(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/006432 A2 9 January 2014 (09.01.2014) P O P C T

(51) International Patent Classification: Not classified AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (21) International Application Number: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/HU20 13/000057 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, (22) International Filing Date: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 10 June 2013 (10.06.2013) MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (25) Filing Language: English SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, (26) Publication Language: English TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every P1200395 2 July 2012 (02.07.2012) kind of regional protection available): ARIPO (BW, GH, 61/666,945 2 July 2012 (02.07.2012) GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, (71) Applicant: UD-GENOMED MEDICAL GENOMIC TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, TECHNOLOGIES KFT. [HU/HU]; Nagyerdei krt. 98., EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, H-4032 Debrecen (HU). MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, (72) Inventors: BALINT, Balint, Laszlo; Tolgyfa u. 26c, H- KM, ML, MR, NE, SN, TD, TG). 4028 Debrecen (HU). NAGY, Laszlo; Karoli Gaspar u. 436, H-4032 Debrecen (HU). KERESZTESSY, Zsolt; Declarations under Rule 4.17 : Horvath Arpad u. 25/3, H-4030 Debrecen (HU). ZA- — as to applicant's entitlement to apply for and be granted a HUCZKY, Gabor, Jozsef; Veres Peter u. 33., H-424 1 patent (Rule 4.1 7(H)) Bocskaikert (HU). — of inventorship (Rule 4.17(iv)) (74) Agent: DANUBIA PATENT AND LAW OFFICE LLC; Dr. SVINGOR Adam, Bajcsy-Zsilinszky lit 16., H-105 1 Published: Budapest (HU). — without international search report and to be republished (81) Designated States (unless otherwise indicated, for every upon receipt of that report (Rule 48.2(g)) kind of national protection available): AE, AG, AL, AM,

< o o (54) Title: CONTROL SYSTEM FOR IMMUNOPRECIPITATION STUDIES (57) Abstract: The, present invention provides for uses of a nanoparticle e.g. a virus or virion, preferably a bacteriophage, for providing control in an immunoprecipitation reaction with a recognition molecule, wherein an epitope peptide is displayed oh said naripparticle, e.g. by said virus or virion and recognized by said recognition molecule in the immunoprecipitation reaction. The nan- oparticle carries a nucleic acid comprising a sequence encoding said epitope. Preferably, the immunoprecipitation is chromatin im - munoprecipitation (ChIP). CONTROL SYSTEM FOR IMMUNOPRECIPITATIONSTUDIES

FIELD OF THE INVENTION The present invention provides for uses of a nanoparticle or a virus or virion, preferably a bacteriophage, for providing control in an immunoprecipitation reaction with a recognition molecule, wherein an epitope peptide is displayed on said nanoparticle or virus or virion and recognized by said recognition molecule in the immunoprecipitation reaction. The nanoparticle carries a nucleic acid comprising a sequence encoding said epitope. Preferably, the immunoprecipitation is chromatin immunoprecipitation (ChIP). BACKGROUND ART Immunoprecipitation (IP, and in analogy, co-immunoprecipitation, Co-IP) is a widespread method of purification of specific proteins (or co-purification of those with associated molecules in Co-IP) from complex samples including cell lysates or whole tissue extracts. Conventional IP protocols start with cell lysis or tissue homogenisation under denaturing (or non-denaturing) conditions for protein extraction, continued by sample pre-cleaning to exclude non-specific interactions. In- the binding step, capture of the antigen (e.g. specific protein) is carried out using Protein A or G conjugated to an insoluble resin, such as agarose or magnetic beads in the form of an antibody complex in solution. This is followed by precipitation of the complex by centrifugation or magnetic field. Detection of the antigen is then typically achieved by Western blotting using labelled specific antibody, or an unlabelled specific antibody together with a labelled secondary anti¬ immunoglobulin antibody (or via detection of the enzymatic activity of the specific protein). Any antibody based detection method, e.g. ELISA can be used, however, for analysis of the antigens. Chromatin immunoprecipitation (ChIP), a specific application of IP, is a method to study protein-DNA interactions, typically in-vivo interactions. The method is one of the most important functional genomic methods that had a significant impact on the development of the field of epigenetics. The sample used in ChIP is typically cell lysate. Upon sample preparation relatively small fractions of the chromatin of the cells are obtained having the chromatin associated protein binding to the chromatin DNA. Quite often the sample is fixed by using a crosslinker as fixative. In general, besides chromatin, any protein binding nucleic acid, either DNA or RNA can be studied based on the same principles. The purification step is carried out by using specific antibodies that recognize a specific epitope of a nucleic acid binding protein. Typically, the antibodies are bound to beads, e.g. beads covered by protein A or protein G or protein A G. With this method it is possible to purify (precipitate) complexes that contain specific nucleic acid fragments, preferably DNA fragments associated with the protein recognized by the antibody. Thus, in ChIP the output of the procedure is the purified nucleic acid. The researcher then analyzes the nucleic acid, e.g. DNA to identify the regions where the nucleic acid binding proteins bind. For example, the nucleic acid binding proteins are chromatin-associated proteins which bind to the chromatin in vivo and these regions are to be identified. The sample used in ChIP is typically cell lysate, wherein nucleic acid - protein complexes as well as protein - protein complexes are cross-linked with formaldehyde as fixative. Thus, a result of cross-linking is that protein complexes bound to the nucleic acid are held together. In a version of ChIP chromatin is sheared by sonication to obtain smaller fragments which can be analysed. In an other version of the method chromatin is digested by nucleases. In this latter version crosslinking is sometimes omitted (native ChIP). The isolated DNA or other nucleic acid should be ready for downstream analysis by methods such as PCR- or qPCR-based assays, or parallel DNA sequencing. Alternatively; protein based detection methods, applicable in traditional immunoprecipitation, e.g. ELISA are also available or can be used in parallel here. One of the big limitations of the method is the lack of standards and controls providing clear results for the procedure, This generates significant variability and makes it difficult to introduce the method in clinical research. Typically, the following types of controls have been used in the art so far: A) Negative controls, like i) a lysate of cells not containing the antigen, ii) immunoprecipitation with unrelated or non-immune antibody. B) Positive controls, like i) a lysate or homogenate comprising the antigen, ii) a purified antigen, iii) transgenic cells overexpressing the antigen. C) Additional controls for various purposes are also used in these methods. Such controls are e.g. i) IP-flow-through to check binding efficiency, ii) first washing step to control stringency, iii) post-elution bead boil to test elution efficiency. Where necessary, appropriate buffers (IP) buffers are used. A kind of positive control can be e.g. an aliquot taken from the chromatin before preclearing or antibody binding (input control). I the chromatin sample is obtained after crosslinking it is decrosslinked and DNA (or nucleic acid) is isolated. This nucleic acid (e.g. DNA) sample can be analysed. For example, if PCR is used for analysis, it should yield a PCR product with all primer sets used. Besides serving as a positive control, the data derived from the input sample can be used for data normalization [see e.g. Haring M. et a.. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization Plant Methods 2007, 3:11.].. A non-immunoprecipitated chromatin control (input control) is recommended as a reference control both in case of PCR analysis and DNA sequencing analysis of the chromatin. As a further kind of positive control, one may select an antibody that consistently binds chromatin-associated proteins under a wide variety of cellular conditions. Antibodies against heterochromatin markers, like H3- K9Me3 H3K4me3 (trimetylated Lys 9 and Lys 4 of histone H3) or markers which are associated with actively transcribed regions (like H3-K9Ac, ie. acetylated Lys 9 of H3 often associated the c-Fos gene [MAGnify™ Chromatin Immunoprecipitation System Catalog no: 49-2024, 27 January 201 1; McEwen KR and Ferguson- Smith AC "Distinguishing epigenetic marks of developmental and imprinting regulation", Epigenetics & Chromatin 20 10, 3:2]. The negative control can be a chromatin sample to which non-specific control serum is added instead of a specific antibody (no antibody or' oAb control sample, cf. e.g. Haring M. et al, 2007, infra). The negative control samples are treated the same way as the CMP samples. The QPCR signals resulting from the NoAb samples indicate the amount of background signal generated by the chromatin preparations and ChIP procedure. In case of NoAb samples theoretically the washing steps should remove non-specifically bound chromatin, resulting in an absence of signals for the NoAb samples. In an other approach, non specific antibodies, like Rabbit IgG and Mouse IgG antibodies can be used in a kit for use as negative controls to measure nonspecific binding. However, to the best o Inventors' knowledge, no epitope presenting system comprising particles presenting epitopes and having the encoding nucleic acid has been used in the art as a spike control in immunoprecipitation methods.

BRIEF.DESCRIPTION . OF THE INVENTION The present invention relates to the Use of a nanoparticle as a control or for providing control i an imrnUhpprecipitatibn reaction carried out with or utilizing a recognition molecule, said nanoparticle comprising a nucleic acid and a polypeptide carrying an epitope; wherein said nucleic acid comprises an oligonucleotide segment, wherein said epitope peptide is displayed o the surface of the nanoparticle and recognized by said recognition molecule in the immunoprecipitation/reaction. Preferably, according to the invention the nanoparticle is a virus or a virion, preferably a virion. The present invention also relates to the use of a virus or a corresponding virion as a control or for providing control in an immunoprecipitation reaction carried put with or Utilizing a recognition molecule, wherein the genetic material of the virus or virion comprises a oligonucleotide segment, wherein sai epitope peptide is displayed by the virion and recognized. by said recognition molecule in the immunoprecipitation reaction. Preferably, according to the invention the oligonucleotide segment is a traceable oligonucleotide segment or region or stretch.. Preferably, according to the invention the oligonucleotide in the microparticle or in the viral genome, e.g. said segment encodes said,epitope peptide. In a preferred embodiment the virus or virion is a bacteriophage. Preferably, the immunoprecipitation reaction according to the invention is nucleic acid immunoprecipitation, preferably direct nucleic acid immunoprecipitation or a nucleic acid —protein complex immunoprecipitation, preferably chromatin'immunoprecipitation. The invention also provides for an immunoprecipitation kit, said kit comprising a recognition molecule recognizing an antigen epitope for use in immunoprecipitation, a positive control nanoparticle, said nanoparticle comprising a nucleic acid and a polypeptide carrying an epitope, whereinthe nucleic acid comprises.an oligonucleotide segment which.is preferably traceable and/or encodes said.epitope peptide. In an alternative embodiment the kit comprises a .recognition molecule recognizing an antigen epitope for use .in immunoprecipitation and as a positive control virus or virion, preferably a bacteriophage, compri sing an oligonucleotide segment in its genome encoding an epitope peptide, wherein said epitope peptide is displayed by said bacteriophage and.recognized by said recognition molecule in.the immunoprecipitation reaction. . Preferably the kit is for use in nucleic acid immunoprecipitation, preferably ChlP. Preferably the kit is a part of or is for use together with a kit for nucleic acid immunoprecipitation^ preferably ChlP. The use of the kit according to. the invention in any type of immunoprecipitation disclosed or contemplated herein is also considered as the subject matter of the invention. Optionally the kit according to the invention comprises a negative- control nanoparticle,, virus and/or virion, preferably a bacteriophage, lacking said oligonucleotide and/or the epitope but preferably having; a nucleic acid and a polypeptide, preferably snowing non-specific binding to the recognition molecule means for detecting the binding of said recognition molecule to said antigen epitope, preferably means. for amplification of said positive control and optionally said negative.control, support or camerfor binding .said fec.o^ition molecule, preferably beads, a cross linking agent: Preferably, the.kit-comprises, as aimeans for amplification, pligonucreotide.primers, preferably - QPCR primers for amplification of a displayed epitope coding sequence, and/or - QPGR primers for amplificatioh of the bacteriophage sequence. Preferably, the kit comprises means for sequencing the nucleic acid or a fragment thereof the antigen or target protein is bound to. The kit may comprise a plate haying containers. The container may comprise elements of the kit- A sample container is used for the analysis of the sample of interest. A control container is used for a control experiment. In certain embodiments of the invention assample container and a control container may be identical. The-invention also relates to an immunoprecipitationimethod-said method comprising the steps of using.a nahoparticle as a positive control, said nanopart icle comprising a nucleic acid and a polypeptide carrying an epitope recognized by a recognition molecule i said immunoprecipitation reaction. Preferably positive control is an epitope presenting system, wherein the nucleic acid comprises an oligonucleotide segment encoding-said epitope peptide, more preferably- said positive control naiipparticle is a v rus or viri o even.mbre preferably a bacteri ophage. In .this preferred embodiment said epitppe peptide is displayed by the yirtis or virion arid is. recognized by said recognition molecule in the immunoprecipitation reaction. The invention also relates to aii immunoprecipitation method said method comprising the steps of using a naiippafticle as a negative control, said nanoparticle lacking the polypeptide carrying an epitope recognized by a recognition molecule in said irrlmunoprecjpitation reaction. Otherwise the negative control nanoparticle may be identical with or may have the same features as the positive-control nanoparticle. Preferably the positive control nanoparticle and/or the negative control nanoparticle is/are added to one or more samples from the set of samples in the experiment, i.e. is/are used as a spike control. The invention,also relates to an inmynpprecipitation .method said method comprising the steps .of - providing a set of samples, i.e. a multiplicity of samples or at least one sample comprising an antigen or a target protein carrying an epitope, - adding a.recognition molecule recpgmzing an.epitppe of said antigen (antigen epitope) to one or more samples from the set of samples, - adding a positive control nanoparticle, said nanoparticle comprising a nucleic acid and.a polypeptide carrying ' an epitope, wherein the nucleic acid comprises an oligonucleotide segment encoding said. epitope peptide, or alternatively adding a positive control virus or virion, preferably a bacteriophage to one or more samples from the set of Samples, wherein said positive control vihis or virion comprising an oligonucleotide' segment in its genome encoding an epitope peptide, wherein said epitope peptide is displayed by the virus or virion and is recognized by said recognition molecule in the immunoprecipitation reaction, - optionally adding to one or more samples from the set of samples a negative control nanoparticle, virus or virion, preferably bacteriophage lacking said oligonucleotide, - contacting or allowing to contact the control or any of the controls with the recognition molecule, and/or carrying out the irnmunopfecipifatipri reaction, - detecting the binding of the.refcpgnition molecule to the displayed epitope. Preferably the number of positive control nanoparticles, yifuses or virions and those bound to the recognition molecule are compared and considered as indicative of the immUhoprecipitation reaction, whereas a higher number bound to the recognition molecule indicates a better performed or higher quality of the immunoprecipitation reaction. In a preferred embodiment as a part of the detecting ste the nanoparticles, viruses or virions bound to the recognition molecule are recovered and the number of recovered nanoparticleSi viruses or virions is compared to those added previously. In a preferred embodiment immunoprecipitation is nucleic acid immunoprecipitation said method further comprising - fragmenting the nucleic acid and/or binding the antigen and thereby those fragments bound by the antigen to the recognition molecule, wherein preferably the recognition molecule is bound to a support or carrier. Preferrably fragmenting the nucleic acid is carried out by sonication and/or by a nucleic acid nuclease, preferably rriicrococcal nuclease. Preferably, the immonprecipitation is nucleic acid immunoprecipitation, preferably selected from chromatin immunoprecipitation (ChlP), DNA immunoprecipitation and RNA immunoprecipitation. In a preferred embodiment the nanoparticles, viruses or virions bound or recovered are analysed. Preferably, they are analysed by QPGR or sequencing, preferably as a part of the detection step. Preferably, the.detection of the-binding of the recognition molecule to the displayed epitope is carried out by - amplifying a region coding the displayed epitope from the nanoparticle, virus^ virion or preferably from the bacteriophage, and/or - adding the nucleic acid fragments bound by the antigen to a chip comprising a multiplicity of nucleic acid sequences wherein preferably at least one of them is complementary to a sequence of the nucleic acid, preferably to the sequence encoding the epitope region^ and/or - sequencing the nucleic- acid fragment bound by the antigen, and/or - an immunological method, e.g by-ah immunosorbent assay; e.g. by ELISA. Preferably the recognition molecule is in the form bound to a support or carrier. Optionally, the recognition molecule is bound to the support or carried before binding of the recognition molecule to the antigen or target protein or thereafter or in the same step, e g.,simultaneousry. Preferably binding of a recognition molecule to the antigen epitope or target protein is also detected. Preferably the recognition molecule binding to the target protein and to the positive control is identical. The invention also relates to a multiplicity of rianopafticles, viruses or virions comprising aft oligonucleotide segment- in their genome said segment encoding an epitope peptide of immunogenic portion of a nucleic acid binding protein, wherein.said epitope peptide or inimunogenic portion is-displayed by said virions, wherein the peptide or immunogenic portion is 7-20, preferably 8 to 8 amino acids long or 5 to 22 amino acids long, preferably at least 5, 6, 7 or amino acids and at most 10, 11, 12, 13, 14, 16, 18 or 20 amino acids long and -wherein said epitope peptide is capable of binding to a recognition .molecule bound to a carrier, preferably by protein A or protein G or any combination thereof bound to a-carrier: In .a preferred embodiment the nanoparticles, viruses or virions are essentially identical preferably except in that they differ only in the epitope or in the immunogenic portion and in the nucleic acid sequence encoding said epitopes.or portions. Preferably the nanoparticles, viruses or virions form a library. Preferably the library s enriched n several panning steps in members having epitppes or immunogenic portions specifically binding to a recognition molecule. The invention also relates to a use of a multiplicity of virions comprising an oligonucleotide segment in their genome said segment encoding an peptide, wherein said pepticie is displayed by said virions..

