Unraveling the Role of B Cells in the Pathogenesis of an Oncogenic Avian Herpesvirus

Unraveling the role of B cells in the pathogenesis of an oncogenic avian herpesvirus

Luca D. Bertzbacha, Maria Laparidoub, Sonja Härtlec, Robert J. Etchesd, Bernd Kaspersc, Benjamin Schusserb,1, and Benedikt B. Kaufera,1

aInstitut für Virologie, Freie Universität Berlin, 14163 Berlin, Germany; bBiotechnologie der Reproduktion, Technische Universität München, 85354 Freising, Germany; cVeterinärwissenschaftliches Department, Institut für Tierphysiologie, Ludwig-Maximilians-Universität München, 80539 Munich, Germany; and dLigand Pharmaceuticals, Inc., San Diego, CA 92121

Edited by Bernard Roizman, The University of Chicago, Chicago, IL, and approved September 21, 2018 (received for review August 15, 2018) Marek’s disease virus (MDV) is a highly oncogenic alphaherpesvi- virus to the feather follicle epithelia, where infectious virus is rus that causes immunosuppression, paralysis, and deadly lympho- produced and shed into the environment. + mas in chickens. In infected animals, B cells are efficiently infected In addition, MDV is able to transform CD4 T cells, resulting and are thought to amplify the virus and transfer it to T cells. MDV in the development of deadly lymphomas. To recruit the target + subsequently establishes latency in T cells and transforms CD4 cells to the site of infection, MDV expresses a CXC chemokine T cells, resulting in fatal lymphomas. Despite many years of re- (vIL-8), which is a functional ortholog of chicken CXCL13 (11). + search, the exact role of the different B and T cell subsets in vIL-8 allows the recruitment of B cells and a subset of CD4 MDV pathogenesis remains poorly understood, mostly due to T cells that are thought to be the target cells for establishment of the lack of reverse genetics in chickens. Recently, Ig heavy chain latency and transformation (12). J gene segment knockout (JH-KO) chickens lacking mature and As B cells are efficiently infected in vivo and in vitro, several peripheral B cells have been generated. To determine the role of laboratories tried to address the role of B cells and the bursa in these B cells in MDV pathogenesis, we infected JH-KO chickens MDV pathogenesis. B cells were depleted by various chemicals, with the very virulent MDV RB1B strain. Surprisingly, viral load X-ray irradiation, and/or surgical removal of the bursa of Fab- in the blood of infected animals was not altered in the absence ricius, the site of B cell development in the chicken (13–20). of B cells. More importantly, disease and tumor incidence in JH-KO Virus replication and pathogenesis in these animals were either MICROBIOLOGY chickens was comparable to wild-type animals, suggesting that decreased, increased, or unaltered, and therefore did not provide both mature and peripheral B cells are dispensable for MDV path- a conclusive answer to the role of these B cells in MDV patho- ogenesis. Intriguingly, MDV efficiently replicated in the bursa of genesis. This could be due to differences in the treatments and Fabricius in JH-KO animals, while spread of the virus to the spleen and thymus was delayed. In the absence of B cells, MDV readily their side effects as well as the levels of B cell depletion. infected CD4+ and CD8+ T cells, allowing efficient virus replication Therefore, the true role of infected B cells in the MDV life cycle in the lymphoid organs and transformation of T cells. Taken to- has remained elusive. gether, our data change the dogma of the central role of B cells, Here, we made use of transgenic knockout (KO) chickens to and thereby provide important insights into MDV pathogenesis. address the role of B cells in MDV replication and pathogenesis in infected chickens. These KO chickens lack mature and pe- Marek’s disease virus | B cells | lymphomagenesis | Ig knockout chickens | ripheral B cells, but still harbor immature progenitor lympho- transgenic chickens cytes in the bursa (21). This was achieved by deleting the J gene segment of the Ig Y heavy chain gene (JH) locus as previously arek’s disease virus (MDV) is a highly oncogenic herpes- Mvirus that causes a variety of clinical symptoms in its nat- Significance ural host, the chicken (1). The symptoms include immunosuppression, polyneuritis, transient paralysis, acute brain edema, and, most Marek’s disease virus (MDV) infects chickens and causes the most notably, fatal T cell lymphomas (2). MDV-induced lymphoma frequent clinically diagnosed cancer in the animal kingdom, and is considered to be the most prevalent clinically diagnosed it is used as a small-animal model for virus-induced tumor for- cancer in the animal kingdom (3). In infected chickens, MDV mation. Until now, B cells were thought to play a central role in MDV pathogenesis. We disproved this dogma using knockout infection only spreads by cell-to-cell transmission and can cause (KO) chickens that lack mature and peripheral B cells. We dem- a mortality rate of up to 100% (1). Current MDV vaccines are onstrated that B cells are dispensable for virus replication, virus highly effective in minimizing commercial losses. Cell-mediated spread, and tumor formation. In the absence of B cells, T cells immunity plays an important role in the protection against facilitate efficient virus replication and are subsequently trans- MDV (4). In contrast, humoral responses play a minor role and formed, resulting in deadly lymphomas. Our data pioneer the maternal antibodies only delay the development of clinical signs use of KO chickens in infectious disease research and expand the and tumors (5). knowledge on the life cycle of this highly oncogenic virus. According to the generally accepted model of the MDV life cycle, infectious viral particles are inhaled with the dust from a Author contributions: L.D.B., B.K., B.S., and B.B.K. designed research; L.D.B., M.L., and S.H. contaminated environment (6). In the lung, antigen-presenting performed research; M.L., S.H., R.J.E., and B.S. contributed new reagents/analytic tools; L.D.B. and B.B.K. analyzed data; and L.D.B. and B.B.K. wrote the paper. cells (APCs) like macrophages and dendritic cells are infected The authors declare no conflict of interest. and transfer the virus to lymphoid tissues, where the virus is This article is a PNAS Direct Submission. passed on to B cells. B cells are thought to serve as the main Published under the PNAS license. target for productive MDV replication and transfer the virus to 1To whom correspondence may be addressed. Email: [email protected] or b. T cells, the primary target cells for establishment of latency (7). [email protected]. MDV integrates its genome into the telomeres of latently in- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. fected T cells, thereby ensuring efficient maintenance of the 1073/pnas.1813964115/-/DCSupplemental. genetic material of the virus (8–10). T cells also transport the

