Tel/Etv6 Is an Essential and Selective Regulator of Adult Hematopoietic Stem Cell Survival

Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

RESEARCH COMMUNICATION

(Tsai et al. 1994; Shivdasani et al. 1995; Okuda et al. Tel/Etv6 is an essential and 1996; Orkin 2000; Kumano et al. 2003), experiments selective regulator of adult thus far have not shown any of these regulators of embryonic hematopoiesis to be essential for maintaining hematopoietic stem cell HSC levels and function after hematopoiesis is established in the bone marrow. In fact, adult HSC function is survival remarkably resistant to loss of Scl (Mikkola et al. 2003), 1,2 1 1 Aml1/runx1 (Ichikawa et al. 2004), Notch1 (Radtke et al. Hanno Hock, Eliza Meade, Sarah Medeiros, 1999), and Integrin ␤1 (Brakebusch et al. 2002), each of 1 1 Jeffrey W. Schindler, Peter J.M. Valk, which is essential for embryonic hematopoiesis. Simi- Yuko Fujiwara,1,4 and Stuart H. Orkin1,3,4,5 larly, loss of ␤-catenin (Cobas et al. 2004) and HoxB4 (Brun et al. 2004), factors that expand HSC numbers on 1 Division of Hematology/Oncology, Children’s Hospital, forced expression (Sauvageau et al. 1995; Reya et al. 2 3 Department of Medical Oncology, and Department of 2003), fails to affect adult bone marrow HSCs. Thus, the Pediatric Oncology, Dana Farber Cancer Institute, Harvard molecular control of adult HSCs remains largely unde- 4 Medical School, Boston, Massachusetts 02115, USA; Howard fined. Hughes Medical Institute, Boston, Massachusetts 02115, USA The Tel/Etv6 locus, which encodes an Ets-related transcriptional repressor, is a frequent target of diverse chro- Hematopoietic stem cells (HSCs) sustain blood forma- mosomal translocations in human leukemias (Golub et tion throughout life. Pathways regulating maintenance al. 1994). Embryos with a conventional knockout (KO) of of adult HSCs are largely unknown. Here we report that the Tel/Etv6 gene die by day 11 of embryonic develop- the Ets-related transcription factor Tel/Etv6, the product ment (E11) due to vascular abnormalities. Blood forma- of a locus frequently involved in translocations in leu- tion in the embryo is largely unperturbed (Wang et al. kemia, is a selective regulator of HSC survival. Follow- 1997). Yet, studies using chimeric mice from Tel/Etv6- ing inactivation of Tel/Etv6, HSCs are lost in the adult deficient embryonic stem (ES) cells suggested a require- bone marrow but their progeny are unaffected and tran- ment in bone marrow hematopoiesis (Wang et al. 1998). Here, we used inducible and lineage-specific gene disrup- siently sustain blood formation. Accordingly, absence of tion strategies to define the role of Tel/Etv6 in adult Tel/Etv6 after lineage commitment is ostensibly with- hematopoiesis. out consequence except for unexpected impairment of maturation of megakaryocytes. Thus, we establish Tel/ Results and Discussion Etv6 as a selective and essential regulator of postembry- onic HSCs. We engineered mice harboring a conditional (floxed) Tel/ Etv6 allele in which recognition sequences (loxP sites) Supplemental material is available at http://www.genesdev.org. for Cre recombinase flank exon 7, which encodes a por- tion of the protein critical for DNA-binding (Supplemen- Received July 14, 2004; revised version accepted August 4, tary Fig. 1). Homozygous floxed mice were healthy and 2004. had normal Tel/Etv6 protein levels, indicating that the unexcised allele was fully functional (Supplementary Most blood cells have short lifespans and require con- Fig. 2; data not shown). Likewise, mice heterozygous for stant renewal from a small population of hematopoietic the excised allele (generated by Cre-mediated recombi- stem cells (HSCs). HSCs have two defining properties: nation in the germ line) were normal (data not shown). the capacity for differentiation and stepwise maturation As anticipated from the prior knockout, intercrossing of into all known blood lineages, and generation of addi- heterozygotes failed to yield viable homozygous excised pups. Analysis of embryonic development confirmed tional HSCs through the process of self-renewal (Orkin ∼ 2000; Kondo et al. 2003). During development, the site of that 95% of homozygous embryos died by E11 with blood formation in the embryo changes sequentially failure of yolk sac angiogenesis (Fig. 1A). The remaining from yolk sac to fetal liver to bone marrow (Orkin 2000). homozygous embryos survived past this stage and exhib- After birth, the bone marrow is the dominant site of ited normal fetal liver hematopoiesis (Fig. 1B,C; data not hematopoiesis and the number of HSCs is maintained in shown). They were not born alive, but appeared normal steady-state by continuous low-level turnover through- when delivered by C-section on E18.5 (Fig. 1C). Patho- out adult life (Cheshier et al. 1999; Kondo et al. 2003). logic examination revealed markedly decreased bone Although genes essential for initial specification of marrow hematopoiesis (Fig. 1D). Diminished hemato- HSCs in the embryo, as well as for their propagation poiesis within the bone marrow in embryos that escaped during embryonic development, have been identified death due to the yolk sac vascular abnormalities is consistent with our prior finding of impaired adult hematopoiesis in the absence of Tel/Etv6 function, as deduced from chimera analysis (Wang et al. 1998). (Mutants that survived longer then E11.5 were not observed during the [Keywords: Ets; hematopoietic stem cell; megakaryocyte; Cre/loxP; Tel/ original analysis of the conventional KO allele, but were Etv6] subsequently found with the conventional KO when 5 Corresponding author. analyzed in the same mixed background as the excised E-MAIL [email protected]; FAX (617) 730 0222. Article published online ahead of print. Article and publication date are conditional described here, suggesting that both dis- at http://www.genesdev.org/cgi/doi/10.1101/gad.1239604. rupted alleles are indistinguishable; data not shown).

