRP and MRP2 variants impact RSV PK.

4.2. Specific Aim 2: To assess the influence of DRV on the expression and activity of

key phases 1 and 2 enzymes

PIs have dual contrasting effects on the drug metabolism pathways. On one hand, PIs may induce enzyme expression and on the other hand they can exert inhibitory activity of

CYP450 enzymes. For this purpose, we employed human hepatocytes and human liver microsomes to assess the overall impact of DRV on the key enzymes such as CYP 3A4, 2C9 and UGTs. PXR is an orphan nuclear receptor and is considered to be the master regulator of

CYP3A4. PXR activation has been linked to enhanced expression of drug metabolizing enzymes including CYP2B6, CYP3A, CYP2C9, UGT1A1 and transporters such as MDR1

(Gupta et al., 2008). Thus, we investigated the effect of DRV and RTV on PXR activation.

Taken together, this aim provided preliminary evidence on the effect of DRV on the expression and activity of key phase 1 and 2 enzymes.

91

4.2.1. Activation of PXR after Chronic Treatment with DRV and RTV

The activation of hPXR by DRV and RTV was examined employing transient transfection of a CYP3A4 reporter gene construct harboring hPXR-responsive regions of the CYP3A gene in LS180 cells. We compared the fold activation of hPXR by DRV (10 μM), RTV

(10μM) and rifampicin (10 μM). As shown in [Fig. 25], we observed a 20.8-fold activation of hPXR following treatment with rifampicin (10 μM) and a 8 and 12- fold activation following treatment with DRV (10 μM) and RTV (10 μM), respectively.

25.00 * DMSO 20.00 Rifampin Ritonavir 15.00 * Darunavir *

10.00 Fold Change Over Control Over Fold Change 5.00

0.00 *p < 0.05

Figure 25: Fold change in hPXR activation in LS180 cells (N=3); p ≤ 0.05.

4.2.2. Induction of CYP3A4, CYP2B6, CYP2C9, UGT 1A1, UGT1A6 and MDR1

transcripts by DRV

Following studies on hPXR activation, we assessed the inductive effect of DRV on

CYP3A4, CYP2B6, CYP2C9, UGT 1A1, UGT 1A6 and MDR1 genes, known to be

92

regulated by hPXR. Since CYP3A4 is the most clinically relevant phase I/oxidative enzyme, we investigated the effect of DRV on its expression and activity. The effect of DRV and the prototypical inducer, rifampicin on CYP3A4-specific mRNA levels in human hepatocytes is shown in [Fig. 26]. DRV induced CYP3A4 transcripts in a concentration-dependent manner but the increase was statistically significant only at concentrations 10 and 25 µM. An increase in mRNA transcripts was also observed for CYP2B6, CYP2C9, UGT1A1 and

UGT1A6 [Fig. 27]. However, the increase in CYP2B6 and CYP2C9 mRNA levels were statistically significant only at a concentration of 25 µM and the increase in UGT mRNA levels was not significant. At concentrations ranging from 1 to 25 μM, DRV caused a 2 to 7 fold increase in CY3A4 transcripts. At concentrations ranging from 1 to 25 μM, DRV caused a 0.7 to 2.7 fold increase in CYP2B6 transcripts, 1 to 3.6 fold in CYP2C9 transcripts,

1.2 to 3.2 fold increase in UGT 1A1 transcripts, 0.4 to 1.3 fold increase in UGT 1A6 transcripts and 0.8 to 4 fold increase in MDR1 transcripts.

Figure 26: Fold change in CYP3A4 mRNA expression in drug treated cells compared to control. (n=3); p ≤ 0.05.

93

Figure 27: Fold change in CYP2B6, CYP2C9, UGT1A1, UGT1A6 & MDR1 mRNA expression in drug treated cells compared to control. (n=3); p ≤ 0.05.

4.2.3. Quantitation of CYP3A4 Activity:

As shown in [Fig. 28], compared to drug-free control, the extent of decrease in CYP3A4 activity caused by DRV was not statistically significant at concentrations ranging from 0.1 to 25 μM. Accordingly, we observed a 0.6 ± 0.18-fold to 0.5 ± 0.16-fold decrease in testosterone 6ß-hydroxylation in cells treated with 0.1 to 25 μM of DRV. In comparison, rifampicin (10 μM) caused a 6.04 ± 2.88 -fold increase in the enzymatic activity.

94

Figure 28: Fold change in CYP3A4 Activity assessed as the rate of testosterone 6β- hydroxylation by drug treated cells compared to control. (n=3); p ≤ 0.05.

4.2.4. Quantitation of P-gp Activity

Uptake of rhodamine 123 was evaluated as a marker for P-gp activity following 72- hour exposure to DRV (Fig. 29). The accumulation of intracellular rhodamine 123 was observed to decrease in a dose-dependent manner. At DRV concentrations of 1, 5, 10, and

25 μM, the intracellular rhodamine levels were 0.91, 0.73, 0.44, 0.44-fold of control, respectively. Rifampicin, a prototypical P-gp inducer used as positive control, caused a reduction of rhodamine 123 accumulation relative to vehicle control. The data suggested that

DRV is also a P-gp inducer with a significant increase in P-gp activity observed at 10 and

25µM.

95

Figure 29: Fold change in P-gp activity measured as uptake of Rh123, in cultured human hepatocytes following 72-hour treatment with rifampicin, DRV compared to control. (n=3); p ≤ 0.01.

4.3. Specific Aim 3: To examine the extent to which DRV and/or RTV modulate the

influx and efflux hepatic drug transporters.

Among the OATP family transporters found on the basolateral membrane of the hepatocytes, OATP1B1 contributes predominantly to the hepatic uptake of RSV, and

OATP1B3 is also partly involved (Ho et al., 2006). It is also a high affinity substrate for the efflux transporter BCRP localized on the liver canalicular cells and intestine (Huang et al.,

2006). MRP2 and P-gp were also shown to contribute to the biliary elimination of RSV in sandwich-cultured rat hepatocytes (Jemnitz et al., 2010b). Therefore, it is reasonable to postulate that interaction may be observed by the inhibition by DRV and/or RTV on RSV

96

uptake into the liver by OATP1B1 or at the level of intestinal/biliary efflux by MRP2 and/or

BCRP.

4.3.1. Inhibitory effect of DRV and RTV on BCRP-mediated Prazosin Uptake

We first investigated the effect of a 2 hour incubation of MDCK cells over-expressing the

BCRP transporter with DRV and/or RTV. The results showed that DRV and RTV increased the uptake of [3H]-prazosin, a BCRP specific substrate, compared with the vehicle control. This was consistent with the increased uptake of prazosin caused by the BCRP selective inhibitor, FTC (10 μM) (V = 1.2 x 10-7 nmoles/mg protein/hr). DRV at concentration of 250 and 500 μM (IC50 = 366 μM) (Fig. 30, 31) and RTV at concentration of 25, 50, 75, 100, 250 and 500 μM markedly inhibit BCRP (IC50 = 24.2 μM) (Fig. 32, 33) in a dose-dependent manner. The observed extent of inhibition was less than those observed with the prototypical BCRP inhibitor, FTC, and are statistically significant (p<0.001). The combination of DRV with 1 and 25 μM of RTV further led to a significant decline in the

IC50 of DRV to 83 (Fig. 34, 35) and 77 μM (Fig. 36, 37) respectively.

97

DRV (μM)

Fig. 30: Effect of DRV on BCRP-mediated prazosin uptake, following 2h acute treatment in

MDCK-BCRP cells (Mean ± SD). (n=3)

IC50 = 366 µM

90

80

70

60

50

40 0 1 2 3 Percent Uptake Rate Prazosin of log Darunavir (µM)

Fig. 31. Effect of DRV (μM) on BCRP-mediated prazosin uptake. The inhibition constant

(IC50) was 366 μM (Mean ± SD). (n=3)

98

RTV (μM)

Fig. 32. Effect of RTV on BCRP-mediated prazosin uptake, following 2h acute treatment in

MDCK-BCRP cells (Mean ± SD). (n=3)

100

80

IC50 = 24 µM 60

40

20

0 0 1 2 3 Percent Uptake Rate Prazosin of log Ritonavir (µM)

Fig. 33. Effect of RTV (μM) on BCRP-mediated prazosin uptake. The inhibition constant

(IC50) was 24.2 μM (Mean ± SD). (n=3)

99

Darunavir (μM)/ 1 μM RTV

Fig. 34. Effect of DRV in the presence of 1 μM RTV on BCRP-mediated prazosin uptake, following 2h acute treatment in MDCK-BCRP cells (Mean ± SD). (n=3)

IC50 = 83 µM

Fig. 35. Effect of DRV in the presence of 1 μM RTV on BCRP-mediated prazosin uptake.

The inhibition constant (IC50) was 83.0 μM (Mean ± SD). (n=3)

100

Darunavir (μM)/ 25 μM RTV

Fig. 36. Effect of DRV in the presence of 25 μM RTV on BCRP-mediated prazosin uptake, following 2h acute treatment in MDCK-BCRP cells (Mean ± SD). (n=3)

IC50 = 77 µM

Fig. 37. Effect of DRV in the presence of 25 μM RTV on BCRP-mediated prazosin uptake.

The inhibition constant (IC50) was 77.0 μM (Mean ± SD). (n=3)

101

4.3.2. Inhibitory effect of DRV and RTV on OATP1B1-mediated RSV Uptake

The uptake of [3H]-RSV in CHO expressing OATP1B1 was estimated for 2 mins [Fig 38].

Prior to the initiation of these experiments, the linearity of cellular uptake of RSV over time

(0, 30 s, 1, 1.5, 2, 3 and 5 mins) was assessed. The uptake into CHO-OATP1B1 cells was linear over 3 min period. Our data shows that the plot of the velocity of RSV cellular accumulation versus its concentrations over the range of 0.005 – 50 µM fitted the Michaelis-

Menten kinetics and the Km (concentration at half of the maximum reaction rate) and Vmax

(maximum reaction rate) were 12.2 µM and 0.5 pmoles/mg protein/min, respectively.

Km = 12.2 µM Vmax = 0.5 pmoles/mg protein/min 0.0003

0.0002

0.0001 (nmoles/mg protein/min) (nmoles/mg [3H]-Rosuvastatin Uptake 0.0000 0 20 40 60 Rosuvastatin (µM)

Figure 38: Michealis-Menten plot of the uptake of RSV in human OATP1B1 expressing

CHO cells. (Mean ± SD). (n=3)

102

The effect of DRV and RTV on the kinetics of OATP1B1–mediated [3H]-RSV uptake is shown in Fig. 39 and 41. DRV at concentration of 10, 25, 50, 75, 100 and 250 μM (IC50 =

15.2 μM) (Fig. 39, 40) and RTV at concentration of 10, 25, 50, 75, 100 and 250 μM significantly inhibit OATP1B1 mediated RSV uptake (IC50 = 4.6 μM) (Fig. 41, 42) in a dose-dependent manner. The IC50 for the inhibitory process for DRV and RTV was 15.2 and

4.6 µM. The combination of DRV with 1 and 25 μM of RTV further led to lowering in the

DRV’s IC50 to 4.1 (Fig. 43, 44) and 3.6 μM (Fig. 45, 46) suggesting synergistic effect of

RTV.

Fig. 39. Effect of DRV on OATP1B1-mediated RSV uptake, following 2 min acute treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)

103

150 IC50 = 15.2 µM

100

50 (nmoles/mg protein/min) (nmoles/mg [3H]-Rosuvastatin Uptake 0 0 1 2 3 log Darunavir (µM)

Fig. 40. Effect of DRV on OATP1B1-mediated RSV uptake. The inhibition constant (IC50) was 15.2 μM (Mean ± SD). (n=3)

Fig. 41. Effect of RTV on OATP1B1-mediated RSV uptake, following 2 min acute treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)

104

150 IC50 = 4.6 µM

100

50 (nmoles/mg protein/min) (nmoles/mg [3H]-Rosuvastatin Uptake 0 0 1 2 3 log Ritonavir (µM)

Fig. 42. Effect of RTV on OATP1B1-mediated RSV uptake. The inhibition constant (IC50) was 4.6 μM (Mean ± SD). (n=3)

Darunavir (μM)/ 1 μM RTV

Fig. 43. Effect of DRV in the presence of 1 μM RTV on OATP1B1-mediated RSV uptake, following 2 min acute treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)

105

150

IC50 = 4.1 µM

100

50 (nmoles/mg protein/min) (nmoles/mg [3H]-Rosuvastatin Uptake 0 0 1 2 3 log Darunavir/ 1 µM Ritonavir (µM)

Fig. 44. Effect of DRV in the presence of 1 μM RTV on OATP1B1-mediated RSV uptake.

