Recurrent MET Fusion Genes Represent a Drug Target in Pediatric

© 2016 Nature America, Inc. All rights reserved. Received Received 19 October 2015; accepted 15 September 2016; published online 17 October 2016; A full list of affiliations appears at the end of the paper. molecularly targeted therapy is currently used. Patient outcomes outcomes Patient used. currently is therapy targeted molecularly No benefit. clinical marginal with chemotherapy, and radio- lective glioblastoma pediatric in ATRX commonly (most genes H3-encoding histone of mutations recurrent of identification The phatidylinositol 3-kinase phos (PI3K) or pathways, areMAPK frequently the deregulated. as such however, pathways, canonical Certain ized by a complex genomic and landscape profound heterogeneity tumor that is character is childhood a deadly glioblastoma Pediatric response. clinical durable a achieve to necessary likely are therapies combination that indicating appeared, lesions treatment-resistant new but symptoms, of relief associated and shrinkage tumor substantial to led therapy This crizotinib. inhibitor targeted the with glioblastoma a MET-fusion-expressing bearing patient a pediatric treated we Finally, models. xenograft in tumors glial aggressive induced regulation, cycle cell compromising lesions with cooperation in and, signaling (MAPK) kinase These the involving fusions gene vitro in five and glioblastomas pediatric 53 of analysis genetic integrative an Using childhood. in tumors brain deadly most and common most the of one is glioblastoma Pediatric David T W Jones Andrey Korshunov Jörg Felsberg Nicholas G Gottardo Saoussen Trabelsi Jacques Grill Andreas Unterberg Sabine Heiland M Cornelis van Tilburg Bingding Huang Paul A Northcott Marina Ryzhova Bender Sebastian in glioblastomapediatric Recurrent nature medicine nature also suggests that epigenetic deregulation has that also suggests deregulation a epigenetic prominent role MET model systems, we identified previously unidentified unidentified previously identified we systems, model in vivo in fusions activated mitogen-activated protein protein mitogen-activated activated fusions . MET inhibitors suppressed MET tumor growth growth tumor MET suppressed inhibitors . MET 21 35 , , Benedikt Brors, Benedikt 22

14 7 12 advance online publication online advance , , Nada Jabado 1 1 , , Christof von Kalle , Elke , Pfaff Elke 1 27 , , 3 3 – , , Ivo Buchhalter , Dominik Sturm , 3 3 17 , , Ho-Keung Ng 41 , , H3F3A 32 19 4 40 MET , , Olaf Witt , , , for the International Cancer Genome PedBrainConsortium Tumor Project 5 – , . Standard treatment is based on nonse on based is treatment Standard . , , Jan Gronych 20 34 2 MET , , , Roland Eils 3 , Chris Jones , ) and chromatin modifiers such as as such modifiers chromatin and ) 13 oncogene in ~10% of cases. cases. of ~10% in oncogene , , Ursula D Weber 1 – 3 fusion genes represent a drug target 23 , , Volker Hovestadt 3 2 , 6 , , 18 24 , 13 6 28 , , Andreas von Deimling , , Astrid M Sehested , 12 , , Christel Herold-Mende 1 3 , , David Zagzag 15 – , 12 10 4 , , Michael Heinold 3 , , , Lynn Bjerke 40 16 , Jan O Korbel , 38 , , Hans-Jörg Warnatz , , Christopher Previti , 39

, , Marie-Laure Yaspo 3 , 4 , , Marc Zapatka

3 , 4 29 10 , , Florian Weinberg 1– 11 , , Thomas Zichner 30 3 25 - - - , Sabine Schmidt . 6 , , Jeffrey C Allen , , David Sumerauer , , Thomas Risch CDKN2B files clustered together with normal brain samples (suggesting high high (suggesting samples brain normal with together clustered files Table 4 ( (ICGC_GBM19&50) pair primary-relapse lar PXA 2 protein ( linker CAP-GLY-domain-containing 2 ( receptor factor growth of fibroblast fusion unknown glioblastoma in fusions FGFR3-TACC3 gliomas glioblastomas infant of 40% in identified involving others and fusion, This variant Ets between ( fusion 6 gene a harbor to found was infant an ( PXAs of typical are 1 Tables 1 Fig. appearance heterogeneous with tumor brain sive (PXA) xanthoastrocytoma pleomorphic resembled ously epigenetic subgroups described to previ the in addition that, revealed on our cohort analysis project ylation Tumor PedBrain (ICGC) ( Consortium Genome Cancer in mutations, H3.3 of the context of trum recurrent the International spec whole the covering lines cell ( glioblastoma pediatric five from samples 53 from DNA molecularly needed. desperately are or therapies stratified individualized for targets new and dismal, remain Fig. 3 , We performed whole-genome sequencing of tumor and blood blood and tumor of sequencing whole-genome performed We 19 17 ETV6 5 16 , 1 , , , Hans Lehrach 20 40 3 and ). The full tumor cohort is described in in described is cohort tumor full The ). , Chris , LawerenzChris , ). ). Three glioblastomas pediatric whose DNA methylation pro 5 4 , , David Capper 11 , Barbara , HutterBarbara , , Stefan M Pfister , , Benjamin Raeder and and ad h nuorpi rcpo tp 2 ( 2 type receptor neurotrophin the and ) doi:10.1038/nm.420 ) , 1 8 Supplementary Tables 2 2 , 9 . Analogous to the highly oncogenic FGFR1-TACC1 and oncogenic to highly the . Analogous . Moreover, one potential PXA (ICGC_GBM34) in in (ICGC_GBM34) PXA potential one Moreover, . 2 . Two of five PXA-like tumors carried lesions that that lesions carried tumors PXA-like five of Two . 8 11 16 31 , 5 9 , Barbara , C Barbara Worst , Sebastian , Halbach Sebastian , Adrian M Stütz , Stephan Wolf , , Matthias A Karajannis 26 BRAF , , Dorra Brahim Hmida-Ben 5 , , Tilman Brummer 3 12 4 , upeetr Tbe 1 Table Supplementary 6 19 V600E and deletion of of deletion and V600E , , , Andreas E Kulozik 1 40 , – 20 11 , , Susanne Gröbner 3 , , , Nathalène Truffaux 41 , , David Milford and NTRK , , Peter Lichter 16 6 , , five of the tumors molecularly , Guido Reifenberger 11 3 1 ). Genome-wide DNA meth , Kathrin Schramm 1 – -family genes, have been been have genes, -family 3 1 3 8 , we found a previously previously a found we , 0 , , , Marcel Kool and some lower-grade lower-grade some and

CLIP2 31 8 , 3 9 , ( , 36

Supplementary Supplementary Supplementary Supplementary Supplementary Supplementary 7 s r e t t e l 14 NTRK2 3 , a less aggres less a , CDKN2A , 2 ), as well as as well as ), ) ) in a molecu ,

37 1 4 , FGFR2 , , ,

3 41

, 27 ,

21 & , 1 ) gene. gene. ) , 22 , 3 ) ) with , and and , 35 3 , 4 , , ------

© 2016 Nature America, Inc. All rights reserved. of five primary-recurrent tumor pairs revealed that known somatic somatic known that revealed pairs tumor primary-recurrent five of repair deficiency mismatch germline with associated often and therapy, adjuvant any (chromothripsis) structural rearrangements marked of frequency high a included features common lytically active NTRK3 kinase domain ( cata the maintained that protein truncated amino-terminally an in site in mutation splice intron 12 of unknown PDGFR/KIT BRAF example, (RTK)- kinase (for RTKs of mutations activating tyrosine including signaling, PI3K-MAPK receptor activated aberrantly in result to likely are that lesions genetic numerous detected Wealso samples. of deletion in mutations with regulation, cycle Supplementary Table 3 ( frequencies allele mutant lower-than-expected notably showed content) cell normal tumors. primary respective the of numbers identification ICGC the indicate row tumor recurrent the in given row. Numbers each of end the at indicated are samples analyzed 58 in alterations genetic of Frequencies lines. cell glioblastoma pediatric five and tumors PXA-like five glioblastomas, pediatric hemispheric 29 and midline 19 in 42) ( whole-genome by identified fusions) and alterations 1 Figure s r e t t e l recurrent and primary between shared typically were events driver

A full overview of genetic alterations is provided in in provided is alterations genetic of overview full A Cell cycle RTK-PI3K-MAPK Chromatiin

and and associated

The genomic landscape of pediatric glioblastomas. Genetic alterations (mutations, small insertions/deletions (InDels), focal copy number number copy focal (InDels), insertions/deletions small (mutations, alterations Genetic glioblastomas. pediatric of landscape genomic The Expr EGFR CCND1/2/3, MGMT meth Meth H3F3A/HIS PIK3CA CDKN2A R or or ession subgr ecurr Chr ylation clust Hyper NRA ) ) or proteins downstream (for example, MY MET omothr A CDKN2A/B 1 ent tumour ge (y 5 PIK3R1/2 PDGFRA FGFR1 NTRK1 RNA C/MY ) ) and alterations in telomere maintenance. Analysis CDK4/6 Location SETD1A ICGC ID S/KRA PPM1D PIK3C Supplementary Fig. 2 Fig. Supplementary mutato SETD2 IDH1/2 T1H3B ylation BRAF ) and high-level gene amplifications of of amplifications gene high-level and ) EGFR PTEN A TER TP53 ear ( ME TRX RB1 ipsis -seq NF1 and and oup KI CN Fig. Fig. -3 -4 er s) . The most commonly altered pathway was cell S T T T A r RNA Location 24 ICGC_GBM2 CDKN2B 1 16 No Ye Hemispher Midline ). ICGC_GBM17 harbored a previously previously a harbored ICGC_GBM17 ).

