UCB R&D Days

UCB R&D Days September 26th, 2006 – London September 28th, 2006 – New York

UCB R&D Day Agenda

z Introduction z Discovery Research – Research overview and differentiating technologies – Sclerostin antibody – CDP323 z Oncology – CDP791 – CMC544 z Inflammation – Epratuzumab – Cimzia™ z CNS – UCB 106607 – Brivaracetam / Seletracetam – Epilepsy commercial strategy z Conclusions

1 Introduction Roch Doliveux CEO

UCB, Next Generation Biopharma

z Unique technologies

z Unique platforms

z Unique products

z Unique team of experts

2 UCB Vision

To build a global biopharmaceutical leader,

based on unique blending of innovation, entrepreneurship and proven experience, bringing to specialists first, new medicines to treat patients suffering from severe diseases

Biopharma - Key Success Factors

z Differentiated new medicine z Resources z Flexible and opportunistic z Core processes

– Quality, compliance, development, supply chain, finance z People with passion and performance

3 Transformational Merger of UCB with Celltech

Quantum Strategic Leap

Creating a Global Leader able to Compete in the Biopharmaceutical World

UCB, Pharma or Biotech?

... Is a mid-size Pharma company

z Partnering with other mid-sized Pharma company

z Dependent on licensing for its long term growth

... Is a Biotech company

z Willing to make bold moves

z Partner with the Best

z Unique research capabilities

z Productive portfolio of new targets, compounds, new medicines

z Big Pharmas and Biotechs looking to partner with us

4 UCB, Next Generation Biopharma

z Science-led research – Unique combination of biology with chemistry z Innovative clinical development z Partners and networks z Focused global business units z Unique diverse people base z Patient centric

UCB Strategy

z Innovation-driven • Science, Patient & People z Specialist Marketing • USA, Europe, Asia z Focus to reach leadership • Neurology, Inflammation, Oncology z Partnering up- and downstream • Access technology and maximise assets z Broadening base • Invest more in R&D • Enhance long term growth

5 UCB, Next Generation Biopharma

UCB is shaping a Next Generation Biopharma

One With a Clear Strategy

One With Passionate Networked Individuals

Who focus

Who aim high

Who perform

Discovery Research

6 Research Overview and Differentiating Technologies Neil Weir Senior Vice President Discovery Research

UCB has a Rich Research Pipeline tion al a inic d d l se 1 a a a Therapeutic Le Le Indication Prec Ph Area Discovery Optimiz Inflammation TNF Mediated Disease (RA, IBD, Psoriasis)

MS Allergy/Asthma SLE Bone Loss

Immunomodulators

Epilepsy CNS Cognition, dementia Neuropathic pain

Oncology Solid Tumours

Biological Project

Small Molecule Project

7 UCB has a Rich Research Pipeline

ion

Therapeutic Lead Lead Indication Optimizat Preclinical Phase 1 Area Discovery Inflammation TNF Mediated Disease CDP 146 (RA, IBD, Psoriasis) Anti IL6 MS p38 Kinase Allergy/Asthma inhibitor SLE Alpha 4 Integrin Bone Loss Antagonist

Immunomodulators Sclerostin Antibody CNS Epilepsy Cognition, dementia Neuropathic pain Histamine Oncology Solid Tumours Receptor target

Biological Project

Small Molecule Project

UCB has a Rich Research Pipeline

ion

Lead Lead Therapeutic Indication Phase 1 Discovery Optimizat Preclinical Area Protein Kinase Inflammation TNF Mediated Disease inhibitor (RA, IBD, Psoriasis)

MS Allergy/Asthma Anti Il17 SLE Bone Loss Anti Immunomodulators CD40L Anti CNS Epilepsy OX40 Cognition, dementia Neuropathic pain

Oncology Solid Tumours

GPCR target

Protein Kinase Biological Project Protein Kinase target target Small Molecule Project

8 Innovation Novel Drug Design and Novel Target Biology ion

Lead Lead Therapeutic Phase 1 Indication Optimizat Preclinical Area Discovery Inflammation TNF Mediated Disease (RA, IBD, Psoriasis)

MS Allergy/Asthma SLE Bone Loss

Immunomodulators

CNS Epilepsy Cognition, dementia Neuropathic pain

Oncology Solid Tumours

Innovative drug design Innovative disease target biology

UCB Target Innovation Linkage of IL17 to CNS Inflammatory Processes

Anti-IL17 treatment 3 Treatment control Effects on murine CR-EAE (MS)

1 Disease Severity score (+/- Severity Disease sem)

0 10 20 30 40 50

PSD Start of Antibody Dosing

9 UCB Addressing Innovative Drug Targets and Discovering Disease Biology Links

Increased Bone Formation in ion KO mice Lead Lead Phase 1 Wild type Knockout mice Discovery Optimizat Preclinical Denser Bones

Courtesy of Amgen

Sclerostin Target and biology discovery, novel approach to bone disease Extensive patenting

Innovative drug design

Innovative disease target biology

NCE Target Innovation Building on Strengths in SV2 Biology and Histamine Receptors

10 Innovation Novel Drug Design Based upon Competitive Technological Strengths

z Small Molecules – Protein kinases as targets for drug discovery – Histamine receptor biology and chemistry

z Biologicals – Optimal antibody selection – Structure aligned to preferred drug function

Antibody Target Epitope Optimisation

z Functional mechanism complexity exemplified by Cimzia™

z UCB approach to proactively map underlying functional complexity

z UCB very well equipped to address this opportunity

11 Selection of Optimal Therapeutic Epitope Exemplified by Antagonists of IL-6 Signaling

Recruitment Receptor of signaling binding IL-6

Hexamer formation

Selection of Optimal Therapeutic Epitope Exemplified by Antagonists of IL-6 Signaling

550 Recruitment Receptor of signaling binding 500 Antibody A IL-6

450

Hexamer 400 formation

350

300 Antibody C

250

Cell Proliferation (OD units x1000) 200 0.01 0.1 1 10 100 1000 10000 100000 1000000 pM binding sites