2336 GENES & DEVELOPMENT 18:2336–2341 © 2004 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/04; www.genesdev.org Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Tel/ETV6 and HSC survival

dicated that there was no excision in HSCs (Fig. 2C). With the exception of the megakaryocyte lineage, therefore, Tel/Etv6 function is dispensable for progenitors and precursors. To address a potential requirement in HSCs, we inactivated the floxed Tel/Etv6 allele in a transient and inducible fashion by use of the Mx-Cre transgene, which is activated by interferon-␣ (IFN-␣) or its inducer polyI– polyC (pIpC) (Kuhn et al. 1995). Of note, the IFN-␣ response itself was not altered by absence of Tel/Etv6 in proB cells ex vivo (Supplementary Fig. 2F). Injections of

Figure 1. Germ-line excision of a floxed Tel/Etv6 allele causes ei- ther midembryonic or perinatal lethality with hypocellular bone marrow. (A) Most progeny homozygous for germ-line-excised Tel/ Etv6 (EX/EX) die at approximately E10.5 with absent yolk sac angiogenesis; wild-type (WT/WT) yolk sac at the same stage is shown for comparison. (B) A few homozygous excised embryos survive longer; they have normal yolk sac angiogenesis and exhibit red livers indicative of active hematopoiesis (arrows) on E12.5. (C) Homozy- gous excised embryos are not born alive (not shown) but at E18.5 (C-section), ∼3% of pups that appear normal are homozygous for the excised allele. (D) Pathological examination of E18.5 homozygotes (n = 3) and their wild-type littermates (n = 3) revealed markedly reduced bone marrow hematopoiesis in the mutants (cross-sections through the humeral head, 60×).

Tel/Etv6 is widely expressed within and outside the hematopoietic system (Wang et al. 1997). To examine its role in the adult blood system, we used Cre-expressing mouse strains that excise selectively in committed lineages by using lineage-specific promoters; that is, CD19- Cre: B lineage; Lck-Cre: T cells; Gata1-Cre: erythroid/ Figure 2. Tel/Etv6 is dispensable for selected lineage-committed megakaryocytic lineages (Fig. 2). Matings were per- hematopoietic cells. (A) CD19-Cre mediated excision in the B-lym- + formed to generate mice harboring a Cre allele in phoid lineage does not affect frequencies of IgM B cells in the spleen assessed by FACS analysis (control, left histogram; lineage- addition to one floxed and one disrupted Tel/Etv6 allele. specific mutant, right histogram); in each case, germ-line genotype By this strategy only a single excision event per cell re- of mice ([WT] wild-type; [Flox] floxed; [KO] conventional knockout) sults in complete loss of Tel/Etv6 without potential am- and expected functional status of both alleles in cells excised by Cre biguity from heterozygosity (Flox/KO → Cre → −/−). (following arrow) are indicated below. Results from representative animals are shown (n = 5). Right panel shows Southern blot analysis Controls bore a wild-type allele in addition to the floxed + allele, and therefore retained function after Cre-medi- of sorted IgM B cells from spleen. Note complete excision of the → → floxed allele in both control (lane 1) and lineage-specific mutant ated recombination (Flox/WT Cre +/−). Remark- (lane 2). (*) Band shared by floxed and wild-type allele; see Supple- ably, Tel/Etv6 was not essential for the maintenance of mentary Figure 1 for complete explanation of band pattern. (B) Lck- any of these mature lineages (Fig. 2A–C). Thus, IgM+ Cre-mediated excision in the T-lymphoid lineage does not affect cells in the spleen were not affected by excision by frequencies of CD4+ and CD8+ T cells in the spleen (upper FACS CD19-Cre (Fig. 2A; data not shown). Additionally, exci- plots) or distribution of subsets of developing T cells in the thymus (lower FACS plots) (n = 4). Southern blots on the right show com- sion in proB-cell lines generated from floxed mice failed plete excision in sorted CD3+ T cells from the spleen (upper) and to implicate Tel/Etv6 in their proliferation (Supplemen- subtotal excision in the thymus (lower) of both controls (lane 1) and tary Fig. 2). Likewise, excision by Lck-Cre did not alter lineage-specific mutants (lane 2). (C) Gata1-Cre-mediated excision the frequencies of T cells in thymus and spleen (Fig. 2B). in erythroid and megakaryocytic lineages reveals terminal mega- Gata1-Cre efficiently excised in Ter119+ (erythroid) pre- karyocyte defect but normal steady-state erythropoiesis. Bar graphs ∼ cursor cells in the bone marrow, but this did not lead to on the left show no difference in hemoglobin levels but 50% re- duction in peripheral blood platelet counts in the lineage-specific anemia or changes in the frequency or morphology of mutants compared with controls. Third bar graph shows approxi- erythroid precursors (Fig. 2C; data not shown). However, mately fivefold elevation of megakaryocyte colonies from mutant platelet counts were ∼50% reduced compared to controls bone marrow. Error bars represent standard deviations. Southern and megakaryocyte colony-forming cells were fivefold blots show the unexcised allele in sorted B220+ B cells from bone marrow (left; control [lane 1], mutant [lane 2]) but only the excised increased, findings consistent with a terminal defect in + megakaryocyte maturation, partially compensated for by allele in Ter119 (erythroid) cells (right; control [lane 3], mutant [lane 4]). (Lane 1) Note that control B220+ cells from Gata1-Cre mice increased progenitors. This requirement for Tel/Etv6 in lack detectable excised allele, confirming that excision is intrinsic the megakaryocyte lineage is intrinsic, as absence of re- to the megakaryocyte/erythroid lineage and does not occur earlier; combination in B220+ B cells from the bone marrow in- that is, in HSCs.