www.pnas.org/cgi/doi/10.1073/pnas.1813964115 PNAS Latest Articles | 1of5 Downloaded by guest on October 2, 2021 described in mammalian species (22–25), resulting in the abro- gation of B cell maturation and migration out of the bursa. To study the role of B cells in MDV pathogenesis, we infected wild- + − − − type (wt), heterozygous (JH / ), and homozygous (JH / )JH-KO birds. Surprisingly, we could demonstrate that mature and peripheral B cells are completely dispensable for MDV pathogenesis. In the absence of B cells, MDV efficiently replicated in + + the target cells for latency and transformation (CD4 and CD8 T cells) resulting in disease progression, tumor formation, and dissemination. Our study thereby disproves the current dogma of the crucial role of B cells and provides important insights into the MDV pathogenesis. Results Infection and Confirmation of B Cell KO Chickens. To determine the role of B cells in MDV pathogenesis and tumor formation, we used transgenic chickens that lack mature and peripheral B cells (JH-KO). The genotype of all animals was determined post- hatching by PCR assays as described previously (21). We sub- + − − − sequently infected 1-d-old wt (n = 17), JH / (n = 22), and JH / (n = 21) chickens intraabdominally with the very virulent RB-1B − − MDV strain. To confirm that the JH / chickens indeed lack B cells, we assessed the presence of antibodies in the blood by Fig. 2. MDV pathogenesis in the absence of B cells. (A) qPCR analysis of ELISA 28 d postinfection (dpi) as described previously (21). We MDV genome copies in the blood of wt, JH+/−, and JH−/− chickens at 4, 7, 10, demonstrated that IgM antibodies were completely absent in 14, and 28 dpi. Mean MDV genome copies per 1 million cells with the SD − − −/− +/− JH / animals and comparable to the PBS control (Fig. 1A), (error bars) are shown for eight chickens per group (JH vs. wt and JH : > – suggesting that no mature and peripheral B cells were present. In P 0.05, Kruskal Wallis test). Disease (B) and tumor incidence (C) of infected −/− animals at termination of the experiment. Results are shown as the per- addition, IgY titers in JH chickens were highly reduced = +/− = −/− +/− centage of affected animals per group [wt (n 17), JH (n 22), and JH compared with wt and JH chickens, indicating that only re- (n = 21)]. No significant difference was observed (Kruskal–Wallis test). Nec- sidual maternal antibodies are present at day 28 (Fig. 1B). Be- ropsies were performed on chickens upon onset of clinical symptoms or after yond that, we confirmed the absence of B cells in the spleen of termination of the experiment. MD, Marek’s disease. (D) Mean number of − − JH / chickens by immunohistochemistry using the B cell marker affected organs harboring gross tumors per animal with the SD (error bars). AV20 (Fig. 1C). No significant difference was observed (Kruskal–Wallis test).

