(12) United States Patent (10) Patent No.: US 9,422,582 B2 Anthony Et Al

USOO9422582B2

(12) United States Patent (10) Patent No.: US 9,422,582 B2 Anthony et al. (45) Date of Patent: * Aug. 23, 2016

(54) HOST CELLS AND METHODS FOR (58) Field of Classification Search PRODUCTION OF ISOBUTANOL CPC ...... C12P 7/16; C12P 7/42; C12N 15/81; C12Y 101/01086; C12Y 202/01006 (71) Applicant: BUTAMAX(TM) ADVANCED USPC ...... 435/160 BIOFUELS LLC, Wilmington, DE (US) See application file for complete search history. (72) Inventors: Larry Cameron Anthony, Aston, PA (US); Hongxian He, Wilmington, DE (56) References Cited (US); Lixuan Lisa Huang, Hockessin, U.S. PATENT DOCUMENTS DE (US); Daniel P. Okeefe, Ridley Park, PA (US); Arthur Leo Kruckeberg, 4,683.202 A 7, 1987 Mullis et al. 4,865,973 A * 9/1989 Kollerup et al...... 435/43 Wilmington, DE (US); Yougen Li, 5,643,779 A 7, 1997 Ehrlich et al. Pennington, NJ (US); Lori Ann 6,586.229 B1 7/2003 Ben-Bassat et al. Maggio-Hall, Wilmington, DE (US); 6,960,465 B1 1 1/2005 Papoutsakis et al. Jessica McElvain, Wilmington, DE 7,541,173 B2 6/2009 Bramucci et al. 7,659,104 B2 2/2010 Bramucci et al. (US); Mark J. Nelson, Newark, DE 7.851,188 B2 12/2010 Donaldson et al. (US); Ranjan Patnaik, Newark, DE 7.910,342 B2 3/2011 Liao et al. (US); Steven Cary Rothman, 7.993,889 B1 8/2011 Donaldson et al. Wilmington, DE (US) 8,017,364 B2 9/2011 Bramucci et al. 8,017,376 B2 9, 2011 Dundon et al. (73) Assignee: Butamax Advanced Biofuels LLC, 8,043,638 B2 10/2011 Omura 8,071,358 B1* 12/2011 Dundon et al...... 435/254.2 Wilmington, DE (US) 8,097.440 B1 1/2012 Buelter et al. 8, 101,808 B2 1/2012 Evanko et al. (*) Notice: Subject to any disclaimer, the term of this 8,129,162 B2 3/2012 Li et al. patent is extended or adjusted under 35 8,133,715 B2 3/2012 Buelter et al. U.S.C. 154(b) by 0 days. 8,153,415 B2 4/2012 Buelter et al. 8, 158.404 B2 4/2012 Lies et al. This patent is Subject to a terminal dis 8, 178,328 B2 5/2012 Donaldson et al. claimer. (Continued) (21) Appl. No.: 13/840,676 FOREIGN PATENT DOCUMENTS (22) Filed: Mar 15, 2013 WO WO9408O20 4f1994 WO OO61722 A1 10, 2000 (65) Prior Publication Data (Continued) US 2014/OO3O783 A1 Jan. 30, 2014 OTHER PUBLICATIONS Related U.S. Application Data Davison BHetal. Continuous Direct Solvent Extration of Butanol in (63) Continuation of application No. 13/428,585, filed on a Fermenting Fluidized-Bed Bioreactor with Immobilized Mar. 23, 2012. Clostridium acetobutylicum. 1993. Applied Biochemistry and Biotechnology, vol. 39/40. p. 415-426.* (60) Provisional application No. 61/472.484, filed on Apr. Kumenovics A et al. Identification of FRA1 and FRA2 as genes 6, 2011, provisional application No. 61/467.261, filed involved in regulating the yeast iron regulon in response to decreased on Mar. 24, 2011, provisional application No. mitochondrial iron-sulfur cluster synthesis. 2008. Journal of Biologi 61/472.487, filed on Apr. 6, 2011, provisional cal Chemistry. 283:10276-10286.* application No. 61/467,271, filed on Mar. 24, 2011, GenBank EDR97797.1. Feb. 12, 2008. 1 page.* provisional application No. 61/570.513, filed on Dec. Abbad-Andaloussi, et al., Carbon and Electron Flow in Clostridium 14, 2011, provisional application No. 61/467.249, butyricum grown in ChemostatCulture on Glycerol and on Glucose, filed on Mar. 24, 2011, provisional application No. Microbiology 142:1149-1158, 1996. 61/472.497, filed on Apr. 6, 2011, provisional (Continued) application No. 61/472.474, filed on Apr. 6, 2011. (51) Int. Cl. Primary Examiner — Paul Holland CI2P 7/16 (2006.01) (57) ABSTRACT CI2N 15/8 (2006.01) CI2N 9/04 (2006.01) Provided herein are recombinant yeast host cells and methods CI2P 7/42 (2006.01) for their use for production of isobutanol. Yeast host cells CI2N L/38 (2006.01) provided comprise an isobutanol biosynthetic pathway and at (52) U.S. Cl. least one of reduced or eliminated aldehyde dehydrogenase CPC. CI2P 7/16 (2013.01); C12N 1/38 (2013.01); activity, reduced or eliminated acetolactate reductase activ CI2N 9/0006 (2013.01); C12N 15/81 ity; or a heterologous polynucleotide encoding a polypeptide (2013.01); C12N 15/815 (2013.01); C12P 7/42 having ketol-acid reductoisomerase activity. (2013.01); Y02E 50/10 (2013.01); Y02P 20/52 (2015.11) 16 Claims, 34 Drawing Sheets US 9,422,582 B2 Page 2

(56) References Cited 2011/02O1072 A1 8/2011 Bastian et al. 2011/0201073 A1* 8, 2011 Buelter ...... C12N 9/OOO6 U.S. PATENT DOCUMENTS 435,160 2011/024453.6 A1 10/2011 Nagarajan et al. 8, 188,250 B2 5/2012 Bramucci et al. 2011/0250610 A1 10, 2011 Bramucci et al. 8,206,970 B2 6, 2012 Eliot et al. 2011/0275129 A1 11/2011 Buelter et al. 8,222,017 B2 7, 2012 Li et al. 2012/0058541 A1 3/2012 Alsaker et al. 8,232,089 B2 7, 2012 Urano et al. 2012fOO64561 A1 3/2012 Flint et al. 8,241,878 B2 8/2012 Anthony et al. 2012fO149080 A1 6/2012 Bramucci et al. 8,273,558 B2 9/2012 Donaldson et al. 2012/0196341 A1 8/2012 Donaldson et al. 8,273,565 B2 9, 2012 Dundon et al. 2012/0237988 A1 9/2012 Anthony et al. 8,283,144 B2 10/2012 Donaldson et al. 2012fO258873 A1 10, 2012 Gibson et al. 8,372,612 B2 2/2013 Larossa et al. 2013.0035515 A1 2/2013 Dobson et al. 8,389.252 B2 3/2013 Larossa 2013,007 1898 A1 3, 2013 Anthony et al. 8,455,224 B2 6, 2013 Paul 2013/0171706 A1 7/2013 Donaldson et al. 8,455.225 B2 6/2013 Bramucci et al. 2013,0203138 A1 8, 2013 McElvain et al. 8,455,239 B2 6, 2013 Feldman et al. 2013,0252296 A1 9, 2013 Maggio-Hall 8.465,964 B2 6/2013 Anthony 2013,0316414 A1 11, 2013 Paul 8,518,678 B2 8, 2013 Flint et al. 2013,0344551 A1 12/2013 Li et al. 8,557,562 B2 10/2013 Bramucci et al. 2014,0004526 A1 1/2014 Dauner et al. 8,614,085 B2 12/2013 Van Dyk 2014/0030782 A1 1/2014 Anthony et al. 8,637,281 B2 1/2014 Paul et al. 2014/0030783 A1 1/2014 Anthony et al. 8,637.289 B2 1, 2014 Anthony et al. 2014/0038263 A1 2/2014 Flint et al. 8,652,823 B2 2/2014 Flint et al. 2014/0038268 A1 2/2014 Flint et al. 8,669,094 B2 3/2014 Anthony et al. 2014/005.1133 A1 2/2014 Govindarajan et al. 8,691,540 B2 4/2014 Bramucci et al. 2014/0051137 A1 2/2014 Flint et al. 8,735,114 B2 5/2014 Donaldson et al. 20140057329 A1 2/2014 Liet al. 8,765,433 B2 7, 2014 Gude et al. 2014/0093.930 A1 4/2014 Li et al. 8,785, 166 B2 7/2014 Anthony 2014/0096439 A1 4/2014 Bramucci et al. 8,795,992 B2 8/2014 Bramucci et al. 2014/0141479 A1 5/2014 Anthony et al. 8,828,694 B2 9/2014 Anthony et al. 2014/0170732 A1 6/2014 Bramucci et al. 8,828,704 B2 9/2014 Donaldson et al. 2014/O186910 A1 7/2014 Rothman et al. 8,871,488 B2 10/2014 Dauner et al. 2014/O1869 11 A1 7/2014 Anthony et al. 8,889,385 B2 11/2014 Donaldson et al. 2014/02731 16 A1 9/2014 Kelly et al. 8,895,307 B2 11/2014 Li et al. 2014/0273129 A1 9/2014 Bhalla et al. 8,906.666 B2 12/2014 Alsaker et al. 2014/0308735 A1 10/2014 Anthony 8,911,981 B2 12/2014 Li et al. 2014/0335582 A1 11/2014 Donaldson et al. 8,940,511 B2 1/2015 Larossa 2014/0349349 A1 11/2014 Dauner et al. 8,945,859 B2 2/2015 Donaldson et al. 2014/0377824 A1 12/2014 Satagopan et al. 8,945,899 B2 2/2015 Li et al. 2015.OO37855 A1 2/2015 Bhadra et al. 8,951,774 B2 2/2015 Donaldson 2015,0111269 A1 4/2015 Li et al. 8,951,937 B2 2/2015 Flint et al. 2015, 0119608 A1 4/2015 Donaldson et al. 8,956,850 B2 2/2015 Anthony 2015/O125920 A1 5/2015 Anthony et al. 8,962.298 B2 2/2015 Donaldson et al. 8,969,065 B2 3/2015 Anthony et al. FOREIGN PATENT DOCUMENTS 8,980,612 B2 3/2015 Donaldson et al. 2002fOO61569 A1 5, 2002 Haselbeck et al. WO WOO112833 2, 2001 2004/0234649 A1 11/2004 Lewis et al. WO WO2005040392 5, 2005 2004/0248250 A1 12/2004 Nakai et al. WO WO2O08098227 8, 2008 2005/005913.6 A1 3/2005 van Maris et al. WO WO2008130995 10, 2008 2005/O112739 A1 5, 2005 Golubkov et al. WO WO2009056984 5, 2009 2007/0031918 A1 2/2007 Dunson, Jr. et al. WO WO 2009056984 A1 * 5, 2009 2007/0031950 A1 2, 2007 Winkler WO WO2009059253 5, 2009 2007/00929.57 A1 4/2007 Donaldson et al. WO WO2009078108 6, 2009 2007/0259411 A1 11/2007 Bramucci et al. WO WO2009086423 T 2009 2008. O1823O8 A1 7/2008 Donaldson et al. WO WO 2010051527 A2 * 5, 2010 2008/026 1230 A1 10, 2008 Liao et al. WO WO2O10062597 6, 2010 2008/026 1861 A1 10/2008 Sleep et al. WO WO2O110 19894 2, 2011 2009,0081746 A1 3/2009 Liao et al. WO 2012O27642 A1 3, 2012 2009/0163376 A1* 6/2009 Li et al...... 506.9 2009,0269823 A1 10, 2009 Bramucci et al. OTHER PUBLICATIONS 2009/0305363 Al 12/2009 Anthony et al. 2010.0081154 A1 4/2010 Flint et al. Arthur, et al., Contribution of VanY D.D-Carboxypeptidase to 2010.00811732010.0081179 A1 4/2010 AnthonyPark et al. et al. Glycopeptide Resistance in Enterococcus faecalis by Hydrolysis of 2010.0081182 A1 4/2010 Paul et al. Peptidoglycan Precursors, Antimicrob. Agents Chemother, 38:1899 2010.0081183 A1 4/2010 Paul et al. 1903, 1994. 2010/0093020 A1 4/2010 Bramucci et al. Aulabaugh, et al., Oxalyl Hydroxamates as Reaction-Intermediate 2010, 0112655 A1 5, 2010 Paul et al. Analogues for Ketol-Acid Reductoisomerase, Biochemistry 2010, 0120105 A1 5/2010 Anthony et al. 29:2824-2830 1990. 2010/O124773 A1 5/2010 Yang et al. 2010/0129887 A1 5/2010 Anthony et al. Biou, et al. The crystal structure of plant acetohydroxy acid 2010.0143997 A1 6, 2010 Buelter et al. isomeroreductase complexed with NADPH, two magnesium ions 2010/O197519 A1 8, 2010 Li et al. and a herbicidal transition state analog determined at 1.65 A resolu 2011/0076733 A1 3f2011 Urano et al...... 435,160 tion, EMBO Journal 16:3405-3415, 1997. 2011/011 1472 A1 5/2011 Donaldson et al. van der Geize, et al., Targeted Disruption of the kstD Gene Encoding 2011/O124060 A1 5/2011 Anthony et al. a 3-Ketosteroid delta1-Dehydrogenase Isoenzyme of Rhodococcus 2011/O1361.92 A1 6, 2011 Paul et al. erythropolis Strain SQ1, Appl. Environ. Microbiol. 66:2029-2036, 2011/O1955.05 A1 8, 2011 Euler et al. 2000. US 9,422,582 B2 Page 3

(56) References Cited Larroy, et al., Characterization of the Saccharomyces cerevisiae YMR318C (ADH6) gene product as a broad specificity NADPH OTHER PUBLICATIONS dependent alcohol dehydrogenase: relevance in aldehyde reduction, Biochem. J. 361: 163-172, 2002. Chunduru, et al., Mechanism of Ketol Acid Reductoisomerase— Maguin, et al., New Termosensitive Plasmid for Gram-Positive Bac Steady State Analysis and Metal Ion Requirement, Biochemistry teria, J. Bacteriol. 174:5633-5638, 1992. 28:486-493 1989. Marinus, et al., Regulation of Isoleucine-Valine Biosynthesis in de Cavalho, et al., Mycobacterium sp., Rhodococcus erythropolis, Pseudomonas aeruginosa, Genetics 63:547-56, 1969. and Pseudomonas putida Behavior in the Presence of Organic Sol Nagarajan, et al., Modular Expression and Secretion Vectors for vents, Microsc. Res. Tech. 64:215-22, 2004. Bacillus subtilis, Gene 114: 121-126, 1992. de la Plaza, et al., Biochemical and molecular characterization of Nakashima, et al., Isolation and Characterization of a Rolling-Circle alpha-ketoisovalerate decarboxylase, an enzyme involved in the for Type Plasmid from Rhodococcus erythropolis and Application of the mation of aldehydes from amino acids by Lactococcus lactis, FEMS Plasmid to Multiple-Recombinant-Protein Expression, Appl. Microbiol. Lett. 238:367-374, 2004. Environ. Microbiol. 70:5557-5568, 2004. Deshpande, Ethanol Production from Cellulose by Coupled Sac Nallaapareddy, et al., Construction of Improved Temperature-Sensi charification Fermentation using Saccharomyces cerevisiae and Cel tive and Mobilizable Vectors and Their Use for Constructing Muta lulase Complex from Sclerotium rolfsii UV-8 Mutant, Appl. tions in the Adhesin-Encoding acm Gene of Poorly Transformable Biochem. Biotechnol. 36:227, 1992. Clinical Enterococcus faecium Strains, Appl. Environ. Microbiol. Dürre, et al., Solventogenic Enzymes of Clostridium acetobutylicum: 72:334-345, 2006. Catalytic Properties, Genetic Organization, and Transcriptional O'Sullivan, et al., High- and low-copy-number Lactococcus shuttle Regulation, FEMS Microbiol. Rev. 17:251-262, 1995. cloning vectors with features for clone screening, Gene 137:227-231. Dirre, New insights and novel developments in clostridial acetone? 1993. butanol isopropanol fermentationAppl. Microbiol. Biotechnol. Payne, et al., Use of Alkaline Phosphatase Fusions to Study Protein 49:639-648, 1998. Secretion in Bacillus subtilis, J. Bacteriol. 173:2278-2282, 1991. Eichenbaum, et al., Use of the Lactococcal nis A Promoter to Regu Renault, et al., Plasmid Vectors for Gram-positive Bacteria Swithch late Gene Expression in Gram-Positive Bacteria: Comparison of ing from High to Low Copy Number, Gene 183: 175-182, 1996. Induction Level and Promoter Strength, Appl. Environ. Microbiol. Scott, et al., Sequences of versatile broad-host-range vectors of the 64:2763-2769, 1998. Fleming, et al., Extracellular Enzyme Synthesis in a Sporulation RK2 family, Plasmid 50:74-79, 2003. Deficient Strain of Bacillus licheniformis, Appl. Environ. Microbiol. Smit, et al., Identification, Cloning, and Characterization of a 61:3775-3780, 1995. Lactococcus lactis Branched-Chain alpha-Keto Acid Decarboxylase Flint, et al., The Role and Properties of the Iron-Sulfur Cluster in Involved in Flavor Formation, Appl. Environ. Microbiol. 71:303 Escherichia coli Dihydroxy-acid Dehydratase, J. Biol. Chem. 311, 2005. 268: 14732-14742, 1993. Sulter, et al., Proliferation and metabolic significance of peroxisomes Ford, et al., Characterization of Yprlp from Saccharomyces in Candidaboidinii during drowth on D-alanine or oleic acid as the cerevisiae as a 2-methylbutyraldehyde reductase, Yeast 19:1087 sole carbon source, Arch. Microbiol. 153:485-489, 1990. 1096, 2002. Sulzenbacher, et al., Crystal Structure of E. coli Alcohol Fujimoto, et al., p.AM401-Based Shuttle Vectors That Enable Dehydrogenase YohD: Evidence of a Covalently Modified NADP Overexpression of Promoterless Genes and One-Step Purification of Coenzyme, J. Mol. Biol. 342:489-502, 2004. Tag Fusion Proteins Directly from Enterococcus faecalis, Appl. Tabor, et al., Abacteriophage T7 RNA polymerase/promoter system Environ. Microbiol. 67: 1262-1267, 2001. for controlled exclusive expression of specific genes, Proc. Acad. Sci. Gollop, et al., Physiological Implications of the Substrate Specifici USA 82:1074, 1985. ties of Acetohydroxy Acid Synthases from Varied Organisms, J. Taghavi, et al., Electroporation of Alcaligenes eutrophus with (Mega) Bacteriol. 172:3444-3449, 1990. Plasmids and Genomic DNA Fragments, Appl. Environ. Microbiol. Groot, et al., Technologies for Butanol Recovery Integrated with 60:3585-3591, 1994. Fermentations, Process. Biochem. 27:61-75, 1992. Tanimoto, et al., Analysis of the Conjugal Transfer System of the Guex, et al., SWISS-MODEL and the Swiss-PdbViewer: An Envi Pheromone-Independent Highly Transferable Enterococcus Plasmid ronment for Comparative Protein Modeling, Electrophoresis pMG1: Identification of a tra Gene (traA)Up-Regulated during Con 18:2714-2723, 1997. jugation, J. Bacteriol. 184:5800-5804, 2002. Hermann, et al., Isolation and Characterization of Butanol-Resistant Tao, et al., Construction of highly efficient E. coli expression systems Mutants of Clostridium acetobutylicum, Appl. Environ. Microbiol. containing low oxygen induced promoter and partition region, Appl. 50: 1238-1243, 1985. Microbiol. Biotechnol. 68:346-354, 2005. Holtzclaw, et al., Degradative Acetolactate Synthase of Bacillus Thompson, et al., CLUSTALW. improving the sensitivity of pro subtilis: Purification and Properties, J. Bacteriol. 121:917-922, 1975. gressive multiple sequence alignment through sequence weighting, Jones, et al., Improved Methods for Building Protein Models in position-specific gap penalties and weight matrix choice, Nuc. Acid Electron Density Maps and the Location of Errors in these Models, Res. 22:4673-4680, 1994. Acta Crystallogr. A 47: 110-119, 1991. Tomas, et al., Transcriptional Analysis of Butanol Stress and Toler Kabelitz, et al., Effect of aliphatic alcohols on growth and degree of ance in Clostridium acetobutylicum, J. Bacteriol. 186:2006-2018, saturation of membrane lipids in Acinetobacter calcoaceticus, FEMS 2004. Microbiol. Lett. 220: 223-227, 2003. Tyagi, et al., The crystal structure of a bacterial Class II ketol-acid Datsenko, et al., One-step inactivation of chromosomal genes in reductoisomerase: Domain conservation and evolution, Protein Sci. Escherichia coli K-12 using PCR products, Proc. Natl. Acad. Sci. 14:3089-3100, 2005. USA97:6640-6645, 2000. van Kranenburg, et al., Functional Analysis of Three Plasmids from Kleerebezem, et al., Controlled Gene Expression Systems for Lactic Lactobacillus plantarum, Appl. Environ. Microbiol. 71: 1223-1230, Acid Bacteria: Transferable Nisin-Inducible Expression Cassettes 2005. for Lactococcus, Leuconostoc, and Lactobacillus spp., Appl. Walker, et al., Isothermal in vitro amplification of DNA by a restric Environ. Microbiol. 63:4581-4584, 1997. tion enzyme/DNA polymerase systemProc. Natl. Acad. Sci. U.S.A. Kostichka, et al., A Small cryptic plasmid from Rhodococcus 89:392–396, 1992. erythropolis : characterization and utility for gene expression Appl. Wyckoff, et al., Characterization and Sequence Analysis of a Stable Microbiol. Biotechnol. 62:61-68, 2003. Cryptic Plasmid from Enterococcus faecium 226 and Development Krogh, et al., Hidden Markov Models in Computational Biology, J. of a Stable Cloning Vector, Appl. Environ. Microbiol. 62: 1481-1486, Mol. Biol. 235:1501-1531, 1994. 1996. US 9,422,582 B2 Page 4

(56) References Cited Khoury, et al., Computational design of Candida boidinii xylose reductase for altered cofactor specificity, Protein Sci. 18:2125-2136, OTHER PUBLICATIONS 2009. Kuzuyama, et al., Characterization of 1-deoxy-D-xylulose 5-Phos Dumas, et al., Purification and characterization of a fusion protein of phate Reductoisomerase, an Enzyme Involved in Isopentenyl plant acetohydroxy acid synthase and acetohydroxy acid Diphosphate Biosynthesis, and Identification of Its Catalytic Amino isomeroreductase, FEBS Lett. 408:156-160, 1997. Acid Residues, J. Biol. Chem. 275:19928-19932, 2000. Bellion et al., Microb. Growth C1 Compd., Int. Symp.), 7th (1993), Medina, et al., Probing the Determinants of Coenzyme Specificity in 41532. (eds): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Ferredoxin-NADP+Reductase by Site-directed Mutagenesis, J. Biol. Andover, UK. Chem. 276: 11902-11912, 2001. Dumas, et al., Isolation and kinetic properties of acetohydroxy acid Wierenga, et al., Predication of the Occurence of the SDP-binding isomeroreductase from spinach (Spinacia oleracea) chloroplasts Beta-alpha-beta Fold in Proteins. Using an Amino Acid Sequence overexpressed in Escherichia coli, Biochem. J. 288:865-874, 1992. Fingerprint, J. Mol. Biol. 187: 101-107, 1986. Epelbaum, et al. Branched-chain amino acid biosynthesis in Salmo Brinkmann-Chen, et al., General approach to reversing ketol-acid nella typhimurium: a quantitative analysis, J. Bacteriol. 180:4056 reductoisomerase cofactor dependence from NADPH to NADH, Proc. Natl. Acad. Sci. 110:10946-10951, 2013. 4067, 1998. Rossmann, et al., Chemical and biological evolution of nucleotide KuZuyama, Mevalonate and nonmevalonate pathways for the binding protein, Nature 250: 194-199, 1974. biosynthese of isoprene units, Biosci. Biotechnol. Biochem. Curien, et al., Nucleotide sequence and characterization of a cDNA 66:1619-1627, 2002. encoding the acetohydroxy acid isomeroreductase from Arabidopsis Garcia, et al. Fusel alcohols production in beer fermentation pro thaliana, Plant Molecular Biology 21:717-722, 1993. cesses, Proc. Biochem. 29:303-309, 1994. Dumas, et al., Purification and characterization of acetohydroxyacid Carlini, et al., Guerbet condensation of methanol with n-propanol to reductoisomerase from spinach chloroplasts, Biochem. J. 262:971 isobutyl alcohol over heterogeneous copper chromite/Mg—Al mixed 976, 1989. oxides, J. Mol. Catalysis. A 220:215-220, 2004. Durner, et al., Ketol-Acid Reductoisomerase from Barley (Hordeum Rothstein, Targeting, disruption, replacement, and allele rescue: inte vulgare): Purification. Properties, and Specific Inhibition, Plant grative DNA transformation in yeast, Meth. Enzymol. 194:281-301, Physiol. 103:903-910, 1993. 1991. Feeney, et al. A single amino acid Substitution in lactate Horton, et al., Engineering hybridgenes without the use of restriction dehydrogenase improves the catalytic efficiency with an alternative enzymes: gene splicing by overlap extension, Gene 77:61-68, 1989. coenzyme, Biochem. Biophys. Res. Commun. 166:667-672, 1990. Kaneko, et al., Complete Genome Sequence of the Filamentous Inui, et al., Identification and sequence determination of the Nitrogen-fixing Cyanobacterium Anabaena sp. strain PCC 7120, acetohydroxy acid isomeroreductase gene from Brevibacterium DNA Res. 8:205-213, 227-253, 2001. flavum MJ233, DNA Seq., 4:95-103, 1993 (Abstract). Dickinson, et al. An Investigation of the Metabolism to Isobutyl Lauvergeat, et al., Site-directed mutagenesis of a serine residue in Alcohol in Saccharomyces cerevisiae, J. Biol. Chem. 273:25752 cinnamyl alcohol dehydrogenase, a plant NADPH-dependent 25756, 1998. dehydrogenase, affects the specificity for the coenzyme, Biochemis Oaxaca, et al., Formation of Ethanol and Higher Alcohols by Immo try 34: 12426-12434, 1995. bilized Zymomonas mobilis in Continuous Culture, ACTA Levskaya, et al., Synthetic biology: engineering Escherichia coli to Biotechnol. 11:523-532, 1991. see light, Nature 438:441-442, 2005. Eppink, et al., Switch of Coenzyme Specificity of Shiraishi, et al., Engineering of pyridine nucleotide specificity of p-Hydroxybenzoate Hydroxylase, J. Mol. Biol. 292:87-96, 1999. nitrate reductase: mutagenesis of recombinant cytochrome b Nakanishi, et al., Switch of Coenzyme Specificity of Mouse Lung reductase fragment of Neurospora crassa NADPH:Nitrate reductase, Carbonyl Reductase by Substitution of Threonine 38 with Aspartic Archives of Biochemistry and Biophysics 358: 104-115, 1998. Acid, J. Biol. Chem. 272:2218-2222, 1997. Tyagi, et al., Probing the mechanism of the bifunctional enzyme Kamerbeek, et al., Identifying Determinants of NADPH Specificity ketol-acid reducoisomerase by site-directed mutagenesis of the in Baeyer-Villiger Monooxygenases, Eur, J. Biochem. 271:2107 active site, FEBS Journal 272:593-602, 2005. 2116, 2004. Zhang, et al., Change of nucleotide specificity and enhancement of Nishiyama, et al., Alteration of Coenzyme Specificity of Malate catalytic efficiency in single point mutants of Vibrio harveyialdehyde Dehydrogenase from Thermus flavus by Site-directed Mutagenesis, dehydrogenase, Biochemistry 38: 11440-11447, 1999. J. Biol. Chem. 268:4656-4660, 1993. International Preliminary Reporton Patentability date Sep. 24, 2013 Martinez-Julvez, et al., Towards a New Interaction Enzyme: Coen for International Application No. PCT/US2012/030479. zyme, Biophys. Chem. 115:219-224, 2005. U.S. Appl. No. 13/428,585, filed Mar. 23, 2012. Rane, et al., Reversal of the Nucleotide Specificity of Ketol Acid EBI Accession No. UniProt: Q87AC2, Entry Date Jun. 6, 2003. Reductoisomerase by Site-Directed Mutagenesis Identifies the EBI Accession No. UniProt: Q0AV 19, Entry Date Jan. 15, 2008. NADPH Binding Site, Archiv. Biochem. Biophys. 338:83-89, 1997. EBI Accession No. UniProt: Q02138. Entry Date Jul. 1, 1993. Ahn, et al., Crystal Structure of Class I Acetohydroxy Acid EBI Accession No. UniProt: Q01292, Entry Date Apr. 1, 1993. Isomeroreductase from Pseudomonas aeruginosa, J. Mol. Biol. EBI Accession No. UniProt: P06168. Entry Date Jan. 1, 1988. 328:505-515, 2003. EBI Accession No. UniProt: P05793, Entry Date Nov. 1, 1988. Paulsen, et al., Complete genome sequence of the plant commensal EBI Accession No. UniProt: B17V88. Entry Date Jun. 6, 2003. Pseudomonas fluorescens Pf-5, Nature Biotechnol. 23:8730878, She, et al., Q97YJ9 UNIPROTKB/Swiss-Prot. Database, Oct. 31, 2005. 2006. Carugo, et al., NADP-Dependent Enzymes I: Conserved Suerbaum, et al., UniProtKB Database. Accession Q7VGW6, 2003. Stereochemistry of Cofactor Binding, Proteins: Structure, Function, Kaneko, et al., Q8YUM UniProt Database, Mar. 23, 2010. and Genetics 28:10-28, 1997. GenBank No. NC 00913.5.1, Methanococcus maripaludis C5, com Dumas, et al., Enzymology, Structure, and Dynamics of plete genome, Apr. 30, 2009. Acetohydroxy Acid Isomeroreductase. Acc. Chem. Res. 34:399-408, GenBank No. NC 005791. 1, Methanococcus maripaludis S2, com 2001. plete genome, Apr. 25, 2009. Elmore, et al., Modification of the Nucleotide Cofactor-binding Site GenBank No. NZ AAWXO1000002. 1, Copeland, et al., Feb. 7, of Cytochrome P-450 Reductaseto Enhance Turnover with NADH in 2007: pp. 1-3. vivo, J. Biol. Chem. 277:48960-48964, 2002. GenBank No. NC 0011444, Saccharomyces cerevisiae chromo Fisher, et al., The X-ray Structure of Brassica napus beta-ketoacyl some XII, complete sequence, Jun. 16, 2008. carrier protein reductase and its implication for Substrate binding and GenBank No. NC 002754.1, Sulfolobus solfataricus P2, complete catalysis, Structure 8:339-347, 2000. genome, Apr. 26, 2009. US 9,422,582 B2 Page 5

(56) References Cited GenBank No. NP 014051. Adhép Saccharomyces cerevisiae), Dec. 9, 2009. OTHER PUBLICATIONS GenBank No. NP 149189, pyruvate decarboxylase Clostridium acetobutylicum ATCC 824), Apr. 26, 2009. GenBank No. NC 003364.1, Pyrobaculum aerophilum str. IM2, GenBank No. NP 349892, NADH-dependent butanol complete genome, Apr. 24, 2009. dehydrogenase A (BDHI) Clostridium acetobutylicum ATCC 824), GenBank No. AAA25079, acetolactate synthase Klebsiella Apr. 14, 2010. pneumoniae, Aug. 5, 1994. GenBank No. NP 417484, alcohol dehydrogenase, NAD(P)-depen GenBank No. AAA25161, alpha-acetolactate synthase, Apr. 21. 1994. dent Escherichia coli str. K-12 substr. MG 1655). Apr. 9, 2010. GenBank No. AAA65614, keto acid dehydrogenase E 1-alpha sub GenBank No. NP 46.1346, indolepyruvate decarboxylase Salmo unit Pseudomonas putida Feb. 27, 2002. nella typhimurium LT2). Apr. 30, 2009. GenBank No. AAA65615, 39 kDa keto acid dehydrogenase E1-beta GenBank No.YP 026248, dihydroxyacid dehydratase Escherichia subunit Pseudomonas putida), Feb. 27, 2002. coli str. K-12 substr. MG1655), Jul. 30, 2009. GenBank No. AAA65617, transacylase E2 (Pseudomonas putida). GenBank No. Z991 15, Bacillus subtilis complete genome (section 12 Feb. 27, 2002. of 21): from 2207806 to 2409180, Nov. 15, 2007. GenBank No. AAA65618, lipoamide dehydrogenase IPseudomonas GenBank No. AL009126, Bacillus subtilis subsp. subtilis str. 168 putidal, Feb. 27, 2002. complete genome, Oct. 1, 2009. GenBank No. AAS49166, branched-chain alpha-ketoacid GenBank No. Z99122, Bacillus subtilis complete genome (section 19 decarboxylase Lactococcus lactis, Dec. 27, 2004. of 21): from 3608981 to 3809670, Apr. 18, 2005. GenBank No. AJ746364. Lactococcus lactis subsp. lactis kivd gene GenBank No. ZPO 1224863.1, ketol-acid reductoisomerase marine for alpha-ketoisovalerate decarboxylase, strain IFPL730, Apr. 15. gamma proteobacterium HTCC2207), Mar. 24, 2006. 2005. GenBank No. NC 003295.1, Ralstonia Solanacearum GMI1000, GenBank No. AY548760, Lactococcus lactis branched-chain alpha complete genome, May 1, 2009. ketoacid decarboxylase (kdcA) gene, complete cods. Dec. 27, 2004. GenBank No. NC 002516. Pseudomonas aeruginosa PAO1, Jul. 20. GenBank No. BX950229, Methanococcus maripaludis strain S2, 2008. complete sequence, May 8, 2008. GenBank No. NC 004129, Pseudomonas fluorescens Pf-5, Jul. 20, GenBank No. CAB14105, dihydroxy-acid dehydratase Bacillus 2008. subtilis Subsp. subtilis str, Oct. 1, 2009. GenBank No. ZP 01313517.1, ketol-acid reductoisomerase GenBank No. CAB14334, branched-chain alpha-keto acid Desulfuromonas acetoxidans DSM 684), May 15, 2006. dehydrogenase E2 subunit (lipoamide acyltransferase) Bacillus GenBank No. O82043, Ketol-acid reductoisomerase, chloroplastic, subtilis Subsp. subtilis str. 168), Oct. 1, 2009. Jun. 16, 2009. GenBank No. CAB14335, branched-chain alpha-keto acid GenBank No. NP 977840.1, ketol-acid reductoisomerase Bacillus dehydrogenase El Subunit Bacillus subtilis Subsp. subtilis str. 168). cereus ATCC 10987), May 1, 2009. Oct. 1, 2009. GenBank No. NP 978252.1, ketol-acid reductoisomerase Bacillus GenBank No. CAB14336, branched-chain alpha-keto acid cereus ATCC 10987), May 1, 2009. dehydrogenase El Subunit Bacillus subtilis subsp. subtilis str. 168). GenBank No. P05793, Daniels, et al., Jun. 16, 2009: pp. 1-9. Oct. 1, 2009. Entrez GenBank Accession No. UNIPROT: Q6F821, Barbe, et al., GenBank No. CAB14337, branched-chain alpha-keto acid Oct. 2004; pp. 1-2. dehydrogenase E3 subunit (dihydrolipoamide dehydrogenase) GenBank Accession No. Q4K608, ketol-acid reductoisomerase, Bacillus subtilis subsp. subtilis str. 168), Oct. 1, 2009. Pseudomonas fluorescens, Aug. 2, 2005, viewed Nov. 14, 2008. GenBank No. CAB 15618, alpha-acetolactate synthase Bacillus GenBank: EDR97797.1, ketol-acid reductoisomerase Anaerostipes subtilis Subsp. subtilis str. 168), Oct. 1, 2009. caccae DSM 14662), Aug. 4. 2012. GenBank No. CAF29874, Dihydroxy-acid dehydratase Vasantha, et al., Genes for Alkaline Protease and Neutral Protease Methanococcus maripaludis S2), May 8, 2008. from Bacillus amyloliquefaciens Contain a Large Open Reading GenBank No. CAG34226, alpha-ketoisovalerate decarboxylase Frame Between the Regions Coding for Signal Sequence and Mature Lactococcus lactis subsp. lactis), Apr. 15, 2005. Protein, J. Bacteriol., 159:811-819, 1984. GenBank No. L16975, Lactococcus lactis alpha-acetolactate Pearson, Comput. Methods Genome Res., Proc. Int. Symp. (1994), Synthase (als) gene, complete cods, Apr. 21, 1994. Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New GenBank No. M57613, Pseudomonas putida branched-chain keto York, NY. acid dehydrogenase operon (bkdA1, bkdA1 and bkdA2), Altschul, et al., Basic Local Alignment Search Tool, J. Mol. Biol. transacylase E2 (bkdB), bkdR and lipoamide dehydrogenase (lpdV) 215:403-410, 1990. genes, complete cds, Feb. 27, 2002. Spano, et al., Environmental stress response in wine lactic acid bac GenBank No. M73842, Klebsiella pneumoniaeacetolactate synthase teria: beyond Bacillus subtilis, Crit. Rev. Microbiol. 32:77-86, 2006. (iluk) gene, complete cols, Aug. 5, 1994. Chang, et al., Construction and Characterization of Amplifiable GenBank No. NC 001142, Nosema ceranae BRL01 NcOO1142, Multicopy DNA Cloning Vehicles Derived from the P15A Cryptic whole genome shotgun sequence, Jun. 9, 2009. Miniplasmid, J. Bacteriol. 134:1141-1156, 1978. GenBank No. NC 003030, Clostridium acetobutylicum ATCC 824. Ferain, et al., Lactobacillus plantarum IdhL gene: overexpression and complete genome, Oct. 22, 2009. deletion, J. Bacteriol. 176:596-601, 1994. GenBank No. NC 001136, Saccharomyces cerevisiae chromosome Godon. et al., Branched-chain amino acid biosynthesis genes in IV, complete sequence, Dec. 9, 2009. Lactococcus lactic subsp. lactis, J. Bacteriol. 174:6580-6589, 1992. GenBank No. NC 001145, Saccharomyces cerevisiae chromosome Horinouchi, et al., Nucleotide sequence and functional map of XIII, complete sequence, Dec. 9, 2009. pE 194, a plasmid that specifies inducible resistance to macrollide, GenBank No. NC 001988, Clostridium acetobutylicum ATCC 824 lincosamide, and streptogramin type B antibiotics, J. Bacteriol. plasmid pSOL1, complete sequence, Apr. 26, 2009. 150:804-814, 1982. GenBank No. NC 003197. Salmonella typhimurium LT2, complete Higgins, et al., CLUSTAL V: improved software for multiple genome, Mar. 30, 2010. sequence alignment, CABIOS 8.189-191, 1992. GenBank No. NP 012550, Dihydroxyacid dehydratase, catalyzes Higgins et al., Fast and sensitive multiple sequence alignments on a third step in the common pathway leading to biosynthesis of microcomputer, CABIOS Communications 5:151-153, 1989. branchedchain amino acids; llv3p Saccharomyces cerevisiae), Nov. Johnson, et al., DNA sequences at the ends of transposon Tn5 5, 2009. required for transposition, Nature 304:280-282, 1983. GenBank No. NP 010656, Jacq., et al., downloaded Apr. 15, 2010, Rud, et al. A synthetic promoter library for constitutive gene expres pp. 1-3. sion in lactobacillus plantarum, Microbiol. 152: 1011-1019, 2006. US 9,422,582 B2 Page 6

(56) References Cited Katz, Michael et al., Efficient Anaerobic Whole Cell Stereoselective Bioreduction With Recombinant Saccharomyces cerevisiae, OTHER PUBLICATIONS Biotechnology and Bioengineering, Dec. 5, 2003, pp. 573-582, vol. 84, No. 5. Yansura, et al., Use of the Escherichia colilac repressor and operator Bianci, Michele M. etal. The petite-negative yeast Kluyveromyces to control gene expression in Bacillus Subtilis, Proc. Natl. Acad. Sci. lactis has a single gene expressing pyruvate decarboxylase activity, USA, vol. 81:439-443, 1984. Yuan, et al., Regulation of groE Expression in Bacillus subtills: the Molecular Microbiology, 1996, pp. 27-36, vol. 19, No. 1. Involvement of the cr-Like Promoter and the Roles of the Inverted Hohmann, Stefan, Characterisation of PDC2, a gene necessary for Repeat Sequence (CIRCE), J. Bacteriol. 177:5427-5433, 1995. high level expression of pyruvate decarboxylase structural genes in Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Saccharomyces cerevisiae, Mol. Gen. Genet., 1993, pp. 657-666, vol. Press, Cold Spring Harbor, NY. pp. 201-202. 241. Butanols, Ullman's Encyclopedia of Industrial Chemistry, 6th Edi Saint-Prix, Florence et al., Functional analysis of the ALD gene tion, 5:716-719, 2003. family of Saccharomyces cerevisiae during anaerobic growth on GenBank Accession No. B9CVH4, viewed Feb. 8, 2011. glucose: the NADP+-dependent Aldép and Ald5p isoforms plays a GenBank Accession No. NC 000913, Escherichia coli str. K-12 substr. MG 1655, May 17, 2008. major role in acetate formation, Microbiology, 2004, pp. 2209-2220, GenBank Accession No. NC 002505, Vibrio cholerae Ol biovar vol. 150. eltor str. N16961, Jul. 21, 2008. Johnson, Monique A. et al., Positive Selection of Novel Peroxisome GenBank Accession No. AAU36450, Psuedomonas aeruginosa cel Biogenesis-Defective Mutants of the Yeast Pichiapastoris, Genetics, lular proliferation protein, Feb. 14, 2002, viewed Nov. 14, 2008. Apr. 1999, pp. 1379-1391, vol. 151. GenBank Accession No. A3EGY6, ketol-acid reductoisomerase, Wang, Xinping et al., Molecular Cloning, Characterization, and Vibrio chlorea, Mar. 20, 2007, viewed Nov. 14, 2008. Potential Roles of Cytosolic and Mitochondrial Aldehyde GenBank Accession No. YP 162876, ketol-acid reductoisomerase Dehydrogenases in Ethanol Metabolism in Saccharomyces Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821), Jun. 10, 2013. cerevisiae, Journal of Bacteriology, Feb. 1998, pp. 822-830, vol. 180, GenBank Accession No. ZP 0793.0881, ketol-acid No. 4. reductoisomerase Anaerostipes sp. 3 2 56FAA), Nov. 27, 2012. Navarro-Avino, Juan P. et al., A Proposal for Nomenclature of Carlquist, Magnus et al., Genetically engineered Saccharomyces Aldehyde Dehydrogenases in Saccharomyces cerevisae and Charac cerevisiae for kinetic resolution of racemic bicyclo5.3.1 nonane terization of the Stress-Inducible ALD2 and ALD3 Genes, Yeast, 2,6-dione, Tetrahedron: Asymmetry, 2008, pp. 2293-2295, vol. 19. 1999, pp. 829-842, vol. 15. Eglinton, Jeffrey M. et al., Decreasing acetic acid accumulation by a Nevoigt, Elke et al., Reduced Pyruvate Decarboxylase and Increased glycerol overproducing strain of Saccharomyces cerevisiae by delet Glycerol-3-phosphate Dehydrogenase NAD+ Levels Enhance ing the ALD6 aldehyde dehydrogenase gene, Yeast, 2002, pp. 295 Glycerol Production in Saccharomyces cerevisiae, Yeast, 1996, pp. 301, vol. 19. 1331-1337, vol. 12. Fujisawa, Hisae et al., Characterization of short-chain Flikweert, Marcel T. et al., Pyruvate Decarboxylase: An Indispens dehydrogenase/reductase homologues of Escherichia coli (YolfG) able Enzyme for Growth of Saccharomyces cerevisiae on Glucose, and Saccharomyces cerevisiae (YMR226C), Biochimica et Yeast, 1996, pp. 247-257, vol. 12. Biophysica Acta, 2003, pp. 89-94, vol. 1645. Nomura, Yukihiro et al., Preparation and Preservation of Freeze-dried Johanson, Ted et al., Strain engineering for Stereoselective bioreduc Cells of Acetic Acid Bacteria with Aldehyde Oxidase Activity, tion of dicarbonyl compounds by yeast reductases, FEMS Yeast Bioscience Biotechnology Biochemistry, 1998, pp. 1134-1137, vol. Research, 2005, pp. 513-525, vol. 5. 62, No. 6. Overcamp, Karin M. et al., Metabolic Engineering of Glycerol Pro Kaneko, Tetsuo et al., Secoiridoid and Flavonoid Glycosides From duction in Saccharomyces cerevisiae, Applied and Environmental Gonocaryum Calleryanum, Phytochemistry, 1995, pp. 115-120, vol. Microbiology, Jun. 2002, pp. 2814-2821, vol. 68, No. 6. 39, No. 1. Wurdig, G. et al., Occurrence, detection, and determination of 2- and Bakker, Barbara M. et al., Stoichiometry and compartmentation of 3-methyl-2,3-dihydroxybutyric acid and 2-hydroxyglutaric acid in NADH metabolism in Saccharomyces cerevisiae, FEMS Microbiol wine, From the Wine Research Institute of the State Viticultural, ogy Reviews, 2001, pp. 15-37, vol. 25. Horticultural, and Agricultural Training and Research Center, Trier, Kumanovics, et al. Identification of FRA 1 and FRA2 as genes 1969, pp. 216-230, Vitis 8. involved in regulating the yeast iron regulon in response to decreased Yang, Yan et al., Enzymatic ketone reduction: mapping the Substrate mitochondrial iron-sulfur cluster synthesis. J. Biol. Chem. profile of a short-chain alcohol dehydrogenase (YMR226c) from 283: 10276-10286, 2008. Saccharomyces cerevisiae, Tetrahedron: Asymmetry, 2007, pp. 1799-1803, vol. 18. * cited by examiner U.S. Patent Aug. 23, 2016 Sheet 1 of 34 US 9,422,582 B2

H?. U.S. Patent Aug. 23, 2016 Sheet 2 of 34 US 9,422,582 B2

Z*01+

{|} {}

U.S. Patent Aug. 23, 2016 Sheet 4 of 34 US 9,422,582 B2

rx wrw Prix Yx w xxx prx err a re - - - is a st

£€(5)I- U.S. Patent Aug. 23, 2016 Sheet 5 of 34 US 9,422,582 B2 U.S. Patent Aug. 23, 2016 Sheet 6 of 34 US 9,422,582 B2

Spe 9572) ric A frief N-Pmel (1195) KV / KAR LEU2-Nil -S 2227 EcoRI (702-/ A ls-LV5 terminator T-Born 286

R /

-- PNY1910-0p -e-PNY2242-Qp. U.S. Patent Aug. 23, 2016 Sheet 7 of 34 US 9,422,582 B2

-e- Phys-DHv sst io -e- PNY2242-DHIV

20 s 60 so Time ir F. G. 6

O PNY1910 0.0 2 PNY2242 s

. glycerol pyruvie 2,3-BDO DHIV/ Kif BAC id F. G. 7 U.S. Patent Aug. 23, 2016 Sheet 8 of 34 US 9,422,582 B2

|00/00 |bordo

bu, ui/ "do U.S. Patent Aug. 23, 2016 Sheet 9 of 34 US 9,422,582 B2

34 K. KAR

0.61 0.60 F. G. 9A 0.59 0.58 0.57 X, S.B. 9 KAR

kgos K984 kgos KAR U.S. Patent Aug. 23, 2016 Sheet 10 of 34 US 9,422,582 B2

t 2. 3S as 2. | go .9- . Kgos koa kissez KAR

5. ": 0.800 F G 9 B an 5. 0.580 L X o K33, K9A. KS3 KAR

KAR U.S. Patent Aug. 23, 2016 Sheet 11 of 34 US 9,422,582 B2 i KAR

0.56 ": 0.65 0.64 F G. 9C an 5 S.

0.5- K969 K984P K963P KAR

K969 K9 B4P K963P KAR U.S. Patent Aug. 23, 2016 Sheet 12 of 34 US 9,422,582 B2

U.S. Patent Aug. 23, 2016 Sheet 13 of 34 US 9,422,582 B2

|*01+ U.S. Patent Aug. 23, 2016 Sheet 14 of 34 US 9,422,582 B2

•r

--- O CO Y (Y) --- fs C C

U.S. Patent Aug. 23, 2016 Sheet 17 of 34 US 9,422,582 B2

E)OÐOV75)*

s s 0€G 8 8

CIZI‘5OH

U.S. Patent Aug. 23, 2016 Sheet 19 of 34 US 9,422,582 B2

( ) D C

CY --- s wa CS - Y c - X s U.S. Patent Sheet 20 of 34 US 9,422,582 B2

E--- SO C\, is O CO CO U.S. Patent Sheet 21 of 34 US 9,422,582 B2

0;IGC

U.S. Patent Aug. 23, 2016 Sheet 26 of 34 US 9,422,582 B2

WIZI"50I

- - Y

---

U.S. Patent Aug. 23, 2016 Sheet 28 of 34 US 9,422,582 B2

(i.