GENES & DEVELOPMENT 2337 Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Hock et al. pIpC into control mice (Flox/WT) resulted in moderate block at the HSC level. Therefore, we assessed the num- transient changes in peripheral blood counts and in bers of phenotypic HSCs over time after induction of Cre stable but quantitative excision of the floxed allele in expression. Figure 3D shows that in control (Flox/WT) hematopoietic tissues (Fig. 3A,B). In conditional mutants mice Lin−, Sca1+, c-Kit+ cells, which include all short- (Flox/KO), most blood counts were also preserved (Fig. term and long-term repopulating HSCs (Uchida and 3A). Hemoglobin concentration and lymphocyte counts Weissman 1992), were fully excised and their frequency remained indistinguishable from those of controls, and remained constant after Cre induction. In contrast, in neutrophil counts were only moderately reduced. Plate- conditional mutant (Flox/KO) mice, HSCs continuously let counts were reduced dramatically after Tel disruption declined in frequency in the first 2 wk until they were but, in contrast to findings obtained with Gata1-Cre virtually undetectable (Fig. 3D, d3, d9, d16). Four weeks matings, counts started to recover after ∼4 wk (Fig. 3A). after Cre-induction (d25 in Fig. 3D), HSCs had fully re- Serial analysis of the excision status detected exclusively covered. Critically, these HSCs were now found to har- excised cells for 3–4 wk after Cre induction (coinciding bor the unexcised allele. We infer that the rare HSCs that with the period of low platelets) (Fig. 3B, t1). After ∼5–6 had escaped excision (below detection limit on day 16, wk, however, excised cells became undetectable in the Fig. 3D) had expanded rapidly to restore the stem cell bone marrow and were replaced by cells harboring the compartment, similar to transplant settings where single unexcised floxed allele (Fig. 3B, t2). Thus, whereas the HSCs are sufficient to rescue hematopoiesis (Osawa et excision of the floxed allele was complete and stable al. 1996). Remarkably, however, HSCs lacking Tel/Etv6 when paired with a wild-type allele in control mice, pro- did not survive. The conclusion that adult HSCs require found selection against the excised allele was observed Tel/Etv6 for survival is supported by lack of contribution when paired with an inactive (KO) allele. Similar of Tel/Etv6−/− cells to bone marrow in chimeric mice changes in blood counts and selection against loss of (Wang et al. 1998) and the bone marrow failure of Tel/ Tel/Etv6 function were observed when unexcised, floxed Etv6-deficient E18.5 embryos (Fig. 1D). mutant marrow was first transplanted to wild-type mice To exclude the possibility that Tel/Etv6 disruption al- and subsequently induced for Cre-mediated excision ters the marker profile of HSCs, rather than leads to their (Fig. 3C). This provides formal demonstration that the loss, we assessed the biological activity of potential requirement for Tel/Etv6 is intrinsic to the hematopoi- HSCs by bone marrow transplantation assays. We trans- etic system. Remarkably, the main precursor populations in the bone marrow (B-cell, myeloid, and erythroid) were largely sustained for several weeks despite the ab- Figure 3. Disruption of Tel/Etv6 in adult mice reveals an essential sence of detectable Tel/Etv6 (Supplementary Fig. 3). and selective role for survival of HSCs. (A) Peripheral blood during Likewise, B-cell, myeloid, and erythroid colony-forming (shaded blue) and after pIpC injection to induce Cre-mediated dis- progenitors were preserved (albeit in somewhat reduced ruption of the floxed allele. Note the absence of differences in he- numbers) after complete excision of Tel/Etv6 (Supple- moglobin (g/dL) and lymphocyte counts (cell#/µL), moderate transient drop in neutrophil counts (cell#/µL) and drastic but transient mentary Fig. 4). drop in platelet count (cell# × 103/µL) in conditional mutants (geno- We hypothesized that the modest eventual decline in type: Floxed/conventional knockout [Flox/KO]; n = 6–11) compared Tel/Etv6 progenitor/precursors could be accounted for with controls (genotype: Floxed/wild-type [Flox/WT]; n = 7–11). (B) entirely by their limited clonal lifespan in the face of a Southern blot of bone marrow (M), thymus (T), and spleen (S) 3 wk after the final pIpC injection demonstrates complete excision of the floxed allele in controls (Flox/WT) and conditional mutants (Flox/ KO). Left panels (t1) show representative results from analysis of six mice in each group from three independent experiments; complete excision of the floxed allele in bone marrow was confirmed as early as 2 d after the final pIpC injection (n = 6, not shown, see Supple- mentary Fig. 5A). Right panels (t2, 6 wk after Cre induction) show persistent excision in control mice (Flox/WT) but absence of detectable excised allele associated with re-emergence of the floxed allele in conditional mutants (Flox/KO). Representative results from analysis of six mice in each group from three independent experiments are shown; excision in controls was found to be undimin- ished as late as 18 mo after Cre-induction (n = 3; not shown). (*) Band shared by floxed and wild-type allele; see Supplementary Fig- ure 1 for complete explanation of band pattern. (C) Excision analysis in experiment performed as above except that mutant marrow had been transplanted into lethally irradiated wild-type recipients 3 mo prior to Cre induction. Longitudinal development of peripheral blood counts (not shown) and excision status after 3 wk (left panel, t1Ј)and6wk(right panel, t2Ј) following Cre induction was indistinguishable from that in untransplanted mutants. (D) FACS analysis of HSCs (lineage−, c-Kit+, Sca-1+, marked with blue frames) and myeloid progenitors (lin−, c-Kit−, Sca-1+, marked with red frames) at days 3, 9, 16 and 25 after Cre induction. In controls (Flox/WT), HSC frequency remained stable, but in conditional mutants HSCs were decreased at day 3, hardly detectable on days 9 and 16, but re- emerged on day 24 (results are representative of six mice for each time point in three independent experiments). Southern blot (bottom) shows excision in high proliferative potential colonies (HPPCs) from sorted control (lane 1) and mutant (lane 2) HSC populations at day 3. At day 25, complete excision was still observed in controls (lane 3) but in conditional mutants stem cells that had re-emerged exclusively harbored unexcised Tel/Etv6 (lane 4).