12 Selection of Optimal Therapeutic Epitope Exemplified by Antagonists of IL-6 Signaling similar in vitro potency can result in very different in vivo activity

Recruitment Receptor of signaling binding IL-6

550

500

450 Antibody A

Hexamer 400

formation 350

300 Antibody C 250 MTT values (OD units x1000)MTT values (OD 200 0.01 0.1 1 10 100 1000 10000 100000 1000000 pM binding sites

Selection of Optimal Therapeutic Epitope Exemplified by Antagonists of IL-6 Signaling similar in vitro potency can result in very different in vivo activity

Antibody A

1 Acute phase protein phase Acute

0 +ve 3 1 0.3 0.1 0.03 0.01 0.003 PBS

A (mg/kg)

13 Selection of Optimal Therapeutic Epitope Exemplified by Antagonists of IL-6 Signaling similar in vitro potency can result in very different in vivo activity

Antibody A Antibody C

2 2

1 1 Acute phase protein phase Acute Acute phase protein phase Acute

0 0 +ve 3 1 0.3 0.1 0.03 0.01 0.003 PBS +ve 0.30.10.03 0.01 0.003 PBS

A (mg/kg) C (mg/kg)

Applying Knowledge from Antibody Function to Inform Small Molecule Discovery

and how

about where

antibodies bind to design new small molecule drugs

Differentiating UCB

14 UCB Research Pipeline Summary

An extensive and innovative Research pipeline Novel target biology and drug design

Focussed Research groups working in areas of competitive strength

Synergistic Combination of Biological and Small Molecule Medicines Discovery

Differentiating Technologies: Selected Lymphocyte Antibody Method Alistair Lawson Director, Antibody Biology

15 Patient-Driven Research

Patient Product Technology

Innovative Products From Leading Edge Technology

Seeing The Potential

In-house e.g. Antibody Fragment Technology Platform

In-licensed e.g. SLAM (Selected Lymphocyte Antibody Method)

UCB Patent Applications

UCB SLAM WO2004/051268 WO2004/106377 WO2005/019823 WO2005/019824

16 UCB SLAM Applying High Throughput Screening Technology to Antibody Discovery

Immune B Cells Variable Region Sequences

ATGCCTAGATAGCTGCTCAAGCT

BIAcore FMAT Secondary Assays Primary Screening Masterplates

Hit Picking

One Thousand Million B Cells → One Antibody

UCB SLAM Delivering High Quality Therapeutics

Antibody variable regions for therapeutics

17 UCB SLAM Delivering High Quality Research Reagents

Antibody variable regions for research reagents

Mechanism 1 Blocking Receptor Binding

Mechanism 2 Blocking Signaling

Determining The Preferred Therapeutic Axis In Vivo

Arthritis Model 8 Disease Progression 7 Blocking Signaling 6 5 4 Blocking 3 Clinical Score Clinical Receptor Binding 2 1 0 5 10 15 20 25 30 35 40 45 Days

18 Building on Strengths Exploring New Opportunities

Antibody Structural Technology Biology SYNERGY HTS Medicinal Chemistry Pharmacology Differentiating UCB

Differentiating Technologies: Antibody to hit Technology Graham Warrellow Vice President - Chemistry UK

19 Pharma’s Basic Research Toolkit

25,000 genes

30,000 proteins

Targets

Less than 10% amenable to targeting with traditional small molecule drugs

“Traditional” Small Molecules

p38 pockets, grooves and clefts

20 90% of the Proteins are Currently “Undruggable” with Small Molecules

TNFα

TNF Receptor

large, flat, apparently featureless surfaces

The Chemical Universe

From Pagliaro et al., 2004 Reproduced with permission of Elsevier Ltd

21 The Chemical Universe

From Pagliaro et al., 2004 Reproduced with permission of Elsevier Ltd

The few small molecules which do inhibit protein-protein interactions push the boundaries of conventional chemical space

22 23 24 Antibodies inhibit protein-protein interactions and can guide us in exploring uncharted chemical space for a new generation of small molecule drugs

25 Applying Knowledge about where and how

antibodies bind

Unique information to help us design novel small molecule drugs

Making the Dream a Reality Output from SLAM High affinity, function-modifying antibodies

Contact information to design pharmacophores

Virtual and directed screening Unique hits for small molecule drug design

1 Playing to Our Core Strengths

Antibody Structural Technology Biology

SYNERGY

Medicinal Chemistry

Differentiating UCB

Antibody-Guided Drug Discovery Where Biology and Chemistry Meet

Differentiating UCB

2 Sclerostin Antibody

Martyn Robinson Vice President Project Biology NBE

Osteoporosis is a Serious and Growing Problem

Bone fractures in the elderly

One year after hip fracture, 40% of patients are still unable to walk independently, 60% have difficulty with at least one essential activity of daily living, and 80% are restricted in other activities, such as driving and grocery shopping

C. Cooper The crippling consequences of fractures and their impact on quality of life Am J Med. 1997

3 Bone Turnover z 5-10% of our bone structure is replaced each year z This is a normal process that allows repair of tiny cracks and weaknesses.

Animation courtesy of Dr Susan Ott, University of Washington

There is a Paucity of Anabolic Therapies for the Treatment of Osteoporosis z A range of drugs inhibit bone resorption but few effectively stimulate bone formation in patients with low bone mass. z New therapies that stimulate the formation of strong new bone have been long sought. z UCB identified a proprietary new target for bone anabolic therapy using molecular analysis of a human inherited disease.