Preferably, the multiplicity of virions is used as a .control in an immunoprecipitation reaction. Preferably, the peptide is an epitope peptide or comprises an epitope or ari.iminunogenic portion. Preferably, The peptide, the epitope or the immunogenic portion is 5-20;, preferably 7 or 8 amino acids long. Preferably, the peptide is capable of binding, preferably via the epitope or the immunogenic portion, to a recognition molecule bound to a carrier, wherein preferably the carrier comprises protein A or protein G o any cpmbinatioh mereofiPreferably, the multiplicity of virions is used as a positive control.

In a preferred embodiment a further multiplicity o virions are used as a negative control ίη· said irrjinunopfecipitation reactipn said further multiplicity of viripns>comprising an pligpnucleotide»segment in their genome said segment encoding a further peptide, said further peptide lacking said epitope or immunogenic portion. Preferably, the -virions are bacteriophages.

In a preferred embodiment the immunoprecipitation is chromatin immunoprecipitation.

DEFINITIONS Immunoprecipitation (IP) is a method comprising binding of an antigen, e g. a protein antigen present in a solution using;a recognition molecule or a multiplicity thereof thatspecifically bind(s) to that particular protein, wherein the recognition.molecule is coupled to a solid substrate at a point of the procedure so that thereby the particular protein, in the form of a complex formed with the recognition 'molecule becomes attached to the solid

substrate in a reaction mixture. This complex is then brought into a form suitable to be collected from the

reaction mixture (precipitation step or: event). This process can be used to isolate and concentrate the particular protein from the solution, e.g. a sample containing different proteins. The recognition molecule, is preferably an antibody or any fragment or variant thereof.

Nucleic acid immunoprecipitation is an immunoprecipitation method wherein in an immunoprecipitation (IP) reaction after immunoprecipitation the complex of the antigen and the recognition molecule comprises a nucleic

acid. In other words, a nucleic acid is bound, either directly:or indirectly to the recognition.molecule. In.a direct nucleic- acid immunoprecipitation me antigen is the nucleic acid and the nucleic acid itself is recognized by the recognition molecule, e.g. antibody. In a nucleic acid — protein complex immunoprecipitation the recognition molecule recognizes and binds a protein target which in turn binds or is bound to a nucleic acid, e.g. DNA or RNA, either double; stranded orsingle stranded (ds or ss, respecitively).

Chromatin immunoprecipitation (GhIP), a , specific application of: IP, and. a variant of nucleic acid

immunoprecipitationis .a method to study protein-nucleic acid interactions, typically in-vivo interactions. In the

broad sense GhIP can be used- to- determine whether a protein interacts with a candidate target nucleic acid,

wherein the complex of the recognition molecule and the target protein also comprises a nucleic acid, preferably

a nucleic acid fragment bound b the target protein. Typically in a GhIP method a long nucleic acid, either DNA or RNA, e.g. a genomic nucleic acid, typically a chromatin is fragmented and those fragments are obtained by the ChIP method which are bound by the target protein. The substrate in an IP reaction, e.g. in a ChIP reaction is typically a bead, preferably a bead covered by protein G or protein A or protein A/G. A recognition molecule is a macromolecule capable of specific binding to a target, such as a polypeptide or protein through at least one antigen recognition site thereof located in the variable region of the recognition molecule. A variable region of a recognition molecule is a region forming, in the native form of the recognition molecule, a molecular surface capable of contacting and binding to the target. Within a set or group of recognition molecules the variable region preferably has a variability significantly higher than other parts of the recognition molecule, i.e. the sequence identity among these sequences within the set or group is typically low. Preferably the recognition molecule is a protein and the variable region comprises, consists of or essentially consists of amino acids. An antibody is a recognition molecule which is an immunoglobulin molecule capable of specific binding to the target through at least one antigen recognition site, located in the variable region of the immunoglobulin molecule. As used herein, the term encompasses not only intact polyclonal or monoclonal antibodies, but also fragments or variants thereof (such as Fab, Fab', F(ab')2, Fv), single chain (ScFv), a monobody, or mutants thereof, fusion proteins comprising, an antibody portion, and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site or artificial variants thereof. An antibody includes an antibody of any class, such as IgG, IgA, or IgM (or sub-class thereof), and the antibody need not be of any particular class. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known in the art. An epitope is a patch or site on a target, such as a polypeptide or protein molecule, preferably a part of its molecular surface, to which a recognition molecule preferably an antibody or the binding region thereof can specifically bind. Preferably an epitope according to the invention is a linear epitope consisting of 5 to 22 amino

acids, preferably at least 5, 6, 7 or 8 amino acids and at most 10, 11, 12, 13, 14, 16, 18 or 20 amino acids. A mimotope of an epitope is a patch or site on a target molecule, preferably a part of its molecular surface, to which the same recognition molecule or antibody or the binding region thereof can bind as to the corresponding epitope. A mimotope can be developed e.g. by selection from peptide libraries preferably using a display method or by protein engineering methods e.g. combined with in silico molecural design. A mimotope is understood herein as a kind .of epitope. A nanoparticle as understood herein is typically a particle having one or more dimensions of the order of 700 nm or less or 500 nm or less or 300 nm or less or 200 run or less or 00 nm or less, said nanoparticle comprising; consisting of or consisting essentially of a nucleic acid and a polypeptide carrying an epitope or a mimotope and optionally a carrier or a coat or envelope thereof. The polypeptide may, at least partly, sourround or cover the nucleic acid or may be stably attached thereto or both the nucleic acid and the polypeptide may be attached to the carrier or coat or envelope. Preferably but. not necessarily at least a part of the polypeptide pr protein is encoded by said nucleic acid said part comprising the epitope. In an embodiment the nanoparticle is syntetic or artificial. In an embodiment the nanoparticle is a virus or virion. A virion, as understood herein is a particle of an infectious agent that can replicate inside the ying cells of an organism only, said particle consisting of or essentially consisting of or comprising nucleic acid surrounded by a protein shell or a protein coat sometimes with external envelope formed e.g. by lipids, wherein at least a part of the protein shell or coat or the envelope is encoded by said nucleic acid. Virions can infect various types of.· organisms, from animals and plants to bacteria and archaea. A. virion is preferably a nanoparticle. A virion is preferably a form of a virus capable of infecting a living cell. A,virus- is understood herein as any form of an agent that can replicate inside one or more living cells of an organism only, either in itself or together with or by the help ofa further nucleic acid within the same cell. A virus has a nucleic acid which can be replicated in the cell and either in itself or together with the further nucleic acid.encodesVproteins of a virion. A .bacteriophage is a virus o preferably a virion that infects bacteria by injecting its genetic material, which is carried enclosed in an outer protein capsid.. The genetic material of a bacteriophage can be ssRNA, dsRNA, ssDNA, or dsDNA (wherein 'ss-' or 'ds-' prefix denotes single-strand or double-strand) along with either circular or linear arrangement). An epitope or peptide is displayed on the surface of a.molecule when it is brought,or present in a form suitable to be recognized and bound by a target molecule The recognition, preferably the sp ecifi c recognition of a target by a recognition molecule is an event or 'series of events, where the target is contacted with the recognition molecule, and the strength of the interaction between them is higher than that of the strength interaction, e.g. affinity or avidity, which might formed or is formed between the same recognition molecule and.at.least one - preferably more than one - different target(s) and the recognition;molecule under same or similar conditions. Positive control in an IP, e.g. in a GhlP reaction is a control substance or agent which, when added to the reaction mixture is indicative of the actual presence of the target i the solution or the actual occurrence of an immunoprecipitation event. An input control is a kind o positive control in the IP method, preferably in the ChlE reaction, comprising a broad range of target molecules, preferably obtained from the solution before carrying out the immunprecipitation step and being suitable to be analyzed e.g. for detecting the. target. Preferably in a GhlP reaction the nucleic acid, e.g. chromatin is obtained and analyzed for the presence of the target sequence. A spike control is a control added to the IP reaction, mixture before and being present during the immunoprecipitation step, wherein the, formation of a complex between the spike control as a target and the recognition molecule.can be detected. Negative control is a control without the presence of a target and/or without the presence of the recognition molecule thereby being: indicative of the not specific recognition and binding during an IP or ChIP method. The nucleic, acid in. the control according to the invention; either in nanoparticles or viruses or virions, is typically traceable- which is to be understood herein that its presence can be detected or monitored, preferably quantitatively detected or measured by any methods For example, the nucleic acid can be detected and preferably its level or quantity measured among others by PGR, sequencing methods, hybridization methods e.g. on a chip, ligation methods, fluorescent marker methods or a combination thereof. To the control function it is , essential that fromihe quantity of the control added what ratio can be recovered, obtained or yielded after the IP reaction.