£5)]©LOJ).Li 5)VLOŽOL?,J,i £),LL5005)VIOJ,), OZI’5ÐI

------t ---

- -

U.S. Patent Aug. 23, 2016 Sheet 33 of 34 US 9,422,582 B2

pe Joo U.S. Patent Aug. 23, 2016 Sheet 34 of 34 US 9,422,582 B2

3 . is . S is ge

ter wo asses s uss ...

s s

(/6) Je. US 9,422,582 B2 1. 2 HOST CELLS AND METHODS FOR Improvements and alternatives for the biosynthesis of PRODUCTION OF SOBUTANOL butanol directly from Sugars would improve economic viabil ity and would represent an advance in the art. CROSS-REFERENCE TO RELATED APPLICATIONS SUMMARY OF THE INVENTION This application is a continuation of U.S. patent applica Provided herein are recombinant yeast host cells and meth tion Ser. No. 13/428,585 (filed Mar. 23, 2012 which claims ods for the production of isobutanol. priority under 35 U.S.C. S 119(e) to U.S. Application Nos. In some embodiments, a recombinant host cell comprises 10 an engineered isobutanol production pathway and (a) at least 61/472.484 (filed Apr. 6, 2011), 61/467.261 (filed Mar. 24, one of (i) a heterologous polypeptide with ketol-acid reduc 2011), 61/472.487 (filed Apr. 6, 2011), 61/467,271 (filed Mar. toisomerase (KARI) activity selected from the group consist 24, 2011), 61/570,513 (filed Dec. 14, 2011), 61/467,249 ing of (1) a polypeptide having at least about 90% identity to (filed Mar. 24, 2011), 61/472,497 (filed Apr. 6, 2011), and a KARI enzyme derived from Bifidobacterium angulatum, 61/472.474 (filed Apr. 6, 2011), each of which is in incorpo 15 Bifidobacterium dentium, Zyrnomonas mobilis, Clostridium rated herein by reference in its entirety. beijerinckii or Anaerostipes caccae, or an active fragment thereof (2) a polypeptide having at least about 90% identity or GOVERNMENT LICENSE RIGHTS at least about 95% identity to SEQID NO: 27, 29, 31,33,35, 37, 39, 41, 43, 45, 47,49, 51, 53, 55, 57, 59, 61, 63, or 65; or This invention was made with Government support under (ii) a heterologous polynucleotide encoding the heterologous Agreement DE-AR0000006 awarded by the United States polypeptide with KARI activity of (a); and (b) at least one Department of Energy. The Government has certain rights in host cell modification that enhances performance of the engi this invention. neered isobutanol production pathway. In some embodi ments, the combination of (a) and (b) results is a synergistic FIELD OF THE INVENTION 25 increase in isobutanol production pathway performance. In some embodiments, a recombinant host cell comprises The invention relates to recombinant host cells and meth an isobutanol biosynthetic pathway and (a) a heterologous ods for fermentative production of isobutanol. polypeptide with ketol-acid reductoisomerase (KARI) activ ity selected from the group consisting of (i) a polypeptide REFERENCE TO SEQUENCE LISTING 30 having at least about 90% identity to a KARI enzyme derived SUBMITTED ELECTRONICALLY VIA EFS-WEB from Bifidobacterium angulatum, Bifidobacterium dentium, Zymomonas mobilis, Clostridium beijerinckii or Anaerosti The content of the electronically submitted Sequence List pes caccae, or an active fragment thereof, (ii) a polypeptide ing (Name: 20120323 CL5367USNA SEQLIST.txt; Size having at least about 90% identity or at least about 95% 2,003,893 bytes; Date of Creation Mar. 23, 2012) is herein 35 identity to SEQID NO: 27, 29, 31,33,35, 37, 39, 41, 43,45, incorporated by reference in its entirety. 47, 49, 51, 53, 55, 57, 59, 61, 63, or 65, (iii) a polypeptide having at least about 90% identity or at least about 95% BACKGROUND OF THE INVENTION identity to a KARI enzyme derived from Bifidobacterium angulatum, Bifidobacterium dentium, Enterococcus galli Butanol is an important industrial chemical, useful as a fuel 40 narum, Streptococcus thermophiles, Zymomonas mobilis, additive, as a feedstock chemical in the plastics industry, and Clostridium beijerinckii, Anaerostipes caccae, or Lactococ as a food grade extractant in the food and flavorindustry. Each cus lactis subsp. Cremoris MG 1363 or an active fragment year 10 to 12 billion pounds of butanol are produced by thereof, wherein the polypeptide has a K for NADH less petrochemical means and the need for this commodity chemi than about 50, (iv) a polypeptide having at least about 90% 45 identity or at least about 95% identity to a KARI enzyme cal will likely increase in the future. derived from Staphylococcus capitis SK14, Staphylococcus Methods for the chemical synthesis of isobutanol are epidermidis M23864-W1, Staphylococcus hominis SK119, known, such as oXo synthesis, catalytic hydrogenation of Staphylococcus aureus Subsp. aureus TCH130, Staphylococ carbon monoxide (Ullmann's Encyclopedia of Industrial cus warneri L37603, Staphylococcus epidermidis W23144, Chemistry, 6th edition, 2003, Wiley-VCH Verlag GmbH and 50 Staphylococcus saprophyticus Subsp. Saprophyticus Co., Weinheim, Germany, Vol. 5, pp. 716–719) and Guerbet ATCC 15305, Staphylococcus carnosus subsp. Carnosus condensation of methanol with n-propanol (Carlini et al., J. TM300, Listeria monocytogenes EGO-e, Listeria gravi DSM Molec. Catal. A. Chem. 220:215-220, 2004). These processes 20601, Enterococcus casselliflavus EC30, Enterococcus use starting materials derived from petrochemicals, are gen gallinarum EG2, Macrococcus caseolyticus JCSC5402, erally expensive, and are not environmentally friendly. The 55 Streptococcus vestibularis, Streptococcus mutans UA159, production of isobutanol from plant-derived raw materials Streptococcusgordonii Str, cgakkus SybStr. CH1, Streptococ would minimize green house gas emissions and would rep cus suis 89/1591, Streptococcus infantarius subsp. infan resent an advance in the art. tarius ATCC BAA-102, Lactococcus lactis subsp cremoris Isobutanol is produced biologically as a by-product of MG 1363, Lactococcus lactis, Leuconostoc mesenteroides yeastfermentation. It is a component of “fusel oil that forms 60 subsp mesenteroides ATCC8293, Lactobacillus buchneri as a result of the incomplete metabolism of amino acids by ATCC 11577, Staphylococcus haemolyticus JCSC 1435, Sta fungi. Isobutanol is specifically produced from catabolism of phylococcus epidermidis ATCC 12228, Streptococcus pneu L-valine. After the amine group of L-valine is harvested as a moniae CGSP14, Streptococcus pneumoniae TIGR4, Strep nitrogen source, the resulting O-keto acid is decarboxylated tococcus sanguinis SK36, Streptococcus salivarius SK126, and reduced to isobutanol by enzymes of the so-called Ehrlich 65 Streptococcus thermophilus LMD-9, Streptococcus pneumo pathway (Dickinson et al., J. Biol. Chem. 273:25752-25756, niae CCRI 1974M2, Lactococcus lactis subsp. lactis II 1403, 1998). Leuconostoc mesenteroides subsp cremoris ATCC 19254, US 9,422,582 B2 3 4 Leuconostoc mesenteroides Subsp cremoris, Lactobacillus polypeptide having aldehyde dehydrogenase activity cata brevis subsp. gravesensis ATCC27305, or Lactococcus lactis lyzes the conversion of isobutyraldehyde to isobutyric acid. subsp lactis NCDO2118 or an active fragment thereof, In some embodiments, the polypeptide having aldehyde wherein the heterologous polypeptide has a K for NADH dehydrogenase activity corresponds to Enzyme Commission less than about 50, (v) a heterologous polypeptide with KARI Number EC 1.21.3, EC 1.2.1.4, and/or EC1.2.1.5. In some activity having at least about 90% identity or at least about embodiments, the host cell is S. cerevisiae and the polypep 95% identity to SEQID NO: 67, 69,71, 73,75, 77, 79,81, 83, tide having aldehyde dehydrogenase activity is ALD2, ALD3, 85, 87, 89,91, 93, 95, 97,99, 101, 103, 105,107, 109, 111, ALD4, ALD5, ALD6 or a homolog thereof. In some embodi 113, 115, 117, 119, 121, 123,125, 127, 129, 131, 133, or 135 ments, the host cell is K. lactis and the polypeptide having or an active fragment thereof, wherein the heterologous 10 aldehyde dehydrogenase activity is KLLAOF00440, polypeptide has a K for NADH less than about 50; (b) a KLLAOE23057, KLLAOD10021, or KLLAOD09999G. In heterologous polynucleotide encoding the heterologous Some embodiments, the host cell is P stipitis and the polypep polypeptide with KARI activity of (a); (c) reduced or elimi tide having aldehyde dehydrogenase activity is ALD2, ALD3, nated aldehyde dehydrogenase activity; (d) reduced or elimi ALD4, ALD5, or ALD7. In some embodiments, the host cell nated aldehyde oxidase activity; (e) reduced or eliminated 15 is Lactobacillus plantarum and said polypeptide having alde acetolactate reductase activity; or (f) a combination thereof. hyde dehydrogenase activity is AldH. In some embodiments, In one embodiment, the recombinant host cell comprises the host cell is E. coli and the polypeptide having aldehyde reduced or eliminated aldehyde dehydrogenase expression dehydrogenase activity is aldA, aldB, or aldH. activity and reduced or eliminated acetolactate reductase In another embodiment, the host cell comprises a deletion, expression or activity. mutation, and/or substitution in an endogenous polynucle In another embodiment, the recombinant host cell com otide encoding a polypeptide having aldehyde oxidase activ prises (i) reduced or eliminated aldehyde dehydrogenase ity. In some embodiments, the polypeptide having aldehyde expression or activity or reduced or eliminated acetolactate oxidase activity catalyzes the conversion of isobutyraldehyde reductase expression or activity and (ii) a heterologous poly to isobutyric acid. In some embodiments, the polypeptide nucleotide encoding a polypeptide having KARI activity and 25 having aldehyde oxidase activity corresponds to Enzyme K for NADH less than 300 uM. Commission Number EC 1.2.3.1. In some embodiments, the In another embodiment, the recombinant host comprises a polypeptide having aldehyde oxidase activity is AOX1 and/or heterologous polypeptide with KARI activity that has at least AOX2. about 90% or at least about 95% identity to SEQID NO: 27, In another embodiment, the host cell comprises a deletion, 29, 141, 143, 275, or 277. 30 mutation, and/or substitution in an endogenous polynucle In some embodiments, the recombinant host cell com otide encoding a polypeptide having acetolactate reductase prises a heterologous polypeptide with KARI activity that activity. In some embodiments, the polypeptidehaving aceto comprises Substitutions in amino acids corresponding to S56 lactate reductase activity comprises a polypeptide encoded by and S58 of SEQ ID NO: 27. In some embodiments, the a polynucleotide selected from the group consisting of SEQ polypeptide with KARI activity further comprises a substitu 35 IDNO: 676, SEQIDNO: 678, SEQID NO: 680, SEQID NO: tion of one or more of the amino acids corresponding to I86, 682, SEQID NO: 684, SEQID NO: 686, SEQID NO: 688, N87, T131, or T191 of SEQ ID NO: 27. In some embodi SEQID NO: 690, SEQID NO: 692, SEQID NO: 694, SEQ ments, the polypeptide with KARI activity having at least ID NO: 696, SEQID NO:702, SEQIDNO: 704, SEQID NO: 90% identity or at least 95% identity to SEQID NO:31, 33, 706, SEQID NO: 708, SEQID NO: 710, SEQID NO: 712, 35, 37, 39, 41, 43, 45, 47,49, 51,53,55, 57, 59, 61, 63, or 65. 40 SEQID NO: 714, SEQID NO: 716, SEQID NO: 718, SEQ In some embodiments, the recombinant host cell has an ID NO: 720, SEQ ID NO: 722, SEQ ID NO: 724, SEQ ID effective isobutanol productivity of at least about 3, at least NO:726, SEQ ID NO:728, and SEQ ID NO: 730. In some about 4, or at least about 5 grams per gram of cells after about embodiments, the polypeptide having acetolactate reductase 48 hours, wherein at least the last about 24 of the 48 hours are activity is YMR226C. under anaerobic conditions. 45 In another embodiment, the recombinant host cell is a yeast In some embodiments, the recombinant host cell com host cell. In some embodiments, the yeast is selected from the prises a heterologous polypeptide with KARI activity that has group consisting of Saccharomyces, Schizosaccharomyces, a K for NADH less than about 350, less than about 100, less Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchen than about 50, or less than about 10 M at pH 6.8. kia, or Pichia. In some embodiments, the host cell is Saccha In some embodiments, the recombinant host cell com 50 romyces cerevisiae. prises a heterologous polypeptide with KARI activity that has In another embodiment, the host cell is a bacterial cell. In at least about 90% identity or at least about 95% identity to some embodiments, the bacterial cell is a Clostridium, SEQID NO:376, 382,378, or 275. Zymomonas, Escherichia, Salmonella, Rhodococcus, In some embodiments, the recombinant host cell com Pseudomonas, Bacillus, Lactobacillus, Enterococcus, Pedio prises a heterologous polypeptide with KARI activity com 55 coccus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, prises an amino acid Substitution at one or more of the posi Corynebacterium, Brevibacterium, Lactococcus, Leuconos tions corresponding to amino acids A41, S56, S58, I87, T131, toc, Oenococcus, Pediococcus, or Streptococcus cell. In some T191, R227, or Q246 of a KARI enzyme derived from embodiment, the bacterial cell is not E. coli. Anaerostipes caccae (SEQID NO:27). In some embodiments, the engineered isobutanol produc In some embodiments, the recombinant host cell com 60 tion pathway of the recombinant host cell comprises the fol prises a heterologous polypeptide with KARI activity that lowing Substrate to product conversions: (a) pyruvate to comprises SEQ ID NO:33 or SEQ ID NO:35 or an active acetolactate, (b) acetolactate to 2,3-dihydroxyisovalerate, (c) fragment thereof. 2,3-dihydroxyisovalerate to 2-ketoisovalerate, (d) 2-ketois In another embodiment, the recombinant host cell com ovalerate to isobutyraldehyde, and (e) isobutyraldehyde to prises a deletion, mutation, and/or substitution in an endog 65 isobutanol and more than one of the substrate to product enous polynucleotide encoding a polypeptide having alde conversions is catalyzed by an enzyme that is heterologous to hyde dehydrogenase activity. In some embodiments, the the host cell. In some embodiments, all of the substrate to US 9,422,582 B2 5 6 product conversions are catalyzed by enzymes heterologous otide encoding a polypeptide with KARI activity and (ii) at to the host cell. In some embodiments, at least one heterolo least one modification that enhances performance of the engi gous polynucleotide encoding an enzyme heterologous to the neered isobutanol production pathway. In some embodi host cell is chromosomally integrated into the host cell. In ments, DHMB production, isobutyric acid production, or Some embodiments, the Substrate to product conversions are both is reduced as compared to methods using a recombinant catalyzed by enzymes Substantially localized to the cytosol. host cell that does not comprise a heterologous polypeptide In some embodiments, the Substrate to product conversion for with KARI activity, a heterologous polynucleotide encoding isobutyraldehyde to isobutanol is catalyzed by an alcohol a polypeptide with KARI activity, reduced or eliminated alde dehydrogenase enzyme that utilizes NADH as a cofactor. In hyde dehydrogenase activity, reduced or eliminated aldehyde Some embodiments, the conversion of acetolactate to 2.3- 10 oxidase activity, reduced or eliminated acetolactate reductase dihydroxyisovalerate is catalyzed by a KARI that can use activity, or a combination thereof. In some embodiments, NADH as a cofactor. DHMB production, isobutyric acid production, or both is In some embodiments, the host cell comprises the plasmid reduced as compared to methods using a recombinant host pIH702 or pH701 or a plasmid having the same coding cell that does not comprise (i) a heterologous polypeptide regions. In some embodiments, the host cell comprises the 15 with KARI activity or a heterologous polynucleotide encod plasmid pl3P915 or a plasmid having the same coding ing a polypeptide with KARI activity and (ii) at least one regions. In some embodiments, the host cell comprises the modification that enhances performance of the engineered plasmid pYZ067 Akiv)AhADH or a plasmid having the same isobutanol production pathway. In some embodiments, the coding regions. molar ratio of isobutanol to glycerol is greater than 1. In some embodiments, the host cell comprises reduced, Methods for producing isobutanol also comprise providing disrupted, or eliminated ability to convert acetolactate to 2,3- a recombinant host cell that produces isobutanol and contact dihydroxy-2-methylbutyrate. ing the host cell with a carbon Substrate under conditions In Some embodiments, the host cell is yeast and has whereby isobutanol is produced, wherein at least a portion of reduced or eliminated pyruvate decarboxylase expression or the contacting occurs under anaerobic conditions, and activity. In some embodiments, the host cell has reduced or 25 wherein the ratio of isobutanol to glycerol produced is greater eliminated PDC1, PDC5, or PDC6 activity or a combination than 1. thereof. Methods for producing isobutanol also comprise growing a In some embodiments, the host cell has reduced or elimi recombinant yeast comprising a biosynthetic pathway nated NAD-dependent glycerol-3-phosphate dehydrogenase capable of converting pyruvate to acetolactate under condi expression or activity. In some embodiments, the host cell has 30 tions whereby butanol is produced and removing DHMB reduced GPD2 activity. from the culture. In some embodiments, the host cell has reduced or elimi Compositions produced by such methods are also provided nated FRA2 expression or activity. herein. In some embodiments, the composition comprises In some embodiments, the host cell produces isobutanol isobutanol and a recombinant host cell provided above. In under anaerobic conditions and the molar ratio of isobutanol 35 Some embodiments, the composition comprises butanol and to glycerol is greater than 1. no more than about 0.5 mM DHMB. In some embodiments, the polypeptide having ketol-acid Fermentative compositions are also provided herein. In reductoisomerase activity matches the profile HMM given Some embodiments, a fermentative composition comprises provided in Table Z with a profile HMME value of <10. the host cell and isobutanol produced according to the meth In some embodiments, the host cell produces isobutanol at 40 ods provided above. a yield greater than about 25%, about 50%, about 75%, or Compositions comprising i) a recombinant yeast capable about 90% of theoretical yield. of producing butanol. ii) butanol, and iii) no more than about In some embodiments, isobutanol and ethanol are pro 0.5 mM DHMB are also provided. duced. Methods for producing a recombinant host cell are also Methods for producing isobutanol include methods com 45 provided. Such methods can comprise (a) providing a recom prising providing a recombinant host cell as described above binant host cell comprising a modification in a polynucleotide and contacting the host cell with a carbon Substrate under encoding a polypeptide having aldehyde dehydrogenase conditions whereby isobutanol is produced. In some embodi activity or aldehyde oxidase activity; and (b) transforming the ments, at least a portion of the contacting occurs under host cell with a polynucleotide encoding a polypeptide of an anaerobic conditions. In some embodiments, the contacting 50 isobutanol biosynthetic pathway. occurs in the presence of an extractant. In some embodiments, Methods for reducing or eliminating the conversion of the contacting occurs in the presence of a sufficient quantity isbutyraldehye to isobutyric acid are also provided. Such of organic extractant to form a two-phase system comprising methods can comprise (a) providing the recombinant host cell an aqueous phase and an organic phase. In some embodi as described herein; and (b) subjecting the host cell to condi ments, one or more of the effective rate, effective titer, or 55 tions wherein the conversion of isbutyraldehye to isobutyric effective yield of isobutanol is increased as compared to acid is reduced or eliminated compared to methods using a methods using a recombinant host cell that does not comprise recombinant host cell that does not comprise reduced or a heterologous polypeptide with KARI activity, a heterolo eliminated aldehyde dehydrogenase and/or aldehyde oxidase gous polynucleotide encoding a polypeptide with KARI activity. activity, reduced or eliminated aldehyde dehydrogenase 60 Certain polypeptides are also provided herein. In some activity, reduced or eliminated aldehyde oxidase activity, embodiments, the polypeptides comprise at least about 90% reduced or eliminated acetolactate reductase activity, or a identity or at least about 95% identity or at least about 99% combination thereof. In some embodiments, one or more of identity to SEQID NO: 29, 31, 33,35, 37, 39, 41, 43, 45,47, the effective rate, effective titer, or effective yield of isobu 49, 51,53,55, 57, 59, 61, 63, 65,417,419,421,423,425,427, tanol is increased as compared to methods using a recombi 65 429, 431, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, nant host cell that does not comprise (i) a heterologous 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, polypeptide with KARI activity or a heterologous polynucle 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465,466, US 9,422,582 B2 7 8 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, ments, decreasing DHMB levels is achieved by decreasing 479, 480, 481,482, 483, 484, 485, 486, 487,488, 489, 490, acetolactate reductase enzyme activity. In some embodi 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, ments, decreasing DHMB levels is achieved by removing 503, 504,505, 506, 507,508, 509, 510,511, 512, 513, 514, DHMB from the composition. 515, 516, 517,518,519, 520,521, 522, 523,524,525,526, In some embodiments, increasing KARI enzyme produc 527, 528, 529,530,531, 532,533, 534, 535, 536,537, 624, tivity in a host cell can comprises culturing a host cell, 626, 628, 630, 632 or an active fragment thereof and have wherein the host cell comprises a heterologous KARI enzyme ketol-acid reductoisomerase activity. In some embodiments, and at least one genetic modification that reduces, disrupts, or the polypeptides comprise at least about 90% identity or at eliminates acetolactate reductase expression or activity, and least about 95% identity or at least about 99% identity to SEQ 10 wherein the KARI enzyme activity is decreased in the pres ID NO: 417,419, 421, 423,425, or 427 or an active fragment ence of DHMB. In some embodiments, the KARI has at least thereof and have ketol-acid reductoisomerase activity. In about 90%, at least about 95%, or at least about 99% identity Some embodiments, a polypeptide comprises a sequence with to E. coli or L. lactis KARI. In some embodiments, the at least about 90% identity, at least about 95% identity, or at reduced, disrupted, or eliminated acetolactate reductase least about 99% identity to SEQID NO: 927,928, 196,266, 15 expression or activity Substantially reduces the presence of 267, 389, 405,637, 781, 782, 783, 835, 853, 854, 855, 856, DHMB. 857, or 859. Methods for increasing dihydroxyacid dehydratase Polynucleotides encoding Such polypeptides and host cells (DHAD) activity are also provided. In some embodiments, comprising Such polynucleotides and polypeptides are also the methods comprise (a) providing a composition compris provided. ing dihydroxyisovalerate (DHIV) and a DHAD enzyme and Methods of converting acetolactate to 2,3-dihydroxyisov (b) decreasing DHMB levels. alerate are also provided. For example, Such methods can comprise (a) providing a polypeptide described above, and BRIEF DESCRIPTION OF THE FIGURES AND (b) contacting the polypeptide with acetolactate under condi INCORPORATION BY REFERENCE OF THE tions wherein 2,3-dihydroxyisovalerate is produced. 25 TABLE FILED ELECTRONICALLY HEREWITH Recombinant yeast cells are also provided herein. In some embodiments, a recombinant yeast comprises a biosynthetic The invention can be more fully understood from the fol pathway capable of converting pyruvate to acetolactate, and lowing detailed description, the Figures, and the accompany the yeast produces less than 0.01 moles 2,3-dihydroxy-2- ing sequence descriptions, which form part of this applica methylbutyrate (DHMB) per mole of sugar consumed. In 30 tion. Some embodiments, a recombinant yeast comprises capable FIG. 1—Shows four different isobutanol biosynthetic of converting pyruvate to acetolactate, and the yeast produces pathways. The steps labeled “a”, “b”, “c”, “d”, “e”, “f”, “g, DHMB at a rate of less than about 1.0 mM/hour. In some “h” “i''' and “k” represent the substrate to product conver embodiments, a recombinant yeast comprises a biosynthetic sions described below. pathway capable of converting pyruvate to acetolactate, and 35 FIG. 2 depicts an alignment of the amino acid sequences of the yeast produces an amount of 2,3-dihydroxy-3-isovalerate the KARI from Pseudomonas fluorescens (“PF5'; SEQ ID (DHIV) that is at least about 1.5 times the amount of DHMB NO: 5) and KARI from Anaerostipes caccae (“K9'; SEQID produced. NO: 27). The bolded positions are targeted for mutagenesis as Methods of identifying a gene involved in DHMB produc described herein. tion are also provided. In some embodiments, the methods 40 FIGS. 3A, 3B and 3C depict an alignment of the amino acid comprise (i) providing a collection of yeast strains compris sequences of KARI enzymes from Bifidobacterium angula ing at least two or more gene deletions; (ii) measuring the tum DSM 20098 (“K1'; SEQID NO: 141), Bifidobacterium amount of DHMB produced by individual yeast strains; (iii) dentium ATCC 27678 (“K2'; SEQID NO: 143), Clostridium selecting a yeast strain that produces no more than about 1.0 beijerinckii NCIMB 8052 (“K7: SEQID NO: 275), Anaero mMDHMB/hour; and (iv) identifying the gene that is deleted 45 stipes caccae DSM 14662 (“K9'; SEQID NO: 27), Entero in the selected yeast strain. In some embodiments, the meth coccus gallinarum EG2 (“K25” SEQID NO:376), Strepto ods comprise (i) providing a collection of yeast strains that coccus thermophilus LIVID-9 (“K26” SEQ ID NO: 121), over-express at least two or more genes; (ii) measuring the Lactococcus lactis subsp. Cremoris MG 1363 (“K29'; SEQ amount of DHMB produced by individual yeast strains; (iii) ID NO:382), Zymomonas mobilis (“S2'; SEQID NO: 277), selecting a yeast strain that produces at least about 1.0 mM 50 and Lactococcus lactis (“LTS'; SEQ ID NO: 380). The DHMB; and (iv) identifying the gene that is over-expressed in bolded positions are targeted for mutagenesis as described the selected yeast strain. herein. Methods for the production ofbutanol are also provided. In FIG. 4 is a plasmid map of pDH556 (pHR81-Pll5 Some embodiments, the methods comprise (a) growing a PfS.KARI) vector (SEQID NO: 138). recombinant yeast comprising a biosynthetic pathway 55 FIG.5 shows the specific rate of isobutanol production, Qp. capable of converting pyruvate to acetolactate under condi of the two strains, PNY 1910 and PNY2242. tions whereby butanol is produced; and b) measuring DHIV FIG. 6 shows the accumulation of DHIV+DHMB in the and/or DHMB concentration. In some embodiments, the culture Supernatant during the fermentation time course with growing and measuring can be performed simultaneously or PNY1910 (triangles) and PNY2242 (diamonds). (DHMB sequentially and in any order. In some embodiments, the 60 and DHIV are not distinguished by the HPLC method used.) measuring comprises liquid chromatography-mass spec FIG. 7 shows the yield of glycerol, pyruvic acid, 2,3- trometry. butanediol (BDO), DHIV/DHMB, O-ketoisovalerate (aKIV), Methods for increasing ketol-acid reductoisomerase and isobutyric acid (iBuAc), DHIV and DHMB are shown (KARI) activity are also provided. In some embodiments, the together as these are not distinguished by the HPLC method methods comprise (a) providing a composition comprising 65 used. acetolactate, a KARI enzyme, and an acetolactate reductase FIG. 8 shows a summary of V/K values for K9G9 enzyme and (b) decreasing DHMB levels. In some embodi variants as described in Example 16. US 9,422,582 B2 9 10 FIGS. 9A, B, and C show isobutanol to glycerol molar cofactor Switching positions in Pseudomonas fluorescens yield ratios, isobutanol molar yields, and isobutanol titers for Pf-5 KARI are identified as positions 24, 33, 47, 50, 52, 53, K9 variants as described in Example 19. 61, 80, 115, 156, and 170. Table Z is submitted herewith FIG. 10 shows an isobutanol biosynthetic pathway. Step electronically and is incorporated herein by reference. “a represents the conversion of pyruvate to acetolactate. Step The sequences provided in the sequence listing filed here “b’ represents the conversion of acetolactate to DHIV. Step with (Name: 20120323 CL5367USNA SEQLIST.txt; Size “c” represents the conversion of DHIV to KIV. Step “d” 2,003.893 bytes; Date of Creation Mar. 23, 2012), is herein represents the conversion of KIV to isobutyraldehyde. Step incorporated by reference. “e' represents the conversion of isobutyraldehyde to isobu Consistent with the World Intellectual Property Organiza tanol. Step “f represents the conversion of acetolactate to 10 DHMB. tion (WIPO) Standard ST.25 (2009), certain primers given in FIG. 11 shows a phylogenetic tree ofYMR226C homologs the sequence listing and herein use N to represent nucleotides from species of ascomycete yeast. A filamentous fungi (Neu a or g or c or t. K is used to represent g or t. M is used to rospora Crassa) sequence is included as an outgroup. representa or c. FIG. 12 shows a multiple sequence alignment (MSF For 15 mat) of nucleotide sequences of ORFs with homology to DETAILED DESCRIPTION OF THE INVENTION YMR226C. The gene names shown correspond to the acces sion numbers and SEQID NOS. given in Table 7. The align Unless defined otherwise, all technical and scientific terms ment was produced by AlignX (Vector NTI). used herein have the same meaning as commonly understood FIG. 13 shows a graph of the molar yield of DHMB over by one of ordinary skill in the art to which this invention time. belongs. In case of conflict, the present application including FIG. 14 depicts the production of isobutanol and isobutyric the definitions will control. Also, unless otherwise required acid in yeast strain NYLA84. by context, singular terms shall include pluralities and plural Table Z is a table (filed electronically herewith and incor terms shall include the singular. All publications, patents and porated by reference) of the Profile HMM of experimentally 25 other references mentioned herein are incorporated by refer verified KARI enzymes listed in Table 1 and as described in ence in their entireties for all purposes as if each individual US App. Pub. Nos. 2010/0197519 and 2009/0163376, which publication or patent application were specifically and indi are herein incorporated by reference in their entireties. vidually indicated to be incorporated by reference, unless only specific sections of patents or patent publications are TABLE 1. 30 indicated to be incorporated by reference. Experimentally verified KARI enzymes. Although methods and materials similar or equivalent to those disclosed herein can be used in practice or testing of the SEQ present invention, Suitable methods and materials are dis GI ID closed below. The materials, methods and examples are illus Number Accession NO: Microorganism 35 trative only and are not intended to be limiting. Other features 70732562 YP 26.2325. 5 Pseudomonas fluorescens Pf-5 and advantages of the invention will be apparent from the 15897495 NP 342100. 1 Sulfolobus solfatanicus P2 18313972 NP 560639. 2 Pyrobaculum aerophilum str. detailed description and from the claims. IM2 The last step in the biosynthesis of isobutanol via a pyru 768O1743 YP 326751. 7 Natronomonas pharaonis DSM 40 vate-utilizing biosynthetic pathway is the conversion of 21 60 1607.9881 NP 390707. 8 Bacilius subtilis subsp. subtilis isobutyraldehyde to isobutanol (FIG. 1). A side reaction in Str. 168 this pathway is the conversion of isobutyraldehyde to isobu 19552493 NP 600495. 9 Corynebacterium glutamicum tyric acid which results in reduced amounts of isobutyralde ATCC 13032 6225SS3 O32414 10 Phaeospiritum molischianum hyde available to convert into isobutanol and reduced isobu 1754.6794 NP 520196. 3 Ralstonia Solanacearum 45 tanol yield. For an efficient biosynthetic process, there is a GMI1 OOO need to prevent the conversion of isobutyraldehyde to isobu 56552O37 YP 162876. 11 Zymomonas mobilis subsp. tyric acid Such that increased amounts of isobutyraldehyde mobilis ZM4 114319705 YP 741388. 12 Aikailimnicola ehrlichei are available for conversion to isobutanol and isobutanol MLHE-1 yields are increased. 57240359 ZP OO3683O8.1 13 Campylobacteriari RM2100 50 Aldehyde dehydrogenases are a family of enzymes that 120553816 YP 9581.67. 14 Marinobacter aquaeolei VT8 catalyze the oxidation (dehydrogenation) of aldehydes 71065099 YP 263826. 15 Psychrobacter arcticus 273-4 83648555 YP 436990. 16 Haheila cheiuensis KCTC 2396 (Wang et al., J. Bacteriol. 180:822-30, 1998: Navarro-Avino 7431.8007 YP 315747. 17 Thiobacillus denitrificans ATCC et al., Yeast 15:829-42, 1999; and Saint-Prix et al., Microbi 25259 ology 150:2209-20, 2004). There is a need to identify suitable 67159493 ZP OO42OO11.1 18 Azotobacter vinelandii AvOP 55 aldehyde dehydrogenases that can be modified to reduce or 6604.4103 YP 233944. 19 Pseudomonas Syrigae pv. Syrigae B728a eliminate aldehyde dehydrogenase activity, and can reduce or 28868203 NP 790822. 20 Pseudomonas Syrigae pv. eliminate the conversion of isobutyraldehyde to isobutyric ionaio str. DC3000 acid, Such that increased amounts of isobutyraldehyde are 26991362 NP 746787. 21 Pseudomonas putida KT2440 1047.83656 YP 610154. 22 Pseudomonas entomophila LA8 available for conversion to isobutanol and isobutanol yields 146306044 YP 001186509.1 23 Pseudomonas mendocina ymp 60 are increased. 15599888 NP 253382. 4 Pseudomonas aeruginosa PAO1 Aldehyde oxidases are a family of enzymes that catalyze 42780593 NP 977840. 24 Bacilius Ceretts ATCC 10987 the production of carboxylic acids from aldehydes (Nomura 42781005 NP 978252. 25 Bacilius Ceretts ATCC 10987 et al., Biosci. Biotechnol. Biochem. 62:1134-7, 1998; and 266346 Q01292 6 Spinacia oleracea Johnson et al., Genetics 151:1379-1391, 1999). There is a 65 need to identify suitable aldehyde oxidases that can be modi The eleven positions in the profile HMM representing the fied to reduce or eliminate aldehyde oxidase activity and can columns in the alignment which correspond to the eleven reduce or eliminate the conversion of isobutyraldehyde to US 9,422,582 B2 11 12 isobutyric acid, such that increased amounts of isobutyralde indicate the inclusion of any recited integer or group of inte hyde are available for conversion to isobutanol and isobutanol gers, and the optional inclusion of any recited integer or group yields are increased. of integers that do not materially change the basic or novel The biosynthesis pathway for the production of butanol in properties of the specified method, structure or composition. genetically engineered yeast includes the conversion of 5 See M.P.E.P. S.2111.03. acetolactate to 2,3-dihydroxy-3-isovalerate (DHIV), which is Also, the indefinite articles “a” and an preceding an ele subsequently converted to butanol. See FIG. 10. However, a ment or component of the invention are intended to be non side reaction in this pathway, which decreases the overall restrictive regarding the number of instances, i.e., occur production of butanol, is the conversion of acetolactate to rences of the element or component. Therefore “a” or an 2,3-dihydroxy-2-methylbutyrate (DHMB). In fact, Appli 10 should be read to include one or at least one, and the singular cants have discovered that DHMB has inhibitory effects on word form of the element or component also includes the enzymes (dihydroxyacid dehydratase and ketol-acid reduc plural unless the number is obviously meant to be singular. toisomerase) in an isobutanol production pathway. For an The term “invention” or “present invention” as used herein efficient biosynthetic process, there is a need to prevent the is a non-limiting term and is not intended to refer to any single conversion of acetolactate to DHMB. 15 embodiment of the particular invention but encompasses all Applicants have solved the stated problems by providing possible embodiments as described in the claims as presented recombinant yeast host cells comprising an isobutanol bio or as later amended and Supplemented, or in the specification. synthetic pathway; and at least one of i) reduced or elimi As used herein, the term “about modifying the quantity of nated aldehyde dehydrogenase activity ii) reduced or elimi an ingredient or reactant of the invention employed refers to nated aldehyde oxidase activity iii) reduced or eliminated variation in the numerical quantity that can occur, for acetolactate reductase activity; iv) a heterologous polynucle example, through typical measuring and liquid handling pro otide encoding a polypeptide having ketol-acid reductoi cedures used for making concentrates or solutions in the real Somerase activity; and V) a heterologous polypeptide having world; through inadvertent error in these procedures; through ketol-acid reductoisomerase activity. Further, Applicants pro differences in the manufacture, Source, or purity of the ingre vide methods of producing butanol utilizing Such host cells. 25 dients employed to make the compositions or to carry out the Such recombinant host cells can be used to increase the pro methods; and the like. The term “about also encompasses duction of a product of a biosynthetic pathway (e.g., isobu amounts that differ due to different equilibrium conditions for tanol, 1-butanol, or 2-butanol) and/or reduce or eliminate the a composition resulting from a particular initial mixture. conversion of pathway intermediates to undesirable byprod Whether or not modified by the term “about', the claims ucts. Applicants have also provided a suitable screening strat 30 include equivalents to the quantities. In one embodiment, the egy for evaluating various candidate enzymes. The identified term “about means within 10% of the reported numerical enzymes can be altered to enhance the production of a product value, or within 5% of the reported numerical value. of a biosynthetic pathway (e.g., isobutanol, 1-butanol, or As used herein, “synergistic' refers to a greater-than-addi 2-butanol) and/or reduce or eliminate the conversion of path tive effect produced by a combination (i.e., an effect that is way intermediates to undesirable byproducts. 35 greater than the sum of individual effects) or an additive effect In order to further define this invention, the following when the individual effects are not expected to be additive. terms, abbreviations and definitions are provided. The term also refers to the addition of one compound which It will be understood that "derived from with reference to results in less of another compound being required. polypeptides disclosed herein encompasses sequences Syn The term “butanol biosynthetic pathway' as used herein thesized based on the amino acid sequences of the KARIs 40 refers to the enzymatic pathway to produce 1-butanol, 2-bu present in the indicated organisms as well as those cloned tanol, or isobutanol. For example, isobutanol biosynthetic directly from the organism’s genetic material. pathways are disclosed in U.S. Patent Application Publica As used herein, the terms “comprises.” “comprising.” tion No. 2007/0092957, which is incorporated by reference “includes.” “including.” “has.” “having.” “contains” or “con herein. taining,” or any other variation thereof, will be understood to 45 The term "isobutanol biosynthetic pathway' refers to the imply the inclusion of a stated integer or group of integers but enzymatic pathway to produce isobutanol. Certain isobutanol not the exclusion of any other integer or group of integers and biosynthetic pathways are illustrated in FIG. 1 and described are intended to be non-exclusive or open-ended. For example, herein. From time to time "isobutanol biosynthetic pathway” a composition, a mixture, a process, a method, an article, oran is used synonymously with "isobutanol production pathway'. apparatus that comprises a list of elements is not necessarily 50 The term “butanol as used herein refers to 2-butanol, limited to only those elements but can include other elements 1-butanol, isobutanol or mixtures thereof. Isobutanol is also no expressly listed or inherent to Such composition, mixture, known as 2-methyl-1-propanol. process, method, article, or apparatus. Further, unless A recombinant host cell comprising an “engineered alco expressly stated to the contrary, “or” refers to an inclusive or hol production pathway' (such as an engineered butanol or and not to an exclusive or. For example, a condition A or B is 55 isobutanol production pathway) refers to a host cell contain satisfied by any one of the following: A is true (or present) and ing a modified pathway that produces alcohol in a manner B is false (or not present), A is false (or not present) and B is different than that normally present in the host cell. Such true (or present), and both A and B are true (or present). differences include production of an alcohol not typically As used herein, the term “consists of or variations such as produced by the host cell, or increased or more efficient “consist of or “consisting of” as used throughout the speci 60 production. fication and claims, indicate the inclusion of any recited inte The term "heterologous biosynthetic pathway” as used ger or group of integers, but that no additional integer or herein refers to an enzyme pathway to produce a product in group of integers can be added to the specified method, struc which at least one of the enzymes is not endogenous to the ture, or composition. host cell containing the biosynthetic pathway. As used herein, the term “consists essentially of” or varia 65 The term “extractant” as used herein refers to one or more tions such as "consist essentially of or “consisting essen organic solvents which can be used to extract butanol from a tially of as used throughout the specification and claims, fermentation broth. US 9,422,582 B2 13 14 The term “effective isobutanol productivity” as used herein polynucleotides or nucleic acids according to the present refers to the total amount ingrams of isobutanol produced per invention further include such molecules produced syntheti gram of cells. cally. An isolated polynucleotide fragment in the form of a The term “effective titer” as used herein, refers to the total polymer of DNA can be comprised of one or more segments amount of a particular alcohol (e.g. butanol) produced by of cDNA, genomic DNA or synthetic DNA. fermentation per liter of fermentation medium. The total The term "NAD(P)H consumption assay” refers to an amount of butanol includes: (i) the amount of butanol in the enzyme assay for the determination of the specific activity of fermentation medium; (ii) the amount of butanol recovered the KARI enzyme, involving measuring the disappearance of from the organic extractant; and (iii) the amount of butanol the KARI cofactor, NAD(P)H, from the enzyme reaction. recovered from the gas phase, if gas stripping is used. 10 Such assays are described in Aulabaugh and Schloss, Bio The term “effective rate” as used herein, refers to the total chemistry 29: 2824-2830, 1990, which is herein incorporated amount of butanol produced by fermentation per liter offer by reference in its entirety. mentation medium per hour of fermentation. The term “NAD(P)H refers to either NADH or NADPH. The term “effective yield' as used herein, refers to the “KARI is the abbreviation for the enzyme ketol-acid amount of butanol produced per unit of fermentable carbon 15 reductoisomerase. substrate consumed by the biocatalyst. The term “close proximity” when referring to the position The term “separation” as used herein is synonymous with of various amino acid residues of a KARI enzyme with “recovery and refers to removing a chemical compound respect to the adenosyl 2-phosphate of NADPH means amino from an initial mixture to obtain the compound in greater acids in the three-dimensional model for the structure of the purity or at a higher concentration than the purity or concen enzyme that are within about 4.5A of the phosphorus atom of tration of the compound in the initial mixture. the adenosyl 2'-phosphate of NADPH bound to the enzyme. The term “aqueous phase, as used herein, refers to the The term “ketol-acid reductoisomerase' (abbreviated aqueous phase of a biphasic mixture obtained by contacting a “KARI), and “acetohydroxy acid isomeroreductase' will be fermentation broth with a water-immiscible organic extract used interchangeably and refer to enzymes capable of cata ant. In an embodiment of a process described herein that 25 lyzing the reaction of (S)-acetolactate to 2,3-dihydroxyisov includes fermentative extraction, the term "fermentation alerate, classified as EC number EC 1.1.1.86 (Enzyme broth' then specifically refers to the aqueous phase in bipha Nomenclature 1992, Academic Press, San Diego). As used sic fermentative extraction. herein the term "Class I ketol-acid reductoisomerase The term “organic phase, as used herein, refers to the enzyme” means the shortform that typically has between 330 non-aqueous phase of a biphasic mixture obtained by con 30 and 340 amino acid residues, and is distinct from the long tacting a fermentation broth with a water-immiscible organic form, called class II, that typically has approximately 490 eXtractant. residues. These enzymes are available from a number of The terms “PDC-, “PDC knockout, or “PDC-KO' as Sources, including, but not limited to E. coli (amino acid SEQ used herein refer to a cell that has a genetic modification to ID NO: 942; GenBank Accession Number NC 000913 inactivate or reduce expression of a gene encoding pyruvate 35 REGION: 3955993.3957468), Vibrio cholerae (GenBank decarboxylase (PDC) so that the cell substantially or com Accession Number NC 002505 REGION: 1574.41.158925), pletely lacks pyruvate decarboxylase enzyme activity. If the Pseudomonas aeruginosa, (GenBank Accession Number cell has more than one expressed (active) PDC gene, then NC 002516, REGION: 5272455.5273.471), and Pseudomo each of the active PDC genes can be inactivated or have nas fluorescens (amino acid SEQ ID NO: 943; GenBank minimal expression thereby producing a PDC-cell. 40 Accession Number NC 004129 REGION: The term “polynucleotide' is intended to encompass a 6017379.6018395). KARI enzymes are described for singular nucleic acid as well as plural nucleic acids, and refers example, in U.S. Pat. Nos. 7,910,342 and 8,129,162 and U.S. to a nucleic acid molecule or construct, e.g., messenger RNA Pub. App. No. 2010/0197519, all of which are herein incor (mRNA) or plasmid DNA (pDNA). A polynucleotide can porated by reference in their entireties. contain the nucleotide sequence of the full-length cDNA 45 KARI is found in a variety of organisms and amino acid sequence, or a fragment thereof, including the untranslated 5° sequence comparisons across species have revealed that there and 3' sequences and the coding sequences. The polynucle are 2 types of this enzyme: a shortform (class I) found in fungi otide can be composed of any polyribonucleotide or and most bacteria, and a long form (class II) typical of plants, polydeoxyribonucleotide, which can be unmodified RNA or Class I KARIs typically have between 330-340 amino acid DNA or modified RNA or DNA. For example, polynucle 50 residues. The long form KARI enzymes have about 490 otides can be composed of single- and double-stranded DNA, amino acid residues. However, Some bacteria Such as DNA that is a mixture of single- and double-stranded regions, Escherichia coil possess a long form, where the amino acid single- and double-stranded RNA, and RNA that is mixture of sequence differs appreciably from that found in plants. KARI single- and double-stranded regions, hybrid molecules com is encoded by the ilvC gene and is an essential enzyme for prising DNA and RNA that can be single-stranded or, more 55 growth of E. coli and other bacteria in a minimal medium. typically, double-stranded or a mixture of single- and double Class II KARIs generally consist of a 225-residue N-terminal stranded regions. “Polynucleotide' embraces chemically, domain and a 287-residue C-terminal domain. The N-termi enzymatically, or metabolically modified forms. nal domain, which contains the NADPH-binding site, has an A polynucleotide sequence can be referred to as "isolated.” CBstructure and resembles domains found in other pyridine in which it has been removed from its native environment. For 60 nucleotide-dependent oxidoreductases. The C-terminal example, a heterologous polynucleotide encoding a polypep domain consists almost entirely of C-helices. tide or polypeptide fragment having dihydroxy-acid dehy Ketol-acid reductoisomerase (KARI) enzymes are useful dratase activity contained in a vector is considered isolated in pathways for the production of isobutanol using engineered for the purposes of the present invention. Further examples of microorganisms (U.S. Pat. Nos. 7,851,188 and 7,993,889, an isolated polynucleotide include recombinant polynucle 65 incorporated by reference herein). otides maintained in heterologous host cells or purified (par A KARI that can utilize NADH can capitalize on the tially or substantially) polynucleotides in solution. Isolated NADH produced by the existing glycolytic and other meta US 9,422,582 B2 15 16 bolic pathways in most commonly used microbial cells and by the EC number 1.2.4.4. These branched-chain keto acid can result in improved isobutanol production. Rane et al. dehydrogenases comprise four subunits, and sequences from (Arch. Biochem. Biophys. 338: 83-89, 1997) discusses all subunits are available from a vastarray of microorganisms, cofactor Switching of a ketol acid reductoisomerase isolated including, but not limited to, B. subtilis (GenBank Nos: from E. coli. US Appl. Pub. Nos. 2009/0163376 and 2010/ CAB14336, Z991 16; CAB 14335, Z991 16; CAB 14334. 0.197519 (each of which is herein incorporated by reference it Z991 16; and CAB14337, Z991 16) and Pseudomonas putida its entirety) describe the generation of KARI enzymes which (GenBank Nos: AAA65614, M57613; AAA65615, M57613; can use NADH. US Appl. Pub. No. 2010/0143997 (which is AAA65617, M57613; and AAA65618, M57613). herein incorporated by reference in its entirety) describes E. As used herein, "aldehyde dehydrogenase activity” refers coli variants with improved K values for NADH. 10 to any polypeptide having a biological function of an alde The terms “ketol-acid reductoisomerase activity” and hyde dehydrogenase, including the examples provided “KARI activity” refer to the ability to catalyze the substrate to herein. Such polypeptides include a polypeptide that cata product conversion (S)-acetolactate to 2,3-dihydroxyisoval lyzes the oxidation (dehydrogenation) of aldehydes. Such erate. polypeptides include a polypeptide that catalyzes the conver The term “acetolactate synthase' refers to an enzyme that 15 sion of isobutyraldehyde to isobutyric acid. Such polypep catalyzes the conversion of pyruvate to acetolactate and CO. tides also include a polypeptide that corresponds to Enzyme Acetolactate has two stereoisomers ((R) and (S)); the enzyme Commission Numbers EC 1.2.1.3, EC 1.2.1.4 or EC 1.2.1.5. prefers the (S)-isomer, which is made by biological systems. Such polypeptides can be determined by methods well known Certain acetolactate synthases are known by the EC number in the art and disclosed herein. 2.2.1.6 (Enzyme Nomenclature 1992, Academic Press, San As used herein, "aldehyde oxidase activity” refers to any Diego). These enzymes are available from a number of polypeptide having a biological function of an aldehyde oxi Sources, including, but not limited to, Bacillus subtilis (Gen dase, including the examples provided herein. Such polypep Bank Nos: CAB15618, Z99122, NCBI (National Center for tides include a polypeptide that catalyzes carboxylic acids Biotechnology Information) amino acid sequence, NCBI from aldehydes. Such polypeptides include a polypeptide that nucleotide sequence, respectively), Klebsiella pneumoniae 25 catalyzes the conversion of isobutyraldehyde to isobutyric (GenBank Nos: AAA25079, M73842 and Lactococcus lactis acid. Such polypeptides also include a polypeptide that cor (GenBank Nos: AAA25161, L16975). responds to Enzyme Commission Number EC 1.2.3.1. Such The term “acetohydroxy acid dehydratase' refers to an polypeptides can be determined by methods well known in enzyme that catalyzes the conversion of 2,3-dihydroxyisov the art and disclosed herein. alerate to O-ketoisovalerate. Certain acetohydroxy acid dehy 30 As used herein, "pyruvate decarboxylase activity” refers to dratases are known by the EC number 4.2.1.9. These enzymes the activity of any polypeptide having a biological function of are available from a vast array of microorganisms, including, a pyruvate decarboxylase enzyme, including the examples but not limited to, E. coli (GenBank Nos: YP 026248, provided herein. Such polypeptides include a polypeptide NC 000913, S. cerevisiae (GenBank Nos: NP 012550, that catalyzes the conversion of pyruvate to acetaldehyde. NC 001142), M. maripaludis (GenBank Nos: CAF29874, 35 Such polypeptides also include a polypeptide that corre BX957219), B. subtilis (GenBank Nos: CAB14105, sponds to Enzyme Commission Number 4.1.1.1. Such Z991 15), Lactococcus lactis (SEQID NO: 926), and Strep polypeptides can be determined by methods well known in tococcus mutans (SEQID NO: 939). the art and disclosed herein. A polypeptide having pyruvate The term “branched-chain C-keto acid decarboxylase' decarboxylate activity can be, by way of example, PDC1, refers to an enzyme that catalyzes the conversion of O-ketois 40 PDC5, PDC6, or any combination thereof. ovalerate to isobutyraldehyde and CO. Certain branched As used herein, “acetolactate reductase activity” refers to chain C-keto acid decarboxylases are known by the EC num the activity of any polypeptide having the ability to catalyze ber 4.1.1.72 and are available from a number of sources, the conversion of acetolactate to DHMB. Such polypeptides including, but not limited to, Lactococcus lactis (GenBank can be determined by methods well known in the art and Nos: AAS49166, AY548760; CAG34226, AJ746364, Salmo 45 disclosed herein. nella typhimurium (GenBank Nos: NP-461346, As used herein, “DHMB” refers to 2,3-dihydroxy-2-me NC-003197), Clostridium acetobutylicum (GenBank Nos: thylbutyrate. DHMB includes “fast DHMB,” which has the NP-149189, NC-001988), Macrococcus caseolyticus (SEQ 2S, 3S configuration, and “slow DHMB, which has the 2S, ID NO: 940), and Listeria gravi (SEQID NO: 941). 3R configurate. See Kaneko et al., Phytochemistry 39: 115 The term “branched-chain alcohol dehydrogenase' refers 50 120 (1995), which is herein incorporated by reference in is to an enzyme that catalyzes the conversion of isobutyralde entirety and refers to fast DHMB as angliceric acid and slow hyde to isobutanol. Certain branched-chain alcohol dehydro DHMB as tigliceric acid. genases are known by the EC number 1.1.1.265, but can also As used herein, “reduced activity” refers to any measurable be classified under other alcohol dehydrogenases (specifi decrease in a known biological activity of a polypeptide when cally, EC 1.1.1.1 or 1.1.1.2). These enzymes utilize NADH 55 compared to the same biological activity of the polypeptide (reduced nicotinamide adenine dinucleotide) and/or NADPH prior to the change resulting in the reduced activity. Such a as electron donorand are available from a number of sources, change can include a modification of a polypeptide or a poly including, but not limited to, S. cerevisiae (GenBank Nos: nucleotide encoding a polypeptide as described herein. A NP 010656, NC 001136: NP 014051, NC 001145), E. coli reduced activity of a polypeptide disclosed herein can be (GenBank No: NP 417484), C. acetobutylicum (GenBank 60 determined by methods well known in the art and disclosed Nos: NP 349892, NC 003030), a indica (amino acid SEQID herein. NO: 945), A. xylosoxidans (amino acid SEQID NO: 944). As used herein, "eliminated activity” refers to the complete The term “branched-chain keto acid dehydrogenase” refers abolishment of a known biological activity of a polypeptide to an enzyme that catalyzes the conversion of O-ketoisoval when compared to the same biological activity of the erate to isobutyryl-CoA (isobutyryl-cofactor A), using NAD" 65 polypeptide prior to the change resulting in the eliminated (nicotinamide adenine dinucleotide) as electron acceptor. activity. Such a change can include a modification of a Certain branched-chain keto acid dehydrogenases are known polypeptide or a polynucleotide encoding a polypeptide as US 9,422,582 B2 17 18 described herein. An eliminated activity includes a biological activity is expressed as units/mg, where an enzyme unit is activity of a polypeptide that is not measurable when com defined as moles of product formed/minute. The specific pared to the same biological activity of the polypeptide prior activity of a sample of pure, fully active enzyme is a charac to the change resulting in the eliminated activity. An elimi teristic of that enzyme. The specific activity of a sample of a nated activity of a polypeptide disclosed herein can be deter mixture of proteins is a measure of the relative fraction of mined by methods well known in the art and disclosed herein. protein in that sample that is composed of the active enzyme The term “carbon substrate' or "fermentable carbon Sub of interest. strate” refers to a carbon source capable of being metabolized The terms “k, and “Kare knownto those skilled in the by host organisms of the present invention and particularly art and are described in Enzyme Structure and Mechanism, carbon Sources selected from the group consisting of 10 2" ed. (Ferst; W.H. Freeman Press, NY, 1985; pp. 98-120), monosaccharides, oligosaccharides, polysaccharides, and K the Michaelis constant, is the concentration of Substrate one-carbon substrates or mixtures thereof. Non-limiting that leads to half-maximal velocity. The term “k, often examples of carbon Substrates are provided herein and called the “turnover number, is defined as the maximum include, but are not limited to, monosaccharides, oligosac number of substrate molecules converted to products per charides, polysaccharides, ethanol, lactate. Succinate, glyc 15 active site per unit time, or the number of times the enzyme erol, carbon dioxide, methanol, glucose, fructose, Sucrose, turns over per unit time. k-V/IE), where E is the xylose, arabinose, dextrose, or mixtures thereof. Other car enzyme concentration (Ferst, Supra). The terms “total turn bon Substrates can include ethanol, lactate. Succinate, or glyc over and “total turnover number are used herein to refer to erol. the amount of product formed by the reaction of a KARI "Fermentation broth' as used herein means the mixture of enzyme with substrate. water, Sugars (fermentable carbon sources), dissolved solids The term “catalytic efficiency” is defined as thek/K of (if present), microorganisms producing alcohol, product an enzyme. Catalytic efficiency is used to quantify the speci alcohol and all other constituents of the material held in the ficity of an enzyme for a substrate. fermentation vessel in which product alcohol is being made The term "isolated nucleic acid molecule', 'isolated by the reaction of Sugars to alcohol, water and carbon dioxide 25 nucleic acid fragment” and “genetic construct” will be used (CO) by the microorganisms present. From time to time, as interchangeably and will mean a polymer of RNA or DNA used herein the term "fermentation medium' and "fermented that is single- or double-stranded, optionally containing Syn mixture' can be used synonymously with “fermentation thetic, non-natural or altered nucleotide bases. An isolated broth. nucleic acid fragment in the form of a polymer of DNA can be “Biomass” as used herein refers to a natural product con 30 comprised of one or more segments of cDNA, genomic DNA taining a hydrolysable starch that provides a fermentable or synthetic DNA. sugar, including any cellulosic or lignocellulosic material and The term "amino acid' refers to the basic chemical struc materials comprising cellulose, and optionally further com tural unit of a protein or polypeptide. The following abbre prising hemicellulose, lignin, starch, oligosaccharides, disac viations are used herein to identify specific amino acids: charides, and/or monosaccharides. Biomass can also com 35 prise additional components, such as protein and/or lipids. Biomass can be derived from a single source, or biomass can Three-Letter One-Letter comprise a mixture derived from more than one source. For Amino Acid Abbreviation Abbreviation example, biomass can comprise a mixture of corn cobs and Alanine Ala A. corn Stover, or a mixture of grass and leaves. Biomass 40 Arginine Arg R includes, but is not limited to, bioenergy crops, agricultural Asparagine ASn N Aspartic acid Asp D residues, municipal Solid waste, industrial Solid waste, sludge Cysteine Cys C from paper manufacture, yard waste, wood, and forestry Glutamine Gln Q waste. Examples of biomass include, but are not limited to, Glutamic acid Glu E 45 Glycine Gly G corn grain, corn cobs, crop residues such as cornhusks, corn Histidine His H stover, grasses, wheat, rye, wheat Straw, barley, barley Straw, Leucine Leu L hay, rice straw, Switchgrass, waste paper, Sugarcane bagasse, Lysine Lys K Sorghum, Soy, components obtained from milling of grains, Methionine Met M Phenylalanine Phe F trees, branches, roots, leaves, wood chips, sawdust, shrubs Proline Pro P 50 and bushes, vegetables, fruits, flowers, animal manure, and Serine Ser S mixtures thereof. Threonine Thr T "Feedstock as used herein means a product containing a Tryptophan Trp W fermentable carbon source. Suitable feedstock include, but Tyrosine Tyr Y are not limited to, rye, wheat, corn, Sugar cane, and mixtures Valine Wall V thereof. 55 The term “aerobic conditions' as used herein means The term “gene’ refers to a nucleic acid fragment that is growth conditions in the presence of oxygen. capable of being expressed as a specific protein, optionally The term “microaerobic conditions' as used herein means including regulatory sequences preceding (5' non-coding growth conditions with low levels of oxygen (i.e., below sequences) and following (3' non-coding sequences) the cod normal atmospheric oxygen levels). 60 ing sequence. “Native gene’ refers to a gene as found in The term “anaerobic conditions” as used herein means nature with its own regulatory sequences. “Chimeric gene’ growth conditions in the absence of oxygen. refers to any gene that is not a native gene, comprising regu The term “specific activity” as used herein is defined as the latory and coding sequences that are not found together in units of activity in a given amount of protein. Thus, the nature. Accordingly, a chimeric gene can comprise regulatory specific activity is not directly measured but is calculated by 65 sequences and coding sequences that are derived from differ dividing 1) the activity in units/ml of the enzyme sample by 2) ent sources, or regulatory sequences and coding sequences the concentration of protein in that sample, so the specific derived from the same source, but arranged in a manner US 9,422,582 B2 19 20 different than that found in nature. “Endogenous gene' refers chemical modification, covalent modification, irradiation to a native gene in its natural location in the genome of a with UV or X-rays, homologous recombination, mitotic microorganism. A “foreign' gene refers to a gene not nor recombination, promoter replacement methods, and/or com mally found in the host microorganism, but that is introduced binations thereof. Guidance in determining which nucle into the host microorganism by gene transfer. Foreign genes otides or amino acid residues can be modified, can be found can comprise native genes inserted into a non-native micro by comparing the sequence of the particular polynucleotide organism, or chimeric genes. A “transgene is a gene that has or polypeptide with that of homologous polynucleotides or been introduced into the genome by a transformation proce polypeptides, e.g., yeast or bacterial, and maximizing the dure. number of modifications made in regions of high homology As used herein, “native refers to the form of a polynucle 10 otide, gene, or polypeptide as found in nature with its own (conserved regions) or consensus sequences. regulatory sequences, if present. The term “recombinant genetic expression element” refers As used herein the term "coding sequence' or 'coding to a nucleic acid fragment that expresses one or more specific region” refers to a DNA sequence that encodes for a specific proteins, including regulatory sequences preceding (5' non amino acid sequence. "Suitable regulatory sequences' refer 15 coding sequences) and following (3' termination sequences) to nucleotide sequences located upstream (5' non-coding coding sequences for the proteins. A chimeric gene is a sequences), within, or downstream (3' non-coding sequences) recombinant genetic expression element. The coding regions of a coding sequence, and which influence the transcription, of an operon can form a recombinant genetic expression RNA processing or stability, or translation of the associated element, along with an operably linked promoter and termi coding sequence. Regulatory sequences can include promot nation region. ers, translation leader sequences, introns, polyadenylation "Regulatory sequences' refers to nucleotide sequences recognition sequences, RNA processing sites, effector bind located upstream (5' non-coding sequences), within, or down ing sites and stem-loop structures. stream (3' non-coding sequences) of a coding sequence, and As used herein, "endogenous” refers to the native form of which influence the transcription, RNA processing or stabil a polynucleotide, gene or polypeptide in its natural location in 25 ity, or translation of the associated coding sequence. Regula the organism or in the genome of an organism. "Endogenous tory sequences can include promoters, enhancers, operators, polynucleotide' includes a native polynucleotide in its natu repressors, transcription termination signals, translation ral location in the genome of an organism. "Endogenous leader sequences, introns, polyadenylation recognition gene' includes a native gene in its natural location in the sequences, RNA processing site, effector binding site and genome of an organism. “Endogenous polypeptide' includes 30 stem-loop structure. a native polypeptide in its natural location in the organism The term “promoter” refers to a nucleic acid sequence transcribed and translated from a native polynucleotide or capable of controlling the expression of a coding sequence or gene in its natural location in the genome of an organism. functional RNA. In general, a coding sequence is located 3' to The term "heterologous' when used in reference to a poly a promoter sequence. Promoters can be derived in their nucleotide, a gene, or a polypeptide refers to a polynucle 35 entirety from a native gene, or be composed of different otide, gene, or polypeptide not normally found in the host elements derived from different promoters found in nature, or organism. “Heterologous also includes a native coding even comprise synthetic nucleic acid segments. It is under region, or portion thereof, that is reintroduced into the Source stood by those skilled in the art that different promoters can organism in a form that is different from the corresponding direct the expression of a gene in different tissues or cell native gene, e.g., not in its natural location in the organism’s 40 types, or at different stages of development, or in response to genome. The heterologous polynucleotide or gene can be different environmental or physiological conditions. Promot introduced into the host organism by, e.g., gene transfer. A ers which cause a gene to be expressed in most cell types at heterologous gene can include a native coding region with most times are commonly referred to as "constitutive promot non-native regulatory regions that is reintroduced into the ers”. “Inducible promoters on the other hand, cause a gene native host. For example, a heterologous gene can include a 45 to be expressed when the promoter is induced or turned on by native coding region that is a portion of a chimeric gene a promoter-specific signal or molecule. It is further recog including non-native regulatory regions that is reintroduced nized that since in most cases the exact boundaries of regu into the native host. “Heterologous polypeptide' includes a latory sequences have not been completely defined, DNA native polypeptide that is reintroduced into the source organ fragments of different lengths can have identical promoter ism in a form that is different from the corresponding native 50 activity. For example, it will be understood that "FBA 1 pro polypeptide. moter can be used to refer to a fragment derived from the A “transgene' is a gene that has been introduced into the promoter region of the FBA1 gene. genome by a transformation procedure. The term “terminator” as used herein refers to DNA As used herein, the term “modification” refers to a change sequences located downstream of a coding sequence. This in a polynucleotide disclosed herein that results in reduced or 55 includes polyadenylation recognition sequences and other eliminated activity of a polypeptide encoded by the poly sequences encoding regulatory signals capable of affecting nucleotide, as well as a change in a polypeptide disclosed mRNA processing or gene expression. The polyadenylation herein that results in reduced or eliminated activity of the signal is usually characterized by affecting the addition of polypeptide. Such changes can be made by methods well polyadenylic acid tracts to the 3' end of the mRNA precursor. known in the art, including, but not limited to, deleting, 60 The 3' region can influence the transcription, RNA processing mutating (e.g., spontaneous mutagenesis, random mutagen or stability, or translation of the associated coding sequence. esis, mutagenesis caused by mutator genes, or transposon It is recognized that since in most cases the exact boundaries mutagenesis), Substituting, inserting, down-regulating, alter of regulatory sequences have not been completely defined, ing the cellular location, altering the State of the polynucle DNA fragments of different lengths can have identical termi otide or polypeptide (e.g., methylation, phosphorylation or 65 nator activity. For example, it will be understood that “CYC1 ubiquitination), removing a cofactor, introduction of an anti terminator' can be used to refer to a fragment derived from sense RNA/DNA, introduction of an interfering RNA/DNA, the terminator region of the CYC1 gene. US 9,422,582 B2 21 22 The term “operably linked’ refers to the association of cell, it is desirable to design the gene Such that its frequency nucleic acid sequences on a single nucleic acid fragment so of codon usage approaches the frequency of preferred codon that the function of one is affected by the other. For example, usage of the host cell. a promoter is operably linked with a coding sequence when it The term "codon-optimized as it refers to genes or coding is capable of effecting the expression of that coding sequence 5 regions of nucleic acid molecules for transformation of Vari (i.e., that the coding sequence is under the transcriptional ous hosts, refers to the alteration of codons in the gene or control of the promoter). Coding sequences can be operably coding regions of the nucleic acid molecules to reflect the linked to regulatory sequences in sense or antisense orienta typical codon usage of the host organism without altering the tion. polypeptide encoded by the DNA. Such optimization The term “expression', as used herein, refers to the tran 10 includes replacing at least one, or more than one, or a signifi Scription and stable accumulation of sense (mRNA) or anti cant number, of codons with one or more codons that are more sense RNA derived from the nucleic acid fragment of the frequently used in the genes of that organism. invention. Expression can also refer to translation of mRNA Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain into a polypeptide. 15 The term “overexpression, as used herein, refers to allow for variations in the sequence coding for the gene. Since expression that is higher than endogenous expression of the each codon consists of three nucleotides, and the nucleotides same or related gene. A heterologous gene is overexpressed if comprising DNA are restricted to four specific bases, there its expression is higher than that of a comparable endogenous are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode sig gene. The term overexpression refers to an increase in the nals ending translation). The 'genetic code” which shows level of nucleic acid or protein in a host cell. Thus, overex which codons encode which amino acids is reproduced herein pression can result from increasing the level of transcription as Table 2A. As a result, many amino acids are designated by or translation of an endogenous sequence in a host cell or can more than one codon. For example, the amino acids alanine result from the introduction of a heterologous sequence into a and proline are coded for by four triplets, serine and arginine host cell. Overexpression can also result from increasing the 25 by six, whereas tryptophan and methionine are coded by just stability of a nucleic acid or protein sequence. one triplet. This degeneracy allows for DNA base composi As used herein the term “transformation” refers to the tion to vary over a wide range without altering the amino acid transfer of a nucleic acid fragment into the genome of a host sequence of the proteins encoded by the DNA. microorganism, resulting in genetically stable inheritance. 30 Host microorganisms containing the transformed nucleic TABLE 2A acid fragments are referred to as “transgenic’’ or “recombi nant’ or “transformed microorganisms. The Standard Genetic Code The terms “plasmid, “vector” and "cassette' refer to an T C A. G extra chromosomal element often carrying genes which are 35 T TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) not part of the central metabolism of the cell, and usually in TTC " TCC " TAC '' TGC the form of circular double-stranded DNA fragments. Such TTA Leu (L.) TCA " TAA Stop TGA Stop elements can be autonomously replicating sequences, TTG. " TCG " TAG Stop TGG Trp (W) genome integrating sequences, phage or nucleotide C CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) sequences, linear or circular, of a single- or double-stranded 40 CTC " CCC. " CAC " CGC " DNA or RNA, derived from any source, in which a number of CTA " CCA " CAA Glin (Q) CGA. " nucleotide sequences have been joined or recombined into a CTG " CCG " GAG. " CGG " unique construction which is capable of introducing a pro A. ATT Ile (I) ACT Thir (T) AAT Asn (N) AGT Ser (S) moter fragment and DNA sequence for a selected gene prod ATC " ACC " AAC " AGC " uct along with appropriate 3' untranslated sequence into a 45 ATA " ACA. " AAA Lys (K) AGA Arg (R) cell. “Transformation cassette' refers to a specific vector ATG Met (M) ACG " AAG. " AGG " containing a foreign gene and having elements in addition to G GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) the foreign gene that facilitates transformation of a particular GTC " GCC " GAC " GGC " host cell. “Expression cassette' refers to a specific vector GTA " GCA. " GAA Glu (E) G.GA " containing a foreign gene and having elements in addition to 50 GTG. " GCG " GAG. " GGG " the foreign gene that allow for enhanced expression of that gene in a foreign host. Many organisms display a bias for use of particular codons The term “site-saturation library” refers to a library which to code for insertion of a particular amino acid in a growing contains random Substitutions at a specific amino acid posi peptide chain. Codon preference, or codon bias, differences tion with up to and including all 20 possible amino acids at 55 in codon usage between organisms, is afforded by degeneracy OCC. of the genetic code, and is well documented among many The term "error-prone PCR refers to adding random copy organisms. Codon bias often correlates with the efficiency of ing errors by imposing imperfect or sloppy PCR reaction translation of messenger RNA (mRNA), which is in turn conditions which generate randomized libraries of mutations believed to be dependent on, inter alia, the properties of the in a specific nucleotide sequence. 60 codons being translated and the availability of particular As used herein the term "codon degeneracy” refers to the transfer RNA (tRNA) molecules. The predominance of nature in the genetic code permitting variation of the nucle selected tRNAs in a cell is generally a reflection of the codons otide sequence without affecting the amino acid sequence of used most frequently in peptide synthesis. Accordingly, genes an encoded polypeptide. The skilled artisan is well aware of can be tailored for optimal gene expression in a given organ the “codon-bias' exhibited by a specific host cell in usage of 65 ism based on codon optimization. nucleotide codons to specify a given amino acid. Therefore, Given the large number of gene sequences available for a when synthesizing a gene for improved expression in a host wide variety of animal, plant and microbial species, it is US 9,422,582 B2 23 24 possible to calculate the relative frequencies of codon usage. TABLE - Continued Codon usage tables are readily available, for example, at the “Codon Usage Database' available at www.kazusa.or.jp/ Codon Usace Table for Saccharomyces cerevisiae codon? (visited Mar. 20, 2008), and these tables can be Frequency per adapted in a number of ways. See Nakamura, Y., et al. Nucl. Amino Acid Codon Number thousand Acids Res. 28:292 (2000). Codon usage tables for yeast, cal culated from GenBank Release 128.0 15 Feb. 2002, are Asp GAC 132O48 2 O.2 reproduced below as Table 2B. This table uses mRNA Glu GAA 297.944 45.6 nomenclature, and so instead of thymine (T) which is found in Glu GAG 12717 19.2 DNA, the tables use uracil (U) which is found in RNA. Table 10 2B has been adapted so that frequencies are calculated for Cys UGU 529 O3 8.1 each amino acid, rather than for all 64 codons. Cys UGC 31,095 4.8 Trp UGG 67789 1 O. 4 TABL E 2B 15 Arg CGU 41791 6. 4 Codon Usage Table for Saccharomyces cerevisiae Arg CGC 16993 2.6 Arg CGA 19562 9. O Frequency per Arg CGG 11351 1.7 Amino Acid Codon Number thousand Arg AGA 139081 21.3 Arg AGG 6O289 9.2 Phe UUU 17O666 26.1 Phe UUC 12O510 18. 4 Gly GGU 15 6109 23.9 Gly GGC 639 O3 9.8 Luell UUA 170884 26.2 Gly GGA 71216 1.O. 9 Luell UUG 177573 27.2 Gly GGG 39.359 6. O Luell CUU 8 OO76 12.3 Luell CUC 355.45 5.4 Stop UAA 6913 1.1 Luell CUA. 87619 13. 4 25 Stop UAG 33 12 O 5 Luell CUG 68494 10.5 Stop UGA 4447 Of