MDV Replication and Tumor Formation Are Not Altered in the A Absence of B Cells. To examine if MDV replication is altered in (Fig. 2 ), suggesting that B cells are not required for the am- the absence of B cells, we analyzed MDV genome copy numbers plification of the virus during lytic replication. Furthermore, disease incidence was not altered in chickens that lack B cells in peripheral blood by qPCR. Surprisingly, MDV could effi- B ciently replicate in the absence of B cells in the infected animals compared with their hatch mates (Fig. 2 ), indicating that B cells are not required for the development of Marek’s disease. Beyond that, no significant difference in tumor incidence was observed + − compared with wt and JH / animals until 13 wk postinfection (Fig. 2C), suggesting that B cells are also dispensable for the transformation process and lymphomagenesis. Furthermore, the dissemination of tumors was not altered in the absence of B cells (Fig. 2D). These data demonstrate that mature and peripheral B cells are dispensable for virus replication in vivo, disease development, tumor formation, and dissemination.

B Cells Are also Dispensable in the Natural Infection of MDV. To confirm that mature and peripheral B cells are also not required during natural infection via the respiratory route, we housed naive contact chickens together with the intraabdominally infected animals. MDV spread to naive individuals that do not have B cells, indicating that B cells in the lung are not essential for early infection via the natural route. As observed in the ex- perimentally infected animals, disease and tumor incidence was also not altered in naturally infected animals in the absence of B cells (Fig. 3). Taken together, our data confirm that mature and peripheral B cells are dispensable for MDV pathogenesis during natural infection.

MDV Efficiently Spreads to Lymphoid Organs in the Absence of B Fig. 1. Confirmation of the absence of B cells in infected KO chickens. + − − − Cells. Quantification of total IgM (A) and IgY (B) in serum from wt, JH / ,andJH / To determine if B cells play a role in the initial spread of chickens by ELISA at 28 dpi. The mean values with the SD (error bars) of the virus to the lymphoid organs during early lytic infection (26), seven chickens per group are shown. (C) Representative images of chicken B we investigated the viral load in the major lymphoid organs in + − − − +/− −/− cell marker (AV20) immunofluorescence staining of JH / (Left) and JH / chickens with (JH ) and without (JH ) B cells at 4, 7, 10, and (Right) spleen tissues (4 dpi). (Scale bars: 20 μm.) 14 dpi by qPCR. Intriguingly, MDV efficiently spread to the