4 UCB / Amgen Collaboration

z The UCB Collaboration with Amgen was established in 2002 and covers antibodies to sclerostin

z Terms: – Cost sharing during development – Profit sharing during commercialisation

Sclerosteosis – An Inherited High Bone Mass Disorder with Massive Bone Overgrowth throughout Life

Normal Sclerosteosis z Sclerostin has been the subject of extensive patent application filings by UCB and Amgen (US6395511, US6489445, US6495736, US6803453, US20030166247,US20040009535, WO 2004082608, WO2005014650, WO2003087763, WO2003073991, WO2005003158)

5 Sclerostin Antibodies Increase Bone Density and Strength in Mice 75 ***

25 Maximum load (N)

Control Anti-sclerostin

Sclerostin Antibody Treatment Increases Bone Density in an Aged Ovariectomised (OVX) Rat Model of Bone Loss

0.29

0.28

0.27

0.26

0.25

0.24

0.23

0.22

BMD ( g/cm2 ) 0.21

0.20

0.19 d 0 d 7 d 14 d 21 d 28 d 35

Lumbar vertebrae ( L1-L5 )

Control OVX. Vehicle. OVX. Anti-sclerostin

6 Sclerostin Antibody Treatment Reverses Ovariectomy-induced Bone Loss

Control OVX OVX + sclerostin antibody

Current Status

z High affinity Sclerostin antibodies have been selected for further development

z When dosed sub-cutaneously these antibodies lead to an increase in bone formation and bone strength

7 Sclerostin Antibody Increases Bone Formation

Bone Bone Marrow Marrow Space Space

Treated Untreated

Green = new bone

Summary

z Gene to Drug

z Good in vivo efficacy

z Lead antibody selected

8 CDP323

Roly Foulkes Vice President Inflammation Research

UCB Understands Patient Needs

z UCB is developing treatments for severe inflammatory / autoimmune and CNS disorders z MS is a severe autoimmune disease with poor prognosis

z We are developing a portfolio of approaches to alleviate patient suffering in MS

9 UCB has Expertise to Deliver Effective Drugs z UCB scientists understand the mechanisms underlying the pathology of some forms of MS – Experience in our Inflammation and CNS Therapeutic Areas z UCB antibody and NCE expertise and experience are leading to novel treatments – mAbs • Antibody-based therapeutics • Pharmacological tools – A small molecule approach that can match antibody efficacy characteristics

Our Target is α4 Integrin

z α4 integrin is a key molecule in controlling access of leukocytes to sites of inflammation

Tethering / Rolling Firm adhesion Spreading Migration into tissue

CDP323

z Pathogenic T-cells in MS express α4 integrin

10 α4 Integrin is a Clinically Proven Target in MS

® z Tysabri is a monoclonal antibody that binds α4 integrin – It is the most effective approved therapy so far in Relapsing Remitting MS

z BUT clinical complications including • A few cases of life threatening viral reactivation (PML) • Long half-life (weeks) – Problematic for treatment withdrawal if PML detected

z Patient focus means understanding and effectively addressing these issues

CDP323 Well Placed to be Best in Class α4 Antagonist z UCB scientists have developed CDP323, a potent and orally active small molecule antagonist of α4-integrins

– Will replicate the level of benefit seen with Tysabri® but with a more controlled patient exposure and dosing convenience

11 Reducing Lymphocyte Adhesion is a Fundamental Property of CDP323

CDP323 Delivers ‘Tysabri®-like’ Efficacy in a Mouse Model of MS

alpha4 antibody CDP323 3 2

control antibody Vehicle 2

1 Mean Disease Score Mean Disease Score Disease Mean

0 0 0 10 20 30 0 10 20 30 Days post sensitization Days post sensitization

12 CDP323 is Well Tolerated in Human Volunteers z Clear demonstrated pharmacological rationale z Safe and well tolerated – Single dose – Repeat dose up to 7 days z UCB scientists developed a novel and robust PD assay – Clear pharmacodynamic effect

th z Data Presented at ECTRIMS meeting 27 September 2006. Madrid

CDP323 Inhibits α4-binding in Volunteers

13 CDP323 Development Plan

z Phase I human volunteer studies successfully completed z Patient studies in Relapsing MS scheduled to start in Q1 2007 z Phase III studies anticipated to begin 2008 z Approach agencies for approval to study CDP323 in other indications – Crohn’s disease – Rheumatoid arthritis – Other autoimmune diseases – Oncology

Conclusion

z α4 antagonists offer the best treatment for Relapsing Remitting MS z CDP323 will deliver an effective treatment for Relapsing Remitting MS z Will bring a therapeutic solution to the treatment and suffering in this severe disease

14 B Cell Depletion and Moderation Strategies Neil Weir Senior Vice President Discovery Research

B Cell Lymphoma Highly Potent Depletion Preferred CMC-544: CD22-targeted Calicheamicin Therapeutic 3.5

3 Vehicle G544 anti-CD22 3 mg/kg 2.5 CMC-544 0.14 mg/kg conj (g) 2 CMC-544 2.2 mg/kg conj mass 1.5

Tumor 1

0.5

0 0 102030405060 Tumor growth period (Days) Ref. Blood 103,1807,2004

15 Autoimmune Disease

No clear requirement for extensive depletion Modulation of function or partial depletion may be preferable

Autoimmune Disease Setting for B Cell Depletion or Modulation z B cell role in autoimmune disease, a developing case z No clear requirement for extensive depletion z Modulation of function or partial depletion may be sufficient z We believe may even be preferable

16 Epratuzumab Expected to Mediate Partial B Cell Depletion

control 2500 Rituxan treated Epratuzumab treated 2000

1500

B-cell/uL 1000

Mean numberof 500

0 -10 0 10 20 30 40 50 60 70 80 90 100110 Day

Summary

z B cell role in autoimmune disease

z Different drug functions may be optimal for oncology and autoimmune disease setting

z CMC 544 for oncology

z Epratuzumab may offer preferred function for autoimmune

17 Oncology

CDP791 Specific VEGFR-2 Inhibitor Lindsey Rolfe Therapeutic Area Oncology Director

18 Oncology Centre of Excellence

z Discovery and clinical therapeutic area expertise on single site z Research pipeline includes antibodies, antibody-cytotoxic conjugates, small molecules z Clinical pipeline: – CMC-544 – CDP791