2338 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Tel/ETV6 and HSC survival planted bone marrow cells 3 d after induction of Cre expression. At this time excision of floxed sequences in bone marrow cells appeared nearly complete, and yet the overall cellular composition of the marrow had not changed dramatically (Supplementary Figs. 3, 5). Colony- forming progenitors that had been excised at the Tel/ Etv6 locus were abundant (Supplementary Fig. 4); in- deed, some excised HSCs were still detectable (Fig. 3D). However, following injection into lethally irradiated mice, Tel/Etv6-deficient bone marrow (Flox/KO → Cre → −/−; 1.8 × 106 cells/recipient) failed to rescue survival of any recipients (0/8), whereas control marrow (Flox/ WT → Cre → +/−; 1.8 × 106 cells/recipient) rescued all recipients (8/8) and established donor-derived hematopoiesis for more than 6 mo (data not shown). To specifically assess long-term repopulating HSCs, we performed competitive repopulation assays, in which mice received a small dose of wild-type competitor marrow cells along with a titration of donor marrow in order to ensure survival of the recipient. In this setting, excised control marrow cells contributed to hematopoiesis in a dose- dependent fashion (Fig. 4A,B; Supplementary Fig. 5). Neither mutant nor control marrow gave rise to detectable unexcised hematopoietic cells in recipients, indicating very high efficiency of excision in HSCs (Supplemen- tary Fig. 5). On the other hand, Tel/Etv6-deficient cells failed to contribute to recipient hematopoiesis even at high dose levels of donor cells, confirming that loss of Tel/Etv6 abrogates long-term repopulating HSC activity. Our data reveal that bone marrow hematopoiesis is entirely dependent on continuous expression of Tel/ Etv6. Yet, Tel/Etv6 does not function as master regulator Figure 4. Bone marrow transplantation following disruption of Tel/Etv6 confirms absence of HSC activity. (A) Analysis of CD45 in the sense that it directs a hematopoietic differentia- isotype variants on blood granulocytes (Gr1+Mac1+) and B cells tion program in a wide spectrum of hematopoietic cells. (B220+) 3 mo after transplantation into lethally irradiated recipients Rather, it has two independent roles in the context of demonstrates absence of competitive repopulation activity in bone specific, narrow stages of hematopoietic differentiation. marrow after Tel/Etv6 disruption. Bone marrow donors had received pIpC to induce Cre until 3 d prior to transplant. Control marrow First, Tel/Etv6 controls the survival of HSCs so that its → disruption indirectly affects the majority of all hemato- (Flox/WT +/−; CD45.2) competed efficiently with a low constant dose of wild-type marrow (“competitor”, CD45.1) in a dose-depen- poietic cells which have limited clonal lifespans and dent fashion, whereas conditional mutant marrow (Flox/KO → −/−; eventually will extinguish without constant regenera- CD45.2) failed to compete. (Bars represent averages on groups of tion from HSCs. Second, Tel/Etv6 is required late in the mice; numbers* indicate mice/group; error bars show standard de- development of the megakaryocyte lineage, where it pre- viation; ND indicates not done; one representative of two experi- sumably acts in concert with transcriptional regulators ments is shown). (B) CD45 isotype analysis of thymocytes, bone marrow myeloid cells (Gr1+Mac1+), B cells (B220+), and progenitors previously implicated in megakaryopoiesis (Nfe2, Scl, (c-Kit+) from representative recipients in the competitive repopula- Gfi-1B, Aml1, Gata1, Fli-1, and Fog1; Italiano and Shiv- tion assay shown in A. Note that CD45.2+ control marrow (middle) dasani 2003) and/or by directly binding ETS motifs efficiently prevents contribution of wild-type “competitor” cells known to be critical in megakaryocytic promoters (Wang (CD45.1, given alone in top row), whereas conditional mutant mar- et al. 2002). row (CD45.2, bottom) completely fails to prevent “competitor” en- Tel/Etv6 is the first regulator that is selectively re- graftment. See Supplementary Figure 5 for excision analysis 3 mo after engraftment. quired for the survival of adult HSCs. Other transcription factors or components of growth factor pathways are necessary in different facets of HSC biology. For in- Recently, Bmi-1 (Lessard and Sauvageau 2003; Park et al. stance, Scl is essential for specification of hematopoietic 2003) and p21Cip1WAF1 (Cheng et al. 2000) and auto- fate (Shivdasani et al. 1995), and Aml1/runx-1 is required crine production of vascular endothelial growth factor for emergence of HSCs during embryogenesis (Okuda et (VEGF) (Gerber et al. 2002) have been shown to be re- al. 1996). Yet, neither is stringently required in HSCs quired for proper maintenance of adult HSCs, but these once they are formed (Mikkola et al. 2003; Ichikawa et have widespread roles within and outside of the hema- al. 2004). Likewise, Notch1 (Radtke et al. 1999; Kumano topoietic system. Neither p21Cip1WAF1 nor Bmi-1 are et al. 2003) and Notch2 (Saito et al. 2003), which are both strictly required for HSC survival: Marrow from p21−/− expressed in HSCs, and RBP-J (Han et al. 2002), down- mice can be transplanted (Cheng et al. 2000) and in Bmi- stream mediator of Notch genes, have been inactivated 1−/− mice phenotypic HSCs are present, even if function- conditionally in mouse bone marrow without compro- ally compromised (van der Lugt et al. 1994; Park et al. mising HSCs. Moreover, HoxB4 and ␤-catenin, both of 2003). which induce stem cell expansion on forced expression Because HSCs are capable of extensive proliferative (Sauvageau et al. 1995; Reya et al. 2003), are dispensable expansion and share with leukemia cells the potentially for HSC function (Brun et al. 2004; Cobas et al. 2004). harmful property of self-renewal, their numbers and sur-