2of5 | www.pnas.org/cgi/doi/10.1073/pnas.1813964115 Bertzbach et al. Downloaded by guest on October 2, 2021 cells, resulting in high viral titers in the major lymphoid organs, disease progression, and tumorigenesis. Discussion Until now, B cells were thought to be the primary target cells for MDV lytic replication and responsible for virus amplification in susceptible hosts (reviewed in refs. 1, 28). This was mostly based on the observation that B cells are efficiently infected in vitro and in vivo. Others previously set out to address the role of B cells and the bursa in MDV pathogenesis by either chemical depletion of B cells and/or surgical removal of the bursa of Fabricius as the site of B cell development. Unfortunately, these Fig. 3. B cells are also dispensable in natural MDV infection. Naive wt (n = studies did not provide a clear answer to the role of B cells as +/− = −/− = 11), JH (n 8), and JH (n 11) chickens were housed together with disease and tumor incidence in these animals was increased (20), infected animals. The percentages of animals with disease (A) and tumors (B) – are shown upon infection via the natural route (P > 0.05, Kruskal–Wallis was decreased (13 17), or did not show any difference compared test). MD, Marek’s disease. with the controls (18, 19). These divergent results could have been caused by off-target effects of the drugs, treatments, and degree of B cell depletion. For example, drug treatment can bursa in the absence of mature and peripheral B cells until 4 dpi affect other lymphocyte populations such as T cells, the main (Fig. 4A). Replication in the bursa was comparable throughout target cell for establishment of latency and transformation, and the experiment, highlighting that mature and peripheral B cells can result in incomplete removal of B cells. Similarly, a partial are dispensable for lytic replication in this lymphoid organ. Viral resection of the bursa would only result in a reduced level of B load in the thymus was significantly reduced at day 4 post- cells. Furthermore, removal of the bursa not only affects the infection (Fig. 4B) and severely reduced in the spleen at day 4 development of B cells but also removes the pool of immature postinfection (Fig. 4C). Taken together, these data indicate that progenitor lymphocytes of the bursa, as discussed further below. B cells may support early dissemination of MDV into the lym- Unfortunately, until recently, there was no KO technology available in chickens to address this long-standing question.

phoid organs. However, similar viral levels were reached be- MICROBIOLOGY tween 7 and 14 dpi, suggesting that the virus can efficiently Schusser et al. (21) recently generated and extensively char- acterized KO chickens in which the JH was deleted. This de- replicate in the absence of B cells once it reaches thymus, bursa, letion abrogates B cell maturation and antibody production in and spleen. Our data show that mature and peripheral B cells are these chickens, as shown above (Fig. 1 A and B). Also, no B cells dispensable for the spread of MDV within the infected host. −/− were detected in tissue samples of JH KO chickens by im- C MDV Lytically Infects CD4+ and CD8+ T Cells in the Absence of B Cells. munohistochemistry (Fig. 1 ). Immature progenitor lympho- To identify the cell types infected in the absence of peripheral cytes still migrate into the bursa, but do not leave this lymphoid organ (21). To elucidate the role of mature and peripheral B and mature B cells, we performed immunohistochemistry on the cells, we infected these chickens with the very virulent RB-1B major lymphoid organs at 7 dpi and quantified the infected MDV strain. Surprisingly, virus load in the blood was not altered target cells. In the presence of B cells, MDV predominantly in- in the absence of the B cells in these animals compared with their fected B cells in the spleen (Fig. 5B) as described previously (27). +/− + + wt and JH siblings (Fig. 2A). This indicates that either B cells In contrast, MDV almost exclusively infected CD4 and CD8 do not significantly contribute to the viral load in the blood or T cells in the spleen in the absence of B cells (Fig. 5B). Similarly, + + other cells can compensate for the loss of peripheral B cells. In CD4 and CD8 T cells were the main target in the thymus and addition, disease and tumor incidence was not altered in ex- −/− bursa of infected JH chickens (SI Appendix, Fig. S1 A and B). perimentally infected animals that lack B cells (Fig. 2 B and C). Intriguingly, very few immature B cells were infected in the bursa This scenario was also observed in animals that were infected via −/− of JH chickens, suggesting that these cells are not very per- the natural route of infection (Fig. 3). missive to infection. Our data demonstrate that infection of the In our experiments, we also found that JH-KO chickens and + + target cells for latency and transformation (CD4 and CD8 their wt siblings are relatively resistant to MDV infection. Viral T cells) compensates for the loss of peripheral and mature B load in the blood as well as disease and tumor incidence were

+ − − − Fig. 4. Virus spread to lymphoid organs in the absence of B cells. qPCR analysis of MDV genome copies in the bursa (A), thymus (B), and spleen (C)inJH / and JH / chickens at 4, 7, 10, and 14 dpi. Mean MDV genome copies per 1 million cells with the SD (error bars) are shown for three chickens per group and time point. Significant differences between JH+/− and JH−/− chickens (*P = 0.05 compared with JH+/−, Wilcoxon–Mann–Whitney test) are indicated with an asterisk.