Ile AUU 196893 3 O. 1 Ile AUC 112176 17.2 By utilizing this or similar tables, one of ordinary skill in Ile AUA. 116254 17.8 the art can apply the frequencies to any given polypeptide 30 sequence, and produce a nucleic acid fragment of a codon Met AUG 13 6805 2O. 9 optimized coding region which encodes the polypeptide, but Wall GUU 144243 22. 1 which uses codons optimal for a given species. Wall GUC 76947 1.8 Wall GUA. 76927 1.8 Randomly assigning codons at an optimized frequency to Wall GUG 7 O337 O. 8 35 encode a given polypeptide sequence, can be done manually by calculating codon frequencies for each amino acid, and Ser UCU 1535.57 23.5 Ser UCC 928.23 4.2 then assigning the codons to the polypeptide sequence ran Ser UCA 122O28 8.7 domly. Additionally, various algorithms and computer soft Ser UCG 55.951 8 : 6 ware programs are readily available to those of ordinary skill Ser AGU 924 66 4.2 40 in the art. For example, the “EditSeq function in the Laser Ser AGC 63726 9.8 gene Package, available from DNAstar, Inc., Madison, Wis., Pro CCU 88263 3.5 the backtranslation function in the Vector NTISuite, available Pro CCC 443 09 6.8 from InforMax, Inc., Bethesda, Md., and the “backtranslate' Pro CCA 119641 8.3 Pro CCG 34597 5.3 function in the GCG-Wisconsin Package, available from 45 Accelrys, Inc., San Diego, Calif. In addition, various Thir ACU 132522 2O3 resources are publicly available to codon-optimize coding Thir ACC 832 Of 2.7 region sequences, e.g., the “backtranslation' function (En Thir ACA 116084 7.8 telechon GmbH, Regensburg, Germany) and the “back Thir ACG 52O45 8. O transeq' function (NRC Saskatoon Bioinformatics, Saska Ala GCU 1383 58 21.2 50 toon, Saskatchewan, Canada). Constructing a rudimentary Ala GCC 82.357 2.6 algorithm to assign codons based on a given frequency can Ala GCA 105.910 6.2 also easily be accomplished with basic mathematical func Ala GCG 4 O358 6.2 tions by one of ordinary skill in the art. Tyr UAU 122728 8.8 Codon-optimized coding regions can be designed by vari Tyr UAC 9 6596 4.8 55 ous methods known to those skilled in the art including soft His CAU 890 Of 3.. 6 ware packages such as “synthetic gene designer” (University His CAC 5. Of 85 7.8 of Maryland, Baltimore, Md.). A polynucleotide or nucleic acid fragment is “hybridiz Glin CAA 178251 27.3 able to another nucleic acid fragment, such as a cDNA, Glin CAG 791.21 2.1 60 genomic DNA, or RNA molecule, when a single-stranded Asn AAU 233 124 35.7 form of the nucleic acid fragment can anneal to the other Asn AAC 162199 24.8 nucleic acid fragment under the appropriate conditions of temperature and Solution ionic strength. Hybridization and Lys AAA 273 618 41.9 Lys AAG 2013 61 3 O 8 washing conditions are well known and exemplified in Sam 65 brook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Asp GAU 245641 37.6 Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989), particularly Chapter 11 and US 9,422,582 B2 25 26 Table 11.1 therein (entirely incorporated herein by refer polypeptides and proteins expressed in host cells are consid ence). The conditions oftemperature and ionic strength deter ered isolated for purposed of the invention, as are native or mine the “stringency” of the hybridization. Stringency con recombinant polypeptides which have been separated, frac ditions can be adjusted to screen for moderately similar tionated, or partially or substantially purified by any suitable fragments (such as homologous sequences from distantly technique. related organisms), to highly similar fragments (such as genes As used herein, the terms “variant and “mutant are syn that duplicate functional enzymes from closely related organ onymous and refer to a polypeptide differing from a specifi isms). Post hybridization washes determine stringency con cally recited polypeptide by one or more amino acid inser ditions. One set of conditions uses a series of washes starting tions, deletions, mutations, and Substitutions, created using, with 6xSSC, 0.5% SDS at room temperature for 15 min, then 10 e.g., recombinant DNA techniques, such as mutagenesis. repeated with 2xSSC, 0.5% SDS at 45° C. for 30 min, and then repeated twice with 0.2xSSC, 0.5% SDS at 50° C. for 30 Guidance in determining which amino acid residues can be min. Another set of stringent conditions uses higher tempera replaced, added, or deleted without abolishing activities of tures in which the washes are identical to those above except interest, can be found by comparing the sequence of the for the temperature of the final two 30 min washes in 0.2x 15 particular polypeptide with that of homologous polypeptides, SSC, 0.5% SDS was increased to 60° C. Another set of highly e.g., yeast or bacterial, and minimizing the number of amino stringent conditions uses two final washes in 0.1 xSSC, 0.1% acid sequence changes made in regions of high homology SDS at 65° C. An additional set of stringent conditions (conserved regions) or by replacing amino acids with consen include hybridization at 0.1xSSC, 0.1% SDS, 65° C. and SuS Sequences. washes with 2xSSC, 0.1% SDS followed by 0.1xSSC, 0.1% “Engineered polypeptide' as used herein refers to a SDS, for example. polypeptide that is synthetic, i.e., differing in Some manner Hybridization requires that the two nucleic acids contain from a polypeptide found in nature. complementary sequences, although depending on the strin Alternatively, recombinant polynucleotide variants encod gency of the hybridization, mismatches between bases are ing these same or similar polypeptides can be synthesized or possible. The appropriate stringency for hybridizing nucleic 25 selected by making use of the “redundancy’ in the genetic acids depends on the length of the nucleic acids and the code. Various codon Substitutions, such as silent changes degree of complementation, variables well known in the art. which produce various restriction sites, can be introduced to The greater the degree of similarity or homology between two optimize cloning into a plasmidor viral vector for expression. nucleotide sequences, the greater the value of Tm for hybrids Mutations in the polynucleotide sequence can be reflected in of nucleic acids having those sequences. The relative stability 30 the polypeptide or domains of other peptides added to the (corresponding to higher Tm) of nucleic acid hybridizations polypeptide to modify the properties of any part of the decreases in the following order: RNA:RNA, DNA:RNA, polypeptide. For example, mutations can be used to reduce or DNA:DNA. For hybrids of greater than 100 nucleotides in eliminate expression of a target protein and include, but are length, equations for calculating Tm have been derived (see not limited to, deletion of the entire gene or a portion of the Sambrook et al., supra, 9.509.51). For hybridizations with 35 gene, inserting a DNA fragment into the gene (in either the shorter nucleic acids, i.e., oligonucleotides, the position of promoter or coding region) so that the protein is not expressed mismatches becomes more important, and the length of the or expressed at lower levels, introducing a mutation into the oligonucleotide determines its specificity (see Sambrook et coding region which adds a stop codon or frame shift Such al., Supra, 11.7 11.8). In one embodiment the length for a that a functional protein is not expressed, and introducing one hybridizable nucleic acid is at least about 10 nucleotides. In 40 or more mutations into the coding region to alteramino acids one embodiment, a minimum length for a hybridizable so that a non-functional or a less enzymatically active protein nucleic acid is at least about 15 nucleotides; at least about 20 is expressed. nucleotides; or the length is at least about 30 nucleotides. Amino acid “substitutions' can be the result of replacing Furthermore, the skilled artisan will recognize that the tem one amino acid with another amino acid having similar struc perature and wash Solution salt concentration can be adjusted 45 tural and/or chemical properties, i.e., conservative amino acid as necessary according to factors such as length of the probe. replacements, or they can be the result of replacing one amino As used herein, the term “polypeptide' is intended to acid with an amino acid having different structural and/or encompass a singular “polypeptide' as well as plural chemical properties, i.e., non-conservative amino acid "polypeptides, and refers to a molecule composed of mono replacements. “Conservative' amino acid Substitutions can mers (amino acids) linearly linked by amide bonds (also 50 be made on the basis of similarity in polarity, charge, Solubil known as peptide bonds). The term “polypeptide' refers to ity, hydrophobicity, hydrophilicity, or the amphipathic nature any chain or chains of two or more amino acids, and does not of the residues involved. For example, nonpolar (hydropho refer to a specific length of the product. Thus, peptides, dipep bic) amino acids include alanine, leucine, isoleucine, Valine, tides, tripeptides, oligopeptides, “protein.” “amino acid proline, phenylalanine, tryptophan, and methionine; polar chain.” or any other term used to refer to a chain or chains of 55 neutral amino acids include glycine, serine, threonine, cys two or more amino adds, are included within the definition of teine, tyrosine, asparagine, and glutamine; positively charged "polypeptide.” and the term “polypeptide' can be used (basic) amino acids include arginine, lysine, and histidine; instead of, or interchangeably with any of these terms. A and negatively charged (acidic) amino adds include aspartic polypeptide can be derived from a natural biological Source or acid and glutamic acid. Alternatively, “non-conservative' produced by recombinant technology, but is not necessarily 60 amino acid substitutions can be made by selecting the differ translated from a designated nucleic acid sequence. It can be ences in polarity, charge, solubility, hydrophobicity, hydro generated in any manner, including by chemical synthesis. philicity, or the amphipathic nature of any of these amino By an "isolated polypeptide or a fragment, variant, or acids. “Insertions' or “deletions' can be within the range of derivative thereof is intended a polypeptide that is not in its variation as structurally or functionally tolerated by the natural milieu. No particular level of purification is required. 65 recombinant proteins. The variation allowed can be experi For example, an isolated polypeptide can be removed from its mentally determined by Systematically making insertions, native or natural environment. Recombinantly produced deletions, or Substitutions of amino acids in a polypeptide US 9,422,582 B2 27 28 molecule using recombinant DNA techniques and assaying Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. the resulting recombinant variants for activity. G. et al., Comput. App. Biosci., 8:189-191 (1992)) and found A “substantial portion of an amino acid or nucleotide in the MegAlignTM program of the LASERGENE bioinfor sequence is that portion comprising enough of the amino acid matics computing suite (DNASTARInc.). For multiple align sequence of a polypeptide or the nucleotide sequence of a ments, the default values correspond to GAP PENALTY=10 gene to putatively identify that polypeptide or gene, either by and GAP LENGTH PENALTY=10. Default parameters for manual evaluation of the sequence by one skilled in the art, or pairwise alignments and calculation of percent identity of by computer-automated sequence comparison and identifica protein sequences using the Clustal method are KTUPLE=1. tion using algorithms such as BLAST (Altschul, S. F., et al., GAP PENALTY=3, WINDOW=5 and DIAGONALS J. Mol. Biol., 215:403-410 (1993)). In general, a sequence of 10 SAVED=5. For nucleic acids these parameters are ten or more contiguous amino acids or thirty or more nucle KTUPLE=2, GAPPENALTY=5, WINDOW=4 and DIAGO otides is necessary in order to putatively identify a polypep NALS SAVED=4. After alignment of the sequences using the tide or nucleic acid sequence as homologous to a known ClustalV program, it is possible to obtain a “percent identity” protein or gene. Moreover, with respect to nucleotide by viewing the “sequence distances” table in the same pro sequences, gene specific oligonucleotide probes comprising 15 gram. Additionally the “ClustalW method of alignment' is 20-30 contiguous nucleotides can be used in sequence-depen available and corresponds to the alignment method labeled dent methods of gene identification (e.g., Southern hybrid ClustalW (described by Higgins and Sharp, CABIOS. 5:151 ization) and isolation (e.g., in situ hybridization of bacterial 153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. colonies or bacteriophage plaques). In addition, short oligo 8:189-191 (1992)) and found in the MegAlignTM v6.1 pro nucleotides of 12-15 bases can be used as amplification prim gram of the LASERGENE bioinformatics computing suite ers in PCR in order to obtain a particular nucleic acid frag (DNASTAR Inc.). Default parameters for multiple alignment ment comprising the primers. Accordingly, a “substantial (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, portion' of a nucleotide sequence comprises enough of the Delay Divergen Segs (%)=30, DNA Transition Weight=0.5, sequence to specifically identify and/or isolate a nucleic acid Protein Weight Matrix-Gonnet Series, DNA Weight fragment comprising the sequence. The instant specification 25 Matrix=IUB). After alignment of the sequences using the teaches the complete amino acid and nucleotide sequence ClustalW program, it is possible to obtain a “percent identity” encoding particular proteins. The skilled artisan, having the by viewing the “sequence distances” table in the same pro benefit of the sequences as reported herein, can now use all or gram. a Substantial portion of the disclosed sequences for purposes It is well understood by one skilled in the art that many known to those skilled in this art. Accordingly, the instant 30 levels of sequence identity are useful in identifying polypep invention comprises the complete sequences as reported in tides, such as from other species, wherein such polypeptides the accompanying Sequence Listing, as well as substantial have the same or similar function or activity, or in describing portions of those sequences as defined above. the corresponding polynucleotides. Useful examples of per The term “complementary' is used to describe the relation cent identities include, but are not limited to: 55%, 60%, 65%, ship between nucleotide bases that are capable of hybridizing 35 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percent to one another. For example, with respect to DNA, adenine is age from 55% to 100% can be useful in describing the present complementary to thymine and cytosine is complementary to invention, such as 55%, 56%, 57%, 58%, 59%, 60%, 61%, guanine, and with respect to RNA, adenine is complementary 62%, 63%, 64%. 65%, 66%, 67%, 68%, 69%, 70%, 71%, to uracil and cytosine is complementary to guanine. 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, The term “percent identity”, as known in the art, is a rela 40 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, tionship between two or more polypeptide sequences or two 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable or more polynucleotide sequences, as determined by compar polynucleotide fragments not only have the above homolo ing the sequences. In the art, “identity also means the degree gies but typically comprise a polynucleotide having at least of sequence relatedness between polypeptide or polynucle 50 nucleotides, at least 100 nucleotides, at least 150 nucle otide sequences, as the case may be, as determined by the 45 otides, at least 200 nucleotides, or at least 250 nucleotides. match between Strings of Such sequences. “Identity” and Further, suitable polynucleotide fragments having the above “similarity” can be readily calculated by known methods, homologies encode a polypeptide having at least 50 amino including but not limited to those described in: 1.) Computa acids, at least 100 amino acids, at least 150 amino acids, at tional Molecular Biology (Lesk, A. M., Ed.) Oxford Univer least 200 amino acids, or at least 250 amino acids. sity: NY (1988); 2.) Biocomputing. Informatics and Genome 50 The term "sequence analysis software” refers to any com Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Com puter algorithm or software program that is useful for the puter Analysis of Sequence Data, Part I (Griffin, A. M., and analysis of nucleotide or amino acid sequences. “Sequence Griffin, H. G., Eds.) Humania: NJ (1994); 4.) Sequence analysis Software' can be commercially available or indepen Analysis in Molecular Biology (von Heinje, G., Ed.) Aca dently developed. Typical sequence analysis Software will demic (1987); and 5.) Sequence Analysis Primer (Gribskov, 55 include, but is not limited to: 1.) the GCG suite of programs M. and Devereux, J., Eds.) Stockton: NY (1991). (Wisconsin Package Version 9.0, Genetics Computer Group Methods to determine identity are designed to give the best (GCG), Madison, Wis.); 2.) BLASTP. BLASTN, BLASTX match between the sequences tested. Methods to determine (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) identity and similarity are codified in publicly available com DNASTAR (DNASTAR, Inc. Madison, Wis.); 4.) puter programs. Sequence alignments and percent identity 60 Sequencher (Gene Codes Corporation, Ann Arbor, Mich.); calculations can be performed using the MegAlignTM pro and 5.) the FASTA program incorporating the Smith-Water gram of the LASERGENE bioinformatics computing suite man algorithm (W. R. Pearson, Comput. Methods Genome (DNASTARInc., Madison, Wis.). Multiple alignments of the Res., Proc. Int. Symp. (1994), Meeting Date 1992, 111-20. sequences are performed using the "Clustal method of align Editor(s): Suhai, Sandor, Plenum: New York, N.Y.). Within ment' which encompasses several varieties of the algorithm 65 the context of this application it will be understood that where including the “ClustalV method of alignment corresponding sequence analysis Software is used for analysis, that the to the alignment method labeled Clustal V (described by results of the analysis will be based on the “default values” of US 9,422,582 B2 29 30 the program referenced, unless otherwise specified. As used TABLE 3 herein “default values' will mean any set of values or param eters that originally load with the software when first initial Effective KARIS ized. SEQ SEQ Standard recombinant DNA and molecular cloning tech ID NO: ID NO: niques are well known in the art and are described by Sam Nucleic Amino brook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: Description acid acid A Laboratory Manual, Second Edition, Cold Spring Harbor Staphylococcus capitis SK14 66 67 Laboratory Press, Cold Spring Harbor, N.Y. (1989) (herein Staphylococcus epidermidis M23864-W1 68 69 10 Staphylococcus hominis SK119 134 135 after “Maniatis’); and by Silhavy, T. J., Bennan, M. L. and Staphylococcus aureus Subsp. aureus TCH130 70 71 Enquis L. W., Experiments with Gene Fusions, Cold Spring Staphylococcus warneri L37603 72 73 Staphylococcus epidermidis W23144 74 75 Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984): Staphylococci is saprophyticus Subsp. 76 77 and by Ausubel, F. M. et al., Current Protocols in Molecular Saprophyticus ATCC15305 Biology, published by Greene Publishing Assoc. and Wiley 15 Staphylococci is canostis Subsp. Canostis 78 79 TM3OO Interscience (1987). Additional methods used here are in Listeria monocytogenes EGD-e 8O 81 Methods in Enzymology, Volume 194, Guide to Yeast Genet Listeria grayi DSM 20601 82 83 ics and Molecular and Cell Biology (Part A, 2004, Christine Enterococcus casselliflavus EC30 84 85 Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, Enterococcus gallinarum EG2 86 87 Macrococcus caseolyticus JCSC5402 88 89 San Diego, Calif.). Other molecular tools and techniques are Streptococcus vestibularis 90 91 known in the art and include splicing by overlapping exten Streptococcus mutans UA159 92 93 sion polymerase chain reaction (PCR) (Yu, et al. (2004) Fun Streptococcusgordonistr, cgakkus Sybstr. CH1 94 95 Streptococcus suis 89/1591 96 97 gal Genet. Biol. 41:973-981), positive selection for mutations Streptococci is infantarius Subsp. infantarius 98 99 at the URA3 locus of Saccharomyces cerevisiae (Boeke, J. D. ATCC BAA-102 et al. (1984) Gen. Genet. 197,345-346; MA Romanos, et al. 25 Lactococcus lactis subsp cremoris MG 1363 OO O1 Lactococci is lactis O2 O3 Nucleic Acids Res. 1991 Jan. 11; 19(1): 187), the cre-lox Leticonostoc mesenteroides Subsp mesenteroides O4 05 site-specific recombination system as well as mutant loX sites ATCC8293 and FLP substrate mutations (Sauer, B. (1987) Mol Cell Biol Laciobacilius buchneri ATCC 11577 O6 O7 7: 2087-2096; Senecoff, et al. (1988) Journal of Molecular Staphylococcus haemolyticus JCSC1435 O8 09 30 Staphylococcus epidermidis ATCC12228 10 11 Biology, Volume 201, Issue 2, Pages 405-421; Albert, et al. Streptococcus pneumoniae CGSP14 12 13 (1995)The Plant Journal. Volume 7, Issue 4, pages 649-659), Streptococcus pneumoniae TIGR4 14 15 Streptococcus sanguinis SK36 16 17 "seamless’ gene deletion (Akada, et al. (2006)Yeast; 23(5): Streptococcus salivarius SK126 18 19 399-405), and gap repair methodology (Ma et al., Genetics Streptococcus thermophilus LMD-9 2O 21 58:201-216; 1981). 35 Streptococcus pneumoniae CCRI 1974M2 22 23 The genetic manipulations of a recombinant host cell dis Lactococcus lactis subsp. lactis II1403 24 25 Leticonostoc mesenteroides Subsp cremoris 26 27 closed herein can be performed using standard genetic tech ATCC192S4 niques and Screening and can be made in any host cell that is Leticonostoc mesenteroides Subsp cremoris 28 29 Suitable to genetic manipulation (Methods in Yeast Genetics, Lactobacilitis brevis Subsp. gravesensis 30 31 ATCC27305 2005, Cold Spring Harbor Laboratory Press, Cold Spring 40 Harbor, N.Y., pp. 201-202). Lactococcus lactis subsplactis NCDO2118 32 33 In embodiments, a recombinant host cell disclosed herein can be any yeast or fungi host useful for genetic modification As described and demonstrated herein, Applicants have and recombinant gene expression including those yeast men discovered additional KARI enzymes and variants of the tioned elsewhere herein, such as in Table 7. In other embodi 45 additional KARIs that result in isobutanol production com ments, a recombinant host cell can be a member of the genera parable to and/or exceeding that observed with the KARI Issatchenkia, Zygosaccharomyces, Schizosaccharomyces, from Lactococcus lactis. Such KARI enzymes and variants Dekkera, Torulopsis, Brettanomyces, Torulaspora, Hans result in comparable or higher isobutanol titer and/or higher eniaspora, Kluveromyces, Yarrowia, and some species of effective isobutanol productivity when compared to that Candida. 50 observed with Lactococcus lactis KARI in the same condi Polypeptides with KARI Activity tions. Accordingly, in embodiments, polypeptides having KARI activity that function in an isobutanol production path In some embodiments, the recombinant host cells and way have isobutanol titer and/or effective isobutanol produc methods provided herein address a need that arises in the tivity comparable to or better than that with the Lactococcus microbial production of isobutanol where the KARI enzyme 55 lactis KARI (SEQID NO:380). performs a vital role. In the isobutanol biosynthetic pathway Such polypeptides having KARI activity may thus be suit able for isobutanol production. It will be appreciated that shown in FIG. 1, the substrate to product conversion of aceto using a combination of structural and sequence information lactate to dihydroxyisovalerate (DHIV) is catalyzed by the available in the art, polypeptides comprising KARI activity KARI enzyme. Disclosed in US Appl. Publication No. 60 and less than 100% identity to the exemplified sequences can US2011/0244536 and incorporated by reference, a be constructed for use in isobutanol biosynthetic pathways. polypeptides having ketol-acid reductoisomerase activity For example, crystal structures of the E. coli KARI enzyme at 2.6A resolution have been solved (Tyagi, et al., Protein Sci., that are members of the SLSL Clade of KARIs. Polypeptides 14:3089-3100, 2005) as has the structure of the Paeruginosa having KARI activity disclosed therein were found to be 65 KARI (Ahn, et al., J. Mol. Biol. 328: 505-515, 2003) and the effective for isobutanol production. The SLSL Clade of KARI enzyme from spinach (Biou V., et al. The EMBO KARIs include those KARI enzymes listed in Table 3. Journal, 16: 3405-3415, 1997). Furthermore, described US 9,422,582 B2 31 32 herein is a Profile HMM (provided herein; Table Z) prepared caccae, Lactococcus lactis KARI enzyme or a variant or using amino acid sequences of 25 KARI proteins with experi active fragment thereof Suited for a range of production con mentally verified function as outlined in Table 1. The KARIs ditions. were from Pseudomonas fluorescens Pf-5, Sulfolobus solfa In some embodiments, provided herein is a polypeptide taricus P2, Pyrobaculum aerophilum str.IM2, Natronomonas having KARI activity and having at least about 80%, at least pharaonis DSM 2160, Bacillus subtilis subsp. subtilis str. about 85%, at least about 90%, at least about 95%, at least 168, Corynebacterium glutamicum ATCC 13032, Phaeospr about 98%, or at least about 99% identity to a KARI enzyme irillum molischianum, Ralstonia Solanacearum GMI1000, of Table 3 or Table 10, or Examples 16, 17, 21 and having a Zymomonas mobilis subsp. mobilis ZM4, Alkalilimnicola K for NADH less than about 300 uM, 100 uM, 50 uM, 20 10 uM, 10uM, or 5uM. In some embodiments, provided herein ehrlichei MLHE-, Campylobacter lari RM2100, Marino is an engineered polypeptide having KARI activity and hav bacter aquaeolei VT8, Psychrobacter arcticus 273-4, ing at least about 80%, at least about 85%, at least about 90%, Hahella cheiuensis KCTC 2396, Thiobacillus denitrificans at least about 95%, at least about 98%, or at least about 99% ATCC 25259, Azotobacter vinelandii AvOP, Pseudomonas identity to a KARI enzyme of Table 3, Table 10 or Examples syringae pv. Syringae B728a, Pseudomonas syringae pv. 16, 17, 21. In some embodiments, such polypeptides have a tomato str. DC3000, Pseudomonas putida KT2440. K for NADH less than that of the corresponding native Pseudomonas entomophila L48, Pseudomonas mendocina enzyme. In some embodiments, the ratio of K for NADH to ymp, Pseudomonas aeruginosa PAO1, Bacillus cereus ATCC K for NAPDH is less than 0.1, in some embodiments less 10987, Bacillus cereus ATCC 10987, and Spinacia oleracea. than 1, in Some embodiments less than 2, in Some embodi Any protein that matches the Profile HMM with an Evalue of ments, less than 4. <10 using hmmsearch program in the HMMER package is KARI enzymes and variants thereof that are particularly expected to be a functional KARI. suitable for isobutanol production include, but are not limited Production of isobutanol is believed to utilize the glycoly to, variants of a ketol-acid reductoisomerase from Anaerosti sis pathway present in the host microorganism. During the pes caccae DSM 14662 (SEQID NO: 643): “K9G9” (SEQID production of two molecules of pyruvate from glucose during 25 NO: 644) and “K9D3” (SEQID NO: 645) which have K for glycolysis, there is net production of two molecules of NADH NADH lower than that of the native enzyme (SEQ ID NO: from NAD+ by the glyceraldehyde-3-phosphate dehydroge 643). nase reaction. During the further production of one molecule Host cells provided herein may comprise a polypeptide of isobutanol from two molecules of pyruvate, there is net having ketol-acid reductoisomerase activity. In embodi consumption of one molecule of NAD(P)H, by the KARI 30 ments, such polypeptides have at least about 80%, at least reaction, and one molecule of NAD(P)H by the isobutanol about 85%, at least about 90%, at least about 95%, at least dehydrogenase reaction. The interconversion of NADH with about 98%, or at least about 99% identity to SEQID NO: 643, NADPH is generally slow and inefficient in yeast; thus, an active variant thereof, or a KARI derived from Anaerosti NADPH to be consumed is generated by metabolism (for pes caccae DSM 14662, or an active variant thereof. In example, by the pentose phosphate pathway) consuming Sub 35 embodiments, the polypeptides have at least about 80%, at strate in the process. Meanwhile, the cell strives to maintain least about 85%, at least about 90%, at least about 95%, at homeostasis in the NAD+/NADH ratio, leading to the excess least about 98%, or at least about 99% identity to SEQID NO: NADH produced in isobutanol production being consumed in 645 or 644. In embodiments, the polypeptides comprise SEQ wasteful reduction of other metabolic intermediates; e.g., by ID NO: 645 or 644. the production of glycerol (Bakker, et al., 2001. Stoichiom 40 In some embodiments, polypeptides having KARI activity etry and compartmentation of NADH metabolism in Saccha comprise at least about 80%, at least about 85%, at least about romyces cerevisiae. FEMS Microbiol. Rev. 25:15-37). Thus, 90%, at least about 95%, at least about 98%, or at least about an imbalance between NADH produced and NADPH con 99% identity to the amino acid sequence of SEQID NO: 419 Sumed by the isobutanol pathway can lead to a reduction in JB4P, 427 SB2, and all those variants listed in Tables 25 the molar yield of isobutanol produced from glucose in two 45 and 26. Such variants provide alternatives for optimizing the ways: 1) unnecessary operation of metabolism to produce efficiency of the isobutanol biosynthetic pathway for particu NADPH, and 2) wasteful reaction of metabolic intermediates lar production conditions. Demonstrated in the Examples is to maintain NAD+/NADH homeostasis. Polypeptides having isobutanol production under conditions. KARI activity that function well in an isobutanol pathway Identification of Additional Polypeptides Having KARI and have a low K for NADH can be used to improve the 50 Activity production of isobutanol. Described in Example 1 is a biodiversity screen of KARL Also disclosed herein are substitutions to the KARI encoding genes from various bacterial and fungal species enzyme sequences provided in Table 3 and in Table 10 to which revealed suitable KARIs for isobutanol production. produce variants with varying ability to utilize NADH as a Equipped with this disclosure, one of skill in the art will be cofactor. Such variants provide alternatives that may be 55 readily able to identify additional suitable polypeptides hav employed to optimize the efficiency of a biosynthetic path ing KARI activity. way utilizing KARI, Such as an isobutanol biosynthetic path The sequences of other polynucleotides, genes and/or way, for particular production conditions. Demonstrated in polypeptides can be identified in the literature and in bioin the Examples is isobutanol production under conditions formatics databases well known to the skilled person using switched from aerobic to anaerobic for variants of the K9 60 sequences disclosed herein and available in the art. For KARI enzyme derived from Anaerostipes caccae with differ example, Such sequences can be identified through BLAST ing abilities to utilize NADH. Thus, equipped with this dis searching of publicly available databases with polynucleotide closure, one of skill in the art will be able to produce recom or polypeptide sequences provided herein. In such a method, binant host cells comprising a SLSL Glade KARI enzyme, or identities can be based on the ClustalW method of alignment a an Enterococcus gallinarum, Streptococcus thermophilus 65 using the default parameters of GAP PENALTY=10, GAP Lactococcus lactis subsp. Cremoris MG 1363, Bifidobacte LENGTH PENALTY=0.1, and Gonnet 250 series of protein rium angulatum, Bifidobacterium dentium, or Anaerostipes weight matrix. US 9,422,582 B2 33 34 Additionally, polynucleotide or polypeptide sequences substitution at at least 2, at least 3, at least 4, or all of the disclosed herein can be used to identify other KARI indicated positions. In some embodiments, the Substitution at homologs in nature. For example, each of the KARI encoding the position corresponding to 186 is T or V. In some embodi nucleic acid fragments disclosed herein can be used to isolate ments, the substitution at the position corresponding to N87 is genes encoding homologous proteins. Isolation of homolo P. In some embodiments, the substitution at the position cor gous genes using sequence-dependent protocols is well responding to N107 is S. In some embodiments, the substi known in the art. Examples of sequence-dependent protocols tution at the position corresponding to T131 is C. L. A. Mor include, but are not limited to (1) methods of nucleic acid V. In some embodiments, the substitution at the position hybridization; (2) methods of DNA and RNA amplification, corresponding to T191 is A. S. O. C., or G. as exemplified by various uses of nucleic acid amplification 10 In embodiments, the polypeptides comprise fewer than 10, technologies e.g., polymerase chain reaction (PCR), Mullis 15, or substitutions with respect to the wild-type sequence. In et al., U.S. Pat. No. 4,683.202; ligase chain reaction (LCR), embodiments, the polypeptides match the Profile HMM Tabor et al., Proc. Acad. Sci. USA 82:1074 (1985); or strand based on experimentally verified KARIs and given in Table Z displacement amplification (SDA), Walker et al., Proc. Natl. with an E value less than <10. Sequences can be compared Acad. Sci. U.S.A., 89:392 (1992); and (3) methods of library 15 to the profile HMM given in Table Z using hmmsearch (HM construction and Screening by complementation. MER software package available from Janelia Farm Research It will be appreciated that one of ordinary skill in the art, Campus, Ashburn, Va.). equipped with this disclosure, can generate active fragments Additional polypeptides having KARI activity and low of polypeptides provided herein, for example, by truncating ered K for NADH can be obtained using methods described polypeptides provided herein based on sequence alignments and demonstrated herein. For example, a polypeptide having at the N-terminus and confirming KARI activity. In embodi KARI activity can be employed in the construction of a site ments, Anaerostipes caccae KARIs and variants thereof pro saturation gene library as described herein. Kits for construc vided herein are truncated at the N-terminus. In one embodi tion of such gene libraries are commercially available (for ment, up to and including the first five amino acids are example, from USB Corporation, Cleveland, Ohio, #78480.) truncated from a polypeptide provided herein. In embodi 25 Site-directed mutagenesis can also be carried out using com ments, the polypeptide is SEQID NO: 27 or a variant thereof. mercially available kits (for example, the QuickChange II XL In one embodiment, a polypeptide having KARI activity site directed mutagenesis kit, Catalog #200524, Stratagene, comprises SEQID NO: 635, 637 (encoded by polynucleotide La Jolla, Calif.). Primer design for target sites for mutagen sequences SEQ ID NO: 636 and 638, respectively), esis is well-known in the art, and multiple sequence align K9 Annabel SH (SEQ ID NO:862, protein SEQ ID 30 ment to identify the target sites is likewise well-known. NO:863) and K9 Zeke SH (SEQ ID NO: 860, protein SEQ Once variants have been generated, KARI activity with ID NO: 861), or any variant listed in Table 40. NADH or NADPH can be readily assessed using methods Lowering K for NADH known in the art and/or disclosed herein. For example, KARI As shown in FIG. 2 and Examples, mutations in the posi activity can be determined by measuring the disappearance of tions corresponding to 50, 52 and 53, and optionally 47, of the 35 the NADPH or NADH from the reaction at 340 nm or by Pseudomonas fluorescens KARI in the KARI enzyme from determination of the Michaelis constant via measurement of Anaerostipes caccae result in KARIs with lowered K for formation of 2,3-dihydroxyisovalerate using HPLC/MS. NADH as compared to wild-type, verifying that mutations in Likewise, isobutanol production from a strain comprising these positions produce NADH accepting variants of highly variants can be confirmed. effective KARIs. Further mutations of Anaerostipes caccae 40 Cofactor Specificity KARI, revealed positions which further lower the K for To determine cofactor specificity, V/K ratios can be NADH. calculated for each cofactor at Saturating acetolactate; those As demonstrated herein (see Examples), Substitution of variants with a higher ratio for NADH will react at a higher amino acids in the phosphate binding region, particularly in rate with NADH than NADPH under conditions of equal two or more positions corresponding to positions 47, 50, 52. 45 molar concentrations of the two cofactors and Saturating and 53 of PF5 KARI (SEQID NO: 5) results in lowered K acetolactate.V, and K values for NADH and NADPH can for NADH. Therefore, provided herein are polypeptides be determined using methods known in the art and/or pro derived from an organism listed herein, for example, in Tables vided herein (see Example 16). For example, to determine 3 and 10 having KARI activity and comprising substitutions V, and K values for NADH and NADPH, the partially at at least two of the four positions corresponding to positions 50 purified proteins can be assayed at various concentrations of 47, 50, 52, and 53 of PF5 KARI as compared to the native NADH and NADPH. amino acid sequence. Provided herein are polypeptides hav As demonstrated herein (see Examples 16 and 18 and FIG. ing KARI activity and comprising Substitutions in the phos 8), substitution of additional amino acids in K9G9 results in phate binding region. Provided herein are polypeptides hav variants having increased specificity for NADH. Thus, pro ing KARI activity and comprising Substitutions at positions 55 vided herein are polypeptides comprising Substitution at one corresponding to S56 and S58 of K9 KARI (SEQID NO:27). or more or all of the positions corresponding to K57,Y53, and In some embodiments the Substitution at the position corre E74 of K9 KARI (SEQID NO: 27). Also provided herein are sponding to S56 is A. In some embodiments, the Substitution polypeptides comprising Substitutions at one or more or all of at the position corresponding to S58 is D or E. In some the positions corresponding to Y53, K57, E74, N87 and K90, embodiments, the Substitution at the position corresponding 60 In embodiments, the Substitution at the position correspond to S53 is Q., E. P. or A. In some embodiments, the substitution ing to Y53 is F. In embodiments, the substitution at the posi at the position corresponding to S56 is V or D. In some tion corresponding to K57 is E. In embodiments, the substi embodiments, the Substitution at the position corresponding tution at the position corresponding to E74 is G. In to S58 is D or Q. In embodiments, the polypeptides further embodiments, the Substitution at the position corresponding comprise a Substitution at one or more positions correspond 65 to N87 is P. In embodiments, the substitution at the position ing to 186, N87, N107, T131, or T191 of K9 KARI (SEQID corresponding to K90 is Mor L. In embodiments, the variants NO: 27). In some embodiments, the polypeptides comprise a comprise Substitutions of at least one position corresponding US 9,422,582 B2 35 36 to S56 or S58 of SEQID NO: 27 and further comprise at least used to line up the active site of monomer A of spinach KARI one, at least two, at least three, or more than three further to the monomer A of PF5 KARI model. The coordinates of substitution(s) corresponding to positions of SEQID NO: 27 NADPH, two magnesium ions and the inhibitor bound in the identified herein. active site of spinach KARI were extracted and incorporated In embodiments, the polypeptides comprise fewer than 2, to molecule A of PF5 KARI. A set of the coordinates of these 3, 4, 5, 10, 15, or 20 substitutions with respect to the wild-type molecules were generated for monomer B of PF5 KARI by sequence. In embodiments, the polypeptides match the Pro applying the transformation operator from monomer A to file HMM based on experimentally verified KARIs and given monomer B calculated by the program. in Table Z with an E value less than <10. Because there is no NADPH in the active site of PAO1 As demonstrated in the Examples, variants of K9SB2 10 KARI crystal structure, the structures of the phosphate bind (SEQID NO: 427) were generated and screened for variants ing loop region in the NADPH binding site (residues 44-45 in with reduced NADPH affinity, revealing additional positions PAO1 KARI, 157-170 in spinach KARI) are very different for substitution. Thus, in embodiments, polypeptides further between the two. To model the NADPH bound form, the comprise Substitutions at one or more positions correspond model of the PF5-KARI phosphate binding loop (44-55) was ing to F53, G55, A56, W59, F67, I84, L85, Q91, M94, and 15 replaced by that of lyve (157-170). Any discrepancy of side P135 of SEQID NO: 427. In embodiments, the substitution at chains between these two was converted to those in the PF5 position G55 is D or C, the substitution at position Q91 is L. KARI sequence using the mutate replace command in pro the substitution at position A56 is T or V, the substitution at gram O. and the conformations of the replaced side-chains P135 is S, the substitution at position F53 is L., the substitution were manually adjusted. The entire NADPH/Mg/inhibitor at position. M94 is I, the substitution at position F67 is L or I, bound dimeric PF5-KARI model went through one round of the substitution at position W59 is C, the substitution at posi energy minimization using program CNX (ACCELRYS San tion 184 is L., and the substitution at position L85 is M. Diego Calif. Burnger, A.T. and Warren, G. L., Acta Crystal KARI Structure logr., D 54: 905-921, 1998) after which the inhibitor was Structural information useful in the identification and replaced by the substrate, acetolactate (AL), in the model. modification of polypeptides having KARI activity is pro 25 Isobutanol Production vided in art, such as in the references described hereas well as Host cells provided herein can comprise a polypeptide in the Profile HMM provided herewith in Table Z and in US having ketol-acid reductoisomerase activity. As described App. Pub. Nos. 20100197519 and 20090163376, incorpo and demonstrated herein, Applicants have discovered addi rated herein by reference tional KARI enzymes and variants of the additional KARIs It was reported that phosphate p2 oxygen atoms of 30 that result in isobutanol production comparable to and/or NADPH form hydrogen bonds with side chains of Arg162, exceeding that observed with the KARI from Lactococcus Ser165 and Ser167 of spinach KARI (Biou V., et al. The lactis (see Examples). Accordingly, in embodiments, EMBO Journal, 16:3405-3415, 1997). Studies by Ahn et al., polypeptides having KARI activity that function in an isobu (J. Mol. Biol. 328: 505-515, 2003) had identified three tanol production pathway have effective isobutanol produc NADPH phosphate binding sites (Arg47, Ser50 and Thr52) 35 tivity and/or produce isobutanol at a titer comparable to or for Pseudomonas aeruginosa (PAO-KARI) following com better than that with the Lactococcus lactis KARI (SEQ ID paring its structure with that of the spinach KARI. The struc NO:380). Such polypeptides are thus considered to be useful ture of PF5-KARI with bound NADPH, acetolactate and for isobutanol production, particularly in cells comprising magnesium ions was built based on the crystal structure of P isobutanol production pathways described herein. In embodi aeruginosa PAO1-KARI (PDB ID 1 NP3, Ahn H. J. et al., J. 40 ments, polypeptides provided herein have effective isobu Mol. Biol. 328: 505-515, 2003) which has 92% amino acid tanol productivity and/or produce isobutanol at a titer greater sequence homology to PF5 KARI, PAO1-KARI structure is a than or about equal to that observed with the Lactococcus homo-dodecamer and each dodecamer consists of six homo lactis KARI (SEQID NO:380) under the same conditions. In dimers with extensive dimer interface. The active site of embodiments, polypeptides provided herein have effective KARI is located in this dimer interface. The biological assem 45 isobutanol productivity greater than about 3 grams per gram bly is formed by six homo-dimers positioned on the edges of of cells, greater than about 4, greater than about 5, or greater a tetrahedron resulting in a highly symmetrical dodecamer of than about 6 grams per gram of cells after about 48 hours 23 point group symmetry. wherein at least the last about 24 hours of the 48 hours are The model of PF5-KARI dimer was built based on the under anaerobic conditions. coordinates of monomer A and monomer B of PAO1-KARI 50 Furthermore, Applicants have discovered that variants of and sequence of PF5-KARI using DeepView/Swiss PDB the polypeptides having KARI activity described above, viewer (Guex, N. and Peitsch, M. C., Electrophoresis, 18: including those with K for NADH lower than that of the 2714-2723, 1997). This model was then imported to program unsubstituted polypeptide, provide advantages for isobutanol O (Jones, T. A. et al. Acta Crystallogr. A 47: 110-119, 1991) production under anaerobic conditions. While not wishing to on a Silicon Graphics system for further modification. 55 be bound by theory, it is believed that such variants provide The structure of PAO1-KARI has no NADPH, substrate or improved isobutanol production due to more effective use of inhibitor or magnesium in the active site. Therefore, the spin NADH as reducing equivalents. In embodiments, isobutanol ach KARI structure (PDB ID lyve, BiouV. et al., The EMBO production employing Such a variant provides reduced glyc Journal, 16: 3405-3415, 1997), which has magnesium ions, erol accumulation. In embodiments, the molar ratio of isobu NADPH and inhibitor (N-Hydroxy-N-isopropyloxamate) in 60 tanol to glycerol is increased for a variant of a polypeptide the acetolacate binding site, was used to model these mol having KARI activity described above with K for NADH ecules in the active site. The plant KARI has very little lower than that of the unsubstituted polypeptide. In embodi sequence homology to either PF5- or PAO1 KARI (<20% ments, the molar ratio of isobutanol to glycerol is greater than amino acid identity), however the structures in the active site 1. In embodiments, the molar ratio of isobutanol to glycerol is region of these two KARI enzymes are very similar. To over 65 greater than 2. In embodiments, the molar ratio is greater than lay the active site of these two KARI structures, commands 3. In embodiments, the molar ratio is greater than 4, greater LSQ ext, LSQ improve, LSQ mol in the program O were than 5, greater than 6, greater than 7, greater than 8, greater US 9,422,582 B2 37 38 than 9, greater than 10, greater than 12, or greater than 14. In or an interfering RNA, and constructs can be introduced that embodiments, the molar ratio is in the range of about 1 to 5, result in coSuppression. In other embodiments, the synthesis about 1 to 10, about 2 to 8, about 5 to 10, about 5 to 15 about or stability of the transcript can be lessened by mutation. In 10 to 15 or about 12 to 15. embodiments, the efficiency by which a protein is translated As demonstrated in the Examples herein, as the biochemi from mRNA can be modulated by mutation. All of these cal specificity for the NADH cofactor, as defined by (NADH methods can be readily practiced by one skilled in the art V/K)/(NADPHV/K) increases, there is an observed making use of the known or identified sequences encoding increase in the isobutanol/glycerol ratio, Suggesting that the target proteins. altered cofactor specificity led to diminished NADPH utili In other embodiments, DNA sequences Surrounding a tar Zation and by-product formation. 10 Modification of Aldehyde Dehydrogenase get aldehyde dehydrogenase coding sequence are also useful In embodiments of the invention, a recombinant host cell in Some modification procedures and are available, for can comprise reduced or eliminated aldehyde dehydrogenase example, for yeasts such as Saccharomyces cerevisiae in the activity and an isobutanol biosynthetic pathway wherein the complete genome sequence coordinated by Genome Project host cell produces butanol. In other embodiments, the recom 15 ID9518 of Genome Projects coordinated by NCBI (National binant host cell can comprise an isobutanol or a 1-butanol Center for Biotechnology Information) with identifying biosynthetic pathway as described further herein. In other GOPID # 13838. An additional non-limiting example of yeast embodiments, the isobutanol biosynthetic pathway can com genomic sequences is that of Candida albicans, which is prise a polynucleotide encoding a polypeptide that catalyzes included in GPID #10771, #10701 and #16373. Other yeast a Substrate to product conversion selected from the group genomic sequences can be readily found by one of skill in the consisting of: (a)pyruvate to acetolactate; (b) acetolactate to art in publicly available databases. 2,3-dihydroxyisovalerate; (c) 2.3-dihydroxyisovalerate to In other embodiments, DNA sequences Surrounding a tar 2-ketoisovalerate; (d) 2-ketoisovalerate to isobutyraldehyde: get aldehyde dehydrogenase coding sequence can be useful and (e) isobutyraldehyde to isobutanol. In other embodi for modification methods using homologous recombination. ments, the isobutanol biosynthetic pathway can comprise 25 In a non-limiting example of this method, aldehyde dehydro polynucleotides encoding polypeptides having acetolactate genase gene flanking sequences can be placed bounding a synthase, keto acid reductoisomerase, dihydroxy acid dehy selectable marker gene to mediate homologous recombina dratase, ketoisovalerate decarboxylase, and alcoholdehydro tion whereby the marker gene replaces the aldehyde dehydro genase activity. In other embodiments, the recombinant cell genase gene. In another non-limiting example, partial alde comprises a 1-butanol biosynthetic pathway. In other 30 hyde dehydrogenase gene sequences and aldehyde embodiments, the 1-butanol biosynthetic pathway comprises dehydrogenase gene flanking sequences bounding a select a polynucleotide encoding a polypeptide that catalyzes a sub able marker gene can be used to mediate homologous recom strate to product conversion selected from the group consist bination whereby the marker gene replaces a portion of the ing of: (a) acetyl-CoA to acetoacetyl-CoA; (b) acetoacetyl target aldehyde dehydrogenase gene. In embodiments, the CoA to 3-hydroxybutyryl-CoA; (c) 3-hydroxybutyryl-CoA 35 selectable marker can be bounded by site-specific recombi to crotonyl-CoA; (d) crotonyl-CoA to butyryl-CoA: (e) nation sites, so that following expression of the correspond butyryl-CoA to butyraldehyde: (f) butyraldehyde to 1-bu ing site-specific recombinase, the resistance gene is excised tanol. In other embodiments, the 1-butanol biosynthetic path from the aldehyde dehydrogenase gene without reactivating way can comprise polynucleotides encoding polypeptides the latter. In embodiments, the site-specific recombination having activity. 40 leaves behind a recombination site which disrupts expression In embodiments of the invention, a recombinant host cell of the aldehyde dehydrogenase protein. In other embodi can comprise a modification or disruption of a polynucleotide ments, the homologous recombination vector can be con or gene encoding a polypeptide having aldehyde dehydroge structed to also leave a deletion in the aldehyde dehydroge nase activity or a modification or disruption of a polypeptide nase gene following excision of the selectable marker, as is having aldehyde dehydrogenase activity. Many methods for 45 well known to one skilled in the art. genetic modification and disruption of target genes to reduce In other embodiments, deletions can be made to an alde or eliminate expression are known to one of ordinary skill in hyde dehydrogenase target gene using mitotic recombination the art and can be used to create a recombinant host cell as described by Wach et al. (Yeast, 10:1793-1808: 1994). disclosed herein. In other embodiments, the recombinant host Such a method can involve preparing a DNA fragment that cell can comprise a deletion, mutation, and/or substitution in 50 contains a selectable marker between genomic regions that an endogenous polynucleotide or gene encoding a polypep can be as short as 20 bp, and which bound a target DNA tide having aldehyde dehydrogenase activity or in an endog sequence. In other embodiments, this DNA fragment can be enous polypeptide having aldehyde dehydrogenase activity. prepared by PCR amplification of the selectable marker gene Such modifications, disruptions, deletions, mutations, and/or using as primers oligonucleotides that hybridize to the ends of Substitutions can result in aldehyde dehydrogenase activity 55 the marker gene and that include the genomic regions that can that is reduced or eliminated. Modifications that can be used recombine with the yeast genome. In embodiments, the linear include, but are not limited to, deletion of the entire gene or a DNA fragment can be efficiently transformed into yeast and portion of the gene encoding an aldehyde dehydrogenase recombined into the genome resulting in gene replacement protein, inserting a DNA fragment into the encoding gene (in including with deletion of the target DNA sequence (((as either the promoter or coding region) so that the protein is not 60 disclosed, for example, in Methods in Enzymology, Volume expressed or expressed at lower levels, introducing a muta 194, Guide to Yeast Genetics and Molecular and Cell Biology tion into the coding region which adds a stop codon or frame (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), shift such that a functional protein is not expressed, and Elsevier Academic Press, San Diego, Calif.)). introducing one or more mutations into the coding region to Moreover, promoter replacement methods can be used to alter amino acids so that a non-functional or a less active 65 exchange the endogenous transcriptional control elements protein is expressed. In other embodiments, expression of a allowing another means to modulate expression such as target gene can be blocked by expression of an antisense RNA described by Mnaimneh et al., ((2004) Cell 118(1):31-44). US 9,422,582 B2 39 40 In other embodiments, the aldehyde dehydrogenase target In embodiments, a recombinant host cell of the invention gene encoded activity can be disrupted using random can be S. carevisiae, and a polypeptidehaving aldehyde dehy mutagenesis, which can then be followed by Screening to drogenase activity can be ALD2, ALD3, ALD4, ALD5, identify strains with reduced or substantially eliminated ALD6, or combinations thereof. In other embodiments, a activity. In this type of method, the DNA sequence of the recombinant host cell can be Kluyveromyces lactis, and a target gene encoding region, or any other region of the polypeptide having aldehyde dehydrogenase activity can be genome affecting carbon Substrate dependency for growth, KLLAOF00440, KLLAOE23057, KLLAOD10021, need not be known. In embodiments, a screen for cells with KLLAOD09999G, or combinations thereof. In other embodi reduced aldehyde dehydrogenase activity, or other mutants ments, a recombinant host cell can be Pichia stipitis, and a having reduced aldehyde dehydrogenase activity, can be use 10 polypeptide having aldehyde dehydrogenase activity can ful for recombinant host cells of the invention. Methods for creating genetic mutations are common and ALD2, ALD3, ALD4, ALD5, ALD7, or combinations well known in the art and can be applied to the exercise of thereof. In other embodiments, a recombinant host cell can be creating mutants. Commonly used random genetic modifica Lactobacillus plantarum, and a polypeptide having aldehyde tion methods (reviewed in Methods in Yeast Genetics, 2005, 15 dehydrogenase activity can be AldH. In other embodiments, a Cold Spring Harbor Laboratory Press, Cold Spring Harbor, recombinant host cell can be E. coli, and a polypeptide having N.Y.) include spontaneous mutagenesis, mutagenesis caused aldehyde dehydrogenase activity can be aldA, aldB, aldH, or by mutator genes, chemical mutagenesis, irradiation with UV combinations thereof. or X-rays, or transposon mutagenesis. In embodiments of the invention, a recombinant host cell Chemical mutagenesis of host cells can involve, but is not can be S. cerevisiae, and an endogenous polynucleotide or limited to, treatment with one of the following DNA gene encoding a polypeptide having aldehyde dehydrogenase mutagens: ethyl methanesulfonate (EMS), nitrous acid, activity can be ALD2, ALD3, ALD4, ALD5, ALD6, or com diethyl sulfate, or N-methyl-N'-nitro-N-nitroso-guanidine binations thereof. In embodiments of the invention, a recom (MNNG). Such methods of mutagenesis have been reviewed binant host cell can be S. cerevisiae, and an endogenous in Spenceretal. (Mutagenesis in Yeast, 1996, Yeast Protocols: 25 polynucleotide or gene encoding a polypeptide having alde Methods in Cell and Molecular Biology. Humana Press, hyde dehydrogenase activity can be ALD6. In other embodi Totowa, N.J.). In embodiments, chemical mutagenesis with ments, a recombinant host cell can be Kiuyveromyces lactis, EMS can be performed as disclosed in Methods in Yeast and an endogenous polynucleotide or gene encoding a Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold polypeptide having aldehyde dehydrogenase activity can be Spring Harbor, N.Y. Irradiation with ultraviolet (UV) light or 30 KLLAOF00440, KLLAOE23057, KLLAOD10021, X-rays can also be used to produce random mutagenesis in KLLAOD09999G, or combinations thereof. In other embodi yeast cells. The primary effect of mutagenesis by UV irradia ments, a recombinant host cell can be Pichia stipitis, and an tion is the formation of pyrimidine dimers which disrupt the endogenous polynucleotide or gene encoding a polypeptide fidelity of DNA replication. Protocols for UV-mutagenesis of having aldehyde dehydrogenase activity can be ALD2, yeast can be found in Spencer et al. (Mutagenesis in Yeast, 35 ALD3, ALD4, ALD5, ALD7, or combinations thereof. In 1996, Yeast Protocols: Methods in Cell and Molecular Biol embodiments, the polypeptide having aldehyde dehydroge ogy. Humana Press, Totowa, N.J.). In embodiments, the intro nase activity is a homolog of ALD6 from Saccharomyces duction of a mutator phenotype can also be used to generate cerevisiae. S. cerevisiae deletion strains containing aldehyde random chromosomal mutations in host cells. In embodi dehydrogenase gene deletions with a kanMX cassette are ments, common mutator phenotypes can be obtained through 40 commercially available from American Type Culture Collec disruption of one or more of the following genes: PMS1, tion catalog #4000753. MAG1, RAD18 or RAD51. In other embodiments, restora In other embodiments, a recombinant host cell can be tion of the non-mutator phenotype can be obtained by inser Lactobacillus plantarum, and an endogenous polynucleotide tion of the wildtype allele. In other embodiments, collections encoding a polypeptide having aldehyde dehydrogenase of modified cells produced from any of these or other known 45 activity can be AldFH. In other embodiments, a recombinant random mutagenesis processes can be screened for reduced host cell can be E. coli, and an endogenous polynucleotide or eliminated aldehyde dehydrogenase activity. encoding a polypeptide having aldehyde dehydrogenase Genomes have been completely sequenced and annotated activity can be aldA, aldB, aldH, or combinations thereof. and are publicly available for the following yeast strains: Examples of aldehyde dehydrogenase polynucleotides, Ashbya gossypii ATCC 10895, Candida glabrata CBS 138, 50 genes and polypeptides that can be targeted for modification Kiuyveromyces lactis NRRL Y-1140, Pichia stipitis CBS or inactivation in a recombinant host cell disclosed herein 6054, Saccharomyces cerevisiae S288c, Schizosaccharomy include, but are not limited to, those of the following Table 4. ces pombe 972h-, and Yarrowia lipolytica CLIB 122. Typi cally BLAST (described above) searching of publicly avail TABLE 4 able databases with known aldehyde dehydrogenase 55 polynucleotide or polypeptide sequences, such as those pro Aldehyde dehydrogenase target gene coding regions and proteins. vided herein, is used to identify aldehyde dehydrogenase Nucleic acid Amino acid encoding sequences of other host cells, such as yeast cells. SEQID NO: SEQID NO: In other embodiments, a polypeptide having aldehyde ALD2 from S. cerevisiae 732 733 dehydrogenase activity can catalyze the conversion of isobu 60 ALD3 from S. cerevisiae 734 735 tyraldehyde to isobutyric acid. In other embodiments, the ALD4 from S. cerevisiae 736 737 conversion of isobutyraldehyde to isobutyric acid in a recom ALD5 from S. cerevisiae 738 739 binant host cell is reduced or eliminated. Instill other embodi ALD6 from S. cerevisiae 740 741 KLLAOF00440 from 742 743 ments, a polynucleotide, gene or polypeptide having alde Kluyveromyces lactis hyde dehydrogenase activity can correspond to Enzyme 65 KLLAOE23057 from 744 745 Commission Number EC 1.2.1.3, EC 1.2.1.4, and/or EC Kluyveromyces lactis 12.1.5. US 9,422,582 B2 41 42 TABLE 4-continued polypeptides having at least about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to Aldehyde dehydrogenase target gene coding regions and proteins. about 90%, about 90% to about 95%, about 96%, about 97%, Nucleic acid Amino acid about 98%, or about 99% sequence identity to any of the SEQ ID NO: SEQID NO: 5 aldehyde dehydrogenase polynucleotides or polypeptides KLLAOD10021 from 746 747 disclosed herein (e.g., SEQ ID NOs: 732-765 of Table 4) Kluyveromyces lactis Identities are based on the Clustal W method of alignment KLLAODO9999 from 748 749 using the default parameters of GAP PENALTY=10, GAP Kluyveromyces lactis ALD2 from Pichia stipits 750 751 10 LENGTH PENALTY=0.1, and Gonnet 250 series of protein ALD3 from Pichia stipitis 752 753 weight matrix. ALD4 from Pichia stipitis 754 755 The modification of aldehyde dehydrogenase in a recom ALD5 from Pichia stipitis 756 757 binant host cell disclosed herein to reduce or eliminate alde ALD7 from Pichia stipitis 758 759 aldA from E. coi 760 761 hyde dehydrogenase activity can be confirmed using methods aldB from E. coi 762 763 15 known in the art. For example, disruption of a particular aldH (puuC) from E. coli 764 765 aldehyde dehydrogenase could be confirmed with PCR screening using primers internal and external to the aldehyde Other examples of aldehyde dehydrogenase polynucle dehydrogenase gene or by Southern blot using a probe otides, genes and polypeptides that can be targeted for modi designed to the aldehyde dehydrogenase gene sequence. fication or inactivation in a recombinant host cell disclosed 20 Alternatively, one could utilize gas chromatography-mass herein include, but are not limited to, aldehyde dehydroge spectroscopy or liquid chromatography to screen strains nase polynucleotides, genes and/or polypeptides having at exposed to isobutyraldehyde for decreased formation of least about 70% to about 75%, about 75% to about 80%, about isobutyric acid. Accordingly, provided herein is a method of 80% to about 85%, about 85% to about 90%, about 90% to screening for strains with decreased isobutyric acid formation about 95%, about 96%, about 97%, about 98%, or about 99% 25 comprising: a) providing a strain comprising a modification sequence identity to any one of the sequences of Table 4. in a polynucleotide encoding a polypeptide having aldehyde wherein such a polynucleotide or gene encodes, or such a dehydrogenase activity and/or a modification in a polynucle polypeptide has, aldehyde dehydrogenase activity. Still other otide encoding a polypeptide having aldehyde oxidase activ examples of aldehyde dehydrogenase polynucleotides, genes ity; b) contacting the cell with isobutyraldehyde; and c) mea and polypeptides that can be targeted for modification or 30 inactivation in a recombinant host cell disclosed herein Suring isobutyric acid formation; wherein isobutyric acid include, but are not limited to an active variant, fragment or formation is reduced as compared to a control strain without derivative of any one of the sequences of Table 4, wherein the modification. In some embodiments, the modification is a Such a polynucleotide or gene encodes, or Such a polypeptide deletion, mutation, and/or Substitution. In some embodi has, aldehyde dehydrogenase activity. 35 ments, the measuring is carried out using gas chromatogra In embodiments, the sequences of otheraldehyde dehydro phy-mass spectroscopy. In some embodiments, isobutyric genase polynucleotides, genes and/or polypeptides can be acid is reduced by at least about 10%, at least 20%, at least identified in the literature and in bioinformatics databases 30%, at least 40%, at least 50%, at least 60%, at least 70%, at well known to the skilled person using sequences disclosed least 80%, or at least 90%. In some embodiments, isobutyric herein and available in the art. For example, such sequences 40 acid formation is Substantially eliminated. can be identified through BLAST searching of publicly avail Modification of Aldehyde Oxidase able databases with known aldehyde dehydrogenase-encod In embodiments of the invention, a recombinant host cell ing polynucleotide or polypeptide sequences. In Such a disclosed herein can have a modification or disruption of a method, identities can be based on the Clustal W method of polynucleotide, gene or polypeptide encoding aldehyde oxi alignment using the default parameters of GAP PEN- 45 dase. In embodiments, the recombinant host cell comprises a ALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 deletion, mutation, and/or Substitution in an endogenous series of protein weight matrix. polynucleotide or gene encoding a polypeptide having alde Additionally, the aldehyde dehydrogenase polynucleotide hyde oxidase activity, or in an endogenous polypeptide hav or polypeptide sequences disclosed herein or known the art ing aldehyde oxidase activity. Such modifications, disrup can be used to identify other aldehyde dehydrogenase 50 tions, deletions, mutations, and/or Substitutions can result in homologs in nature. For example, each of the aldehyde dehy aldehyde oxidase activity that is reduced or eliminated. drogenase encoding nucleic acid fragments disclosed herein In embodiments of the invention, a polypeptide having can be used to isolate genes encoding homologous proteins. aldehyde oxidase activity can catalyze the conversion of Isolation of homologous genes using sequence-dependent isobutyraldehyde to isobutyric acid. In other embodiments, protocols is well known in the art. Examples of sequence- 55 the conversion of isobutyraldehyde to isobutyric acid in a dependent protocols include, but are not limited to (1) meth recombinant host cell is reduced or eliminated. In other ods of nucleic acid hybridization; (2) methods of DNA and embodiments, a polynucleotide, gene or polypeptide having RNA amplification, as exemplified by various uses of nucleic aldehyde oxidase activity can correspond to Enzyme Com acid amplification technologies e.g., polymerase chain reac mission Number EC 1.2.3.1. tion (PCR). Mullis et al., U.S. Pat. No. 4,683.202; ligase chain 60 In embodiments, a recombinant host cell of the invention reaction (LCR), Tabor et al., Proc. Acad. Sci. USA 82:1074 can be Pichia stipitis and a polynucleotide, gene or polypep (1985); or strand displacement amplification (SDA), Walker tide having aldehyde oxidase activity can be AOX1 and/or et al., Proc. Natl. Acad., Sci. U.S.A., 89:392 (1992); and (3) AOX2. methods of library construction and screening by comple Examples of aldehyde oxidase polynucleotides, genes and mentation. 65 polypeptides that can be targeted for modification or inacti Accordingly, it is within the scope of the invention to vation in a recombinant host cell disclosed herein include, but provide aldehyde dehydrogenase polynucleotides, genes and are not limited to, those of the following Table 5. US 9,422,582 B2 43 44 TABLE 5 host cell disclosed herein can further comprise a modification in a polynucleotide encoding a polypeptide having pyruvate Aldehyde Oxidase target gene coding regions and proteins. decarboxylase activity and/or a modification in a polynucle Nucleic acid Amino acid otide encoding a polypeptide having hexokinase 2 activity. In embodiments, a recombinant host cell of the invention can SEQ ID NO: SEQID NO: produce a production of a biosynthetic pathway (e.g., isobu AOX1 from Pichia stipitis 864 866 tanol), and can comprise a polynucleotide encoding a AOX2 from Pichia stipitis 867 868 polypeptide that catalyzes a Substrate to product conversion selected from the group consisting of: (a) pyruvate to aceto Other examples of aldehyde oxidase polynucleotides, 10 lactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2.3- genes and polypeptides that can be targeted for modification dihydroxyisovalerate to 2-ketoisovalerate; (d) 2-ketoisoval or inactivation in a recombinant host cell disclosed herein erate to isobutyraldehyde; and (e) isobutyraldehyde to include, but are not limited to, aldehyde oxidase polynucle isobutanol. In other embodiments, such a recombinant host otides, genes and/or polypeptides having at least about 70% cell can produce a product of a biosynthetic pathway (e.g., to about 75%, about 75% to about 80%, about 80% to about 15 isobutanol) at a yield or amount that is greater than the yield 85%, about 85% to about 90%, about 90% to about 95%, or amount of the same product produced by a recombinant about 96%, about 97%, about 98%, or about 99% sequence host cell that does not comprise reduced or eliminated alde identity to any one of the sequences of Table 5, wherein such hyde dehydrogenase activity and/or aldehyde oxidase activ a polynucleotide or gene encodes a polypeptide having, or ity. In other embodiments, a recombinant host cell of the such a polypeptide has, aldehyde oxidase activity. Still other invention can reduce or eliminate the conversion of isobu examples of aldehyde oxidase polynucleotides, genes and tyraldehyde to isobutyric acid, and can be used for screening polypeptides that can be targeted for modification or inacti candidate polypeptides having aldehyde dehydrogenase and/ vation in a recombinant host cell disclosed herein include, but or aldehyde oxidase activity. As such, Applicants have also are not limited to an active variant, fragment or derivative of provided methods of increasing the yield or titer of a product any one of the sequences of Table 5, wherein Such a poly 25 of a biosynthetic pathway (e.g., isobutanol), methods for nucleotide or gene encodes, or Such a polypeptide has, alde reducing or eliminating the conversion of isobutyraldehyde to hyde oxidase activity. isobutyric acid, and methods for Screening candidate In embodiments, a polynucleotide, gene and/or polypep polypeptides having aldehyde dehydrogenase and/or alde tide encoding an aldehyde oxidase sequence disclosed herein hyde oxidase activity. or known in the art can be modified, as disclosed above for 30 In embodiments of the invention, methods of producing a acetolactate reductase or aldehyde dehydrogenase. In other recombinant host cell are provided which comprise (a) pro embodiments, a polynucleotide, gene and/or polypeptide viding a recombinant host cell disclosed herein; and (b) trans encoding aldehyde oxidase can be used to identify another forming said host cell with a polynucleotide encoding a aldehyde oxidase polynucleotide, gene and/or polypeptide polypeptide of a biosynthetic pathway (e.g., an isobutanol sequence and/or can be used to identify an aldehyde oxidase 35 biosynthetic pathway). In other embodiments, methods of homolog in other cells, as disclosed above for aldehyde dehy producing a recombinant host cell are provided which com drogenase. Such aldehyde oxidase encoding sequences can prise (a) providing a recombinant host cell comprising a be identified, for example, in the literature and/or in bioinfor modification in a polynucleotide encoding a polypeptide hav matics databases well known to the skilled person. For ing aldehyde dehydrogenase activity or in a polypeptide hav example, the identification of an aldehyde oxidase encoding 40 ing aldehyde dehydrogenase activity; and (b) transforming sequence in another cell type using bioinformatics can be said host cell with a polynucleotide encoding a polypeptide of accomplished through BLAST (as disclosed above) search a biosynthetic pathway (e.g., an isobutanol biosynthetic path ing of publicly available databases with a known hexose way). In other embodiments, methods of producing a recom kinase encoding DNA and polypeptide sequence, such as any binant host cell are provided which comprise (a) providing a of those provided herein. Identities are based on the ClustalW 45 recombinant host cell comprising a modification in a poly method of alignment using the default parameters of GAP nucleotide encoding a polypeptide having aldehyde oxidase PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet activity or in a polypeptide having aldehyde oxidase activity; 250 series of protein weight matrix. and (b) transforming said host cell with a polynucleotide The modification of aldehyde oxidase in a recombinant encoding a polypeptide of an isobutanol biosynthetic path host cell disclosed herein to reduce or eliminate aldehyde 50 way. oxidase activity can be confirmed using methods known in In embodiments, methods for reducing or eliminating the the art. For example, disruption of a particular aldehyde oxi conversion of isobutyraldehyde to isobutyric acid are pro dase could be confirmed with PCR screening using primers vided which comprise (a) providing a recombinant host cell internal and external to the aldehyde oxidase gene or by disclosed herein; and (b) growing said host cell under condi Southern blot using a probe designed to the aldehyde oxidase 55 tions wherein the conversion of isobutyraldehyde to isobu gene sequence. Alternatively, one could utilize gas chroma tyric acid is reduced or eliminated compared to a recombinant tography or other analytical methods to screen strains host cell that does not comprise reduced or eliminated alde exposed to isobutyraldehyde for decreased formation of hyde dehydrogenase and/or aldehyde oxidase activity. The isobutyric acid (as described and demonstrated in the conversion of isobutyraldehyde to isobutyric acid of a recom Examples). In some embodiments, isobutyric acid is reduced 60 binant host cell disclosed herein can be measured by methods by at least about 10%, at least 20%, at least 30%, at least 40%, known in the art (see, e.g., Methods in Yeast Genetics, 2005, at least 50%, at least 60%, at least 70%, at least 80%, or at Cold Spring Harbor Laboratory Press, Cold Spring Harbor, least 90%. In some embodiments, isobutyric acid formation is N.Y., pp. 201-202) and/or described herein. substantially eliminated. Reduction of DHMB Applicants have provided recombinant host cells compris 65 The production of DHMB in a host cell comprising an ing reduced or eliminated aldehyde dehydrogenase and/or isobutanol biosynthetic pathway indicates that not all of the aldehyde oxidase activity. In embodiments, a recombinant pathway Substrates are being converted to the desired prod US 9,422,582 B2 45 46 uct. Thus, yield is lowered. In addition, DHMB can have In some embodiments, the host cell comprises at least one inhibitory effects on product production. For example, deletion, mutation, and/or substitution in at least one endog DHMB can decrease the activity of enzymes in the biosyn enous polynucleotide encoding a polypeptide having aceto thetic pathway or have other inhibitory effects on yeast lactate reductase activity. In some embodiments, the host cell comprises at least one deletion, mutation, and/or Substitution growth and/or productivity during fermentation. Thus, the in each of at least two endogenous polynucleotides encoding methods described herein provide ways of reducing DHMB polypeptides having acetolactate reductase activity. during fermentation. The methods include both methods of In some embodiments, a polypeptide having acetolactate decreasing the production of DHMB and methods of remov reductase activity can catalyze the conversion of acetolactate ing DHMB from fermenting compositions. to DHMB. In some embodiments, a polypeptide having Decreasing DHMB Production 10 acetolactate reductase activity is capable of catalyzing the In some embodiments described herein, a recombinant reduction of acetolactate to 2S,3S-DHMB (fast DHMB) and/ host cell can comprise reduced or eliminated ability to con or 2S,3R-DHMB (slow DHMB). vert acetolactate to DHMB. The ability of a host cell to TABLE 6 convert acetolactate to DHMB can be reduced or eliminated, 15 for example, by a modification or disruption of a polynucle Polypeptides and polynucleotides having acetolactate otide or gene encoding a polypeptide having acetolactate reductase activity in Saccharomyces cerevisiae reductase activity or a modification or disruption of a polypeptide having acetolactate reductase activity. In other SEQID NO: embodiments, the recombinant host cell can comprise a dele Gene (nucleic acid, amino acid) tion, mutation, and/or Substitution in an endogenous poly YMR226C 676, 677 nucleotide or gene encoding a polypeptide having acetolac YIL074C (Chr9) 678,679 YIRO36C (Chr9) 680, 681 tate reductase activity or in an endogenous polypeptide YPLO61W (ALD6)(Chr 16) 682,683 having acetolactate reductase. Such modifications, disrup YPLO88W(Chr 16) 684, 685 tions, deletions, mutations, and/or Substitutions can result in 25 YCR105W (ADH7)(Chr3) 686, 687 acetolactate reductase activity that is reduced, Substantially YDR541C(Chr4) 688, 689 YERO81 (SER3)(Chr5) 690, 691 eliminated, or eliminated. In some embodiments of the inven YPL275W (FDH2)(Chr 16) 692, 693 tion, the product of the biosynthetic pathway is produced at a YBRO06W (UGA5)(Chr2) 694,695 greater yield or amount compared to the production of the YOLO59W(Chr15) 696, 697 same product in a recombinant host cell that does not com 30 YERO81W (Chr5) 869,870 prise reduced or eliminated ability to convert acetolactate to YOR375C (Chr15) 871, 872 DHMB. Thus, the product can be a composition comprising butanol In some embodiments, the conversion of acetolactate to that is substantially free of, or free of DHMB. In some DHMB in a recombinant host cell is reduced, substantially embodiments, the composition comprising butanol contains 35 eliminated, or eliminated. In some embodiments, the no more than about 5 mM, about 4 mM, about 3 mM, about 2 polypeptide having acetolactate reductase activity is selected mM, about 1 mM, about 0.5 mM, about 0.4 mM, about 0.3 from the group consisting of: YMR226C, YER081W, mM DHMB, or about 0.2 mM DHMB. YIL074C, YBR006W, YPL275W, YOLO59W, YIR036C, The product can also be a composition comprising 2.3- YPL061 W, YPL088W, YCR105W, YOR375c, and YDR541C. In some embodiments, the polypeptide having butanediol (BDO) that is substantially free of, or free of 40 acetolactate reductase activity is a polypeptide comprising a DHMB. In some embodiments, the composition comprising sequence listed in Table 6 or a sequence that is at least about BDO contains no more than about 5 mM, about 4 mM, about 70%, at least about 75%, at least about 80%, at least about 3 mM, about 2 mM, about 1 mM, about 0.5 mM, about 0.4 85%, at least about 90%, at least about 95%, or at least about mM, about 0.3 mM DHMB, or about 0.2 mM DHMB. 99% identical to a polypeptide sequence listed in Table 6. In Any product of a biosynthetic pathway that involves the 45 Some embodiments, the polypeptide having acetolactate conversion of acetolactate to a substrate other than DHMB reductase activity is a polypeptide encoded by a polynucle can be produced with greater effectiveness in a recombinant otide sequence listed in Table 6 or a sequence that is at least host cell disclosed herein having the described modification about 70%, at least about 75%, at least about 80%, at least of acetolactate reductase activity. Such products include, but about 85%, at least about 90%, at least about 95%, or at least are not limited to, butanol, e.g., isobutanol, 2-butanol, and about 99% identical to a polynucleotide sequence listed in BDO, and branched chain amino acids. Table 6. TABLE 7 Example YMR226C Yeast Homologs