-seq ICGC_GBM12 s 13 ICGC_GBM16 18 ICGC_GBM17 2 8 ICGC_GBM27 1 5 7 4 ic TP53 ICGC_GBM33 , hypermutated tumors (before (before tumors hypermutated , , being identified in 83% of all all of 83% in identified being , ICGC_GBM53 53 6 Supplementary Fig. Supplementary 3 ICGC_GBM66 1 5 or ICGC_GBM65 ). Meth 5 ICGC_GBM60 High nor PXA Non-H3/non-IDH IDH mu H3.3 G34R H3.3/H3.1 K27M PPM1D 1 7

NTRK3 ICGC_GBM18 ylation 1 1 ICGC_GBM24 -lik 1 4 ICGC_GBM26 n n/ e t 2 4 a = 52) or whole-exome/low-coverage whole-genome (INF_51_XT1) and RNA-sequencing ( RNA-sequencing and (INF_51_XT1) whole-genome whole-exome/low-coverage or = 52) ma ICGC_GBM83 4 8 , or homozygous , or homozygous ICGC_GBM7 l , likely resulting , resulting likely ICGC_GBM28 NRAS 8 8 Figure Figure ICGC_GBM38 n /a INF_51_XT1 1 5 ICGC_GBM48 1 3 ). ). Other , , ICGC_GBM5 EGFR KRAS 1 4

1 ICGC_GBM22 Expr and and 3 9 ICGC_GBM43 Classic Mesench Neural Pr 3 0 ICGC_GBM44 ession oneural - 2 1 , , ICGC_GBM45 n/ 1 5 n a ICGC_GBM62 /a 2 9 MET a with glioblastomas pediatric primary two we identified also knowledge, our of best the to setting, pediatric the in time first a harbored (ICGC_GBM41) lymphoma large-cell RTKs, anaplastic in ALK or carcinoma other thyroid papillary in with NTRK1 as such proteins chimeric form to described previously the ICGC_GBM1, In was which gene (TFG), to domain. TRK-fused was fused domain MET kinase kinase carboxy-terminal the only retained that MET of fusions unknown previously two Wedetected gene was affected 64%; 42, of ated genes, such as (27 samples most in TableSupplementary 4 rearrangements structural of GBM49, (ICGC_GBM36, tumors recurrent both (ICGC_GBM4, tumor primary the in detected Supplementary Fig. 4 lesions; distinct anatomically ICGC_GBM71 two as reported and clinically were (which ICGC_GBM11 of exception the with lesions, ICGC_GBM63 n/ ymal 1 7 a

RNA sequencing revealed fusion transcripts that were the results results the were that transcripts fusion revealed sequencing RNA ICGC_GBM79 * 1 9 ICGC_GBM42 1 8 fusion ICGC_GBM85 1 4 ICGC_GBM6 1 7 BCOR ICGC_GBM15 1 3 ICGC_GBM25 Aberration 2 6 1 ICGC_GBM67 8 7 0 Ger F Deletion Ampli cation Indel Mutation . In this variant, expression of full-length MET was was MET full-length of expression variant, this In . ICGC_GBM82 usion V1112fs) of one patient ( patient one of V1112fs) advance online publication online advance ICGC_GBM32 mline 12 MET ICGC_GBM56 FGFR2 * 7 9 ICGC_GBM58 12 16

). ). Notably, different ICGC_GBM1 , , which encodes an oncogenic tyrosine kinase. , an kinase. tyrosine encodes which oncogenic 7 1 ). ). These often involved known cancer-associ

7 ICGC_GBM46 46 . The pediatric glioblastoma cell line SJ-G2 SJ-G2 line cell glioblastoma pediatric The . ICGC_GBM61 n/ , , 14 a NTRK2 ICGC_GBM57 17

53 n/a # * ICGC_GBM59 12 CLIP2 ICGC_GBM11 14 11 R TER TER TER ICGC_GBM71 ecurr 9 4

and ICGC_GBM52 * T pr T pr T pr

- ICGC_GBM86 ence ofICGC_GBM53 MET 7 6

omot omot omot ICGC_GBM4 4 4 PIK3R2

BCOR ICGC_GBM49 5 7 Supplementary Fig. 4 Fig. Supplementary BCOR ICGC_GBM36 er notanal er mutation C250T er mutation C228T fusion ( fusion ICGC_GBM19 n 19 1 6 /a ICGC_GBM50 1 2 wild type and ICGC_ type wild . . The most frequently

ICGC_GBM23 gene mutations were

BCOR ICGC_GBM34 nature medicine nature yz 1 5 Fig. 2 Fig. ed NEM157

1 5 MGBM1 # 8 6

F206fs) and and F206fs) KNS42 SF188 a 4 ). For the the For ).

PTPRZ1 SJ-G2 4% 16 7% 5% 26% 69% 4% 5% 7% 9% 9% 9% 12 12 12 14 16 16 14 4% 5% 10 43% 47% 22% 5% 59% n = % % % % % % % % %

y equenc fr e elativ R - - © 2016 Nature America, Inc. All rights reserved. detected expression of the HA-tagged fusion protein, as well as as well as protein, fusion HA-tagged the of expression immunohistochemistry detected and glioma, high-grade of that of charac was teristic that histology revealed evaluation Neuropathological ( lesions contrast-enhancing extensive and symptoms cal and 7) ( mice wild-type Trp53 (Ntv-a), wild-type of (Ntv-a; cells Cdkn2a-deficient nestin-positive into kb) size ~2.5 insert of RCAS the limit exceed TFG- fusions the (PTPRZ1-MET introduce fusion to MET system transfer gene somatic RCAS/Tv-a ( foretinib of these cells was also completely abolished in of the presence of was completely abolished cells 0.5 also these of >300 concentrations at even cells, SJ-G2 of viability the affect not did glioblastoma) pediatric for chemotherapeutic standard current (the temozolomide therapy, alkylating to sensitivity suggest may moter µ IC the fusion, MET without lines (IC concentration inhibition half-maximum a in resulting manner, tration-dependent concen a in viability cell reduced foretinib cells, SJ-G2 expressing ( activation MAPK MET-fusion-induced abrogated which or SGX523 crizotinib, foretinib, the MET inhibitors 6c Fig. ( JUN) and FOS example, (for factors transcription ing (for example, MAP2K6 MAP2K3, and DUSP14) and downstream well as altered expression of multiple factors involved in MAPK signal ( transformation of indicative was that change phenotypic a displayed cells Transduced astrocytes. human normal TFG-MET-overexpressing of profiles expression generated that better mimics the presumed origins of glioblastoma, we pediatric PTPRZ1 fusions showed much higher downstream activity than the full-length, ( ( levels pERK elevated substantially by indicated as signaling, MAPK of activation kinase ( the of domain loop activation the in Y1235 and Y1234 phosphorylation tyrosines the of in resulted cells HEK293T in PTPRZ1-MET gliomas high-grade of 6% in described recently was which of variant short the expressed tumors the of None separately. clustering as glioblastomas pediatric bearing MET-fusion- show not did expression gene and methylation DNA the of deletion homozygous of result a as regulation cycle cell impaired a have bearing glioblastomas pediatric all a harboring tumor mutant 5c Fig. and ( ICGC_GBM15 ICGC_GBM71 ICGC_GBM11, the detected hybridization fluorescence Dual-color and ICGC_GBM71). (ICGC_GBM43 of a the presence suggested RNA-seq without copy analysis data, number overexpression ( active highly the from driven nature medicine nature Supplementary Fig. 6a Supplementary M; M; To test the oncogenicity of MET fusions fusions MET of oncogenicity the test To with treated subsequently were cells TFG-MET-overexpressing To changes in induced transcriptional a characterize model further or TFG-MET (HA)-tagged hemagglutinin of Overexpression PTPRZ1 Supplementary Fig. 6d Supplementary µ −/− and and M M ( ). ICGC_GBM43 (H3.3 G34R) was the only histone H3.3- histone only the was G34R) (H3.3 ICGC_GBM43 ). Trp53 -driven variant ( variant -driven ) neonatal mice. Although no tumors could be found in in found be could tumors no Although mice. neonatal ) i. 2 Fig. Supplementary Fig. 6f Fig. Supplementary Supplementary Fig. 6e Fig. Supplementary Supplementary Table 5 Supplementary - MET Fig. Fig. −/− b Supplementary Fig. 5a Supplementary mice ( mice n ). Moreover, this overexpression induced strong strong induced overexpression this Moreover, ). 2 50 = 7) by 12 weeks after injection, injection, after weeks 12 by 7) = fusion, which we subsequently confirmed by PCR confirmed we which subsequently fusion,