I Ά 'preferred embodimenfthe traceable nucleic, acid encodes the epitope itself. The terms Comprises o comprising or including are to be construed herein as having a,non-exhaustive meaning and allow the addition or involvement of further features or method steps or components to anything which comprises the listed features or method steps or components. The expression consisting essentially of is to be understood as consisting of mandatory features or method steps ' or components listed in a list whereas allowing to contain additionally other features or method steps or components which do not materially affect the essential characteristics of the subject matter.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 HDAC l monoclonal antibody immunogen epitope peptide (P4) coding sequence and P4-M13KE phage vector construct. A) Translation of the P4 peptide encoding sequence specified in the text. B) Partial nucleotide and coded protein sequence of the theoretical M13KE-P4 phage DNA construct. Annotation: Start codon of M13 phage genlll gene (gtg, medium grey), secretion signal sequence, Acc65I and Eagl restriction endpnuclease cleavage sites (ggtacc and cggccg, respectively, light grey), P4 peptide coding sequence (dark grey), phage genlll protein coding sequence. Figure 2 Schematic structure of the theoretical P4-M13KE phage displaying the P4 peptide. The recombinant filamentous M13 phage was generated .in E. coli ER2738 strain via electroporation of the- double stranded M13KE vector containing the nucleotide sequence encoded for the P4 peptide subcloned in a way which. allows the N-terminal fusion of the peptide to the genelll protein (minor coat protein). The mature phage is assembled within the cells from the positive strand of the vector construct (single-stranded form, ssDNA, consisting of 7222 bases) and from coat proteins, that is the major geneVIII protein (~2700 copies), and the minor geneVI, geneVII, genelX. proteins, and the P4-geneIII fusion protein (3-5 copies). The recombinant P4-M1 3KE phage therefore displays the P4 peptide on its surface and is physically linked to its encoding DNA. Figure 3 Capillary sequencing of P4-M13KE clones. A) Sequence of the antisense strands of P4_2, P4_6, and P4 13-M13KE clones obtained using the M13 -96 sequencing primer (New England Biolabs). Eagl site (CGG CCG; underlined): position 81-86; P4 peptide reading frame: position 88-135 (dark grey); Acc65I site (GGT ACC, light grey): position 152-1 57; 13 E genlll start codon (CAC in the antisense strand, medium grey): position 187-1 89. B) Sequence read for P4_2 M13KE clone from ABI 3 10 Avant DNA sequencer. The sequence of the negative (antisense) strand of the P4-M1 phage DNA was obtained using -96 sequencing primer. Eagl site (CGG CCG); position 81-86; P4 peptide reading frame: position 88-135; Acc65I site (GGT ACC): 52-57; M13KE genlll start codon (CAC): 187-189. Figure 4 P4 Specific QPCR assay used for screening. A. Outline of the design. B. Sequences and melting temperatures. Figure 5 Fragment size analysis of the Chromatin used for the ChIP reaction as assessed on an Agilent Bioanalyzer. Figure 6 QPCR analysis of the Phage controls in a typical ChIP experiment. A) Amplification curves of the Phage Spike measurements after ChIP reaction. 1 million, 100 thousand and 10 thousand HDACl specific P4 phages were collected with the HDAC1 antibody B) Amplification curves of the Phage Spike measurements after ChIP reaction. 1 million, 100 thousand and 10 thousand HDACl specific P4 phages were collected with the HDACl antibody. Figure 6B is presenting a technical replicate of the experiment shown in Figure 6A. C) Amplification curves ofthe Phage Spike measurements without ChIP reaction. DNA was isolated from 0% of Input from the 1 million, 100 thousand and 10 thousand phage containg reactions without any immunoprecipitation step. D) Amplification curves of the Phage Spike measurements without ChIP reaction. DNA was isolated from 10% of Input from 10 million phage containing chromatin samples (wells: E7, E8, E9) and 1 million phages without chromatin (wells: F7, E8, E9). No immunoprecipitation was performed. E) Amplification curves of the Phage Spike measurements after ChIP reactions. DNA isolated from a ChIP reaction containing HDAC1 specific antibody and 10 thousand P4 Phage particles is shown together with the following negative control reactions P4 phage in the following amounts: 1 million, 100 thousand and 10 thousand copies, together with 1 million of M13KE empty phages. F) Amplification curves of the Phage Spike measurements after ChIP reactions. DNA isolated from a ChIP reaction containing HDAC 1 specific antibody and 1 million, 100 thousand and 10 thousand P4 Phage particles respectively is shown together with the negative control reaction of 1 million of M13KE empty phage that is not expressing the epitope sequence recognized b the HDAC1 specific antibody. G) Cp Values of the Spike QPCR reactions. QPCR reactions were performed in triplicates. Average Cp and standard deviations from the average are shown. One million of positive controll phages are shown as it follows: Al , A2, A3 are parallel QPCR measurements whereas A4, A5 and A6 are triplicate QPCR measurements of a techical replicate measured in positions Al , A2 and A3. Hundred thousand of phages were investigated in two technical replicates and three QPCR measurements each in the wells Bl, B2B3 and B4, B5, B6 respectively. Ten thousand of phages were measured in a simillar approach in wells CI, C2, C3 and C4, C5, C6 respectivelly. Input represents 10% ot the material used for immunoprecipitation. Figure 7 A. Results of the pirosequencing on a 454 Junior system of the the phage libraries. Conservation, quality and Consensus are shown for the first 10 analysed sequences from Second round of panning with MECP2 antibody. B. Conservation, quality and Consensus are shown for the first 100 analysed sequences from third round of panning with MECP2 antibody Data were analyzed with Mimox software as described in the results section. C. ChIP recovery of the libraries generated by three rounds of panning. Same input of one million phages were recovered as described and measured by qPCR relative quantitation method. Results from round two and three of panning are shown for both MECP2 and P300 antibodies. Figure 8 A. Results of the pirosequencing on a 454 Junior system of the the phage libraries. Conservation, quality and Consensus are shown for the first 100 analysed sequences from Second round of panning with p300ntibody. B. Conservation, quality and Consensus are shown for the first 100 analysed sequences from third round of panning with p300 antibody Data were analyzed with Mimo software as described in the results section. C. ChIP recovery of the libraries generated by three rounds of panning. Same input of one million phages were recovered as described and measured by qPCR relative quantitation method. Results from round tw and three of panning are shown for both MEGP2 and P300 antibodies. Figure 9 The mimotope quality scores and the ChIP recovery of the phage libraries. A. Quality scores for individual positions in the analyzed libraries as calculated by Mimox software. B. Sum of the Mimox quality scores of the two different antibody selected libraries and rounds two and three of the selection respectively. Figure 10 Amino Acid conservation scores for third round of phage library selection performed with MEGP2 and P300 antibodies respectively. Figure 11 Sensitivity limit of Phage M13 ELISA. The sensitivity drops significantly for copy numbers in the range of one million phages, a concentration that is far too high for optimal usage as a spiking control. Figure 12 Mapping of histone modifications by ChIP Seq. Histone H3 K27 acetylation is mapped on technical replicates. The region of the mouse FABP4 gene is shown. ChIP Seq analysis was performed on an Illumina sequencing instrument. Figure 13 Fragment size distribution after incomplete sonication (partial fragmentation). If sonication is done till mononucleosomal fragments, large protein complexes might be disrupted and this is reducing significantly the efficiency of ChIP for transcription factors. Figure 14 DNAse based fragmentation of chromatin (A) Fragment size distribution of the Agilent Bioanalyzer size marker (B) Fragment size distribution shown on gel like representation of the Agilent Bioanalyzer results. First column shows the marker presented in panel A. Second column is the DNA isolated withour Micrococcal nuclease digestion. Columns three to 9 is showing digestion with Micrococcal nuclease in a three fold dilution curve. Digestion was performed for 15 minutes at 37 degree Celsius.

DETAILED DESCRIPTION OF THE INVENTION The present inventors discovered a method that can be used to create spikes that have similar properties to the protein: DNA complex that is investigated in the chromatin immunoprecipitation method. The;method is based on the use of an epitope presenting system as a control. The epitope presenting system is useful as a positive control comprising a given epitope or a negative control lacking it. The epitope presenting system can be a multiplicity of nanoparticles having a polypeptide comprising and a nucleic acid encoding an epitope. The epitope presenting system.is preferably viruses encoding and presenting an epitope, preferably bacteriophages. In order to understand the performance of an immunoprecipitation assay it is important to have positive and negative controls for the assay. An appropriate positive control should show for the laboratory operator that the experiment performed well from technical point of view. A negative control defines a background for the measurement. The difference between the signal measured by the positive control assay and the negative control one should give an information about the dynamic range of the reaction. A significant advantage of the controls of the invention is that they comprise both an epitope of an appropriate target and a nucleic acid, wherein the nucleic acid. is traceable. Thus, in an immunoprecipitation experiment the control microparticle of the invention is bound to the recognition molecule, e.g. antibody of interest and precipitated; in principle the same way as the target protein or antigen itself. Therefore, for example in a ChIP experiment they work a very similar way to chromatin itself. This feature can be utilized at several levels of quality control including the IP reaction itself to detection by modern techniques like QPCR, ChlP-on-a-chip (ChlP-chip) and ChlP-sequencing (ChIP Seq or ChlP-seq). In a preferred embodiment the nucleic acid comprises a sequence encoding the epitope and therefore the epitope coding sequence itself provides a possibility to detect or trace the control, i.e. in this case a positive control or, in case of a negative control, the absence thereof. Using a viral system, preferably the phage system as an example, the present inventors have developed a positive control for the whole procedure that is able to monitor the performance of the method. The phage carries at its surface an epitope which is bound by the recognition molecule, preferably, same peptide that was used to generate an antibody or a mimotope thereof. As a preferred example, phage display methodology is used to provide the controls of the invention. Peptide phage display technology involves expressing peptides in fusion with viral coat proteins, thereby displaying the peptides on the surface of the phage. Since the peptide coding DNA sequence, which is cloned into the phage genome, is also encapsulated in the whole phage as single stranded DNA, this allows identification of the

peptide via nucleotide sequencing of the corresponding ' coding region. By this mean, in chromatin immunoprecipitation experiments, a recombinant phage displaying the epitope peptide of the monoclonal antibody used, will allow to use such a phage as a control. In case of polyclonal antibodies a mixture of phages could be used to monitor the performance of the immunoprecipitation reaction. The phage can express the same peptide that was used to generate the antibody. The positive control according to the invention is useful as a spike control, i.e. the virion can be added to the immunoprecipitation reaction , mixture and be present during the immunoprecipitation experiment, thereby duly reporting on the performance thereof. For example, a phage can be added to the chromatin sample as a spike and the level of the immunoprecipitated phage monitored in the purified DNA after the ChIP reaction. In analogy, any virus capable of presenting an epitope and encoding the same epitope in its genome is suitable as a positive control in the present invention. In the prior art bacteriophages have been used as epitope display libraries (e.g. in WO 02/46213, Gyuris Jeno) and specifically in identifying epitopes in panning experiments, said epitopes being effectively bound by patient antibodies and useful in vaccines e.g. against SARS (e.g. in WO2006/071896, Guo Zhihong et al.). As a negative control a phage can be used that is not encoding the investigated peptide. This spike will show the non-specific binding of the phage to the plastic ware, the beads, or the antibodies used in the procedure, i.e the background noise or signal. By using quantitative PCR (QPCR) assays that are specific for the phage encoding the peptide or the empty one we can easily measure the dynamic range of the procedure. A QPCR assay that is specific to the phage system will also provide good quantitative data about the enrichment of the phages based spikes' by immunoprecipitation. Acccording to the invention various epitope presenting systems can be used. The epitope presenting system is a nanoparticle consisting of or essentially consisting of or comprising a nucleic acid and a polypeptide or a protein carrying an epitope and optionally a carrier, wherein at least a part of the polypeptide or protein is encoded by said nucleic acid said part comprising the epitope. Thus, the epitope is also coded. within the nucleic acid. Nanoparticles manufactured according to the art can be used, therefore, to carry a nucleic acid and, on their surface, an epitope or a polypeptide carrying said epitope. For example, a liposome may comprise the nucleic acid whereas the epitope carrying polypeptide may be attached to its .membrane either covalently or through a membrane anchor, e.g. a membrane spanning polypeptide. Alternatively, both the nucleic acid and the polypeptide may be attached to a nanogold particle. Preparation of nanoparticles applicable in the present invention are reviewed by Scott S. E. [Nanotechnology for the biologist, Journal of Leukocyte Biology Volume 78, September 2005, 585-594] and disclosed in the publications cited by him. Nucleic acids