SEQ ID NO: Species Accession (nucleic acid, amino acid) Saccharomyces paradoxus AABYO1 OOO127 698, 699

Saccharomyces bayanus AACAO1 OOO631 7 OO, 7 O1 MSOGRKAAERLANKTWLITGASA GIGKATALEYLEASNGNMKLILAA RRLEKLEELKKTIDEEFPNAKWH WGOLDITOAEKIKPFIENLPEAFK DIDILINNAGKALGSERVGDATO DIODVFDTNWTALINVTOAVLPIF QAKNSGDIVNLGLGGRORRIPH RLHLLCFOVCRRCWH* QFEKGT US 9,422,582 B2 47 48 TABLE 7 - continued Example YMR226C Yeast Homolods SEQ ID NO: Species Accession (nucleic acid, amino acid) DOHEDOSYLDRAGAGDRVLTG OIOR* * GTS kKRLQGHYAVDGRR RG'k LNRIFHFOKAEHRGCRHPDL PHOPSLALPHLSRLk (SEQ ID NO: 701) The sequence came from a comparative genomics study using draft" genome sequences with 7 fold coverage Kellis at al., Nature 423:241-254 (2003) ) .

Saccharomyces castellii AACFO1 OOO116 7 O2, 7 O3

Saccharomyces mikafae AACHO1 OOOO19 704, 7 O5

Ashbya gossypii AEO16819 706, 707

Candida glabrata CR.38 O959 708, 7 O9

Debaryomyces hansenii CR.38213.9 710, 711 Scheffersomyces stipitis XM OO1387479 712, 713 (formerly Pichia stipitis) Meyerozyma guilliermondii XM 0014 2184 714, 715 (formerly Pichia guilliermondit)

Vanderwaltozyma polyspora XM 001645671 716, 717 (formerly Kluyveromyces polysporus

Candida dubliniensis XM 002419771 718, 719 Zygosaccharomyces rouxii XM 0024.94574 72O, 721 Lachancea thermotolerans XM 0.02553230 722, 723 (formerly Kluyveromyces thermotolerans) Kluyveromyces lactis XM 451902 724, 725

Saccharomyces kluyveri SAKLOHO473 O 726, 727

Yarrowia lipolytica XM 5O1554 728, 729 Schizosaccharomyces NM_001018495 73 O, 731 pombe