GENES & DEVELOPMENT 2339 Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Hock et al. vival must be tightly controlled. As Tel/Etv6 activity is Flow cytometry most likely modulated by phosphorylation similar to MoFlow or FACS-Calibur flow cytometers were used for analysis and Yan (Lai and Rubin 1992), its closest relative in Dro- sorting. Where appropriate, red cells were lysed by brief exposure to sophila, we speculate that Tel/Etv6 mediates a continu- ammonium buffer (NH4CL 0.15 M/KHCO3 0.01 M/Na2 EDTA 0.1 mM), and nonspecific binding was reduced by preincubation with unconju- ous survival signal specifically within the hematopoietic gated antibody to Fc␥II/III (2.4G2). Dead cells were excluded by prop- niche in the bone marrow. Very likely, Tel/Etv6 lies idium iodide (Molecular Probes), TO-PRO1 (Molecular Probes), or by downstream in a pathway initiated by interaction of sur- forward/side light-scatter profile. Antibody conjugates and matched iso- face receptors on HSCs and ligands within the marrow type controls were obtained from PharMingen or eBioscience. IgM (R6- microenvironment. The apparent dispensability of Tel/ 60, FITC), CD4 (RM4-5, PE), CD8 (53-6, PerCP), CD3␧ (145-2C11, FITC), Etv6 for hematopoiesis during embryonic development Ter119 PE, B220 (RA3-6B2, FITC), Gr1 (RB6-8C5, APC), Mac1 (M1/70, may simply reflect that a survival signal is not necessary, PE). HSC-stain: lineage markers CD4 (RM4-5), CD8 (53-6), CD3␧ (145- ␤ as embryonic hematopoiesis is transient and not sus- 2C11), TCR (H54-597), B220 (RA3-6B2), CD19 (6D5), IgM (R6-60), Gr1 tained. Elucidating the molecular pathway(s) by which (RB6-8C5), Mac-1 (M1/70), Ter119 (all FITC); CD117 (c-kit, 2B8, APC- Cy7); Sca-1 (E13-161, PE). CD45 isotype analysis: B220 (RA3-6B2, APC), Tel/Etv6 preserves HSCs may explain the unique capa- Gr1 (RB6-8C5, APC), Mac1 (M1/70,PE), CD117 (c-kit, 2B8, APC), CD45.1 bility of the bone marrow microenvironment to sustain (104, FITC), CD45.2 (A20, PE). this rare cell type, and will likely be crucial for developing novel strategies for maintaining and/or expanding Blood counts HSCs ex vivo. Blood samples (250 µL) were obtained by tail vein nicking or retro-orbital sinus puncture, anticoagulated in EDTA, and analyzed using an auto- Materials and methods mated system (Advia 120, Bayer). Generation of a conditional Tel/Etv6 allele A 14-kb clone from a 129/sv genomic library containing exons 6, 7, and Administration of pIpC 8 was modified to generate the targeting vector (Supplementary Fig. 1A). Poly(I)–poly(C) (Sigma P-0913) was diluted in endotoxin-free D-PBS The 5Ј loxP site was introduced by blunt end ligation of a synthetic (Gibco) at a concentration of 2 mg/mL and passed through a 0.22-µm adapter (CACTCGAGATCGATATAACTTCGTATAATGTATGCTATA filter (Millipore) before intraperitoneal injection. Mice received seven ∼ CGAAGTTATTAACTAGTGGCC) → 5Ј-Spe1–loxP–Xho1–Apa1-3Ј)in- doses (every other day) of 25 µg/g body weight. The day of the last to the unique Apa1 site between exons 6 and 7. Subsequently, a loxP- injection of pIpC was designated day 0. flanked neomycin resistance gene was introduced into a unique EcoRV site between exons 7 and 8, and a thymidine kinase gene was cloned into Bone marrow transplantation the pBlueScript backbone outside of the homology region. The final vec- Bone marrow transplantations were performed by intravenous injection tor was linearized with Pvu1, ligated to hairpins, and introduced into CJ7 of bone marrow cells from 6–10-week-old donor mice (C57BL6/129 ES cells by electroporation. Subsequently, ES cells that had integrated the mixed) and/or competitor bone marrow into recipients that had received plasmid in the correct location after homologous recombination were 1200 cGy of radiation as a split dose. Recipients were C57BL6x129 F1 enriched by neomycin selection and gancyclovir counterselection. (101043, Jackson). The source of competitor bone marrow cells for com- Clones with correct integration were identified by Southern blot using petitive repopulation assays was B6.SJL (002014, Jackson) both 5Ј and 