can be present in a gelatin nanoparticle capsule, e.g. in a polycation, whereas the target polypeptide linked to the surface thereof. Preferred nanoparticles applicable in the present invention are disclosed e.g.a in US 2008/0160096 A l published on July 3, 2008 (Berbely J. et al., 2008). In a preferred embodiment a virus or a virion is applied herein as control; for example, the nanoparticle of the invention is a virus or a virion. The virus can belong to the order of any of the following: Caudovirales, Herpesvirales, MOnonegavirales, Nidovirales, Picornavirales, Tymovirales and Ligamenviralesv The virus or virion can be a double stranded.(ds) DNA virus or a single stranded (ss) DNA virus or RNA virus a and may or may not use reverse transcriptase (RT). In addition, ssRNA viruses may be either sense (- ) or antisense - ). The virus may have either a linear or a circular genome. In:a preferred embodiment the virus is a DNA virus, e.g. a . dsDNA virus in case of chromatin immunoprecipitation e.g.an adenovirus, and adeno- associated virus or an RNA virus, e-g. a retrovirus i case of RNA immunoprecipitation. Manipulation o Viruses; in particular adenoviruses s disclosed, e.g.a in the- manual "Virus Gonstruction Kit - The Manual Freiburg JBioware lGEM 20 10 (available e.g. at the Freibourg Bioware group and its home page. In a highly preferred embodiment of the invention the virus or virion is a bacteriophage. As an example of the system an M 13 phage system was used. The nucleotide sequence encoded for the exemplary P4 peptide was subcloned in a way which allows the N-termihal fusion of, the peptide to the genelll protein (minor coat protein). However, any other protein of the phages which has a surface portion capable of carrying an epitope may be useful according to the invention. In particular, for the display of a specific epitope peptide or the selection-of mimo tope control mixtures or monoclonal :mimotopes a protein,selected.from the group of geneVIII protein, genelX protein, gene VI protein and gene VII protein can be used instead of ' genelll protein. The recombinant filamentous M13 phage was generated in E. co'li via electroporation of the double stranded M13 vector. The mature phage is assembled within the cells from the positive strand of the vector construct and from coat proteins,, that is the major geneVIII protein (~2700 copies), and the minor gene VI, geneVII, genelX proteins and the P4-geneIII fusion protein (3-5 copies). The recombinant P4-M13 phage construct therefore displays the P4 peptide on,its surface and is physically linked to its encoding DNA (Figure 2). Both lytic phages and lysogenic phages are applicable in the present invention as this feature is not: utilized in the immunoprecipitation reaction but upon propagation of the virus only '. The bacteriophage according to the invention can be for example but not limited to a phage selected from the group of phages of the following families: Siphoviridae, Myoviridae, Podoviridae, Lipothrixviridae; Rudiviridae, Cystoviridae, Fuselloviridae, Globuloviridae, Guttavirus, Corticoviridae; Clavaviridae, Bicaudaviridae, Bacilloviridae, Ampullaviridae, Tectiviridae, Plasmaviridae, Microviridae, Leviviridae, Inoyiridae. The bacteriophage according to the invention can be for example but not limited to a lambda phage (λ phage), a T type phage, e.g. a T2 phage, a T4 phage, a T7 phage, a I phage, an R17 phage, an M type or an MS type- phage, like an 13 phage or an MS2 phage a G type phage, .like>a G4 phage, a P type phage like a P 1 phage, a P2 phage or a .P4 phage, a Phi phage; like a Phi - ,74 phage,, a Φ6 phage or a 29 phage^ an phage like an N4 phage, a 186 phage. ChIP experiments In a preferred :method Of the' invention the controls are used, in a GhIP experiment. The first step of a GhIP experiment is quite often the fixation of the sample, e.g. by cross-linking. In certain embodiments, however, e.g. if histone modifications or nucleosome positioning are to be determined this may not be necessary (native GhIP) [Barski A e al. Identification of transcription factor target genes by GhIP display. Methods Mol Biol 2008·, 455: 177-190.]. In certain embodiments further :or alternative cross-linkers are used (e;g. ' disuccinimidyl glutarate) to preserve protein-protein complexes. Cross-linking also stabilizes the complexes during sonication o mechanical fragmentation: Fragmentation of the chromatin (or nucleic acid in general) is an important issue. It is important to achieve sufficient and reproducible fragmentation. Most often the desired fragment size is about 150 to 500 bp. The fragmentation method should be reproducible, as far as possible: If subsequent detection is to be done by sequencing a 200 to 400 bp, preferably to 300 bp fragment size is preferred. The size of the lower limit is defined by the size of the nucleosome. This can be achieved e.g. by nuclease digestion. It is true in general that smaller fragment size and more gentle fragmentation can be achieved by digestion by nucleases, e.g. by micrococcal nucleases. As preparation of the subsequent library of fragments for sequencing requires fragment sizes of 200 to 300 bp, .digestion can be a preferred option in this case, or in case of native ChTP. The next step, immunoprecipitation, is crucial for a successful ChlP experiment. In this step a specific recognition molecule, e.g. an antibody is used to bind the protein of interest (target protein), and the complex shall become bound to a support, e.g. protein A or protein G covered beads, so that precipitation may occur. The beads can be e.g. magnetic or sepharose beads and can be collectedly a magnet or by centrifugation. The beads may also comprise label and can be sorted by used that label. The complex may be formed either before or after to binding of the recognition molecule to the support. Thereby, the fragmented chromatin sample is enriched in those fragments which comprise the target protein bound to their specific site on the nucleic acid. The success of the ChlP experiment largely depends on the level of enrichment of the right chromatin fragments which in turn depends on the quality of the recognition molecule (or antibody). While several antibodies are ChlP-validated; in real world other antiobodies are to be used in a number of applications. Even in case of ChlP-validated antibodies the success of this step is difficult to be checked by appropriate controls. The present solution addresses this need. In particular if the positive spike control according to the invention added before the immunoprecipitation step and recovered in a sufficient ratio after entrichment, whereas no or significantly less enrichment is found with an appropriate negative control, the immunoprecipitation step is considered successful. Thus, if no enrichment of the target protein having the same or highly similar epitope is observed, the problem is to be sought not in this step. An appropriate negative controm may be a nonspecific control antibody such as anti-IgG and/or a virus or nanoparticle according to the invention without the epitope (or rriimotope) of interest. ChlP seq project depends crucially on strong enrichment of the chromatin specifically bound by the protein

Under study. We routinely test a number of antibodies and choose the one with consistently high enrichment of DNA at a known binding site when compared with the DNA immUnoprecipitated by a nonspecific control antibody such as anti-IgG arid o enrichment at negative control sites. n the immunoprecipitation reaction of the invention the sample to be analysed, i.e. the sample of interest and the control sample are present in different containers or vials. I this case the control of the invention, either positive control or negative control are added to the control sample, i.e. to a different container or vial from that containing the sample to be analysed. In an alternative embodiment the control is added to the same sample to be analysed or to container comprising that sample. In this case the immunoprecipitation reaction is carried out both on the sample of interest an on the control not only simultaneously, but in the same reaction. In this embodiment the control should be detected besides the sample of interest from the same reaction mixture. This is possible by several detection method, for example but not limited to QPC or Chip-chip. Typically aliqots are taken from the mixture after the reaction. However, if detection allows monitoring the reaction and differentiating between the signal from the control and from that of the sample of interest, e.g. by QPCR with fluorescent markers, in certain embodiments the control value and the measured value obtained by the target or antigen can be obtained in a single reaction step. Recognition molecules In principle, any kind of recognition molecule can be applied in the immunoprecipitation method of the present invention provided that it is or can be bound to an appropriate support, e.g. beads a d it binds the target protein with a sufficient binding strength, expressed e.g. as affinity or avidity. In the last decade, using the principles observed with variable domains .of immunoglobulins attempts have been made to create alternative recognition molecules [Skerra, A. (2001) Anticalins: a new class of engineered ligand-binding proteins with antibody-like properties. Rev. Mdl. Biotech. 74, 257-275., Xu, L. at al. (2002) Directed evolution of high-affinity antibody mimics using m-RNA display. Chemistry & Biology 9, 933-942.]. Such molecules capable of binding a target protein and attached to a support, i.e. useful in an immunoprecipitation method; can be applied in the present invention. These type of recognition and binding molecules are expected to be further improved in the future and may provide even better alternatives to antibodies. At present, nevertheless; antibodies and antibody fragments as well as modified, e.g. stabilized versions thereof (called.generally antibodies herein) are preferred according to the invention. Selection of antibodies in an IP reaction, in particular in a ChIP reaction is critical. A successful IP experiment requires that the antibody recognizes the target protein and that it readily binds to the support, preferably to protein A and/or protein G. Additionally, the successful use of a specific antibody in experiments other than ChIP (i.e., western blotting ) does ot automatically mean the antibody is suitable for ChIP. Some antibodies are sensitive to inhibitory factors present in the input chromatin sample, resulting in a decrease in binding efficiency of the antibody when increasing the amount of input. Iri general, polyclonal antibody populations may recognize a nlimber of different epitopes, rather than the monoclonal antibodies, which recognize a single epitope; both may have advantages in an irrimunoprecipitation method. Mimotopes Mimotopes, i.e. analoges of epitopes can be prepared by various methods. In a preferred embodiment a display method, e.g. a phage display method is applied to present an peptide library to an antibody of interest. In a preferred embodiment an unbiased peptide library is used. The length of the peptides is e.g. at. least 7, at least 8 or at least 9 amino acids and at most 22, almost 20, almost 18, at; most 16, at most 14', at most 12 or at most 10 arhino acids. If a consensus sequence is known an fixed in the peptide library, a smaller library is sufficient. Similarly, if an N- o C-terminal segment or portion of the peptide is known, the variable region can be smaller, even as small as 1, 2, 3, 4, 5 or 6 amino acids. Thereafter a library of nanopafticles as defined according to the invention, viruses (virions), e.g. bacteriophages is provided (prepared or obtained) presenting the library of peptides and comprising the corresponding encoding nucleic acids, taking into account the degeneration of the, genetic code. The library is then contacted in several selectiori (panning) steps against a pre-selected recognition molecule (e.g. antibody). The recognition molecule preferably has a know binding property and/or its target protein is known. These rounds are carried out in experiments comprising binding of the particles to the recognition- molecule and isolating the bound particles and, if necessary, analyising them or monitoring the enrichment some way ; In each panning step enrichment of shall be found. Mohitpring enrichment can be followed e.g. by capillary sequencing or by detecting the ratio of recovery of the nanoparticles (or viruses or phages). Alternatively, hybridization of the nucleic acids to a chip comprising a large number of appropriate sequences can be used. Chip-sequencing is more cumbersome but can be used, and may be advisable, when a new method is set. This mimotope finding method is applicable even in cases when no appropriate epitope on the target protein is known. To develop a mimotope of appropriate binding to a given antibody artificial evolution methods can be used as well. In these methods viruses can be applied an propagated in each rounds of panning. Mutations in the sequences are allowed or induced during or between the panning steps and the bound viruses presenting epitope sequences of appropriate binding level are obtained. The so obtained viruses then are propagated in an appropriate host organism. Epitopes as molecular surface parts of a molecule can by given and mimotopes also can be prepared e.g. as described [Goede,.Andrean et al.: BMC Bioinformatics 2005, 6:223]. As a control in the IP method of the invention either a library sufficiently enriched in appropriate epitopes can be used, or individual nanoparticles, viruses (virions) or phages having a particular epitope can be selected. Detection methods Results of traditional immunoprecipitation experiments can be detected by an immunological method, e.g by Western-blotting or by ELISA. These methods provide detection at the protein level. The controls of the invetion have been validated to ELISA as illustrated in the Examples. In ChIP experiments a nucleic acid binding protein is immunoprecipitated with its cognate DNA or RNA and the presence of this binding at a specific site can be assessed at the nucleic acid level. A method utilizing nucleic acid modifying enzymes may also be applicable, provided that a restriction endonuclease specific to that particular modification is available. As an example, DNA adenine methyltransferase (DAM) can be mentioned. This protein methylates adenines in the DNA. In this method

DAM is fused to the protein of interest, this fusion protein is expressed, methylates the adenines which are o t- covered by the target protein and those parts are identified by endonuclease mapping. A powerful, stable and fast detection means is quantitative PCR (qPCR or QPCR). However, by QPCR, as it requires primers of known sequence, only pre-determined individual sites can be detected. A further method utilizing hybridization is ChlP -on a-chip or ChiP-chip utilizing the. nucleic acid hybridization array technology. The sequences on the chip used depend on the purpose of the experiment. They may comprise a pre-defined portion of the genome (part of a chromosome or e.g. regulatory regions). While the method is relatively simple arid effective, the resolution o this method is relatively low, however, depends on the hybridization conditions. Sequencing methods provide a highly precision tool for ChIP detection. A sequencing experiment after QPCR is possible. In case of capillary sequencing, a fast method, hoever, a mixture of sequences is obtained. This well be applicable to monitor either a ChIP reacitiori or an epitope panning experiment, its information content is lower than that can be obtained from a ChlP-seq experiment-. . A ChlP-seq experiment is the sequencing of nucleic acid fragments that co-precipitate with the specific binding protein of interest. In principle, any nucleotide sequence precipitated can be sequenced and the result does not depend on prior knowledge of binding sites. In practice, this method is performed with high-throughput Next- Generation Sequencing (ChlP-seq) and became suitable for whole genome mapping of protein-DNA interactions [Kozarewa I et al. Amplification-free Illumina sequencing-library preparation facilitates improved mapping arid assembly of (G+C)-biased genomes. Nat Methods 2009, 6:291-295., Goren A et al: Chromatin profiling by directly sequencing small quantities of immunoprecipitated DNA. Nat Methods 2010, 7:47-49.,

Barski A and Zhao K: Genomic location analysis by ChlP-Seq. J Cell.Biochem 2009, 107: 11- 18.]

While a .number of methods for analysis of the results are available for a person skilled in the art, there are many potential problems, however, with the interpretation of ChIP seq results and data analysis which necessitates the. careful use of available software [Liu ;Τ . et.al., Q&A:- ChlP-seq technologies arid the study of gene regulation, BMC Biology 20 10, 8:56, Nix DA, et al. Empirical methods for controlling false positives and estimating confidence i ChlP-Seq peaks. BMC Bioinformatics 2008, 9:523. Pepke S et al: Computation for ChlP-seq arid RNA-seq studies. Nat Methods 2009, 6:S22-S32.]. In case of any a quantitative PCR validation of selected ChlP-seq peaks is advisable. The present controls of the invention are suitable for sequencing experiments just as chromatin itself arid therefore provide an additional possibility to control the quality of the ChIP experiment. Kits A kit according to the invention may comprise the controls only indicated that it is to be used as a control in TP experimehs. More preferably the kits comprise both positive and negative controls for a given recognition molecule validated for IP or ChIP experiment. Preferably the controls are provided in solution. In a preferred embodiment the recognition molecule is provided in the kit, In a further preferred embodinient the kit also comprises a QPCR assay kit or at least primers suitable to arnplify the epitope.region. ' In preferred embodiments further controls like non-specific antibody control like IgG or other negative, non- specific controls are provided in the kit. Moreover, IP buffers, PCR buffers, washing solutions arid desired media, solutions and other reagents are provided in the kit. The invention is further illustrated below by specific examples. It is to be understood that the scope of the invention is not limited to these examples as other embodiments based on the same inventive idea can be carried out by a person skilled in the art without departing from the solution as defined herein.