In some embodiments, a polypeptide having acetolactate One way of identifying a gene involved in DHMB produc reductase activity is YMR226C or a homolog of YMR226C. tion comprises measuring the amount of DHMB produced by Thus, in some embodiments, the polypeptide having aceto 50 individual yeast strains in a yeast knock-out library. Knock lactate reductase activity is a polypeptide comprising a out libraries are available, for example, from Open Biosys sequence listed in Table 7 or a sequence that is at least about tems(R) (a division of Thermo Fisher Scientific, Waltham, 70%, at least about 75%, at least about 80%, at least about Mass.). In this method, a decrease in DHMB production 85%, at least about 90%, at least about 95%, or at least about indicates that the gene that has been knocked-out functions to 99% identical to a polypeptide sequence listed in Table 7. In 55 increase DHMB production, and an increase in DHMB pro Some embodiments, the polypeptide having acetolactate duction indicates that the gene that has been knocked-out reductase activity is a polypeptide encoded by a polynucle functions to decrease DHMB production. otide sequence listed in Table 7 or a sequence that is at least Two ways that a knockout (“KO') library can be used to about 70%, at least about 75%, at least about 80%, at least identify candidate genes for involvement in DHMB synthesis about 85%, at least about 90%, at least about 95%, or at least 60 include: (1) DHMB and DHIV accumulated in the culture about 99% identical to a polynucleotide sequence listed in during growth from endogenous Substrates (acetolactate and Table 7. Acetolactate reductases capable of converting aceto NADPH or NADH) can be analyzed in samples from cul lactate to DHMB can be identified, for example, by screening tures. These samples can be placed in a hot (80-100°C.) water genetically altered yeast for changes in acetolactate con bath for 10-20 min, or diluted into a solution such as 2% sumption, changes in DHMB production, changes in DHIV 65 formic acid that will kill and permeabilize the cells. After production, or changes in other downstream product (e.g., either treatment, small molecules will be found in the super butanol) production. natant after centrifugation (5 min, 1100xg). The DHMB/ US 9,422,582 B2 49 50 DHIV ratio of a control strain (e.g., BY4743) can be com can be determined using PCR screening. A decrease in aceto pared to that of the different KO derivatives, and the gene(s) lactate reductase activity can also be determined based on a missing from any strain(s) with exceptionally low DHMB/ reduction in conversion of acetolactate to DHMB. A decrease DHIV ratios can encode acetolactate reductase (ALR). (2) in acetolactate reductase activity can also be determined DHMB and/or DHIV formation rates in vitro from exogenous based on a reduction in DHMB production. A decrease in substrates (acetolactate and NADH and/or NADPH) can be acetolactate reductase activity can also be determined based measured in timed Samples taken from a suspension of per on an increase in butanol production. meabilized cells, and inactivated in either of the ways Thus, in some embodiments, a yeast that is capable of described above. Since the Substrates for DHMB and DHIV producing butanol produces no more than about 5 mM, about synthesis are the same, this allows one to measure the relative 10 4 mM, about 3 mM, about 2 mM, about 1 mM, about 0.9 mM, levels of ALR and KARI activity in the sample. about 0.8 mM., about 0.7 mM, about 0.6 mM, about 0.5 mM, Another way of identifying a gene involved in DHMB about 0.4 mM or about 0.3 mM DHMB. In Some embodi production comprises measuring the amount of DHMB pro ments, a yeast producing butanol produces no more than duced by individual yeast strains in a yeast overexpression about 5 mM, about 4 mM, about 3 mM, about 2 mM, about 1 library. Overexpression libraries are available, for example, 15 mM, about 0.9 mM, about 0.8 mM., about 0.7 mM, about 0.6 from Open Biosystems(R) (a division of Thermo Fisher Sci mM, about 0.5 mM, about 0.4 mM or about 0.3 mM DHMB. entific, Waltham, Mass.). In this method, a decrease in In some embodiments, a yeast producing butanol produces no DHMB production indicates that the overexpressed gene more than about 0.2 mM or 0.2 mM DHMB. functions to decrease DHMB production, and an increase in In some embodiments, a yeast capable of producing DHMB production indicates that the overexpressed gene butanol produces no more than about 10 mM DHMB when functions to increase DHMB production. cultured under fermentation conditions for at least about 50 Another way of identifying a gene involved in DHMB hours. In some embodiments, a yeast capable of producing production is to biochemically analyze a DHMB-producing butanol produces no more than about 5 mM DHMB when yeast strain. For example, DHMB-producing cells can be cultured under fermentation conditions for at least about 20 disrupted. This disruption can be performed at low pH and 25 hours, at least about 25 hours, at least about 30 hours, at least cold temperatures. The cell lysates can be separated into about 35 hours, at least about 40 hours, at least about 45 hours, fractions, e.g., by adding ammonium Sulfate or other tech or at least about 50 hours. In some embodiments, a yeast niques known to those of skill in the art, and the resulting capable of producing butanol produced no more than about 3 fractions can be assayed for enzymatic activity. For example, mMDHMB when cultured under fermentation conditions for the fractions can be assayed for the ability to convert aceto 30 at least about 5 hours, at least about 10 hours, at least about 15 lactate to DHMB. Fractions with enzymatic activity can be hours, at least about 20 hours, at least about 25 hours, at least treated by methods known in the art to purify and concentrate about 30 hours, at least about 35 hours, at least about 40 hours, the enzyme (e.g., dialysis and chromatographic separation). at least about 45 hours, or at least about 50 hours. In some When a sufficient purity and concentration is achieved, the embodiments, a yeast capable of producing butanol produced enzyme can be sequenced, and the corresponding gene 35 no more than about 1 mM DHMB when cultured under fer encoding the acetolactate reductase capable of converting mentation conditions for at least about 1 hour, at least about 5 acetolactate to DHMB can be identified. hours, at least about 10 hours, at least about 15 hours, at least Furthermore, since the reduction of acetolactate to DHMB about 20 hours, at least about 25 hours, at least about 30 hours, occurs in yeast, but does not occur to the same extent in E. at least about 35 hours, at least about 40 hours, at least about coli, acetolactate reductases that are expressed in yeast, but 40 45 hours, or at least about 50 hours. In some embodiments, a not expressed in E. coli, can be selected for Screening. yeast capable of producing butanol produced no more than Selected enzymes can be expressed in yeast or other protein about 0.5 mM DHMB when cultured under fermentation expression systems and screened for the capability to convert conditions for at least about 1 hour, at least about 5 hours, at acetolactate to DHMB. least about 10 hours, at least about 15 hours, at least about 20 Enzymes capable of catalyzing the conversion of acetolac 45 hours, at least about 25 hours, at least about 30 hours, at least tate to DHMB can be screened by assaying for acetolactate about 35 hours, at least about 40 hours, at about 45 hours, or levels, by assaying for DHMB levels, by assaying for DHIV at least about 50 hours. levels, or by assaying for any of the downstream products in In some embodiments, a yeast comprising at least one the conversion of DHIV to butanol, including isobutanol. deletion, mutation, and/or Substitution in an endogenous DHMB can be measured using any technique known to 50 polynucleotide encoding an acetolactate reductase produces those of skill in the art. For example, DHMB can be separated no more than about 0.5 times, about 0.4 times, about 0.3 and quantified by methods known to those of skill in the art times, about 0.2 times, about 0.1 times, about 0.05 times the and techniques described in the Examples provided herein. amount of DHMB produced by a yeast containing the endog For example, DHMB can be separated and quantified using enous polynucleotide encoding an acelotacatate reductase liquid chromatography-mass spectrometry, liquid chroma 55 when cultured under fermentation conditions for the same tography-nuclear magnetic resonance (NMR), thin-layer amount of time. In some embodiments, a yeast that is capable chromatography, and/or HPLC with UV/Vis detection. of producing butanol produces an amount of DHIV that is at In embodiments, selected acetolactate reductase poly least about 5 mM, at least about 6 mM, at least about 7 mM, nucleotides, genes and/or polypeptides disclosed herein can at least about 8 mM, at least about 9 mM, or at least about 10 be modified or disrupted. Many suitable methods are known 60 mM. to those of ordinary skill in the art and include those described In some embodiments, a yeast that is capable of producing for aldehyde dehydrogenase (above). butanol produces an amount of DHIV that is at least about the The modification of acetolactate reductase in a recombi amount of DHMB produced. In some embodiments, a yeast nant host cell disclosed herein to reduce or eliminate aceto that is capable of producing butanol produces an amount of lactate reductase activity can be confirmed using methods 65 DHIV that is at least about twice, about three times, about five known in the art. For example, the presence or absence of an times, about ten times, about 15 times, about 20 times, about acetolactate reductase-encoding polynucleotide sequence 25 times, about 30 times, about 35 times, about 40 times, US 9,422,582 B2 51 52 about 45 times, or about 50 times the amount of DHMB 2,3-dihydroxyisovalerate to 2-ketoisovalerate (see FIG. 1, produced. In some embodiments, a yeast that is capable of pathway step c therein) as catalyzed for example by producing butanol produces DHIV at a rate that is at least acetohydroxy acid dehydratase, also called dihydroxy about equal to the rate of DHMB production. In some acid dehydratase (DHAD): embodiments, a yeast that is capable of producing butanol 5 2-ketoisovalerate to isobutyraldehyde (see FIG.1, pathway produces DHIV at a rate that is at least about twice, about step d therein) as catalyzed for example by branched three times, about five times, about ten times, about 15 times, chain 2-keto acid decarboxylase; and about 20 times, about 25 times, about 30 times, about 35 isobutyraldehyde to isobutanol (see FIG. 1, pathway step e times, about 40 times, about 45 times, or about 50 times the therein) as catalyzed for example by branched-chain rate of DHMB production. 10 alcohol dehydrogenase. In some embodiments, a yeast that is capable of producing In another embodiment, the isobutanol biosynthetic path butanol produces less than 0.010 moles of DHMB per mole of way comprises the following Substrate to product conver glucose consumed. In some embodiments, a yeast produces sions: less than about 0.009, less than about 0.008, less than about pyruvate to acetolactate, which may be catalyzed, for 0.007, less than about 0.006, or less than about 0.005 moles of 15 example, by acetolactate synthase; DHMB per mole of glucose consumed. In some embodi acetolactate to 2,3-dihydroxyisovalerate, which may be ments, a yeast produces less than about 0.004, less than about catalyzed, for example, by ketol-acid reductoisomerase: 0.003, less than about 0.002, or less than about 0.001 moles of 2,3-dihydroxyisovalerate to C.-ketoisovalerate, which may DHMB per mole of glucose consumed. be catalyzed, for example, by dihydroxyacid dehy In some embodiments, acetolactate reductase activity is dratase; inhibited by chemical means. For example, acetolactate C.-ketoisovalerate to valine, which may be catalyzed, for reductase could be inhibited using other known substrates example, by transaminase or valine dehydrogenase; Such as those listed in Fujisawa et al. including L-serine, valine to isobutylamine, which may be catalyzed, for D-serine, 2-methyl-DL-serine, D-threonine, L-allo-threo example, by valine decarboxylase; nine, L-3-hydroxyisobutyrate, D-3-hydroxyisobutyrate, 25 isobutylamine to isobutyraldehyde, which may be cata 3-hydroxypropionate, L-3-hydroxybutyrate, and D-3-hy lyzed by, for example, omega transaminase; and, droxybutyrate. Biochimica et Biophysica Acta 1645:89-94 isobutyraldehyde to isobutanol, which may be catalyzed, (2003), which is herein incorporated by reference in its for example, by a branched-chain alcohol dehydroge entirety. aSC. DHMB Removal 30 In another embodiment, the isobutanol biosynthetic path In other embodiments described herein, a reduction in way comprises the following Substrate to product conver DHMB can beachieved by removing DHMB from a fermen Sions: tation. Thus, fermentations with reduced DHMB concentra pyruvate to acetolactate, which may be catalyzed, for tions are also described herein. Removal of DHMB can result, example, by acetolactate synthase; for example, in a product of greater purity, or a product 35 acetolactate to 2,3-dihydroxyisovalerate, which may be requiring less processing to achieve a desired purity. There catalyzed, for example, by acetohydroxy acid reductoi fore, compositions comprising products of biosynthetic path Somerase; ways such as ethanol or butanol with increased purity are also 2,3-dihydroxyisovalerate to C.-ketoisovalerate, which may provided. be catalyzed, for example, by acetohydroxy acid dehy DHMB can be removed during or after a fermentation 40 dratase; process and can be removed by any means known in the art. C.-ketoisovalerate to isobutyryl-CoA, which may be cata DHMB can be removed, for example, by extraction into an lyzed, for example, by branched-chain keto acid dehy organic phase or reactive extraction. drogenase; In some embodiments, the fermentation broth comprises isobutyryl-CoA to isobutyraldehyde, which may be cata less than about 0.5 mM DHMB. In some embodiments, the 45 lyzed, for example, by acetylating aldehyde dehydroge fermentation broth comprises less than about 1.0 mMDHMB nase; and, after about 5 hours, about 10 hours, about 15 hours, about 20 isobutyraldehyde to isobutanol, which may be catalyzed, hours, about 25 hours, about 30 hours, about 35 hours, about for example, by a branched-chain alcohol dehydroge 40 hours, about 45 hours, or about 50 hours of fermentation. aSC. In some embodiments, the fermentation broth comprises less 50 In another embodiment, the isobutanol biosynthetic path than about 5.0 mM DHMB after about 20 hours, about 25 way comprises the Substrate to product conversions shown as hours, about 30 hours, about 35 hours, about 40 hours, about steps k, g, and e in FIG. 1. 45 hours, or about 50 hours of fermentation. Genes and polypeptides that can be used for the substrate to Butanol Biosynthetic Pathways product conversions described above as well as those for Certain suitable isobutanol biosynthetic pathways are dis 55 additional isobutanol pathways, are described in U.S. Patent closed in U.S. Pat. Nos. 7,851,188 and 7,993,889, each of Appl. Pub. No. 2007 10092957 and POT Pub. No. WO 2011/ which is incorporated by reference herein. A diagram of the 019894, both incorporated by reference herein. US Appl. Pub. disclosed isobutanol biosynthetic pathways is provided in Nos. 2011/019894, 2007 10092957, 2010/0081154, which FIG. 1. As described in U.S. Pat. No. 7,851,188, steps in an are herein incorporated by reference, describe dihydroxyacid example isobutanol biosynthetic pathway include conversion 60 dehydratases including those from Lactococcus lactis and of: Streptococcus mutans. Ketoisovalerate decarboxylases pyruvate to acetolactate (see FIG. 1, pathway step a include those derived from Lactococcus lactis, Macrococcus therein), as catalyzed for example by acetolactate Syn caseolyticus (SEQ ID NO: 542) and Listeria grayi (SEQ ID thase (ALS), NO: 543). U.S. Patent Appl. Publ. No. 2009/0269823 and acetolactate to 2,3-dihydroxyisovalerate (see FIG. 1, path 65 U.S. Appl. Publ. No. 2011/0269 199, incorporated by refer way step b therein) as catalyzed for example by aceto ence, describe alcohol dehydrogenases, including those that hydroxy acid isomeroreductase (KARI); utilize NADH as a cofactor. Alcohol dehydrogenases include US 9,422,582 B2 53 54 SadB from Achromobacter xylosoxidans. Additional alcohol one embodiment, the 1-butanol biosynthetic pathway com dehydrogenases include horse liver ADH and Beijerinkia prises the following Substrate to product conversions: indica ADH. Alcohol dehydrogenases include those that uti a) acetyl-CoA to acetoacetyl-CoA, which may be cata lize NADH as a cofactor. In one embodiment abutanol bio lyzed, for example, by acetyl-CoA acetyl transferase; synthetic pathway comprises a) a ketol-acid reductoi 5 b) acetoacetyl-CoA to 3-hydroxybutyryl-CoA, which may somerase that has a K for NADH less than about 300 uM, be catalyzed, for example, by 3-hydroxybutyryl-CoA less than about 100LLM, less than about 50M, less than about dehydrogenase; 20 or less than about 10uM; b) an alcoholdehydrogenase that c) 3-hydroxybutyryl-CoA to crotonyl-CoA, which may be utilizes NADH as a cofactor; or c) both a) and b). catalyzed, for example, by crotonase; WO 2011/019894 and US Appl. Pub. Nos. 2011/019894, 10 d) crotonyl-CoA to butyryl-CoA, which may be catalyzed, 2007/0092957, 2010/0081154, which are herein incorpo for example, by butyryl-CoA dehydrogenase; rated by reference in their entireties, describe suitable dihy e) butyryl-CoA to butyraldehyde, which may be catalyzed, droxyacid dehydratases. Methods of increasing DHAD activ for example, by butyraldehyde dehydrogenase; and, ity are described, for example, in U.S. Patent Application f) butyraldehyde to 1-butanol, which may be catalyzed, for Publication No. 2010/0081173 and U.S. patent application 15 example, by butanol dehydrogenase. Ser. No. 13/029,558, filed Feb. 17, 2011, which are herein Biosynthetic pathways for the production of 2-butanol that incorporated by reference in their entireties. may be used include those described in U.S. Appl. Pub. No. Suitable ketol-acid reductoisomerase (KARI) enzymes are 2007/02594.10 and U.S. Appl. Pub. No. 2009/0155870, which described in U.S. Patent Appl. Pub. Nos. 2008/0261230 A1, are incorporated herein by reference. In one embodiment, the 2009/0163376, 2010/0197519, 2010/0143997 and 2011/ 2-butanol biosynthetic pathway comprises the following Sub 0244536, which are herein incorporated by reference in their strate to product conversions: entireties. Examples of KARIs disclosed therein are those a) pyruvate to alpha-acetolactate, which may be catalyzed, from Vibrio cholerae, Pseudomonas aeruginosa PAO1, and for example, by acetolactate synthase; Pseudomonas fluorescens PF5. In some embodiments, the b) alpha-acetolactate to acetoin, which may be catalyzed, KARI enzyme has a specific activity of at least about 0.1 25 for example, by acetolactate decarboxylase; micromoles/min/mg, at least about 0.2 micromoles/min/mg, c) acetoin to 3-amino-2-butanol, which may be catalyzed, at least about 0.3 micromoles/min/mg, at least about 0.4 for example, acetonin aminase; micromoles/min/mg, at least about 0.5 micromoles/min/mg, d) 3-amino-2-butanol to 3-amino-2-butanol phosphate, at least about 0.6 micromoles/min/mg, at least about 0.7 which may be catalyzed, for example, by aminobutanol micromoles/min/mg, at least about 0.8 micromoles/min/mg, 30 kinase; at least about 0.9 micromoles/min/mg, at least about 1.0 e) 3-amino-2-butanol phosphate to 2-butanone, which may micromoles/min/mg, or at least about 1.1 micromoles/min/ be catalyzed, for example, by aminobutanol phosphate mg. Suitable polypeptides to catalyze the Substrate to product phosphorylase; and, conversion acetolactate to 2,3-dihydroxyisovalerate include f) 2-butanone to 2-butanol, which may be catalyzed, for those that that have a KM for NADH less than about 300 uM, 35 example, by butanol dehydrogenase. less than about 100LLM, less than about 50M, less than about In another embodiment, the 2-butanol biosynthetic path 25uM or less than about 10 uM. way comprises the following Substrate to product conver In some embodiments, the KARI utilizes NADPH. Meth sions: ods of measuring NADPH consumption are known in the art. a) pyruvate to alpha-acetolactate, which may be catalyzed, For example, US Published Application No. 2008/0261230, 40 for example, by acetolactate synthase; which is herein incorporated by reference in its entirety, pro b) alpha-acetolactate to acetoin, which may be catalyzed, vides methods of measuring NADPH consumption. In some for example, by acetolactate decarboxylase; embodiments, an NADPH consumption assay is a method c) acetoin to 2,3-butanediol, which may be catalyzed, for that measures the disappearance of the cofactor, NADPH, example, by butanediol dehydrogenase; during the enzymatic conversion of acetolactate to C-B-dihy 45 d) 2,3-butanediol to 2-butanone, which may be catalyzed, droxy-isovalerate at 340 nm. The activity is calculated using for example, by dial dehydratase; and, the molar extinction coefficient of 6220M'cm for NADPH e) 2-butanone to 2-butanol, which may be catalyzed, for and is reported as umole of NADPH consumed per min per example, by butanol dehydrogenase. mg of total protein in cell extracts (see Aulabaugh and In some embodiments of the invention, a recombinant host Schloss, Biochemistry 29: 2824-2830, 1990). 50 cell comprises a biosynthetic pathway. The biosynthetic path In some embodiments, the KARI is capable of utilizing way can comprise reduced or eliminated aldehyde dehydro NADH. In some embodiments, the KARI is capable of uti genase activity and an isobutanol or 1-butanol biosynthetic lizing NADH under anaerobic conditions. KARI enzymes pathway wherein the pathway comprises the Substrate to using NADH are described, for example, in U.S. Patent product conversion pyruvate to acetolactate. In some embodi Application Publication No. 2009/0163376, which is herein 55 ments, a host cell comprising a biosynthetic pathway capable incorporated by reference in its entirety. of converting pyruvate to acetolactate comprises a polynucle Additional genes that can be used can be identified by one otide encoding a polypeptide having acetolactate synthase skilled in the art through bioinformatics or using methods activity. For example, the biosynthetic pathway can be a well-known in the art. butanol producing pathway or a butanediol producing path Additionally described in U.S. Patent Application Publica 60 way. The biosynthetic pathway can also be a branched-chain tion No. US 2007/0092957 A1, which is incorporated by amino acid (e.g., leucine, isoleucine, Valine) producing path reference herein, are construction of chimeric genes and way. genetic engineering of bacteria and yeast for isobutanol pro In other embodiments, the recombinant host cell can com duction using the disclosed biosynthetic pathways. prise an isobutanol, 1-butanol, or a 2-butanol biosynthetic Biosynthetic pathways for the production of 1-butanol that 65 pathway as described herein. In some embodiments, the may be used include those described in U.S. Appl. Pub. No. butanol biosynthetic pathway is an isobutanol biosynthetic 2008/0182308, which is incorporated herein by reference. In pathway. Production of isobutanol or 2-butanol in a recom US 9,422,582 B2 55 56 binant host cell disclosed herein may benefit from a reduc In embodiments, a polypeptide having PDC activity or a tion, Substantial elimination or elimination of an acetolactate polynucleotide or gene encoding a polypeptide having PDC reductase activity. activity corresponds to Enzyme Commission Number EC Modifications 4.1.1.1. In other embodiments, a PDC gene of a recombinant Functional deletion of the pyruvate decarboxylase gene host cell disclosed herein is not active under the fermentation has been used to increase the availability of pyruvate for conditions used, and therefore such a gene would not need to utilization in biosynthetic product pathways. For example, be modified or inactivated. U.S. Application Publication No. US 2007/0031950 A1, Examples of recombinant host cells with reduced pyruvate which is herein incorporated by reference in its entirety, dis decarboxylase activity due to disruption of pyruvate decar closes a yeast strain with a disruption of one or more pyruvate 10 boxylase encoding genes have been reported, such as for decarboxylase genes and expression of a D-lactate dehydro Saccharomyces in Flikweert etal. (Yeast (1996) 12:247-257), genase gene, which is used for production of D-lactic acid. for Kluyveromyces in Bianchi et al. (Mol. Microbiol. (1996) 19(1):27-36), and disruption of the regulatory gene in Hohm U.S. Application Publication No. US 2005/0059136 A1, ann (Mol. Gen. Genet. (1993). 241:657-666). Saccharomyces which is herein incorporated by reference in its entirety, dis 15 strains having no pyruvate decarboxylase activity are avail closes glucose tolerant two carbon source independent able from the ATCC with Accession H200027 and H200028. (GCSI) yeast strains with no pyruvate decarboxylase activity, Examples of PDC polynucleotides, genes and/or polypep which can have an exogenous lactate dehydrogenase gene. tides that can be targeted for modification or inactivation in Nevoigt and Stahl (Yeast 12:1331-1337 (1996)) describe the the recombinant host cells disclosed herein include, but are impact of reduced pyruvate decarboxylase and increased NAD-dependent glycerol-3-phosphate dehydrogenase in not limited to, those of the following Table 8. Saccharomyces cerevisiae on glycerol yield. U.S. Appl. Pub. TABLE 8 No. 2009/0305363, which is hereinincorporated by reference in its entirety, discloses increased conversion of pyruvate to Pyruvate decarboxylase target gene coding regions and proteins. acetolactate by engineering yeast for expression of a cytosol 25 SEQ SEQ localized acetolactate synthase and Substantial elimination of ID NO: ID NO: pyruvate decarboxylase activity. Nucleic Amino In embodiments of the invention, a recombinant host cell Description acid acid disclosed herein can comprise a modification in an endog PDC1 pyruvate decarboxylase from Saccharomyces 648 649 enous polynucleotide encoding a polypeptide having pyru 30 cerevisiae vate decarboxylase (PDC) activity or a modification in an PDC5 pyruvate decarboxylase from Saccharomyces 6SO 651 endogenous polypeptide having PDC activity. In embodi cerevisiae PDC6 pyruvate decarboxylase from Saccharomyces 652 653 ments, a recombinant host cell disclosed herein can have a cerevisiae modification or disruption of a polynucleotide, gene and/or pyruvate decarboxylase from Candida glabrata 654 655 polypeptide encoding PDC. In embodiments, a recombinant 35 PDC1 pyruvate decarboxylase from Pichia stipitis 656 657 PDC2 pyruvate decarboxylase from Pichia stipitis 658 659 host cell comprises a deletion, mutation, and/or Substitution pyruvate decarboxylase from Kluyveromyces lactis 660 661 in an endogenous polynucleotide or gene encoding a pyruvate decarboxylase from Yarrowia lipolytica 662 663 polypeptide having PDC activity, or in an endogenous pyruvate decarboxylase from Schizosaccharomyces 664 665 polypeptides having PDC activity. Such modifications, dis pombe ruptions, deletions, mutations, and/or Substitutions can result 40 pyruvate decarboxylase from Zygosaccharomyces 666 667 in PDC activity that is reduced or eliminated, resulting, for iOt example, in a PDC knock-out (PDC-KO) phenotype. In embodiments of the invention, an endogenous pyruvate Other examples of PDC polynucleotides, genes and decarboxylase activity of a recombinant host cell disclosed polypeptides that can be targeted for modification or inacti herein converts pyruvate to acetaldehyde, which can then be 45 vation in a recombinant host cell disclosed herein include, but converted to ethanol or to acetyl-CoA via acetate. In other are not limited to, PDC polynucleotides, genes and/or embodiments, a recombinant host cell is Kiuyveromyces lac polypeptides having at least about 70% to about 75%, about tis containing one gene encoding pyruvate decarboxylase, 75% to about 80%, about 80% to about 85%, about 85% to Candida glabrata containing one gene encoding pyruvate about 90%, about 90% to about 95%, about 96%, about 97%, decarboxylase, or Schizosaccharomyces pombe containing 50 about 98%, or about 99% sequence identity to any one of the one gene encoding pyruvate decarboxylase. sequences of Table 8, wherein such a polynucleotide or gene In other embodiments, a recombinant host cell is Saccha encodes, or such a polypeptide has, PDC activity. Still other romyces cerevisiae containing three isozymes of pyruvate examples of PDC polynucleotides, genes and polypeptides decarboxylase encoded by the PDC1, PDC5, and PDC6 that can be targeted for modification or inactivation in a genes, as well as a pyruvate decarboxylase regulatory gene, 55 recombinant host cell disclosed herein include, but are not PDC2. In a non-limiting example in S. cerevisiae, the PDC1 limited to an active variant, fragment or derivative of any one and PDC5 genes, or the PDC1, PDC5, and PDC6 genes, are of the sequences of Table 8, wherein such a polynucleotide or disrupted. In another non-limiting example in S. cerevisiae, gene encodes, or Such a polypeptide has, PDC activity. pyruvate decarboxylase activity can be reduced by disrupting In embodiments, a polynucleotide, gene and/or polypep the PDC2 regulatory gene. In another non-limiting example 60 tide encoding a PDC sequence disclosed herein or known in in S. cerevisiae, polynucleotides or genes encoding pyruvate the art can be modified, as disclosed above for aldehyde decarboxylase proteins such as those having about 70% to dehydrogenase. In other embodiments, a polynucleotide, about 75%, about 75% to about 80%, about 80% to about gene and/or polypeptide encoding PDC can be used to iden 85%, about 85% to about 90%, about 90% to about 95%, tify another PDC polynucleotide, gene and/or polypeptide about 96%, about 97%, about 98%, or about 99% sequence 65 sequence or to identify a PDC homolog in other cells, as identity to PDC1, PDC2, PDC5 and/or PDC6 can be dis disclosed above for acetolactate dehydrogenase. Such a PDC rupted. encoding sequence can be identified, for example, in the US 9,422,582 B2 57 58 literature and/or in bioinformatics databases well known to ments, a recombinant host cell can be K. lactis and a poly the skilled person. For example, the identification of a PDC nucleotide, gene or polypeptide having hexokinase 2 activity encoding sequence in other cell types using bioinformatics can be RAGS. In other embodiments, a recombinant host cell can be accomplished through BLAST (as described above) can be H. polymorpha and a polynucleotide, gene or polypep searching of publicly available databases with a known PDC tide having hexokinase 2 activity can be HPGLK1. In other encoding DNA and polypeptide sequence, Such as those pro embodiments, a recombinant host cell can be S. pombe and a vided herein. Identities are based on the ClustalW method of polynucleotide, gene or polypeptide having hexokinase 2 alignment using the default parameters of GAP PEN activity can be HXK2. ALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 Examples of hexokinase 2 polynucleotides, genes and series of protein weight matrix. 10 The modification of PDC in a recombinant host cell dis polypeptides that can be targeted for modification or inacti closed herein to reduce or eliminate PDC activity can be vation in a recombinant host cell disclosed herein include, but confirmed using methods known in the art. For example, are not limited to, those of the following Table 9. disruption of a particular pyruvate decarboxylase could be TABLE 9 confirmed with PCR screening using primers external to the 15 gene sequence, or by Southern blot using a probe designed to Hexokinase 2 target gene coding regions and proteins. the pyruvate decarboxylase gene sequence. Alternatively, one could utilize analytical methods such as gas chromatography HXK2 from Nucleic acid (SEQID NO: 668) S. cerevisiae Amino acid (SEQID NO: 669) or HPLC to screen strains for decreased or eliminated pro RAGS from Nucleic acid (SEQID NO:670): duction of acetaldehyde and/or ethanol. K. iactis Amino acid (SEQID NO: 671): Functional deletion of the hexokinase 2 gene has been used HPGLK1 from Nucleic acid (SEQID NO: 672) to reduce glucose repression and to increase the availability of H. polymorpha Amino acid (SEQID NO: 673) HXK2 from Nucleic acid (SEQID NO: 674): pyruvate for utilization in biosynthetic pathways. For S. pombe example, International Publication No. WO 2000/061722A1, Amino acid (SEQID NO: 675): which is incorporated herein by reference in its entirety dis 25 closes the production of yeast biomass by aerobically grow Other examples of hexokinase 2 polynucleotides, genes ing yeast having one or more functionally deleted hexokinase and polypeptides that can be targeted for modification or 2 genes or analogs. In addition, Rossell et al. (Yeast Research inactivation in a recombinant host cell disclosed herein 8:155-164 (2008)) found that Saccharomyces cerevisiae with include, but are not limited to, hexokinase 2 polynucleotides, a deletion of the hexokinase 2 gene showed 75% reduction in 30 genes and/or polypeptides having at least about 70% to about fermentative capacity, defined as the specific rate of carbon 75%, about 75% to about 80%, about 80% to about 85%, dioxide production under sugar-excess and anaerobic condi about 85% to about 90%, about 90% to about 95%, about tions. After starvation, the fermentation capacity was similar 96%, about 97%, about 98%, or about 99% sequence identity to that of a strain without the hexokinase 2 gene deletion. to any one of the sequences of Table 9, wherein such a poly Diderich et al. (Applied and Environmental Microbiology 35 nucleotide or gene encodes, or such a polypeptide has, hex 67:1587-1593 (2001)) found that S. cerevisiae with a deletion okinase 2 activity. Still other examples of hexokinase 2 poly of the hexokinase 2 gene had lower pyruvate decarboxylase nucleotides, genes and polypeptides that can be targeted for activity. modification or inactivation in a recombinant host cell dis In embodiments, a recombinant host cell disclosed herein closed herein include, but are not limited to an active variant, can comprise a modification in an endogenous polynucle 40 fragment orderivative of any one of the sequences of Table 9, otide encoding a polypeptide having hexokinase 2 activity wherein such a polynucleotide or gene encodes, or such a and/or a modification in a polypeptide having hexokinase 2 polypeptide has, hexokinase 2 activity. activity. In embodiments, a recombinant host cell disclosed In embodiments, a polynucleotide, gene and/or polypep herein can have a modification or disruption of a polynucle tide encoding a hexokinase 2 sequence disclosed herein or otide, gene or polypeptide encoding hexokinase 2. In embodi 45 known in the art can be modified or disrupted, as disclosed ments, a recombinant host cell comprises a deletion, muta above for aldehyde dehydrogenase. In other embodiments, a tion, and/or Substitution in an endogenous polynucleotide or polynucleotide, gene and/or polypeptide encoding hexoki gene encoding a polypeptide having hexokinase 2 activity, or nase 2 can be used to identify another hexokinase 2 poly an endogenous polypeptide having hexokinase 2 activity. nucleotide, gene and/or polypeptide sequence or to identify a Such modifications, disruptions, deletions, mutations, and/or 50 hexokinase 2 homolog in other cells, as disclosed above for Substitutions can result in hexokinase 2 activity that is aldehyde dehydrogenase. Such a hexokinase 2 encoding reduced or eliminated, resulting, for example, in a hexokinase sequence can be identified, for example, in the literature 2 knockout (HXK2-KO) phenotype. In embodiments, the and/or in bioinformatics databases well known to the skilled host cell comprises a modification as described in U.S. Appn. person. For example, the identification of a hexokinase 2 Serial. Nos. 2011/0124060A1 or 2012/001541.6 A1, which 55 encoding sequence in other cell types using bioinformatics are incorporated herein by reference in their entireties. can be accomplished through BLAST (as described above) In embodiments, a polypeptide having hexokinase 2 activ searching of publicly available databases with a known hex ity can catalyze the conversion of hexose to hexose-6-phos okinase 2 encoding DNA and polypeptide sequence. Such as phate, and/or can catalyze the conversion of D-glucose to those provided herein. Identities are based on the Clustal W D-glucose 6-phosphate, D-fructose to D-fructose 6-phos 60 method of alignment using the default parameters of GAP phate, and/or D-mannose to D-mannose 6-phosphate. In PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet other embodiments, a polynucleotide, gene or polypeptide 250 series of protein weight matrix. having hexokinase 2 activity can correspond to Enzyme The modification of hexokinase 2 in a recombinant host Commission Number EC 2.7.1.1. cell disclosed herein to reduce or eliminate hexokinase 2 In embodiments of the invention, a recombinant host cell 65 activity can be confirmed using methods known in the art. For can be S. cerevisiae and a polynucleotide, gene or polypeptide example, disruption of hexokinase 2 could be confirmed with having hexokinase 2 activity can be HXK2. In other embodi PCR screening using primers external to the hexokinase 2 US 9,422,582 B2 59 60 gene, or by Southern blot using a probe designed to the of theoretical, at a yield of greater than about 50% of theo hexokinase 2 gene sequence. Alternatively, one could exam retical, at a yield of greater than about 60% of theoretical, at ine putative hexokinase 2 knockout strains for increased bio a yield of greater than about 70% of theoretical, at a yield of mass yield on glucose-containing media. greater than about 75% of theoretical, at a yield of greater than Examples of additional modifications that can be useful in 5 about 80% of theoretical at a yield of greater than about 85% cells provided herein include modifications to reduce glyc of theoretical, at a yield of greater than about 90% of theo erol-3-phosphate dehydrogenase activity and/or disruption in retical, at a yield of greater than about 95% of theoretical, at at least one gene encoding a polypeptide having pyruvate a yield of greater than about 96% of theoretical, at a yield of decarboxylase activity or a disruption in at least one gene greater than about 97% of theoretical, at a yield of greater than encoding a regulatory element controlling pyruvate decar 10 about 98% of theoretical, at a yield of greater than about 99% boxylase gene expression as described in U.S. Patent Appl. of theoretical, or at a yield of about 100% of theoretical. In Pub. No. 2009/0305363 (incorporated herein by reference), other embodiments, the product is produced as a co-product modifications to a host cell that provide for increased carbon along with ethanol. In still other embodiments, the product of flux through an Entner-Doudoroff Pathway or reducing the biosynthetic pathway is isobutanol. equivalents balance as described in U.S. Patent Appl. Pub. 15 Any product of a biosynthetic pathway that has the conver No. 2010/0120105 (incorporated herein by reference). Other sion of isobutyraldehyde to isobutyric acid as a pathway modifications include integration of at least one polynucle by-product can be produced with greater effectiveness in a otide encoding a polypeptide that catalyzes a step in a pyru recombinant host cell disclosed herein having the described vate-utilizing biosynthetic pathway described in POT Appn. modification of aldehyde dehydrogenase and/or aldehyde Pub. No. WO 2012/033832, which is herein incorporated by oxidase activity. A list of Such products includes, but is not reference in its entirety. A genetic modification which has the limited to, isobutanol. effect of reducing glucose repression wherein the yeast pro Microbial Hosts for Isobutanol Production duction host cell is pdc- is described in U.S. Appl. Publ No. Microbial hosts for isobutanol production can be selected US 2011/0124060, which is herein incorporated by reference from bacteria, cyanobacteria, filamentous fungi and yeasts. in its entirety. 25 The microbial host used for butanol production should be U.S. Appl. Publ. No. 20120064561A1, which is herein tolerant to isobutanol so that the yield is not limited by butanol incorporated by reference, discloses recombinant host cells toxicity. Although butanol-tolerant mutants have been iso comprising (a) at least one heterologous polynucleotide lated from solventogenic Clostridia, little information is encoding a polypeptide having dihydroxy-acid dehydratase available concerning the butanol tolerance of other poten activity; and (b)(i) at least one deletion, mutation, and/or 30 tially useful bacterial strains. Most of the studies on the com Substitution in an endogenous gene encoding a polypeptide parison of alcohol tolerance in bacteria Suggest that butanol is affecting Fe S duster biosynthesis; and/or (ii) at least one more toxic than ethanol (de Cavalho, et al., Microsc. Res. heterologous polynucleotide encoding a polypeptide affect Tech., 64: 215-22, 2004) and (Kabelitz, et al., FEMS Micro ing Fe—S duster biosynthesis. In embodiments, the polypep biol. Lett., 220: 223-227, 2003, Tomas, et al., J. Bacteriol., tide affecting Fe—S duster biosynthesis is encoded by AFT1. 35 186: 2006-2018, 2004) report that the yield of 1-butanol AFT2, FRA2, GRX3, or CCC1. In embodiments, the during fermentation in Clostridium acetobutylicum can be polypeptide affecting Fe—S duster biosynthesis is constitu limited by 1-butanol toxicity. The primary effect of 1-butanol tive mutant AFT1 L99A, AFT1 L102A, AFT1 C291F, or on Clostridium acetobutylicum is disruption of membrane AFT1 C293F. functions (Hermann et al., Appl. Environ. Microbiol. 50: Additionally, host cells can comprise heterologous poly 40 1238-1243, 1985). nucleotides encoding a polypeptides with phosphoketolase The microbial hosts selected for the production of isobu activity and/or a heterologous polynucleotide encoding a tanol should be tolerant to isobutanol and should be able to polypeptide with phosphotransacetylase activity Such as, for convert carbohydrates to isobutanol. The criteria for selection example, those encoded by SEQID NOs: 962 and 963, and as of suitable microbial hosts include the following: intrinsic described in POT Appn. Pub. No. WO 2011/159853, which is 45 tolerance to isobutanol, high rate of glucose utilization, avail herein incorporated by reference in its entirety. ability of genetic tools for gene manipulation, and the ability Isobutanol and Other Products to generate stable chromosomal alterations. In embodiments of the invention, methods for the produc Suitable host strains with a tolerance for isobutanol can be tion of a product of a biosynthetic pathway are provided identified by screening based on the intrinsic tolerance of the which comprise (a) providing a recombinant host cell dis 50 strain. The intrinsic tolerance of microbes to isobutanol can closed herein; and (b) growing the host cell under conditions be measured by determining the concentration of isobutanol whereby the product of the biosynthetic pathway is produced. that is responsible for 50% inhibition of the growth rate (ICs) In other embodiments, the product is produced as a co-prod when grown in a minimal medium. The ICso values can be uct along with ethanol. In still other embodiments, the prod determined using methods known in the art. For example, the uct of the biosynthetic pathway is isobutanol. 55 microbes of interest can be grown in the presence of various In other embodiments of the invention, the product of the amounts of isobutanol and the growth rate monitored by biosynthetic pathway is produced at a greater yield or amount measuring the optical density at 600 nanometers. The dou compared to the production of the same product in a recom bling time can be calculated from the logarithmic part of the binant host cell that does not comprise reduced or eliminated growth curve and used as a measure of the growth rate. The aldehyde dehydrogenase and/or aldehyde oxidase activity 60 concentration of isobutanol that produces 50% inhibition of and/or acetolactate reductase activity. In embodiments, yield growth can be determined from a graph of the percent inhi is increased by at least about 2%, at least about 5% or at least bition of growth versus the isobutanol concentration. In one about 10%. In embodiments, this greater yield includes pro embodiment, the host strain has an ICs for isobutanol of duction at a yield of greater than about 10% of theoretical, at greater than about 0.5%. a yield of greater than about 20% of theoretical, at a yield of 65 The microbial host for isobutanol production should also greater than about 25% of theoretical, at a yield of greater than utilize glucose at a high rate. Most microbes are capable of about 30% of theoretical, at a yield of greater than about 40% metabolizing carbohydrates. However, certain environmental US 9,422,582 B2 61 62 microbes cannot metabolize carbohydrates to high efficiency, able. Some tools for codon optimization are available based and therefore would not be suitable hosts. on the GC content of the host microorganism. The ability to genetically modify the host is essential for Once the relevant pathway genes are identified and isolated the production of any recombinant microorganism. The mode they can be transformed into suitable expression hosts by of gene transfer technology can be by electroporation, con means well known in the art. Vectors or cassettes useful for jugation, transduction or natural transformation. A broad the transformation of a variety of host cells are common and range of host conjugative plasmids and drug resistance mark commercially available from companies such as EPICEN ers are available. The cloning vectors are tailored to the host TRER (Madison, Wis.), Invitrogen Corp. (Carlsbad, Calif.), microorganisms based on the nature of antibiotic resistance Stratagene (La Jolla, Calif.), and New England Biolabs, Inc. 10 (Beverly, Mass.). Typically the vector or cassette contains markers that can function in that host. sequences directing transcription and translation of the rel The microbial host also has to be manipulated in order to evant gene, a selectable marker, and sequences allowing inactivate competing pathways for carbon flow by deleting autonomous replication or chromosomal integration. Suit various genes. This requires the availability of either trans able vectors comprise a region 5' of the gene which harbors posons to direct inactivation or chromosomal integration vec 15 transcriptional initiation controls and a region 3' of the DNA tors. Additionally, the production host should be amenable to fragment which controls transcriptional termination. Both chemical mutagenesis so that mutations to improve intrinsic control regions can be derived from genes homologous to the isobutanol tolerance can be obtained. transformed host cell, although it is to be understood that such Based on the criteria described above, suitable microbial control regions can also be derived from genes that are not hosts for the production of isobutanol include, but are not native to the specific species chosen as a production host. limited to, members of the genera Clostridium, Zymomonas, Initiation control regions or promoters, which are useful to Escherichia, Salmonella, Rhodococcus, Pseudomonas, drive expression of the relevant pathway coding regions in the Bacillus, Vibrio, Lactobacillus, Enterococcus, Alcaligenes, desired host cell are numerous and familiar to those skilled in Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, the art. Virtually any promoter capable of driving these Brevibacterium, Pichia, Candida, Issatchenkia, Hansenula, 25 genetic elements, including those used in the Examples, is Kluyveromyces, and Saccharomyces. Suitable hosts include: suitable for the present invention including, but not limited to, Escherichia coli, Alcaligenes eutrophus, Bacillus lichenifor CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, mis, Paenibacillus macerans, Rhodococcus erythropolis, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expres Pseudomonas putida, Lactobacillus plantarum, Enterococ sion in Saccharomyces); AOK1 (useful for expression in cus faecium, Enterococcus gallinarium, Enterococcus faeca 30 Pichia); and lac, ara, tet, trp, IP, IP, T7, tac, and trc (useful lis, Bacillus subtilis and Saccharomyces cerevisiae. In some for expression in Escherichia coli, Alcaligenes, and embodiments, the host cell is Saccharomyces cerevisiae. S. Pseudomonas) as well as the amy, apr, npr promoters and cerevisiae yeast are known in the art and are available from a various phage promoters useful for expression in Bacillus variety of sources, including, but not limited to, American subtilis, Bacillus licheniformis, and Paenibacillus macerans. Type Culture Collection (Rockville, Md.), Centraalbureau 35 For yeast recombinant host cells, a number of promoters can voor Schimmelcultures (CBS) Fungal Biodiversity Centre, be used in constructing expression cassettes for genes, includ LeSaffre, Gert Strand AB, Ferm Solutions, North American ing, but not limited to, the following constitutive promoters Bioproducts, Martrex, and Lallemand. S. cerevisiae include, suitable for use in yeast: FBA1, TDH3 (GPD), ADH1, ILV5, but are not limited to, BY4741, CEN.PK 113-7D, Ethanol and GPM1; and the following inducible promoters suitable Red R) yeast, Ferm ProTM yeast, Bio-Ferm R) XR yeast, Gert 40 for use in yeast: GAL1, GAL10, OLE1, and CUP1. Other Strand Prestige Batch Turbo alcohol yeast, Gert Strand Pot yeast promoters include hybrid promoters UAS(PGK1)- Distillers yeast, Gert Strand Distillers Turbo yeast, FerMaxTM FBA1p (SEQ ID NO: 406), UAS(PGK1)-ENO2p (SEQ ID Green yeast, FerMaxTM Gold yeast, ThermosaccR) yeast, NO: 538), UAS(FBA1)-PDC1p (SEQ ID NO: 539), UAS BG-1, PE-2, CAT-1, CBS7959, CBS7960, and CBS7961. (PGK1)-PDC1p (SEQID NO:540), and UAS(PGK)-OLE1p Construction of Production Host 45 (SEQID NO: 541). Recombinant microorganisms containing the necessary Promoters, transcriptional terminators, and coding regions genes that will encode the enzymatic pathway for the conver can be cloned into a yeast 2 micron plasmid and transformed sion of a fermentable carbon substrate to butanol can be into yeast cells (Ludwig, et al. Gene, 132: 33-40, 1993; US constructed using techniques well known in the art. In the Appl. Pub. No. 20080261861 A1). present invention, genes encoding the enzymes of one of the 50 Adjusting the amount of gene expression in a given host isobutanol biosynthetic pathways of the invention, for may be achieved by varying the level of transcription, such as example, acetolactate synthase, acetohydroxy acid isomer through selection of native or artificial promoters. In addition, oreductase, acetohydroxy acid dehydratase, branched-chain techniques such as the use of promoter libraries to achieve C.-keto acid decarboxylase, and branched-chain alcohol desired levels of gene transcription are well known in the art. dehydrogenase, can be isolated from various sources, as 55 Such libraries can be generated using techniques known in the described above. art, for example, by cloning of random cDNA fragments in Methods of obtaining desired genes from a genome are front of gene cassettes (Gohet al. (2002) AEM 99, 17025), by common and well known in the art of molecular biology. For modulating regulatory sequences present within promoters example, if the sequence of the gene is known, Suitable (Ligret al. (2006) Genetics 172, 2113), or by mutagenesis of genomic libraries can be created by restriction endonuclease 60 known promoter sequences (Alperetal. (2005) PNAS, 12678: digestion and can be screened with probes complementary to Nevoigt et al. (2006) AEM 72, 5266). the desired gene sequence. Once the sequence is isolated, the Termination control regions can also be derived from vari DNA can be amplified using standard primer-directed ampli ous genes native to the hosts. Optionally, a termination site fication methods such as polymerase chain reaction (U.S. Pat. can be unnecessary or can be included. No. 4,683.202) to obtain amounts of DNA suitable for trans 65 Certain vectors are capable of replicating in a broad range formation using appropriate vectors. Tools for codon optimi of host bacteria and can be transferred by conjugation. The Zation for expression in a heterologous host are readily avail complete and annotated sequence of pRK404 and three US 9,422,582 B2 63 64 related vectors-pRK437, pRK442, and pRK442(H) are avail required for the production of isobutanol can be cloned in able. These derivatives have proven to be valuable tools for plasmids pBE20 or pBE60 derivatives (Nagarajan et al., genetic manipulation in Gram-negative bacteria (Scott et al., Gene, 114: 121-126, 1992). Methods to transform B. licheni Plasmid, 50: 74-79, 2003), Several plasmid derivatives of formis are known in the art (Fleming et al. Appl. Environ, broad-host-range Inc P4 plasmid RSF1010 are also available 5 Microbiol. 61:3775-3780, 1995). The plasmids constructed with promoters that can function in a range of Gram-negative for expression in B. subtilis can be transformed into B. bacteria, Plasmid pAYC36 and pAYC37, have active promot licheniformis to produce a recombinant microbial host that ers along with multiple cloning sites to allow for the heter produces isobutanol. ologous gene expression in Gram-negative bacteria. Expression of a Butanol Biosynthetic Pathway in Paenibacil Chromosomal gene replacement tools are also widely 10 lus macerans available. For example, a thermosensitive variant of the Plasmids can be constructed as described above for expres broad-host-range replicon pWV 101 has been modified to sion in B. subtilis and used to transform Paenibacillus mac construct a plasmid pVE6002 which can be used to effect erans by protoplast transformation to produce a recombinant gene replacement in a range of Gram-positive bacteria microbial host that produces isobutanol. (Maguin et al., J. Bacteriol., 174: 5633-5638, 1992). Addi 15 Expression of the Butanol Biosynthetic Pathway in Alcali tionally, in vitro transposomes are available to create random genes (Ralstonia) eutrophus mutations in a variety of genomes from commercial sources Methods for gene expression and creation of mutations in Such as EPICENTRE(R). Alcaligenes eutrophus are known in the art (Taghavi et al., The expression of a butanol biosynthetic pathway in vari Appl. Environ, Microbiol. 60:3585-3591, 1994). The genes ous microbial hosts is described in more detail below. for an isobutanol biosynthetic pathway can be cloned in any Expression of a Butanol Biosynthetic Pathway in E. Coli of the broad host range vectors described above, and elec Vectors or cassettes useful for the transformation of E. coli troporated to generate recombinants that produce isobutanol. are common and commercially available from the companies The poly(hydroxybutyrate) pathway in Alcaligenes has been listed above. For example, the genes of an isobutanol biosyn described in detail, a variety of genetic techniques to modify thetic pathway can be isolated from various sources, cloned 25 the Alcaligenes eutrophus genome is known, and those tools into a modified puC19 vector and transformed into E. coli can be applied for engineering an isobutanol biosynthetic NM522. pathway. Expression of a Butanol Biosynthetic Pathway in Rhodococ Expression of a Butanol Biosynthetic Pathway in Pseudomo cus erythropolis nas putida A series of E. coli-Rhodococcus shuttle vectors are avail 30 Methods for gene expression in Pseudomonas putida are able for expression in R. erythropolis, including, but not lim known in the art (see for example Ben-Basset et al., U.S. Pat. ited to, pRhBR17 and pL)A71 (Kostichka et al., Appl. Micro No. 6,586.229, which is incorporated herein by reference). biol. Biotechnol., 62: 61-68, 2003). Additionally, a series of The butanol pathway genes can be inserted into pPCU18 and promoters are available for heterologous gene expression in this ligated DNA can be electroporated into electrocompetent R. erythropolis (Nakashima et al., Appl. Environ. Microbiol. 35 Pseudomonas putida DOT-T1 C5aAR1 cells to generate 70: 5557-5568, 2004 and Tao et al., Appl. Microbiol. Bio recombinants that produce isobutanol. technol. 68: 346-354, 2005). Targeted gene disruption of Expression of a Butanol Biosynthetic Pathway in Saccharo chromosomal genes in R. erythropolis can be created using myces cerevisiae the method described by Tao et al., supra, and Brans et al. Methods for gene expression in Saccharomyces cerevisiae (Appl. Environ. Microbiol. 66: 2029-2036, 2000). 40 are known in the art (e.g., Methods in Enzymology, Volume The heterologous genes required for the production of 194, Guide to Yeast Genetics and Molecular and Cell Biology, isobutanol, as described above, can be cloned initially in Part A, 2004, Christine Guthrie and Gerald R. Fink, eds., pDA71 or pRhBR71 and transformed into E. coli. The vectors Elsevier Academic Press, San Diego, Calif.). Expression of can then be transformed into R. erythropolis by electropora genes in yeast typically requires a promoter, followed by the tion, as described by Kostichka et al., supra. The recombi 45 gene of interest, and a transcriptional terminator. A number of nants can be grown in synthetic medium containing glucose yeast promoters, including those used in the Examples herein, and the production of isobutanol can be followed using meth can be used in constructing expression cassettes for genes ods known in the art. encoding an isobutanol biosynthetic pathway, including, but Expression of a Butanol Biosynthetic Pathway in B. Subtilis not limited to constitutive promoters FBA, GPD, ADH1, and Methods for gene expression and creation of mutations in 50 GPM, and the inducible promoters GAL1, GAL10, and B. subtilis are also well known in the art. For example, the CUP1. Suitable transcriptional terminators include, but are genes of an isobutanol biosynthetic pathway can be isolated not limited to FBAt, GPDt, GPMt, ERG10t, GAL1t, CYC1, from various sources, cloned into a modified puC19 vector and ADH1. For example, suitable promoters, transcriptional and transformed into Bacillus subtilis BE1010. Additionally, terminators, and the genes of an isobutanol biosynthetic path the five genes of an isobutanol biosynthetic pathway can be 55 way can be cloned into E. coli-yeast shuttle vectors and trans split into two operons for expression. The three genes of the formed into yeast cells as described in U.S. App. Pub. No. pathway (bubE, ilvD, and kiv D) can be integrated into the 20100129886. These vectors allow strain propagation in both chromosome of Bacillus subtilis BE 1010 (Payne, et al., J. E. coli and yeast strains. Typically the vector contains a Bacteriol., 173,2278-2282, 1991). The remaining two genes selectable marker and sequences allowing autonomous rep (ilvC and bdhB) can be cloned into an expression vector and 60 lication or chromosomal integration in the desired host. Typi transformed into the Bacillus strain carrying the integrated cally used plasmids in yeast are shuttle vectors pRS423, isobutanol genes pRS424, pRS425, and pRS426 (AmericanType Culture Col Expression of a Butanol Biosynthetic Pathway in B. licheni lection, Rockville, Md.), which contain an E. coli replication formis origin (e.g., pMB1), a yeast 2L origin of replication, and a Most of the plasmids and shuttle vectors that replicate in B. 65 marker for nutritional selection. The selection markers for subtilis can be used to transform B. licheniformis by either these four vectors are His3 (vector pRS423), Trp 1 (vector protoplast transformation or electroporation. The genes pRS424), Leu2 (vector pRS425) and Ura3 (vector pRS426). US 9,422,582 B2 65 66 Construction of expression vectors with genes encoding Bacteriol., 184: 5800-5804, 2002); pNZ9520 (Kleerebezem polypeptides of interest can be performed by either standard et al., Appl. Environ. Microbiol. 63: 4581-4584, 1997); molecular cloning techniques in E. coli or by the gap repair pAM401 (Fujimoto et al., Appl. Environ. Microbiol., 67: recombination method in yeast. 1262-1267, 2001); and p AT392 (Arthur et al., Antimicrob. The gap repair cloning approach takes advantage of the Agents Chemother, 38: 1899-1903, 1994). Several plasmids highly efficient homologous recombination in yeast. Typi from Lactobacillus plantarum have also been reported (van cally, a yeast vector DNA is digested (e.g., in its multiple Kranenburg R, et al. Appl. Environ. Microbiol. 71: 1223 cloning site) to create a 'gap' in its sequence. A number of 1230, 2005). insert DNAs of interest are generated that contain a >21 bp Expression of a Butanol Biosynthetic Pathway in Various sequence at both the 5' and the 3' ends that sequentially 10 Enterococcus sieges (E. faecium, E. gallinarium, and E. overlap with each other, and with the 5' and 3' terminus of the faecalis) vector DNA. For example, to construct a yeast expression The Enterococcus genus belongs to the Lactobacillales vector for “Gene X', a yeast promoter and a yeast terminator family and many plasmids and vectors used in the transfor are selected for the expression cassette. The promoter and mation of Lactobacilli, Bacilli and Streptococci species can terminator are amplified from the yeast genomic DNA, and 15 be used for Enterococcus species. Non-limiting examples of Gene X is either PCR amplified from its source organism or suitable vectors include pAMR1 and derivatives thereof obtained from a cloning vector comprising Gene X sequence. (Renaultet al., Gene, 183: 175-182, 1996); and (O'Sullivanet There is at least a 21 bp overlapping sequence between the 5' al., Gene, 137: 227-231, 1993); pMBB1 and pHW800, a end of the linearized vector and the promoter sequence, derivative of pMBB1 (Wyckoffet al. Appl. Environ. Micro between the promoter and Gene X, between Gene X and the biol., 62: 1481-1486, 1996); pMG1, a conjugative plasmid terminator sequence, and between the terminator and the 3' (Tanimoto et al., J. Bacteriol., 184: 5800-5804, 2002); end of the linearized vector. The "gapped vector and the pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol. 63: insert DNAs are then co-transformed into a yeast strain and 4581-4584, 1997): p.AM401 (Fujimoto et al., Appl. Environ. plated on the medium containing the appropriate compound Microbiol., 67: 1262-1267, 2001); and pAT392 (Arthur et al., mixtures that allow complementation of the nutritional selec 25 Antimicrob. Agents Chemother, 38: 1899-1903, 1994). tion markers on the plasmids. The presence of correct insert Expression vectors for E. faecalis using the niSA gene from combinations can be confirmed by PCR mapping using plas Lactococcus can also be used (Eichenbaum et al., Appl. Envi mid DNA prepared from the selected cells. The plasmid DNA ron. Microbiol. 64: 2763-2769, 1998). Additionally, vectors isolated from yeast (usually low in concentration) can then be for gene replacement in the E. faecium chromosome can be transformed into an E. coli strain, e.g. TOP10, followed by 30 used (Nallaapareddy et al., Appl. Environ. Microbiol. 72: mini preps and restriction mapping to further verify the plas 334-345, 2006). mid construct. Finally the construct can be verified by Fermentation Media sequence analysis. Fermentation media in the present invention must contain Like the gap repair technique, integration into the yeast suitable carbon substrates. Suitable substrates can includebut genome also takes advantage of the homologous recombina 35 are not limited to monosaccharides such as glucose and fruc tion system in yeast. Typically, a cassette containing a coding tose, oligosaccharides such as lactose, maltose, galactose, region plus control elements (promoter and terminator) and Sucrose, polysaccharides such as starch or cellulose or mix auxotrophic marker is PCR-amplified with a high-fidelity tures thereof and unpurified mixtures from renewable feed DNA polymerase using primers that hybridize to the cassette stocks Such as cheese whey permeate, cornsteep liquor, Sugar and contain 40-70 base pairs of sequence homology to the 40 beet molasses, and barley malt. Additionally the carbon sub regions 5° and 3° of the genomic area where insertion is strate can also be one-carbon Substrates such as carbon diox desired. The PCR product is then transformed into yeast and ide, or methanol for which metabolic conversion into key plated on medium containing the appropriate compound mix biochemical intermediates has been demonstrated. In addi tures that allow selection for the integrated auxotrophic tion to one and two carbon Substrates methylotrophic micro marker. For example, to integrate “Gene X into chromo 45 organisms are also known to utilize a number of other carbon Somal location'Y', the promoter-coding regionX-terminator containing compounds such as methylamine, glucosamine construct is PCR amplified from a plasmid DNA construct and a variety of amino acids for metabolic activity. For and joined to an autotrophic marker (such as URA3) by either example, methylotrophic yeast are known to utilize the car SOE PCR or by common restriction digests and cloning. The bon from methylamine to form trehalose or glycerol (Bellion full cassette, containing the promoter-coding regionX-termi 50 et al., Microb. Growth C1 Compa. Int. Symp., 7th (1993), nator-URA3 region, is PCR amplified with primer sequences 415-32. (eds): Murrell, J. Collin; Kelly, Don P. Publisher: that contain 40-70 bp of homology to the regions 5' and 3' of Intercept, Andover, UK). Similarly, various species of Can location “Y” on the yeast chromosome. The PCR product is dida will metabolizealanine or oleic acid (Sulter et al., Arch. transformed into yeast and selected on growth media lacking Microbiol. 153: 485-489, 1990). Hence it is contemplated uracil. Transformants can be verified either by colony PCR or 55 that the source of carbon utilized in the present invention can by direct sequencing of chromosomal DNA. encompassa wide variety of carbon containing Substrates and Expression of a Butanol Biosynthetic Pathway in Lactoba will only be limited by the choice of microorganism. cillus plantarum Although it is contemplated that all of the above mentioned The Lactobacillus genus belongs to the Lactobacillales carbon substrates and mixtures thereof are suitable in the family and many plasmids and vectors used in the transfor 60 present invention, in some embodiments, the carbon Sub mation of Bacillus subtilis and Streptococcus can be used for strates are glucose, fructose, and Sucrose, or mixtures of these Lactobacillus. Non-limiting examples of Suitable vectors with C5 Sugars such as Xylose and/or arabinose for yeasts include p AMB1 and derivatives thereof (Renault et al., Gene cells modified to use C5 sugars. Sucrose can be derived from 183:175-182, 1996); and (O'Sullivan et al., Gene, 137:227 renewable Sugar Sources such as Sugar cane, Sugar beets, 231, 1993); pMBB1 and pHW800, a derivative of pMBB1 65 cassava, Sweet Sorghum, and mixtures thereof. Glucose and (Wyckoff et al., Appl. Environ. Microbiol., 62: 1481-1486, dextrose can be derived from renewable grain sources 1996); pMG1, a conjugative plasmid (Tanimoto et al., J. through saccharification of starch based feedstocks including US 9,422,582 B2 67 68 grains such as corn, wheat, rye, barley, oats, and mixtures fermentation the medium is inoculated with the desired thereof. In addition, fermentable sugars can be derived from microorganism or microorganisms, and fermentation is per renewable cellulosic or lignocellulosic biomass through pro mitted to occur without adding anything to the system. Typi cesses of pretreatment and saccharification, as described, for cally, however, a “batch” fermentation is batch with respect to example, in U.S. Parent App. Pub. No. 2007/0031918 A1, the addition of carbon source and attempts are often made at which is herein incorporated by reference in its entirety. Bio controlling factors such as pH and oxygen concentration. In mass refers to any cellulosic or lignocellulosic material and batch systems the metabolite and biomass compositions of includes materials comprising cellulose, and optionally fur the system change constantly up to the time the fermentation ther comprising hemicellulose, lignin, starch, oligosaccha is stopped. Within batch cultures cells moderate through a rides and/or monosaccharides. Biomass can also comprise 10 static lag phase to a high growth log phase and finally to a additional components, such as protein and/or lipid. Biomass stationary phase where growth rate is diminished or halted. If can be derived from a single source, or biomass can comprise untreated, cells in the stationary phase will eventually die. a mixture derived from more than one source; for example, Cells in log phase generally are responsible for the bulk of biomass can comprise a mixture of corncobs and corn Stover, production of end product or intermediate. or a mixture of grass and leaves. Biomass includes, but is not 15 A variation on the standard batch system is the Fed-Batch limited to, bioenergy crops, agricultural residues, municipal system. Fed-Batch fermentation processes are also Suitable in Solid waste, industrial Solid waste, sludge from paper manu the present invention and comprise a typical batch system facture, yard waste, wood and forestry waste. Examples of with the exception that the substrate is added in increments as biomass include, but are not limited to, corn grain, corn cobs, the fermentation progresses. Fed-Batch systems are useful crop residues such as cornhusks, corn Stover, grasses, wheat, when catabolite repression is apt to inhibit the metabolism of wheat Straw, barley, barley Straw, hay, rice straw, Switchgrass, the cells and where it is desirable to have limited amounts of waste paper, Sugar cane bagasse, Sorghum, Soy, components substrate in the medium. Measurement of the actual substrate obtained from milling of grains, trees, branches, roots, leaves, concentration in Fed-Batch systems is difficult and is there wood chips, sawdust, shrubs and bushes, vegetables, fruits, fore estimated on the basis of the changes of measurable flowers, animal manure, and mixtures thereof. 25 factors such as pH, dissolved oxygen and the partial pressure In addition to an appropriate carbon Source, fermentation of waste gases such as CO. Batch and Fed-Batch fermenta media must contain Suitable minerals, salts, cofactors, buffers tions are common and well known in the art and examples can and other components, known to those skilled in the art, be found in Thomas D. Brock in Biotechnology: A Textbook of suitable for growth of the cultures and promotion of the Industrial Microbiology, Second Edition (1989) Sinauer enzymatic pathway necessary for butanol production 30 Associates, Inc., Sunderland, Mass., or Deshpande, Mukund described herein. (Appl. Biochem. Biotechnol. 36: 227, 1992), herein incor Culture Conditions porated by reference. Typically cells are grown at a temperature in the range of Although the present invention is performed in batch mode about 20° C. to about 40° C. in an appropriate medium. it is contemplated that the method would be adaptable to Suitable growth media in the present invention are common 35 continuous fermentation methods. Continuous fermentation commercially prepared media Such as Luria Bertani (LB) is an open system where a defined fermentation medium is broth, Sabouraud Dextrose (SD) broth or Yeast Medium added continuously to a bioreactor and an equal amount of (YM) broth or broth that includes yeast nitrogen base, ammo conditioned medium is removed simultaneously for process nium sulfate, and dextrose (as the carbon/energy source) or ing. Continuous fermentation generally maintains the cul YPD Medium, a blend of peptone, yeast extract, and dextrose 40 tures at a constant high density where cells are primarily in in optimal proportions for growing most Saccharomyces cer log phase growth. evisiae strains. Other defined or synthetic growth media can Continuous fermentation allows for modulation of one also be used, and the appropriate medium for growth of the factor or any number of factors that affect cell growth or end particular microorganism will be known by one skilled in the product concentration. For example, one method will main art of microbiology or fermentation Science. The use of 45 tain a limiting nutrient Such as the carbon Source or nitrogen agents known to modulate catabolite repression directly or level at a fixed rate and allow all other parameters to moder indirectly, e.g., cyclic adenosine 2',3'-monophosphate ate. In other systems a number of factors affecting growth can (CAMP), can also be incorporated into the fermentation be altered continuously while the cell concentration, mea medium. Sured by medium turbidity, is kept constant. Continuous sys Suitable pH ranges for the fermentation are between pH 5.0 50 tems strive to maintain steady state growth conditions and to pH 9.0, where pH 6.0 to pH 8.0 is preferred for the initial thus the cell loss due to the medium being drawn off must be condition. Suitable pH ranges for the fermentation of yeast balanced against the cell growth rate in the fermentation. are typically between about pH 3.0 to about pH 9.0. In one Methods of modulating nutrients and growth factors for con embodiment, about pH 5.0 to about pH 8.0 is used for the tinuous fermentation processes as well as techniques for initial condition. Suitable pH ranges for the fermentation of 55 maximizing the rate of product formation are well known in other microorganisms are between about pH 3.0 to about pH the art of industrial microbiology and a variety of methods are 7.5. In one embodiment, about pH 4.5 to about pH 6.5 is used detailed by Brock, supra. for the initial condition. It is contemplated that the present invention can be prac Fermentations can be performed under aerobic or anaero ticed using either batch, fed-batch or continuous processes bic conditions. In one embodiment, anaerobic or microaero 60 and that any known mode of fermentation would be suitable. bic conditions are used for fermentation. Additionally, it is contemplated that cells can be immobilized Industrial Batch and Continuous Fermentations on a Substrate as whole cell catalysts and Subjected to fermen The present processes may employ a batch method of tation conditions for isobutanol production. fermentation. A classical batch fermentation is a dosed sys Methods for Butanol Isolation from the Fermentation tem where the composition of the medium is set at the begin 65 Medium ning of the fermentation and not subject to artificial alter Bioproduced butanol can be isolated from the fermentation ations during the fermentation. Thus, at the beginning of the medium using methods known in the art for ABE fermenta US 9,422,582 B2 69 70 tions (see, e.g., Durre. Appl. Microbiol. Biotechnol. 49:639 the aqueous phase containing the microorganism, thereby 648 (1998), Groot et al., Process. Biochem. 27:61-75 (1992), limiting the exposure of the microorganism to the inhibitory and references therein). For example, solids can be removed butanol. from the fermentation medium by centrifugation, filtration, Liquid-liquid extraction can be performed, for example, decantation, or the like. Then, the butanol can be isolated according to the processes described in U.S. Patent Appl. Pub. from the fermentation medium using methods such as distil No. 2009/0305370, the disclosure of which is hereby incor lation, azeotropic distillation, liquid-liquid extraction, porated in its entirety. U.S. Patent Appl. Pub. No. 2009/ adsorption, gas stripping, membrane evaporation, or per 0305370 describes methods for producing and recovering vaporation. butanol from a fermentation broth using liquid-liquid extrac Because butanol forms a low boning point, azeotropic mix 10 tion, the methods comprising the step of contacting the fer ture with water, distillation can be used to separate the mix mentation broth with a water immiscible extractant to form a ture up to its azeotropic composition. Distillation can be used two-phase mixture comprising an aqueous phase and an in combination with another separation method to obtain organic phase. Typically, the extractant can be an organic separation around the azeotrope. Methods that can be used in extractant selected from the group consisting of Saturated, combination with distillation to isolate and purify butanol 15 mono-unsaturated, poly-unsaturated (and mixtures thereof) include, but are not limited to, decantation, liquid-liquid C to C fatty alcohols, C to C fatty acids, esters of C. extraction, adsorption, and membrane-based techniques. to C fatty acids, C to C fatty aldehydes, and mixtures Additionally, butanol can be isolated using azeotropic distil thereof. The extractant(s) for ISPR can be non-alcohol extrac lation using an entrainer (see, e.g., Doherty and Malone, tants. The ISPR extractant can be an exogenous organic Conceptual Design of Distillation Systems, McGraw Hill, extractant such as oleyl alcohol, behenyl alcohol, cetyl alco New York, 2001). hol, lauryl alcohol, myristyl alcohol, Stearyl alcohol. 1-unde The butanol-water mixture forms a heterogeneous azeo canol, oleic acid, lauric acid, myristic acid, Stearic acid, trope so that distillation can be used in combination with methyl myristate, methyl oleate, undecanal, lauric aldehyde, decantation to isolate and purify the butanol. In this method, 20-methylundecanal, and mixtures thereof. the butanol containing fermentation broth is distilled to near 25 In some embodiments, the ester can be formed by contact the azeotropic composition. Then, the azeotropic mixture is ing the alcohol in a fermentation medium with a carboxylic condensed, and the butanol is separated from the fermenta acid (e.g., fatty acids) and a catalyst capable of esterifying the tion medium by decantation. The decanted aqueous phase can alcohol with the carboxylic acid, as described in POT Appn, be returned to the first distillation column as reflux. The Pub. No. WO/2011/159998, which is herein incorporated by butanol-rich decanted organic phase can be further purified 30 reference in its entirety. In such embodiments, the carboxylic by distillation in a second distillation column. acid can serve as an ISPR extractant into which the alcohol The butanol can also be isolated from the fermentation esters partition. The carboxylic acid can be supplied to the medium using liquid-liquid extraction in combination with fermentation vessel and/or derived from the biomass supply distillation. In this method, the butanol is extracted from the ing fermentable carbon fed to the fermentation vessel. Lipids fermentation broth using liquid-liquid extraction with a Suit 35 present in the feedstock can be catalytically hydrolyzed to able solvent. The butanol-containing organic phase is then carboxylic acid, and the same catalyst (e.g., enzymes) can distilled to separate the butanol from the solvent. esterify the carboxylic acid with the alcohol. The catalyst can Distillation in combination with adsorption can also be be supplied to the feedstock prior to fermentation, or can be used to isolate butanol from the fermentation medium. In this Supplied to the fermentation vessel before or contemporane method, the fermentation broth containing the butanol is dis 40 ously with the supplying of the feedstock. When the catalyst tilled to near the azeotropic composition and then the remain is Supplied to the fermentation vessel, alcohol esters can be ing water is removed by use of an adsorbent, such as molecu obtained by hydrolysis of the lipids into carboxylic acid and lar sieves (Aden et al., Lignocellulosic Biomass to Ethanol substantially simultaneous esterification of the carboxylic Process Design and Economics Utilizing Co-Current Dilute acid with butanol present in the fermentation vessel. Car Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Sto 45 boxylic acid and/or native oil not derived from the feedstock ver, Report NREL/TP-510-32438, National Renewable can also be fed to the fermentation vessel, with the native oil Energy Laboratory, June 2002). being hydrolyzed into carboxylic acid. Any carboxylic acid Additionally, distillation in combination with pervapora not esterified with the alcohol can serve as part of the ISPR tion can be used to isolate and purify the butanol from the extractant. The extractant containing alcohol esters can be fermentation medium. In this method, the fermentation broth 50 separated from the fermentation medium, and the alcohol can containing the butanol is distilled to near the azeotropic com be recovered from the extractant. The extractant can be position, and then the remaining water is removed by per recycled to the fermentation vessel. Thus, in the case of vaporation through a hydrophilic membrane (Guo et al., J. butanol production, for example, the conversion of the Membr. Sci. 245, 199-210 (2004)). butanol to an ester may reduce the free butanol concentration In situ product removal (ISPR) (also referred to as extrac 55 in the fermentation medium, shielding the microorganism tive fermentation) can be used to remove butanol (or other from the toxic effect of increasing butanol concentration. In fermentative alcohol) from the fermentation vessel as it is addition, unfractionated grain can be used as feedstock with produced, thereby allowing the microorganism to produce out separation of lipids therein, since the lipids can be cata butanol at high yields. One method for ISPR for removing lytically hydrolyzed to carboxylic acid, thereby decreasing fermentative alcohol that has been described in the art is 60 the rate of build-up of lipids in the ISPR extractant. liquid-liquid extraction. In general, with regard to butanol In situ product removal can be carried out in a batch mode fermentation, for example, the fermentation medium, which ora continuous mode. In a continuous mode of in situ product includes the microorganism, is contacted with an organic removal, product is continually removed from the reactor. In extractant at a time before the butanol concentration reaches a batchwise mode of in situ product removal, a volume of a toxic level. The organic extractant and the fermentation 65 organic extractant is added to the fermentation vessel and the medium form a biphasic mixture. The butanol partitions into extractant is not removed during the process. For in situ the organic extractant phase, decreasing the concentration in product removal, the organic extractant can contact the fer US 9,422,582 B2 71 72 mentation medium at the start of the fermentation forming a volume, “v/v’ means volume per volume, “nm’ means biphasic fermentation medium. Alternatively, the organic nanometer(s), “mm” means millimeter(s), 'cm’ means cen extractant can contact the fermentation medium after the timeter(s), “mM” means millimolar, “M” means molar, “g microorganism has achieved a desired amount of growth, means gram(s), “ug' means microgram(s), 'mg” means mil which can be determined by measuring the optical density of 5 ligram(s), ''g' means the gravitation constant, “rpm’ means the culture. Further, the organic extractant can contact the revolutions per minute, “HPLC' means high performance fermentation medium at a time at which the product alcohol liquid chromatography, “MS’ means mass spectrometry, level in the fermentation medium reaches a preselected level. “HPLC/MS means high performance liquid chromatogra In the case ofbutanol production according to Some embodi phy/mass spectrometry, “EDTA means ethylendiamine-tet ments of the present invention, the carboxylic acid extractant 10 raacetic acid, “dNTP means deoxynucleotide triphosphate, can contact the fermentation medium at a time before the “C.” means degrees Celsius, and “V” means voltage. butanol concentration reaches a toxic level. So as to esterify High Throughput Screening Assay of Gene Libraries the butanol with the carboxylic acid to produce butanol esters High throughput Screening of the gene libraries of mutant and consequently reduce the concentration ofbutanol in the KARI enzymes was performed as described herein (with the fermentation vessel. The ester-containing organic phase can 15 exception of Examples 16 and 21): 10x freezing medium then be removed from the fermentation vessel (and separated containing 554.4 g/L glycerol. 68 mM of (NHA)SO4 mM from the fermentation broth which constitutes the aqueous MgSO 17 mM sodium citrate, 132 mM. KHPO, 36 mM phase) after a desired effective titer of the butanol esters is KHPO was prepared with molecular pure water and filter achieved. In some embodiments, the ester-containing organic sterilized. Freezing medium was prepared by diluting the 10x phase is separated from the aqueous phase after fermentation 20 freezing medium with the LB medium. An aliquot (200 ul) of of the available fermentable sugar in the fermentation vessel the freezing medium was used for each well of the 96-well is Substantially complete. archive plates (cat #3370, Corning Inc. Corning, N.Y.). Clones from the LB agar plates were selected and inocu EXAMPLES lated into the 96-well archive plates containing the freezing 25 medium and grown overnight at 37°C. without shaking. The The present invention is further defined in the following archive plates were then stored at -80° C. E. coli strain Examples. It should be understood that these Examples, Bw251 13 transformed with pBAD-HisB (Invitrogen) was while indicating preferred embodiments of the invention, are always used as the negative control. The positive controls for given by way of illustration only. From the above discussion the libraries in Examples 3, 4, and 5 are the wild type and these Examples, one skilled in the art can ascertain the 30 K9-KARI, AB1D3, AB1D3 respectively. essential characteristics of this invention, and without depart Clones from archive plates were inoculated into the ing from the spirit and scope thereof, can make various 96-deep well plates. Each well contained 3.0 ul of cells from changes and modifications of the invention to adapt it to thawed archive plates, 200 ul of the LB medium containing various uses and conditions. 100 lug/ml amplicillin and 0.02% (w/v) arabinose as the General Methods: 35 inducer. Cells were the grown overnight at 37°C. with 80% Standard recombinant DNA and molecular cloning tech humidity while shaking (900 rpm), harvested by centrifuga niques used in the Examples are well known in the art and are tion (4000 rpm, 5 min at 25° C.). (Eppendorf centrifuge, described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Brinkmann Instruments, Inc. Westbury, N.Y.) and the cell Molecular Cloning: A Laboratory Manual, Cold Spring Har pellet was stored at -20° C. for later analysis. The assay bor Laboratory Press, Cold Spring Harbor, N.Y., 1989, by T. 40 Substrate, (R.S)-acetolactate, was synthesized as described J. Silhavy, M. L. Bennan, and L. W. Enquist, Experiments by Aulabaugh and Schloss (Aulabaugh and Schloss, Bio with Gene Fusions, Cold Spring Harbor Laboratory, Cold chemistry, 29:2824-2830, 1990). AH other chemicals used in Spring Harbor, N.Y., 1984, and by Ausubel, F. M. et al., the assay were purchased from Sigma. Current Protocols in Molecular Biology, Greene Publishing The enzymatic conversion of acetolactate to C.f3-dihy Assoc. and Wiley-Interscience, N.Y., 1987. 45 droxy-isovalerate by KARI was followed by measuring the Materials and methods suitable for the maintenance and disappearance of the cofactor, NADPH or NADH, from the growth of bacterial cultures are also well known in the art. reaction at 340 nm using a plate reader (Molecular Device, Techniques suitable for use in the following Examples can be Sunnyvale, Calif.). The activity was calculated using the found in Manual of Methods for General Bacteriology, Phil molar extinction coefficient of 6220 M'cm for either lipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. 50 NADPH or NADH. The stock solutions used were: KHPO Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, (0.2 M); KHPO (0.2 M); EDTA (0.5 M), MgCl, (1.0 M); eds. American Society for Microbiology, Washington, D.C., NADPH (2.0 mM); NADH (2.0 mM) and acetolactate (45 1994, or by Thomas D. Brock in Biotechnology: A Textbook of mM). The 100 ml reaction buffer (pH 6.8) containing: 2.0 ml Industrial Microbiology, Second Edition, Sinauer Associates, KHPO, 3.0 ml KHPO, 4.0 ml MgCl, 0.1 ml EDTA and Inc., Sunderland, Mass., 1989. All reagents, restriction 55 90.9 ml water was prepared. enzymes and materials used for the growth and maintenance Frozen cell pellet in deep-well plates and BugBuster were ofbacterial cells were obtained from Aldrich Chemicals (Mil warmed up at room temperature for 30 min at the same time. waukee, Wis.), BD Diagnostic Systems (Sparks, Md.), Life Each well of 96-well assay plates was filled with 120 ul of the Technologies (Rockville, Md.), or Sigma Chemical Com reaction buffer and 20 ul of NADH (2.0 mM).75 ul of 50% pany (St. Louis, Mo.), unless otherwise specified. 60 BugEBuster (v/v in water) was added to each well after 30 min The meaning of abbreviations used is as follows: “A” warm-up and cells were suspended using plate shaker. The means Angstrom, “min' means minute(s), “h” means hour(s), plates were incubated at room temperature for 20 min. An “ul” means microliter(s), “ngful' means nano gram per aliquot (15 to 25 ul depending the expected activity) of cell microliter, “pmol/ul' means pico mole per microliter, “ml lysate was transferred into each well of 96-well assay plates. means milliliter(s), “L” means liter(s), g/L mean gram per 65 Absorbance at 340 nm was recorded as background, 16 ul of liter, “ng” means nano gram, 'sec’ means second(s), “ml/ acetolactate (4.5 mM, diluted with the reaction buffer) was min' means milliliter per minute(s), “w/v’ means weight per added to each well and mixed with shaking by the plate US 9,422,582 B2 73 74 reader. Absorbance at 340 nm was recorded at 0, and 10 to 30 by ionization at m/z =133, using electrospray ionization -30 minutes depending the expected activity after Substrate addi V cone voltage. The amount of product 2,3-dihydroxyisoval tion. The difference in absorbance (before and after substrate erate was calculated by comparison to an authentic standard. addition) was used to determine the activity of the mutants. To calculate the K for NADH and NADPH, the rate data Mutants with higher KARI activity compared to the positive 5 for DHIV formation measured in assays at a fixed concentra control were selected for re-screening. tion of S-acetolactate (2.5 mM) was fitted to the single sub The number of clones screened for the libraries in Example strate Michaelis-Menten equation, using a least-squares 1, 2 and 3 are about 12,000, 12,000 and 92 respectively. The regression in Microsoft Excel, assuming saturating acetolac top performers from each library were re-screened described tate concentration. below as secondary assay. 10 Construction of Plasmids pYZ058, pILH550, pI H556, and Secondary Assay of Active Mutants pLH702 Cells containing selected mutants identified by high pYZ058 (pHR81-P-AlsS-P1-yeast KARI:SEQID throughput Screening (above) were grown overnight, at 37° NO: 176) was derived from pYZ090 (pHR81-P-AlsS C., in 3.0 ml of the LB medium containing 100ampicillin and P-lactic KARI:SEQID NO: 195). pYZ090 was cut with 0.025% (w/v) arabinose as the inducer while shaking at 250 15 PmeI and Sfil enzymes, and ligated with a PCR product of rpm. The cells were then aliquoted into 96 deepwell plates yeast KARI. The PCR product was amplified from genomic (200 ul per well) and harvested by centrifugation at 4,000xg DNA of Saccharomyces cerevisiae BY4741 (Research for 5 min at room temperature. 75ul of 50% BugEuster (v/v Genetics Inc.) strain using upper primer 5'-catcatcacagtttaaa in water) was added to each well and cells were suspended cagtatgttgaagcaaatcaactitcggtgg-3' (SEQ ID NO. 272) and using plate shaker. The plates were incubated at room tem- 20 lower primer 5'-ggacggg.ccctgcaggcct tattg perature for 20 min. An aliquot (15 to 25 ul depending the gttittctggtctcaactttctgac-3' (SEQ ID NO; 273), and digested expected activity) of cell lysate was transferred into each well with PmeI and Sfil enzymes. pYZ058 was confirmed by of 96-well assay plates, which contain 120 ul of the reaction sequencing. buffer and 20 ul of NADH (2.0 mM) per well. Absorbance at pLH550 (pHR81-PCUP1-AlsS-PILV5-Pf5.KARI, SEQ 340 nm was recorded as background, 16 Jul of acetolactate 25 ID NO: 175) was derived from pYZ058 (SEQID NO: 176). (4.5 mM, diluted with the reaction buffer) was added to each The wild type Pf5.KARI gene was PCR amplified with well and mixed with shaking by the plate reader. Absorbance OT1349 (5'-catcatcacagtttaaacagtat at 340 nm was recorded at 0, and 5 to 10 minutes depending gaaagttttctacgataaagactg.cgacc-3'; SEQ ID NO: 177) and the expected activity after substrate addition. The difference OT1318 (5'-gcacttgataggcctgcagggcct tagt in absorbance (before and after substrate addition) was used 30 tctggctttgtcgacgattittg-3'; SEQ ID NO: 178), digested with to determine the activity of the mutants. Mutants with higher PmeI and Sfil enzymes and ligated with pYZ058 vector cut KARI activity compared to the positive control were selected with PmeI and Sfil. The vector generated, pI H550, was con for further characterization. firmed by sequencing, pI H556 (SEQ ID NO: 138; FIG. 4) Measurement of NADH and NADPH Michaelis Constants was derived from plH550 by digesting the vector with Spel KARI enzyme activity can be routinely measured by 35 and Not enzymes, and ligating with a linker annealed from NADH or NADPH oxidation as described above, however to OT1383 (5'-ctagticaccggtggc-3', SEQ ID NO: 179) and measure the Michaelis constant (K) for these pyridine OT1384 (5'-ggccgccaccggtga-3, SEQ ID NO: 180) which nucleotides formation of the 2,3-dihydroxyisovalerate prod contains overhang sequences for Spel and Not sites. This uct was measured directly using HPLC/MS. cloning step eliminates the Alss gene and a large fragment of Protein concentration of crude cell extract from Bugbuster 40 the PCUP1 promoter, with 160 bp residual upstream lysed cells (as described above) was measured using the Bio sequence that is not functional. pl. H556 was confirmed by Rad protein assay reagent (BioRad Laboratories, Inc., Her sequencing. cules, Calif. 94547). Between 0.2 and 1.0 micrograms of pHR81::ILV5p-K9D3 (pLH702, SEQ ID NO: 181) was crude extract protein was added to a reaction buffer consisting derived from plH556. The K9D3 mutant KARI gene was of 100 mM MOPS KOH, pH 6.8, 10 mM MgCl, 1 mM 45 excised from vector p3AD-K9D3 using PmeI and Sfil EDTA, 1 mM glucose-6-phosphate (Sigma-Aldrich), 0.2 enzymes, and ligated with plH556 at PmeI and Sfil sites, Units of Leuconostoc mesenteroides glucose-6-phosphate replacing the Pfs.KARI gene with the K9D3 gene. The con dehydrogenase (Sigma-Aldrich), and various concentrations structed vector was confirmed by sequencing. of NADH or NADPH, to a volume of 90 uL. The reaction was initiated by the addition of 10 uI of S-acetolactate to a final 50 Example 1 concentration of 2.5 mM and a final volume of 100 uL. After 10 min incubations at 30°C., the reaction was quenched by Construction of Yeast Isobutanol Pathway Strains withdrawing 50 uL of the reaction mixture and adding it to Containing Various KARI Genes 150 uL of 0.1% formic acid. To measure the Kof NADH and NADPH, the concentrations used were 0.0003, 0.001, 0.003, 55 To identify polypeptides having KARI activity and perfor 0.01, 0.03, 0.1, 0.3 and 1 mM. mance in yeast isobutanol production, biodiversity Screening To analyze for 2,3-dihydroxyisovalerate, 2 LL of the for of KARI-encoding genes from various bacterial and fungal mic acid quenched reaction mixture was injected into a species was carried out. The KARI genes were codon opti Waters Acquity HPLC equipped with Waters SOD mass spec mized based on codon preferences of Saccharomyces cerevi trometer (Waters Corporation, Milford Mass.). The chroma- 60 siae genes where indicated in Table 10. For each KARI gene, tography conditions were: flow rate (0.5 ml/min), on a Waters a PmeI restriction site and additional 3 bp (AGT) was added Acquity HSST3 column (2.1 mm diameter, 100 mm length). to the 5' end with the sequence 5'-GTTTAAACAGT-3' (SEQ Buffer A consisted of 0.1% (v/v) in water, Buffer B was 0.1% ID NO: 136) before the ATG start codon, and a Sfil restriction formic acid in acetonitrile. The sample was analyzed using site was added to the 3' end with the sequence 5'- 1% buffer B (in buffer A) for 1 min, followed by a linear 65 GGCCCTGCAGGCC-3' (SEQID NO:137). All of the KARI gradient from 1% buffer Bat 1 minto 75% buffer Bat 1.5 min. genes were synthesized by GenScript USA Inc. (Piscataway, The reaction product, 2,3-dihydroxyisovalerate, was detected N.J.). Each KARI gene was subcloned into pHR81-P- US 9,422,582 B2 75 76 AlsS-Pas-Pf5.Ilv5 vector (SEQ ID NO: 175) via the PmeI TABLE 10-continued and Sfil sites (Ilv5 encodes for yeast ketol-acid reductoi Isobutanol titers and effective productivities from yeast Somerase). This vector contains two expression cassettes: isobutanol production strains carrying various KARI genes Bacillus subtilis acetolactate synthase (AlsS) gene under the measured after 48 h of growth under progressively oxygen yeast CUP1 promoter, and yeast Ilv5 gene controlled by the limited conditions in shake flasks at 30° C. Ilvis promoter. Sequence analysis was performed to confirm SEQID NO: the KARI gene sequences. (nucleic acid, The pHR81-PCUP1-AlsS-P1-KARI vectors carrying amino acid) the KARI genes were co-transformed with plH468 * All nucleic 10 acid seqs (pRS423-P-DHAD-P-kivD-P-ha H1, SEQ except LTS Iso- Effective ID NO: 139) into host strain BP1135 (PNY 1505: Example 8) and S2 are butanol Isobutanol (CEN.pk 113-7D deltaura3:loxP delta his3 delta pdc6 delta KARI codon- titer Productivity pdc1::ilvD.Sm delta pdc5::sadB delta gpd2:loxP delta fra2). clone optimized (g/L) (g/g) Source Organism The yeast transformants were selected on minimum drop-out 15 B3KO2 142, 143 3.5 3.7 Bifidobacterium media plates (SE-Ura-His, 2% ethanol) after 5-7 days at 30° (K2) dentium ATCC 27678 C., and restreaked on SE-Ura-His to obtain cell patches after B3KO9 26, 27 4.3 5.2 Anaerostipes caccae additional 3 day incubation. The cell patches were used for (K9) DSM 14662 shake flask inoculation. B3K2S 375,376 3.6 4.4 Enterococcits (K25) gallinarum EG2 Example 2 B3K26 381,382 4.4 3.2 Streptococci is (“K26) thermophilus LMD-9 B3K29 377,378 4.1 3.3 Lactococci is lactis Screening the KARI Diversity Collection for (K29) Subsp. cremoris Isobutanol Production MG1363 LTS 379,380 2.7 3.1 Lactococci is lactis 25 B3KO7 274,275 3.7 2.8 Cliostridium The various KARI genes were evaluated based on their (“K7) beijerinckii NCIMB “effective productivities' in yeast. The effective productivity 8052 was determined after a certain period of growth under pro S2 276,277 3.6 1.5 Zymomonas mobilis gressively oxygen-limited conditions (e.g. 48 h). The yeast biomass was calculated with the assumption that 1 ODoo of 30 yeast cells is equivalent to 0.3 g/L. Example 3 The yeast isobutanol pathway strains carrying various KARI genes were inoculated into 10 mL SEG-Ura. His media with 0.2% glucose and 0.2% ethanol, and grown aerobically KARI Enzyme Analysis of the Yeast Isobutanol overnight at 30°C., to about 2 OD. The cultures were centri Pathway Strains fuged and a portion of the cells were resuspended in SEG 35 Ura. His (2% glucose, 1% ethanol) to an initial ODoo of 0.4 in IpOHA (N-isopropyl oxalylhydroxamic acid) is a mimic of 25 mL total volume in a 125 mL shake flask. The shake flasks a reaction intermediate for the reaction catalyzed by the were dosed with a screw-on Solid plastid cap, and the cultures KARI enzyme. It is a tight binding inhibitor that binds to the were grown under progressively oxygen-limited conditions active site of the KARI enzyme. The synthesis of IpOHA and in the flask under minimal air and oxygen exchange with the 40 its tight binding to KARI from E. coli is described in literature outside environment. After 48 h incubation at 30° C., 250 (A. Aulabaugh and J. V. Schloss, Biochemistry, 1990, 29. RPM, the cultures were removed for ODo measurement and 2824-2830). Its use for active site titration has not been HPLC analysis to measure isobutanol production. reported before. IpOHA was synthesized from '''C-oxalate From the KARI genes screened, as shown below, multiple according to literature. had comparable or better isobutanol titers than Lactococcus 45 The yeast cultures from Example 2 were harvested and lactis KARI. In particular, the K9 (Anaerostipes caccae DSM analyzed for KARI enzyme activities. 25 mL of the cultures 14662) KARI clone showed a high isobutanol titer and effec was pelleted and resuspended in 10 mL of 50 mM Tris-HCl, tive isobutanol productivity, as measured after 48 h of growth pH 7.5. The cells were centrifuged again to remove the buffer under progressively oxygen-limited conditions (Table 10). and the cell pellets are stored at -70 C. The cell pellets were 50 resuspended in 1 mL of 50 mM Tris-HCl pH 7.5 and soni TABLE 10 cated. Soluble crude cell extracts were used to perform the Isobutanol titers and effective productivities from yeast enzyme assays. A portion of enzyme was incubated with a isobutanol production strains carrying various KARI genes molar excess of "C-IpOHA, and saturating concentrations measured after 48 h of growth under progressively oxygen of NAD(P)H and Mg". Because a reversible, dilution-sensi limited conditions in shake flasks at 30°C. 55 tive complex forms first, extract concentrations were kept high, to favor complexation and thus reduce the time taken for SEQID NO: (nucleic acid, tight complex formation. Because it was not known a priori amino acid) how long it would take each KARI to form the tight complex, * All nucleic two time points were taken for each sample to verify that the acid seqs 60 except LTS Iso- Effective results agree. At the end of the incubation time, Small mol and S2 are butanol Isobutanol ecules were separated from protein molecules by ultrafiltra KARI codon- titer Productivity tion using Microcon R (Millipore Inc., Billerica, Mass.), and clone optimized (g/L) (g/g) Source Organism the high molecular weight fraction was counted. The concen B3KO1 140, 141 2.6 4.1 Bifidobacterium tration of KARI in the sample in either uM or mg/ml was (“K1) angulatum DSM 65 back-calculated from the ''C dpm, the volumes, and the 20098 KARI subunit molecular weight. A fixed-time enzyme assay was run concurrently, and the data were used to calculate US 9,422,582 B2 77 78 U/ml. The specific activity was calculated by dividing U/ml at 68° C. for 25 min more, and then held at 4° C. for later by mg/ml for a given sample. The assumption made was that processing. The PCR reaction was cleaned up using the Zymo full activity and the ability to bind IpOHA are strictly corre DNA clean-up kit (Zymo Research Corporation, Orange lated. The specific activities of the KARI enzymes thus mea Calif., #D4004). DNA was eluted out of membrane using 84 sured are listed in Table 11. The KARI activity in “Units per 5 ul of water. The DNA template was removed with Dpn mg represents the activity per milligram of KARI enzyme as (Promega, Madison Wis., #R6231) at 37°C. for 3 hr (reaction quantitated using the IpOHA assay. Total protein concentra mixture: 10 ul of 10x reaction buffer, 1.0 ul BSA, 6.0 ul of tion was determined by the Bradford method, and the expres Dpn I and 83 ul cleaned PCR DNA). The Dpn Idigested DNA sion level of KARI is calculated by dividing KARI enzyme was cleaned up again with Zymo DNA clean-up kit and amount by the amount of total soluble cellular proteins. 10 digested again with Dpn I to completely remove the DNA template (reaction mixture: 1.5ul of 10x reaction buffer, 0.15 TABLE 11 ul BSA, 0.85 ul of Dpn I and 83 ul cleaned PCR DNA). The reaction mixture was directly used to transform an electro KARI enzyme activities measured by the IPOHA assay competent strain of E. coli Bw25113 (AilvC) (described in 15 KARI, KARI U.S. Pat. No. 8,129,162, which is herein incorporated by KARI activity % total reference in its entirety) using a BioRad Gene Pulser II (Bio clone Umg protein Organism Rad Laboratories Inc., Hercules, Calif.). The transformed clones were streaked on agar plates containing the LB B3KO1 O.S6 21 Bifidobacterium angulatum DSM 20098 B3KO2 0.44 28 Bifidobacterium dentium ATCC 27678 medium and 100 ug/ml amplicillin (Cati L1004, Teknova Inc. B3KO9 2.4 15 Anaerostipes caccae DSM 14662 Hollister, Calif.) and incubated at 37° C. overnight. Clones B3K2S 1.3 21 Enterococcus gallinarum EG2 were screened for activity using NADH. K. for the variants B3K26 1.5 17 Streptococcus thermophilus LMD-9 B3K29 1.6 14 Lactococcus lactis subsp. cremoris MG 1363 was measured (Table 12). LTS O.8 23.0 Lactococcus iactis TABLE 12 25 Kinetic Values for K9 KARI Variants in E. coi Example 4 Extracts, as Determined via DHIV Formation Assays SEQID NO: Construction of a Site-Saturation Gene Library to (nucleic Identify Variants Utilizing NADH with K. Lower 30 acid, amino K (IM) Ka (M) than Wild Type Mutant acid) Mutations (NADH) (NADPH) K9 Wt 26, 27 326 O.2 To construct the pBAD-based bacterial expression vector AB1D1 28, 29 SS6A 164 1 for K9 KARI, the K9 KARI gene (synthesized by Genscript, 49SBS 30, 31 SS6ASS8H 44 4 35 AB1 D3 (also 32, 33 SS6ASS8D 38 9 Piscataway, N.J.) was subcloned into pBAD-ps-JEA1 vector referred to as (SEQID NO:905) via the PmeI and Sfil sites. The ketol-acid “K9D3) reductolsomerase (KARI) from Anaerostipes caccae (called AB1G9 (also 34, 35 SS6ASS8E 47 23 K9-KARI) was used for the library construction. One gene referred to as library was constructed using the commercially available “K9G9) kits, T4 polynucleotide kinase (PNK) (USB Corporation, 40 Cleveland, Ohio, #70031Z) and Chang IT Multiple Mutation Site Directed Mutagenesis Kit (USB Corporation, Cleveland, Example 5 Ohio, #78480). The oligonucleotides (K9 56 58 060210f; GAAG Construction of Site Saturation Gene Libraries to GANNKAAANNKTGGAAGAGAGC, SEQ ID NO: 144: 45 Lower K for NADH and K9 56 58 06021Or: GCTCTCTTCCAMNNTTT MNNTCCTTC, SEQID NO: 145) were synthesized by Inte Based on work with Pseudomonas fluorescens KARI grated DNA Technologies, Inc (Coralville Iowa). They were (PF5-KARI) positions 24, 33, 61, 80, 156 and 170 were first phosphorylated by T4 PNK. In brief. A 30 ul reaction targeted as mutagenesis targets for K9 KARI. Through mul mixture contained: 3.0 ul of 10x T4 PNKbuffer supplied with 50 tiple sequence alignment (MSA) between PF5-KARI and K9 the kit, 4.0 ul of primer (about 35uM), 0.8 ul of 100 mM ATP KARI (FIG.2), the corresponding positions are 30, 39, 67, 86, mix, 0.6 ul T4 PNk and 22 Jul of water. The reaction mixture 162, and 176. was incubated at 37° C. for 1.0 hr and T4 PNK was then To identify more mutagenesis targets, MSA of existing deactivated at 65° C. for 20 min. KARI enzymes (K1, K2, K7, K9, K25, K26, L. Lactis and The phosphorylated primers were then directly used for the 55 S2), determined to produce isobutanol in abutanologen strain subsequent PCR reaction to introduce the mutations at two (see other examples) was used to identify more mutagenesis sites into K9 KARI wild type using the kit. In brief, a 30 ul targets. Positions 41, 87, 131, 191,227, and 246 were selected reaction mixture contained: 3.0 ul of 10x reaction buffer as mutagenesis targets. supplied with the kit, 3.0 ul of phosphorylated forward primer The oligonucleotides targeting positions 30, 39, 41, 67, 86, and reverse primer, 2.0 ul of K9 KARI wild type (50 ng/ul), 60 87, 131, 162, 176, 191, 227, and 246 were commercially 1.2 ul Chang IT enzyme and 17.8 ul of water. This reaction synthesized by Integrated DNA Technologies, Inc (Coralville mixture was placed into thin well 200 ul-capacity PCR tubes Iowa) (Table 13). Eight pairs of oligonucleotides targeting and the following PCR reaction program were used for the positions 30, 67, 131, 162, 176, 191,227, and 246 were used PCR: The starting temperature was 95°C. for 2 min followed to generate Megaprimers using Supermix from Invitrogen by 30 heating/cooling cycles. Each cycle consisted of 95°C. 65 (Catil 10572-014, Invitrogen, Carlsbad, Calif.). For each PCR for 30 sec, 55° C. for 30 sec, and 68° C. for 20 min. At the reaction, a pair of primers, any combination of one forward completion of the temperature cycling, the samples were kept primer and one reverse primer encoding different positions US 9,422,582 B2 79 80 from those eight pairs of oligonucleotides (e.g. perature was 95°C. for 30 sec followed by 25 heating/cooling K9 30 101110f and K9 67 101110r), were used. There are cycles. Each cycle consisted of 95°C. for 30 sec, 55° C. for 1 total Ps, or 56 combinations. A 25ul reaction mixture con min, and 68°C. for 6 min. At the completion of the tempera tained: 22.5ul of Supermix solution, 1.0 ul of forward primer ture cycling, the samples were kept at 68°C. for 8 min more, and then held at 4°C. for later processing. The PCR reaction and 1.0 ul of reverse primer, 0.5ul of AB1D3 DNA template mixture was processed with Dpn I restriction enzyme same as (50 ng/ul). The mixture was placed in a thin well 200 ul tube that used in Example 4. for the PCR reaction in a Mastercycler gradient equipment The oligonucleotides K9 37&39 101110?, (Brinkmann Instruments, Inc. Westbury, N.Y.). The following K9 37&39 101110r and K9 86&87 101110f, conditions were used for the PCR reaction: The starting tem K9 86&87 101110r were directly then used to generate gene perature was 95° C. for 1.0 min followed by 35 heating/ 10 libraries using the QuickChange II XL site directed mutagen cooling cycles. Each cycle consisted of 95°C. for 20 sec, 55° esis kit. Two 25 d reaction mixtures for the two oligonucle C. for 20 sec, and 72°C. for 1.0 min. At the completion of the otide sets, each 25ul reaction mixture contained: 2.5ul of 10x temperature cycling, the samples were kept at 72°C. for 2.0 reaction buffer, 1.0 ul of 50 ng/ul template, 1.0 ul of forward min more, and then held awaiting sample recovery at 4°C. 15 primer, 1.0 ul reverse primer, 0.5ul of 40 mM dNTP mix, 0.5 The PCR product was cleaned up using a DNA cleaning kit ulpfu-ultra DNA polymerase and 18.5 ul of water. The PCR (Cati D4003, Zymo Research, Orange, Calif.) as recom program and the Subsequent Dpn I processing are the same. mended by the manufacturer. The Dpn I processed DNA mixture was cleaned up using The Megaprimers were then used to generate gene libraries Zymo DNA clean-up kit following the manufacturers proto using the QuickChange II XL site directed mutagenesis kit col. The cleaned-up DNA was used to transform an electro (Catalog #200524, Stratagene, La Jolla Calif.). A 25ul reac competent strain of E. coli Bw25113 (AilvC) using a BioRad tion mixture contained: 2.5ul of 10x reaction buffer. 1.0 ul of Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, Calif.). 50 ng/ul template, 20.5 of Megaprimer, 0.5 of 40 mM dNTP The transformed clones were streaked on agar plates contain mix, 0.5 ul pfu-ultra DNA polymerase. Except for the ing the LB medium and 100 ug/ml amplicillin (Catil 1004, Megaprimer and the templates, all reagents used here were 25 Teknova Inc. Hollister, Calif.) and incubated at 37° C. over supplied with the kit indicated above. This reaction mixture night. Clones were screened for improved activity using was placed in a thin well 200 ul-capacity PCR tube and the NADH. K. for the improved mutants was measured (Table following reactions were used for the PCR: The starting tem 14). TABLE 1.3