The inhibition constant (IC50) was 4.1 μM (Mean ± SD). (n=3)

Darunavir (μM)/ 25 μM RTV

Fig. 45. Effect of DRV in the presence of 25 μM RTV on OATP1B1-mediated RSV uptake, following 2 min acute treatment in CHO-OATP1B1 cells (Mean ± SD). (n=3)

106

150

IC50 = 3.6 µM

100

50 (nmoles/mg protein/min) (nmoles/mg [3H]-Rosuvastatin Uptake 0 0 1 2 3 log Darunavir/ 25 µM Ritonavir (µM)

Fig. 46. Effect of DRV in the presence of 25 μM RTV on OATP1B1-mediated RSV uptake.

The inhibition constant (IC50) was 3.6 μM (Mean ± SD). (n=3)

107

5. CHAPTER FIVE: DISCUSSION

HIV infection represents a considerable global health problem, with increased rates of newer infections and elevated mortality worldwide. HAART comprises a wide range of HIV treatment regimens usually consisting of three or more mechanistically dissimilar antiretroviral drugs that lead to a decrease in plasma viral load below the limits of quantification. Thus, such antiretroviral therapy has greatly improved the prognosis for HIV- infected patients. An ideal antiretroviral therapy should maximally and durably suppress

HIV replication and delay the emergence of drug resistance strains that lead to treatment failure. Within the past few years, the addition of newer anti-HIV compounds belonging to different mechanistic classes have made the attainment of total virological repression a realistic goal in a significant proportion of highly treatment-experienced patients

Although HAART has substantially improved the morbidity and mortality from AIDS- related opportunistic infections, it continues to be associated with adverse complications like lipodystrophy, dyslipidemia and myocardial infarctions. This is now a critical problem since with drastically reduced mortality HIV therapy is required on chronic basis. As such careful optimization of combination of primary and adjunct therapies to minimize side effects is required on an ongoing basis. The two classes of approved antiretroviral agents such as NRTIs and PIs contain compounds associated with significant metabolic abnormalities within each class. They include dyslipidemia, insulin-resistance, fat redistribution disorders and elevated risk of CHD. Dyslipidemias associated with depressed levels of TC, LDL-C and HDL-C and elevations in TG levels were described in

108

approximately 50% of patients (Carr et al., 1999; Heath et al., 2001) with HIV infection in the absence of HAART (Chapman et al., 2010; Chinetti et al., 2001; Constans et al.,

1994b).

The introduction of protease inhibitors (PIs) in the mid 90’s is considered a major advancement and primary factor contributing to the aforementioned success of HAART.

Pharmacokinetic boosting employing ritonavir now is a standard practice as such regimens maintain very high drug levels above the minimal inhibitory concentration in treatment- naïve and treatment-experienced patients. PI based therapies work efficiently as first-line therapies despite their adverse events due to their limited potential to develop resistance.

The currently available boosted PIs exhibit similarity in their virological and immunological responses, however, careful considerations based on their toxicity profile and dosing administration must be followed in accordance with each clinical case. Despite the progress in HIV treatment, long term PI use is associated with clinical drawbacks such as increased susceptibility for drug-drug interactions and adverse side-effects such as metabolic disturbances which include elevated levels of triglycerides and low-density lipoprotein cholesterol (LDL-C) and reduced levels of high-density lipoprotein cholesterol (HDL-C)

(Tenore and Ferreira, 2009c). Hence, there is an ever increasing need to develop novel PIs that are active against drug resistant HIV strains, and have a reduced propensity for adverse effects such as abnormalities in lipid alterations and drug-drug interactions.

DRV is a next generation PI approved for its use along with a low boosting dose of RTV in both treatment-naïve as well as in experienced patients with HIV-1 infection. The POWER

109

studies performed in treatment experienced patients with HIV infection confirmed that

DRV/rtv (600/100 mg bid) demonstrated greater efficacy and a favorable safety profile than investigator-selected RTV-boosted control PIs or RTV-boosted lopinavir (Clotet et al.,

2007). The ARTEMIS study which compared the efficacy and safety of DRV/rtv (800/100 mg qd) and lopinavir/ritonavir (800/200 mg total daily dose) when administered with an optimized background regimen, showed that DRV/rtv was non-inferior to boosted lopinavir at 48 weeks and highly effective than lopinavir at 96 weeks in antiretroviral-naïve population (Mills et al., 2009). Several randomized clinical trials reported that DRV/rtv was generally well tolerated in patients with HIV-1 infection and was associated with a lower incidence of GI disturbances and lipid abnormalities than investigator-selected RTV-boosted control PIs or RTV-boosted lopinavir in treatment-experienced or -naive patients (Clotet et al., 2007, Mills et al., 2009). Hence, for the management of treatment-naive or experienced patients with HIV-1 infection, a RTV-boosted DRV-based HAART regimen is an invaluable treatment option

Statins are recommended as a first-line therapy for the treatment of patients with elevated low-density lipoprotein (LDL) cholesterol regardless of HIV status (Dube et al., 2003b).

The currently available statins include simvastatin, lovastatin, pravastatin, atorvastatin, fluvastatin, cerivastatin, pitavastatin and rosuvastatin. Statins display different pharmacokinetic profiles based on their physicochemical properties. Among the approved statins, RSV has the lowest 50% inhibitory constant (IC50) of 5.4 nM (Bachmeier et al.,

2005; McTaggart et al., 2001b). However, the choice of statins is limited in HIV subjects, because of significant drug-drug interactions with antiretroviral drugs, particularly PIs.

110

Statins such as simvastatin and lovastatin are exclusively metabolized by CYP3A4/5, and are usually contraindicated in the presence of PIs as these enzymes are subjected to significant inhibition. The hydrophilic statin drugs such as pravastatin, rosuvastatin, and pitavastatin are minimally metabolized by CYP 450 enzymes and are primarily cleared via biliary excretion. Increased incidence of drug-drug interactions with PIs upon co- administration with the hydrophilic statins were reported, as several PIs were shown to alter the expression and activity of one or more hepatic uptake and/or biliary/intestinal efflux drug transporters such as OATP1B1, BCRP, MRP2 and P-gp (Dixit et al., 2007). However, the nature and the extent of these interactions are not easily predictable and necessitate further clinical investigation. For instance, concurrent administration with lopinavir/ritonavir

(400/100 mg twice-daily) did not lead to significant alteration in pravastatin systemic exposure (Carr et al., 2000). However, the AUC of pravastatin increased by 50% when administered in combination with saquinavir/ritonavir (400/400 mg twice-daily)

(Fichtenbaum et al., 2002a). Kiser et al reported a 2.1 fold and a 4.7 fold increase in the

AUC and Cmax of RSV with attenuation of the lipid lowering effects of RSV upon co- administration with lopinavir/ritonavir (400/100 mg twice-daily) (Kiser et al., 2008b).

Several studies showed that such pharmacokinetic interactions reflective of increased plasma concentrations of statins led to an elevated risk of rhabdomyolysis in patients

(Backman et al., 2002a).

Nevertheless the pharmacokinetic interactions of darunavir and their clinical impact have not been comprehensively delineated. The role of multidrug transporters in its systemic absorption and clearance are not well understood. As noted in the rationale of our overall

111

undertaking two clinical studies document 21 and 81 % increase in pravastatin AUC when given to subjects on darunavir/ritonavir therapy. Given that rosuvastatin is the most potent statin and it is now the statin drug of choice, it is likely that rosuvastatin will be given to subjects stabilized on darunavir/ritonavir containing regiments. Therefore the current study was undertaken a) to investigate the plausible pharmacokinetic interactions between

DRV/rtv and RSV and consequent alterations in the pharmacodynamic activity of RSV as manifested by changes in circulating lipid levels and b) to delineate the mechanistic basis of this interaction using clinical relevant in vitro tools.

5.1. Clinical assessment of PK and PD interaction between DRV/rtv and RSV in

healthy volunteers

Our study findings constitute the first report that the concomitant administration of DRV/rtv in HIV seronegative healthy volunteers cause a marked change in the systemic exposure of

RSV. The geometric means of RSV steady state Cmax and AUC[0-24hr] increased an average of 2.4- fold and 1.5-fold, respectively. As stated in the FDA guidance document on bioequivalence, no clinically significant differences are present when the 90% confidence intervals for systemic exposure ratios fall entirely within the equivalence range of 80-125%.

As the fold change in the geometric means of Cmax and AUC[0-24hr] are above the range of 0.8 to 1.25, we conclude that the overall systemic exposure to RSV in the absence and the presence of darunavir/ritonavir are not equivalent. Even though there were only marginal differences in the mean elimination half-lives of RSV, marked inter-subject variability was observed in the presence and the absence of DRV/rtv co-administration, which led to a

112

difficulty in discerning the potential mechanism of interaction. Furthermore, the systemic clearance normalized to the oral bioavailability (Cls/F) showed a considerable reduction.

And no significant differences in the pharmacokinetic parameters of DRV and RTV were reported.

As predicted, exposure to DRV and RTV for a short term resulted in a significant reduction in HDL-C levels and an increase in non-HDL-C levels. RSV reliably exerted a favorable effect on the lipid profile leading to a reduction in total cholesterol, LDL-C and non-HDL-C levels. On the other hand, when given in combination with DRV/rtv, the co-administration led to a blunting of the effects of RSV. The attenuation of the lipid-lowering efficacy despite higher plasma concentrations of RSV is highly interesting. The total reduction of the effects of RSV on lipid levels was less than 25% with the exception of its influence on triglycerides where the combination therapy led to a nullification of the effects of RSV.

Thus it may be inferred that the detected elevations in AUC and Cmax of RSV may either be a consequence from increased systemic bioavailability or its decreased hepatic uptake.

There were a number of limitations to this study. 1) the study was performed for a short- term with administration of agents for <10 days at a time. While the directional effects were clearly demonstrated, there is a possibility that additional changes might be observed over a longer period of time. 2) the doses used in this study may perhaps not reflect the drug-drug interactions observed with lower doses of DRV and RTV, for instance, as those used in treatment naïve persons (800 mg / 100 mg daily, respectively). 3) HIV seronegative volunteers were used in the study because of the necessity to determine drug-drug

113

interactions using “monotherapy” with DRV and RTV. However, in the standard of care, these agents are not administered alone in HIV infected population due to the possibility of the emergence of drug resistance. 4) the employed therapy in our study was not directly observed and slight variations in adherence might have adversely affected our conclusions.

On the other hand, the plasma concentration profiles for each subject implies that non- adherence was not an issue. 5) the long-term safety of co-administration of all of these agents was not known. Nevertheless, there were few adverse reactions overall. All the three subjects that retreated from the study experienced skin eruptions upon the administration of

DRV/rtv alone in the absence of RSV. There were negligible transient elevations in CPK levels in two subjects and minimal elevation in AST in two subjects. Whether these effects would be more or less pronounced after long-term administration is not known. However, higher plasma concentrations of statins have been related with the occurrence of more considerable adverse events. Hence, RSV should be used with prudence starting at the lowest possible effective dose.

We then conducted exploratory analyses to investigate the genetic basis for the previously mentioned inter-subject variabilities in the systemic exposure of RSV in the presence and the absence of DRV/rtv co-administration. In one subject (0246126C) AUC remained essentially unchanged with or without DRV/rtv and similarly, the subject 0246146A showed minimal changes. Hence, these two subjects were considered outliers in our drug-drug interaction study. The apparent inter-subject variability makes it difficult to conclusively rule out mechanisms. Based on the mechanism of hepatic uptake and biliary/intestinal efflux of RSV, we hypothesized that this observed variability among subjects may be related to the

114

genetic variants of the transporters, OATP-C (OATP1B1) and/or BCRP and MRP2, known to impact clinical pharmacokinetics of substrates, including RSV (Hsiang et al., 1999).