EXAMPLES Materials and methods Cloning coding DNA sequence of the P4peptide into MI3KE vector and propagation of the vector Peptide Phage Display Cloning Vector, M 13KE. was purchased from New England Biolabs, Ipswich, MA

(NEB, Catalogue No. E8 101 S). Subclonihg of the coding DNA sequence of the P4 peptide into M13KE vector and propagation of the M13KE vector and whole phage was carried out in the F+ E. coli K12 ER2738 host strain (NEB, Catalogue No. E4104S) according to the manufacturer's suggestions (Ph.D. Phage Display Libraries Instruction Manual, NEB, Catalogue No. E8100) with the following modifications. A single stranded oligonucleotide was . synthetised by Sigma-Aldrich, wit the sequence of -5'- CATGTTTCGGCCGACGCCAGTTTAACTTCTTCTTTAACACCTTTC GCTTCCGG rTTTrCTTCAGAGTGAGAATAGAAAGGTACCCGGG-3' (ST00099785, „Phage Peptide 4") which encodes the P4 peptide (Figure 1 A) and in addition, contains flanking sequences to facilitate cloning of a double stranded oligonucleotide formed from it in a later step. The Phage Peptide 4 oligonucleotide (5 ug, ~ 80 pmol) was annealed to 3 molar excess (4,1 ug, 540 pmol) of a single stranded oligonucleotide, "Extension Primer" with the sequence of 5'-CATGCCCGGGTACCTTTCTATTCTC-3' (ST00099787, ...Phage Extension", synthesized by Sigma-Aldrich) in 50 ul TE buffer containing 100 mM NaCl, by heating to 95 oC and cooling to 25 oC under 30 min. The annealed oligonucleotide pair was extended using 15 Units of lenow fragment in 200 ul NEBuffer 2 containing 10 mM dNTP. mix for 10 min, 37 oC, followed by an incubation at 65 oC for 15 min. The extended duplex was digested with 50 Units of EagI and 50 Units of Aec65I restriction endonucleases in 400 NEBuffer 3 at 37 oC for 5 h. The digested duplex was purified by separating on, 5% MetaPhor Agarose (Cambrex) gel electrophoresis on a Bio-Rad Mini SubCell apparatus; excising the 7 1 bp fragment with cohesive ends, and purifying using a High Pure P R Cleanup Micro Kit (Roche), and DNA concentration was determined using a NanoDrop spectrophotometer (25 ng/ul). 4 ug of double stranded M13KE phage vector was digested with 50 Units of EagI and 50 Units of Acc65I restriction endonucleases in 50 ul NEBuffer 3 at 37 oC for 5 h. Linearised vector was loaded onto 1% Certified Molecular Biology Agarose (Bio-Rad) and the fragment (7202 bp) with cohesive ends was excised from the gel and purified with a GeneClean Kit (Qbiogen) and DNA concentration was determined using a NanoDrop spectrophotometer (200 ng/ul).

The digested duplex (100 ng) was ligated into the linearised M13KE vector (100 ng, molar ratio 10: 1, insert:vector) using 1.5 Weiss Units of T4 DNA Ligase (Promega) in 10 ul of T4 ligase buffer at 16 oC for an overnight and heat-killed at 65 oC for 15 min. To recover the recombinant M13KE construct harbouring the P4 coding sequence (Figure 1 B) and to generate whole M13KE phage, the ligation mix was electroporated into E. coli K12 strain ER2738. 1 ul of the ligation reaction was combined with 100 ul of electrocompetent ER2738 cells (previously prepared according to the supplier's suggestions) and electroporated using a BTX electroporator in 0.1 cm cuvette (2.5kV/RESISTANCE High Voltage (HV), resistance: , charging: 1.4 kV, resulting pulse length: 5 msec). 1 ml SOC medium was added to the cuvette, then the electroporation mix was transferred into 13 ml flip-top Falcon tube and cells an whole phages were recovered by incubating at 37 oC for 45 min with shaking at 250 rpm (outgrowth). 100 ul of the outgrowth was mixed with 3 ml Top- Agar (10 g Bacto-Tryptone, 5 g Yeast extract, 0.5 g NaCl, 7 g Bacto-Agar per liter, Sigma) melted at 45 oC and containing 200 ul of ER2738 culture (20 mL) previously grown to OD595 0:38 in LB medium containig 20 ug/L tetracycline (37 oC, shaking at 240 RPM). The Top-Agar mix was plated on LB-Agar plates containing 1 ml/L

IPTG/Xgal stock ( 1.25 g -IPTG and 1 g Xgal in 25 mL DMF, Sigma) and incubated at 37 oC for an overnight. Single blue phage plaques arising on the plates due to IPTG induced beta-galactosidase expression from

functional M13KE vector were picked with sterile tips and inoculated into early-log phase (0. 1: OD 590 nm) ER2738 cultures ( lmL LB without antibiotics) and grown at 37 oC for 4.5 h with shaking (250 rpm) to amplify individual phage clones. Bacterial cells were removed from the medium by centrifugation (14 000 x g, 1 min) to obtain the amplified phage stock. Phage DNA template was prepared from 100 ul of the stock using: the High Pure PCR Template Preparation Kit (Roche) for qPCR-based clone screening specific to the P4 peptide coding insert. The presence and correct frame of the insert sequence in qPCR positive clones was verified by capillary nucleotide sequencing using 100 ng single stranded phage DNA as template and the M l 3 -96 sequencing primer on an ABI 3 10 Avant.DNA sequencer (Figure 3 A and 3 B). P4-M13KE phage clones which were foiind positive in the qPCR-based screen were amplified by adding an aliquot (5 iil) of the amplified phage' stock (see above) to an early-log phase (OD595: 0.05) ER273 8· culture (20 ml LB), and incubating at 37' oC for 4,5 h 'with shaking (25.0 rpm). The culture was then spinned at 8000 x g for 20 minutes and the supernatant was treated with 1/6 volume of 20% PEG/2.5 M NaCl. After an overnight precipitation at 4 oC, whole phages were collected and. washed b y centrifugation and resuspended in TBS (50 ul) to obtain purified amplified phage clones for further experiments. Fragment preparation for chromatin immUnoprecipitation (ChIP) 293Tcells were grown in DMEM, 10%FBS, Pen/Strepto, Glutamine, in 5%C02, 37C, humidified environment in a T75 tissue culture;flask, in 20 ml riiedium,;in; a'numb er of 15-20 million cells per flask Medium was removed and replaced with 20 m PBS. 540ul Formaldehyde (37%) Sigma, was added and incubated at room temperature for 10 minutes with gently mixing.. 1,7 ml of 1,67M glycine was added to quench the fixation and mixed, Flask was put on ice and superhatant was removed immediately. Cells were washed twice with 10 ml of icecold PBS. PBS was removed and 5 ml of fresh PBS was added. Cells were scraped in these five ml of icecold PBS. Scraped cells were transferred into a 50 ml conical centrifuge tube and supplemented to 20 ml PBS. Cells were centrifuged at 1000 g for 10 minutes at 4C. Supernatant was removed carefully, resuspended in l PBS and washed again with total 20 ml PBS as previously. PBS was removed carefully and pellet was resuspended in 0,5 ml of icecold PBS and transferred in 1,6 ml Low Binding Microcentrifuge tubes. Cells were centrifuged 6120 g 4G, 2 minutes. Supernatant was removed and pellet was resuspended in lml of Sonication Buffer (1%SDS, lOmM EDTA, 50mMTrisHCl, pH8. 1 and Proteinase inhibitors Roche'Complete mini 04-693-124-001).

Buffer was. transferred into 15 ml conical polystyrol tubes (BD Falcon 352095 ) and sonicated on Bioruptor 3 0min High.setting, 30 sec ON/30 sec OFF. Sample was transferred into Low binding 1,6 ml tubes, and centrifuged for 5 min 14000: rpm . [Supernatant was transferred into a clean microcentrifuge tube and 50 ul was used for fragment analysis, The remaining were stored at -20C. The. Fragment analysis was done as it follows: 50 ul was completed to 200ul with Elution Buffer (freshly dissolved Ο,Ϊ Μ NaHC03 and 1%SDS). 8ul of. 5M NaCl was added, 2ul of 0,5M EDTA (pH8) and was incubated overnight at 65C. Next morning lul RNAseA(stock solution of lOug/ul), incubated for 30 minutes at 37C, then 4ul 0,5 M ED TA (pH8), 8ul TrisCl ( 1M, pH7) and 0,5 ul Proteinase K ( 18,5 mg/ml, Ferrnentas EO

04 1): Solution was incubated in a/thermomixer while shaking with lOOOrpm, for 2hours at 45C. Solution was purified on a Roche High Pure Template preparation PCR Kit. Columns were eluated twice with 50ul-s generating roughly lOOtil of eluate. This was quantified with Qubit High Sensitivity Double stranded NA Kit

(Invitrogen 3285 1). Concentration was in the range of 70-100 ng/ul. Fragment size was investigated by Agilent 2 lOOBioanalyzer, 7500 DNA ChIP and i s shown in Figure 5. ChIP experiment: All steps were done on ice. 264ul of Invitrogen Dyanal Beads Protein A (Invitrogen Dynalbeads 100.02D) and

264ul of G beads (Invitrogen Dynalbeads 100.04D) were mixed and, 1336ul όΐ · IP reaction buffer (generated from a 1:9 mixture of Sonication buffer and IP Dilution buffer, plus Proteinase in bit rs) (Γ Dilution Buffer: 0,0 1% SDS, 1,l%Triton X-100, 1,2mM.EDTA, 16,7mM Tris pH 8,1, 167mM NaCl) mixed arid centrifuged for 5 minutes 16 1g. Supernatant was removed and 1336ul of. the IP reaction buffer were added and centrifuged again. Supernatant was removed as described previously. 5-28ul buffer was added to the. beads and beads were split in two equal parts. Beads were suplemented with reaction buffer to 1,4ml and 24ul HDAC1 antibody was added to one of the vials and 8ul of IgG (2ug/ul) to the other vial. Tubes were incubated in a rotation platform (30 rpm) at A for two hours. Tubes were inserted into a Invitrogen magnetic rack and left 1 min, after which supernatant was removed. Next we added 528ul of reaction buffer to each tube and the content of the tubes was further divided into 8 Low binding tubes (Axygen MCT-150-L-C, 3 11-09-05 1) for IDAC 1 (Diagenode Catalogue No. S 144- 100) or IGG cprrespondigly (30ul coated beads per reaction). Sonicated chromatin corresponding to 500 cells in 30ul of Sonication buffer were diluted tenfold with IP

Dilution buffer (and Proteinase inhibitors and final concentration of lmM DTT) up to 3OOul. This was added to each bead containing 1,6 ml microcentrifuge tube. These reactions in individual tubes were spiked with the corresponding amount of phages as.it is shown in Table 1. Tubes were incubated overnight on a rotating platform at 4C. Next tubes were placed on a magnetic rack and after one minute the supernatant was removed. Beads were washed with 600ul chilled ChlPA buffer (0,1%SDS, 1% Triton X 100, 2mM EDTA, 20 TrisHCl P H8,1, 150 mM NaCl aiid Proteinase Inhibitors) for 4 min, 4G, on a rotating platform. The same washing precedure was fepeted with buffers ChIP B (0,1%SDS, 1% Triton X100, 2mM EDTA, 20 mM TrisHCl pH8,l , 500 mM NaCl and Proteinase Inhibitors), and ChlP C (0,25M LiCl, l%NP-40, 1% Sodium deoxycholate, lmM EDTA, O M TrisHCl pH8, 1 and Proteinase inhibitors) and twice with Buffer TE (0, mM Tris, 1 mM EDTA, pH8). Beads were resuspended in 40ul Buffer TE (without .Proteinase Inhibitors) and transferred to a fresh tube. Next tubes were placed on a magnetic rack arid after one minute the supernatant was removed. From th s point on the tubes were manipulated on room teniperature.