b ) of 0.8 0.8 of ) ), and resulted in cell rounding and detachment detachment and rounding cell in resulted and ), advance online publication online advance n ) 2 Fig. 2 Fig. = 5) rapidly developed severe neurologi severe developed rapidly 5) = 0 PTPRZ1 . . Notably, truncated the amino-terminally Cdkn2a MET µ ). Although the methylated the methylated ). Although CDKN2A M. In three pediatric glioblastoma cell cell glioblastoma pediatric three In M. b PTPRZ1 ). fusion and amplification. Notably, amplification. and fusion 50 ). ). Anchorage-independent growth growth ). Anchorage-independent −/− - was substantially higher (2–13.5 (2–13.5 higher substantially was ). MET ; ; Supplementary Fig. 6a Fig. Supplementary and and Pten MET , MET promoter, leading to MET MET to leading promoter, b fusion in tumor sections of in fusion tumor sections Fig. 2b Fig. ). ). In tumors two additional CDKN2B fl/fl lacking exons 7 and 8, 8, and 7 exons lacking fusion were found to to found were fusion n vivo in ) or p53-null (Ntv-a; (Ntv-a; p53-null or ) , c TP53 ). In CLIP2-MET- In ). Supplementary Supplementary Supplementary Supplementary Cdkn2a

locus ( locus , we used the the used we , mutation or or mutation MGMT Fig. 3a Fig. 1 9 . −/− Fig. Fig. in in situ , b ( pro ), as as ), µ , n b 1 M = ). ). ). ). - - - - -

postnatal day 10), we used luciferase-labeled RCAS-TFG-MET-driven reliable techniques for oral drug delivery in infant mice (younger than Gronych). (J. observations data published previously of basis the on can in be system excluded this to tumorigenesis mutagenesis viral ( Erk and MET phosphorylated (0.5 foretinib inhibitors MET the with indicated where treated were cells HEK293T ( kDa. 65 of weight molecular a had protein TFG-MET-HA overexpressed PTPRZ1-MET-HA; overexpressed or MET (wild-type) endogenous represent kDA 140 at Proteins indicated. where h 0.5 with treated were Cells immunoblot. by proteins indicated of abundance the We measured cells. HEK293 in expressed were MET wild-type or PTPRZ1-MET) or (TFG-MET fusions MET tagged MET. ( full-length contain proteins fusion PTPRZ1-MET whereas domain, kinase the only maintain CLIP2-MET and TFG-MET activation. MET for crucial are (Y1234/Y1235) 1235 and 1234 Tyrosines ligases. ubiquitin recruiting by MET regulates negatively (Y1003) 1003 Tyrosine (CT). domain carboxy-terminal the and (KD) domain kinase the (JM), domain juxtamembrane the (TM), domain transmembrane the (ED), domain extracellular the of composed is precursor polypeptide MET The glioblastomas. pediatric in identified proteins fusion and 2 Figure b a (ICGC_GBM71 (ICGC_GBM 1,704 aa PTPRZ (INF_51_XT1) 1,436 aa PTPRZ (ICGC_GBM 1,41 PTPRZ (ICGC_GBM41 1,235 aa CLIP2 (ICGC_GBM1) 57 TFG chr 1 MET 390 aa As a result of the rapid growth of RCAS-driven tumors and the lack of 4 aa GFP .7 4 aa –MET DMSO –MET MET-HA 1 1 1 –MET –MET –MET

Oncogenic MET fusions. ( fusions. MET Oncogenic

PTPRZ1-MET-HA 15 11 ) ) ) ) µ TFG-MET-HA M), SGX523 (1 (1 SGX523 M), GFP Fo

MET-HA r etini PTPRZ1 (chr PTPRZ1 (chr PTPRZ1 (chr

PTPRZ1-MET-HA b

TFG-MET-HA Ex Ex µ G pERK1/2 HA (65) pMET (65) MET (65) HA (1 pMET (1 MET (1 Ex on 1–8 on 1–2 M) or crizotinib (1 (1 crizotinib or M) APDH on Fig. 3 Fig. .7) .7) .7) a 40) 1 ) Schematics of wild-type MET MET wild-type of Schematics ) 40) 40) Ex MET (chr Ex MET (chr Ex MET (chr c ED on 1–21 on 1–21 on 1–21 ). A contribution of off-target of off-target A ). contribution 2 CLIP2 (chr 1 c c and our own unpublished unpublished own our and TFG (chr ) MET-fusion-overexpressing MET-fusion-overexpressing ) Ex Ex GFP_DMSO .7) .7) .7) on 1–1 TM on 1–4 TFG-MET DMSO Y1 .7) .3) µ JM 003 2 µ M) for 24 h. 24 for M)

M foretinib for 24 24 for foretinib M Foretinib Ex MET (chr Ex MET (chr s r e t t e l on 1 on 1 SGX523 -HA KD 5–21 5–21 Crizotinib Y1 .7) .7) 234/Y1 G pERK1/2 pMET (65) HA (65) b APDH ) HA- ) 235 CT

© 2016 Nature America, Inc. All rights reserved. in in ( 5 mm. represent bars Scale a week. once performed was imaging bioluminescence Intravital surgery. ( foretinib mg/kg 60 with treated were Mice a week. once imaging bioluminescence intravital ( foretinib with ( ( foretinib mg/kg 60 with treated and mice SCID C.B-17 adult of striatum the into implanted were cells tumor RCAS-TFG-MET Ntv-a; in TFG-MET of overexpression by induced a tumor (Ntva; Cdkn2a-null ( 1 mm. represents bar Scale shown. is virus RCAS-TFG-MET-HA with inoculation after 2 weeks Ntv-a; neonatal of hemisphere cerebral the into particles 3 Figure inhibition 6–8- of striatum week-old the immunocompromised mice to into assess pharmacological MET allografted were that cells tumor mouse s r e t t e l control. a loading as shown is RAB11 (T202/Y204). ERK phosphorylated detecting antibodies with experiment independent n

= 10) every other day starting 1 week after surgery. Kaplan–Meier analysis of survival revealed a significant survival benefit for animals treated treated animals for benefit survival a significant revealed survival of analysis Kaplan–Meier surgery. after 1 week starting day other every = 10) e c a d ( Fraction survival P 0.5 1. < 0.0001). ( < 0.0001). 0 0

MET fusion animal model and preclinical testing of a MET inhibitor. ( inhibitor. a MET of testing preclinical and model animal fusion MET 0 P in vivo in < 0.000 H&E H&E P < 0.0001). ( < 0.0001). 1 V Fo Cdkn2a . We split the mice into two groups with similar similar with groups two into mice the split We . g ehicle ) Immunoblot analysis of protein extracts from SJ-G2 xenografts of a foretinib-treated and an untreated (vehicle) mouse from an from mouse (vehicle) untreated an and a foretinib-treated of xenografts SJ-G2 from extracts protein of analysis ) Immunoblot 5 r etini b −/− T e ime (d) Tr ; ; ) C.B-17 SCID animals were transplanted with luciferase-labeled CLIP2-MET-expressing SJ-G2 cells and subjected to subjected and cells SJ-G2 CLIP2-MET-expressing luciferase-labeled with transplanted were animals SCID ) C.B-17 Pten eatment b 10

pMET Fraction survival 0.5 HA 1. fl/fl 0 0 0 ) and p53-null (Ntv-a; (Ntv-a; p53-null ) and 15 20 Ntv Ntv Ntv 40 pER Gf 20 -a; -a; -a T Cdkn2 Cdkn2a ap ime (d)

Tr Cdkn2a K p53 Trp53 60 –/– −/− f −/− –/–

; ; Fraction survival ;

−/−

; ; Pt

0.5

Pten 1.