Thus, based on the clinical relevance of low function alleles, the study subjects were genotyped for OATP1B1 c.521T > C, 388A>G, BCRP c.421 C > A, MRP2 c. -24C>T,

1249G>A, 3972C>T variants (63396T>C, -24381A>C, -25385C>T. The results from the

TaqMan SNP genotyping assay revealed that the aforementioned 2 outlier subjects

(0246126C and 0246146A) observed in our drug interaction study were heterozygous for the

OATP*15 SNP. Consequently, in these 2 subjects, the change in the Cmax and AUC[0-24hr] of

RSV in the presence of DRV/rtv was found to be minimal, strongly suggests a possible association between OATP1B1*15 variant and RSV pharmacokinetics. Our findings are in agreement with the previously reported observation that in individuals with OATP1B1*15 variant, the disposition of statin drugs such as RSV and pravastatin is altered. For instance

Ho et al reported that the *15 variant was associated with a profound loss in the OATP1B1 activity which led to an impaired hepatic uptake of RSV (Ho et al., 2006). Because pravastatin, like rosuvastatin, is relatively hydrophilic compared with other statins, it is not substantially metabolized by CYP 450 enzymes and an active transport mechanism by

OATP1B1 majorly mediates its hepatic accumulation (Hsiang et al., 1999). Consequently,

OATP1B1*15 polymorphism was associated with lower systemic clearance and higher plasma concentrations of pravastatin than that in subjects with the reference variant

(Nishizato et al., 2003). The genomic impact on the disposition of compounds is frequently confounded by numerous factors, such as involvement of numerous genes and number of allelic variants and a clear correlation between genotype-phenotype is difficult to establish. Indeed our findings add to the growing evidence of the clinical significance of

115

this variant. Thus, based on this exploratory aim it appears that OATP1B1 polymorphisms, but not BCRP and MRP2 variants impact RSV PK.

5.2. Modulation of phase 1 and 2 drug metabolizing enzymes/transporters by DRV

Given the limited extent of metabolic clearance, it is less likely that inhibition of CYP 450 enzymes, specifically CYP2C9, by DRV/rtv accounts for the observed changes in RSV pharmacokinetics. However, due to the apparent inter-subject variability in our clinical assessment, the potential role of CYP 450 enzymes cannot be precluded. Therefore, we evaluated the effects of DRV and RTV on the expression and activity of several phase 1 and phase 2 drug metabolizing enzymes and transporters for gaining preliminary evidence on the mechanistic insights of our drug interaction study. Because of the significant role of PXR in regulation of CYP3A4 and transporters, the effect of DRV and RTV on PXR activation was determined. We observed that DRV is a strong activator of PXR, almost similar to RTV.

This is consistent with other reports of PXR activation by these PIs (Luo et al 2002; Faucette

2004; Dixit et al 2007). DRV was also evaluated as a CYP3A4 inducer following long-term treatment of primary human hepatocyte cultures. Along with hPXR activation, we also observed an increase in the CYP3A4/5-specific transcripts, however, the study failed to show an increase in CYP3A4/5 activity following treatment with DRV. Thus, this clearly indicates that DRV, similar to RTV, is potent CYP3A4 inducer at the transcriptional level.

Despite the effect of PIs on the induction of CYP3A transcripts, the net effect is a suppression of the CYP3A activity. Compared to most PIs, DRV demonstrated a net effect of suppression of CYP3A activity in primary human hepatocytes. For protease inhibitors,

116

the discrepancy between an increase at the mRNA and protein level versus CYP3A4 enzymatic activity is well known, as these drugs increase CYP3A4 gene transcription but cause a mechanism-based inhibition of the activity.

Significant advances in our understanding of the factors that impact regulation of drug metabolism and transport pathways have established a role of the PXR as a "master regulator" involved in transcriptional activation of an ever growing list of target genes.

These include phase I enzyme such as CYPs 2B6, 2C8, 2C9 and3A4, and Phase II enzymes such as UGTs1A1, 1A6 and 2B7 and efflux transporters such as P-gp. While not a primary focus of our undertaking, we observed that darunavir markedly induced CYP 2B6 and

CYP2C9 in a concentration dependent manner. It also modestly elevated UGT 1A1 and

1A6 transcripts, however, this increase was not statistically significant. Additionally, DRV was observed to be an inducer of MDR1 mRNA expression with a statistically significant increase in Pgp activity observed at 10 and 25µM. The clinical implications of PXR activation and the associated increase in mRNA levels of various other genes by darunavir have thus far not been thoroughly evaluated. Our studies suggest that such studies are needed to identify if co-administration of other compounds should be prohibited or done with added precaution.

117

5.3. Modulation of the hepatic influx and intestinal/biliary efflux drug transporters

by DRV and/or RTV.

The increased plasma drug concentrations observed in our clinical study with slightly blunted lipid-lowering effects of RSV is indicative of its reduced hepatic availability in the presence of DRV/rtv. This may by and large entail an increase in the extent of oral bioavailability and/or decrease in the hepatic uptake and/or biliary excretion mediated by

DRV and/or RTV. In the recently published in vitro study performed by Annaert et al, DRV inhibited the accumulation of the OATP1B1 substrate CGamF, in CHO cell lines over- expressing this transporter (Annaert et al., 2010e) and RTV inhibited the in vitro transport of OATP1B1 substrate, 17β-estradiol glucuronide (Tirona et al., 2003). Thus, it is plausible that the reduced hepatic uptake of RSV may underlie the inhibition of OATP1B1 by DRV and/or RTV. Another conceivable mechanism may entail the role of efflux transporters

BCRP and MRP2, present on several tissues including the apical surfaces of enterocytes and the bile canalicular membrane of hepatocytes, in influencing the bioavailability and the efflux of drugs out of the body (Mao and Unadkat, 2005; Takano et al., 2006). Despite the lack of sufficient data on DRV’s role on MRP2 and BCRP, recent in vitro studies have reported inhibition of MRP2 and BCRP by lopinavir and RTV (Bierman et al., 2010b).

Hence, the observed pharmacokinetic interaction os RSV may involve either OATP1B1 mediated hepatic uptake of RSV and/or its biliary efflux by BCRP and MRP2. Oxidative

CYP450 enzymes were shown to play a minor role in RSV systemic elimination. Less than

10% of this compound is metabolized by CYP2C9. For instance, the co-administration of fluconazole, a potent CYP2C9 inhibitor, produced only marginal increases in RSV AUC0–τ

118

and Cmax, which perceivably had no clinical impact (Annaert et al., 2010d). Given the minor role of metabolic transformation in RSV clearance, it is less likely that inhibition of

CYP2C9 by DVR and/or RTV account for the observed changes in RSV pharmacokinetics.

However, due to the apparent inter-subject variability in our clinical assessment, the potential role of CYP 450 enzymes cannot be refuted.

With the above considerations, we assessed the mechanistic impact of DRV and/or RTV on the transporters involved in hepatic uptake and intestinal/biliary efflux of RSV.

Accordingly, we evaluated the potential influence of DRV and RTV on the activity of

OATP1B1 and BCRP employing CHO-OATP1B1 and MDCK-BCRP cells, respectively.

For studies on BCRP, we used a prototypical substrate, [3H] prazosin and a specific inhibitor, FTC. We observed that both DRV and RTV individually inhibited BCRP function as reflected in reduced prazosin intracellular accumulation. However, the extent of inhibition was statistically significant only at very high concentrations of the PIs and overall the IC50 values for inhibition for RTV and DRV (24 and 366 µM, respectively) are much higher than the observed corresponding plasma Cmax values of 1 and 10 µM, respectively. As suggested by Giacomini et al., to extrapolate the in vitro findings to the clinical realm, it is useful to project the hepatic inlet concentration in vivo. The equation used for this purpose is Iin,maxis the estimated maximum inhibitor concentration at the inlet to the liver and is equal to: Imax +

(Fa × Dose × ka/Qh). Imax is the maximum systemic plasma concentration of the inhibitor;

Fa is the fraction of the dose of the inhibitor which is absorbed; ka is the absorption rate constant of the inhibitor; and Qh is the hepatic blood flow (1,500 ml per min) (Giacomini et al., 2010)

119

Based on the above calculations, the RTV and DRV concentrations can be estimated to be approximately, 4 and 72 µM, respectively. Thus, when IC50 values indicated above are compared to these projected human hepatic blood concentrations it appears that neither ritonavir nor darunavir is likely to cause a substantial change in BCRP mediated rosuvastatin biliary efflux. We also assessed the impact of co-treatment of DRV (1 - 500 µM) in the presence of RTV at extracellular medium concentrations of 1 and 25 µM. The choice of these concentrations was based on the observation that RTV Cmax is around 1 µM (clinically observed maximum plasma concentrations when administered at a 100 mg boosting dose) and 25 µM may represent the supraphysiologic or hepatic RTV levels. At 1 and 25 µM concentrations of RTV, the IC50 was lowered to 83 and 77 µM, respectively, suggesting potentiation of BCRP inhibition by RTV. However, these IC50 values are still considerably higher than the projected hepatic inlet DRV levels. Thus, inhibition of BCRP by DRV and/or RTV is unlikely to be the major cause of the observed clinical interaction with RSV.

We next evaluated the OATP1B1 activity in CHO-OATP1B1 cells treated with DRV alone

(1 -250 µM), RTV alone (1 - 250 µM) or in combination at the aforementioned concentrations. We employed [3H] RSV, as this compound is perhaps the best known

OATP1B1 substrate. RSV uptake kinetics exhibited saturable Michaelis-Menten with

OATP1B1 with a km and Vmax of 12.2 µM and 0.5 pmoles/mg protein/min, respectively. The concentration dependent inhibition curves for DRV and RTV with respect to [3H]-RSV (0.1

µM) accumulation in CHO-OATP1B1 cells illustrate that these PIs showed a significant propensity for the OATP1B1 transporter family (DRV IC50 = 15.2 µM; RTV IC50 = 4.6

µM). In the presence of RTV at 1 and 25 µM concentration, the IC50 was reduced to 4.1 and

120

3.6 µM, respectively. This suggests at even at low RTV concentration there is substantial potentiation of DRV mediated OATP1B1 inhibition. When compared to the above- indicated projected hepatic inlet concentrations of DRV and RTV of 72 and 4 µM, respectively, it appears that OATP1B1 inhibition by DRV/RTV combination is the most likely mechanism of the increased plasma levels of RSV.

Most PIs, especially RTV, is now well known to impact numerous drug metabolism and transport pathways. Moreover, the net effect is often contradictory as such compounds can cause both inhibition and induction of one or more of these pathways. It is indeed perplexing that a compound such as RTV impacts a multitude of structurally and mechanistically diverse enzymes and transporters. More specifically relevant to our findings, it is not known if DRV and RTV are indeed substrates for OATP1B1 and if the inhibition of this transporter involves direct/competitive inhibition or it entails more complex mechanisms. For that matter, it is unclear why RTV is significantly more potent than DRV and as indicated in other reports, than other PIs. Structural features of compounds causing inhibition of multidrug transporters involved have been investigated by several groups of researchers. Studies employing QSAR models suggest that significant determinants of the interaction with enzyme/transporter protein include lipophilicity, polarizability, planar structure, amine bonded to carbon of a heterocyclic ring, and hydrogen bonding potential of an inhibitor (Saito et al., 2006). Furthermore, Clark et al examined the kinetics of association or dissociation of the BCRP substrate, [3H]-daunomycin. They reported that the ability of several BCRP inhibitors to completely or partially displace the substrate binding is dependent on the presence of multiple binding sites in BCRP and the

121

binding affinity (Kd) of the substrates and inhibitors with the transporter (Clark et al.,

2006b). Multiple substrate binding sites have been suggested for broad-substrate transporter such as OATP1B1 (Gui et al., 2008; Weaver and Hagenbuch, 2010). Noe et al reported that

OATP1B1 inhibition by gemfibrozil was substrate dependent as the transport of fluvastatin, pravastatin, simvastatin, and taurocholate was inhibited by gemfibrozil, while the transport of estrone-3-sulfate and troglitazone sulfate was not altered (Noe et al., 2007). The authors also reported that estrone-3-sulfate exhibits biphasic transport with high and low affinity components and that gemfibrozil repressed only the low-affinity component. The specificity and potency of an inhibitor may, therefore, depend on a specific binding site of the transporter. PIs differ in their physicochemical properties such as shape, size, polarity, and hydrophobicity, and several authors have reported that these compounds bind to CYP active site(s) in different ways and exhibit type I, type II, or no spectral binding

(Muralidhara et al., 2008; Roberts et al., 2005). RTV displays type II binding, which is largely attributed to the presence of thio-imidazole group. A critical mediator of the covalent binding of RTV with CYP3A prosthetic heme binding site, the thioimidazole group, imparts the strong CYP3A inhibitory activity of RTV (Kumar et al., 2010a).