Beads were resuspended in lOOul Elution Buffer and incubated in a shaker (1000RPM) on room temperature for

1 minutes. This step was repeated twice and eluates combined in a fresh microcentrifuge tube. 10% of the input chromatin was supplemented with Elution buffer to 20Oul and treated together with the previous ones from this step oh. From this step on the DNA isolation was performed as described for the fragment analysis step previously. DNA was ejuted in lOOul of Elution buffer.: Subcloning-an epitope peptide coding sequence into M13KE bacteriophage vector The coding sequence of the H C 1 monoclonal antibody immunogen epitope peptide was subcloned into the .Peptide Phage Display Cloning Vector, M 13KE purchased from.New England Biolabs to generate recombinant M13KE. phages displaying the .epit pe peptide N-terrninally fused to genlll phage coat protein according to the manufacturer's suggestions. Sequence of the immunogen, epitope peptide used for the generation of HDAC1 monoclonal antibody (Diagenode Catalogue No. SN 144- 100) was disclosed by Diagenode SA as to be NH3+- EEKPEAKGVKEEVKLA-COO- (hereinafter also referred as P4). Coding nucleotide sequence of the P4

peptide was generated and optiinised iii silico for E. coli .K.12 codon usage using the open source Gene Design software (www.genedesign.org) as

5'-(iAAGAAAAACCGGAAGCGAAAGGTG ' AAA A ( AAG TAAACTG€iCG-3 '(Figure 1). The above coding DNA sequence was synthetised and directionally subcloned as described later in the text into the Acc65I (5') and Eagl (3') restriction endonuclease sites in frame with the coding sequence of genlll, 3' from the secretion signal sequence and 5' from the coding sequence of the mature genlll protein. This results in the expression of an P4-genIII protein, with the P4 as an N-terminally fused peptide. 3-5 copies of the P4-genIII protein are expected to be incorporated into the mature P4-M13BCE phage produced in ¥.. coli 12 cells from the P4-M13KE; DNA after transformation (Figure 2). Upon ligation of a purified DNA fragment containing the P4 peptide coding sequence (see above) into the M13KE vector and transformation into E. coli 12 cells, blue phage plaques arised on LB-Agar-IPTG-Xgal plates coated with bacterial lawn showing a prior infection of cells with intact M 13KE DNA arising from the ligation reaction. Individual M13RE phage clones were amplified from 6 well separated blue plaques and 5 of them (plaque No. P4_2, 6, 11, 12, arid- 13) was screened for the presence the P4 peptide coding insert using a qPCR-based protocol with M l3 specific forward primer

(General F or General S), P4 insert specific reverse primer (Peptide4 R or Peptide4 S), and a general V 13 probe (General TM). All 5 clones (clone No. P4 2, 6, 11, 12, arid 3) proved to be positive for. the presence of the,P4 peptide encoding insert in the qPCR screen. The DNA sequence of 3 M 13KE phage clones (clone P4_2, P4 6, and P4_13) was analysed by capillary sequencing to prove correct orientation and reading frame of the P4 peptide coding insert. All 3 clones (clone 4 2, P4_6, and .P4_13) were found to be of the right sequence (Figure 3). Positive P4-M13KE phage clones (P4 2, P4_6, and P4 13) were amplified as whole phage and purified by PEG/NaCl precipitation for chromatin ',ijnuttunoprecipitation experiments. Testing binding o f antibodies to the cloned Phages Binding of anti HDACl monoclonal antibody In order to use the phages as a Spike control System; we tested if the specific anti FIDAC 1 monoclonal antibody can bind the cloned Phages. We used 100 k copies of the cloned Phages in a 100 microliter volume of ChIP buffer and 3ul of the antibody. The Chromatin immunoprecipitation was performed as described earlier with.modifications (Balirit et al MCB 2006). Detailed protocol in Materials and Methods section. Briefly: Antibody was bound to a 1:1 mixture of paramagnetic beads coated with Protein "A or Protein G respectively. Excess antibody was washed away and beads covered with the antibodies were mixed with the sheared chromatin solution generated from 100 k HEK293T cells. After overnight incubation beads were washed with a series of Tow salt, high salt and LiCl containing buffers followed by two washes with ' TE buffer. After these washing- steps the bound complexes were eluted with Elution buffer and after reversal of crosslinks, RNAse and Proteinase digestion the DNA was purified with column purification method. The recovered DNA was quantified with QPCR methods. Further details of the procedure in the Materials and Methods section. To investigate what fraction of the phages was recovered by the antibody, we compared the enrichment to the initial input and found that 3ug of HDAC1 antibody is able to bind close to the total input used in the reaction. Binding of IgG - control experiment We riext.examined if IgG is able to bind the cloned or empty phages. We repeatedy found that the system works well, IgG' was not binding the cloned or the empty vector both gave no relevant amplification in QPCR reactions; Detection of cloned phages by QPCR assays - study o f quality criteria QPCR assays were developed in a way to allow the detection of virtually any newly cloned. Phage. One of the primers and the probe are specific to the backbone, while the other primer to the cloned fragment. Alternatively QPCR assays Were developed that are able to detect the empty phages too, namely the negative controls. See details in Figure 4.

Our results show the following: we investigated phage numbers from 1 million, lOOK. and 10k copies of the HDACl mimicking phage. As little as lOK was detected by both QPCR assays the one that was recognizing- the insert-and.the assay developed to detect any M 13 phage. The experiment also showed us that the antibody, the beads, the plasticware or any other components of the system did -.not bound at relevant levels the negative control phages. . ' Detection by QPCR Three different qPRC assays were used: 1. A qPCR assay that is recognizing the cloned phages. This assay is using a general probe and a general forward oligd that binds the backbone o the phage, while the the reverse primer is specific for the cloned insert (Figure 4). Peptide4 R gCCgACgCCAgTTTAACTT General S (FW) TCACCT.CgAAAgC AAgCTgA General TM FAM-AgAAAggTACCACTAAAggAATTgCgAAT-BBQ

2. A qPCR assay that is recognizing the backbone of the M 13 E phages. As a probe in this case the Universal Probe Library (Roche) probe number UPX4.8 is used. M13KE A UPL48 FW: 5' - ATTCACTGGC.CGTCGTTTTA 13K.E A UPI .48 REV: 5' - GGCGATTAAGTTGGGTAACG 3. A.qPCR assay that recognizes all cloned phages from this study with the UPL probe number UPL2 1:

Peptide 1-5 A UPL2 1 FW: 5' - TTGCTATCCCTGAAAATGAGG Peptide 1-5 A UPL2 1 REV: 5' - GTACCGCCACCCTCAGAAC 2ul of the purified DNA was used for the QPCR reaction. Each QPCR measurement was performed in triplicates '. One PCR reaction- contained the following: 13,68ul Nuclease free water, 2,2 10X PGR Buffer, 2,7 MgC12 25m , l ul dNTP 2,5mM each, 0,08ul Forward Primer (lOOuM) arid 0.08ul Reverse Primer (lOOuM), 0,13ul Probe (20uM), 0,13ul Ta Polimerase (5U/ul .Fermeritas EP 0402). Measurement was performed on a Roche Lightcycler 480 instrument. Second derivative max method was used to calculate the Gp values during the analysis the results of the QPCR reaction. Panels A arid B of Figure 6 shows two biological replica, according to which the phage can be recovered from the CMP reaction by the HDACl antibody in three concentrations, namely 1 million, 100 thousands or 10 thousands .Panels C and D shows the quantitiy of the phages added to the system (10% of the INPUT and the total quantity). P4 specific assay were used to the QPC measurements. Panel E shows that IgG control was negative in/aJJ cases. Panel D shows that empty Μ Γ3 Ε phages are not boiiftd by the HDACl antibody: Cp' values are shown in Table 1. and panel F of Figure 6.

The ratio of the added phages (INPUT) bound by 3 ug antibody has also been studied. Our results showed that while in case of 750 thousands added phages the recovered ration was 87% (635440 phages recovered vs. 1227 non-:recovered), when 250 thousands phages were added this ratio increased to 90% (222780. phages recovered vs. 22231 non-recovered). This appears to be the evidence "for the empirical fact that in an IP reaction in case of more diluted samples enrichment level is.higher than in case of more concentrated samples. Selection of mimotopes from a peptide phage display library for ChIP control applications Monoclonal antibodies raised in mouse against the human MECP 2 and p300 proteins were used as targets in a random heptapeptide phage display library selection protocol to enrich for phage clones with heptapeptides which are capable of specifically binding to the antibodies (mimotopes), in order to generate phage clone pools which can be used as controls in MECP2 or p300 ChIP protocols. As the random peptide library, Ph.D.-7 Phage Display Peptide Library (NEB) was utilised, which consists of recombinant M13KE phages displaying a fully randomised peptide library ^terminally fused to genlll phage coat protein via a GGG linker sequence.

The library preparation has a phage concentration of O 3 pfu/ml with random heptapeptide library representation of 70 copies of each possible sequence (which is 1.28 x l O9 in case of a 7-mer peptide) in a 1 ul aliquot (according to the manufacturer).

Biopanning of the library on the antibodies was carried out in solution, starting with a phage blocking step to prevent non-specific interactions with the antibodies, wherein, as the input, a 10 ul aliquot (in which the total number of phages were 10 ' pfu) was added to 1 ml. Tris Buffer Saline with 0.1% Tween-20 (TBST) containig 1% BSA and incubated for 60 min at room temperature with rotation. In the binding step, 10 ug of MECP2 or p300 specific antibody was added and the mixtures were incubate for 60 min at room temperature with shaking. Capture (precipitation) of the immunocomplexes was achieved by Protein G magnetic beads (Dynabeads) by .adding a 50 ul (1.5 ;mg) aliquot of Protein G magnetic beads (Dynabeads) prepared according to the manufacturer's instructions and incubated for 10 min at room temperature.-Beads were collected using a magnet and washed 10 times with 1 ml TBST containig 1% BSA. Antibody-phage immunocomplexes were eluted from the beads with 1 ml 0.2.M Glycine-HCl, pH 2.2 containing 1% BSA by rocking for 10 min at room temperature, followed by neutralisation with 150 u 1 ml 1M Tris-HCl, pH9.1. Eluted phages were quantified by UV measurement using the equation:. Phage #/ml=dilution x 0D26O x 2.214 x 101 1, where dilution equaled to 30, or by titration of a small amount (~1 µΐ) of the eluate as described in General M13 Methods (NEB). The phage eluate except the samples used for phage quantification was amplified as described in the Ph.D. ™ Phage Display Libraries Instruction Manual (New England Biolabs) to obtain the amplified phage output of the biopanning in .200 ul TBS. the phage concentration was determined as described above. These steps corresponded to the First Round of.Biopanning, which were repeated in two further rounds (Second and Third

Rounds of Biopanning) was carried out using an aliquot of the. outputs from the preceeding rounds, containing

.1 pfu, as the input of the biopanning rounds. Phage amplificates were analysed by capillary sequencing as a fast monitoring of the process. Next generation sequencing by Roche 454 Junior System was applied to characterize quality of the panning steps and enrichment together with qPCR quantification in the ChIP protocols. The ChIP validated phage clones* the displayed mimotope peptide sequence of which are also confirmed 'indirectly by DNA sequencing, will comprise monoclonal mimotope controls for ChIP protocols. Next we used the procedure described previously by using 106 phages per chromatin sample produced from 100k cells and 1 ug of the investigated antibody. Next we sequenced by 454 Junior sequencing procedure the phage libraries according to the standard protocols of the 454Junior system: Amplicon Library Preparation Method Manual GS Junior Titaniuih.Series May 20 0 (Rev. June 201 0) http://454.com/downloads/mv454/documentation/gs-iunior/method-manuals/GSJum0r_AmpliconLibra RevJune2010.pdf

Sequencing Method Manual- G S Junior Titanium Series May 2 0 10 (Rev. June 2 0 10) ht^://454.com/dowriloads/mv454/documentation/gs-iuriior/method-manuals/GSJuriior Sequencing-MM- RevJune2010.pdf Brieflly, phages were isolated and DNA purified with standard column based DNA purification by using Roche PGR purification Kit according to the manufacturer's recommendations. Templates were used for PCR amplification of the desired region of the phage genome and in the same time tagging with an M13 FW and l RW tags. In the second round, of the PCR multiple identifyer indexes (MID adaptors) and sequencing primers were added to the amplicohs. The generated amplicons were mixed and sequenced according to the manufacturer's recommendations. Results were translated into protein sequences and consensus sequences were investigated. Briefly, the best 100 sequences from the 454Junior sequencing. results ;were analyzed (Table 2). Sequences with insertions deletions, stop codons and those that contained unidentified nucleotide sequences were removed. Translation was performed with the Transeq tool of the EMBOSS package. Results were analyzed by Mimox {BMC Bidinformatics 2006, 7:45 1 doi: 10. 186/1 47 -2 05-7-45 1) and quality score of the consensus was extracted

through JalView representation of the results. The amino aeid sequencelength used in the Mimox software

differs from seven as a result of the fact that amino acid sequence alignment generated by the program

is not fully overlapping (see Table 2 and 3).