S-TFG-MET CA R -HA ( -HA ) en Pt ; Cdkn2a -a; Pten Ntv

0 0 en

) mice inoculated with RCAS-TFG-MET ( RCAS-TFG-MET with inoculated ) mice fl/fl –/– fl/fl 5 0 80 fl/fl P fl/fl < 0.000 animals. MRI imaging (T1 RARE) of an Ntv-a; Ntv-a; an of RARE) (T1 imaging MRI animals. animals. Scale bars represent 100 100 represent bars Scale animals. 1 d on/1 d off treatment regimen. Foretinib treatment significantly treatment Foretinib regimen. treatment off d on/1 d 1 subsequently subjected them to a 60 mg per kg foretinib versus vehicle distributions of luminescence intensity 1 week after transplantation and a 10 ) We injected 10 ) We injected 1 V Fo 0 ehicle r etini 10 b e Foretinib Vehicle Tr eatment 10 T n ime (d) = 7) or vehicle ( vehicle or = 7) 15 advance online publication online advance b 15 ) Kaplan–Meier survival analysis of wild-type (Ntv-a), (Ntv-a), wild-type of analysis survival ) Kaplan–Meier 5 Sur DF-1 cells producing RCAS-TFG-MET-HA viral viral RCAS-TFG-MET-HA producing cells DF-1 viv 20 20 f al (d) ) Kaplan–Meier analysis of the mice described described mice the of analysis ) Kaplan–Meier 25 25 P n 30 = 0.0001). ( = 0.0001). = 7) every other day starting 7 d after 7 d after starting day other every = 7) µ m. ( m. Da y 7 d 30 ) Luciferase-labeled murine murine ) Luciferase-labeled Da Cdkn2a y 1 g c ) Histologic analysis of analysis ) Histologic n 4 SJ-G2 x = 10) or vehicle vehicle or = 10)

V Da −/− ehicle y 21 nature medicine nature ; ; Pten enogra Da C ounts fl/fl Fo y 28 ft r s etini 1,000 2,000 3,000 4,000 5,000 6,000 7 animal animal ,000 b RAB1 pER K 1

© 2016 Nature America, Inc. All rights reserved. a partial response at the site of the main lesion was observed (arrows). New lesions also developed during the course of treatment (arrowheads). Scale Scale (arrowheads). treatment of course the during developed also lesions New (arrows). observed was lesion main the of site the at response a partial mg/m 2 × 280 to (equivalent mg/d 2 × 250 at orally administered was Crizotinib treatment. of initiation after points time indicated at and baseline at INF_51_XT1 100 represent bars Scale INF_51_XT1. patient in (bottom) glioblastoma pediatric PTPRZ1-MET-expressing the and (top) medulloblastoma primary the of (Y1234/Y1235) (pMET) MET phosphorylated 4 Figure concomitant with lesion primary the of response partial a revealed initiation treatment after 2 months evaluation (MRI) imaging nance tumor of regression a inhibitor with activity against MET), which has been shown to induce kinase Administration–approved Drug and Food (a crizotinib with ( glioblastoma) bellar glioblastoma (that is, most likely a radiation-induced secondary lar and review indicated histological that this lesion was in fact a cere PTPRZ1 a of presence the revealed This (INF_51_XT1). medulloblastoma 3 from an 8-year-old male patient treated 3 years previously for a lesion group recurrent a on performed were sequencing RNA and tation) (for copy whole-genome number anno low-coverage Whole-exome, oncology personalized INFORM the program of phase pilot the in cation ( reduced was cating that target inhibition was and successful downstream signaling phosphorylation in tumor tissue of the foretinib-treated animals, indi 26 d; 17 vehicle, d; foretinib, survival: had (median died animals untreated the of seven of six whereas treatment, 2-week the of end the at alive still were animals foretinib-treated All treatment. under decreased lumines or the stagnated animals in cence signal, signal in foretinib-treated even increase clear a showed animals vehicle-treated the of ( imaging bioluminescence intravital by week a once monitored was growth Tumor mice. immunocompromised MET the harbor endogenously that cells SJ-G2 luciferase-labeled Fig. 6g decelerated MET-fusion-driven tumor growth ( nature medicine nature 5 cm. represent bars a Finally, we were able to translate these findings into clinical appli clinical into findings these translate to able Finally, were we using model xenograft a established we results, our confirm To Hematoxylin andeosin fusion, which we transplanted intracranially into C.B-17 SCID SCID C.B-17 into intracranially transplanted we which fusion, P ), leading to prolonged overall survival ( = 0.0001; = 0.0001;

- Translation of MET inhibitor treatment into a clinical setting. ( setting. a clinical into treatment inhibitor MET of Translation 2 MET 2 (German Clinical Trials Register ID: ID: Register Trials Clinical (German 2 Fig. 3 Fig. fusion in the recurrent tumor, and subsequent molecu , published recommended phase II dose II phase recommended , published Fig. 4 Fig. Fig. 3 Fig.

g advance online publication online advance ). a MET ). On this basis, the patient received treatment treatment received patient the basis, ). On this f ). ). Western ERK showed reduced blot analysis -amplified glioblastoma -amplified GFAP P < 0.0001; Fig. 3 µ Fig. 3 Fig. m. ( m. d 2 DRKS0000762 3 b 3 ). pMET 3 ) All images represent axial T1-weighted MRI scans with contrast enhancement of patient patient of enhancement contrast with scans MRI T1-weighted axial represent images ) All . Magnetic . reso Magnetic e

) for 11 weeks, with a pause from days 13 to 16. Marked tumor shrinkage corresponding to corresponding shrinkage tumor Marked 16. to 13 days from a pause with weeks, 11 ) for Supplementary ). Although all all Although ).

CLIP2

PTPRZ1-MET-positve glioblastoma PTPRZ1-MET-positve Medulloblastoma 3 a ) Immunohistochemical staining for hematoxylin and eosin, GFAP and eosin, and hematoxylin for staining ) Immunohistochemical ). ). ------b A recent screen of data of the Cancer Genome Atlas interrogating interrogating multiple tumor Atlas types ( Genome Cancer the of data of screen recent A that was originally identified in mutagen-treated osteosarcoma cells lation downregu of forms MET,normal active escape which constitutively cytosolic, represent however, versions, truncated amino-terminally the by driven MET full-length of expression high extremely on rely to seems which fusion, this of character ing in situ clonality of the distinct ICGC_GBM71, representing two lesions from one patient, suggest that 10% of cases. Notably, the structural alterations in ICGC_GBM11 and tumors tomas, glioblastomas and sarcomas carcinomas, system, hematopoietic of the cancer including malignancies, human mechanism. resistance the studying for available was ( patient the of death ultimately the in lesions resulted those of progression Rapid observed. also were lesions of relief However,treatment-resistant new symptoms. several a small number of of number small a mice, but not in wild-type animals. wild-type in not but mice, or Trp53-deficient in tumors Cdkn2a- brain glial aggressive induced cells progenitor neural in TFG-MET of overexpression Accordingly, of har mutations fusion bored MET a bearing glioblastomas pediatric seven All tion. regula cycle cell affecting lesions genetic additional on dependent entities. tumor across role broader a have may breast, lung and thyroid cancer, that suggesting Oncogenic activation of MET signaling is found in numerous numerous in found is signaling MET of activation Oncogenic Our data suggest that MET-fusion-induced tumorigenesis is is tumorigenesis MET-fusion-induced that suggest data Our 2 hybridization data, further underlines the likely tumor-initiat underlines data, further hybridization Baseline 7 10 MET . The latter are analogous to the oncogenic oncogenic the to analogous are latter The . PTPRZ1 , 2 6 , , whereas we found that gene amplification has been described in about 3–7% of in 3–7% about described has been amplification gene PTPRZ1 - MET MET TP53 htt fusions arose separately in each tumor. High tumor.High each in separately arose fusions - fusions, including one one including fusions, MET Crizotinib (8.5weeks) p://54.84.12.177/PanCanFusV2 or deletions of of deletions or fusion, as indicated by our fluorescence MET Fig. 4 Fig. fusions were present in up to 24 CDKN2A , 2 b 5 PTPRZ1 ). No autopsy material material autopsy No ). . In pediatric glioblas pediatric In . MET TFG Crizotinib (11weeks) TPR rearrangements rearrangements - s r e t t e l and and MET promoter. The - / MET ) 2 fusion, in in fusion, CDKN2B 9 revealed fusion fusion 2 8 - - - - - . . © 2016 Nature America, Inc. All rights reserved. S.B., J. Gronych, H.-J.W., E.P., F.W., S. Halbach, D. Sturm, L.B., A.M. Stütz, K.S., 00064203 (University Hospital Motol, Prague, Czech Republic). of Health, Czech Republic) for conceptual development of research organization Research Centre at The Royal Marsden and the ICR as well as the project (Ministry Scholarship. The authors acknowledge NHS funding to the NIHR Biomedical Foundation. J. Gronych was supported by a Dr. Mildred Scheel Foundation (NCATS), US National Institutes of Health, and grants from the Making Headway TR000038 from the National Center for the Advancement of Translational Science from the National Cancer Institute, US National Institutes of Health, UL 1 Center, supported in part by the Cancer Center Support Grant, P30 CA16087 Langone Human Specimen Resource Center, Laura and Isaac Perlmutter Cancer grant the EDMLA2983/2-1), and the Lemos Foundations, the New York University Center grant(PCCC, number HA-305), the German Research Foundation (DFG, grant ESGI #262055), the Helmholtz Alliance Preclinical Comprehensive Cancer Max Planck(Munich, Society Germany), the European Union (FP7/2007-2013, (DKFZ-HIPO), the German Cancer Consortium (DKTK, INFORM project), the German Cancer Research Center–Heidelberg Center for Personalized Oncology #031A425A and CancerTelSys Additional#01ZX1302). support came from the NGFNplus#0315416C, #01GS0883 and e:Med Joint Research Projects SYS-GLIO of Ministry Education and Research (BMBF, grants MedSys#01KU1201A, Consortium, funded by German Cancer Aid (109252) and by the German Federal by the PedBrain Tumor Project contributing to the International Cancer Genome (Fred Hutchinson Cancer Research Center). This work was principally supported Amsterdam). Ntv-a; (NCT,Diseases Heidelberg), and the Department of Oncogenomics (University of (MPIMG) Genetics in the Berlin, tissue bank of the National Center for Tumor Kovacsovics and V. Amstislavskiy from the Max Planck Institute for Molecular from the NCT Heidelberg, S. Thamm, D. Balzereit, S. Dökel, M. Linser, A. S. Rüffer and T. Giese from the Heidelberg University Hospital, M. Rabenstein Bioinformatics, DKFZ), C. Jäger-Schmidt (Data Management Group, DKFZ), Theoretical Bioinformatics, DKFZ), M. Bieg and M. (Division Schlesner of Applied Core Facility, the DKFZ Center for Preclinical Research, R. Kabbe (Division of Xanthopoulos, D. Sohn and N. Mack, the DKFZ Genomics and Proteomics For technical support andwe thank expertise, A. Wittmann, L. Sieber, C. online ve Note: Any Supplementary Information and Source Data files are available in the number accession the ac.uk/ega available at the European Genome-phenome Archive ( codes. Accession the t of version in available are references associated any and Methods M trials. clinical glioblastoma pediatric in future of inhibitors MET analysis systematic for the nale therapy. strong ratio provide data also Our personalized for optimal basis a as patients cancer for diagnosis molecular individualized of tumorigenesis in pediatric glioblastoma and underline the importance gliomas pontine intrinsic in of diffuse inhibition multiple RTKs, as described recently cancers numerous of treatment the in well-known challenge a is inhibition MET to resistance acquired that Given outcome. a to fatal led ultimately monotherapy crizotinib under idly of tumor.the primary Unfortunately, rapnew lesions that developed of relief a symptoms to over a period leading of 2 inhibitor, months and MET substantial a volume reduction with glioblastoma pediatric a with child a treating by application into translated clinical was MET immediately inhibition macological s r e t t e l B.R., D.M., S. Heiland, C.v.K., S.S., S.W., J.F., T.B. performed and/or coordinated AUTHOR CONTRIBUTIONS A