Currently, there is a dearth of studies that provide functional and structural insights into the mechanism of the inhibition of drug transport by PIs. Whether the findings from the spectral binding studies of PIs can be extrapolated to their interactions with the transporters is not clear. However, these studies perhaps provide a glimpse into the mechanism and differing abilities of PIs for inhibiting transporters such as OATP1B1 and BCRP and for the observed potentiation of DRV inhibition by RTV.

122

6. CHAPTER SIX: CONCLUSIONS AND FUTURE DIRECTIONS

This doctoral dissertation research spans pre-clinical and clinical investigations where

"bedside" findings were queried using in vitro tools. Firstly, employing a phase I study design, we tested our hypothesis that co-administration of DRV/rtv with RSV leads to increase in the steady-state systemic exposure (Cmax and AUC0-24hr) of the lipid lowering agent. Indeed, there was a notable increase in the mean Cmax and AUC of RSV but there was a marked inter-subject variability in the extent of this interaction and in fact two of the twelve subjects experienced only a marginal change perhaps since they already had relatively elevated levels of RSV. In so far as the pharmacokinetics of the PIs is concerned, there was only a minimal change due to RSV co-administration. It was interesting that while co-administration of DRV/rtv markedly perturbed the pharmacokinetics of RSV, the pharmacodynamic changes while statistically significant in some cases, were subtle. The net attenuation of the effects of RSV on lipid levels was less than 25% with the exception of the impact on triglycerides where the presence of DRV/rtv appeared to nullify the effect of

RSV. Our study findings are in agreement with the previously reported observation of Kiser et al in the evaluation of bioequivalence of RSV and lopinavir/rtv when administered alone and in combination. The authors revealed a significant increase in the systemic exposure with some attenuation of the LDL-lowering effects of RSV when given in combination with lopinavir/rtv (400/100 mg twice-daily) of RSV (Kiser et al., 2008).

The observed increase in plasma concentrations of statins may also have considerable implications for the toxicity of statins with chronic use, with rhabdomyolysis being a major concern (Backman et al., 2002b). Thus, with the marked higher exposure to RSV apparent

123

in our clinical trial, it seems prudent to advocate starting with lower doses (10 mg/day) when combined with DRV/rtv and observing patients carefully to reduce side effects.

We conducted correlative in vitro studies to gain mechanistic insights into our clinical findings. The observed drug interaction is unlikely to be mediated by either upregulation/induction or inhibition of CYP/UGT enzymes, which are frequently implicated in the interactions of PIs, because RSV hepatic clearance is primarily due to biliary excretion of the unchanged compound. While DRV and RTV both activated the human

PXR in cell based receptor assays and induced several drug metabolism genes (CYP3A4,

CYP2B6, CYP2C9, UGT1A1, UGT1A3) and drug transporters such as P-gp in primary human hepatocytes, these are unlikely to be consequence for RSV pharmacokinetics.

However, these findings may have implications for other drugs that are substrates for these pathways and further studies should be pursued for comprehensive delineation of potential drug-drug interactions of DRV.

With regards to RSV, as indicated earlier, hepatic uptake and biliary efflux are important factors that impact not only the pharmacokinetics but also the pharmacodynamics of RSV.

Since the hepatic influx of RSV is mediated by OATP1B1and/or biliary/intestinal efflux by

BCRP and MRP2, we employed appropriate in vitro tools (cell lines overexpressing each transporter individually, typical probe substrates and specific inhibitors) to discern the role of each transporter. The synopsis of these findings is that both DRV and RTV individually inhibit OATP1B1 with IC50 values lower than the projected hepatic levels of these drugs.

Moreover, the combination of the two agents may in fact have synergistic interactions such

124

as that RTV may directly potentiate the OATP1B1 inhibitory activity of DRV and/or indirectly by boosting DRV hepatic levels due to inhibition of oxidative metabolism. The mechanism of DRV/RTV interaction with RSV is unlikely to entail inhibition of BCRP and

MRP2 given that both DRV and RTV caused weak inhibition even at high concentrations.

Two additional lines of evidence in our studies support reduced hepatic uptake of RSV.

First, while not a striking difference, increased plasma levels of RSV did result in diminished efficacy of RSV. This is perhaps due to OATP1B1 mediated inhibition resulting in lower intra-hepatocyte concentrations of this HMG Co-A reductase inhibitor. Secondly, our exploratory genomic analysis suggests that individuals with functionally impaired

OATP1B1 activity due to genetic polymorphism (OATP1B1*15 carriers), had relatively higher plasma drug levels and these two subjects experienced minimal perturbation in their plasma pharmacokinetics. Thus, it appears that a loss of OATP1B1 function either due to low activity allele or drug interaction results in higher plasma concentration which further underscores our in vitro finding that DRV and/or RTV impacts OATP1B1 facilitated RSV uptake.

We hypothesize that due to the different inhibitory/spectral binding characteristics of DRV and RTV and the presence of multiple binding sites on the surface of the transporters, the presence of RTV synergistically influences the ability of DRV to inhibit the drug transporters such as OATP1B1 and BCRP. The next step would be to assess the spectral binding potential of DRV and RTV by analyzing differential interactions of drug transporters with DRV and RTV.

125

Overall, our findings provide the foundation for further pre-clinical and clinical studies.

From a pre-clinical perspective it is intriguing that a protease inhibitor such as RTV seems to have pleiotropic effects with regards to its ability to modulate multiple pathways involved in drug metabolism and pathways. Some of these properties include on one hand mechanism-based inhibition of CYP enzymes, inhibition of multidrug transporters and on the other hand contrasting CYP/UGT/P-gp inductive effects. The mechanistic bases for such interactions are unclear and need to be explored given the tremendous therapeutic implications, both from circumventing adverse drug reactions to using some of these properties for therapeutic advantage. From a clinical perspective, clearly our findings warrant undertaking studies on DRV/rtv (and perhaps other PI combinations with RTV) in larger number of HIV positive subjects. Additionally, our investigation should be considered a pilot study in support of conducting a prospectively controlled study in HIV positive subjects that is adequately powered to fully elucidate the extent of the interaction in patient population much likely to have considerable lipid abnormalities.

126

REFERENCES

1. (2001) Executive Summary of The Third Report of The National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, And Treatment of High Blood Cholesterol In Adults (Adult Treatment Panel III). JAMA 285:2486-2497.

2. Aberg JA, Rosenkranz, SL, Fichtenbaum, CJ, Alston, BL, Brobst, SW, Segal, Y, and Gerber, JG (2006) Pharmacokinetic interaction between nelfinavir and pravastatin in HIV-seronegative volunteers: ACTG Study A5108. AIDS 20:725-729.

3. Anderson MS, Kakuda, TN, Hanley, W, Miller, J, Kost, JT, Stoltz, R, Wenning, LA, Stone, JA, Hoetelmans, RM, Wagner, JA, and Iwamoto, M (2008) Minimal pharmacokinetic interaction between the human immunodeficiency virus nonnucleoside reverse transcriptase inhibitor etravirine and the integrase inhibitor raltegravir in healthy subjects. Antimicrob Agents Chemother 52:4228-4232.

4. Annaert P, Ye, ZW, Stieger, B, and Augustijns, P (2010a) Interaction of HIV protease inhibitors with OATP1B1, 1B3, and 2B1. Xenobiotica 40:163-176.

5. Annaert P, Ye, ZW, Stieger, B, and Augustijns, P (2010b) Interaction of HIV protease inhibitors with OATP1B1, 1B3, and 2B1. Xenobiotica 40:163-176.

6. Arnadottir M, Eriksson, LO, Thysell, H, and Karkas, JD (1993) Plasma concentration profiles of simvastatin 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitory activity in kidney transplant recipients with and without ciclosporin. Nephron 65:410- 413.

7. Asberg A (2003) Interactions between cyclosporine and lipid-lowering drugs: implications for organ transplant recipients. Drugs 63:367-378.

8. Bachmeier CJ, Spitzenberger, TJ, Elmquist, WF, and Miller, DW (2005) Quantitative assessment of HIV-1 protease inhibitor interactions with drug efflux transporters in the blood-brain barrier. Pharm Res 22:1259-1268.

9. Back D, Sekar, V, and Hoetelmans, RM (2008a) DRV: pharmacokinetics and drug interactions. Antivir Ther 13:1-13.

10. Backman JT, Kyrklund, C, Neuvonen, M, and Neuvonen, PJ (2002) Gemfibrozil greatly increases plasma concentrations of cerivastatin. Clin Pharmacol Ther 72:685-691.

11. Behrens G, Dejam, A, Schmidt, H, Balks, HJ, Brabant, G, Korner, T, Stoll, M, and Schmidt, RE (1999) Impaired glucose tolerance, beta cell function and lipid metabolism in HIV patients under treatment with protease inhibitors. AIDS 13:F63-F70.

12. Bierman WF, Scheffer, GL, Schoonderwoerd, A, Jansen, G, van Agtmael, MA, Danner, SA, and Scheper, RJ (2010) Protease inhibitors atazanavir, lopinavir and RTV are potent blockers, but poor substrates, of ABC transporters in a broad panel of ABC transporter- overexpressing cell lines. J Antimicrob Chemother 65:1672-1680.

127

13. Brown MS and Goldstein, JL (1985) The LDL receptor and HMG-CoA reductase--two membrane molecules that regulate cholesterol homeostasis. Curr Top Cell Regul 26:3-15.

14. Buratti FM, Leoni, C, and Testai, E (2006) Foetal and adult human CYP3A isoforms in the bioactivation of organophosphorothionate insecticides. Toxicol Lett 167:245-255.

15. Burk O, Koch, I, Raucy, J, Hustert, E, Eichelbaum, M, Brockmoller, J, Zanger, UM, and Wojnowski, L (2004) The induction of cytochrome P450 3A5 (CYP3A5) in the human liver and intestine is mediated by the xenobiotic sensors pregnane X receptor (PXR) and constitutively activated receptor (CAR). J Biol Chem 279:38379-38385.

16. Carr A, Samaras, K, Thorisdottir, A, Kaufmann, GR, Chisholm, DJ, and Cooper, DA (1999) Diagnosis, prediction, and natural course of HIV-1 protease-inhibitor-associated lipodystrophy, hyperlipidaemia, and diabetes mellitus: a cohort study. Lancet 353:2093- 2099.

17. Chapman MJ, Le, GW, Guerin, M, and Kontush, A (2010) Cholesteryl ester transfer protein: at the heart of the action of lipid-modulating therapy with statins, fibrates, niacin, and cholesteryl ester transfer protein inhibitors. Eur Heart J 31:149-164.

18. Chinetti G, Lestavel, S, Bocher, V, Remaley, AT, Neve, B, Torra, IP, Teissier, E, Minnich, A, Jaye, M, Duverger, N, Brewer, HB, Fruchart, JC, Clavey, V, and Staels, B (2001) PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. Nat Med 7:53-58.

19. Clark R, Kerr, ID, and Callaghan, R (2006) Multiple drugbinding sites on the R482G isoform of the ABCG2 transporter. Br J Pharmacol 149:506-515.

20. Clotet B, Bellos, N, Molina, JM, Cooper, D, Goffard, JC, Lazzarin, A, Wohrmann, A, Katlama, C, Wilkin, T, Haubrich, R, Cohen, C, Farthing, C, Jayaweera, D, Markowitz, M, Ruane, P, Spinosa-Guzman, S, and Lefebvre, E (2007) Efficacy and safety of DRV- RTV at week 48 in treatment-experienced patients with HIV-1 infection in POWER 1 and 2: a pooled subgroup analysis of data from two randomised trials. Lancet 369:1169- 1178.

21. Constans J, Pellegrin, JL, Peuchant, E, Dumon, MF, Pellegrin, I, Sergeant, C, Simonoff, M, Brossard, G, Barbeau, P, Fleury, H, and . (1994a) Plasma lipids in HIV-infected patients: a prospective study in 95 patients. Eur J Clin Invest 24:416-420.

22. Constans J, Pellegrin, JL, Peuchant, E, Dumon, MF, Pellegrin, I, Sergeant, C, Simonoff, M, Brossard, G, Barbeau, P, Fleury, H, and . (1994b) Plasma lipids in HIV-infected patients: a prospective study in 95 patients. Eur J Clin Invest 24:416-420.