Table 2 The best mimotope sequences based on similarity for antibodies against MECP2 and p300 proteins

ID MECP2 mimotope sequence ID p300 sequence CON 1143 1 His Asn Arg Glu Met Pro lie. CON 1306 1 Asn Ala Phe Leu Asn Asn Arg CON 101 1 His Asn Arg Glu Met Pro lie CON 1382 1 Asn Ala Tyr Leu Asn Ser Arg CON 1131 1 His Asn Arg Glu Val Pro e . CON 140 1 Asn Ala Tyr Leu Asn Ser Arg

CON _ l 138 1 Plie Asn Arg Glu Tyr Pro lie CON 1.488 1 . Asn Gin Leu Asn Ser Met

CON 5 1 His Asn Arg Glu Val Pro e CON 1730 1 Asn Ser Ala Leu Asn Ser Ala CON 11 1 · Phe His Tyr Pro Trp Ser Thr CON 1551 1 Ser Asn Ser Asn Leu Asn Ser CON 1327 1 Asn Asn Arg Glu Ala Pro Val CON 1300 1 Asn. er Thr Leu Asn Ser Leu

CON 1128 1 Ser Pro Asn A g Glu Thr Pro CON 22 .1. Asn Ser Ala Leu Asn Ser Ala

CON 1225 1 Asn Asn Arg Glu Pro Pro Leu CON 4.8 1 . Asn Ala Phe Leu Asn Asn Arg CON 1149 1 Tyr Asn Arg Glu Pro Pro Val CON 1545- 1 Asn Thr Leu Leu Asn .Ser Lys CON 1254 1 Val Pro Asn Arg Glu Thr Pro CON. 1.777 1 Asn Ser e Leu Asn Asn Ala CON 24 1 Phe Asn Arg Glu Tyr Pro ie CON 1497 1 Tyr Asn Thr Asp. Leu. Asn, sn CO 163 1 Phe His Tyr Pro T p Ser Thr CON 1523 1 His Asn Ala Asp Leu Ash Ser CO 1163 1 His Asn Arg Glu Ser Pro Leu CON 39 1 Asn Ser Ala Leu Asn Ser Ala CON 2 16 1 Val Pro Asn Arg Glu Thr Pro CON 166 1 Asn Ser Ala Leu Asn Ser Ala CON 248 1 Asn Asn Arg Glu Pro Pro Leu CON 1398 1 Asn Thr Leu Leu Asn Ser Asn CON_ 68 1 His Asn Arg Glu Ser Pro Leu CON 1359 1 Asn Gin Ser Leu Asn Ser Gin CON 223 1 · Ala Asn Arg Glu Leu Pro Val CON 1557 1 Asn His Ala Leu Asn Ser His CON 170 1 Ser Pro Asn Arg Glu Thr Pro CON 396 1 Asn Gin Ala Leu A Ser Met CON 1325 1 Ser Asn, Arg Glu Pro Pro Leu CON 9 1 Trp Gly Asn Gin Asp Leu Asn CON 1478 1 Phe Asn Arg Glu Pro Pro Leu CON 1567 1 Asn Thr.Ala Leu Asn Ser Thr CON 130 1 Asn Asri Arg Glu Ala Pro Val CON 1734 1 Asn Thr Phe Leu Asn Asn Leu CON 66 1 Ala Asn Arg: Glu Ser Pro Val. CON 7 1 Asn Thr Gin LeU Asn Ser His

CON 136 1. Ala Pro Asn Arg Glu Pro Pro CON 1648 Asn Thr.Asp Leu Asn Thr Asp CON 1195 1 Ala Pro Asri Arg Gl Pro Pro CON 1565 1 Asri Leu Asp Leu Asri Thr Lys

CON ,1 15 1 1 Ser Pro Asn Α¾ Glu Thr Pro CON 1348 ' 1 Asn Asp Leu Asn Thr Thr

CON 1242 1 Phe Tyr e -Pro Pro is Met CON 32 1 Asri Thr, Asp Leu A Thr Asp CON 1288 1 Asn Arg Glu Pro Pro Leu Tyr CON 9 1 1 Asn His Asp Leu Asn Asn Arg- CON 121 1 Ser Asn Arg Glu Pro Pro Leu CON 1442 1 Asn His. Asp Leu Asn- Asn Arg CON 1172 1 Ser Asn Arg Glu Pro Pro e CON 362 1 Asri Val Ser Leu Asn Ser Ser CON 1427 1 Asn Arg Glu Tyr Pro e Tyr CON 1385 1 Asn Val Ala Leu Asn Ser His

CON 1557 1 Alia Asn Arg Glu Ser Pro Val CON 234 1 Asn Ser Val Leu Asn Ser Ala CON 1329 1 Ala Asn Arg Glu Leu Pro Val CON 3 1 1 Asn Ser He Leu Asn Asn Ala CON 13 11 1 Ala Asn Arg Glu L Pro Val CON 1 9 1 Asn Ser Glu.Leu Asn Thr Arg CON 1345 1 Ala Asn Arg Glu Val Pro Leu CON 320 1 Asri Thr Phe Leu Asri Asn Leu CON 118 1 1 Tyr As Arg Glu Pro Pro e CON 137 1 1 Asn Thr Ser Leu Asn Ser Met CON 129 1 Ser A Arg Glu Pro Pro ie CON 150 1 Asn Thr.Leu Leu As Ser Lys CON 103 1 Phe Tyr He Pro Pro His Met CON 192 1 1 Asn Arg Asp Leu Asn Thr Asn CON 153 1 Ala. Asn Arg Glu Val Pro Leu CON 14 1 Asn Gin Ser Leu Asn Ser Gin CON 15 1 1 Val Pro Asn Arg Glu Thr Pro CON_14 15_ 1 Asn His Gin Leu Asn Ser Arg CON 145 1 Tyr Asn Arg Glu Pro.Pro Val CON 374 1 Asn Ser Thr Leu Asn Ser Leu

CON 272 1 ' Asn. Arg Glu Tyr Pro He Ty CON 70 1 Ty¾ A ri T r Asp Leu Asn Asn CON 2 19 1 Ala Asn Arg Glu Leu Pro Val CON 77 r Ser.Asn Ser Asn Leu Asn Ser CON 1306 1 Ala Asn, Arg Glu Pro Pro lie CON 89 1 Asn Thr Ala Leu Asn Ser Thr CON 1400 1 Tyr Asn Arg Glu Pro Pro Leu CON 1416 1 Asn Ser Ala Leu Asn Ser Arg

CON 12 13 1 Tyr Pro Pro Arg Leu Va1Tyr CON ,1336 1, Asn Gin Glu Leu Asn Thr Val

CON 139 1 1 Ser Asri Ar Glu Pro Pro He CON 1332 1 Asri Leu Asp Leu Asn Thr Arg CON 104 1 Ser Pro Asn Arg Glu Thr Pro CON 1436 1 Asn Val Ser Leii Asn Ser Ser CON 8 1 1 Phe Asn Arg Glu Pro Pro Leu CON 165 1 Asn Val Ala Leu Asn Ser His CON 140 1 Asri Asn, Arg Glu Leu Pro Leu CON 1559 1 Asn. Ser eu Leu Asn Ser Val CON 82 1 . Asn Arg Glu Pro Pro Val Ala CON 253 1 Asn Ser Ser Leu-Asn Ser Leu

CON 16.87 Ϊ Ser A Arg Glu pro Pro lie CONJ 3 11 1 He: Asn Thr Asp Leu A Ser CON J 169 1 Met Leu Pro Ser Val Leu Asp CON 189 1 Asri Asn Ser He Leu Asri Ser CON 1380 1 His Asn Arg Glu Pro Pro Val CON 1425 1 Asn Thr Glu Leu Asn Thr Leu

CON 76 1 Tyr Pro Pro Arg Leu Val Tyr CON 1768 1. Asn Thr Phe Leu Asn Ser Thr CON 13 19 1 Tip Asn Arg Glu Pro Pro Val CON 1450 1 Asn Ala Thr Leu Asn Ser Lys CON ' 161 5 1 Asn Asn Arg Glu e Pro e CO 1547 1 Asn Tyr Ser Leu Asn Ser Arg

CON 1471 1 His Asn Arg Glu Leu Pro He CON 2206 1 Asn Ser Ala Leu Asn Asn Ser CON 99 1 His Asn Arg Glu Ser Pro Val CON 1594 1 Asn Ser Gly Leu Asn Ser Val CON 189 1 Ala Pro Asn Arg Glu Ser Pro CON 1502 1 Asn Ser Glu Leu Asn Thr Arg CON 149 1 Asn Arg Glu Pro Pro Val Ala CON 143 1 1 Ash Tr Glu eu Asn Thr Leu CON 1173 1 His Asn Arg Glu Glu Pro He CON 29 .1 Thr Thr Asn Ser- Asp Leu Asn CON 142 1 Ala Asn Arg Glu He Pro Leu CON 1659 1 . Ser Gin Ser Thr He His Val CON 1409 1 Ala Asn Arg Glu Thr Pro Val CON 1603 1 Trp Gly Asn in Asp Leu Asn

CON 1568 1. Ala Pro Asn Arg Glu Leu Pro CON 354 1 Asn Ash Asp Leu Asn Thr Thr CON 1682 1 Tyr Asn Lys Glu His Pro lie CON 2 10 1 Asn Thr Leu Leu Asn Ser Asn

CON 135 1 1 Asn Asn Arg Glu Glu Pro He CON 27 ,1 Asn Thr Ser Leu Asn Ser Met CON 1414 1 Asn Arg Glu Pro Pro Val Ala GON 340 Asn Ser Ala. Leu Asn Ser Arg

CON 1307 1. Thr Asn Arg Glu Pro Pro He CON 17 18 1 Asn He Val Leu Asn Ser Arg CON 1 42 1 Met Tyr Leu Pro Asp Thr Ser CON 1542 1 Asn Gin Ala Leu Asn Ser Ser CON 409 1 His Asn Arg Glu Leu Pro Val 1 CON 376 1 Asn, Ala Thr Leu Asn Ser Lys CON 48 1 His Asn Arg,Glu Leu Pro He CON 13 1_1 Thr Asn He Asp Leu Asn Ser CON. 302 1 His Asn Arg Glu Ser Pro Val CON 58 1 Asp Asn Phe Asp Leu Asn Ser

CON 1662 1 Ala Asn Arg Glu He Pro Leu CON .1 528 1 Gly Gin Ser Thr Leu Trp Val

CON 191 7 .1 Ala Asn. Arg Glu His Pro Val CON 1539 1 Val Asn Thr Asp Leu Asn Ser

CON 1652 1 Gly Glu Thr Arg Ala Pro, Leu CON 474 1 Asn His Leu .Leu Asn Ser Thr CON 1105 1 Lys Pro Asn Arg Glu Pro Pro CON 1538 1 . Asn His Leu Leu Asn Ser Thr CON 383 1 Asn Asn Arg Glu He Pro He CON 307 1 Asn Leu Asp Teu Asn Thr Lys CON 37 1 Asn Arg Glu He Pro Leu Ala CON 10 1 Asn Val Leu Leu Asn Ser Arg CON 1416 1 . Asn Arg Glu Pro Pro Leu Leu CON 1324 1 Asn Val Leu Leu Asn Ser Ser CON 2021 1 Thr Asn Arg Glu Pro Pro He CON 1647 1 Asn Val Ala Leu. Ash Ser Thr CON 1167 1 Thr Pro Asn Arg Glu Thr Pro CON 145 1 1 · Asn Ser Ser Leu Asn Ser Gin CON_125 1_l Ser Asn Arg Glu Pro Pro Leu CON 1417 1 Asn Ser Met Leu Asn Ser Met

CON 2 11. 1 His Asn Arg Glu Pro.Pro Val CO 1345 1 Ser Thr Leu Asp lie Thr Thr

CON 3 18 1 His Asn Arg Glu Trp Pro Val CON 400 1 Asn Asn Asp Leu Asn Thr Lys CON_209 1 , eu Pro Ash Arg Glu Thr ro CON 482 1 Asn Asn Ser He Leu Asn Ser CON 1233 1 Ala Asn Arg Glu Val Pro Leu CON Γ593 1 Asn Thr Met Leu Asn Ser Gin

CON 1323 1 Ala Asn Arg Glu Thr Pro Leu CON 1386 1 Asn Thr Val Leu Asn Ser Lys CON 1160 1 Ala Asn Arg Glu Ser Pro Val CON 180 1 Asn Thr Phe Leu Asn Ser Thr CON 402· 1 Ala Asn Arg.Glu.Pro Pro He CON 1877 1 Asn Thr Thr Leu Asn Ser Met CON 525 1 Ala Asn Arg Glu I is Pro Val CON 269. 1 Ash Ser Leu eu Asn Ser Phe- CON 14 1 1 Ala Pro Asn Arg Glu Ala Pro CON 1738 1 Asn Ser Leu Leu Ash Ser Phe CON 1909 1 Tyr Asn Arg Glu Pro Pro e CON 1522 1 Asn Ser Phe Leu Asn Ser Thr CON 53 1 Tyr Asn Arg Glu Asp Pro Leu CON 34 1 Asn Gin Glu Leu Asn Thr Val CON 1 00 1 Asn His Asp Leu Asn Ser Pro CON 596 Asn.His Gly Leu Asn Ser Arg CON_7 1_1 Asn Leu Asp Leu Asn Thr Arg Consensus sequences MECP2 Round 3 consensus (100) p300 Round 3 consensus (100)

Xaa Asn Arg Glu Pro Pro [He Leu Val] Asn Ser [Asp Glu] Leu Asn Ser [Lys Arg]

As seen in Figure 9 the mimotope quality score reflects the fraction of recovered phages during the ChIP procedure as measured by QPCR. The calculation of quality scores is shown in Table. 3 as well as on Figure 9 A: Table 3 The mimotope quality score reflects the recovery in a CHIP reaction

Summa 337,8 1078,1

In a further refinement of the phage mimotope approach to develop ChIP controls, further rounds (fourth, fifth, sixth etc.) of mimotope selection by biopanning (fourth, fifth or sixth) are carried out to increase the average specificity of the mimotope mixture to the antibody. In a further refinement of the phage mimotope approach to develop ChIP controls, individual mimotope clones can be isojated, amplified to obtain monoclonal mimotope controls for ChIP protocols. An aliquote of the amplified phage eluate fro the third (or the final of any further) round of biopanning. is. used to infect a culture of any K.coli strain which is competent to M13KE phage-infection, then plated onto LB-Agar/IPTG/X-gal plates using the top agar protocol (Ph.D. ™ Phage Display Libraries Instruction Manual ,ΝΕΒ ). Blue plaques (10-100) are amplified separately to obtain single clones, and. amplified phages screened in a ChIP protocol for antibody binding and recovery. Fjfotti the ChIP validated phage clones will represent monoclonal, single stranded phage' DNA is purified (e.g. any NA purification kit capable of purifying single stranded DNA with a size of 7222 bases ) ChIP sequencing We have set the aim to provide appropriate controls to the ChlP-seq technology. Iri-this experimental setting two approaches were used: mapping histone modifications and mapping transcription factor binding sites. Acetylatiori of histone H3 Lys27 (H3K27ac) has recently been shown to be associated with many active mammalian genes and is typical of enhancer regions. In this experimerit genomic segments were mapped with the I13K 7ac specific antibody: . Technical replicates show a similar pattern on the promoter and enhancer of the FABP4 gene on mouse bone marrow macrophages (Figure 12). In a C P Seq experiment a nanoparticle (or.phage, virion) based controll that is bound by the antibody used i the specific GhIP- Seq experiment could serve as a process controll of the procedure. Fragment size optimization for CHIP sequencing The most often applied genome sequencing method is the Illumina "Sequencing by synthesis" methodology, in which clonally amplified. DNA to.be sequenced on a solid phase is obtained by a so-called. bridge amplification [Chee-Seng, Ku et al. Next Generation Sequencing Technologies and Their Applications. In: Encyclopedia of Life Sciences (ELS). John Wiley & Sons, Ltd: Chichester. April 2010]. The optimal DNA fragment length to the. bridge PCR.reaction is at most 300 bp. This size is appropriate for the ChTP-s'eq methodology as it corresponds to the size of two nucleosomes. It has been found that in case of fragments longer than 300 bp transcription factors can be detected with more difficulty. Two approaches have been used to overcome this difficulty.