CDP791

z CDP791 is a specific & potent inhibitor of VEGFR-2

PEG

19 CDP791 will have a Unique Profile

-A

CDP791 – Phase 1 Study Results

20 CDP791 – No Dose Limiting Toxicity

z In phase 1 study, well-tolerated at each dose level

z Combination with a wide variety of cytotoxic chemotherapeutic regimens and targeted therapies attractive

CDP791 – Next Steps

z Randomized phase 2 study in advanced non-small-cell lung cancer combined with carbo/taxol

21 CMC-544 Inotuzumab ozogamicin Lindsey Rolfe Therapeutic Area Oncology Director

CMC544 CD22-Targeted Chemotherapy

22 CMC544 Phase 1 Study Demonstrates Activity z Phase 1 monotherapy study in Non-Hodgkin’s Lymphoma z 66% response rate at likely phase 2 dose (Advani et al ASH 2005) z Phase 1/2 study of CMC544 combined with rituximab in NHL ongoing

UCB Oncology

23 Inflammation

Epratuzumab

David Mason Vice President Therapeutic Area Rheumatology/Gastroenterology

24 Epratuzumab Plays to UCB Research and Development Strengths z Immunology/Inflammation Key Discovery and Development Area of Interest

z Broadening Development Personnel Strengths and Portfolio in: – RA – SLE, Sjogren’s Syndrome

z Rapidly Building Commercial and Development Teams to Support this Area of Interest

Why Epratuzumab?

z B cell targets are “hot” – Rituximab, lymphostat B

z Partial B cell depletion, i.e. of “activated” subset may be effective, and safer than profound B cell depletion

z KOL feedback in Atlanta, September 18, 2006

z FDA - fast tracked

25 What about the SLE Patient?

z High prevalence (Estimated 700k+ pts WW), but diagnosis can be difficult and few effective treatments

z Can be severe and fatal – - 80% of patients diagnosed – - Often late stage with irreversible organ damage present

z Our patients – Moderate to Severe SLE

What about the Deal?

z Deal with Immunomedics signed on 9th May 2006 for worldwide rights to develop, manufacture and commercialize epratuzumab and epratuzumab products in autoimmune diseases – Initial agreed indication is SLE – All manufacturing know how transferred to UCB z Responsibility for and cost of Phase III SLE development and subsequent indications will predominantly be borne by UCB z Milestone payments to Immunomedics based upon specified success criteria while royalty rates are determined by the level of sales achieved

1 Current Status

z Patients Actively Enrolled in 2 Pivotal Trials

z Further Profiling Pharmacology

z Current Studies Recently Put on Clinical Hold – Addressing Manufacturing (product fill) Issues – Consulting with FDA – Planning Trial Restart

z Assessing Other Indications

Plans for SLE Development

Open Label Extension

ALLEVIATE A Phase III Efficacy in Severe / Flare Patients

BLA / MAA Phase II PK/PD Filings

ALLEVIATE B Phase III Efficacy in Moderate Patients

Open Label Extension

2 Epratuzumab

z In line with our Core Values – Care, Innovation

z Tremendous support from patients, investigators and regulators

z Supports our vision and portfolio needs

z Offers many opportunities for synergy and success

Cimzia™ - Mode of Action

Andrew Nesbitt Senior Group Leader, Antibody Biology

3 All Anti-TNFs are not the Same

z Basic structure

z Signalling through membrane TNF

Three Classes of Anti-TNF

Etanercept Infliximab Adalimumab Certolizumab (Enbrel®) (Remicade®) (Humira®) pegol Fab’ (CIMZIA™)

Receptor

Fc Fc PEG

Human PEGylated recombinant Monoclona humanized receptor/Fc l antibody Fab′ fragment fusion protein = murine = human

Adapted from Hanauer SB. Gastroenterol Disord 2004;4(Suppl. 3):S18-24.

4 Methods of Killing Cells

z Necrotic cell death – ADCC and complement lysis

z Apoptotic cell death – Signalling through membrane TNF

Complement killing of TNF6.5 cells 80 IgG1 control Enbrel Humira 60 Remicade Fab'PEG control

40 Cimzia ADCC of TNF6.5 cells 20 60 IgG1 control Enbrel % of Propidium% Iodide positive cells 0 Humira 0.0001 0.001 0.01 0.1 1 10 100 Remicade Drug concentration [µg/ml] 40 Fab'PEG control Cimzia

CIMZIA™ is the only anti-TNF 20 which cannot kill cells by % of Propidium% Iodide positive cells these mechanisms 0 0 1 10 100 Drug concentration [µg/ml]

5 Apoptosis of activated lymphocytes

30 IgG1 control Enbrel 25 Humira Remicade 20 Fab'PEG control Apoptosis of activated Cimzia 15 monocytes

10 60 IgG1 control 5 Enbrel Humira % of Annexin V positive cells positive cells V of % Annexin 0 Remicade 0 1 10 100 40 Fab'PEG control Drug concentration [µg/ml] Cimzia

CIMZIA™ is the only anti-TNF 20 which does not kill cells by positive cells V of % Annexin 0 apoptosis in vitro 0 1 10 100 Drug concentration [µg/ml]

Summary of in vitro Properties of the Anti-TNF Reagents

Neutralisn Neutralisn Inhibitn Complem. Apoptosis Neutrophil of sol. of m/b Cytokine lysis death TNF TNF Secretion and ADCC

CIMZIA™ +++ +++ +++ – ––

Humira® ++ +++ ++ +++ +++ +++

Remicade® ++ +++ ++ +++ +++ +++

Enbrel® +++ ++ +/- +++ ++ ++

6 Summary

z CIMZIA™ appears to be equally efficacious to Remicade® and Humira® in Crohn’s disease

z CIMZIA™ does not kill cells by any mechanism

Cimzia™ Programmes

David Mason Vice President Therapeutic Area Rheumatology/Gastroenterology

7 CIMZIA™ – Planning the Future

CIMZIA™ in Crohn’s disease z MAA submitted to EMEA in April 2006 z BLA submitted to FDA in February 2006

z Approval expected H1`07 (US) H2`07 (EU) z Have Received Comments from Rapporteurs z Expecting FDA Comments in Near Term