23. Coon MJ (2005) Cytochrome P450: nature's most versatile biological catalyst. Annu Rev Pharmacol Toxicol 45:1-25.

128

24. Cooper CL, van Heeswijk, RP, Gallicano, K, and Cameron, DW (2003) A review of low- dose RTV in protease inhibitor combination therapy. Clin Infect Dis 36:1585-1592.

25. Cusatis G, Gregorc, V, Li, J, Spreafico, A, Ingersoll, RG, Verweij, J, Ludovini, V, Villa, E, Hidalgo, M, Sparreboom, A, and Baker, SD (2006) Pharmacogenetics of ABCG2 and adverse reactions to gefitinib. J Natl Cancer Inst 98:1739-1742.

26. Cvetkovic RS and Goa, KL (2003) Lopinavir/RTV: a review of its use in the management of HIV infection. Drugs 63:769-802.

27. da Silva EF and Barbaro, G (2009) New Options in the Treatment of Lipid Disorders in HIV-Infected Patients. Open AIDS J 3:31-37.

28. Dahan A and Amidon, GL (2010) MRP2 mediated drug-drug interaction: indomethacin increases sulfasalazine absorption in the small intestine, potentially decreasing its colonic targeting. Int J Pharm 386:216-220.

29. de Wildt SN, Kearns, GL, Leeder, JS, and van den Anker, JN (1999) Glucuronidation in humans. Pharmacogenetic and developmental aspects. Clin Pharmacokinet 36:439-452.

30. de TP, Kirstetter, M, Perier, A, Meunier, C, Zucman, D, Force, G, Doll, J, Katlama, C, Rozenbaum, W, Masson, H, Gardette, J, and Melchior, JC (2007) Reduction in triglyceride level with N-3 polyunsaturated fatty acids in HIV-infected patients taking potent antiretroviral therapy: a randomized prospective study. J Acquir Immune Defic Syndr 44:278-285.

31. Dilger K, Hofmann, U, and Klotz, U (2000) Enzyme induction in the elderly: effect of rifampin on the pharmacokinetics and pharmacodynamics of propafenone. Clin Pharmacol Ther 67:512-520.

32. Dixit V, Hariparsad, N, Li, F, Desai, P, Thummel, KE, and Unadkat, JD (2007) Cytochrome P450 enzymes and transporters induced by anti-human immunodeficiency virus protease inhibitors in human hepatocytes: implications for predicting clinical drug interactions. Drug Metab Dispos 35:1853-1859.

33. Doyle LA, Yang, W, Abruzzo, LV, Krogmann, T, Gao, Y, Rishi, AK, and Ross, DD (1998) A multidrug resistance transporter from human MCF-7 breast cancer cells. Proc Natl Acad Sci U S A 95:15665-15670.

34. Dresser GK, Spence, JD, and Bailey, DG (2000) Pharmacokinetic-pharmacodynamic consequences and clinical relevance of cytochrome P450 3A4 inhibition. Clin Pharmacokinet 38:41-57.

35. Duanmu Z, Locke, D, Smigelski, J, Wu, W, Dahn, MS, Falany, CN, Kocarek, TA, and Runge-Morris, M (2002) Effects of dexamethasone on aryl (SULT1A1)- and hydroxysteroid (SULT2A1)-sulfotransferase gene expression in primary cultured human hepatocytes. Drug Metab Dispos 30:997-1004.

129

36. Dube MP, Sprecher, D, Henry, WK, Aberg, JA, Torriani, FJ, Hodis, HN, Schouten, J, Levin, J, Myers, G, Zackin, R, Nevin, T, and Currier, JS (2000) Preliminary guidelines for the evaluation and management of dyslipidemia in adults infected with human immunodeficiency virus and receiving antiretroviral therapy: Recommendations of the Adult AIDS Clinical Trial Group Cardiovascular Disease Focus Group. Clin Infect Dis 31:1216-1224.

37. Dube MP, Stein, JH, Aberg, JA, Fichtenbaum, CJ, Gerber, JG, Tashima, KT, Henry, WK, Currier, JS, Sprecher, D, and Glesby, MJ (2003a) Guidelines for the evaluation and management of dyslipidemia in human immunodeficiency virus (HIV)-infected adults receiving antiretroviral therapy: recommendations of the HIV Medical Association of the Infectious Disease Society of America and the Adult AIDS Clinical Trials Group. Clin Infect Dis 37:613-627.

38. Dube MP, Stein, JH, Aberg, JA, Fichtenbaum, CJ, Gerber, JG, Tashima, KT, Henry, WK, Currier, JS, Sprecher, D, and Glesby, MJ (2003b) Guidelines for the evaluation and management of dyslipidemia in human immunodeficiency virus (HIV)-infected adults receiving antiretroviral therapy: recommendations of the HIV Medical Association of the Infectious Disease Society of America and the Adult AIDS Clinical Trials Group. Clin Infect Dis 37:613-627.

39. Dube MP, Wu, JW, Aberg, JA, Deeg, MA, ston-Smith, BL, McGovern, ME, Lee, D, Shriver, SL, Martinez, AI, Greenwald, M, and Stein, JH (2006) Safety and efficacy of extended-release niacin for the treatment of dyslipidaemia in patients with HIV infection: AIDS Clinical Trials Group Study A5148. Antivir Ther 11:1081-1089.

40. Enokizono J, Kusuhara, H, and Sugiyama, Y (2007) Effect of breast cancer resistance protein (Bcrp/Abcg2) on the disposition of phytoestrogens. Mol Pharmacol 72:967-975.

41. Farady CJ and Craik, CS (2010) Mechanisms of macromolecular protease inhibitors. Chembiochem 11:2341-2346.

42. Feingold KR, Krauss, RM, Pang, M, Doerrler, W, Jensen, P, and Grunfeld, C (1993) The hypertriglyceridemia of acquired immunodeficiency syndrome is associated with an increased prevalence of low density lipoprotein subclass pattern B. J Clin Endocrinol Metab 76:1423-1427.

43. Fichtenbaum CJ and Gerber, JG (2002) Interactions between antiretroviral drugs and drugs used for the therapy of the metabolic complications encountered during HIV infection. Clin Pharmacokinet 41:1195-1211.

44. Fichtenbaum CJ, Gerber, JG, Rosenkranz, SL, Segal, Y, Aberg, JA, Blaschke, T, Alston, B, Fang, F, Kosel, B, and Aweeka, F (2002a) Pharmacokinetic interactions between protease inhibitors and statins in HIV seronegative volunteers: ACTG Study A5047. AIDS 16:569-577.

45. Fichtenbaum CJ, Gerber, JG, Rosenkranz, SL, Segal, Y, Aberg, JA, Blaschke, T, Alston, B, Fang, F, Kosel, B, and Aweeka, F (2002b) Pharmacokinetic interactions between 130

protease inhibitors and statins in HIV seronegative volunteers: ACTG Study A5047. AIDS 16:569-577.

46. Friis-Moller N, Sabin, CA, Weber, R, d'Arminio, MA, El-Sadr, WM, Reiss, P, Thiebaut, R, Morfeldt, L, de, WS, Pradier, C, Calvo, G, Law, MG, Kirk, O, Phillips, AN, and Lundgren, JD (2003) Combination antiretroviral therapy and the risk of myocardial infarction. N Engl J Med 349:1993-2003.

47. Fujino H, Nakai, D, Nakagomi, R, Saito, M, Tokui, T, and Kojima, J (2004) Metabolic stability and uptake by human hepatocytes of pitavastatin, a new inhibitor of HMG-CoA reductase. Arzneimittelforschung 54:382-388.

48. Fujino H, Saito, T, Ogawa, S, and Kojima, J (2005) Transporter-mediated influx and efflux mechanisms of pitavastatin, a new inhibitor of HMG-CoA reductase. J Pharm Pharmacol 57:1305-1311.

49. Fujino H, Yamada, I, Shimada, S, and Kojima, J (2002a) Metabolic fate of pitavastatin, a new inhibitor of HMG-CoA reductase--effect of cMOAT deficiency on hepatobiliary excretion in rats and of mdr1a/b gene disruption on tissue distribution in mice. Drug Metab Pharmacokinet 17:449-456.

50. Fujino H, Yamada, I, Shimada, S, Nagao, T, and Yoneda, M (2002b) Metabolic fate of pitavastatin (NK-104), a new inhibitor of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase. Effects on drug-metabolizing systems in rats and humans. Arzneimittelforschung 52:745-753.

51. Gadbut AP, Caruso, AP, and Galper, JB (1995) Differential sensitivity of C2-C12 striated muscle cells to lovastatin and pravastatin. J Mol Cell Cardiol 27:2397-2402.

52. Galetin A and Houston, JB (2006) Intestinal and hepatic metabolic activity of five cytochrome P450 enzymes: impact on prediction of first-pass metabolism. J Pharmacol Exp Ther 318:1220-1229.

53. Gardner-Stephen D, Heydel, JM, Goyal, A, Lu, Y, Xie, W, Lindblom, T, Mackenzie, P, and Radominska-Pandya, A (2004) Human PXR variants and their differential effects on the regulation of human UDP-glucuronosyltransferase gene expression. Drug Metab Dispos 32:340-347.

54. Gerbal-Chaloin S, Pascussi, JM, Pichard-Garcia, L, Daujat, M, Waechter, F, Fabre, JM, Carrere, N, and Maurel, P (2001) Induction of CYP2C genes in human hepatocytes in primary culture. Drug Metab Dispos 29:242-251.

55. Giacomini KM, Huang, SM, Tweedie, DJ, Benet, LZ, Brouwer, KL, Chu, X, Dahlin, A, Evers, R, Fischer, V, Hillgren, KM, Hoffmaster, KA, Ishikawa, T, Keppler, D, Kim, RB, Lee, CA, Niemi, M, Polli, JW, Sugiyama, Y, Swaan, PW, Ware, JA, Wright, SH, Yee, SW, Zamek-Gliszczynski, MJ, and Zhang, L (2010) Membrane transporters in drug development. Nat Rev Drug Discov 9:215-236.

131

56. Goldberg AC (2002) Clinical implications of statin event trials. Curr Atheroscler Rep 4:337-342.

57. Goodwin B, Moore, LB, Stoltz, CM, McKee, DD, and Kliewer, SA (2001) Regulation of the human CYP2B6 gene by the nuclear pregnane X receptor. Mol Pharmacol 60:427- 431.

58. Goodwin B, Redinbo, MR, and Kliewer, SA (2002) Regulation of cyp3a gene transcription by the pregnane x receptor. Annu Rev Pharmacol Toxicol 42:1-23.

59. Grunfeld C, Pang, M, Doerrler, W, Shigenaga, JK, Jensen, P, and Feingold, KR (1992) Lipids, lipoproteins, triglyceride clearance, and cytokines in human immunodeficiency virus infection and the acquired immunodeficiency syndrome. J Clin Endocrinol Metab 74:1045-1052.

60. Guengerich FP (1999) Cytochrome P-450 3A4: regulation and role in drug metabolism. Annu Rev Pharmacol Toxicol 39:1-17.

61. Guengerich FP (2006) Cytochrome P450s and other enzymes in drug metabolism and toxicity. AAPS J 8:E101-E111.

62. Gui C, Miao, Y, Thompson, L, Wahlgren, B, Mock, M, Stieger, B, and Hagenbuch, B (2008) Effect of pregnane X receptor ligands on transport mediated by human OATP1B1 and OATP1B3. Eur J Pharmacol 584:57-65.

63. Gupta A, Mugundu, GM, Desai, PB, Thummel, KE, and Unadkat, JD (2008) Intestinal human colon adenocarcinoma cell line LS180 is an excellent model to study pregnane X receptor, but not constitutive androstane receptor, mediated CYP3A4 and multidrug resistance transporter 1 induction: studies with anti-human immunodeficiency virus protease inhibitors. Drug Metab Dispos 36:1172-1180.

64. Hagenbuch B and Gui, C (2008) Xenobiotic transporters of the human organic anion transporting polypeptides (OATP) family. Xenobiotica 38:778-801.

65. Hagenbuch B and Meier, PJ (2003) The superfamily of organic anion transporting polypeptides. Biochim Biophys Acta 1609:1-18.

66. Hatanaka T (2000) Clinical pharmacokinetics of pravastatin: mechanisms of pharmacokinetic events. Clin Pharmacokinet 39:397-412.

67. Heath KV, Hogg, RS, Chan, KJ, Harris, M, Montessori, V, O'Shaughnessy, MV, and Montanera, JS (2001) Lipodystrophy-associated morphological, cholesterol and triglyceride abnormalities in a population-based HIV/AIDS treatment database. AIDS 15:231-239.