Bertzbach et al. PNAS Latest Articles | 3of5 Downloaded by guest on October 2, 2021 phase of MDV replication, we analyzed the key lymphoid organs: the bursa, thymus, and spleen. We observed that within 4 d, MDV spreads to the major lymphoid organs even in the absence of peripheral B cells. Although viral load in the thymus and spleen was reduced in the first 4 dpi, the trend of viral replication in the primary lymphoid organs was similar in chickens lacking mature B cells and their normal siblings (Fig. 4A), indicating that other cells can compensate for the loss of B cells. The delay in the spread of the virus to the thymus and spleen suggests that B cells only play a minor role in the early dissemination of the virus. Although B cells were thought to be the main target population of MDV replication in wt animals, other targets have been identified. For example, it has been shown that MDV can productively replicate in phagocytes such as macrophages (31, 32) and T cells (27, 33, 34) in vitro. Our data revealed that MDV replicates in the primary target cells for latency and trans- + + formation, CD4 and CD8 T cells, in the absence of B cells in vivo. Similarly, immature lymphocyte progenitor cells were infected in the bursa, however, to a much lesser extent than mature B cells in wt animals. In summary, we addressed the role of mature and peripheral B cells in the pathogenesis of MDV, an important veterinary pathogen that is also frequently used as an animal model for herpesvirus-induced tumor formation. Our data surprisingly demonstrate that B cells are dispensable targets of MDV. Within 4 dpi, the virus reaches the bursa, thymus, and spleen independent of B cells. Once MDV reaches these major lymphoid organs, the virus is rapidly amplified in both wt and JH-KO chickens. In the absence of B cells, the target cells of latency and transformation + + (CD4 and CD8 T cells) are directly infected and compensated for the loss of B cells during lytic replication. These data pioneer the use of KO technology to study infectious disease in chickens. In addition, they unequivocally refute the current dogma of the crucial role of B cells in MDV pathogenesis and refocus future studies onto other target cells infected by the virus.

+ + Fig. 5. Infection of CD4 and CD8 T cells compensates for the lack of B Materials and Methods cells. (A) Representative immunohistochemistry images of infected B cells Ethics Statement. All animal work was conducted according to relevant na- + + +/− −/− (AV20) and CD4 and CD8 T cells in the spleens of JH and JH chickens tional and international guidelines for humane use of animals. Animal ex- at 7 dpi. Images show cell nuclei (DAPI, blue), the indicated cellular marker periments were approved by the Landesamt für Gesundheit und Soziales in (red), and virus antigens (green). Infected AV20+ cells were not detected − − Berlin (approval no. G 0218/12). (n.d.) in JH / chickens. (Scale bars: 10 μm.) (B) Quantification of infected B + + cells and CD4 and CD8 T cells in the spleen (n = 304). + − In Vivo Experiments. One-day-old MDV maternal antibody-positive wt, JH / , − − and JH / chickens (21) were infected intraabdominally with 4,000 plaque- forming units of the very virulent RB-1B clone (GenBank EF523390.1) (35). similar to resistant chicken lines [e.g., N2a (29, 30)]. However, RB1B stocks were propagated in passaged chicken embryo cells that were our animals were less susceptible than other chicken lines fre- generated from Valo specific-pathogen-free embryos (Lohman Tierzucht) quently used in MDV research. This is likely due to the outbred and maintained in MEM supplemented with 10% FBS (PAN-Biotech) and penicillin/streptomycin (Applichem) at 37 °C and 5% CO2. Heterozygotes nature of the JH-KO chickens, which tend to be more resistant + − (JH / ) still develop mature and peripheral B cells and produce antibodies to MDV. comparable to wt birds. Naive chickens were housed with infected animals A prerequisite for disease and tumor formation is efficient to assess transmission via the natural route of infection. Water and food virus replication in the host. To assess the early events in the lytic were provided ad libitum. Blood samples were taken from infected animals