CIMZIA™ - novel treatment choice in Crohn’s disease

Psoriasis Data are Outstanding

CIMZIA™ in Psoriasis z The psoriasis patient suffers – symptoms and disability can include progressive arthritis as well as skin lesions

8 Patients and Investigators Reported Success z Early trial reports - lesions clearing rapidly

z Quick and robust response an improvement over standard treatments

z Product tolerability excellent - particularly to injection

CIMZIA™ Psoriasis Phase II Results Percentage of Subjects with PASI75 at Week 12 ITT Population

100 82.8 * 74.6 * 80

40 % of patients of % 20 6.8

0 Placebo, n=59 Certolizumab pegol Certolizumab pegol 200 mg EOW, n=59 400 mg EOW, n=58

* Versus placebo, p< 0.001

9 UCB set to Enter a New Era with CIMZIA™

CIMZIA™ Future Success – Multiple Indications in Development z Psoriasis – Phase III trials planned

z Rheumatoid Arthritis Pivotal Studies to Complete Q3 and 4, 2006, On Time – sBLA/MAA in planning stage

z Other indications are being planned

10 Expanding the Clinical Profile

z WELCOME Study – CIMZIA™ benefit in patients failing or intolerant to infliximab – 26 week – 600 patients – Enrolment ongoing

z MUSIC Study – CIMZIA™ impact on endoscopic and mucosal healing – 54 week study – 85 patients planned

What Else is New? CIMZIA™ Pre-filled Syringe

11 Self-injectable Device: Pre-filled Syringe z Commercially competitive, pre-filled syringe using stable liquid formulation will be available

CIMZIA™

Humira®

Anti-TNFs hold Significant Market Potential

• Global biological market of USD 51 billion in 2005

• Global biological sales increase by 18% (global pharma sales +7.5%)

• Global anti -TNF market USD 7 billion (2005); 32% annual growth

• 2 of Top 10 global biological blockbusters are anti-TNFs

- Enbrel® (Amgen) USD 3.5 billion

- Remicade® (J&J) USD 2.9 billion

• Commercial sales and support teams in place for successful launch

Source: IMS Health MIDAS, Scrip News 12.04.06

12 CIMZIA™- Conclusions A Novel Treatment Choice in Crohn’s Disease

z UCB has great expertise in antibody development programs

z New approach to anti-TNF therapy

z Once-monthly subcutaneous administration

z Stable and consistent dosing regimen

z Excellent efficacy

z Well-tolerated

z Low immunogenicity

z Low incidence of auto-antibody formation

z Label expansion under way

z Pre-filled syringe will be available

Overall Remission Rates for Anti-TNFs PRECiSE 2 ACCENT I

80 64% 80 59% 48% 60 31% 60 39% % 29% 23% 40 18% % 40 21% 12% 20 20 0 0 Week 6 Week 26 Overall Week 2 Week 30 Overall Response Remission Remission Response Remission Remission Week 26 Week 30 PRECiSE 1 CHARM 80 80 58% 60 60 40% % 30% % 40 18% 40 23% 17% 10% 20 20 0 0 Overall Week 4 Week 26 Overall Remission Response Remission Remission Week 26 Week 26

• Overall remission rate = Remission of Responders x Response

13 Central Nervous System (CNS)

UCB 106607

Henrik Klitgaard Vice President CNS Research

14 UCB 106607 a novel drug candidate targeting unmet medical needs in depression

Major Depression - High Comorbidity with Anxiety and Insomnia High risk of developing MD

Anxiety Major 40-60% Depression Disorders

40%

Insomnia High risk of developing MD Secondary effect z Antidepressant therapy should go beyond treating depressive symptoms

15 SSRIs and SNRIs Dominate the Depression Market but lag Time before Alleviation of Anxiety or Insomnia

z 50-70% of the depressive patients need co-prescription of anxiolytic or sedative drugs to better cover the symptoms of anxiety, insomnia and nervousness

z Chronic treatment with SSRIs and SNRIs induces sexual dysfunction that is considered as major cause for discontinuation

z Need for an antidepressant drug without negative impact on sexual function and with a significant ability to counteract anxiety and insomnia

UCB 106607 – a Triple Target Drug Candidate Designed to Relieve Major Unmet Medical Needs in Depression

Mechanisms of ucb 106607: SSRI + 5-HT2 antagonist + H1 antagonist

Unmet need

Sexual SE Remission Onset

Attainment

16 UCB 106607 Currently in Phase I Studies z An innovative triple target drug candidate with potential to – ameliorate depressive symptoms – decrease anxiety and insomnia resulting in a more rapid onset of action – prevent sexual side-effects – relieve neuropathic pain z Principal indication is major depression z Anxiety disorders and neuropathic pain possible line extensions z Targeted treatment schedule is once a day z Patent protection until 2023

SV2A, SV2B and SV2C Innovative and Productive Targets for CNS Drug Discovery Henrik Klitgaard Vice President CNS Research

17 All Antiepileptic Drugs except Keppra® act by Modulating Ion Channels and Receptors

Reduce excitation: Enhance inhibition:

A • A z + R z GABA Ragonists Na channel antagonists• P AP P P 2+ E z EnhancedE • GABA levels z Ca channelK antagonists• K

Keppra® is the only AED that Binds to Synaptic Vesicle Protein 2A (SV2A)

[3H]levetiracetam bound (dpm) 3000 r2=0.84

2500 8

2000 7

1500 hSV2A 6 50 1000 pIC 5 500

0 4 Li Lu Ki Sp Pa He Ad Hi Co Ce 3 4 5 6 7 pED50 Peripheral organs Brain protection against audiogenic seizures in mice

Noyer et al., Eur. J. Pharmacol. 286:137-146, 1995 Lynch et al., PNAS 101:9861-9866, 2004