68. Hines RN (2007) Ontogeny of human hepatic cytochromes P450. J Biochem Mol Toxicol 21:169-175.

132

69. Hirano M, Maeda, K, Hayashi, H, Kusuhara, H, and Sugiyama, Y (2005a) Bile salt export pump (BSEP/ABCB11) can transport a nonbile acid substrate, pravastatin. J Pharmacol Exp Ther 314:876-882.

70. Hirano M, Maeda, K, Matsushima, S, Nozaki, Y, Kusuhara, H, and Sugiyama, Y (2005b) Involvement of BCRP (ABCG2) in the biliary excretion of pitavastatin. Mol Pharmacol 68:800-807.

71. Hirano M, Maeda, K, Shitara, Y, and Sugiyama, Y (2004) Contribution of OATP2 (OATP1B1) and OATP8 (OATP1B3) to the hepatic uptake of pitavastatin in humans. J Pharmacol Exp Ther 311:139-146.

72. Ho RH, Tirona, RG, Leake, BF, Glaeser, H, Lee, W, Lemke, CJ, Wang, Y, and Kim, RB (2006) Drug and bile acid transporters in RSV hepatic uptake: function, expression, and pharmacogenetics. Gastroenterology 130:1793-1806.

73. Holdgate GA, Ward, WH, and McTaggart, F (2003) Molecular mechanism for inhibition of 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase by RSV. Biochem Soc Trans 31:528-531.

74. Hsiang B, Zhu, Y, Wang, Z, Wu, Y, Sasseville, V, Yang, WP, and Kirchgessner, TG (1999) A novel human hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA reductase inhibitor transporters. J Biol Chem 274:37161-37168.

75. Hsyu PH, Schultz-Smith, MD, Lillibridge, JH, Lewis, RH, and Kerr, BM (2001) Pharmacokinetic interactions between nelfinavir and 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors atorvastatin and simvastatin. Antimicrob Agents Chemother 45:3445-3450.

76. Huang L, Wang, Y, and Grimm, S (2006) ATP-dependent transport of RSV in membrane vesicles expressing breast cancer resistance protein. Drug Metab Dispos 34:738-742.

77. Huisman MT, Smit, JW, Crommentuyn, KM, Zelcer, N, Wiltshire, HR, Beijnen, JH, and Schinkel, AH (2002) Multidrug resistance protein 2 (MRP2) transports HIV protease inhibitors, and transport can be enhanced by other drugs. AIDS 16:2295-2301.

78. Ichimaru N, Takahara, S, Kokado, Y, Wang, JD, Hatori, M, Kameoka, H, Inoue, T, and Okuyama, A (2001) Changes in lipid metabolism and effect of simvastatin in renal transplant recipients induced by cyclosporine or tacrolimus. Atherosclerosis 158:417-423.

79. Ichimaru N, Takahara, S, Moriyama, T, Kondo, M, Nonomura, N, Tanaka, T, Wang, JD, Imai, E, Okuyama, A, and Kondo, Y (2004) Pharmacokinetics and lipid-lowering effect of fluvastatin in hypercholesterolaemic patients on maintenance haemodialysis. J Int Med Res 32:45-52.

133

80. Istvan ES (2002a) Structural mechanism for statin inhibition of 3-hydroxy-3- methylglutaryl coenzyme A reductase. Am Heart J 144:S27-S32.

81. Istvan ES (2002b) Structural mechanism for statin inhibition of 3-hydroxy-3- methylglutaryl coenzyme A reductase. Am Heart J 144:S27-S32.

82. Ito S, Ieiri, I, Tanabe, M, Suzuki, A, Higuchi, S, and Otsubo, K (2001) Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects. Pharmacogenetics 11:175-184.

83. Itoh S, Yanagimoto, T, Tagawa, S, Hashimoto, H, Kitamura, R, Nakajima, Y, Okochi, T, Fujimoto, S, Uchino, J, and Kamataki, T (1992) Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5' flanking region. Biochim Biophys Acta 1130:133-138.

84. Iwai M, Suzuki, H, Ieiri, I, Otsubo, K, and Sugiyama, Y (2004) Functional analysis of single nucleotide polymorphisms of hepatic organic anion transporter OATP1B1 (OATP- C). Pharmacogenetics 14:749-757.

85. Jedlitschky G and Keppler, D (2002) Transport of leukotriene C4 and structurally related conjugates. Vitam Horm 64:153-184.

86. Jedlitschky G, Leier, I, Buchholz, U, Barnouin, K, Kurz, G, and Keppler, D (1996) Transport of glutathione, glucuronate, and sulfate conjugates by the MRP gene-encoded conjugate export pump. Cancer Res 56:988-994.

87. Jemnitz K, Veres, Z, Tugyi, R, and Vereczkey, L (2010) Biliary efflux transporters involved in the clearance of RSV in sandwich culture of primary rat hepatocytes. Toxicol In Vitro 24:605-610.

88. Jones PH, Davidson, MH, Stein, EA, Bays, HE, McKenney, JM, Miller, E, Cain, VA, and Blasetto, JW (2003) Comparison of the efficacy and safety of RSV versus atorvastatin, simvastatin, and pravastatin across doses (STELLAR* Trial). Am J Cardiol 92:152-160.

89. Keppler D (2005) Uptake and efflux transporters for conjugates in human hepatocytes. Methods Enzymol 400:531-542.

90. Kiser JJ, Gerber, JG, Predhomme, JA, Wolfe, P, Flynn, DM, and Hoody, DW (2008) Drug/Drug interaction between lopinavir/RTV and RSV in healthy volunteers. J Acquir Immune Defic Syndr 47:570-578.

91. Kitamura S, Maeda, K, Wang, Y, and Sugiyama, Y (2008) Involvement of multiple transporters in the hepatobiliary transport of RSV. Drug Metab Dispos 36:2014-2023.

92. Kliewer SA, Goodwin, B, and Willson, TM (2002) The nuclear pregnane X receptor: a key regulator of xenobiotic metabolism. Endocr Rev 23:687-702.

134

93. Koizumi F, Kanzawa, F, Ueda, Y, Koh, Y, Tsukiyama, S, Taguchi, F, Tamura, T, Saijo, N, and Nishio, K (2004) Synergistic interaction between the EGFR tyrosine kinase inhibitor gefitinib ("Iressa") and the DNA topoisomerase I inhibitor CPT-11 (irinotecan) in human colorectal cancer cells. Int J Cancer 108:464-472.

94. Kolars JC, Awni, WM, Merion, RM, and Watkins, PB (1991) First-pass metabolism of cyclosporin by the gut. Lancet 338:1488-1490.

95. Konig J (2011) Uptake transporters of the human OATP family: molecular characteristics, substrates, their role in drug-drug interactions, and functional consequences of polymorphisms. Handb Exp Pharmacol1-28.

96. Konig J, Nies, AT, Cui, Y, Leier, I, and Keppler, D (1999a) Conjugate export pumps of the multidrug resistance protein (MRP) family: localization, substrate specificity, and MRP2-mediated drug resistance. Biochim Biophys Acta 1461:377-394.

97. Konig J, Nies, AT, Cui, Y, Leier, I, and Keppler, D (1999b) Conjugate export pumps of the multidrug resistance protein (MRP) family: localization, substrate specificity, and MRP2-mediated drug resistance. Biochim Biophys Acta 1461:377-394.

98. Konig SK, Herzog, M, Theile, D, Zembruski, N, Haefeli, WE, and Weiss, J (2010) Impact of drug transporters on cellular resistance towards saquinavir and DRV. J Antimicrob Chemother 65:2319-2328.

99. Kullak-Ublick GA, Beuers, U, Fahney, C, Hagenbuch, B, Meier, PJ, and Paumgartner, G (1997) Identification and functional characterization of the promoter region of the human organic anion transporting polypeptide gene. Hepatology 26:991-997.

100. Kumar S, Earla, R, Jin, M, Mitra, AK, and Kumar, A (2010) Effect of ethanol on spectral binding, inhibition, and activity of CYP3A4 with an antiretroviral drug nelfinavir. Biochem Biophys Res Commun 402:163-167.

101. Laaksonen R, Katajamaa, M, Paiva, H, Sysi-Aho, M, Saarinen, L, Junni, P, Lutjohann, D, Smet, J, Van, CR, Seppanen-Laakso, T, Lehtimaki, T, Soini, J, and Oresic, M (2006) A systems biology strategy reveals biological pathways and plasma biomarker candidates for potentially toxic statin-induced changes in muscle. PLoS One 1:e97-

102. Lacroix D, Sonnier, M, Moncion, A, Cheron, G, and Cresteil, T (1997) Expression of CYP3A in the human liver--evidence that the shift between CYP3A7 and CYP3A4 occurs immediately after birth. Eur J Biochem 247:625-634.

103. Lalani SR, Vladutiu, GD, Plunkett, K, Lotze, TE, Adesina, AM, and Scaglia, F (2005) Isolated mitochondrial myopathy associated with muscle coenzyme Q10 deficiency. Arch Neurol 62:317-320.

104. Lamba JK, Lin, YS, Schuetz, EG, and Thummel, KE (2002a) Genetic contribution to variable human CYP3A-mediated metabolism. Adv Drug Deliv Rev 54:1271-1294.

135

105. Lamba JK, Lin, YS, Schuetz, EG, and Thummel, KE (2002b) Genetic contribution to variable human CYP3A-mediated metabolism. Adv Drug Deliv Rev 54:1271-1294.

106. Lasser KE, Allen, PD, Woolhandler, SJ, Himmelstein, DU, Wolfe, SM, and Bor, DH (2002) Timing of new black box warnings and withdrawals for prescription medications. JAMA 287:2215-2220.

107. Lau YY, Okochi, H, Huang, Y, and Benet, LZ (2006) Multiple transporters affect the disposition of atorvastatin and its two active hydroxy metabolites: application of in vitro and ex situ systems. J Pharmacol Exp Ther 316:762-771.

108. Le TC, Barrail, A, Goujard, C, and Taburet, AM (2005) Clinical pharmacokinetics and summary of efficacy and tolerability of atazanavir. Clin Pharmacokinet 44:1035-1050.

109. Lennernas H (2003) Clinical pharmacokinetics of atorvastatin. Clin Pharmacokinet 42:1141-1160.

110. Lennernas H and Fager, G (1997a) Pharmacodynamics and pharmacokinetics of the HMG-CoA reductase inhibitors. Similarities and differences. Clin Pharmacokinet 32:403-425.

111. Lennernas H and Fager, G (1997b) Pharmacodynamics and pharmacokinetics of the HMG-CoA reductase inhibitors. Similarities and differences. Clin Pharmacokinet 32:403-425.

112. Leucuta SE and Vlase, L (2006) Pharmacokinetics and metabolic drug interactions. Curr Clin Pharmacol 1:5-20.

113. Leuthold S, Hagenbuch, B, Mohebbi, N, Wagner, CA, Meier, PJ, and Stieger, B (2009) Mechanisms of pH-gradient driven transport mediated by organic anion polypeptide transporters. Am J Physiol Cell Physiol 296:C570-C582.

114. Lin JH and Lu, AY (2001) Interindividual variability in inhibition and induction of cytochrome P450 enzymes. Annu Rev Pharmacol Toxicol 41:535-567.

115. LOWRY OH, ROSEBROUGH, NJ, FARR, AL, and RANDALL, RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-275.

116. Madsen JK, Jensen, JD, Jensen, LW, and Pedersen, EB (1996) Pharmacokinetic interaction between cyclosporine and the dihydropyridine calcium antagonist felodipine. Eur J Clin Pharmacol 50:203-208.

117. Manfredi R and Chiodo, F (2001) Disorders of lipid metabolism in patients with HIV disease treated with antiretroviral agents: frequency, relationship with administered drugs, and role of hypolipidaemic therapy with bezafibrate. J Infect 42:181-188.

118. Mao Q and Unadkat, JD (2005) Role of the breast cancer resistance protein (ABCG2) in drug transport. AAPS J 7:E118-E133.

136

119. Martin PD, Mitchell, PD, and Schneck, DW (2002) Pharmacodynamic effects and pharmacokinetics of a new HMG-CoA reductase inhibitor, RSV, after morning or evening administration in healthy volunteers. Br J Clin Pharmacol 54:472-477.