Table 1. Primers and probes for genotyping and qPCR Construct name Direction Sequence (5′ → 3′)

wt region For ATGGGGCCACGGGACCGAA Rev GCCCAAAATGGCCCCAAAAC JH-KO region For AGTGACAACGTCGAGCACAGCT Rev GCCCAAAATGGCCCCAAAAC ICP4 (qPCR) For CGTGTTTTCCGGCATGTG Rev TCCCATACCAATCCTCATCCA Probe FAM-CCCCCACCAGGTGCAGGCA-TAM Inducible nitric oxide synthase (qPCR) For GAGTGGTTTAAGGAGTTGGATCTGA Rev TTCCAGACCTCCCACCTCAA Probe FAM-CTCTGCCTGCTGTTGCCAACATGC-TAM

For, forward; Rev, reverse.

4of5 | www.pnas.org/cgi/doi/10.1073/pnas.1813964115 Bertzbach et al. Downloaded by guest on October 2, 2021 at 4, 7, 10, 14, 21, and 28 dpi. Chickens were monitored for clinical symp- Immunohistochemistry. Tissue samples were snap-frozen in liquid nitrogen toms of Marek’s disease on a daily basis throughout the 91-d experiment. and stored at −80 °C. Before sectioning, samples were embedded in Tissue- To eliminate bias, the examining veterinarian had no knowledge of the Tek (Sakura Finetek). Cryostat sections (5 μm thick) were mounted on Super genotypes of the birds throughout the experiment. Animals were eutha- FrostPlus slides (Thermo Fisher Scientific), air-dried, and fixed in 4% para- nized and examined for tumor lesions either once clinical symptoms were formaldehyde for 15 min. Sections were rehydrated in PBS and blocked for 1 h evident or after termination of the experiment. with 1% BSA and 2.5% normal goat serum (Dianova) in PBS. This was followed by a 1-h incubation at room temperature (RT) with a mixture of anti-VP5 Genotyping. DNA was isolated from the blood of chickens using the E-Z96 96- (clone F19, 1:3,000) and anti-ICP4 (clone E21, 1:1,000) kindly provided by well blood DNA isolation kit (Omega Biotek) according to the manufacturer’s Jean-Francois Vautherot (INRA Centre Val de Loire, Nouzilly, France), followed instructions. PCR primers specific for the J gene segment deletion and the wt by an overnight incubation at 4 °C with goat-anti-mouse IgG1-AlexaFluor555 locus were used as described previously (21) (Table 1). (1:500; SBA) and blocking for 1 h with normal mouse serum (5% in PBS). Fi- nally, the cell surface markers anti-CD4-AlexaFluor647 (clone CT4, 1:100; SBA) ELISA. Total plasma IgM and IgY were measured as described previously (21). and anti-Bu1-AF647 (clone AV20, 1:200; SBA) were added for 1 h at RT. For anti- Briefly, enzyme immunoassay plates (Sarstedt) were coated with 2 μg/mL CD8 staining, anti-CD8 [clone 3-298 (37), supernatant 1:50] was added simulta- goat anti-chicken IgM (Biomol) or goat anti-chicken IgY (Biomol) overnight. neously with anti-MDV antibodies and anti-mouse IgG2b-APC (1:400; Jackson Plates were blocked with 4% (wt/vol) skim milk and incubated with chicken ImmunoResearch Europe) together with anti-mouse IgG1-AlexaFluor555. – plasma for 2 h. Bound chicken IgM or IgY was detected with goat anti- Sections were counterstained with DAPI (100 ng/mL; Sigma Aldrich) for chicken IgM-HRP (Biomol) or goat anti-chicken IgY-HRP (Biomol) and de- 10 min and mounted in ProLong Glass Antifade Mountant (Thermo Fisher veloped with 3,3′,5,5′-tetramethylbenzidine substrate. The OD at 450 nm Scientific). Images were taken using a VisiScope spinning disk confocal mi- was measured. All samples were measured in duplicate. croscope (Visitron Systems GmbH). Images were processed using ImageJ software v1.51 (NIH). At least 100 infected cells per organ were evaluated. Quantification of MDV Genome Copies. DNA was isolated from the blood as described above. In addition, DNA was isolated from the bursa, thymus, and ACKNOWLEDGMENTS. We thank Ann Reum (Freie Universität Berlin), Theresa Thoma (Technische Universität München), and Marina Kohn (Ludwig- spleen of infected animals using the innuSPEED Tissue DNA Kit (Analytik Jena) ’ Maximilians-Universität München) for technical assistance and Ibrahim Alzuheir according to the manufacturer s instructions. MDV genome copies were (Freie Universität Berlin) for helping with the animal experiments. This work was determined by qPCR using specific primers and a probe for the gene supported by the International Max Planck Research School for Infectious Dis- encoding MDV ICP4. ICP4 copy numbers were normalized against cellular eases and Immunology (L.D.B.) and by the Deutsche Forschungsgemeinschaft inducible nitric oxide synthase as described previously (36) (Table 1). (DFG) Grants KA 3492/3-1 (to B.B.K.) and Schu 2446/3-1 (to B.S. and M.L.).