18 Brivaracetam and Seletracetam Two High Affinity SV2A Ligands

Keppra® Brivaracetam Seletracetam

F O N O N N O NH 2 NH 2 NH 2 O O O

® z Chemically related to Keppra ® z Higher affinity for SV2A than Keppra

Brivaracetam and Seletracetam Different and Superior to Keppra® in Animal Models of Seizures and Epilepsy

Epileptiform activity Keppra® BRV SEL

Different in vitro Hyperexcitability + +++ ++ characteristics of BRV Hypersynchronization + ++ +++ and SEL

Acute seizures – + – Different Focal seizures + +++ ++ in vivo Generalized seizures activity of + ++ +++ BRV and Status epilepticus SEL seizures + +++ + CNS tolerability + + ++

19 SV2A, SV2B and SV2C Three Isoforms of SV2 – with Different Brain Distribution z SV2A is the most common isoform, expressed ubiquitously throughout the brain z SV2B is not as prevalent but often co-expressed with SV2A z SV2C restricted to midbrain areas C A B

Immunostaining of whole brain sections with selective antibodies for SV2A(A); SV2B(B) and SV2C(C). 1 = striatum; 2 = substantia nigra; 3 = midbrain; 4 = hindbrain

SV2A, SV2B and SV2C Three Isoforms of SV2 – with Potential Different Disease Implications z Phenotyping of SV2A KO mice revealed epilepsy and anxiety phenotypes SV2A KO mice rapidly SV2A KO mice are anxious acquire kindling

Corneal kindling development Elevated plus maze

35 100 30 80 25 20 60 WT 15 ** SV2A +/- 40 * 10 WT

Proportionof mice with 20 SV2A +/- 5 *p<0.05 **p<0.01 n= 10-11/group secondarily generalised seizures (%) 0 0 0 5 10 15 20 25 Number of stimulations time on % visits on open arms (s) open arms 2 mA – 3 sec N=10/group

K. Leclercq et al. Y. Lamberty et al. Unaltered seizure susceptibility contrasts accelerated kindling Heterozygous SV2A KO mice are associated with an anxiety-related acquisition in heterozygous SV2A KO mice phenotype SFN abstract 82.7/LL38, October 2006 SFN abstract 830.5/FF23, October 2006

20 SV2A, SV2B and SV2C Innovative and Productive Targets for CNS Drug Discovery at UCB z Exploit unique expertise at UCB in both chemistry, biology and pharmacology on SV2 ligands z Novel targets and novel approach unique to UCB z Possess a promising potential for providing new medicines for the treatment of a number of neurological and psychiatric disorders

Brivaracetam / Seletracetam

Peter Verdru Vice President Therapeutic Area Neurology/Psychiatry

21 UCB: the Epilepsy Company

® z Keppra – expanding our leadership

® z Keppra XR: phase III on track

z Brivaracetam and seletracetam – Robust Efficacy – Programs on track

Keppra® Developing the Full Potential

Epilepsy

De novo patients monotherapy less refractory

Partial add-on in adults

Children

Refractory patients Adults

Partial onset Generalized seizures seizures

22 Keppra® Status

1999 2005 YTD 2006 2006 2007

Pediatrics Pediatrics JME in JME in US in US in Europe Europe

Tonic clonic Mono- seizures therapy MAA in Europe submitted

IV XR IV solution program solution in Europe launched in US

Completion Approval China of Phase in South approval III Korea expected program in Japan

Key : Indications Formulations Geography

Introducing Keppra® XR

z Extended release formulation (XR): True once daily

z Indications: – Add-on therapy

z Pre-IND* meeting with FDA: – Agreement on Development Plan – Allowing for 3 years market exclusivity

z Phase III trials ongoing

z Results expected in Q4 2007

z Planning for Monotherapy

* Investigational New Drug

23 Brivaracetam Phase II Results

z Different pharmacology – 10 times more potent – More efficacious z Broader mechanism of action

Brivaracetam Phase II Studies: Main Inclusion Criteria

z Focal epileptic syndrome, refractory seizures z At least 4 partial onset seizures during the 4-week baseline period z One or two concomitant AED(s) at stable dose z 16 to 65 years

24 N01114: Study Design

150 mg

50 mg

PLC

Baseline Titration Evaluation

Very Low Discontinuation Rate at 50 and 150 mg/day

Placebo 50 mg 150 mg

ITT 52 53 52

Completed 48 51 49 (92.3%) (96.2%) (94.2%)

N01114: disposition of patients

25 Robust Treatment Effect (1)

35 38 30 30 25

15 19

N01114: % Reduction in seizure frequency 0 Placebo 50 mg 150 mg

p = 0.093 and 0.124

Robust Treatment Effect (2)

35 40

33 30

20 23

N01114: 50 % Responder Rate 0 Placebo 50 mg 150 mg

1 Robust Treatment Effect – Even Seizure Freedom

9 9.4 8

6 5.8 5

2 N01114: Seizure freedom 1 1.9

0 Placebo 50 mg 150 mg

N01193: Study Design

50 mg

20 mg

5 mg

PLC Baseline Evaluation

2 Very Low Discontinuation Rate at 5, 20 and 50 mg/day

Placebo 5 mg 20 mg 50 mg

ITT 54 50 52 52

Completed 49 46 51 51 (90.7%) (92.0%) (98.1%) (98.1%)

N01193: disposition of patients

Robust Efficacy

50 53

40 43

30 20 22

10 N01193: % frequency Reduction in seizure

0 Placebo 5 mg 20 mg 50 mg p = 0.24, 0.062 and 0.004

3 Robust Efficacy

56 50

40 44

30 32 20

17 10 N01193: 50 % Responder Rate 0 Placebo 5 mg 20 mg 50 mg

Seizure Freedom

8 7.7 7.7 7 8 6

1 1.9 N01193 % Seizure freedom 0 Placebo 5 mg 20 mg 50 mg

4 Brivaracetam: Conclusions

z Very strong efficacy z This population includes patients not controlled with Keppra® (60 and 30 % for study N01114 and N01193, respectively). z Very well tolerated: – Particular low drop out rates in active groups. – No difference in AE rates compared to placebo