120. Martin PD, Warwick, MJ, Dane, AL, Hill, SJ, Giles, PB, Phillips, PJ, and Lenz, E (2003) Metabolism, excretion, and pharmacokinetics of RSV in healthy adult male volunteers. Clin Ther 25:2822-2835.

121. Martinez E, Domingo, P, Galindo, MJ, Milinkovic, A, Arroyo, JA, Baldovi, F, Larrousse, M, Leon, A, de, LE, and Gatell, JM (2004) Risk of metabolic abnormalities in patients infected with HIV receiving antiretroviral therapy that contains lopinavir-RTV. Clin Infect Dis 38:1017-1023.

122. Matsushima S, Maeda, K, Kondo, C, Hirano, M, Sasaki, M, Suzuki, H, and Sugiyama, Y (2005) Identification of the hepatic efflux transporters of organic anions using double- transfected Madin-Darby canine kidney II cells expressing human organic anion- transporting polypeptide 1B1 (OATP1B1)/multidrug resistance-associated protein 2, OATP1B1/multidrug resistance 1, and OATP1B1/breast cancer resistance protein. J Pharmacol Exp Ther 314:1059-1067.

123. McArthur JC (2004) HIV dementia: an evolving disease. J Neuroimmunol 157:3-10.

124. McKeage K and Scott, LJ (2010) DRV: in treatment-experienced pediatric patients with HIV-1 infection. Paediatr Drugs 12:123-131.

125. McTaggart F, Buckett, L, Davidson, R, Holdgate, G, McCormick, A, Schneck, D, Smith, G, and Warwick, M (2001a) Preclinical and clinical pharmacology of RSV, a new 3- hydroxy-3-methylglutaryl coenzyme A reductase inhibitor. Am J Cardiol 87:28B-32B.

126. McTaggart F, Buckett, L, Davidson, R, Holdgate, G, McCormick, A, Schneck, D, Smith, G, and Warwick, M (2001b) Preclinical and clinical pharmacology of RSV, a new 3- hydroxy-3-methylglutaryl coenzyme A reductase inhibitor. Am J Cardiol 87:28B-32B.

127. McTaggart F, Buckett, L, Davidson, R, Holdgate, G, McCormick, A, Schneck, D, Smith, G, and Warwick, M (2001c) Preclinical and clinical pharmacology of RSV, a new 3- hydroxy-3-methylglutaryl coenzyme A reductase inhibitor. Am J Cardiol 87:28B-32B.

128. Mills AM, Nelson, M, Jayaweera, D, Ruxrungtham, K, Cassetti, I, Girard, PM, Workman, C, Dierynck, I, Sekar, V, Abeele, CV, and Lavreys, L (2009) Once-daily DRV/RTV vs. lopinavir/RTV in treatment-naive, HIV-1-infected patients: 96-week analysis. AIDS 23:1679-1688.

129. Mizuarai S, Aozasa, N, and Kotani, H (2004) Single nucleotide polymorphisms result in impaired membrane localization and reduced atpase activity in multidrug transporter ABCG2. Int J Cancer 109:238-246.

130. Montessori V, Press, N, Harris, M, Akagi, L, and Montaner, JS (2004) Adverse effects of antiretroviral therapy for HIV infection. CMAJ 170:229-238.

137

131. Morimoto K, Oishi, T, Ueda, S, Ueda, M, Hosokawa, M, and Chiba, K (2004) A novel variant allele of OATP-C (SLCO1B1) found in a Japanese patient with pravastatin- induced myopathy. Drug Metab Pharmacokinet 19:453-455.

132. Moyle GJ and Back, D (2001) Principles and practice of HIV-protease inhibitor pharmacoenhancement. HIV Med 2:105-113.

133. Muck W (2000) Clinical pharmacokinetics of cerivastatin. Clin Pharmacokinet 39:99- 116.

134. Muralidhara BK, Sun, L, Negi, S, and Halpert, JR (2008) Thermodynamic fidelity of the mammalian cytochrome P450 2B4 active site in binding substrates and inhibitors. J Mol Biol 377:232-245.

135. Murray M (1997) Drug-mediated inactivation of cytochrome P450. Clin Exp Pharmacol Physiol 24:465-470.

136. Mwinyi J, Kopke, K, Schaefer, M, Roots, I, and Gerloff, T (2008) Comparison of SLCO1B1 sequence variability among German, Turkish, and African populations. Eur J Clin Pharmacol 64:257-266.

137. Nakai D, Nakagomi, R, Furuta, Y, Tokui, T, Abe, T, Ikeda, T, and Nishimura, K (2001) Human liver-specific organic anion transporter, LST-1, mediates uptake of pravastatin by human hepatocytes. J Pharmacol Exp Ther 297:861-867.

138. Negre-Aminou P, van Vliet, AK, van, EM, van Thiel, GC, van Leeuwen, RE, and Cohen, LH (1997) Inhibition of proliferation of human smooth muscle cells by various HMG- CoA reductase inhibitors; comparison with other human cell types. Biochim Biophys Acta 1345:259-268.

139. Nelson DR, Koymans, L, Kamataki, T, Stegeman, JJ, Feyereisen, R, Waxman, DJ, Waterman, MR, Gotoh, O, Coon, MJ, Estabrook, RW, Gunsalus, IC, and Nebert, DW (1996) P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6:1-42.

140. Neuvonen PJ (2010) Drug interactions with HMG-CoA reductase inhibitors (statins): the importance of CYP enzymes, transporters and pharmacogenetics. Curr Opin Investig Drugs 11:323-332.

141. Neuvonen PJ and Jalava, KM (1996) Itraconazole drastically increases plasma concentrations of lovastatin and lovastatin acid. Clin Pharmacol Ther 60:54-61.

142. Neuvonen PJ, Kantola, T, and Kivisto, KT (1998) Simvastatin but not pravastatin is very susceptible to interaction with the CYP3A4 inhibitor itraconazole. Clin Pharmacol Ther 63:332-341.

143. Neuvonen PJ and Suhonen, R (1995) Itraconazole interacts with felodipine. J Am Acad Dermatol 33:134-135.

138

144. Nicolle E, Boccard, J, Guilet, D, Dijoux-Franca, MG, Zelefac, F, Macalou, S, Grosselin, J, Schmidt, J, Carrupt, PA, Di, PA, and Boumendjel, A (2009) Breast cancer resistance protein (BCRP/ABCG2): new inhibitors and QSAR studies by a 3D linear solvation energy approach. Eur J Pharm Sci 38:39-46.

145. Niemi M, Arnold, KA, Backman, JT, Pasanen, MK, Godtel-Armbrust, U, Wojnowski, L, Zanger, UM, Neuvonen, PJ, Eichelbaum, M, Kivisto, KT, and Lang, T (2006) Association of genetic polymorphism in ABCC2 with hepatic multidrug resistance- associated protein 2 expression and pravastatin pharmacokinetics. Pharmacogenet Genomics 16:801-808.

146. Nishizato Y, Ieiri, I, Suzuki, H, Kimura, M, Kawabata, K, Hirota, T, Takane, H, Irie, S, Kusuhara, H, Urasaki, Y, Urae, A, Higuchi, S, Otsubo, K, and Sugiyama, Y (2003) Polymorphisms of OATP-C (SLC21A6) and OAT3 (SLC22A8) genes: consequences for pravastatin pharmacokinetics. Clin Pharmacol Ther 73:554-565.

147. Noe J, Portmann, R, Brun, ME, and Funk, C (2007) Substrate-dependent drug-drug interactions between gemfibrozil, fluvastatin and other organic anion-transporting peptide (OATP) substrates on OATP1B1, OATP2B1, and OATP1B3. Drug Metab Dispos 35:1308-1314.

148. Olbricht C, Wanner, C, Eisenhauer, T, Kliem, V, Doll, R, Boddaert, M, O'Grady, P, Krekler, M, Mangold, B, and Christians, U (1997) Accumulation of lovastatin, but not pravastatin, in the blood of cyclosporine-treated kidney graft patients after multiple doses. Clin Pharmacol Ther 62:311-321.

149. Olkkola KT, Aranko, K, Luurila, H, Hiller, A, Saarnivaara, L, Himberg, JJ, and Neuvonen, PJ (1993) A potentially hazardous interaction between erythromycin and midazolam. Clin Pharmacol Ther 53:298-305.

150. Ortiz de Montellano PR (1995) The 1994 Bernard B. Brodie Award Lecture. Structure, mechanism, and inhibition of cytochrome P450. Drug Metab Dispos 23:1181-1187.

151. Ozdemir M, Aktan, Y, Boydag, BS, Cingi, MI, and Musmul, A (1998) Interaction between grapefruit juice and diazepam in humans. Eur J Drug Metab Pharmacokinet 23:55-59.

152. Paine MF, Khalighi, M, Fisher, JM, Shen, DD, Kunze, KL, Marsh, CL, Perkins, JD, and Thummel, KE (1997) Characterization of interintestinal and intraintestinal variations in human CYP3A-dependent metabolism. J Pharmacol Exp Ther 283:1552-1562.

153. Periard D, Telenti, A, Sudre, P, Cheseaux, JJ, Halfon, P, Reymond, MJ, Marcovina, SM, Glauser, MP, Nicod, P, Darioli, R, and Mooser, V (1999) Atherogenic dyslipidemia in HIV-infected individuals treated with protease inhibitors. The Swiss HIV Cohort Study. Circulation 100:700-705.

139

154. Pizzagalli F, Hagenbuch, B, Stieger, B, Klenk, U, Folkers, G, and Meier, PJ (2002) Identification of a novel human organic anion transporting polypeptide as a high affinity thyroxine transporter. Mol Endocrinol 16:2283-2296.

155. Polasek TM and Miners, JO (2006) Quantitative prediction of macrolide drug-drug interaction potential from in vitro studies using testosterone as the human cytochrome P4503A substrate. Eur J Clin Pharmacol 62:203-208.

156. Preissner S, Kroll, K, Dunkel, M, Senger, C, Goldsobel, G, Kuzman, D, Guenther, S, Winnenburg, R, Schroeder, M, and Preissner, R (2010) SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res 38:D237-D243.

157. Prueksaritanont T, Zhao, JJ, Ma, B, Roadcap, BA, Tang, C, Qiu, Y, Liu, L, Lin, JH, Pearson, PG, and Baillie, TA (2002a) Mechanistic studies on metabolic interactions between gemfibrozil and statins. J Pharmacol Exp Ther 301:1042-1051.

158. Prueksaritanont T, Zhao, JJ, Ma, B, Roadcap, BA, Tang, C, Qiu, Y, Liu, L, Lin, JH, Pearson, PG, and Baillie, TA (2002b) Mechanistic studies on metabolic interactions between gemfibrozil and statins. J Pharmacol Exp Ther 301:1042-1051.

159. Regazzi R, Kikuchi, A, Takai, Y, and Wollheim, CB (1992) The small GTP-binding proteins in the cytosol of insulin-secreting cells are complexed to GDP dissociation inhibitor proteins. J Biol Chem 267:17512-17519.

160. Riddler SA, Smit, E, Cole, SR, Li, R, Chmiel, JS, Dobs, A, Palella, F, Visscher, B, Evans, R, and Kingsley, LA (2003) Impact of HIV infection and HAART on serum lipids in men. JAMA 289:2978-2982.

161. Roberts AG, Campbell, AP, and Atkins, WM (2005) The thermodynamic landscape of testosterone binding to cytochrome P450 3A4: ligand binding and spin state equilibria. Biochemistry 44:1353-1366.

162. Robey RW, Medina-Perez, WY, Nishiyama, K, Lahusen, T, Miyake, K, Litman, T, Senderowicz, AM, Ross, DD, and Bates, SE (2001) Overexpression of the ATP-binding cassette half-transporter, ABCG2 (Mxr/BCrp/ABCP1), in flavopiridol-resistant human breast cancer cells. Clin Cancer Res 7:145-152.

163. Rodriguez YM and Davalos, A (2008) [Statins and stroke]. Med Clin (Barc ) 130:453- 454.

164. Rodriguez-Antona C, Donato, MT, Boobis, A, Edwards, RJ, Watts, PS, Castell, JV, and Gomez-Lechon, MJ (2002) Cytochrome P450 expression in human hepatocytes and hepatoma cell lines: molecular mechanisms that determine lower expression in cultured cells. Xenobiotica 32:505-520.

140

165. Rodriguez-Antona C, Jande, M, Rane, A, and Ingelman-Sundberg, M (2005) Identification and phenotype characterization of two CYP3A haplotypes causing different enzymatic capacity in fetal livers. Clin Pharmacol Ther 77:259-270.