1. Osterrieder N, Kamil JP, Schumacher D, Tischer BK, Trapp S (2006) Marek’s disease 20. Morris J, Jerome F, Reinhart B (1969) Surgical bursectomy and the incidence of MICROBIOLOGY virus: From miasma to model. Nat Rev Microbiol 4:283–294. Marek’s disease (MD) in domestic chickens. Poult Sci 48:1513–1515. 2. Nair V (2005) Evolution of Marek’s disease–A paradigm for incessant race between 21. Schusser B, et al. (2013) Immunoglobulin knockout chickens via efficient homologous the pathogen and the host. Vet J 170:175–183. recombination in primordial germ cells. Proc Natl Acad Sci USA 110:20170–20175. 3. Parcells MS, Burnside J, Morgan RW (2012) Marek’s disease virus-induced T-cell lym- 22. Ménoret S, et al. (2010) Characterization of immunoglobulin heavy chain knockout phomas. Cancer Associated Viruses. Current Cancer Research (Springer, New York), pp rats. Eur J Immunol 40:2932–2941. 307–335. 23. Chen J, et al. (1993) Immunoglobulin gene rearrangement in B cell deficient mice 4. Sharma JM, Witter RL (1975) The effect of B-cell immunosuppression on age-related generated by targeted deletion of the JH locus. Int Immunol 5:647–656. resistance of chickens to Marek’s disease. Cancer Res 35:711–717. 24. Mendicino M, et al. (2011) Generation of antibody- and B cell-deficient pigs by tar- 5. Boodhoo N, Gurung A, Sharif S, Behboudi S (2016) Marek’s disease in chickens: A geted disruption of the J-region gene segment of the heavy chain locus. Transgenic review with focus on immunology. Vet Res 47:119. Res 20:625–641. 6. Davison F, Nair V (2004) Marek’s Disease: An Evolving Problem (Elsevier, London). 25. Chen F, et al. (2015) Generation of B cell-deficient pigs by highly efficient CRISPR/ 7. Davison F, Nair V (2005) Use of Marek’s disease vaccines: Could they be driving the Cas9-mediated gene targeting. J Genet Genomics 42:437–444. virus to increasing virulence? Expert Rev Vaccines 4:77–88. 26. Jarosinski KW, Tischer BK, Trapp S, Osterrieder N (2006) Marek’s disease virus: Lytic 8. Osterrieder N, Wallaschek N, Kaufer BB (2014) Herpesvirus genome integration into replication, oncogenesis and control. Expert Rev Vaccines 5:761–772. telomeric repeats of host cell chromosomes. Annu Rev Virol 1:215–235. 27. Baigent SJ, Ross LJ, Davison TF (1998) Differential susceptibility to Marek’s disease is 9. Greco A, Fester N, Engel AT, Kaufer BB (2014) Role of the short telomeric repeat associated with differences in number, but not phenotype or location, of pp38+ region in Marek’s disease virus replication, genomic integration, and lymphoma- lymphocytes. J Gen Virol 79:2795–2802. genesis. J Virol 88:14138–14147. 28. Calnek BW, Witter RL (1986) Marek’s disease–A model for herpesvirus oncology. Crit 10. Kaufer BB, Jarosinski KW, Osterrieder N (2011) Herpesvirus telomeric repeats facili- Rev Microbiol 12:293–320. tate genomic integration into host telomeres and mobilization of viral DNA during 29. Cole RK (1968) Studies on genetic resistance to Marek’s disease. Avian Dis 12:9–28. reactivation. J Exp Med 208:605–615. 