cknowledgments et In conclusion, our results highlight a new recurrent mechanism of mechanism a recurrent new highlight our results In conclusion, phar data, xenograft and allograft preclinical our of basis the On hods rsion of the pape / ), hosted by the European Bioinformatics Institute under under Institute Bioinformatics European the by hosted ), he pape he 3 Cdkn2a 2 Short-read sequencing and methylation data are are data methylation and sequencing Short-read , might represent a promising therapeutic option. therapeutic promising a represent might , r . r . EGAS0 −/− ; ; Pten 000100113 fl/fl mice were kindly provided by E. Holland PTPRZ1 9 . - MET 30 , 3 1 , combinatorial combinatorial , http://www. fusion-driven fusion-driven online online ebi. - - 6. 26. 25. 24. 23. 22. 21. 20. 19. 18. 17. 16. 8. 7. 5. 4. 3. 2. 1. reprints/index.htm at online available is information permissions and Reprints The authors declare no competing interests.financial provided project leadership. U.D.W., J.O.K., B.B.,G.R., H.L., T.B., M.-L.Y.,R.E., S.M.P., P.L. and D.T.W.J.D.T.W.J. prepared the initial manuscript and figures. S.B., J. Gronych, patient materials. S.B., J. Gronych, H.-J.W., B. Hutter, S.M.P., P.L. and D.H.-B.B., S.T., H.-K.N., D.Z., J.C.A., dataN.G.G. collected and provided D. Sumerauer, M.A.K., C.J., C.H.-M., A.K., J. Grill, N.T., C.M.v.T., B.C.W., analysis. A.E.K., M.R., A.U., O.W., A.v.D., D.C., N.J., A.M. Sehested, T.Z., B. Huang, I.B.,M.R., M.H., T.R., M.Z., C.P., C.L., B.C.W. performed data the work.experimental S.B., J. Gronych, H.-J.W., B. Hutter, S.G., V.H., M.K., P.A.N., 15. 14. 13. 12. 11. 10. 9. COMPETING FINANCIAL INTERESTS FINANCIAL COMPETING

Sturm, D. Sturm, isSnaaa D. Dias-Santagata, A. Korshunov, cwrznrbr J. Schwartzentruber, G. Wu, D.N. Louis, Jones, C. & Baker, S.J. Unique genetic and epigenetic mechanisms driving pediatric D. Sturm, Weber, R.G. and biological subgroups of glioblastoma. of subgroups biological and glioblastoma. pediatric (2012). in genes remodeling chromatin glioblastomas. (2012). non-brainstem and gliomas pontine Revised glioma. high-grade diffuse emerge. Oncogene CDKN2B deletion and low TSC1 mRNA expression in pleomorphic xanthoastrocytomas. implications. therapeutic and diagnostic xanthoastrocytoma: Neuropathol. markers. prognostic molecular associated with tumors favorable biologically of (2011). rna, C.W. Brennan, in TargetingMET G. Woude, Vande & C. W.,Birchmeier,Birchmeier, E., Gherardi, VandeWoude,G.F.& Birchmeier,metastasis, W.,Birchmeier,E. C., Met, Gherardi, A.S. Chi, B.C. Worst, kinase BRAF The J.P. Robinson, & S.L. Holmen, A.H., Grossmann, C.H., Shin, Laser-Azogui, A., Diamant-Levi, T., Israeli, S., Roytman, Y. & Tsarfaty, I. Met-induced A.C. Navis, Z.S. Bao, L. Hernández, A. Greco, hin A. Shlien, P.J. Stephens, D. Singh, J. Zhang, D.T.Jones, Wu, G. 462–477 (2013). 462–477 progress. and rationale cancer: more. and motility transition amesenchymal-epithelial inhibitor. with glioblastoma recurrent MET-amplified (2016). study. pilot INFORM patients—The cancer pediatric vivo. in gliomas (2015). of development the promotes domain (2014). invasion. 1788–1798 and motility cell amoeboid to leads blebbing membrane (2015). protein. intracellular auto-active an in resulting glioblastomas. secondary (2014). in transcript fusion Blood translocations. TFG-ALK different structurally two producing lymphoma cell large domain. coiled-coil potential a has product whose 3 chromosome on gene novel a involves (2015). 257–262 repair genes result in rapid onset of ultra-hypermutated cancers. ultra-hypermutated of onset rapid in result genes repair development. cancer during event catastrophic glioblastoma. gliomas. low-grade astrocytoma. glioma. high-grade non-brainstem

94 et al. 4th edn. (IARC, 2016). (IARC, edn. 4th Nat. Rev. Cancer Rev. Nat. Mol. Cell. Biol. Cell. Mol. t al. et , 3265–3268 (1999). 3265–3268 ,

J. Clin. Oncol. Clin. J. et al. et et al. et et al. et 26 et al. et et al. et t al. et t al. et t al. et et al. et The genomic landscape of diffuse intrinsic pontine glioma and pediatric et al. t al. et

t al. et , 1088–1097 (2007). 1088–1097 , Nat. Genet. Nat. 129 Science et al. et l Whole-genome sequencing identifies genetic alterations in pediatric in alterations genetic identifies sequencing Whole-genome et al. et oai hsoe 3 leain i pdarc ifs intrinsic diffuse pediatric in alterations H3 histone Somatic Rapid radiographic and clinical improvement after treatment of a of treatment after improvement clinical and radiographic Rapid RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET recurrent novel, a revealed gliomas 272 of RNA-seq . t al. et t al. et advance online publication online advance Hotspot mutations in mutations Hotspot Pediatric and adult glioblastoma: multiform (epi)genomic culprits (epi)genomic multiform glioblastoma: adult and Pediatric obnd eeiay n smtc uain o rpiain error replication of mutations somatic and hereditary Combined h DA eragmn ta gnrts h TKT oncogene TRK-T3 the generates that rearrangement DNA The t al. et Recurrent somatic alterations of FGFR1 and NTRK2 in pilocytic in NTRK2 and FGFR1 of alterations somatic Recurrent Frequent loss of chromosome 9, homozygous CDKN2A/p14(ARF)/ , 669–678 (2015). 669–678 , rnfrig uin o FF ad AC ee i human in genes TACC and FGFR of fusions Transforming

Identification of a novel MET mutation in high-grade glioma inhigh-grade MET mutation anovel of Identification WHO Classification of Tumors of the Central Nervous System, Nervous the Central of Tumors of Classification WHO Nat. Rev. Mol. Cell Biol. Cell Mol. Rev. Nat. Nat. Genet. Nat. Integrated analysis of pediatric glioblastoma reveals a subset a reveals glioblastoma pediatric of analysis Integrated t al. et TRK-fused gene (TFG) is a new partner of ALK in anaplastic in ALK of partner new a is (TFG) gene TRK-fused h smtc eoi lnsae f glioblastoma. of landscape genomic somatic The

etgnrto proaie mdcn fr high-risk for medicine personalised Next-generation 337 asv gnmc eragmn aqie i a single a in acquired rearrangement genomic Massive

t al. et 15

RF 60 mttos r cmo i pleomorphic in common are mutations V600E BRAF 45 14 , 1231–1235 (2012). 1231–1235 , Nat. Rev. Cancer Rev. Nat. , 6118–6127 (1995). 6118–6127 , , e30–e33 (2012). e30–e33 , , 927–932 (2013). 927–932 , , 92–107 (2014). 92–107 ,

Nat. Rev. Cancer Rev. Nat. 45 rvr uain i hsoe 33 and H3.3 histone in mutations Driver Nat. Genet. Nat. , 602–612 (2013). 602–612 , H3F3A Cancer Cell Cancer

14 4 and

, 915–925 (2003). 915–925 , 46 , 651–661 (2014). 651–661 , Cell Acta Neuropathol. Acta

eoe Res. Genome 12 , 444–450 (2014). 444–450 , IDH1

, 89–103 (2012). 89–103 , 144

u. . Cancer J. Eur. a. Genet. Nat. 22

define distinct epigenetic distinct define , 27–40 (2011). 27–40 , , 425–437 (2012). 425–437 , http://www.nature.c ee Cancer Genes nature medicine nature Nature PLoS One PLoS

Nat. Genet. Nat.