3Јprobes outside of the homology region (Supplementary Fig. 1B). A targeted ES-cell clone was injected into C57/BL6 blastocysts to generate chimeras for germ-line transmission. Floxed-⌬Neo mice Acknowledgments (Supplementary Fig. 1A, fourth from the top) were derived from floxed- We thank Dr. Lichun Wang for help with targeting the Tel/Etv6 locus, Neo+ mice (Supplementary Fig. 1A, fifth from the top) fortuitously while and Dr. Christoph Klein and Dr. Richard Mulligan for help with retro- intercrossing with lineage-specific Cre mice, but regardless of the pres- viral gene transfer and the vector CMMP. We thank Dr. Klaus Rajewsky ence of the neomycin resistance gene, the floxed allele was fully func- for Mx-Cre and CD19-Cre mice, and Dr. J. Marth for Lck-Cre mice. We tional and efficiently excised by Cre. For description and references of appreciate the expert assistance of Maris Handley, Herb Levine, Joyce A. Cre-expressing mouse strains, see Supplemental Material. Lavecchio, Melanie Hamblen, Carol Browne, Shelley Galusha and Aimee Williams. We thank Dr. Heather Rooke and Dr. Charles Roberts for criti- Genotyping and excision analysis cal reading of the manuscript. H.H. was supported by a Special Fellow- For detailed explanation and illustration of Southern blot strategy used to ship of the Leukemia Society of America and by an NCI Career Devel- assessTel/Etv6 gene status and targeting, please see Supplementary Fig- opment award (1 KO8 CA096701-01). This work was in part supported by ure 1. For DNA extraction, tissues were minced or bone marrow was a Center of Excellence grant in Molecular Hematology from the NIH. flushed from femurs with PBS using a 22G needle and incubated in lysis S.H.O. is an Investigator with the Howard Hughes Medical Institute. solution (100 mM Tris HCL at pH 8.0, 5 mM EDTA, 0.2% SDS, 200 mM NaCL, and 100 µg/mL Proteinase K) at 55°C for 24–48 h, followed by phenol and phenol/chloroform extractions and precipitation in isopropa- References nol. 5Ј and 3Ј probes were used to confirm the correct targeting, as shown in Supplementary Figure 1A,B. For genotyping of mice harboring the Brakebusch, C., Fillatreau, S., Potocnik, A.J., Bungartz, G., Wilhelm, P., conditional Tel/Etv6 allele and analysis of the excision status of the Svensson, M., Kearney, P., Korner, H., Gray, D., and Fassler, R. 2002. floxed allele, a cloned fragment combining the PCR-amplified coding ␤1 integrin is not essential for hematopoiesis but is necessary for the regions for exon 6 and exon 7 was used. Probes for neomycin and Cre T cell-dependent IgM antibody response. Immunity 16: 465–477. were used to detect the conventional Tel/Etv6 knockout allele and Brun, A.C., Bjornsson, J.M., Magnusson, M., Larsson, N., Leveen, P., mouse strains harboring Cre, respectively. Ehinger, M., Nilsson, E., and Karlsson, S. 2004. Hoxb4 deficient mice have normal hematopoietic development but exhibit a mild prolif- Embryology eration defect in hematopoietic stem cells. Blood. 103(11): 4126–4133. Embryos at defined timepoints of development were obtained by C-sec- Cheng, T., Rodrigues, N., Shen, H., Yang, Y., Dombkowski, D., Sykes, tion after mating of heterozygous excised mice (Fig. 1). Time of concep- M., and Scadden, D.T. 2000. Hematopoietic stem cell quiescence tion was determined by daily inspection of female mice for the occur- maintained by p21cip1/waf1. Science 287: 1804–1808. rence of vaginal plugs; the day of visualization of this plug was counted Cheshier, S.H., Morrison, S.J., Liao, X., and Weissman, I.L. 1999. In vivo as E0.5. Findings on all embryos were documented; tissue was fixed in proliferation and cell cycle kinetics of long-term self-renewing hema- Bouin’s solution and stored, and mutants were identified by Southern topoietic stem cells. Proc. Natl. Acad. Sci. 96: 3120–3125. blot analysis. For histological analysis, tissue was embedded in paraffin, Cobas, M., Wilson, A., Ernst, B., Mancini, S.J., MacDonald, H.R., Kemler, sectioned at 6 µm, and stained with hematoxylin-eosin. R., and Radtke, F. 2004. ␤-catenin is dispensable for hematopoiesis