1) Incomplete sonication results in fragments both of appropriate size and of larger ones. Therefore efficiency of the sonication had to be improved. On Figure 13 the fragment profile of a partially fragmented sample is shown wherein ChIP data still could be obtained with a sufficient efficiency. 2) A second approach is the application of a different fragmentation method. A suitable tool is the Micrococcal nuclease method. An advantage of this method is that it is gentle, i:e. that probably leaves large protein complexes intact, and that replaces the expensive sonicator equipment. On Figure 14 it is shown that DNAse based fragmentation of chromatine was successfully established. Fixation methods When we have attempted transcription factor detection by the ChIP Seq method we have faced the following problem. A part of the transcription factors is not linked with the DNA by the traditional formaldehyde based fixation method. The probable reason is that distances in the complex are probably longer than that can be bridged by this small molecule. Therefore disuccinimidyl glutarate (DSG) has been.used which can form even a molecular bridge of 7.7A. By this methodology good quality ChlP-seq data were produced with transcription factors. As a positive control the phage library as disclosed herein can b applied. A kit for this purpose preferably comprises DSG as a cross-linking agent; Detection b ELISA As an alternative means for detection, sandwitch (capture) ELISA method was also evaluated for the quantification of phages in the ChIP output using a Phage Titration, ELISA Kit (PRPHAGE, PROGEN) by

following' the manufacturer's instructions Briefly, serial dilution of M l 3 phage was prepared (at O7, 2.5 x 107, 5 x 107, 1 8 .phage particles/ml final concentrations in 100 u final assay volume, and in addition, at 104 ,10 5 , 106 phage particles/ml final concentrations, as being relevant to ChIP output phage final concentrations), added to ELISA strips (8-well) pre-coated by the capture antibody for M13 phage, and blocked.with BSA, after 1 hour incubation at room temperature, wells were washed and treated with the detection antibody. After several washing steps, wells were developed and absorbance of well contents were determined at 450 nm. The results shows (represented in Figiire 11)-that the sensitivity of the above ELISA measurement drops significantly below a concentration or 10· phage particles/ml. Other LISA methods may be used or improvement of the existing protocols may lead to an increased sensitivity of the method for phage quantification at the concentration range of 104-10^ phage particles/ml, which. is relevant to concentrations observed in ChIP output samples using M phage specific qPCR. Using phage controls in conventional immunoprecipitation A mature M13KE phage preparation, either displaying the specific epitope peptide for, or a mixture of phage clones selected in .a biopanning, process on the specific antibody to be used ;in the immunoprecipitation experiment, is used as a positive control for antibody specificity and complex formation. In analogy to the immunoprecipitation reaction, the specific antibody binds to phages which either contain its specific epitope peptide, or a mixture of peptide sequences to which the antibody is capable of binding (mimotopes selected from a random peptide phage display library), the complexes are then be precipitated usind protein A or G beads, and finally, phages remaining bound after washing are detected and/or quantified by either M l 3KE phage specific qPGR, or phage coat protein specific ELISA, or phage coat protein specific Western blotting.

Into aliquots of a cleared supernatant of a cell lysate or tissue homogenate (e.g. 10 million cell 's are collected by centrifugation and resuspended in 1 ml lysis buffer containing 1% Triton X-lOO, 5 m M EDTA, proteinase inhibitor coctail, 1 mM PMSF in 10 mM I RIS. HQ, pH 7.6), we add the phage preparations to a final concentration of 1 cfu/ml, or 104 cfu/ml, or 105 cfu/ml, or 06 cfu/ml, or 107 cfu/ml, or l O8 cfu/ml, or 109 cfu/m! (e.g. via diluting of a phage stock of TO 3 pfu/rril). The phage-treated lysate aliquots are rotated at 4 °C for 3.0 min, followed. y centrifugation at 20 000 x g for 30 min a <4 °C in a tabletop microfuge. An.aliquot (e.g. 3-5 %) is saved as the input sample, and treated in accordance with the type of its downstream processing; that is. phage quantification (e.g. for SDS-PAGE and Western blotting, add equal volume of 2x Laemli buffer, boil for 5 min; store at 4 oC for ELISA or qPCR measurements). To the remaining phage-treated aliquots (95-97 %), 1-2 ug specific antibody "is added-and rotated-at 4 °C for 2-3 hours to allow aritibody-phage comple formation to occur. Protein A/G Sepharose (Santa Cruz Biotech) or Protein A/G magnetic beads (DynaBeads). are prepared (e.g. washed with lysis buffer according to the manufacturer's instructions) for antibody binding (in an Fc- specific manner), arid 30-50 ul of a 30-50% slurry is added per 1 ml phage-treated aliquote and rotate at 4 o.G for 1 hour to allow precipitation of the immune complexes. Collect precipitate either by centrifugation (e.g. 4000 g, 1 min for Protein A G Sepharose) or using a magnet (for Protein A G magnetic beads), aspire supernatant, remove supernatant, wash the beads (in pellet or retained by the magnet) with an equal volume of lysis buffer to the initial sample Volume, repeat the precipitate collection as above, wash 2 more times e.g. For analysis on SDS-PAGE or Western blotting, add equal volume of 2 I.aemmli buffer; or for analysis i ELISA o qP.CR measurements add 30 ul lysis buffer and store at 4 oC. Example f a reagent kit: a. A typical example of our reagent kit would provide:

i. A solution of positive control phage in a concentration of 1,00 k uriifs/micfoliter. ii. A solution of empty negative control phage in a concentration of 100 uhits/microliter. iii. A QPCR assay sufficient for 96 QPCR reactions in 50 microliters final volume detecting the phage. iv. QPCR mastermix sufficient for 96 QPCR reactions in 50 microliters final volume. v. Antibody for which the phage contrdll system was developped in a volume sufficient for 24 CHIP reactions. vi. IgG control in a volume-sufficient fpr 24 CHIP reactions. vii. A detailed manual on how to prepare chromatin for the investigation and detailed description of the recommended ChIP method. INDUSTRIAL APPLICABILITY An advantage of the controls of the invention is that they comprise both an epitope of an appropriate target and a nucleic acid encoding it, therefore in a ChIP experiment they work a very similar way to chromatin itself. The system of the invention have the following features. One can easily asses the efficiency of virtually any immunoprecipitation reaction preferably but not limited to Chromatin immunoprecipitation. One can easily calculate the how many epitopes can be recovered by the tested antibody and by this a new QC parameter can be added to the antibodies. By adding the spike controls to the samples one can monitor the workflow. Any significant loss of the spike^ during the procedure will prevent further laborious and expensive investigation such as deep sequencing. Binding capacity of an antibody epitope can be precisely determined in a given experimental setup and thereby work-flow can be optimized- The assays of the invention can be widely used to study proteins, e.g. nucleic acid binding proteins including both histones and non-histone proteins, such as transcription factors, e.g. within the context of the cell. CLAIMS 1.Use of a nanoparticle for providing control in an immunoprecipitation;reaction carried out with a recognition moleciile, said nanoparticle comprising a nucleic acid and a polypeptide carrying an epitope, wherein the 5 nucleic acid comprises a traceable oligonucleotide segment, wherein said epitope peptide is displayed on the surface of the nanoparticle and recognized by said recognition molecule in the immunoprecipitation reaction. 2. Use of a virus or virion for providing control in an immunoprecipitation reaction carried out with a recognition molecule, wherein the genetic material of the virus or virion comprises a traceable oligonucleotide segment in its genome encoding an epitope peptide, wherein said epitope peptide is displayed 10 by the virion.and recognized by said recognition molecule in t e immunoprecipitation reaction. 3. The use according to claim 1 wherein the nanoparticle is a virus, preferably a virion. 4.The use according to claim 2 or 3 wherein the virus is a bacteriophage. 5. The use according to any of claims 1 to 4 wherein the immunoprecipitation reaction is nucleic acid immunoprecipitation selected from 15 - a direct nucleioacid immunoprecipitation and - immunoprecipitation of a complex containing a nucleic acid, preferably chromatin.immunoprecipitation. 6. inimunoprecipitation kit,;said kit comprising - precognition molecule recognizing an antigen epitope.for use ih immunoprecipitation, - a positive control nanoparticle, said nanoparticle comprising a nucleic acid and a polypeptide carrying 20 an epitope, wherein the nucleic acid comprises a traceable oligonucleotide segment and optionally - a negative control nanoparticle lacking said oligonucleotide and epitope but preferably having a .nucleic acid and a polypeptide (preferably a negative control bacteriophage lacking said oligonucleotide and epitope,) 25 - means for detecting the binding of said recognition molecule to said antigen epitope, preferably means for amplification of said positive control bacteriophage and optionally said negative control bacteriophage, - support or carrier for binding said.recognition molecule, preferably beads. 7.The irnmunoprecipjtation kit of claim 6 for use in a nucleic acid immunoprecipitation, said kit comprising as a 30 means for amplification oligonucleotide primers, preferably QPGR primers for amplification of displayed epitope coding sequence,- and/or QPCR primers for amplification of the bacteriophage sequence.

. n i un p cip tatio method said me c l comprising the steps of. ÷providing a set of samples comprising an antigen or a target protein carrying an epitope, - adding a recognition molecule recognizing an epitope of said antigen (antigen epitope) to one or more :35 samples from the set of samples, - adding a positive control nanoparticle^- said nanoparticle comprising a nucleic acid and a polypeptide carrying an epitope; wherein the nucleic acid comprises a traceable oligonucleotide segment, - optionally adding a negative control nanoparticle lacking said epitope to one or more samples from the set of samples, 40 - adding the recognition molecule to the set of samples - carrying out the immunoprecipitation reaction, - detecting the binding of the recognition. molecule to the displayed epitope. 9. The immunoprecipitation method according to claim 3 wherein immunoprecipitation is a nucleic acid - protein complex immunoprecipitation, preferably chromatin immunoprecipitation said method further compri sing fragmenting^ the nucleic acid - protein complex, and binding the antigen and thereby those fragments bound by the antigen to the recognition molecule, wherein preferably the recognition molecule is bound to a support or carrier. 10. The method according to any of claims 8 to 9 wherein the detection of the binding of the recognition molecule to the displayed epitope is carried out by - amplifying a region coding the displayed epitope from the traceable nucleic acid from the nanoparticle, and/or - adding the nucleic acid fragments bound by the antigen to a chip comprising a multiplicity of nucleic acid sequences wherein preferably at least one of them is complementary to a sequence of the nucleic acid, preferably to the sequence encoding the epitope region, and/or - sequencirig;thevnucleic acid fragment bound by the antigen. 11. The use of a multiplicity of virions as a control in an immunoprecipitation reaction, said multiplicity of virions comprising an oligonucleotide segment in their genome said segment encoding a peptide, wherein said peptide is displayed by said virions and comprises an epitope or an immunogenic portion, wherein the epitope or the immunogenic portion is 5-20, preferably 7 or 8 amino acids long and wherein said peptide is capable of binding to a recognition molecule bound to a carrier, wherein preferably the carrier comprises protein A or protein G or any combination thereof. 12. The use according to claim 11 wherein the multiplicity of virions is used as a positive control. 13. The use according to any of claims 11 to 12 wherein a further multiplicity of virions are used as a negative control in said immunoprecipitation reaction said further multiplicity of virions comprising an oligonucleotide segment in their genome said segment encoding a further peptide, said further peptide lacking said epitope or immunogenic portion.

14. The use according to any of claims 11 to 13 wherein the virions are bacteriophages. 15. The use according to any of claims 11 to 14 wherein the immunoprecipitation is chromatin immunoprecipitation.