Primers Targeted position (s) of K9-KARI Primers 3O K9 30 101110 f: gacitat cqc.cgittatcggtNNKggttct caaggtoac SEQ ID NO: 146 K9 30 101110r: GTGACCTTGAGAACCMNNACCGATAACGGCGATAGTC SEQ ID NO: 147 67 K9 67 101110 f: gagctgaagaacaaggtNNKgaagt ctacaccgctgc SEQ ID NO: 148 K9 67 10111or: GCAGCGGTGTAGACTTCMNNACCTTGTTCTTCAGCTC SEQ ID NO: 149 131 K9 131 10 Of: caaaggacgttgatgtcNNKatgatcgcticcaaag SEQ ID NO: 150 K9 131 10 Or: CTTTGGAGCGATCATMNNGACATCAACGTCCTTT SEO ID NO : 151 162 K9 162 10 Of: gotgtcgaacaagacNNKactggcaaggctittg SEQ ID NO: 152 K9 162 10 Or: CAAAGCCTTGCCAGTMNNGTCTTGTTCGACAGC SEO ID NO: 153 176 K9 176 10 Of: gotttggcc tacgctttalNNKatcggtggtgctagagc SEQ ID NO : 154 K9 176 10 Or: GCTCTAGCACCACCGATMNNTAAAGCGTAGGCCAAAGC SEO ID NO : 155 191 K9 191 10 Of: gaaactacctt cagaNNKgaaactgaaaccogac SEQ ID NO: 156 K9 191 10 or ; GTCGGTTTCAGTTTCMNNTCTGAAGGTAGTTTC SEQ ID NO: 157 227 K9 227 10 Of: go cqgttacgacc caNNKaacgct tact tcgaatg SEQ ID NO: 158 K9 227 10 Or : CATTCGAAGTAAGCGTTMNNTGGGTCGTAACCGGC SEO ID NO : 159 246 K9 246 10 Of: gttgacttgat ctacNNKtotggitttct cogg tatgc SEQ ID NO: 160 K9 246 10 Or: GCATACCGGAGAAACCAGAMNNGTAGATCAAGTCAAC SEQ ID NO: 161 39, 41 K9 37&39 10111 of: gttct caaggtoacgctNNKgccNNKaatgctaaggaatcc SEQ ID NO: 162 K9 37&39 10111or: GGATTCCTTAGCATTMNNGGCMNNAGCGTGACCTTGAGAAC SEQ ID NO: 163 86, 87 K9 86&87 10111 of: gacat cattatgatcttgNNKNNKgatgaaaag caggc SEQ ID NO: 164 K9 86&87 10111or: GCCTGCTTTTCATCMNNMNNCAAGATCATAATGATGTC SEQ ID NO: 165

65 US 9,422,582 B2 81 82 TABLE 1.4 processing. The PCR reaction was cleaned up using the Zymo DNA clean-up kit (Zymo Research Corporation, Orange List of some mutants with their measured Ka values Calif., #D4004). DNA was eluted out of membrane using 84 SEQID NO: ul of water. The DNA template was removed with Dpn I (nucleic 5 (Promega, Madison Wis., #R6231) at 37°C. for 3 hr (reaction acid, amino Ka (M) KA (IM) mixture: 10 ul of 10x reaction buffer, 1.0 ul BSA, 6.0 of Dpn Mutant acid) Mutations (NADH) (NADPH) I and 83 ul cleaned PCR DNA). The Dpn Idigested DNA was AO7A9 38, 39 SS6ASS8D, I86TN87P 15 7 cleaned up again with Zymo DNA clean-up kit and digested AO7BS 36,37 SS6ASS8D, I86VN87P 8 4 AO7H8 40, 41 SS6ASS8DN87P 8 6 10 again with Dpn I to completely remove the DNA template AO7D8 42, 43 SS6ASS8D, T13 1C: 26 6 (reaction mixture: 1.5 ul of 10x reaction buffer, 0.15ul BSA, T191S 0.85ul of Dpn I and 83 ul cleaned PCR DNA). AO7F7 44, 45 SS6ASS8D, T131W 28 7 T191A The Dpn I processed DNA mixture was cleaned up using AO7H7 46,47 SS6ASS8D, T191S 29 8 Zymo DNA clean-up kit following the manufacturer's proto 15 col. The cleaned-up DNA was used to transform an electro competent strain of E. coli Bw25113 (AilvC) using a BioRad Example 6 Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, Calif.). The transformed clones were streaked on agar plates contain Construction of a Combinatorial Library to Lower ing the LB medium and 100 ug/ml amplicillin (Catil 1004, K or NADH 2O Teknova Inc. Hollister, Calif.) and incubated at 37° C. over night. Clones were screened for improved activity using Based on the mutagenesis results (Example 4), T131L, NADH, K for the improved mutants was measured (Table T131A, T131W, T131M, T13 1C, T191D, T191C, T191S, and 16). TABL E 15 Primers for example 6 Targeted position (s) of K9-KARI Primers 131 K9 131L. 112210 f: ggacgttgatgtcTTGatgat cqctcc SEQ ID NO: 166 K9 131A 112210 f: gaacgttgatgtcGCAatgatcgctcc SEQ ID NO: 167 K9 131V 112210 f: ggacgttgatgtcGTTatgat cqctcc SEQ ID NO: 168 K9 131M 112210 f: ggacgttgatgtcATGatgat cqctcc SEQ ID NO: 169 K9 13 1C 112210 f: ggacgttgatgtcTGAatgat cqctcc SEQ ID NO: 170 191 K9 191D 11221or: GGTTTCAGTTTCGTCTCTGAAGGTAGTTTC SEQ ID NO: 171 K9 191C 11221or: GGTTTCAGTTTCGCCTCTGAAGGTAGTTTC SEQ ID NO: 172 K9 191S 11221or: GGTTTCAGTTTCCGATCTGAAGGTAGTTTC SEQ ID NO: 173 K9 191G 11221or: GGTTTCAGTTTCGCCTCTGAAGGTAGTTTC SEQ ID NO: 174

T191G are considered as beneficial mutations to improve K. TABLE 16 for NADH. A combinatorial library to introduce these ben eficial mutations into AO7B5 was made. List of some mutants with their measured K values All oligonucleotides were synthesized by the Integrated 45 DNA Technologies, Inc (Coralville Iowa). They were first sigt No. phosphorylated by T4 PNK. In brief, a 20 ul reaction mixture acid, amino Ka (M) KA (IM) contained: 2.0 ul of 10x T4 PNKbuffer supplied with the kit, Mutant acid) Mutations (NADH) (NADPH) 2.85 of primer (about 35uM, 0.6 ul of 100 mM ATP mix, 0.4 ul T4 PNK and 14.15 ul of water. The reaction mixture was 50 AWB9 52, 53 S56A/S58D/I86V/N87P/ 10 4 incubated at 37° C. for 1.0 hr and T4 PNK was then deacti- T131A vated at 65°O C. for 20 min. AWC1 54, 55 T131VS56A/S58D/I86V/N87P/ 9 3 The phosphorylated primers were then directly used for the AWD6 62. 63 SS6ASS8D, I86VN87P 5 2 subsequent PCR reaction to introduce the mutations at two s T131VT191S sites into AO7B5 using the kit. In brief, a 50 reaction mixture 55 AWD10 64, 65 S56A/S58D/I86V/N87P/ 8 3 contained: 5.0 ul of 10x reaction buffer supplied with the kit, T131AT191C 2.5 of phosphorylated forward primer (0.5ul of each forward AWF4 56, 57 S56A/S58D/I86V/N87P/ 7 3 primer shown in Table 15), 2.5 ul reverse primer (0.625 of N107 ST131V each forward primer shown at Table 15), 2.5 of A07B5 (50 AWF6 58, 59 S56A/S58D/I86V/N87P/ 7 2 ngful), 2.5 Chang IT enzyme and 35ul of water. This reaction 60 T131VT191D mixture was placed into thin well 200 ul-capacity PCR tubes AWG4 50, 51 ss 58DI86VN87P/ 7 3 and the following PCR reaction program were used for the AWEH3 60, 61 SS6ASS8D, I86VN87P 6 2 PCR: The starting temperature was 95°C. for 2 min followed s T131VT191G by 30 heating/cooling cycles. Each cycle consisted of 95°C. AS.6F1 48, 49 S56A/S58D/I86V/N87P/ 4 1 for 30 sec, 55° C. for 30 sec, and 68° C. for 20 min. At the 65 T131MT191G completion of the temperature cycling, the samples were kept at 68° C. for 25 min more, and then held at 4° C. for later US 9,422,582 B2 83 84 Example 7 pH 5.5, thiamine 30 mg/L, nicotinic acid 30 mg/L). A calcu lated amount of cells were transferred to 45 mL total volume Isobutanol Production from K9 KARI Variants of the same media for a starting OD=0.2 in a 60 mL serum vial, with the top closed tightly by a crimper. This step was The following variants of K9 KARI were generated as 5 done in the regular bio-hood in air. The serum vials were described above. incubated at 300, 200 rpm for 2 days. At 48 h, the samples were removed for OD and HPLC analysis of glucose, isobu TABLE 17 tanol and pathway intermediates. 24h samples were taken in an anaerobic chamber to maintain the anaerobic condition in KARI variants and the corresponding yeast expression vectors 10 the serum vials. In the initial phase of the 48 h incubation, the Amino air present in the head space (~15 mL) and the liquid media is Nucleotide Point Acid consumed by the growing yeast cells. After the oxygen in the Clone Yeast Vector Mutation Locations Mutation head space is consumed, the culture becomes anaerobic. Names Name 166 168 172 173 174 Positions 15 Therefore this experiment includes switching condition from WT K9 pHR81-PIlv5- T T T C C S56, S58 aerobic to oxygen limiting and anaerobic conditions. KARI, KARI-K9 Of the four K9 variants, AB1 G9 and AB1D3 produced AB1G9 pHR81-PIlv5- G G G A. G S56A, relatively high isobutanol titers, while 495B5 and AB1D1 KARI-K9.G.9 S58E have lower titer. Wild type K9 KARI strain produced the 495 B5 pHR81-PIlv5- G T C A. T S56A, KARI-K9.B5 SS8H 2O lowest titer. While not wishing to be bound by theory, it is AB1D3 pHR81-PIlv5- G T G A. T S56A, believed that the lower titer is due to the shifted balance of KARI-K9.D3 SS8D NADH and NADPH when cells are Switched from aerobic to AB1 D1 pHR81-PIlv5- G T T C C SS6A KARI-K9.D1 anaerobic conditions. By this rationale, under anaerobic con ditions, NADH concentration and availability increased sig 25 nificantly, favoring the variant KARI enzymes that use The yeast expression plasmids were made by Subcloning of NADH. Based on the kinetic analysis, AB1G9 (“K9G9') and the variant KARI genes from E. coli vectors (p3AD.KARI) AB1D3 (“K9D3') mutants have relatively high K for into pHR81-PIlv5-PfS.KARI vector plH556 (FIG. 4, SEQ NADPH (23 & 9.2 uM), in addition to their relative low K. ID NO: 138) at PmeI and Sfil sites. Yeast pathway strains for NADH (47 & 38 uM). As comparison, 495B5 and were made in PNY2204 host (MATa ura3A:loxP his3A 30 AB1D1’s K’s are 2.5 and 1.1 uM respectively for NADPH, pdc6A pdc1A::PPDC1-DHADilvD Sm-PDC1t-pUC19 and wt K9's K is 0.10 uM. The low NADH K of AB1G9 loxP-kanMX-loxP-PFBA1-ALS alsS BS-CYC1t pdc5A: and AB1D3, together with the high NADPH K of AB1 G9 PPDC5-ADHIsadB Ax-PDC5t gpd2A:loxP fra2A and AB1D3 may have led to reduced NADPH utilization adh1A::UAS(PGK1)PFBA1-kivD Ll(y)-ADH1t; Example under anaerobic conditions, and relatively high NADH utili 13) by co-transforming the KARI vectors as pathway plasmid 35 zation. As evidence, AB1G9 and AB1 D3 have lower glycerol #1, and pBP915 (pRS423-P-DHAD-P-haDH1; accumulation (isobutanol:glycerol-3.3) compared to 495B5 SEQ ID NO: 182) as pathway plasmid #2. Transformants and AB1D1 (2-3). The isobutanol:glycerol ratio is for the wild were patched to the same medium containing 2% glucose and type K9 is 1:1 under the same switched aerobic to anaerobic 0.1% ethanolas carbon sources. Three patches were tested for condition. TABLE 1.8 Kinetic properties of wild type and variant K9 KARI enzymes, and isobutanol tilter and productivity measured from aerobic to anaerobic Switch experiment in serum vials. Effective NADPH NADH Isobutanol Clone KM Vmax KM V. Isobutanol Productivity Names (NADPH) (U/mg) (NADH) (Umg) g/L (gg cells) O.19 2.0 326 1.5 O.9 3.1 23 2.4 47 2.0 3.4 1O.S 3.5 2.5 44 1.9 2.2 9.2 9.2 2.1 38 1.9 3.3 10.8 1.1 2.8 164 2.1 2.3 9.5