2340 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Tel/ETV6 and HSC survival

and lymphopoiesis. J. Exp. Med. 199: 221–229. formation in mice lacking the T-cell leukaemia oncoprotein tal-1/ Gerber, H.P., Malik, A.K., Solar, G.P., Sherman, D., Liang, X.H., Meng, SCL. Nature 373: 432–434. G., Hong, K., Marsters, J.C., and Ferrara, N. 2002. VEGF regulates Tsai, F.Y., Keller, G., Kuo, F.C., Weiss, M., Chen, J., Rosenblatt, M., Alt, haematopoietic stem cell survival by an internal autocrine loop F.W., and Orkin, S.H. 1994. An early haematopoietic defect in mice mechanism. Nature 417: 954–958. lacking the transcription factor GATA-2. Nature 371: 221–226. Golub, T.R., Barker, G.F., Lovett, M., and Gilliland, D.G. 1994. Fusion of Uchida, N. and Weissman, I.L. 1992. Searching for hematopoietic stem PDGF receptor ␤ to a novel ets-like gene, tel, in chronic myelomono- cells: Evidence that Thy-1.1lo Lin− Sca-1+ cells are the only stem cells cytic leukemia with t(5;12) chromosomal translocation. Cell 77: 307– in C57BL/Ka-Thy-1.1 bone marrow. J. Exp. Med. 175: 175–184. 316. van der Lugt, N.M., Domen, J., Linders, K., van Roon, M., Robanus- Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K., Yoshimoto, M., Na- Maandag, E., te Riele, H., van der Valk, M., Deschamps, J., Sofroniew, kahata, T., Ikuta, K., and Honjo, T. 2002. Inducible gene knockout of M., van Lohuizen, M., et al. 1994. Posterior transformation, neuro- transcription factor recombination signal binding protein-J. reveals logical abnormalities, and severe hematopoietic defects in mice with its essential role in T versus B lineage decision. Int. Immunol. 14: a targeted deletion of the bmi-1 proto-oncogene. Genes & Dev. 8: 637–645. 757–769. Ichikawa, M., Asai, T., Saito, T., Yamamoto, G., Seo, S., Yamazaki, I., Wang, L.C., Kuo, F., Fujiwara, Y., Gilliland, D.G., Golub, T.R., and Or- Yamagata, T., Mitani, K., Chiba, S., Hirai, H., et al. 2004. AML-1 is kin, S.H. 1997. Yolk sac angiogenic defect and intra-embryonic apo- required for megakaryocytic maturation and lymphocytic differentia- ptosis in mice lacking the Ets-related factor TEL. EMBO J. 16: 4374– tion, but not for maintenance of hematopoietic stem cells in adult 4383. hematopoiesis. Nat. Med. 10: 299–304. Wang, L.C., Swat, W., Fujiwara, Y., Davidson, L., Visvader, J., Kuo, F., Italiano Jr., J.E. and Shivdasani, R.A. 2003. Megakaryocytes and beyond: Alt, F.W., Gilliland, D.G., Golub, T.R., and Orkin, S.H. 1998. The The birth of platelets. J. Thromb. Haemost. 1: 1174–1182. TEL/ETV6 gene is required specifically for hematopoiesis in the bone Kondo, M., Wagers, A.J., Manz, M.G., Prohaska, S.S., Scherer, D.C., Beil- marrow. Genes & Dev. 12: 2392–2402. hack, G.F., Shizuru, J.A., and Weissman, I.L. 2003. Biology of hema- Wang, X., Crispino, J.D., Letting, D.L., Nakazawa, M., Poncz, M., and topoietic stem cells and progenitors: Implications for clinical appli- Blobel, G.A. 2002. Control of megakaryocyte-specific gene expression cation. Annu. Rev. Immunol. 