482 130

1765–1773 , 44 Oncogene

251–253 , 226–231 , , 131–144 , 6

91–101 , Cell , e17948 , 6 9–18 ,

155

Acta

om/ 33 47 , , ,

© 2016 Nature America, Inc. All rights reserved. ( authors contributed equally to this work. and Molecular (IPMB), Biotechnology University of Heidelberg, Heidelberg, Germany. University of Freiburg, Freiburg, Germany. 35 Western Australia, Perth, Western Australia, Australia. of Pediatric Oncology and Haematology, Princess Margaret Hospital for Children, Perth, Western Australia, Australia. New York University School of Medicine, New York, USA. University of Hong Kong, Hong Kong, China. 27 Denmark. the McGill University Health Center Research Institute, Montreal, Quebec, Canada. McGill University and the McGill University Health Center Research Institute, Montreal, Quebec, Canada. Villejuif, France. Germany. Neuropathology, University of Heidelberg, Heidelberg, Germany. Hospital, Heidelberg, Germany. 16 Heidelberg University Hospital, Heidelberg, Germany. German Cancer Research Center (DKFZ), Heidelberg, Germany. Cancer Research, Sutton, UK. 9 Institute, Neurosurgical Moscow, Russia. Germany. Germany. Immunology, Heidelberg University Hospital, Heidelberg, Germany. 1 30. 29. 28. 27. nature medicine nature [email protected] Centre Centre for Biological Signalling Studies (BIOSS), University of Freiburg, Freiburg, Germany. Division of Pediatric Neuro-oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany. Department Department of Neuropathology, Düsseldorf, Düsseldorf, Germany.Heinrich-Heine-University Department of Cytogenetics and Reproductive Biology, Farhat Hached Hospital, Sousse, Tunisia. Genomics and Proteomics Core Facility, German Cancer Research Center (DKFZ), Heidelberg, Germany.

Diamond,J.R. K. Yoshihara, Cooper,C.S. H.H. Mak, inMET-mutated papillary renal cell carcinoma. fusions. transcript line. cell human transformed pathway. degradative endocytic the from Oncogene exclusion involves Tpr-Met, protein, 21 6 4 26 Division Division of Applied German Bioinformatics, Cancer Research Center (DKFZ), Heidelberg, Germany. Division of Molecular Genetics, German Cancer Research Center (DKFZ), Heidelberg, Germany. Unité Unité Mixte de Recherche du Centre National de la Recherche Scientifique (CNRS) 8203, Laboratoire de Vectorologie et Anticancéreuses, Thérapeutiques Department Department of Pediatric Hematology and Oncology, 2nd Faculty of Medicine, Charles University and University Hospital Motol, Prague, Czech Republic.

26 t al. et et al. et , 7213–7221 (2007). 7213–7221 , et al. et 22 etal. Department Department of Pediatric and Adolescent Oncology, Institut Gustave Roussy, Université Paris Sud, Villejuif, France. noei atvto o te e rcpo trsn kns fusion kinase tyrosine receptor Met the of activation Oncogenic Molecular cloning of a new transforming gene from a chemically a from gene transforming new a of cloning Molecular ) ) or P.L. ( Initial clinical sensitivity andacquired resistance toMET inhibition Oncogene The landscape and therapeutic relevance of cancer-associated of relevance therapeutic and landscape The advance online publication online advance [email protected] 11

34 18 Nature European European Molecular Biology Laboratory (EMBL), Genome Biology Unit, Heidelberg, Germany. Clinical Clinical Cooperation Unit Pediatric Oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany. , 4845–4854 (2015). 4845–4854 ,

311 41 8 Institute Institute of Molecular Medicine and Cell Research (IMMZ), Faculty of Medicine, University of Freiburg, Freiburg, Germany. 37 These These authors jointly directed this work. should Correspondence be addressed to S.M.P. ( , 29–33 (1984). 29–33 , Deutsches Deutsches Konsortium für Translationale (DKTK), Krebsforschung Standort Freiburg, Germany. 29 J.Clin. Oncol. Department Department of Pathology, New York University School of Medicine, New York, USA. ). 15 34 Division Division of Translational Oncology, German Cancer Research Center (DKFZ), Heidelberg, Germany. School School of Pediatrics and Child Health, University of Western Australia, Perth, Western Australia, Australia. 31

31 Department Department of Pediatrics, New York University Langone Medical Center, New York, USA. , e254–e258, (2013).

13 20 National National Center for Tumor Diseases (NCT), Heidelberg, Germany. Clinical Clinical Cooperation Unit Neuropathology, German Cancer Research Center (DKFZ), Heidelberg, 3 German German Cancer Consortium (DKTK), German Cancer Research Center (DKFZ), Heidelberg, 25 33. 32. 31. Department Department of Pediatric Hematology and Oncology, Copenhagen, Rigshospitalet, 39 BioQuant BioQuant Center, University of Heidelberg, Heidelberg, Germany.

Mossé, Y.P. Truffaux,N. a, A.Z. Lai, 1 consortium study. consortium 1 phase Group Children’sOncology a lymphoma: large-cell anaplastic or tumors solid (2015). 953–964 glioma. pontine intrinsic diffuse of treatment the for cabozantinib (2014). eel a ehns o du rssac i gsrc cancer. gastric in resistance drug of mechanism a reveals 10 36 Divisions Divisions of Molecular Pathology and Cancer Institute Therapeutics, of Comprehensive Cancer Comprehensive Center Freiburg CCCF, Medical Center – 28 t al. et et al. et al. et Department Department of Anatomical and Cellular Pathology, Chinese 2 Department Department of Pediatric Oncology, Hematology and Safety and activity of crizotinib for pediatric patients with refractory Preclinical evaluation of dasatinib alone and in combination with combination in and alone dasatinib of evaluation Preclinical yai rpormig f inln uo mt inhibition met upon signaling of reprogramming Dynamic 24 17 5 Max Max Planck Institute for Molecular Genetics, Berlin, Department Department of Human Genetics, McGill University and Department Department of Neurosurgery, Heidelberg University Lancet Oncol. Lancet 7 Department Department of Neuropathology, NN Burdenko 33 Telethon Kids Institute, University of

14 , 472–480 (2013). 472–480 , 12 Division Division of Theoretical Bioinformatics, 30 14 [email protected] Department Department of Neurosurgery, Department Department of Neuroradiology, 23 Department Department of Pediatrics, 38 Institute Institute for Pharmacy 19 Department Department of c. Signal. Sci. s r e t t e l 32 ), ), D.T.W.J. Department Department Neuro-oncol. 40 These These