55 isobutanol production under microaerobic conditions in Example 8 serum vials. A done that was transformed with pBP915 and the plH702 plasmid which expresses K9D3 was designated Construction of Saccharomyces cerevisiae Strains PNY 1910. BP1135 (PNY1505) and PNY1507 and Yeast colonies from the transformation on SE-Ura-His 60 Isobutanol-Producing Derivatives plates appeared after 5-7 days. The colonies were patched onto fresh SE-Ura-His plates, incubate at 30° C. for 3 days. This example describes construction of Saccharomyces The patched cells were inoculated into 25 mL SEG-Ura.His cerevisiae Strains BP1135 and PNY 1507. These Strains were media with 0.2% glucose and 0.2% ethanol and grown aero derived from PNY 1503 (BP1064). PNY 1503 was derived bically for 1-2 days at 30° C., to 2-30D. The cells were 65 from CEN.PK 113-7D (CBS 8340; Centraalbureau voor centrifuged and re-suspended in 1 mL of SEG-Ura. His media Schimmelcultures (CBS) Fungal Biodiversiry Centre, Neth (2% glucose, 0.1% ethanol, 10 mg/L ergosterol, 50 mMMES, erlands). BP1135 contains an additional deletion of the FRA2 US 9,422,582 B2 85 86 gene. PNY 1507 was derived from BP1135 with additional products were purified on an agarose gel followed by a Gel deletion of the ADH1 gene, with integration of the kiv) gene Extraction kit (Qiagen). The FRA2 ABUC cassette was cre from Lactococcus lactis, codon optimized for expression in ated by overlapping PCR by mixing FRA2 Fragment AB and Saccharomyces cerevisiae, into the ADH1 locus. FRA2 Fragment UC and amplifying with primers oBP594 Deletions/integrations were created by homologous 5 (SEQ ID NO:183 and oBP601 (SEQ ID NO:190). The PCR recombination with PCR fragments containing regions of product was purified with a PCR Purification kit (Qiagen). homology upstream and downstream of the target gene and Competent cells of PNY 1503 were made and transformed the URA3 gene for selection of transformants. The URA3 with the FRA2ABUCPCR cassette using a Frozen-EZYeast gene was removed by homologous recombination to create a Transformation II kit (Zymo Research; Orange, Calif.). Scarless deletion/integration. 10 Transformation mixtures were plated on synthetic complete The Scarless deletion/integration procedure was adapted media lacking uracil supplemented with 1% ethanol at 30°C. from Akada et al., Yeast, 23:399, 2006. In general, the PCR Transformants with a fra2 knockout were screened for by cassette for each deletion/integration was made by combining PCR with primers oBP602 (SEQ ID NO:191) and oBP603 four fragments, A-B-U-C, and the gene to be integrated by (SEC) ID NO:192) using genomic DNA prepared with a cloning the individual fragments into a plasmid prior to the 15 Gentra Puregene Yeast/Bact kit (Qiagen). A correct transfor entire cassette being amplified by PCR for the deletion/inte mant was grown in YPE (yeast extract, peptone, 1% ethanol) gration procedure. The gene to be integrated was included in and plated on synthetic complete medium containing the cassette between fragments A and B. The PCR cassette 5-fluoro-orotic acid (0.1%) at 30°C. to select for isolates that contained a selectable/counter-selectable marker, URA3 lost the URA3 marker. The deletion and marker removal were (Fragment U), consisting of the native CEN.PK 113-7D confirmed by PCR with primers oBP602 (SEQ ID NO:191) URA3 gene, along with the promoter (250 bp upstream of the andoBP603 (SEQID NO:192) using genomic DNA prepared URA3 gene) and terminator (150 bp downstream of the with a Gentra Puregene Yeast/Bact kit (Qiagen). The absence URA3 gene) regions. Fragments A and C (each approxi of the FRA2 gene from the isolate was demonstrated by a mately 100 to 500 bp long) corresponded to the sequence negative PCR result using primers specific for the deleted immediately upstream of the target region (Fragment A) and 25 coding sequence of FRA2, oBP605 (SEQ ID NO.193) and the 3' sequence of the target region (Fragment C), Fragments oBP606 (SEQID NO:194). The correct isolate was selected A and C were used for integration of the cassette into the as strain CEN.PK 113-7D MATaura3A:loxP his3A pdc6A chromosome by homologous recombination. Fragment B pdc1A::PPDC1-DHADilvD Sm-PDC1t pdc5A::P (500 bp long) corresponded to the 500 bp immediately down PDC5-ADHisadB Ax-PDC5tgpd2A:loxP fra2A and des stream of the target region and was used for excision of the 30 ignated as PNY 1505 (BP1135). URA3 marker and Fragment C from the chromosome by This strain was transformed with isobutanol pathway plas homologous recombination, as a direct repeat of the sequence mids (pYZ090, SEQID NO: 195) and pLH468 (SEQID NO: corresponding to Fragment B was created upon integration of 139), and one clone was designated BPI 168 (PNY1506). the cassette into the chromosome. pYZ090 (SEQ ID NO: 195) was constructed to contain a FRA2 Deletion 35 chimeric gene having the coding region of the als.S gene from The FRA2 deletion was designed to delete 250 nucleotides Bacillus subtilis (nt position 457-2172) expressed from the from the 3' end of the coding sequence, leaving the first 113 yeast CUP1 promoter (nt 2-449) and followed by the CYC1 nucleotides of the FRA2 coding sequence intact. An in-frame terminator (nt 2181-2430) for expression of ALS, and a chi stop codon was present 7 nucleotides downstream of the meric gene having the coding region of the ilvC gene from deletion. The four fragments for the PCR cassette for the 40 Lactococcus lactis (nt 3634-4656) expressed from the yeast starless FRA2 deletion were amplified using Phusion High ILV5 promoter (2433-3626) and followed by the ILV5 termi Fidelity PCR Master Mix (New England BioLabs: Ipswich, nator (nt 4682-5304) for expression of KARI. Mass.) and CEN.PK 113-7D genomic DNA as template, pre ADH1 Deletion and kiv D Ll(y) Integration pared with a Gentra Puregene Yeast/Bact kit (Qiagen; Valen The ADH1 gene was deleted and replaced with the kiv) cia, Calif.). FRA2 Fragment A was amplified with primer 45 coding region from Lactococcus lactis codon optimized for oBP594 (SEQID NO: 183) and primeroBP595 (SEQID NO: expression in Saccharomyces cerevisiae. The Scarless cas 184), containing a 5' tail with homology to the 5' end of FRA2 sette for the ADH1 deletion-kivD L1(y) integration was first Fragment B. FRA2 Fragment B was amplified with primer cloned into plasmid puC19-URA3MCS, as described in U.S. oBP596 (SEQID NO:185), containing a 5' tail with homol Apple. No. 61/356,379, filed Jun. 18, 2010, incorporated ogy to the 3' end of FRA2 Fragment A, and primer oBP597 50 herein by reference. The vector is puC19 based and contains (SEQID NO:186), containing a 5' tail with homology to the the sequence of the URA3 gene from Saccharomyces cerevi 5' end of FRA2 Fragment U. FRA2 Fragment U was ampli siae CEN.PK 113-7D situated within a multiple cloning site fied with primer oBP598 (SEQID NO: 187), containing a 5' (MCS), puC19 contains the pMB1 replicon and a gene cod tail with homology to the 3' end of FRA2 Fragment B, and ing for beta-lactamase for replication and selection in primer oBP599 (SEQID NO: 188), containing a 5' rail with 55 Escherichia coli. In addition to the coding sequence for homology to the 5' end of FRA2 Fragment C. FRA2 Fragment URA3, the sequences from upstream (250 bp) and down C was amplified with primer oBP600 (SEQ ID NO:189), stream (150 bp) of this gene are present for expression of the containing a 5' tail with homology to the 3' end of FRA2 URA3 gene in yeast. The vector can be used for cloning Fragment U, and primer oBP601 (SEQ ID NO:190). PCR purposes and can be used as a yeast integration vector. products were purified with a PCR Purification kit (Qiagen). 60 The kiv) coding region from Lactococcus lactic codon FRA2 Fragment AB was created by overlapping PCR by optimized for expression in Saccharomyces cerevisiae was mixing FRA2 Fragment A and FRA2 Fragment Band ampli amplified using plH468 (SEQID NO:139) as template with fying with primers oBP594 (SEQ ID NO:183) and oBP597 primeroBP562 (SEQID NO:197), containing a PmeI restric (SEQID NO:186). FRA2 Fragment UC was created by over tion site, and primer oBP563 (SEQID NO:198), containing a lapping PCR by mixing FRA2 Fragment U and FRA2 Frag 65 5' tail with homology to the 5' end of ADH1 Fragment B. ment C and amplifying with primers oBP598 (SEQ ID ADH1 Fragment B was amplified from genomic DNA pre NO:187) and oBP601 (SEQID NO:190). The resulting PCR pared as above with primer oBP564 (SEQID NO:199), con US 9,422,582 B2 87 88 taining a 5' tail with homology to the 3' end of kiv) L1(y), and pWS358-FBA1p-GUS. The pWS358-PGK1 p-GUS plasmid primer oBP565 (SEQID NO:200), containing a Fsel restric was generated by inserting a PGK1p and beta-glucuronidase tion site. PCR products were purified with a PCR Purification gene (GUS) DNA fragments into multiple cloning site of kit (Qiagen). kiv) L1(y)-ADH1 Fragment B was created by pWS358, which was derived from pRS423 vector (Christian overlapping PCR by mixing the kiv) Lloy) and ADH1 Frag son et al., Gene, 110:119-122, 1992). Secondly, the resulting ment B PCR products and amplifying with primers oBP562 pWS358-FBA1p-GUS plasmid was digested with SalI and (SEQ ID NO:197) and oBP565 (SEQ ID NO:200). The SacI, a DNA fragment containing a FBA1p promoter, GUS resulting PCR product was digested with PmeI and FseI and gene, and FBAt terminator gel-purified, and cloned into SalI/ ligated with T4 DNA ligase into the corresponding sites of SacI sites on pRS316 to create pRS316-FBA1p-GUS. pUC19-URA3MCS after digestion with the appropriate 10 Thirdly, a 118 bp DNA fragment containing an upstream enzymes. ADH1 Fragment A was amplified from genomic activation sequence (UAS) located between positions -519 DNA with primer oBP505 (SEQ ID NO:201), containing a and -402 upstream of the3-phosphoglycerate kinase (PGK1) SacI restriction site, and primer oBP506 (SEQID NO:202), open reading frame, namely UAS(PGK1), was PCR-ampli containing an AscI restriction site. The ADH1 Fragment A fied from genomic DNA of CEN.PK with primers T-U/PGK1 PCR product was digested with SacI and AscI and ligated 15 (KpnI) (SEQ ID NO:770) and B-U/PGK1(Sall) (SEQ ID with T4DNA ligase into the corresponding sites of the plas NO:771). The PCR product was digested with KpnI and Sal I mid containing kiv) L1(y)-ADH1 Fragment B. ADH1 Frag and cloned into KpnI/SalI sites on pRS316-FBA 1 p-GUS to ment C was amplified from genomic DNA with primer create pRS316-UAS(PGK1)-FBA1p-GUS. oBP507 (SEQID NO:203), containing a Padrestriction site, and primer oBP508 (SEQ ID NO:204), containing a Sal I Example 9 restriction site. The ADH1 Fragment C PCR product was digested with Pad and SalI and ligated with T4 DNA ligase Improved Recombinant Host Cells Comprising into the corresponding sites of the plasmid containing ADH1 Elimination of ALD6 Fragment A-kivD L1(y)-ADH1 Fragment B. The hybrid pro moter UAS(PGK1)-P was amplified from vector 25 The purpose of this example is to describe methods to pRS316-UAS(PGK1)-P-GUS (SEQ ID NO:209) with modify a yeast host strain for improved production of isobu primeroBP674 (SEQID NO:205), containing an AscI restric tanol. These modifications include integration of genes tion site, and primer oBP675 (SEQID NO:206), containing a encoding isobutyraldehyde reductase activity and elimina PmeI restriction site. The UAS(PGK1)-P, PCR product tion of the native genes ALD6 and YMR226C, encoding was digested with AscI and PmeI and ligated with T4 DNA 30 NADP+-dependent acetaldehyde dehydrogenase and a ligase into the corresponding sites of the plasmid containing NADPH-dependent dehydrogenase, respectively. kivD Ll(y)-ADH1 Fragments ABC. The entire integration Construction of S. cerevisiae Strain PNY 2211 cassette was amplified from the resulting plasmid with prim PNY2211 was constructed in several steps from S. cerevi ers oBP505 (SEQ ID NO:201) and oBP508 (SEQ ID siae strain PNY 1507 (Example 8) as described in the follow NO:204) and purified with a PCR Purification kit (Qiagen). 35 ing paragraphs. First PNY 1507 was modified to contain a Competent cells of PNY 1505 were made and transformed phosophoketolase gene. Next, an acetolactate synthase gene with the ADH1-kivD Ll(y) PCR cassette constructed above (alsS) was added to the strain, using an integration vector using a Frozen-EZ Yeast Transformation H kit (Zymo targeted to sequences adjacent to the phosphokeloase gene. Research). Transformation mixtures were plated on synthetic Finally, homologous recombination was used to remove the complete media lacking uracil Supplemented with 1% ethanol 40 phosphoketolase gene and integration vector sequences, at 30°C. Transformants were grown inYPE (1% ethanol) and resulting in a starless insertion of alss in the intergenic region plated on synthetic complete medium containing 5-fluoro between pdc1A::ilvD (described in Example 12) and the orotic acid (0.1%) at 30° C. to select for isolates that lost the native TRX1 gene of chromosome XII. The resulting geno URA3 marker. The deletion of ADH1 and integration of type of PNY2211 is MATaura3A:loxPhis3A pdc6A pdc1A: kivD Ll(y) were confirmed by PCR with external primers 45 PPDC1-DHADlilvD Sm-PDC1t-PFBA 1 oBP495 (SEQ ID NO:207) and oBP496 (SEQ ID NO:208) ALSlalsS BS-CYC1t pdc5A::PPDC5-ADHI sadB Ax and with kivD L1(y) specific primer oBP562 (SEQ ID PDC5t gpd2A:loxP fra2A adh1A::UAS(PGK1)PFBA 1 NO:197) and external primer oBP496 (SEQ ID NO:208) kivD Ll(y)-ADH1t. using genomic DNA prepared with a Gentra Puregene Yeast/ A phosphoketolase gene cassette was introduced into Bact kit (Qiagen). The correct isolate was selected as strain 50 PNY 1507 by homologous recombination. The integration CEN.PK 113-7D MATaura3A::loxP his3A pdc6A pdc1A::P construct was generated as follows. The plasmid pRS423:: PDC1-DHADlilvD Sm-PDC1 tpdc5A::PPDC5 CUP1-alsS+FBA-budA (previously described in US2009/ ADHIsadB Ax-PDC5t gpd2A::loxP fra2A adh1A::UAS 0305363, which is herein incorporated by reference in its (PGK1)PFBA 1-kivD L1(y)-ADH1t and designated as entirety) was digested with NotI and Xmal to remove the 1.8 PNY 1507 (BP1201). PNY 1507 was transformed with isobu 55 kb FBA-budA sequence, and the vector was religated after tanol pathway plasmids pYZ090 (SEQ ID NO:195) and treatment with Klenow fragment. Next, the CUP1 promoter pBP915 (SEQ ID NO: 182) and the resultant strain was was replaced with a TEF1 promoter variant (M4 variant pre named PNY 1513. viously described by Nevoigt et al. Appl. Environ, Microbiol. Construction of the pRS316-UAS(PGK1)-FBA1p-GUS Vec 72: 5266-5273 (2006), which is herein incorporated by ref tOr 60 erence in its entirety) via DNA synthesis and vector construc To clonea cassette UAS(PGK1)-FBA1p (SEQID NO:766, tion service from DNA2.0 (Menlo Park, Calif.). The resulting first a 602 bp FBA1 promoter (FBA1p) was PCR-amplified plasmid, pRS423::TEF(M4)-alsS was cut with StuI and Mlul from genomic DNA of CEN.PK with primers T-FBA1(Sall) (removes 1.6 kb portion containing part of the alss gene and (SEQID NO:767) and B-FBA1(SpeI) (SEQID NO:768), and CYC1 terminator), combined with the 4 kb PCR product cloned into SalI and Spel sites on the plasmid pWS358 65 generated from pRS426::GPD-xpk1+ADH-eutD (SEQ ID PGK1p-GUS (SEQ ID NO:769) after the PGK1p promoter NO:383) with primers N1176 (SEC) ID NO:282) and N1177 was removed with a SalI/Spel digest of the plasmid, yielding (SEQID NO:283) and an 0.8 kb PCR product DNA (SEQID US 9,422,582 B2 89 90 NO: 284) generated from yeast genomic DNA (ENO1 pro PNY2218 was treated with Crerecombinase and the result moter region) with primers N822 (SEQ ID NO:285) and ing clones were screened for loss of thexpk1 gene and pUC19 N1178 (SEQID NO:286) and transformed into S. cerevisiae integration vector sequences by PCR (primers N886 (SEQID strain BY4741 (ATCC #201388); gap repair cloning method NO: 211) and N160SeqR5 (SEQID NO:388)). This left only ology, see Ma et al. Gene 58:201-216 (1987). Transformants the alss gene integrated in the pdc1-TRX1 intergenic region were obtained by plating cells on synthetic complete medium after recombination the DNA upstream of xpk1 and the without histidine. Proper assembly of the expected plasmid homologous DNA introduced during insertion of the integra (pRS423:TEF(M4)-xpk1+ENO1-eutlD, SEQ ID NO:293) tion vector (a 'scarless' insertion since vector, marker gene was confirmed by PCR (primers N821 (SEQID NO:287) and and loXP sequences are lost). Although this recombination N1115 (SEQ ID NO:288)) and by restriction digest (BgII). 10 could have occurred at any point, the vector integration Two clones were subsequently sequenced. The 3.1 kb TEF appeared to be stable even without geneticin selection and the (M4)-xpk1 gene was isolated by digestion with SacI and NotI recombination event was only observed after introduction of and cloned into the puC19-URA3::ilvD-TRX1 vector (Clone the Cre recombinase. One clone was designated PNY2211. A, cut with AflII). Cloning fragments were treated with Kle An isolate of PNY 2218 containing the plasmids now fragment to generate blunt ends for ligation. Ligation 15 pYZ090AalsS and pBP915 was designated PNY2209. reactions were transformed into E. coli Stb13 cells, selecting PNY 1528 (hADH Integrations in PNY2211) for amplicillin resistance. Insertion of TEF (M4)-xpk1 was Deletions/integrations were created by homologous confirmed by PCR (primers N1110 (SEQ ID NO:367) and recombination with PCR products containing regions of N1114 (SEQ ID NO:290)). The vector was linearized with homology upstream and downstream of the target region and AflII and treated with Klenow fragment. The 1.8 kb KpnI the URA3 gene for selection of transformants. The URA3 HincII geneticin resistance cassette (SEQ ID NO: 384) was gene was removed by homologous recombination to create a cloned by ligation after Klenow fragment treatment. Ligation Scarless deletion/integration. reactions were transformed into E. coli Stb13 cells, selecting YPRCA15 Deletion and Horse Liver adh Integration for amplicillin resistance. Insertion of the geneticin cassette The YPRCA15 locus was deleted and replaced with the was confirmed by PCR (primers N160SeqF5 (SEQ ID 25 horse liver adh gene, codon optimized for expression in Sac NO:210) and BK468 (SEQ ID NO:368)). The plasmid charomyces cerevisiae, along with the PDC5 promoter region sequence is provided as SEQ ID NO: 291 (pUC19-URA3:: (538 bp) from Saccharomyces cerevisiae and the ADH1 ter pdc1::TEF (M4)-xpk1::kan). minator region (316 bp) from Saccharomyces cerevisiae. The The resulting integration cassette (pdc1::TEF(M4)-xpk1:: scarless cassette for the YPRCA15 deletion-PPDC5 KanMX::TRX1) was isolated (AscI and Nael digestion gen 30 adh HL(y)-ADH1t integration was first cloned into plasmid erated a 5.3 kb band that was gel purified) and transformed pUC19-URA3MCS (described in Example 8). into PNY 1507 using the Zymo Research Frozen-EZ Yeast Fragments A-B-U-C were amplified using Phusion High Transformation Kit (Cat. No. T2001). Transformants were Fidelity PCR Master Mix (New England BioLabs: Ipswich, selected by plating onYPE plus 50 ug/ml G418. Integration at Mass.) and CEN.PK 113-7D genomic DNA as template, pre the expected locus was confirmed by PCR (primers N886 35 pared with a Gentra Puregene Yeast/Bact kit (Qiagen; Valen (SEQ ID NO:211) and N1214 (SEQ ID NO:281)). Next, cia, Calif.). YPRCA 15 Fragment A was amplified from plasmid pRS423::GAL1p–Cre (SEQ ID NO:271), encoding genomic DNA with primer oBP622 (SEQID NO: 212), con Cre recombinase, was used to remove the loXP-flanked taining a KpnI restriction site, and primer oBP623 (SEQ ID KanMX cassette. Proper removal of the cassette was con NO: 213), containing a 5' tail with homology to the 5' end of firmed by PCR (primers oBP512 (SEQ ID NO:337) and 40 YPRCA15 Fragment B.YPRCA15 Fragment B was amplified N160SeqF5 (SEQID NO:210)). Finally, the alsS integration from genomic DNA with primer oBP624 (SEQID NO:214), plasmid described in Example 13, puC19-kan::pdc1::FBA containing a 5° tail with homology to the 3' end of YPRCA15 alsS::TRX1, clone A) was transformed into this strain using Fragment A, and primeroBP625 (SEQIDNO:215), contain the included geneticin selection marker. Two integrants were ing a Fse restriction site. PCR products were purified with a tested for acetolactate synthase activity by transformation 45 PCR Purification kit (Qiagen). YPRCA15 Fragment with plasmids pYZ090AalsS (SEQID NO:371) and p3P915 A YPRCA 15 Fragment B was created by overlapping PCR (SEQID NO:182) (transformed using Protocol #2 in Amberg, by mixing the YPRCA15 Fragment A and YPRCA15 Frag Burke and Strathern “Methods in Yeast Genetics” (2005)), ment B PCR products and amplifying with primers oBP622 and evaluation of growth and isobutanol production in glu (SEQ ID NO: 212) and oBP625 (SEQ ID NO: 215). The cose-containing media (methods for growth and isobutanol 50 resulting PCR product was digested with KpnI and FseI and measurement are as follows: All strains were grown in Syn ligated with T4 DNA ligase into the corresponding sites of thetic complete medium, minus histidine and uracil contain pUC19-URA3MCS after digestion with the appropriate ing 0.3% glucose and 0.3% ethanol as carbon sources (10 mL enzymes. YPRCA 15 Fragment C was amplified from medium in 125 mL vented Erlenmeyer flasks (VWR Cat. No. genomic DNA with primer oBP626 (SEQID NO: 216), con 89095-260). After overnight incubation (30° C., 250 rpm in 55 taining a Not restriction site, and primer oBP627 (SEQ ID an Innova R40 New Brunswick Scientific Shaker), cultures NO: 217), containing a PacI restriction site. The YPRCA15 were diluted back to 0.2OD (Eppendorf BioPhotometer mea Fragment C PCR product was digested with NotI and PacI Surement) in synthetic complete medium containing 2% glu and ligated with T4 DNA ligase into the corresponding sites cose and 0.05% ethanol (20 ml medium in 125 mL tightly of the plasmid containing YPRCA15 Fragments AB. The capped Erlenmeyer flasks (VWR Cat. No. 89095-260)). After 60 PDC5 promoter region was amplified from CEN.PK 113-7D 48 hours incubation (30°C., 250 rpm in an Innova R40 New genomic DNA with primer HY21 (SEQ ID NO: 218), con Brunswick Scientific Shaker), culture supernatants (collected taining an AscI restriction site, and primer HY24 (SEQ ID using Spin-X centrifuge tube filter units, Costar Cat. No. NO: 219), containing a 5° tail with homology to the 5' end of 8169) were analyzed by HPLC per methods described in U.S. adh H1(y). adh H1(y)-ADH1t was amplified from pBP915 Appl. Pub. No. 2007/0092957, which is herein incorporated 65 (SEQ ID NO: 182) with primers HY25 (SEQ ID NO: 220), by reference in its entirety) One of the two clones was positive containing a 5' tail with homology to the 3' end of PPDC5. and was named PNY 2218. and HY4 (SEQ ID NO: 221), containing a PmeI restriction US 9,422,582 B2 91 92 site. PCR products were purified with a PCR Purification kit region was amplified from CEN.PK 113-7D genomic DNA (Qiagen). PPDC5-adh HL(y)-ADH1t was created by over with primer HY16 (SEQ ID NO: 231), containing an AscI lapping PCR by mixing the PPDC5 and adh HL(y)-ADH1t restriction site, and primer HY19 (SEQ ID NO. 232), con PCR products and amplifying with primers HY21 (SEQ ID taining a 5 tail with homology to the 5' end of adh H1(y). NO: 218) and HY4 (SEQID NO: 221). The resulting PCR adh H1(y)-ADH1t was amplified from plBP915 with primers product was digested with AscI and PmeI and ligated with T4 HY20 (SEQID NO: 233), containing a 5' tail with homology DNA ligase into the corresponding sites of the plasmid con to the 3' end of PIPDC1, and HY4 (SEQ ID NO: 221), taining YPRCA15 Fragments ABC. The entire integration containing a PmeI restriction site. PCR products were puri cassette was amplified from the resulting plasmid with prim fied with a PCR Purification kit (Qiagen). PPDC1-adh HL ers oBP622 (SEQ ID NO: 212) and oBP627 (SEQ ID NO: 10 (y)-ADH1t was created by overlapping PCR by mixing the 217). PPDC1 and adh HL(y)-ADH1t PCR products and ampli Competent cells of PNY2211 were made and transformed fying with primers HY16 (SEQID NO: 231) and HY4 (SEQ with the YPRCA15 deletion-PPDC5-adh HL(y)-ADH1t ID NO: 221). The resulting PCR product was digested with integration cassette PCR product using a Frozen-EZ Yeast AscI and PmeI and ligated with T4 DNA ligase into the Transformation II kit (Zymo Research; Orange, Calif.). 15 corresponding sites of the plasmid containing fra2A Frag Transformation mixtures were plated on synthetic complete ments ABC. The entire integration cassette was amplified media lacking uracil supplemented with 1% ethanol at 30°C., from the resulting plasmid with primers oBP691 (SEQ ID Transformants were screened for by PCR with primers NO: 225) and oBP696 (SEQID NO: 230). URA3-end F (SEQID NO: 222) and oBP637 (SEQ ID NO: Competent cells of the PNY2211 variant with adh H1(y) 224). Correct transformants were grown inYPE (1% ethanol) integrated at YPRCA15 were made and transformed with the and plated on synthetic complete medium Supplemented with fra2A-PPDC1-adh HL(y)-ADH1t integration cassette 1% EtOH and containing 5-fluoro-orotic acid (0.1%) at 30 C PCR product using a Frozen-EZYeast Transformation II kit to select for isolates that lost the URA3 marker. The deletion (Zymo Research). Transformation mixtures were plated on of YPRCA15 and integration of PPDC5-adh HL(y)- synthetic complete media lacking uracil Supplemented with ADH1t were confirmed by PCR with external primers 25 1% ethanol at 30° C. Transformants were screened for by oBP636 (SEQID NO: 223) and oBP637 (SEQID NO: 224) PCR with primers URA3-end F (SEQ ID NO: 222) and using genomic DNA prepared with a YeaStar Genomic DNA oBP731 (SEQ ID NO: 235). Correct transformants were kit (Zymo Research). A correct isolate of the following geno grown in YPE (1% ethanol) and plated on synthetic complete type was selected for further modification: CEN.PK 113-7D medium supplemented with 1% EtOH and containing MATa ura3A::loxP his3A pdc6A pdc1A::PPDC1 30 5-fluoro-orotic acid (0.1%) at 30°C. to select for isolates that DHADilvD Sm-PDC1t-PFBA1-ALSlalsS BS-CYC1t lost the URA3 marker. The integration of PPDC1-adh HL pdc5A::PPDC5-ADHisadB Ax-PDC5t gpd2A:loxP (y)-ADH1t was confirmed by colony PCR with internal fra2A adh1A::UAS(PGK1)PFBA1-kivD Ll(y)-ADH1t primer HY31 (SEQID NO: 236) and external primeroBP731 yprc.A 15A::PPDC5-ADHladh H1-ADH1 t. (SEQ ID NO: 235) and PCR with external primers oBP730 Horse Liver adh Integration at fra2A 35 (SEQ ID NO. 234) and oBP731 (SEQ ID NO: 235) using The horse liver adh gene, codon optimized for expression genomic DNA prepared with a YeaStar Genomic DNA kit in Saccharomyces cerevisiae, along with the PDC1 promoter (Zymo Research). A correct isolate of the following genotype region (870 bp) from Saccharomyces cerevisiae and the was designated PNY 1528: CEN.PK 113-7D MATaura3A: ADH1 terminator region (316 bp) from Saccharomyces cer loxP his3A pdc6A pdc1A::PPDC1-DHADlilvD Sm evisiae, was integrated into the site of the fra2 deletion. The 40 PDC1t-PFBA1-ALS|alsS BS-CYC1t pdc5A::PPDC5 scarless cassette for the fra2A-PPDC1-adh HL(y)-ADH1t ADHisadB Ax-PDC5t gpd2A::loxP fra2A::PPDC1 integration was first cloned into plasmid puC19-URA3MCS. ADHladh H1-ADH1t adh1A::UAS(PGK1)PFBA 1 Fragments A-B-U-C were amplified using Phusion High kivD Ll(y)-ADH1t yprcA15A::PPDC5-ADHladh H1 Fidelity PCR Master Mix (New England BioLabs: Ipswich, ADH1t. Mass.) and CEN.PK 113-7D genomic DNA as template, pre 45 PNY2237 (Scarless YMR226C Deletion) pared with a Gentra Puregene Yeast/Bact kit (Qiagen; Valen The gene YMR226C was deleted from S. cerevisiae strain cia, Calif.). fra2A Fragment C was amplified from genomic PNY 1528 by homologous recombination using a PCR ampli DNA with primer oBP695 (SEQID NO: 229), containing a fied 2.0 kb linear scarless deletion cassette. The cassette was NotI restriction site, and primer oBP696 (SEQID NO: 230), constructed from spliced PCR amplified fragments com containing a Padrestriction site. The fra2A Fragment C PCR 50 prised of the URA3 gene, along with its native promoter and product was digested with NotI and Pad and ligated with T4 terminator as a selectable marker, upstream and downstream DNA ligase into the corresponding sites of puC19 homology sequences flanking the YMR226C gene chromo URA3MCS. fra2A Fragment B was amplified from genomic Somal locus to promote integration of the deletion cassette DNA with primer oBP693 (SEQID NO: 227), containing a and removal of the native intervening sequence and a repeat PmeI restriction site, and primer oBP694 (SEQID NO:228), 55 sequence to promote recombination and removal of the containing a FseI restriction site. The resulting PCR product URA3 marker. Forward and reverse PCR primers (N1251 and was digested with PmeI and FseI and ligated with T4 DNA N1252, SEQID NOs: 247 and 248, respectively), amplified a ligase into the corresponding sites of the plasmid containing 1,208 bp URA3 expression cassette originating from pla33 fra2A fragment C after digestion with the appropriate (pUC19:loxP-URA3-loxP (SEQID NO:268)). Forward and enzymes. fra2A Fragment A was amplified from genomic 60 reverse primers (N1253 and N1254, SEQ ID NOs: 249 and DNA with primer oBP691 (SEQ ID NO: 225), containing 250, respectively), amplified a 250 bp downstream homology BamHI and AsiSI restriction sites, and primer oBP692 (SEQ sequence with a 3° URA3 overlap sequence tag from a ID NO: 226), containing AscI and Swal restriction sites. The genomic DNA preparation of S. cerevisiae strain PNY2211 fra2A fragment A PCR product was digested with BamHI and (above). Forward and reverse PCR primers (N1255 and AscI and ligated with T4 DNA ligase into the corresponding 65 N1256, SEQID NOs: 251 and 252, respectively) amplified a sites of the plasmid containing fra2A fragments BC after 250 bp repeat sequence with a 5' URA3 overlap sequence tag digestion with the appropriate enzymes. The PDC1 promoter from a genomic DNA preparation of S. cerevisiae strain US 9,422,582 B2 93 94 PNY2211. Forward and reverse PCR primers (N1257 and SEQID NOs: 255 and 256, respectively). Additionally, prim N1258, SEQID NOS: 253 and 254, respectively) amplified a ers internal to the ALD6 gene (N1230 and N1231; SEQ ID 250 bp upstream homology sequence with a 5' repeat overlap NOs: 261 and 262, respectively) were used to insure that no sequence tag from a genomic DNA preparation of S. cerevi merodiploids were present. Finally, ald6A::loxP clones were Siae Strain PNY 2211. screened by PCR to confirm that a translocation between Approximately 1.5 lug of the PCR amplified cassette was ura3A::loxP (N1228 and N1229, SEQID NOs: 259 and 260) transformed into strain PNY 1528 (above) made competent and gpd2A::loxP (N1223 and N1225, SEQID NOS: 257 and using the ZYMO Research Frozen Yeast Transformation Kit 258) had not occurred. Two positive clones were identified and the transformation mix plated on SE 1.0%-uracil and from screening of transformants of PNY 1528, Clone B has incubated at 30° C. for selection of cells with an integrated 10 been designated PNY 2243. Three positive clones were iden ymr226CA::URA3 cassette. Transformants appearing after tified from screening transformants of PNY2237. Clones E 72 to 96 hours are subsequently short-streaked on the same and K were both assessed for isobutanol production at small medium and incubated at 30° C. for 24 to 48 hours. The scale (below). Although statistically identical in most param short-streaks are screened for ymr226CA::URA3 by PCR, eters, Clone E was selected (PNY2238) for further develop with a 5' outward facing URA3 deletion cassette-specific 15 ment. internal primer (N1249, SEQ ID NO: 245) paired with a flanking inward facing chromosome-specific primer (N1239, Example 10 SEQ ID NO: 243) and a 3' outward-facing URA3 deletion cassette-specific primer (N1250, SEQ ID NO: 246) paired Isobutanol Pathway Plasmids with a flanking inward-facing chromosome-specific primer (N1242, SEQID NO:244). A positive PNY 1528ymr226CA: The purpose of this example is to describe construction or URA3 PCR screen resulted in 5' and 3' PCR products of 598 modification of isobutanol pathway plasmids for production and 726 bp, respectively. of isobutanol in host strains. Three positive PNY 1528 ymr226CA::URA3 clones were pYZ067 (SEQID NO:374) was constructed to contain the picked and cultured overnight in aYPE 1% medium of which 25 following chimeric genes: 1) the coding region of the ilvD 100 uL was plated on YPE 1%+5-FOA for marker removal. gene from S. mutans UA159 with a C-terminal Lumio tag Colonies appearing after 24 to 48 hours were PCR screened expressed from the yeast FBA 1 promoter followed by the for marker loss with 5' and 3' chromosome-specific primers FBA 1 terminator for expression of dihydroxy acid dehy (N1239 and N1242). A positive PNY 1528ymr226CA mark dratase, 2) the coding region for horse liver ADH expressed erless PCR screen resulted in a PCR product of 801 bp. 30 from the yeast GPM1 promoter followed by the ADH1 ter Multiple clones were obtained and one was designated minator for expression of alcohol dehydrogenase, and 3) the PNY 2237. coding region of the Kiv) gene from Lactococcus lactis PNY2238 and PNY 2243 (ALD6 Deletion Strains) expressed from the yeast TDH3 promoter followed by the A vector was designed to replace the ALD6 coding TDH3 terminator for expression of ketoisovalerate decar sequence with a Cre-lox recyclable URA3 selection marker. 35 boxylase. Sequences 5' and 3' of ALD6 were amplified by PCR (primer pYZ067AkivDAhADH (SEQ ID NO: 385) was con pairs N1179 and N1180 and N1181 and N1182, respectively: structed from pYZ067 (SEQ ID NO: 374) by deleting the SEQ ID NOs: 237, 238, 239, and 240, respectively). After promoter-gene-terminator cassettes for both kiv) and adh. cloning these fragments into TOPO vectors (Invitrogen Cat. pYZ067 was digested with BamHI and SacI (New England No. K2875-J10) and sequencing (M13 forward (SEQ ID 40 BioLabs: Ipswich, Mass.), and the 7934 bp fragment was NO:269) and reverse (SEQID NO:270) primers), the 5' and 3' purified on an agarose gel followed by a Gel Extraction kit flanks were cloned into pIA33 (pUC19::loxP:URA3:loxP) (Qiagen; Valencia, Calif.). The isolated fragment of DNA was (SEQ ID NO:268) at the EcoRI and SphI sites, respectively. treated with DNA Polymerase I, Large (Klenow) Fragment Each ligation reaction was transformed into E. coli Stb13 (New England BioLabs; Ipswich, Mass.) and then self-li cells, which were incubated on LB Amp plates to select for 45 gated with T4 DNA ligase and used to transform competent transformants. Proper insertion of sequences was confirmed TOP10 Escherichia coli (Invitrogen; Carlsbad, Calif.). Plas by PCR (primers M13 forward (SEQID NO:269) and N1180 mids from transformants were isolated and checked for the (SEQ ID NO:238) and M13 reverse (SEQID NO:270) and proper deletion by sequence analysis. A correct plasmid iso N1181 (SEQ ID NO:239), respectively). late was designated pYZ067Akiv AhaDH. The vector described above (pUC19::ald6A::loxP-URA3 50 pYZ067 AkivDAilvD (SEQ ID NO: 772) was constructed loxP) was linearized with AhdI and transformed into to contain a chimeric gene having the coding region of the adh PNY 1528 and PNY2237 using the standard lithium acetate gene from horse liver (nt position 3148-2021), codon opti method (except that incubation of cells with DNA was mized for expression in Saccharomyces cerevisiae, expressed extended to 2.5 h). Transformants were obtained by plating on from the yeast GPM promoter (nt 3916-3160) and followed synthetic complete medium minus uracil that provided 1% 55 by the ADH1 terminator (nt 2012-1697) for expression of ethanol as the carbon source. Patched transformants were ADH. pyZ067DkivDDilvD was constructed from pYZ067 screened by PCR to confirm the deletion/integration, using by deleting the promoter-gene-terminator cassettes for both primers N1212 (SEQID NO: 241) and N1180 (5' end) (SEQ kivD and ilvD. pYZ067 was digested with Aati I and SacI ID NO. 238) and N1181 (SEQID NO: 239) and N1213 (SEQ (New England BioLabs; Ipswich, Mass.) and the 10196 bp ID NO: 242) (3' end). A plasmid carrying Cre recombinase 60 fragment was purified on an agarose gel followed by a Gel (pRS423::GAL1p–Cre=SEQ ID No. 271) was transformed Extraction kit (Qiagen; Valencia, Calif.). The isolated frag into the strain using histidine marker selection, Transfor ment of DNA was treated with DNA Polymerase I, Large mants were passaged onYPE supplemented with 0.5% galac (Klenow) Fragment (New England BioLabs; Ipswich, Mass.) tose. Colonies were screened for resistance to 5-FOA (loss of and then self-ligated with T4DNA ligase. The resulting plas URA3 marker) and for histidine auxotrophy (loss of the Cre 65 mid was then digested with NgoMIV and BamHI (New plasmid). Proper removal of the URA3 gene via the flanking England BioLabs: Ipswich, Mass.) and the 7533 bp fragment loxP sites was confirmed by PCR (primers N1262 and N1263, was purified on an agarose gel followed by a Gel Extraction US 9,422,582 B2 95 96 kit (Qiagen; Valencia, Calif.). The isolated fragment of DNA mants were plated on synthetic complete medium without was treated with DNA Polymerase I, Large (Klenow) Frag histidine or uracil (1% ethanol as carbon source). Transfor ment (New England BioLabs; Ipswich, Mass.) and then self mants were patched to the same medium containing, instead, ligated with T4 DNA ligase. Plasmids were isolated and 2% glucose and 0.05% ethanol as carbon sources. Three checked for the proper deletions by sequence analysis. A patches were tested for isobutanol production, as described correct plasmid isolate was designated pYZ067DkivDDilvD. above. All three performed similarly in terms of glucose pK9G9.OLE1 p.ilvD (SEQ ID NO: 773), derived from consumption and isobutanol production. One clone was des pYZ090 (SEQ ID NO: 195), was constructed to contain a ignated PNY2242 and was further characterized under fer chimeric gene having the coding region of the ilvD gene from mentation conditions, as described herein below. Streptococcus mutans (nt position 5377-3641) expressed 10 from the yeast OLE1 promoter (nt 5986-5387) and followed Example 12 by the FBA1 terminator (nt 3632-3320) for expression of DHAD, and a chimeric gene having the coding region of the Construction of Saccharomyces cerevisiae Strain variant K9G9 of the ilvC gene from Anaerostipes caccae BP1064 (PNY1503) (nucleic acid and amino acid SEQID NOs: 774 and 647) (nt 15 1628-2659) expressed from the yeast ILV5 promoter (nt 427 The Strain BP1064 was derived from CEN.PK 113-7D 1620) and followed by the ILV5 terminator (nt 2685-3307) (CBS 8340; Centraalbureau voor Schimmelcultures (CBS) for expression of KARI. Construction of the plasmid was as Fungal Biodiversity Centre, Netherlands) and contains dele follows. The chimeric gene from plasmid pYZ067 having the tions of the following genes: URA3, HIS3, PDC1, PDC5, coding region of the ilvD gene from Streptococcus mutans PDC6, and GPD2. BP1064 was transformed with plasmids expressed from the yeast FBA 1 promoter and followed by the pYZ090 (SEQID NO: 195) and pLH468 (SEQID NO:139) to FBA 1 terminator was ligated into pYZ090 after digestion create strain NGCI-070 (BP1083: PNY 1504). with restriction enzymes NgoMIV and BamHI. The alsS cod Deletions, which completely removed the entire coding ing region and 280 bp from the 3' end of the CUP1 promoter sequence, were created by homologous recombination with was deleted from the resulting plasmid by digesting with the 25 PCR fragments containing regions of homology upstream restriction enzymes Spel and Pad and self-ligating the result and downstream of the target gene and either a G418 resis ing large DNA fragment. The yeast FBA 1 promoter upstream tance marker or URA3 gene for selection of transformants. of ilvD was removed from the resulting plasmid by digesting The G418 resistance marker, flanked by loxP sites, was with the restriction enzymes NgoMIV and PmlI and was removed using Cre recombinase (pRS423::PGAL1-cre: SEQ replaced with the yeast OLE 1 promoter amplified with prim 30 ID NO: 271). The URA3 gene was removed by homologous ers pCLE1-NgoMI (SEQ ID NO: 775) and pCLE1-Pml I recombination to create a scarless deletion, or if flanked by (SEQID NO: 776). The coding region of the ilvC gene from loxP sites was removed using Cre recombinase. Lactococcus lactis was deleted from the resulting plasmid by URA3 Deletion digestion with restriction enzymes PmeI and Sfil followed by To delete the endogenous URA3 coding region, a ura3:: gel purification of the large DNA fragment. The coding 35 loxP-kanMX-loxP cassette was PCR-amplified from pl.A54 region of the variant K9G9 ilvC gene (SEQID NO: 777) from template DNA (SEQ ID NO:386). p. A54 contains the K. Anaerostipes caccae was digested out of plH701 (SEQ ID lactis TEF1 promoter and kanMX marker, and is flanked by NO: 778) with PmeI and Sfiland gel purified. The two DNA loXP sites to allow recombination with Cre recombinase and fragments were ligated to generate pK9G9.OE 1 p.ilvD. removal of the marker. PCR was done using Phusion DNA 40 polymerase and primers BK505 and BK506 (SEQ ID NOs: Example 11 294 and 295). The URA3 portion of each primer was derived from the 5° region upstream of the URA3 promoter and 3 Construction of PNY 2240 and PNY 2242 region downstream of the coding region Such that integration of the loxP-kanMX-loxP marker resulted in replacement of Strain PNY 2240 was derived from PNY 2211 after trans 45 the URA3 coding region. The PCR product was transformed formation with plasmids plH702 (SEQ ID NO: 181) and into CEN.PK 113-7D using standard genetic techniques pBP915 (SEQ ID NO: 182). Transformants were plated on (Methods in Yeast Genetics, 2005, Cold Spring Harbor Labo synthetic complete medium without histidine or uracil (1% ratory Press, Cold Spring Harbor, N.Y., pp. 201-202) and ethanol as carbon Source). Transformants were patched to the transformants were selected on YPD containing G418 (100 same medium containing, instead, 2% glucose and 0.05% 50 ug/ml) at 30°C. Transformants were screened to verify cor ethanol as carbon Sources. Three patches were used to inocu rect integration by PCR using primers LA468 and LA492 late liquid medium (synthetic complete minus uracil with (SEQID NOS:296 and 297) and designated CEN.PK113-7D 0.3% glucose and 0.3% ethanol as carbon sources). To test Aura3::kanMX. isobutanol production, liquid cultures were sub-cultured into HIS3 Deletion synthetic complete medium minus uracil containing 2% glu 55 The four fragments for the PCR cassette for the scarless cose and 0.05% ethanol as carbon sources that also contained HIS3 deletion were amplified using Phusion High Fidelity BME vitamin mix (Sigma Cat. No. B6891). Cultures were PCR Master Mix (New England BioLabs: Ipswich, Mass.) incubated in sealed serum vials (10 ml medium in 15 ml vials) and CEN.PK 113-7D genomic DNA as template, prepared at 30° C. with shaking (250 rpm in an Infors Multitron with a Gentra Puregene Yeast/Bact kit (Qiagen; Valencia, shaker). After 48 hours, culture medium was filtered (Spin-X 60 Calif.). HIS3 Fragment A was amplified with primer oBP452 column) and analyzed by HPLC (as described in US App. (SEQ ID NO:298) and primer oBP453 (SEQ ID NO:299), Pub. No. 2007/0092957, which is incorporated herein by containing a 5' tail with homology to the 5' end of HIS3 reference in its entirety). One clone was designated Fragment B. HIS3 Fragment B was amplified with primer PNY 2240. oBP454 (SEQ ID NO:300), containing a 5' tail with homol Strain PNY 2242 was derived from PNY 2238 after trans 65 ogy to the 3' end of HIS3 Fragment A, and primer oBP455 formation with plasmids plH702 (SEQ ID NO: 181) and (SEQID NO:301), containing a 5' tail with homology to the pYZ067 AkivDAhADH (described herein above). Transfor 5' end of HIS3 Fragment U. HIS3 Fragment U was amplified US 9,422,582 B2 97 98 with primer oBP456 (SEQID NO:302), containing a 5" tail fied with primer oBP440 (SEQ ID NO:310) and primer with homology to the 3' end of HIS3 Fragment B, and primer oBP441 (SEQ ID NO:311), containing a 5' tail with homol oBP457 (SEQ ID NO:303), containing a 5' tail with homol ogy to the 5' end of PDC6Fragment B. PDC6Fragment B was ogy to the 5' end of HIS3 Fragment C. HIS3 Fragment C was amplified with primer oBP442 (SEQID NO:312), containing amplified with primeroBP458 (SEQID NO:304), containing 5 a 5' tail with homology to the 3" end of PDC6 Fragment A, a 5' tail with homology to the 3' end of HIS3 Fragment U, and and primer oBP443 (SEQ ID NO:313), containing a 5' tail primer oBP459 (SEQID NO:305). PCR products were puri with homology to the 5' end of PDC6 Fragment U. PDC6 fied with a PCR Purification kit (Qiagen). HIS3 Fragment AB Fragment U was amplified with primer oBP444 (SEQ ID was created by overlapping PCR by mixing HIS3 Fragment A NO:314), containing a 5' tail with homology to the 3' end of and HIS3 Fragment B and amplifying with primers oBP452 10 PDC6 Fragment B, and primer oBP445 (SEQ ID NO:315), (SEQ ID NO:298) and oBP455 (SEQ ID NO:301). HIS3 containing a 5' tail with homology to the 5' end of PDC6 Fragment UC was created by overlapping PCR by mixing Fragment C. PDC6 Fragment C was amplified with primer HIS3 Fragment U and HIS3 Fragment C and amplifying with oBP446 (SEQ ID NO:316), containing a 5' tail with homol primers oBP456 (SEQ ID NO:302) and oBP459 (SEQ ID ogy to the 3' end of PDC6 Fragment U, and primer oBP447 NO:305). The resulting PCR products were purified on an 15 (SEQ ID NO:317). PCR products were purified with a PCR agarose gel followed by a Gel Extraction kit (Qiagen). The Purification kit (Qiagen), PDC6 Fragment AB was created by HIS3 ABUC cassette was created by overlapping PCR by overlapping PCR by mixing PDC6 Fragment A and PDC6 mixing HIS3 Fragment AB and HIS3 Fragment UC and Fragment B and amplifying with primers oBP440 (SEQ ID amplifying with primers oBP452 (SEQ ID NO:298) and NO:310) and oBP443 (SEQ ID NO:313), PDC6 Fragment oBP459 (SEQ ID NO:305). The PCR product was purified UC was created by overlapping PCR by mixing PDC6 Frag with a PCR Purification kit (Qiagen). ment U and PDC6 Fragment C and amplifying with primers Competent cells of CEN.PK 113-7D Aura3:kanMX were oBP444 (SEQ ID NO:314) and oBP447 (SEQID NO:317). made and transformed with the HISS ABUC PCR cassette The resulting PCR products were purified on an agarose gel using a Frozen-EZ Yeast Transformation H kit (Zymo followed by a Gel Extraction kit (Qiagen). The PDC6ABUC Research: Orange, Calif.). Transformation mixtures were 25 cassette was created by overlapping PCR by mixing PDC6 plated on synthetic complete media lacking uracil Supple Fragment AB and PDC6 Fragment UC and amplifying with mented with 2% glucose at 30°C. Transformants with a his3 primers oBP440 (SEQ ID NO:310) and oBP447 (SEQ ID knockout were screened for by PCR with primers oBP460 NO:317). The PCR product was purified with a PCR Purifi (SEQ ID NO:306) and oBP461 (SEQ ID NO:307) using cation kit (Qiagen). genomic DNA prepared with a Gentra Puregene Yeast/Bact 30 Competent cells of CEN.PK 113-7D Aura3:loxP Ahis3 kit (Qiagen). A correct transformant was selected as Strain were made and transformed with the PDC6 ABUC PCR CEN.PK 113-7D Aura3::kanMX Ahis3::URA3. cassette using a Frozen-EZYeast Transformation II kit (Zymo KanMX Marker Removal from the Aura3 Site and URA3 Research). Transformation mixtures were plated on synthetic Marker Removal from the Ahis3 Site complete media lacking uracil Supplemented with 2% glu The KanMX marker was removed by transforming 35 cose at 30° C. Transformants with a pdc6 knockout were CEN.PK 113-7D Aura3::kanMX Ahis3::URA3 with screened for by PCR with primers oBP448 (SEQIDNO:318) pRS423::PGAL1-cre (SEQID NO: 271) using a Frozen-EZ andoBP449 (SEQID NO:319) using genomic DNA prepared Yeast Transformation H kit (Zymo Research) and plating on with a Gentra Puregene Yeast/Bact kit (Qiagen). A correct synthetic complete medium lacking histidine and uracil transformant was selected as strain CEN.PK 113-7D Aura3:: supplemented with 2% glucose at 30°C. Transformants were 40 loxPAhis3 Apdc6::URA3. grown inYP supplemented with 1% galactose at 30°C. for ~6 CEN.PK 113-7D Aura3::loxP Ahis3 Apdc6::URA3 was hours to induce the Cre recombinase and KanMX marker grown overnight in YPD and plated on synthetic complete excision and plated onto YPD (2% glucose) plates at 30° C. medium containing 5-fluoro-orotic acid (0.1%) at 30° C. to for recovery. An isolate was grown overnight in YPD and select for isolates that lost the URA3 marker. The deletion and plated on synthetic complete medium containing 5-fluoro 45 marker removal were confirmed by PCR and sequencing with orotic acid (0.1%) at 30° C. to select for isolates that lost the primers oBP448 (SEQ ID NO:318) and oBP449 (SEQ ID URA3 marker, 5-FOA resistant isolates were grown in and NO:319) using genomic DNA prepared with a Gentra Pure plated on YPD for removal of the pRS423::PGAL1-cre plas gene Yeast/Bact kit (Qiagen). The absence of the PDC6 gene mid, Isolates were checked for loss of the KanMX marker, from the isolate was demonstrated by a negative PCR result URA3 marker, and pRS423::PGAL1-cre plasmid by assay 50 using primers specific for the coding sequence of PDC6, ing growth onYPD+G418 plates, synthetic complete medium oBP554 (SEQ ID NO:320) and oBP555 (SEQ ID NO:321). lacking uracil plates, and synthetic complete medium lacking The correct isolate was selected as Strain CEN.PK 113-7D histidine plates. A correct isolate that was sensitive to G418 Aura3::loxP Ahis3 Apdc6 and designated as BP891. and auxotrophic for uracil and histidine was selected as strain PDC1 Deletion ilvDSm Integration CEN.PK 113-7D Aura3::loxP Ahis3 and designated as 55 The PDC1 gene was deleted and replaced with the ilvD BP857. The deletions and marker removal were confirmed by coding region from Streptococcus mutans ATCC #700610. PCR and sequencing with primers oBP450(SEQID NO:308) The A fragment followed by the ilvD coding region from and oBP451 (SEQ ID NO:309) for Aura3 and primers Streptococcus mutans for the PCR cassette for the PDC1 oBP460 (SEQ ID NO:306) and oBP461 (SEQ ID NO:307) deletion-ilvDSm integration was amplified using Phusion for Ahis3 using genomic DNA prepared with a Gentra Pure 60 High Fidelity PCR Master Mix (New England BioLabs) and gene Yeast/Bact kit (Qiagen). NYLA83 genomic DNA as template, prepared with a Gentra PDC6 Deletion Puregene Yeast/Bact kit (Qiagen). NYLA83 is a strain which The four fragments for the PCR cassette for the scarless carries the PDC1 deletion-ilvDSm integration described in PDC6 deletion were amplified using Phusion High Fidelity U.S. Patent Application Publication No. 200910305363, PCR Master Mix (New England BioLabs) and CEN.PK 113 65 which is herein incorporated by reference in its entirety. 7D genomic DNA as template, prepared with a Gentra Pure PDC1 Fragment A-ilvDSm (SEQID NO:322) was amplified gene Yeast/Bact kit (Qiagen). PDC6 Fragment A was ampli with primer oBP513 (SEQ ID NO:326) and primer oBP515 US 9,422,582 B2 99 100 (SEQID NO:327), containing a 5' tail with homology to the segment of the PCR cassette for the PDC5 deletion-sadB 5' end of PDC1 Fragment B. The B, U, and C fragments for integration was first cloned into plasmid puC19-URA3MCS. the PCR cassette for the PDC1 deletion-ilvDSm integration pUC19-URA3MCS is puC19 based and contains the were amplified using Phusion High Fidelity PCR Master Mix sequence of the URA3 gene from Saccharomyces cerevisiae (New England BioLabs) and CEN.PK113-7D genomic DNA situated within a multiple cloning site (MCS). pUC19 con as template, prepared with a Gentra Puregene Yeast/Bact kit tains the pMB1 replicon and a gene coding for beta-lactamase (Qiagen). PDC1 Fragment B was amplified with primer for replication and selection in Escherichia coli. In addition to oBP516 (SEQID NO:328) containing a 5' tail with homology the coding sequence for URA3, the sequences from upstream to the 3' end of PDC1 Fragment A-ilvDSm, and primer and downstream of this gene were included for expression of 10 the URA3 gene in yeast. The vector can be used for cloning oBP517 (SEQ ID NO:329), containing a 5' tail with homol purposes and can be used as a yeast integration vector. ogy to the 5' end of PDC1 Fragment U. PDC1 Fragment U The DNA encompassing the URA3 coding region along was amplified with primer oBP518 (SEQ ID NO:330), con with 250 bp upstream and 150 bp downstream of the URA3 taining a 5° tail with homology to the 3' end of PDC1 Frag coding region from Saccharomyces cerevisiae CEN.PK 113 ment B, and primer oBP519 (SEQID NO:331), containing a 15 7D genomic DNA was amplified with primers oBP438 (SEQ 5' tail with homology to the 5' end of PDC1 Fragment C. ID NO:334), containing BamHI, AscI, PmeI, and Fse restric PDC1 Fragment C was amplified with primer oBP520 (SEQ tion sites, and oBP439 (SEQID NO:335), containing Xbal, ID NO:332), containing a 5' tail with homology to the 3' end PacI, and NotI restriction sites, using Phusion High-Fidelity of PDC1 Fragment U, and primeroBP521 (SEQID NO:333). PCR Master Mix (New England BioLabs). Genomic DNA PCR products were purified with a PCR Purification kit was prepared using a Gentra Puregene Yeast/Bact kit (Qiagen). PDC1 Fragment A-ilvDSm-B was created by over (Qiagen). The PCR product and puC19 (SEQ ID NO:325) lapping PCR by mixing PDC1 Fragment A-ilvDSm and were ligated with T4DNA ligase after digestion with BamHI PDC1 Fragment B and amplifying with primers oBP513 and Xbal to create vector puC19-URA3MCS. The vector (SEQ ID NO:326) and oBP517 (SEC) ID NO:329). PDC1 was confirmed by PCR and sequencing with primers oBP264 Fragment UC was created by overlapping PCR by mixing 25 (SEQID NO:342) and oBP265 (SEQID NO:343). PDC1 Fragment U and PDC1 Fragment C and amplifying The coding sequence of sadB and P005 Fragment B were with primers oBP518 (SEQ ID NO:330) and oBP521 (SEQ cloned into puC19-URA3MCS to create the sadB-BU por ID NO:333). The resulting PCR products were purified on an tion of the PDC5 A-sadB-BUC PCR cassette. The coding agarose gel followed by a Gel Extraction kit (Qiagen). The sequence of sadB was amplified using plH468-sadB (SEQ PDC1 A-ilvDSm-BUC cassette (SEQ ID NO:323) was cre 30 ID NO:359) as template with primer oBP530 (SEQ ID ated by overlapping PCR by mixing PDC1 Fragment A-il NO:344), containing an AscI restriction site, and primer vDSm-Band PDC1 Fragment UC and amplifying with prim oBP531 (SEQ ID NO:345), containing a 5' tail with homol ers oBP513 (SEQ ID NO:326) and oBP521 (SEQ ID ogy to the 5' end of PDC5 Fragment B. PDC5 Fragment B was NO:333). The PCR product was purified with a PCR Purifi amplified with primeroBP532 (SEQID NO:346), containing cation kit (Qiagen). 35 a 5" tail with homology to the 3' end of sadB, and primer Competent cells of CEN.PK 113-7D Aura3::loxP Ahis3 oBP533 (SEQIDNO:347), containing a PmeI restriction site. Apdc6 were made and transformed with the PDC1 A-il PCR products were purified with a PCR Purification kit VDSm-BUCPCR cassette using a Frozen-EZYeast Transfor (Qiagen), sadB-PDC5 Fragment B was created by overlap mation H kit (Zymo Research). Transformation mixtures ping PCR by mixing the sadB and PDC5 Fragment B PCR were plated on synthetic complete media lacking uracil 40 products and amplifying with primers oBP536 (SEQ ID supplemented with 2% glucose at 30°C. Transformants with NO:344) and oBP533 (SEQID NO:347). The resulting PCR a pdc1 knockout ilvDSm integration were screened for by product was digested with AscI and PmeI and ligated with T4 PCR with primers oBP511 (SEQ ID NO:336) and oBP512 DNA ligase into the corresponding sites of puC19 (SEQID NO:337) using genomic DNA prepared with a Gen URA3MCS after digestion with the appropriate enzymes. tra Puregene Yeast/Bact kit (Qiagen). The absence of the 45 The resulting plasmid was used as a template for amplifica PDC1 gene from the isolate was demonstrated by a negative tion of sadB-Fragment B-Fragment Uusing primers oBP536 PCR result using primers specific for the coding sequence of (SEQID NO:348)andoBP546 (SEQIDNO:349), containing PDC1, oBP550 (SEQ ID NO:338) and oBP551 (SEQ ID a 5' tail with homology to the 5' end of PDC5 Fragment C. NO:339). A correct transformant was selected as strain PDC5 Fragment C was amplified with primer oBP547 (SEQ CEN.PK 113-7D Aura3:loxPAhis3 Apdc6 Apdc1::ilvDSm 50 ID NO:350) containing a 5' tail with homology to the 3' end of URA3 PDC5 sadB-Fragment B-Fragment U, and primer oBP539 CEN.PK 113-7D Aura3::loxP Ahis3 Apdc6 Apdc1::il (SEQ ID NO:351). PCR products were purified with a PCR VDSm-URA3 was grown overnight in YPD and plated on Purification kit (Qiagen). PDC5 sadB-Fragment B-Fragment synthetic complete medium containing 5-fluoro-orotic acid U-Fragment C was created by overlapping PCR by mixing (0.1%) at 30° C. to select for isolates that lost the URA3 55 PDC5 sadB-Fragment B-Fragment U and PDC5 Fragment C marker. The deletion of PDC1, integration of ilvDSm, and and amplifying with primers oBP536 (SEQID NO:348) and marker removal were confirmed by PCR and sequencing with oBP539 (SEQ ID NO:351). The resulting PCR product was primers oBP511 (SEQ ID NO:336) and oBP512 (SEQ ID purified on an agarose gel followed by a Gel Extraction kit NO:337) using genomic DNA prepared with a Gentra Pure (Qiagen). The PDC5 A-sadB-BUC cassette (SEQ ID gene Yeast/Bact kit (Qiagen). The correct isolate was selected 60 NO:324) was created by amplifying PDC5 sadB-Fragment as strain CEN.PK 113-7D Aura3::loxPAhis3 Apdc6 Apdc1:: B-Fragment U-Fragment C with primers oBP542 (SEQ ID ilvDSm and designated as BP907. NO:352), containing a 5' tail with homology to the 50 nucle PDC5 Deletion sadB Integration otides immediately upstream of the native PDC5 coding The PDC5 gene was deleted and replaced with the sadB sequence, and oBP539 (SEQID NO:351). The PCR product coding region from Achromobacter xylosoxidans (the sadB 65 was purified with a PCR Purification kit (Qiagen). gene is described in U.S. Patent Appl. No. 2009/0269823, Competent cells of CEN.PK 113-70 Aura3::loxP Ahis3 which is herein incorporated by reference in its entirety). A Apdc6 Apdc1::ilvDSm were made and transformed with the US 9,422,582 B2 101 102 PDC5A-sadB-BUC PCR cassette using a Frozen-EZYeast between the PDC1 and TRX1 coding sequences in Chromo Transformation Hkit (Zymo Research). Transformation mix some XII. Strains resulting from the use of this vector are also tures were plated on synthetic complete media lacking uracil described. supplemented with 1% ethanol (no glucose) at 30 C. Trans Construction Of Integration Vector puC19-kan::pdc1::FBA formants with a pdc5 knockout sadB integration were 5 alsS::TRX1 screened for by PCR with primers oBP540 (SEQIDNO:353) The FBA-alsS-CYCt cassette was constructed by moving andoBP541 (SEQID NO:354) using genomic DNA prepared the 1.7 kb BbvCI/PacI fragment from pRS426:GPD:alsS: with a Gentra Puregene Yeast/Bact kit (Qiagen). The absence CYC (described in U.S. Pat. No. 7,851,188, which is herein of the PDC5 gene from the isolate was demonstrated by a incorporated by reference in its entirety) to pRS426::FBA:: negative PCR result using primers specific for the coding 10 ILV5::CYC (described in U.S. Pat. No. 7,851,188, which is sequence of PDC5, oBP552 (SEQID NO:355) and oBP553 herein incorporated by reference in its entirety), which had (SEQ ID NO:356). A correct transformant was selected as been previously digested with BbyCI/PacIto release the ILV5 strain CEN.PK 113-7D Aura3:loxP Ahis3 Apdc6 Apdc1:: gene. Ligation reactions were transformed into E. coli TOP10 ilvDSm Apdc5::sadB-URA3. cells and transformants were screened by PCR using primers CEN.PK 113-7D Aura3::loxP Ahis3 Apdc6 Apdc1::il 15 N98SeqF1 (SEQ ID NO:363) and N99SeqR2 (SEC) ID VDSm Apdc5::sadB-URA3 was grown overnightinYPE (1% NO:365). The FBA-alsS-CYCt cassette was isolated from the ethanol) and plated on synthetic complete medium Supple vector using BglII and NotI for cloning into puC19-URA3:: mented with ethanol (no glucose) and containing 5-fluoro ilvD-TRX1 (done “B”) at the AflII site (Klenow fragment was orotic acid (0.1%) at 30 C to select for isolates that lost the used to make ends compatible for ligation). Transformants URA3 marker. The deletion of PDC5, integration of sadB, containing the alsS cassette in both orientations in the vector and marker removal were confirmed by PCR with primers were obtained and confirmed by PCR using primers oBP540 (SEQ ID NO:353) and oBP541 (SEQ ID NO:354) N98SeqF4 (SEQID NO:364) and N1111 (SEQID NO:366) using genomic DNA prepared with a Gentra Puregene Yeast/ for configuration “A” and N98SeqF4 (SEQID NO:364) and Bact kit (Qiagen). The correct isolate was selected as strain N1110 (SEQID NO:367) for configuration “B”. A geneticin CEN.PK 113-7D Aura3::loxP Ahis3 Apdc6 Apdc1::ilvDSm 25 selectable version of the 'A' configuration vector was then Apdc5::sadB and designated as BP913. made by removing the URA3 gene (1.2 kb NotI/Nael frag GPD2 Deletion ment) and adding a geneticin cassette. Klenow fragment was To delete the endogenous GPD2 coding region, a gpd2:: used to make all ends compatible for ligation, and transfor loxP-URA3-loxP cassette (SEQ ID NO:361) was PCR-am mants were screened by PCR to select a clone with the gene plified using loxP-URA3-loxP PCR (SEQ ID NO:360) as 30 ticin resistance gene in the same orientation as the previous template DNA. loxP-URA3-loxP contains the URA3 marker URA3 marker using primers BK468 (SEQID NO:368) and from (ATCC #77107) flanked by loxP recombinase sites. N160SeqF5 (SEQ ID NO:210). The resulting clone was PCR was done using Phusion DNA polymerase and primers called puC19-kan::pdc1:FBA-alsS:TRX1 (clone A) (SEQ LA512 and LA513 (SEQID NOs:340 and 341). The GPD2 ID NO:387). portion of each primer was derived from the 5' region 35 Construction of alsS Integrant Strains and Isobutanol-Pro upstream of the GPD2 coding region and 3° region down ducing Derivatives stream of the coding region Such that integration of the loXP The puC19-kan::pdc1::FBA-alsS integration vector URA3-loxP marker resulted in replacement of the GPD2 described above was linearized with PmeI and transformed coding region. The PCR product was transformed into BP913 into PNY 1507 (Example 8). PmeI cuts the vector within the and transformants were selected on synthetic complete media 40 cloned pdc1-TRX1 intergenic region and thus leads to tar lacking uracil Supplemented with 1% ethanol (no glucose). geted integration at that location (Rodney Rothstein, Methods Transformants were screened to verify correct integration by in Enzymology, 1991, volume 194, pp. 281-301). Transfor PCR using primers oBP582 and AA270 (SEQ ID NOS:357 mants were selected on YPE plus 50 ug/ml G418. Patched and 358). transformants were screened by PCR for the integration event The URA3 marker was recycled by transformation with 45 using primers N160SeqF5 (SEQ ID NO:210) and oBP512 pRS423::PGAL1-cre (SEQID NO:271) and plating on syn (SEQ ID NO:337). Two transformants were tested indirectly thetic complete media lacking histidine Supplemented with for acetolactate synthase function by evaluating the strains 1% ethanol at 30C. Transformants were streaked on synthetic ability to make isobutanol. To do this, additional isobutanol complete medium Supplemented with 1% ethanol and con pathway genes were Supplied on E. coli-yeast shuttle vectors taining 5-fluoro-orotic acid (0.1%) and incubated at 300 to 50 (pYZ090AalsS and pBP915, described below). One done was select for isolates that lost the URA3 marker. 5-FOA resistant designated as PNY 2205. The plasmid-free parent strain was isolates were grown in YPE (1% ethanol) for removal of the designated PNY2204 (MATa ura3A::loxP his3A pdc6A pRS423::PGAL1-cre plasmid. The deletion and marker pdc1A::PPDC1-DHADilvD Sm-PDC1t-pUC19-loxP removal were confirmed by PCR with primers oBP582 (SEQ kanMX-loxP-PFBA1-ALSalsS BS-CYC1t pdc5A::P ID NO:357) and oBP591 (SEQ ID NO:362). The correct 55 PDC5-ADHisadB Ax-PDC5tgpd2A::loxP fra2A adh1A:: isolate was selected as Strain CEN.PK 113-7D Aura,3::loxP UAS(PGK1)PFBA1-kivD L1(y)-ADH1t). Ahis3 Apdc6 Apdc1::ilvDSm Apdc5::sadB Agpd2::loxP and Isobutanol Pathway Plasmids (pYZ090AalsS and pBP915) designated as BP1064 (PNY1503). pYZ090 (SEQ ID NO:195) was digested with Spel and NotI to remove most of the CUP1 promoter and all of the alsS Example 13 60 coding sequence and CYC terminator. The vector was then self-ligated after treatment with Klenow fragment and trans Construction of PNY2204 and Isobutanol Pathway formed into E. coli Stbl3 cells, selecting for ampicillin resis Plasmids tance. Removal of the DNA region was confirmed for two independent clones by DNA sequencing across the ligation The purpose of this example is to describe construction of 65 junction by PCR using primer N191 (SEQID NO:370). The a vector to enable integration of a gene encoding acetolactate resulting plasmid was named pYZ090AalsS (SEQ ID synthase into the naturally occurring intergenic region NO:371). The plH468 plasmid was constructed for expres US 9,422,582 B2 103 104 sion of DHAD, KivD and HADH in yeast. pBP915 (SEQID Off-gas composition was monitored by a Prima DB mass NO: 182) was constructed from plH468 (SEQ ID NO:139) spectrometer (Thermo Electron Corp., USA). The tempera by deleting the kiv) gene and 957 base pairs of the TDH3 ture was maintained at 30 C and pH controlled at 5.2 with 2N promoter upstream of kiv D. plH468 was digested with Swal KOH throughout the entire fermentation. Directly after and the large fragment (12896 bp) was purified on an agarose inoculation with 80 mL of the inoculum, d6 was controlled by gel followed by a Gel Extraction kit (Qiagen; Valencia, agitation at 30%, pH was controlled at 5.25, aeration was Calif.). The isolated fragment of DNA was self-ligated with controlled at 0.2 L/min. Once OD of approximately 3 was T4 DNA ligase and used to transform electrocompetent reached, the gas was switched to N2 for anaerobic cultivation. TOP10 Escherichia coli (Invitrogen; Carlsbad, Calif.). Plas Throughout the fermentation, glucose was maintained in mids from transformants were isolated and checked for the 10 excess (5-20 g/L) by manual additions of a 50% (w/w) solu proper deletion by restriction analysis with the Swal restric tion. tion enzyme. Isolates were also sequenced across the deletion Methods for Analyzing Cultivation Experiments site with primers oBP556 (SEQ ID NO:372) and oBP561 (SEQ ID NO:373). A clone with the proper deletion was OD at v-600 nm was determined in a spectrophotometer designated pBP915 (pLH468Akiv)) (SEQID NO:182). 15 by pipetting a well mixed broth sample into a cuvette (CS500 pYZ090 is based on the pHR81 (ATCC #87541. Manassas, VWR International, Germany). If biomass concentration of Va.) backbone. pYZ090 was constructed to contain a chi the sample exceeded the linear absorption range of the spec meric gene having the coding region of the als.S gene from trophotometer (typically OD values from 0.000 to 0.300), the Bacillus subtilis (nt position 457-2172) expressed from the sample was diluted with 0.9% NaCl solution to yield values in yeast CUP1 promoter (nt 2-449) and followed by the CYC1 the linear range. terminator (nt 2181-2430) for expression of ALS, and a chi Measurements of glucose, isobutanol, and other fermenta meric gene having the coding region of the ilvC gene from tion byproducts in the culture Supernatant were carried out by Lactococcus lactis (nt 3634-4656) expressed from the yeast HPLC, using a Bio-Rad Aminex HPX-87H column (Bio ILV5 promoter (2433-3626) and followed by the ILV5 termi Rad, USA), with refractive index (RI) and a diode array (210 nator (nt 4682-5304) for expression of KARL 25 nm) detectors. Chromatographic separation was achieved using 0.01 NHSO as the mobile phase with a flow rate of 0.6 Example 14 mL/min and a column temperature of 40°C. Isobutanol reten tion time is 32.2 minutes under these conditions. Isobutanol Isobutanol Production-PNY 1910 and PNY 2242 concentration in off-gas samples was determined by mass 30 spectrometer. Methods: Results Preparation of Inoculum Medium Maximal biomass concentration measured as optical den 1 L of inoculum medium contained: 67 g. Yeast Nitrogen sity (OD), volumetric rate of isobutanol production, final Base w/o amino acids (Difco 0919-15-3); 2.8 g. Yeast Syn isobutanol titer, and isobutanol yield on glucose are presented thetic Drop-out Medium Supplement Without Histidine, Leu 35 in the table below. The strain PNY2242 had higher titers and cine, Tryptophan and Uracil (Sigma Y2001); 20 mL of 1% faster rates than the strain PNY 1910 and produced isobutanol (w/v) L-Leucine; 4 mL of 1% (w/v) L-Tryptophan; 3 g of with higher specific rate and titer. The specific rates are shown ethanol; 10 g of glucose. in FIG. 5. Accumulation of the DHIV DHMB in the culture Preparation of Defined Fermentation Medium supernatant was three times higher with PNY 1910 compared The volume of brothafter inoculation was 800 mL, with the 40 to the PNY2242 strain (FIG. 6), Yield of glycerol, pyruvic following final composition, per liter: 5 gammonium Sulfate, acid, BDO, DHIV+DHMB*, CKIV, and isobutyric acid on 2.8g potassium phosphate monobasic, 1.9 g magnesium Sul glucose is shown in FIG. 7. fate septahydrate, 0.2 mL antifoam (Sigma DF204), Yeast *DHIV analyzed by HPLC method includes both DHIV Synthetic Drop-out Medium Supplement without Histidine, and DHMB. Leucine, Tryptophan, and Uracil (Sigma Y2001), 16 mg 45 L-leucine, 4 mg. L-tryptophan, 6 mL of a vitamin mixture (in TABLE 19 1 L water, 50 mg biotin, 1 g Ca-pantothenate, 1 g nicotinic acid, 25g myoinositol. 1 g thiamine chloride hydrochloride, Max. Rate Titer Yield 1 g pyridoxol hydrochloride, 0.2 g p-aminobenzoic acid) 6 Strain OD600 (g/L/h) (gL) (gg) mL of a trace mineral solution (in 1 L water, 15 g. EDTA, 4.5 50 PNY1910 S.O O16 10.9 O.25 g Zinc sulfate heptahydrate, 0.8 g. manganese chloride dehy PNY2242 S.O O.23 16.1 0.27 drate, 0.3 g cobalt chloride hexahydrate, 0.3 g copper sulfate pentahydrate, 0.4 g disodium molybdenum dehydrate, 4.5 g. calcium chloride dihydrate, 3 g iron Sulfate heptahydrate, 1 g Example 15 boric acid, 0.1 g potassium iodide), 30 mg thiamine HCl, 30 55 mg nicotinic acid. The pH was adjusted to 5.2 with 2N KOH Construction of K9G9 Error Prone PCR Library and glucose added to 10 g/L. Preparation of Inoculum Error prone PCR of K9G9 was performed to generate a A 125 mL shake flask was inoculated directly from a frozen library that can be screened for variants with increases in the vial by pipetting the whole vial culture (approx. 1 ml) into 10 60 Km values for NADPH relative to NADH. Mutagenic PCR of mL of the inoculum medium. The flask was incubated at 260 K9G9 was performed with the GeneMorph R. II EZClone rpm and 30° C. The strain was grown overnight until OD Domain Mutagenesis Kit (Catalog #200552; Agilent Tech about 1.0 OD at WF600 nm was determined in a Beckman nologies, Stratagene Products Division, La Jolla, Calif.). spectrophotometer (Beckman, USA). Primers K9G9 EZ F1 (AAA CAT GGA AGA ATG TAA Bioreactor Experimental Design 65 GATGGC: SEQID NO:390) and K9G9 EZ R1 (TCA GTT Fermentations were carried out in 1 L Biostat B DCU3 GTT AAT CAA CTT GTC TTC G: SEQ ID NO:391) were fermenters (Sartorius, USA) with a working volume on 0.8 L. commercially synthesized by Integrated DNA Technologies, US 9,422,582 B2 105 106 Inc (Coralville Iowa). Other than the primers, template, and pendent KARI activity. A K9G9 variant with reduced NADP" ddHO, reagents used here were supplied with the kit indi inhibition of activity with NADH can potentially exhibit an cated above. The mutagenic PCR mixture consisted of 4 ul of increase in the ratio of the K for NADPH to the K for pHR81-PIlv5-KARI-K9.G9 (SEQID NO:392) (770 ng/ug), NADH. With a specific objective to increase K for NADPH 1.25 ul of each primer (100 ng/ul stocks), 5 ul of 10x relative to Km for NADH, the hits from the screen were Mutazyme II reaction buffer, 1 ul of 40 mM dNTP mix, 1.5ul partially purified and kinetic analyses were performed to of Mutazyme II DNA polymerase, and 36 ul of ddHO. The determine V, and K parameters with NADH and with following conditions were used for the PCR reaction: The NADPH. starting temperature was 95°C. for 2.0 min followed by 30 High Throughput Screening Assay of K9G9 Gene Library heating/cooling cycles. Each cycle consisted of 95°C. for 30 10 High throughput Screening of the gene libraries of mutant sec. 48°C. for 30 sec, and 72°C. for 2.0 min. At the comple KARI enzymes was performed as described herein: 10x tion of the temperature cycling, the sample was kept at 72°C. freezing medium containing 554.4 g/L glycerol. 68 mM of for 10.0 min more, and then held awaiting sample recovery at (NH4)2SO4 mM MgSO4, 17 mM sodium citrate, 132 mM 4°C. The reaction product was separated from the template KHPO, 36 mMKHPO was prepared with molecular pure via agarose gel electrophloresis (1% agarose, 1XTBE buffer) 15 water and filter-sterilized. Freezing medium was prepared by and recovered using the StrataPrep R DNA Gel Extraction Kit diluting the 10x freezing medium with the LB medium. An (Cath4.00766, Agilent Technologies, Siratagene Products aliquot (200LL) of the 1x freezing medium was used for each Division, La Jolla, Calif.) as recommended by the manufac well of the 96-well archive plates (cat #3370, Corning Inc. turer. Corning, N.Y.). The isolated reaction product was employed as a Clones from the LB agar plates were selected and inocu megaprimer to generate gene libraries in the “EZClone reac lated into the 96-wed archive plates containing the freezing tion' of the kit indicated above. Other than the megaprimer, medium and grown overnight at 37°C. without shaking. The template, and ddPIO, reagents used here were Supplied with archive plates were then stored at -80° C. E. coli strain the kit indicated above. The reaction consisted of 25ul of the Bw25113(AilvC), as described in U.S. Pat. No. 8,129,162, 2x EZClone enzyme mix, 4 Jul of megaprimer (125 ng/l), 2 ul 25 transformed with pBAD-HisB (Invitrogen) was always used of K9G9 in apBAD.KARI vector (25 ng/ul), 3 ul of EZClone as the negative control. The positive control for the library solution, and 160 of ddHO. The following conditions were was K9G9-KARI in E. coli strain Bw25113 (AilvC), as used for the reaction: The starting temperature was 95°C. for described in U.S. Pat. No. 8,129,162. 1.0 min followed by 30 heating/cooling cycles. Each cycle Clones from archive plates were inoculated into the consisted of 95°C. for 50 sec, 60° C. for 50 sec, and 68°C. for 30 96-deep well plates. Each well contained 3.0 ul of cells from 10.0 min. At the completion of the temperature cycling, the thawed archive plates, 200 ul of the LB medium containing samples were kept at 72°C. for 10.0 min more, and then held 100 g/ml ampicillin and 0.02% (w/v) arabinose as the awaiting sample recovery at 4°C. 1 ul of the Dpn I (10 U/ul) inducer. Cells were the grown overnight at 37°C. with 80% was added and the mixture was incubated for 4 hours at 37°C. humidity while shaking (900 rpm), harvested by centrifuga 4 ul of the Dpn I digested “EZClone reaction' product was 35 tion (3750 rpm, 5 min at 25° C.). (Eppendorf centrifuge, then transformed into 50 ul XL10-Gold(R) Ultracompetent E. Brinkmann Instruments, Inc. Westbury, N.Y.) and the cell coli cells (provided in the GeneMorph R. H EZClone Domain pellet was stored at -20°C. for later analysis. Mutagenesis Kit) as recommended by the manufacturer. The The assay Substrate. (R.S)-acetolactate, was synthesized as transformants were spread on agar plates containing the LB described by Aulabaugh and Schloss (Aulabaugh and medium and 100 g/ml amplicillin (Cati L1004, Teknova Inc. 40 Schloss, Biochemistry, 29: 2824-2830, 1990). All other Hollister, Calif.), incubated at 37° C. overnight, and store at chemicals used in the assay were purchased from Sigma. The 4°C. These steps were repeated with 4 ul Dpn I digested enzymatic conversion of acetolactate to C.B-dihydroxyisov “EZClone reaction' product and 50 ulcells per transforma alerate by KARI was followed by measuring the oxidation of tion for a total of 10 transformations. The resultant library in the cofactor, NADH, from the reaction at 340 nm using a plate XL-Gold was scraped off the agar plates with a solution 45 reader (Saphire 2, Tecan, Mannedorf, Switzerland). The containing M9 salts, combined, diluted into media containing activity was calculated using the molar extinction coefficient the LB medium and 100 ug/ml amplicillin, and incubated at of 6220 Mcm NADH. 37°C. overnight. The library DNA was isolated from the cells Frozen cell pellet in deep-well plates and BugEBuster with the QIAprep Spin Miniprep Kit (Catalog #2706; Qiagen, (Novagen 71456, Darmstadt, Germany) were warmed up at Valencia, Calif.) according to the protocol provided by the 50 room temperature for 30 min at the same time. 75 ul of 50% manufacturer. The amplified library was then used to trans BugEBuster (v/v in water) was added to each well after 30 min form an electro-competent strain of E. coli Bw25113 (AilvC) warm-up and cells were suspended using plate shaker. The using a BioRad Gene Pulser II (Bio-Rad Laboratories Inc., plates with cell pellet/50% Bug Buster suspension were incu Hercules, Calif.). The transformed clones were spread on bated at room temperature for 30 min. Cell lysate diluted with agar plates containing the LB medium and 100 ug/ml ampi 55 75uL d.d water, resulting in 0.5x lysate. Assays of the diluted cillin (#101320-154, Teknova Inc. Hollister, Calif.) and incu cell free extracts were performed at 30°C. in buffer contain bated at 37° C. overnight. Clones were employed for high ing 2.4 mM (R/S)-acetolactate, 100 mM HEPES pH 6.8, 100 throughput Screening as described in Example 16. mM KC1, 10 mM MgCl, 150 uM NADH, 12.5 uL 0.5x cell lysate with or without 2.5 mM NADP+. Example 16 60 Identification of K9G9 Variants with Reduced NADP+ Inhi bition of NADH KARI Activity Identification of K9G9 Variants with Increased K The ratio for the measured rate of NADH oxidation in the for NADPH Via Screening for Diminished NADP+ presence of NADP+ to the measured rate of NADH oxidation Inhibition of NADH Activity in the absence of NADP+ was calculated for each variant and 65 positive control well (2 per plate). The mean and standard The K9G9 library described in Example 15 was screened deviation of ratios for all of the positive control wells (104 for variants with reduced NADP" inhibition of NADH-de total) were calculated. US 9,422,582 B2 107 108 A variant well was considered to contain an initial hit if the Kinetic Analysis of Partially Purified Variant Protein rate in the absence of NADP+ was greater than 0.1 OD/hr and E. coli strain Bw25113 (AilvC), as described in U.S. Pat. the rate ratio was both greater than 0.45 (three standard devia No. 8,129,162, was used to express the seventeen variants and tions higher than the positive control mean) and less than 1. A positive control K9G9. Strains were grown for 8 hours in 10 total of 521 hits were identified from a pool of 4607 potential mL of LB broth (#46-060-CM, Mediatech, Manassas, Va.) variants. These initial hits were consolidated, forming a containing 100 g/mL amplicillin at 37° C. with shaking in smaller library for further analysis. 125 mL baffled, vented filtered lid flasks. 200 uL of this Secondary Screening of Initial Library Hit culture was used to inoculate 100 mL LB broth with 100 The consolidated hit library was grown in biological trip ug/mL amplicillin and 0.2% (w/v) arabinose added. These licate and cell free extracts were prepared and assayed as 10 described above. Rate ratios were then calculated for the cultures were grown for 16 to 18 hours at 37°C. with shaking variants and positive controls as above. Final hits that were in 500 mL baffled, vented filtered lid flasks. Cells were har selected for detailed kinetic analysis met the following crite Vested in a 20 mL and two 40 mL aliquots, Supernatants were ria: the rate in the absence of NADP+ was greater than 0.6 decanted and the pellets were frozen at -80°C. OD/hr, rate ratio was greater than 0.51 and less than 1, and at 15 To partially purify the protein, the cell pellet corresponding least two out of three biological replicates passed the criteria. with the mL cell culture harvest was thawed and resuspended Seventeen hits were identified for kinetic analysis and in 1 mL Bug Buster Master Mix (Novagen 71456, Darmstadt, streaked out on to LB plates with 100 ug/mL ampicillin Germany). The cell Suspension was incubated at room tem added. perature for 15 minutes followed by 15 minute incubation at Sequence Analysis of K9G9 Variants 60° C. to denature the heat liable proteins. Cell debris and DNA sequencing of the seventeen variants identified from denatured proteins were pelleted by centrifugation for 30 the secondary HTS screening was accomplished by using minutes at 4°C. Supernatant containing the heat stable cyto TempliPhiTM (GE Healthcare) with the primers pBAD-For solic protein, including K9G9 and variants, was recovered (ATGCCATAGCATTTTTATCC: SEQ ID NO: 393) and and stored at 4°C. pBAD-Rev (CTGATTTAATCTGTATCAGGCT, SEQ ID 25 The total protein of the heat stable cytosolic protein frac NO:394). tion was measured by the Bradford Assay using Coomaisse Plus (Thermo Scientific #23238, Rockford, Ill.). BSA was TABLE 20 employed as the standard. The concentration of protein was measured by determining the absorbance at 595 nm using a Amino Acid Substitutions for K9G9 Variants 30 Cary 300 spectrophotometer (Agilent Technologies, Wilm Varian Seq Amino Acid Substitutions ington, Del.). 878 C 873 None identified To determine V, and K values for NADH and NADPH, 879 A7 874 K90M the partially purified proteins were assayed at various con 879 C2 875 H37O centrations of NADH (0, 16.4, 32.8, 65.7. 98.5, 164.3 and 880 A11 876 A182T, P320O 35 246.5 M) and NADPH (0, 12.8, 25.6, 51.2, 76.8 and 128 880 B4 877 K57E WO), Assays were conducted at 30° C. in 100 mM HEPES 880 D11 878 K90M, A174V (pH 6.8), 10 mM MgCl, 100 mM KCl and 4.8 mM R/S- acetolactate. Between 0.1 to 0.35 mg/mL total protein was 882 B12 882 H118R 40 added to the assay. The rate of conversion of S-acetolactate to 882 C10 883 G31S, R61S, C121Y, D129N, G183D DHIV was measured via monitoring the oxidation of NAD 882 C7 933 ES4G (P)H at 340 nm using a Cary 300 spectrophotometer (Agilent Technologies, Wilmington, Del.). The activity was calculated 882 G6 93S GSSA using the molar extinction coefficient of 6220 K cm. V. 882 G12 936 V142L, S285Y and K values were calculated by plotting specific activity 883 C4 937 A17OV 45 883 G9 938 L197M, K31OM (U/mg) vs. cofactor concentration and the data were fit to the Michaelis-Menten equation using Kaleidagraph software (Synergy, Reading, Pa.). TABLE 21 Kinetic Values for Partially Purified K9G9 Variants as Determined via NAD(P)H Consumption Assays Vmax K. Vmax/Kn Vmax Vmax/Kn NADPH, NADPH, NADPH, NADH, K NADH, NADH, Variant Umg M Limin mg Umg M L/min * mg K9G9 1.53 45.5 O.O34 1.09 674 O.O16 878 C1 0.75 42.2 O.018 O.62 107.8 O.OO6 879 A7 2.51 S46 O.OOS 1.44 263 O.OO6 879 C2 1.27 103 O.O12 1.23 187 O.007 880 A11 0.72 86.9 O.OO8 O.S1 117 O.004 880 B4 1.23 233 O.OOS 1.14 133 O.O09 880 D11 1.38 130 O.O11 1...SO 232 O.OO6 881A2 O.88 93.5 O.OO9 1.13 166.8 O.007 881. G3 O.69 99.2 O.OO7 O.69 618 O.O11 881 G9 1.03 158 O.OO7 O.96 310 O.OO3 882 B12 O.87 30.3 O.O29 O49 78.9 O.OO6 882 C10 O.71 34.1 O.O21 O.S6 97.9 O.OO6 882 C7 1.62 45.3 O.036 O.96 75.6 O.O13 US 9,422 582 B2 109 110 TABLE 21-continued Kinetic Values for Partially Purified K9G9 Variants as Determined via NAD(P)H Consumption Assays Vmax K. Vmax/Kn Vmax Vna/Kn NADPH, NADPH, NADPH, NADH, K NADH, NADH, Variant Umg M Limin mg Umg M L/min * mg 882 F9 1.39 256 O.OOS 1.19 335 O.004 882 G6 O.9S 47.4 O.O2O O.74 98.7 O.007 882 1.06 63.5 O.O17 0.75 81.2 O.O09 G12 883 C4 1.26 46.8 O.O27 O.67 83.9 O.OO8 883 G9 1.26 38 O.O33 1.01 71.9 O.O14