Seletracetam: Phase II Results

z N01184: Proof of concept. z N01191 and N01192: Maximum Tolerated Dose in patients without (N01191) or with (N01192) Keppra®

5 Photoparoxysmal Response: Proof of Concept

100% 80% 60% 40% 20% 0% -20% -40% -60% 0.5mg (n=5) 1 mg (n=4) 2 mg (n=7) 4 mg (n=5) 10 mg (n=7) 20 mg (n=8)

Non-Response Partial-Response Full-Response

Phase IIa Studies

z N01191 – Refractory Partial Onset Seizure patients currently on up to 3 AEDs, but currently not receiving Keppra®. N=31

z N01192 – Refractory POS patients on up to 3 AEDs, one of which had to be Keppra®. N=59

Data on File, UCB

6 N01191-N01192: Study Design

160 mg

80 mg 80 mg

40 mg 40 mg 20 mg 20 mg

Baseline Up-Titration Down-Titration

Proven Efficacy at all Doses Tested

50 * 40 * * * 30 * 20 10 0 -10 20 40 80 160 80 40 20 0 -20

SEL Dose (mg/day)

* p ≤ 0.05 significantly different from baseline

7 Similar Efficacy - Patients on Keppra®

50 * 40 * * * 30 * * * 20

0 20 40 80 160 80 40 20 0

SEL Dose (mg/day)

* p ≤ 0.05 significantly different from baseline

Seletracetam: Conclusions

z Efficacy demonstrated in very refractory patients

® z Efficacy in patients failing on Keppra

z Majority of the patients reached the maximum allowed dose

z Seletracetam was very well tolerated

8 UCB: the Epilepsy Company

® z Keppra : expanding our leadership

® z Keppra XR on track. z Brivaracetam to become the next standard moves into phase III; ULD program on track z Seletracetam, in a once daily formulation, moves to phase IIb / III

Epilepsy Commercial Strategy

Troy Cox Senior Vice President UCB & President CNS Operations

9 Unmet Need for True Once Daily Formulation z Once daily dosing not yet standard for anti-epileptic drugs (AEDs) z Most AED XR forms have one or more limitations (e.g. often taken twice-a-day, titration, loading, etc.) z AED XR forms in development are few and expected to have significant limitations (e.g. lamotrigine XR; oxcarbazepine ER) z No new AED molecules in late development are expected to be once-a-day, except Seletracetam z Once daily dosing is particularly important for monotherapy

Opportunity remains for a true once-a-day AED which can be started at an effective dose from day one

Introducing Keppra® XR

z Extended release formulation (XR): True once daily z Indications: – Add-on therapy z Pre-IND* meeting with FDA: – Agreement on Development Plan – Allowing for 3 years market exclusivity z Phase III trials ongoing z Results expected in Q4 2007 z Planning for Monotherapy

* Investigational New Drug

10 Keppra® XR Target Profile Development Program Objectives are Expected to Deliver the New Standard

® z Improved efficacy/tolerability ratio versus Keppra IR z Efficacy from day one with no titration

® z Better tolerated versus Keppra IR z Demonstrated lowest cognitive side effects of any AED z Once a day convenience and compliance z Cost effectiveness demonstrated through Prospective Health Outcomes studies z Monotherapy Indication: key differentiator versus Keppra® IR

Smoothened Plasma Levels*

Potential for reduced seizures on awakening

16 XR 1000 od tr2

14 IR 500 bid

4 BID Morning Dose

0 0 12 24

time (h) * Steady State Simulation based on N01140 results

11 XR Presents Opportunity for Improved Efficacy

Source: Clinical comparison of extended release divalproex versus delayed release divalproex: pooled data from nine trials; Michael Smith, Franca Centorrino, et al.; Epilepsy and Behavior; July 7, 2004

XR Presents Opportunity for Improved Tolerability Improved Adverse Event Profile (AEP) when switching from Carbamazepine (CBZ) IR to CBZ ER formulation

Figure 1. Percentage change from baseline to end point for individual item AEP mean scores in adult subjects

Source: Ficker et al. Neurology 2005;65:593-595

12 Patients Prefer Once Daily Treatment

Keppra® XR Could Achieve Critical Unmet Needs

Rank Unmet Needs

1 Treatments for refractory seizures

2 Tolerable drug therapies

3 Prophylactic Strategies

4 Once-daily dosing

5 Convenient/easy formulations for patients

Source: Decision Resources

13 Expect Physicians to Prescribe More Keppra® XR

Survey Question: How would the availability of a once-daily form of Keppra® affect your prescribing of the drug?*

70% 60% 60% 48% 50% 36% 40% 32%

30% 20%

Percent Responding Percent 20% 12%

10%

0% Increase First Increase Add-on Increase in Increase Need More No Impact Choice Pediatric & Elderly Monotherapy Information

*Respondents were asked to select all that apply Source: Decision Resources

Benchmarks: Transition/Grow with XR

US Valproate Sales US Carbamazepine Sales

200,000 60,000 (000€) (000€) 180,000 Total IR/XR Total IR/XR 50,000 160,000

140,000 40,000

120,000 IR XR 100,000 30,000

XR 80,000 IR 20,000 60,000

40,000 10,000

20,000

0 0 Q1/00 Q3/00 Q1/01 Q3/01 Q1/02 Q3/02 Q1/03 Q3/03 Q1/04 Q3/04 Q1/05 Q3/05 Q1/06 Q4-96 Q1-97 Q2-97 Q3-97 Q4-97 Q1-98 Q2-98 Q3-98 Q4-98 Q1-99 Q2-99 Q3-99 Q4-99 Q1-00 Q2-00 Q3-00 Q4-00 Q1-01 Q2-01 Q3-01

Immediate Release Extended Release TOTAL Immediate Release Extended Release TOTAL

Source: IMS

14 Keppra® XR Conclusions

z Potentially improved efficacy/tolerability ratio z Could address most important unmet needs

® z Expect Physicians to prescribe more Keppra XR z Patients prefer once-a-day z Strategy: – Continue to redefine “well controlled” – Transition and grow z The new standard !