30. Jarosinski KW, Yunis R, O’Connell PH, Markowski-Grimsrud CJ, Schat KA (2002) In- 11. Haertle S, et al. (2017) Identification of the receptor and cellular ortholog of the fluence of genetic resistance of the chicken and virulence of Marek’s disease virus Marek’s disease virus (MDV) CXC chemokine. Front Microbiol 8:2543. (MDV) on nitric oxide responses after MDV infection. Avian Dis 46:636–649. 12. Engel AT, Selvaraj RK, Kamil JP, Osterrieder N, Kaufer BB (2012) Marek’s disease viral 31. Chakraborty P, et al. (2017) Marek’s disease virus infection of phagocytes: A de novo interleukin-8 promotes lymphoma formation through targeted recruitment of B cells in vitro infection model. J Gen Virol 98:1080–1088. and CD4+ CD25+ T cells. J Virol 86:8536–8545. 32. Barrow AD, Burgess SC, Baigent SJ, Howes K, Nair VK (2003) Infection of macrophages 13. Baaten BJ, et al. (2009) Early replication in pulmonary B cells after infection with by a lymphotropic herpesvirus: A new tropism for Marek’s disease virus. J Gen Virol Marek’s disease herpesvirus by the respiratory route. Viral Immunol 22:431–444. 84:2635–2645. 14. Purchase HG, Sharma JM (1974) Amelioration of Marek’s disease and absence of 33. Schermuly J, et al. (2015) In vitro model for lytic replication, latency, and trans- vaccine protection in immunologically deficient chickens. Nature 248:419–421. formation of an oncogenic alphaherpesvirus. Proc Natl Acad Sci USA 112:7279–7284. 15. Foster AG, Moll T (1968) Effect of immunosuppression on clinical and pathologic 34. Shek WR, Calnek BW, Schat KA, Chen CH (1983) Characterization of Marek’s disease manifestations of Marek’s disease in chickens. Am J Vet Res 29:1831–1835. virus-infected lymphocytes: Discrimination between cytolytically and latently infected 16. Isogai H, Fujimoto Y, Okada K, Ichijo K (1980) Effect of bursectomy on the patho- cells. J Natl Cancer Inst 70:485–491. genesis of Marek’s disease. Jpn J Vet Res 28:137–148. 35. Petherbridge L, et al. (2004) Oncogenicity of virulent Marek’s disease virus cloned as 17. Schat KA, Calnek BW, Fabricant J (1981) Influence of the bursa of Fabricius on the bacterial artificial chromosomes. J Virol 78:13376–13380. pathogenesis of Marek’s disease. Infect Immun 31:199–207. 36. Jarosinski K, Kattenhorn L, Kaufer B, Ploegh H, Osterrieder N (2007) A herpesvirus 18. Payne LN, Rennie M (1970) Lack of effect of bursectomy on Marek’s disease. J Natl ubiquitin-specific protease is critical for efficient T cell lymphoma formation. Proc Natl Cancer Inst 45:387–397. Acad Sci USA 104:20025–20030. 19. Fernando WWD, Calnek BW (1971) Influence of bursa of Fabricius on infection and 37. Luhtala M, Koskinen R, Toivanen P, Vainio O (1995) Characterization of chicken CD8- pathological response of chickens exposed to Marek’s disease herpesvirus. Avian Dis specific monoclonal antibodies recognizing novel epitopes. Scand J Immunol 42: 15:467–476. 171–174.

Bertzbach et al. PNAS Latest Articles | 5of5 Downloaded by guest on October 2, 2021