ra38 ,

17 ,

© 2016 Nature America, Inc. All rights reserved. downloaded from from downloaded 37.1, build (NCBI GRCh37 genome of human reference the 2 assembly phase genomes 1000 the to mapped were reads workflow, Genome Whole Cancer Mapping and analysis. MWG Operon). (Eurofins primer pmol 15 RT ng 30 of sequencing Sanger Capillary Research). (Zymo Kit Recovery DNA Gel Zymoclean the using purified and PCR products were separated and on visualized 2.5% TBE-agarose gel, excised RT- breakpoints. of transcript the and downstream upstream located primers using #E0803-02) RT-PCR (EURx Kit 1-Step dART the using amplified were transcripts fused and transcribed, reverse were RNAs total of vali ng 50 transcript dation, fusion For (v70). annotation gene Ensembl the of basis the on annotated were transcripts Fusion exons. fused on coverages RNA-seq of inspection and visual of artifacts common filtering after were retained events reference assembly using SOAPfuse fusion NCBI37/hg19 Gene human the to mapping read reads. RNA-seq by bp detected were events 51 × 2 with instrument 2000 HiSeq a on sequenced 1 from prepared µ were libraries paired-end Stranded (Agilent). instrument sequencing. RNA instruments. 2000 HiSeq Illumina with out carried was sequencing Deep excision. gel agarose using performed was selection and size device, of bp a size ~300 with Covaris (~1 DNA Genomic protocols. v2 Illumina sequencing. DNA content. cell tumor and histology confirm to review neuropathological to subjected were Tumor tissues guidelines. ICGC the to according obtained was Heidelberg) of Faculty Medical the of Committee (Ethics vote ethical an samples. tumor and Patient O nature medicine nature with Picard version tools ( The output was converted to sorted1,000 genomesBAM referencewith SAMtools sequence withand Gencode duplicates version 17 weretranscript marked annotations. COMMON = 1 flag. we discard SNVs and indels known from 1,000 genomes or with the dbSNP 141 coding gene or splice site. For defining potential somatic SNVs in the cell lines, then We nonsilentextracted coding SNVs, SNVs analysis. at splice sites and indels thatfurther fall into a for considered were indels and SNVs confidence phase 1 integrated calls 20101123 and COSMIC version 66. Only somatic, high by overlapping the genomic positions with dbSNP version 141, 1,000 genomes included is informationAdditional model. gene 19 version Gencode the with the control were not tolerated. in reads variant of presence and tumor the in counts variant low quality, very combinations of Platypus non-PASS filter flags, bad quality values, low genotype than 10%, and indels that have more than two of the remaining flags. badReads flag, In with alleleBias addition,or strandBias if the variant allele frequency is less a similar scoring scheme as for SNVs. In detail, we discard candidates with the PASS flag filter or custom pass for allowing filters low using variant frequency (control somatic are calls 0/0) fidence, genotype required to have Platypus the 0.7.4 (ref. 39) by providing the tumor and control BAM files. To be of high con previously previously described as frequency with parameter adjustments to allow ofcalling somatic variants with low allele bcftools and mpileup SAMtools on based pipeline detection Perl scripts. files. BAM per-lane the of merging during duplicates PCR mark to package biobambam The 0. -T option with e n g RNA using the Ribo-Zero Gold Kit (Epicentre). One library per lane was was lane per library One (Epicentre). Kit Gold Ribo-Zero the using RNA g NLINE MET NLINE c RNA-seq reads were mapped with STAR version 2.3.0e ANNOVAR with annotated are mutations All Short insertions and deletions (indels) were identified with Platypus version For detection of single nucleotide variants (SNVs), we used our in-house SNV High-level copy number gains were identified by read depth plots and custom e / p h a s e 1 1 2 . _ r e f e HODS r e RNA integrity was evaluated by using a Bioanalyzer 2100 2100 Bioanalyzer a using by evaluated was integrity RNA f Paired-end library preparation was conducted using using conducted was preparation library Paired-end n t p c e : / _ According to the ICGC The Cancer Genome Atlas Pan / a f h t s ttp://broadinstitute p s e . 1 m 0 Informed consent from all patients as well as as well as patients all from consent Informed b 0 0 l y g _ e 3 s 3 n 8 e 4 and heuristic filtering, also as described described as also filtering, heuristic and o and TopHat2-Fusion q m u e e n s – c . e PCR product was performed with with performed was product PCR e 3 b .github.io/picard ) ) using BWA µ 7 i was used to sort the output and and output the sort to used was . g) was fragmented to an insert insert an to fragmented was g) a c . u 4 k 0 version November 2014, 2014, November version / v o l 4 1 1 3 using an index of the / 6 3 f version 0.7.8 mem 0.7.8 version t 5 p . High-confidence / , version 1.90). / 3 t 6 e version 0.1.19 0.1.19 version c h n i c a l / r e f e r - - - correlation coefficient as the distance measure and average linkage ( linkage average and measure distance the as coefficient correlation > the data 1-Pearson (s.d. Samples were across using set probes 0.3). clustered methylated variably most 2,052 the selected we clustering, hierarchical vised described as DNAwere probes previously filtered methylation described glioblastomas pediatric previously reference 64 of data methylation DNA 450k Facility. In addition, Core Proteomics and Genomics DKFZ at the tions instruc manufacturer’s the to according BeadChip HumanMethylation450 ( samples ICGC_GBM ylation, profiling. methylation DNA previously their expression values. respective genes, as well as genes in high-level copy number gains, were assigned SAMtools.The with RNA BAMfile the in DNA position the variantof pileup and the total number of reads (in millions) counted in total by coverageBed. per gene, and then divided by the combined length of its exon units coverageBed from the BEDtools package (in kilobases) with units exon all for counted were zero above quality mapping with reads merged into nonredundant exon units with a custom Perl script. Nonduplicate were variants transcript all from exons annotated overlapping gene, each For of exon model per million reads (RPKM). As the gene model, RefSeq was used. HA-tagged TFG-MET, this cDNA was amplified from pLVX/TFG–MET-puro previously described of NHAs. Transduction DMEM medium was 24 replaced h. every DMSO-containing or Foretinib- period. time indicated the after instructions 96-well cell transformation assay (Cell Biolabs) according to the manufacturer’s age-independent growth of SG-G2 cells was determined by using the CytoSelect instructions using a Mithras LB 940 Microplate Reader. QuantificationGlo luminescence ofcell-viability anchor assay (Promega) according to the manufacturer and 5% CO replacing the drug-containing medium and incubated for another 24 h at 37 °C cated concentration of foretinib and temozolomide for an additional 24 h before at 37 °C and 5% CO (GIBCO) h in DMEM supplemented with 10% FCS (GIBCO) and penicillin/streptomycin cell lines were seeded in a 96-well format (opaque-walled) and incubated for 24 tion reagent (Mirus). ducing a HA tag. HEK293T cells were transfected using TransIT-LT1 transfec cloned from tumor cDNA into the pcDNA3.1 vector (Life Technologies) intro experiments. of initiation before mycoplasma for and genotype for checked were lines Cell replaced. was tors, stored at −20 °C. 3 h before cell cell harvest, culture medium, including inhibi mide (University Hospital Heidelberg) was Pharmacy dissolved in DMSO and temozolo and Chemicals) (Selleck Foretinib 80%. of confluency a reaching CO 5% and °C 37 at (GIBCO) penicillin/ streptomycin and (GIBCO) FCS 10% with supplemented Technologies) (Life Eagle’sDulbecco’s Modified glucose (DMEM) Medium in high were cultured stocks) long-term (authors’ cells glioblastoma SJ-G2 human and HEK293T vitro In signature Atlas previously described as performed was array expression Plus2.0 U133 Affymetrix the on studied samples tumor of Classification (NHAs). astrocytes human normal transduced vector empty ( and classification. profiling expression Gene ( linkage average and distance Methylation probes were reordered by using clustering Euclidean hierarchical t test: test: Chromothripsis was scored in accordance with the criteria outlined outlined criteria the with accordance in scored was Chromothripsis a generating by information RNA with annotated were indels and SNVs Expression levels were determined per gene and sample as reads per kilobase To determine the IC were TFG-MET or PTPRZ1-MET MET, wild-type of sequences Coding P < 0.01) were identified by comparing TFG-MET-overexpressing and TFG-MET-overexpressing by comparing were < identified 0.01) tde o MTfso-xrsig E23 ad JG cells. SJ-G2 and HEK293T MET-fusion-expressing of studies 4 6 3 2 , 16 normal brain samples as well as seven PXAs was included. included. was PXAs seven as well as samples brain normal 16 , . . . Cell viability was determined in triplicates by using the CellTiter- 4 4 . 4 5 50 . . To C-terminally vector encoding generate a pMIBerry of foretinib and temozolomide, pediatric glioblastoma The bicistronic retroviral vector pMIBerry has been been has pMIBerry vector retroviral bicistronic The 2 For genome-wide assessment of DNA meth DNA of assessment genome-wide For y . . Subsequently, werecells treated indi the with axis). n = 51) were analyzed using the Illumina Illumina the using analyzed were 51) = 6 4 using the 840 gene Cancer Genome Genome Cancer gene 840 the using 2 . . The read counts were summarized 2 Differentially expressed genes expressed Differentially . Cells were trypsinized upon upon trypsinized were Cells . doi: 10.1038/nm.4204 6 . . For unsuper x -axis). -axis). ′ s ------