UCB: The Epilepsy Company Continuously Redefine the New Standard

Seletracetam Potential to Surpass and Brivaracetam complement The Standard Brivaracetam to Beat Keppra® XR Tomorrow’s Keppra® Standard

Efficacy/Tolerability Ratio Today’s Standard Time

15 Conclusions Melanie Lee Executive Vice President R&D

UCB – Business Partners for Strength

z UCB partners throughout our value chain • Discovery • Development • Commercialization z Our partners have complementary strengths to ourselves z Our partners are specific for each product z We value our partners z We strive to be a partner of choice

16 UCB R&D Pipeline Partners

New tba Academia Amgen SOST Celtic BiogenIdec OX40 Crucell CD40L Astra Zeneca Aggrecanase

Seattle ImClone Genetics Anti-VEGFR2

Lonza ChemBridge Ab Mfg Wyeth Immunomedics CMC544 Epratuzumab Millennium ICOS CXCR3 Abgenix Discovery Partners Non-exhaustive list

Antibody Target Partnerships

New tba Academia Amgen SOST Celtic BiogenIdec OX40 Crucell CD40L Astra Zeneca Aggrecanase

Seattle ImClone Genetics Anti-VEGFR2

Lonza ChemBridge Ab Mfg Wyeth Immunomedics CMC544 Epratuzumab Millennium ICOS CXCR3 Abgenix Discovery Partners Non-exhaustive list

17 Chemistry Partnerships

New tba Academia Amgen SOST Celtic BiogenIdec OX40 Crucell CD40L Astra Zeneca Aggrecanase

Seattle ImClone Genetics Anti-VEGFR2

Lonza ChemBridge Ab Mfg Wyeth Immunomedics CMC544 Epratuzumab Millennium ICOS CXCR3 Abgenix Discovery Partners Non-exhaustive list

Technology Partnerships

New tba Academia Amgen SOST Celtic BiogenIdec OX40 Crucell CD40L Astra Zeneca Aggrecanase

Seattle ImClone Genetics Anti-VEGFR2

Lonza ChemBridge Ab Mfg Wyeth Immunomedics CMC544 Epratuzumab Millennium ICOS CXCR3 Abgenix Discovery Partners Non-exhaustive list

18 New UCB’s R&D

z “People First” z Science-led Research – Unique Combination of Biology with Chemistry – Unique technologies z Innovative Clinical Development z Dual, rich pipeline z Patient Centric z Focused on treating severe diseases – Immunology, including inflammation and allergy – Neurology, especially epilepsy and movement disorders – Oncology

UCB Strategy

19 UCB, Next Generation Biopharma

Appendix

20 Sclerostin

Project : Chemical Code : Generic name : NBE NA NA

Indication : Target or Mode of Trade name : Low bone mass Action : NA disorders, for example Sclerostin osteoporosis

Formulation : Partner : Phase : Injection Amgen Pre-clinical

CDP 323

Project : Chemical Code : Generic name : NCE CDP 323 NA

Indication: Target or Mode of Trade name : (CNS) Action: NA Multiple Sclerosis α4 integrin antagonist

Formulation : Partner : Phase : Oral administration potential partnering I, phase II will start in 2007 candidate

21 CDP 791

Project : Chemical Code : Generic name : NBE CDP 791 NA

Indication : Target or Mode of Trade name : Oncology, Action : NA PoC in Non-small Cell Anti-VEGFR-2 Lung Cancer

Formulation : Partner : Phase : Intravenous Imclone II

CMC 544

Project : Chemical Code : Generic name : NBE CMC 544 Inotuzumab ozogamicin

Indication : Target or Mode of Trade name : Oncology, PoC in Non- Action : NA Hodgkin Lymphoma Anti-CD22 Calicheamicin - conjugated

Formulation : Partner : Phase : Intravenous Wyeth I/II

22 Brivaracetam

Project : Chemical Code : Generic name : NCE UCB 34714 Brivaracetam

Indication Target or Mode of Trade name : (CNS) : Action : NA

zEpilepsy SV2A Ligand +

zOrphan Conditions inhibition of voltage dependent Na+ currents

Formulation: Partner : Phase : Oral tablets None IIb

Seletracetam

Project : Chemical Code : Generic name : NCE UCB 44212 Seletracetam

Indication : Target or Mode of Trade name : (CNS) Action : Ongoing Epilepsy Racetam, SV2A Ligand

Formulation: Partner : Phase : Oral capsule None II

23 Keppra®

Project : Chemical Code : Generic name : NCE UCB L059 Levetiracetam

Indication : Target or Mode of Trade name : (CNS) Action : Keppra ® Epilepsy SV2A Ligand

Formulation : Partner : Phase :

zTablets None Launched/

zOral Solution Phase III (Japan and XR)

zInjectable

UCB 106607

Project : Chemical Code : Generic name : NCE UCB 106607 NA

Indication : Target or Mode of Trade name : (CNS) Action: NA Depression SSRI / H1 antagonism / 5HT2 antagonism

Formulation : Partner : Phase : Oral capsule Partnership targeted I

24 Cimzia™

Project : Chemical Code : Generic name : NBE CDP 870 Certolizumab pegol

Indication : Target or Mode of Trade name : (Inflammation) Action : Cimzia

zCrohn’s Disease Anti TNF

zRheumatoid Arthritis

zPsoriasis Formulation : Partner : Phase :

zLyophilised None Filed (CD),

zLiquid II (Pso), III (RA)

zSubcutaneous Injection

Epratuzumab

Project : Chemical Code : Generic name : NBE CDP 3194 Epratuzumab

Indication : Target or Mode of Trade name : SLE Action : NA antibody against CD22

Formulation : Partner : Phase : Intravenous Immunomedics III

25 Scientific Advisory Board in London

z Professor Sir Tom Blundell z Professor Robert Darnell z Dr Frank Fildes z Professor George Griffin, Chairman z Dr John McCall z Peter Fellner, UCB Board Member