21: 759–806. by GATA-1 and FOG-1: Role of Ets transcription factors. EMBO J. 21: Kuhn, R., Schwenk, F., Aguet, M., and Rajewsky, K. 1995. Inducible gene 5225–5234. targeting in mice. Science 269: 1427–1429. Kumano, K., Chiba, S., Kunisato, A., Sata, M., Saito, T., Nakagami- Yamaguchi, E., Yamaguchi, T., Masuda, S., Shimizu, K., Takahashi, T., et al. 2003. Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity 18: 699– 711. Lai, Z.C. and Rubin, G.M. 1992. Negative control of photoreceptor development in Drosophila by the product of the yan gene, an ETS domain protein. Cell 70: 609–620. Lessard, J. and Sauvageau, G. 2003. Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 423: 255–260. Mikkola, H.K., Klintman, J., Yang, H., Hock, H., Schlaeger, T.M., Fuji- wara, Y., and Orkin, S.H. 2003. Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature 421: 547–551. Okuda, T., van Deursen, J., Hiebert, S.W., Grosveld, G., and Downing, J.R. 1996. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84: 321–330. Orkin, S.H. 2000. Diversification of haematopoietic stem cells to specific lineages. Nat. Rev. Genet. 1: 57–64. Osawa, M., Hanada, K., Hamada, H., and Nakauchi, H. 1996. Long-term lymphohematopoietic reconstitution by a single CD34–low/negative hematopoietic stem cell. Science 273: 242–245. Park, I.K., Qian, D., Kiel, M., Becker, M.W., Pihalja, M., Weissman, I.L., Morrison, S.J., and Clarke, M.F. 2003. Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature 423: 302–305. Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J., MacDon- ald, H.R., and Aguet, M. 1999. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 10: 547– 558. Reya, T., Duncan, A.W., Ailles, L., Domen, J., Scherer, D.C., Willert, K., Hintz, L., Nusse, R., and Weissman, I.L. 2003. A role for Wnt signal- ling in self-renewal of haematopoietic stem cells. Nature 423: 409– 414. Saito, T., Chiba, S., Ichikawa, M., Kunisato, A., Asai, T., Shimizu, K., Yamaguchi, T., Yamamoto, G., Seo, S., Kumano, K., et al. 2003. Notch2 is preferentially expressed in mature B cells and indispens- able for marginal zone B lineage development. Immunity 18: 675– 685. Sauvageau, G., Thorsteinsdottir, U., Eaves, C.J., Lawrence, H.J., Largman, C., Lansdorp, P.M., and Humphries, R.K. 1995. Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes & Dev. 9: 1753–1765. Shivdasani, R.A., Mayer, E.L., and Orkin, S.H. 1995. Absence of blood

GENES & DEVELOPMENT 2341 Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Tel/Etv6 is an essential and selective regulator of adult hematopoietic stem cell survival

Hanno Hock, Eliza Meade, Sarah Medeiros, et al.

Genes Dev. 2004, 18: Access the most recent version at doi:10.1101/gad.1239604

Supplemental http://genesdev.cshlp.org/content/suppl/2004/09/29/gad.1239604.DC1 Material

References This article cites 31 articles, 12 of which can be accessed free at: http://genesdev.cshlp.org/content/18/19/2336.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.

Cold Spring Harbor Laboratory Press