Example 17 15 KARI sequences were inoculated into LB medium containing 100 ug/ml amplicillin and incubated at 33°C. with shaking at Manual Recombination of K9 KARI Variants Via 225 rpm. Plasmid DNA was isolated from the cells with the Site Directed Mutagenesis QIAprep Spin Miniprep Kit (Catalog #2706; Qiagen, Valen 2O cia, Calif.) according to the protocol provided by the manu Site directed mutagenesis of the K9G9 derivatives K9JB4 facturer. The resultant clones K9.JB4P and K9JG3P were and K9JG3 (identified in Example 16 as 880 B4 and 881 G3, derived from K9JB4 and K9JG3, respectively. respectively) was performed to incorporate other amino acid Additional Site Directed Mutagenesis was Performed as Described Above With Modifications. changes described in the examples. The initial step was to add 25 Variant K9JA1 was derived from K9JG3P employing to the N87P substitution, which is described in Example 5. primers oK57E1 (GGTTTATTCGAAGGTGCGGAG Mutations were introduced into the KARI genes with primers GAGTGGAAAAGAGCTG: SEQID NO:397) and oK57E1r N87PC1 (CTGACATCATTATGATCTTGATCCCA (CAGCTCTTTTCCACTCCTCCGCACCTTC GATGAAAAGCAGGCTACCATGTAC; SEQID NO:395) GAATAAACC: SEQID NO:398). The mutagenesis reaction and N87PC1r (GTACATGGTAGCCTGCTTTTCATCTGG 30 contained 1 ul K9JG3P (50 ng/ul), 1 ul of each primer (150 ngful), 5ul of 10x reaction buffer, 1 ul of dNTP mix, 1 ul of GATCAAGATCATAATGATGT CAG; SEQ ID NO: 396), Pful Jltra HF DNA polymerase, and 40 ul of ddH.O. Liquid employing the QuikChangeR II Site-Directed Mutagenesis cultures for E. coli transformants were incubated at 37° C. Kit (Catalog #200523; Agilent Technologies, Stratagene instead of 33° C. Products Division, La Jolla, Calif.). Except for the primers, 35 Variant K9SB2 was derived from K9JB4P employing templates, and ddH2O, all reagents used here were Supplied primers oY53F1 (GTAACGTTATCATTGGTTTATAC with the kit indicated above. Primers were commercially GAAGGTGCGGAGGAG: SEQID NO:399) and oY53F1r synthesized by Integrated DNA Technologies, Inc (Coralville (CTCCTCCGCACCTTCGAATAAACCAAT GATAACGTTAC: SEQID NO: 400). The mutagenesis reac Iowa). Templates were K9 KARI variants in E. coli vectors 40 tion contained 1 ul K9JB4P (50 ng/ul), 1 ul of each primer (pBAD.KARI). For mutagenesis of K9JB4, the reaction mix (150 ngful), 5ul of 10x reaction buffer, 1 ul of dNTP mix, 1 ture contained 1 lul K9JB4 (50 ng/ul), 1 ul of each primer (150 ul of Pful Jltra HF DNA polymerase, and 40 ul of dd H2O. ng/ul), 5ul of 10x reaction buffer, 1 ul of dNTP mix, 1 ul of Liquid cultures for E. coli transformants were incubated at Pfu Ultra HF DNA polymerase, and 40 ul ofddHO. For, the 45 37° C. instead of 33° C. K9JG3 reaction mixture, 1 ul K9JB4 (50 ng/ul) was substi Variant K9SB2-K90L was derived from K9SB2 employ tuted with 1 ul K9JG3 (50 ng/ul). The following conditions ing primers oK90L1(GATCTTGATCCCAGATGAATTG CAGGCTACCATGTACAAAAA C: SEQ ID NO: 401) and were used for both reactions: The starting temperature was oK90L1 r (GTTTTT GTA CAT GGT AGO CTG CAATTC 95°C. for 30 sec followed by 16 heating/cooling cycles. Each so ATC TGG GAT CAA GAT C; SEQ ID NO: 402). The cycle consisted of 95°C. for 30 sec, 55° C. for 30 sec, and 68° mutagenesis reaction contained 2.5ul K9SB2 (50 ng/ul), 1 ul C. for 5.0 min. At the completion of the temperature cycling, of each primer (150 ng/ul), 5ul of 10x reaction buffer, 1 ul of dNTP mix, 1 ul of Pful Jltra HF DNA polymerase, and 38.5ul the samples held awaiting sample recovery at 4°C. 1 ul of the of ddH.O. For the heating/cooling cycles, the step of 55° C. Dpn I (10 U/ul) was added to each reaction and the mixtures 55 for 30 sec was increased to 1 min. Liquid cultures for E. coli were incubated for 1 hour at 37° C. transformants were incubated at 37°C. instead of 33°C. 2 Jul of each mutagenic reaction was transformed into One Variant K9SB2-K90M was derived from K9SB2 employ Shot(R) TOP10 Chemically Competent E. coli (Invitrogen, ing primers oK90M1 (CTTGATCCCAGATGAAATGCAG Catalog #C404003) according to the manufacturer's instruc GCTACCATGTACAAAAAC; SEQ ID NO: 403) and tions. The transformants were spread on agar plates contain- 60 oK90M1r (GTTTTT GTA CAT GGT AGO CTG CAT TTC ing the LB medium and 100 ug/ml amplicillin (Catil 1004, ATCTGG GAT CAAG: SEQID NO: 404). The mutagenesis Teknova Inc. Hollister, Calif.) and incubated at 37° C. over reaction contained 2.5 ul K9SB2 (50 ng/ul), 1 ul of each night. Multiple transformants were then selected for Tem primer (150 ngful), 5ul of 10x reaction buffer, 1 ul of dNTP pliphi TM (GE Healthcare) based DNA sequencing employing mix, 1 ul of Pful Jltra HF DNA polymerase, and 38.5 ul of primers pBAD-For (ATGCCATAGCATTTTTATCC: SEQ 65 ddHO. For the heating/cooling cycles, the step of 55° C. for ID NO: 393) and pBAD-Rev (CTGATTTAATCTGTAT 30 sec was increased to 1 min. Liquid cultures for E. coli CAGGCT: SEQID NO:394). Transformants with confirmed transformants were incubated at 37°C. instead of 33°C., US 9,422,582 B2 111 112 TABLE 22 gation; the Supernatant was discarded and cell pellets were frozen at -80° C. until purification. Amino Acid Substitutions of K9G9 Variants and Combinations K9G9 and all variants were purified using the same pro cess. Two cell pellets, representing 40 mL cell culture ali quots each, were resuspended in 4 mL Bug Buster Master Mix (Novagen 71456, Darmstadt, Germany) and incubated for 15 minutes at room temperature followed by 15 minutes at 60° C. Denatured proteins and cell debris was pelleted by centrifugation at 7,000 rpm for 30 minutes and 4°C. The 10 Supernatant was decanted, save and filtered through a Acro disc 0.2 um syringe filter (PN4192, Pall, Ann Arbor, Mich.). K9G9 was purified from the filtered heat treated cell free extract using a GE Healthcare HiLoad 26/60 Superdex 200 gel filtration column (17-1071-01, Buckinghamshire, 15 England). The column was pre-equilibrated with 0.2 CV equilibration with 50 mM HEPES (pH 7.5) 5 mM MgCl, buffer at a 2.0 mL/min flow rate prior to protein loading, K9G9 and variants were eluted over a 1.5 CV isocratic step consisting of 50 mM HEPES (pH 7.5) 5 mM MgCl, buffer at a 2.0 mL/min flow rate. Fractions 2.5 mL in volume were Kinetic Characterization of Purified K9G9 collected using a Frac-950 fraction collector (Buckingham Derivatives with Increased Ratios of K, NADPH to shire, England) in a serpentine pattern, K9G9 and variants all KNADH eluted between fractions D5-E5 or D6-E4. Fractions were pooled using a 15 mL Amicon Ultra YM-30 spin filter K9G9 and variants were overexpressed in E. coli strain 25 (UFC903008, Millipore, Billercia, Mass.) and washed with Bw25113 (AilvC), as described in U.S. Pat. No. 8,129,162, 10 mL 100 mM HEPES (pH 6.8) and 10 mM MgCl, buffer. and purified in order to obtain a more accurate determination Filtrate was discarded and the purified protein was eluted of cofactor affinity and maximum velocity. from the membrane using 1 mL buffer containing 100 mM For expression and characterization, E. coli plasmids HEPES (pH 6.8) and 10 mM MgCl. (pBAD.KARI) were used to transform an electro-competent 30 To determine V, and K values for NADH and NADPH, strain of E. coli Bw25113 (AivC) as described in U.S. Pat. No. the purified proteins were assayed at various concentrations 8,129,162, using a BioRad Gene Pulser II (Bio-Rad Labora of NAD(P)H (0 to 1000 uM) coupled with a NAD(P)H regen tories Inc., Hercules, Calif.). The transformed clones were eration system. Assays were conducted at 30°C. in a buffer spread on agar plates containing the LB medium and 100 containing 100 mM MOPS, pH 6.8, 10 mM MgCl, 1 mM ug/ml ampicillin (#101320-154, Teknova Inc. Hollister, 35 EDTA, 5 mM (R/S)-acetolactate, 1 mM glucose-6-phos Calif.) and incubated at 37° C. overnight. A single transfor phate, 3 mU/L glucose-6-phosphate dehydrogenase. The mant for each strain was streaked out onto LB plates with 100 reaction as quenched after ten minutes with three Volumes ug/mL amplicillin. A single colony from each of these plates 0.1% formic acid. DHIV concentration was measured using was used to inoculate 10 mL LB broth with 100 lug/mL LC-MS. The rate of conversion of S-acetolactate to DHIV ampicillin. These cultures were grown for 8 hours at 37° C. 40 was determined by measuring the amount of DHIV produced with shaking in 125 mL baffled flasks with vented, filtered at a fixed time point. V, and K values were calculated by lids. 200 uL of this culture was used to inoculate two 500 mL plotting specific activity (U/mg) vs. cofactor concentration baffled flasks with filtered vented lids containing LB broth and the data were fit to the Michaelis-Menten equation. Mea with 100 ug/mL amplicillin and 0.2% (w/v) arabinose. The Surements of acetolactate Km values (at a fixed concentration expression cultures were grown for 16-18 hours at 37°C. with 45 of NADH) indicated that the fixed acetolactate concentration shaking. Cells were harvested in 40 mLaliquots via centrifu employed for the cofactor Km determinations was saturating. TABLE 23

Kinetic Values for Purified K9G9 Variants as Determined via DHIV Formation Assays Vmax Vmax/Kn Vmax Vmax/Kn NADPH, K NADPH, NADPH, NADH, K NADH, NADH, Variant Umg M Limin mg Umg M L/min * mg 2.2 24.1 O.091 1.9 78.2 O.O24 2.7 249 O.O11 3.4 115 O.O3O 2 83.2 O.O24 2.9 34.1 O.O85 3.1 113 O.O27 2.8 106 O.O26 1.8 33.6 O.OS4 2.1 18.1 O. 116 2.6 63.4 O.O41 3.4 14 O.243 1.7 44.8 O.O38 1.8 11.6 0.155 2.1 173 O.O12 2.4 28.6 O.O84

1.8 245 O.OO7 2.2 41.3 O.OS3 US 9,422,582 B2 113 114 Example 19 Anaerobic cultures were grown for 24 to 72 hours with a target ODoo value of at least 1.2. Additional anaerobic Isobutanol Production of K9G9 Derivatives with growth steps used the cells from the previous anaerobic cul Increased Ratios of K, NADPH to K, NADH ture step as inoculant. Three transformants were evaluated for each variant. The yeast expression plasmids for K9JB4. K9JB4P. HPLC Analysis of Yeast Strains with K9G9 KARI Variants K9JG3, K9JG3P. K9JA1, and K9SB2 were made by subclon Samples were taken for HPLC analysis and to obtain ing of the variant KARI genes from E. coli vectors ODoo values at the end of the anaerobic growth period. (pBAD.KARI) into pHR81-PIlv5-KARI-K9.G9 at PmeI and HPLC analysis was performed using a Waters 2695 separa Sfil sites. The resultant plasmids together with pHR81-PIlv5 10 KARI-K9.G9 and pHR81-PIlv5-KARI-K9D3 (SEQID NO: tions unit, 2996 photodiode array detector, and 2414 refrac 181) were analyzed for isobutanol production and by-product tive index detector (Waters, Milford, Mass.) with a Shodex formation in yeast. Yeast pathway strains were made in Sugar SH-G pre-column and Shodex Sugar SH 1011 separa PNY2259 (MATa ura3A:loxP his3A pdc6A pdc1A::P tions column (Shodex, JM Science, Grand Island, N.Y.). PDC1-DHADlilvD Sm-PDC1t-PFBA1-ALS|alsSBs 15 Compounds were separated by isocratic elution at 0.01 N CYC1t pdc5A::PPDC5-ADHisadB Ax-PDC5t gpd2A: sulfuric acid with a flow rate of 0.5 mL/min. Chromatograms loxP fra2A::PPDC1-ADHladh H1-ADH1t adh1A::UAS were analyzed using the Waters Empower Prosoftware. (PGK1)PFBA1-kivD Lg(y)-ADH1typrcA15A::PPDC5 Molar yields for glycerol, isobutanol and the glycerol/ ADHladh H1-ADH1tymr226CA ald6A::loxP; Example 22) isobutanol ratio were determined. Mean and standard devia host by co-transforming the KARI vectors as pathway plas tions were calculated from triplicate analyses for each vari mid #1, and pBP915 (pRS423-P-DHAD-P- ant. Student's t-test was then employed to determine if the hADH1; SEQ ID NO: 182) as pathway plasmid #2. The difference in the values was statistically significant from the transformed cells were plated on synthetic medium without K9D3 control values. For the new variants, the increases in histidine or uracil (1% ethanol as carbon source). Three trans Kvalues for NADPH relative to K for NADH are expected formants were transferred to fresh plates of the same media. 25 result reduced NADPH utilization. Results reported in the The transformants were tested for isobutanol production Table below and in FIG. 9 indicate that the new variants with under anaerobic conditions in serum vials. increased ratios of K, NADPH to K, NADH exhibit higher Yeast colonies from the transformation on SE-Ura-His isobutanol to glycerol ratios relative to K9D3 and K9G9. plates appeared after 3-5 days. The three colonies from each K9SB2 demonstrated a 35% increase in isobutanol titer com variant were patched onto fresh SE-Ura-His plates, incubate 30 pared to K9D3. at 30° C. for 3 days. Growth Media and Procedure Two types of media were used during the growth procedure TABLE 24 of yeast strains: an aerobic pre-culture media and an anaero K9G9 Variants Kinetic and Isobutanol Data bic culture media. All chemicals were obtained from Sigma 35 K. unless otherwise noted (St. Louis, Mo.) (NADPH), Isobutanol/ Aerobic pre-culture media (SE-Ura-His): 6.7 g/L yeast Vari- K. Glycerol Isobutanol Isobutanol nitrogen base without amino acids (Difico, 29 1940, Sparks, ant (NADH) Ratio Molar Yield Titer, mM Md.), 1.4 g/L yeast synthetic drop-out medium Supplement Experi- K9D3 O.24 1.67 + O.O2 O-5810.007 33.9 - 18 40 without histidine, leucine, tryptophan and uracil, 0.2% etha ment 1 K9UB4 2.2 2.10 OO6 O.603 OOO6 353 - 1.3 nol, 0.2% glucose, 0.01% w/v leucine and 0.002% w/v tryp K9JG3 1.1 2.07 - 0.06 0.598 OOO4 39.1 - 1.6 tophan. Experi- K9D3 O.24 1.75- 0.06 0.586 O1OO 63.7 0.6 ment 2 K9JA1 4.5 224 0.04 O.611 OOO2 78.25.4 Anaerobic culture media (SEG-Ura-His): 50 mM MES K9SB2 3.9 2.21 - 0.1O O.608 OOO7 77.2 - 1.4 (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids Experi- K9G9 O.31 2.10 - 0.03 0.624 OO11 54.21.5 (Difico, 29 1940, Sparks, Md.), 1.4 g/L yeast synthetic drop 45 ment 3 K9JG3P 1.9 2.56 0.08 O.652 OOO9 66.34.O out medium Supplement without histidine, leucine, tryp K9JB4P 2.4 2.54 - 0.07 O.654 OOO6 61.5 - 3.4 tophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thia mine and 10 mg/L ergosterol made up in 50/50 V/v Tween/ Example 20 ethanol Solution. 50 The patched cells were inoculated into 25 mL SEG-Ura, His media with 0.2% glucose and 0.2% ethanol, and grown Construction of K9SB2 Error Prone PCR Library under progressively oxygen-limited conditions with lid closed for approximately 48 hours at 30° C. with shaking, The K9SB2 error prone PCR library was constructed in a until a target ODoo value of approximately 1.5 to 2 was 55 similar manner as the K9G9 library with the following modi achieved. ODo values were recorded. Cells were pelleted fications. The mutagenic PCR mixture consisted of 9.5 ul via centrifugation and the Supernatant was discarded. Cell K9SB2 in apBAD.KARI vector (190ng/ul), 1.25ulofprimer pellets were transferred into a Coy Anaerobic Bag (Grass K9G9 EZ F1 (100 ng/ul), 1.25ul of primer K9G9 EZ R1 Lake, Mich.) where pellets were resuspended in 1.0 mL (100 ng/ul), 5ul of 10x Mutazyme H reaction buffer, 1 ul of anaerobic growth media (SEG-Ura-His). The resuspended 60 40 mM dNTP mix, 1.5 ul of Mutazyme HDNA polymerase, cell pellets were used to inoculate 30 mL SEG-Ura-His media and 30.5ul of dd H2O. The “EZclone reaction” contained 25 in 50 mL serum bottles (Wheaton, 223748, Millville, N.J.) to ul of the 2x EZClone enzyme mix, 3 ul of megaprimer a target initial ODoo value of 0.2. Allanaerobic media, serum (K9SB2 mutagenic PCR product, 190ng/ul), 2.6 ul of K9SB2 vials, stoppers and crimps were allowed to degas in the template DNA (19 ng/ul), 3 ul of EZClone solution 1, and 16 anaerobic bag for at least 24 hours prior to inoculation. Serum 65 ul ofddHO. For the Dpn I step, the mixture was incubated for bottles were stoppered, crimped and transferred out of the 3 hr at 37° C. Clones were employed for high throughput anaerobic bag and grown at 30°C. with shaking at 240 rpm. screening as described in Example 21. US 9,422,582 B2 115 116 Example 21 DNA sequencing of the 68 variants identified from the NADH rate screening was accomplished by using Tem Screening for K9SB2 Variants with Further pliPhiTM (GE Healthcare) with primers pBAD-For (ATGC Increased Ratios of Kim NADPH to Kim NADPH Based on Increased NADH to NADPH Activity CATAGCATTTTTATCC: SEQID NO:393) and pBAD-Rev Ratios (CTGATTTAATCTGTATCAGGCT, SEQ ID NO:394). 17 sequences were different form wild type and the amino acid The K9SB2 library described in Example 20 was screened substitutions of the 2 substitutions that appeared repeatedly for variants with reduced NADPH affinity. With the specific are listed in the second table below. objective to increase Km for NADPH relative to Km for 10 NADH, the hits from the screen were partially purified and TABLE 25 kinetic analyses were performed to determine V, and K K9SB2 Variants Amino Acid Substitutions parameters with NADH and with NADPH. High Throughput Screening Assay of K9SB2 Gene Library 15 Variants were screened using HTS as described in Example 16, with the following exceptions. Assays buffer consisted of 2.4 mM (R/S)-acetolactate, 100 mM HEPES pH 6.8, 10 mM MgCl, 150M NADH or 100M NADPH and 12.5uL 0.5x cell lysate. The ratio for the measured rate for oxidation of 100 uM NADPH to the measured rate for oxidation of 150 uMNADH was calculated for each variant and positive control well (2 25 per plate). A variant well was considered to contain an initial hit if the NADH rate was greater than 0.6 OD/hr and the rate ratio (NADPH/NADH) was less than 0.37 (three standard deviations lower than the positive control mean). A total of 30 218 hits were identified from a pool of 4947 potential vari ants. These initial hits were consolidated, forming a smaller library for further analysis. The consolidated initial hit library was grown in biological 35 triplicate and cell free extracts were prepared and assayed as described above. Rate ratios were then calculated for the variants and positive controls as above. Final hits that were selected for detailed kinetic analysis met the following crite 40 ria: the NADPH/NADH rate ratio was less than 0.45, the NADH rate was greater than 0.6 OD/hr and at least two out of three biological replicates passed the criteria. 107 variants were identified. Data were also analyzed to identify variants that had a 45 higher rate of conversion for S-acetolactate to DHIV with the NADH cofactor. The average rate and standard deviation of NADH oxidation was calculated for all the positive controls. A variant was considered a potential hit if the rate of NADH 50 oxidation was at least 3 standard deviations higher than the rate of the positive control (2.524 OD/hr). 68 variants were identified and sequence analysis determined that 17 had at least one amino acid substitution. The substitutions T93A and 55 T93I each appeared twice and variants 2017 B12 and D6 have been selected for further analysis. DNA sequencing of the 107 variants identified from the secondary HTS screening was accomplished by using Tem 60 pliPhiTM (GE Healthcare) with the primers pBAD-For (AT GCCATAGCATTTTTATCC: SEQID NO:393) and pBAD Rev (CTGATTTAATCTGTATCAGGCT, SEQID NO:394). 105 sequences were different from the parent and the amino 65 acid substitutions are listed in the first of the following two tables. US 9,422,582 B2 117 118 TABLE 25-continued TABLE 26

K9SB2 Variants Amino Acid Substitutions K9SB2 Variants Amino Acid Substitutions AA Seq ID NO; Nucleic acid Variant SEQ ID NO Amino Acid Substitutions K9SB2 427 Y53F, S56A, K57E, S58E, N87P 2017 B12 639: 640 2017 D6 641; 642 10 Kinetic Analysis of Partially Purified K9SB2 Variant Proteins E. coli strain Bw25113 (AilvC), as described in U.S. Pat. No. 8,129,162, was used to express the 107 variants from the secondary HTS screening and positive control K9SB2. 15 Clones from archive plates were inoculated into the 96-deep well plates. Each well contained 3.0 ul of cells from thawed archive plates, 200 ul of the LB medium containing 100 g/ml ampicillin and 0.02% (w/v) arabinose as the inducer. Cells were the grown overnight at 37°C. with 80% humidity while shaking (900 rpm), harvested by centrifugation (4000 rpm, 7 min at 4°C.) (75004251, Thermo Scientific, Rockford, Ill.) and the cell pellet was stored at -80°C. for later analysis. Frozen cell pellets in deep-well plates were thawed at room temperature for 30 minutes at the same time. 75 ul of 50% 25 BugEBuster (Novagen 71456, Darmstadt, Germany) (0/in water) was added to each and cells were Suspended using a plate shaker. The cells suspension in 50% Bug Buster was incubated for 30 minutes at room temperature which was then followed by a 15 minute incubation at 60° C. Cell debris and denatured heat labile proteins were pelleted by centrifugation 30 (4000 rpm, 15 min at 4°C.) (75004251, Thermo Scientific, Rockford, Ill.) and 75ull of the supernatant was transferred to a flat bottomed 96-well plate (Corning, 3370, Corning, N.Y.) and diluted two-fold with 75 uL 100 mM HEPES (pH 6.8), 100 mM KC1, 10 mM MgCl. 35 Total protein was determined by using the Bradford Assay with Coomaisse Plus (Thermo Scientific, #23238, Rockford, Ill.). BSA was employed as the standard. The concentration of protein was measured by determining the absorbance at 595 nm using a Cary 300 spectrophotometer (Agilent Technolo 40 gies, Wilmington, Del.). To determine V, and K values for NADH and NADPH, the partially purified proteins were assayed at various con centrations of NADH (20, 30, 40, 60, 80, 120, 200 and 300 uM) and NADPH (60,80, 120, 200,300 and 400 uM). Assays 45 were conducted at 30°C. in 100 mM HEPES (pH 6.8), 10 mM MgCl, 100 mM KCl and 4.8 mM R/S-acetolactate. Between 0.005 to 0.015 mg/mL total protein was added to the assay. The rate of conversion of S-acetolactate to DHIV was mea sured via monitoring the oxidation of NAD(P)H at 340 nm using a Spectramax 384 Plus plate reader (Molecular 50 Devices, Sunnyvale, Calif.). The activity was calculated using the molar extinction coefficient of 6220M'cm'.V. and K values were calculated by plotting specific activity (U/mg) vs. cofactor concentration and the data were fit to the Michaelis-Menten equation using Kaleidagraph software (Synergy, Reading, Pa.). TABLE 27 Kinetic Values for Partially Purified K9SB2 Variants as Determined via NAD(P)H Consumption ASSays Vmax K. V,a? Kn Vmax Vna Kn NADPH, NADPH, NADPH, NADH, K NADH, NADH, Variant Umg M Limin mg Umg M L/min * mg

1.79 153 O.O12 2.10 87.4 O.O24 148 897 O.OO2 1.94 71.2 O.O27 1.43 371 O.OO)4 1.33 44.1 O.O3O