166. Ruzilawati AB, Suhaimi, AW, and Gan, SH (2007) Genetic polymorphisms of CYP3A4: CYP3A4*18 allele is found in five healthy Malaysian subjects. Clin Chim Acta 383:158- 162.

167. Saito H, Hirano, H, Nakagawa, H, Fukami, T, Oosumi, K, Murakami, K, Kimura, H, Kouchi, T, Konomi, M, Tao, E, Tsujikawa, N, Tarui, S, Nagakura, M, Osumi, M, and Ishikawa, T (2006) A new strategy of high-speed screening and quantitative structure- activity relationship analysis to evaluate human ATP-binding cassette transporter ABCG2-drug interactions. J Pharmacol Exp Ther 317:1114-1124.

168. Saito H, Masuda, S, and Inui, K (1996) Cloning and functional characterization of a novel rat organic anion transporter mediating basolateral uptake of methotrexate in the kidney. J Biol Chem 271:20719-20725.

169. Samineni D and Fichtenbaum, CJ (2010) Fenofibrate in the treatment of dyslipidemia associated with HIV infection. Expert Opin Drug Metab Toxicol 6:995-1004.

170. Sasaki M, Suzuki, H, Ito, K, Abe, T, and Sugiyama, Y (2002) Transcellular transport of organic anions across a double-transfected Madin-Darby canine kidney II cell monolayer expressing both human organic anion-transporting polypeptide (OATP2/SLC21A6) and Multidrug resistance-associated protein 2 (MRP2/ABCC2). J Biol Chem 277:6497-6503.

171. Schneck DW, Birmingham, BK, Zalikowski, JA, Mitchell, PD, Wang, Y, Martin, PD, Lasseter, KC, Brown, CD, Windass, AS, and Raza, A (2004a) The effect of gemfibrozil on the pharmacokinetics of RSV. Clin Pharmacol Ther 75:455-463.

172. Schneck DW, Birmingham, BK, Zalikowski, JA, Mitchell, PD, Wang, Y, Martin, PD, Lasseter, KC, Brown, CD, Windass, AS, and Raza, A (2004b) The effect of gemfibrozil on the pharmacokinetics of RSV. Clin Pharmacol Ther 75:455-463.

173. Schneck DW, Knopp, RH, Ballantyne, CM, McPherson, R, Chitra, RR, and Simonson, SG (2003) Comparative effects of RSV and atorvastatin across their dose ranges in patients with hypercholesterolemia and without active arterial disease. Am J Cardiol 91:33-41.

174. Sekar V, Kestens, D, Spinosa-Guzman, S, De, PM, De, PE, Vangeneugden, T, Lefebvre, E, and Hoetelmans, RM (2007) The effect of different meal types on the pharmacokinetics of DRV (TMC114)/RTV in HIV-negative healthy volunteers. J Clin Pharmacol 47:479-484.

175. Sekar VJ, Lefebvre, E, De, PM, Vangeneugden, T, and Hoetelmans, RM (2008) Pharmacokinetics of DRV/RTV and ketoconazole following co-administration in HIV- healthy volunteers. Br J Clin Pharmacol 66:215-221.

141

176. Shirasaka Y, Suzuki, K, Nakanishi, T, and Tamai, I (2010) Intestinal absorption of HMG- CoA reductase inhibitor pravastatin mediated by organic anion transporting polypeptide. Pharm Res 27:2141-2149.

177. Shitara Y, Itoh, T, Sato, H, Li, AP, and Sugiyama, Y (2003) Inhibition of transporter- mediated hepatic uptake as a mechanism for drug-drug interaction between cerivastatin and cyclosporin A. J Pharmacol Exp Ther 304:610-616.

178. Shitara Y and Sugiyama, Y (2006a) Pharmacokinetic and pharmacodynamic alterations of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors: drug-drug interactions and interindividual differences in transporter and metabolic enzyme functions. Pharmacol Ther 112:71-105.

179. Shitara Y and Sugiyama, Y (2006b) Pharmacokinetic and pharmacodynamic alterations of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors: drug-drug interactions and interindividual differences in transporter and metabolic enzyme functions. Pharmacol Ther 112:71-105.

180. Simonson SG, Raza, A, Martin, PD, Mitchell, PD, Jarcho, JA, Brown, CD, Windass, AS, and Schneck, DW (2004) RSV pharmacokinetics in heart transplant recipients administered an antirejection regimen including cyclosporine. Clin Pharmacol Ther 76:167-177.

181. Sirtori CR (1993) Tissue selectivity of hydroxymethylglutaryl coenzyme A (HMG CoA) reductase inhibitors. Pharmacol Ther 60:431-459.

182. Sparreboom A, Gelderblom, H, Marsh, S, Ahluwalia, R, Obach, R, Principe, P, Twelves, C, Verweij, J, and McLeod, HL (2004) Diflomotecan pharmacokinetics in relation to ABCG2 421C>A genotype. Clin Pharmacol Ther 76:38-44.

183. Spatzenegger M and Jaeger, W (1995) Clinical importance of hepatic cytochrome P450 in drug metabolism. Drug Metab Rev 27:397-417.

184. Staffa JA, Chang, J, and Green, L (2002) Cerivastatin and reports of fatal rhabdomyolysis. N Engl J Med 346:539-540.

185. Stevens JC, Hines, RN, Gu, C, Koukouritaki, SB, Manro, JR, Tandler, PJ, and Zaya, MJ (2003) Developmental expression of the major human hepatic CYP3A enzymes. J Pharmacol Exp Ther 307:573-582.

186. Takano M, Yumoto, R, and Murakami, T (2006) Expression and function of efflux drug transporters in the intestine. Pharmacol Ther 109:137-161.

187. Taniguchi K, Wada, M, Kohno, K, Nakamura, T, Kawabe, T, Kawakami, M, Kagotani, K, Okumura, K, Akiyama, S, and Kuwano, M (1996) A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation. Cancer Res 56:4124-4129.

142

188. Tenore SB and Ferreira, PR (2009) The Place of protease inhibitors in antiretroviral treatment. Braz J Infect Dis 13:371-374.

189. Tirona RG and Kim, RB (2002) Pharmacogenomics of organic anion-transporting polypeptides (OATP). Adv Drug Deliv Rev 54:1343-1352.

190. Tirona RG, Leake, BF, Merino, G, and Kim, RB (2001) Polymorphisms in OATP-C: identification of multiple allelic variants associated with altered transport activity among European- and African-Americans. J Biol Chem 276:35669-35675.

191. Tirona RG, Leake, BF, Wolkoff, AW, and Kim, RB (2003) Human organic anion transporting polypeptide-C (SLC21A6) is a major determinant of rifampin-mediated pregnane X receptor activation. J Pharmacol Exp Ther 304:223-228.

192. Transon C, Leemann, T, and Dayer, P (1996) In vitro comparative inhibition profiles of major human drug metabolising cytochrome P450 isozymes (CYP2C9, CYP2D6 and CYP3A4) by HMG-CoA reductase inhibitors. Eur J Clin Pharmacol 50:209-215.

193. Transon C, Leemann, T, Vogt, N, and Dayer, P (1995) In vivo inhibition profile of cytochrome P450TB (CYP2C9) by (+/-)-fluvastatin. Clin Pharmacol Ther 58:412-417.

194. Trivedi RK, Kallem, RR, Mullangi, R, and Srinivas, NR (2005) Simultaneous determination of RSV and fenofibric acid in human plasma by LC-MS/MS with electrospray ionization: assay development, validation and application to a clinical study. J Pharm Biomed Anal 39:661-669.

195. van Herwaarden AE and Schinkel, AH (2006) The function of breast cancer resistance protein in epithelial barriers, stem cells and milk secretion of drugs and xenotoxins. Trends Pharmacol Sci 27:10-16.

196. Vanden BH, Koymans, L, and Moereels, H (1995) P450 inhibitors of use in medical treatment: focus on mechanisms of action. Pharmacol Ther 67:79-100.

197. Vermeir M, Lachau-Durand, S, Mannens, G, Cuyckens, F, van, HB, and Raoof, A (2009) Absorption, metabolism, and excretion of DRV, a new protease inhibitor, administered alone and with low-dose RTV in healthy subjects. Drug Metab Dispos 37:809-820.

198. Vlaming ML, Lagas, JS, and Schinkel, AH (2009) Physiological and pharmacological roles of ABCG2 (BCRP): recent findings in Abcg2 knockout mice. Adv Drug Deliv Rev 61:14-25.

199. von Moltke LL, Durol, AL, Duan, SX, and Greenblatt, DJ (2000) Potent mechanism- based inhibition of human CYP3A in vitro by amprenavir and RTV: comparison with ketoconazole. Eur J Clin Pharmacol 56:259-261.

200. Wakabayashi K, Nakagawa, H, Adachi, T, Kii, I, Kobatake, E, Kudo, A, and Ishikawa, T (2006) Identification of cysteine residues critically involved in homodimer formation and

143

protein expression of human ATP-binding cassette transporter ABCG2: a new approach using the flp recombinase system. J Exp Ther Oncol 5:205-222.

201. Wang RW, Kari, PH, Lu, AY, Thomas, PE, Guengerich, FP, and Vyas, KP (1991) Biotransformation of lovastatin. IV. Identification of cytochrome P450 3A proteins as the major enzymes responsible for the oxidative metabolism of lovastatin in rat and human liver microsomes. Arch Biochem Biophys 290:355-361.

202. Wang YH, Jones, DR, and Hall, SD (2005) Differential mechanism-based inhibition of CYP3A4 and CYP3A5 by verapamil. Drug Metab Dispos 33:664-671.

203. Watanabe M, Koike, H, Ishiba, T, Okada, T, Seo, S, and Hirai, K (1997) Synthesis and biological activity of methanesulfonamide pyrimidine- and N-methanesulfonyl pyrrole- substituted 3,5-dihydroxy-6-heptenoates, a novel series of HMG-CoA reductase inhibitors. Bioorg Med Chem 5:437-444.

204. Weaver YM and Hagenbuch, B (2010) Several conserved positively charged amino acids in OATP1B1 are involved in binding or translocation of different substrates. J Membr Biol 236:279-290.

205. White CM (2002) A review of the pharmacologic and pharmacokinetic aspects of RSV. J Clin Pharmacol 42:963-970.

206. Wysowski DK and Swartz, L (2005) Adverse drug event surveillance and drug withdrawals in the United States, 1969-2002: the importance of reporting suspected reactions. Arch Intern Med 165:1363-1369.

207. Xie W, Yeuh, MF, Radominska-Pandya, A, Saini, SP, Negishi, Y, Bottroff, BS, Cabrera, GY, Tukey, RH, and Evans, RM (2003) Control of steroid, heme, and carcinogen metabolism by nuclear pregnane X receptor and constitutive androstane receptor. Proc Natl Acad Sci U S A 100:4150-4155.

208. Xu C, Li, CY, and Kong, AN (2005) Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch Pharm Res 28:249-268.

209. Yanase K, Tsukahara, S, Asada, S, Ishikawa, E, Imai, Y, and Sugimoto, Y (2004) Gefitinib reverses breast cancer resistance protein-mediated drug resistance. Mol Cancer Ther 3:1119-1125.

210. Yanase K, Tsukahara, S, Mitsuhashi, J, and Sugimoto, Y (2006) Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development. Cancer Lett 234:73-80.

211. Zamber CP, Lamba, JK, Yasuda, K, Farnum, J, Thummel, K, Schuetz, JD, and Schuetz, EG (2003) Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine. Pharmacogenetics 13:19-28.

144

212. Zhang L, Zhang, YD, Strong, JM, Reynolds, KS, and Huang, SM (2008) A regulatory viewpoint on transporter-based drug interactions. Xenobiotica 38:709-724.

213. Zhang W, Yu, BN, He, YJ, Fan, L, Li, Q, Liu, ZQ, Wang, A, Liu, YL, Tan, ZR, Fen, J, Huang, YF, and Zhou, HH (2006) Role of BCRP 421C>A polymorphism on RSV pharmacokinetics in healthy Chinese males. Clin Chim Acta 373:99-103.

214. Zhou S, Yung, CS, Cher, GB, Chan, E, Duan, W, Huang, M, and McLeod, HL (2005) Mechanism-based inhibition of cytochrome P450 3A4 by therapeutic drugs. Clin Pharmacokinet 44:279-304.

145