© 2016 Nature America, Inc. All rights reserved. the number of animals required to get significant results. significant get to required animals of number the minimize to chosen were sizes Sample symptoms. tumor-related of presence the for daily monitored and DKFZ the of Research Preclinical for Center the in IVC caging in housed were Mice G-163/14). G-238/12, Tübingen; G-4/11, (Regierungspräsidium and approved council by regulations the regional legal studies. Animal microscopically. analyzed were nuclei interphase tumor, 200 For each probe. specific red) (RP11-95I20; MET and green) (RP11-207K20; PTPRZ1 a using cence Fluorescence website. manufacturer’s the on provided is antibodies all Validation of 1:10,000). Calbiochem; (CB1001; GAPDH and 1:1,000), pERK1/2 (4370; Cell 1:2,000) RAB11 Signaling; (5589; Cell 1:2,000) Signaling; Signaling; Cell (3077; pMET 1:1,000), Signaling; Cell (8198; MET 1:1,000), Signaling; Cell (3724; HA-tag applied: were antigens following the against Antibodies procedure. wet-blotting full a using membrane (PVDF) fluoride Gels polyvinylidene a to Precast transfer protein by followed Bis-Tris Technologies) NuPAGE(Life gradient 4–12% sam using protein of performed was Inhibitor separation ples Phosphatase Electrophoretic Halt Scientific). the (Thermo Cocktail including (Sigma-Aldrich) buffer RIPA blotting. Western the using objective oil 1.3 PlanNeoFluar software. 4.8 Rel 40× AxioVision a with taken were Images AxioCamMRm. connected a with 2 ApoTome plus microscope field bright Z1 Axio-observer ZEISS the with were imaged cells Stained turers’ protocols. manufac to according applied were (LifeTechnologies) Gold DAPI ProLong and Signaling)) 488 Alexa (Cell °C. Subsequently, (Phalloidin staining F-actin for solution 15 min at 4% with were paraformaldehyde 20–22 fixed then Cells h). (~72 subconfluency reaching until grown and Dickinson) (Becton slides Immunofluorescence. tion and monitored by flow cytometry. Infected cells were by autofluorescence identified dsRed2 their 48 h postinfec medium. Plat-E transfectantsastrocyte with indicated pMIG orthe pMIBerry from supernatants retroviral of dilution 1:1 a with incubated then were cells NHATAg-ecoR resulting The G418. mg/ml 2 with selected NHA/TAgswere 2 with transfected were cells mediated suppression of naturally senescence. Subsequently,occurring 2 × 10 vector pQCXIN/TAg (TAg)antigen T large expressionVirus 40 Simian the with infected were cells previously described as particles viral ecotropic with infection the for allows turn in which retroviruses, murine by used receptor tor kit (Lonza). This procedure allows for transient expression of the ecotropic 2 with transfected manufacturer. bythe 10 × 2 For immortalization, directed as (Lonza) medium astrocyte designated in grown were and Lonza) were derived from primary normal human astrocytes (NHA; lot lumber 5F1118; ral supernatants, have been described previously cDNA sequence. TFG-MET the confirmed sequencing Sanger pMIBerry. with XhoI and linearized and BamHI into subcloned XhoI/BamHI tocol supplied by the manufacturer. PCR amplicons were gel digested purified, AGGCATAGTCAGGCACGTCATAAGGATATG-3 AGCTAATC-3 5 METfwd XhoITFG– oligonucleotides the and (Finnzymes) polymerase Phusion using doi: The culture and transfection of Plat-E cells, as well as the generation of retrovi 10.1038/nm.4204 in in situ ′ - AATTCTCGAGATGAACGGACAGTTGGATCTAAGTGGGA - hybridization was performed on FFPE-embedded tissue sections sections tissue on was FFPE-embedded performed hybridization in situ in ′ and BamHITFG–METrev 5 BamHITFG–METrev and All animal experiments were conducted in accordance with with accordance in conducted were experiments animal All µ Protein extract of cell pellets were generated by using using by generated were pellets cell of extract Protein g of pQCXIN/ecoR and the ‘primary neurons’nucleofec‘primary the and pQCXIN/ecoR of g 4 hybridization (FISH). hybridization 5 . . Tag-expressing NHAs were positively selected by TAg- Infected NHA/TAg-ecoR cells were plated on chamber µ g of the plasmid pQCXIN/ecoR. Nucleofected pQCXIN/ecoR. plasmid the of g ′ -TTAAAGGATCCTCTAGACT Dual-color interphase fluores interphase Dual-color 4 5 . The immortalized astrocytes 6 NHAweretransiently cells ′ 4 using the standard pro standard the using 6 . 2 d later, d 2 nucleofected . 6 ------

starting at day 7 after surgery. Kaplan–Meier analysis was done using GraphPad Foretinib or vehicle was administered nonblinded by oral gavage every other day to treatment or control strata according to their luminescence signals. 60 mg/kg 5 mg/ml hydroxypropyl methylcellulose/0.05% SDS. Animals were randomized For the treatment studies, Foretinib was dissolved in DMSO and then diluted in IVIS100 or IVIS Lumina luminescence imager with an exposure time of 5 min. injected with 100 continuedwas analgesia Carprofen. with For wereanimals luciferaseimaging, tive Carprofen analgesia and were anesthetized with Isoflurane. Postsurgically, pre-emp received Animals respectively). JanvierLabs, or River Charles from obtained animals bregma; to relative ventr. mm 3 caud., mm 1 lat., mm 2.5 (coordinates SCID C.B-17 female 6–8-week-old of striatum the into planted FACS sorted. 500,000 SJ-G2 cells or 100,000 TFG-MET-RCAS cells were trans GFP-positivesubsequentlyandwere lentivirus cells pGF using luciferase with animals injected with RCAS-TFG-MET virus or SJ-G2 tumor cells were labeled Xenograft and preclinical studies. cerebral left syringe. the Hamilton a using into hemisphere cells virus-producing 100,000 with 0 day postnatal at Cdkn2a FuGene HD (Promega) according to the manufacturer’s protocol. Ntv-a, Ntv-a; using by transfection fibroblasts and chicken DF-1 in done was production Virus amplified sites. PCR restriction NotI and ClaI was using backbone RCASBP(A) fusion the into cloned TFG-MET HA-tagged the transfer, gene tumor model. RCAS-based 46. 45. 44. 43. 42. 41. 40. 39. 38. 37. 36. 35. 34. min. 5 = time acquisition total 1; = factor RARE 2; = NA mm, = 0.3/0.3 = thickness/gap × 0.1 = slice mm, 0.1 × 200 resolution 150, matrix ms, 1,000/6 = TR/TE follows: was as were parameters GmbH), MRI The acquired. Buchler Healthcare GE mmol/ml, (0.5 Omniscan of dilution 100 of injection intraperitoneal an after relaxation sequence, with enhancement) acquisition (rapid RARE T1-weighted slice 15 A coil. head CryoProbe the with Germany) Ettlingen, GmbH, BioSpin Bruker USR, 94/20 MRI. Prism, and statistical significance was calculated using a log–rank test.

iehrt A.E. Eisenhardt, M. Röring, R.G. Verhaak, cancer in chromothripsis of inference for Criteria P.J. Campbell, & J.O. forcomparing Korbel, of utilities suite flexible a BEDTools: I.M. Hall, & A.R. Quinlan, A. Dobin, genetic of annotation functional ANNOVAR: H. Hakonarson, & M. Li, K., Wang, Rimmer,A. D.T.Jones, Tischler, G. & Leonard, S. biobambam: tools for read pair collation based algorithms Burrows-Wheeler with alignment read short accurate and Fast R. Durbin, & H. Li, D. Kim, W.Jia, associated with pilocytic astrocytoma. pilocytic with associated signalling. B-Raf kinase-dead and V600E NF1. and EGFR IDH1, PDGFRA, in abnormalities by characterized glioblastoma of subtypes genomes. features. genomic (2013). 15–21 (2010). data. sequencing high-throughput from variants (2014). applications. sequencing clinical in variants calling for Nature files. BAM on transform. fusions. gene and deletions insertions, data. RNA-Seq end MRI was undertaken on a 9.4T horizontal bore NMR scanner (BioSpec (BioSpec scanner bore NMR on a horizontal 9.4T was undertaken MRI −/−

et al. et 488 ; ; et al. et Pten Cell Cancer Cell Cancer Bioinformatics t al. et , 100–105 (2012). 100–105 , t al. et et al. et et al. et SOAPfuse: an algorithm for identifying fusion transcripts from paired- from transcripts fusion identifying for algorithm an SOAPfuse:

TopHat2: accurate alignment of transcriptomes in the presence of presence the in transcriptomes of alignment accurate TopHat2: fl/fl Source Code Biol. Med. Biol. Code Source µ 152 t al. et l Luciferin solution (15 mg/ml, Promega) and imaged using an TR utaat nvra RAsq aligner. RNA-seq universal ultrafast STAR: Integrating mapping-, assembly- and haplotype-based approaches haplotype-based and assembly- mapping-, Integrating itnt eurmn fr n nat ie itrae n wild-type, in interface dimer intact an for requirement Distinct Dissecting the genomic complexity underlying medulloblastoma. underlying complexity genomic the Dissecting , Ntv-a; , Ntv-a; t al. et Bioinformatics , 1226–1236 (2013). 1226–1236 , Genome Biol. Genome Integrated genomic analysis identifies clinically relevant clinically identifies analysis genomic Integrated

17 ucinl hrceiain f BA isrin mutant insertion BRAF a of characterization Functional

, 98–110 (2010). 98–110 , 25 Trp53 For tumor induction using RCAS-based somatic somatic RCAS-based using For tumor induction , 1754–1760 (2009). 1754–1760 ,

−/− Cells derived from Ntv-a;

26 14 or or Ntv-a; or or Ntv-a; , 841–842 (2010). 841–842 , , R12 (2013). R12 ,

Int. J. Cancer J. Int. 9 Genome Biol. Genome , 13 (2014). 13 , EMBO J. EMBO Trp53 uli Ais Res. Acids Nucleic

129 14 , 2629–2647 (2012). 2629–2647 , Nat. Genet. Nat. , R36 (2013). R36 , −/− , 2297–2303 (2011). 2297–2303 , nature medicine nature pups were injected injected were pups Cdkn2a Bioinformatics

46 µ −/−

, 912–918 , l of a 1:10 1:10 a of l 38 ; Pten e164 ,

29 fl/fl - - ,