In Vitro Amyloid Aggregate Forming Ability of TGFBI Mutants That Cause Corneal Dystrophies

Cornea In Vitro Amyloid Aggregate Forming Ability of TGFBI Mutants that Cause Corneal Dystrophies

Gary Hin-Fai Yam,1 Kaijie Wang,1,4 Vishal Jhanji,1 Kwong-Wai Choy,2 Larry Baum,3 and Chi-Pui Pang1

PURPOSE. We investigated the in vitro amyloid aggregation repeated episodes of pain without permanent loss of vision. It ability of TGFBI (transforming growth factor beta-induced) usually requires surgical management, such as corneal trans- mutants causing corneal dystrophies (CDs). plantation or excimer laser ablation.1 With regard to the localization of opacity within the corneal layers (epithelial and METHODS. Peripheral blood samples were collected from 42 subepithelial, stroma, Bowman, or Descemet/endothelial), CD unrelated Chinese CD patients and 185 healthy subjects for 2–4 mutation screening in all TGFBI coding exons and flanking is heterogeneous. It is usually inherited as an autosomal introns. The expression vector pCMV6_TGFBI containing wild- dominant trait with variable penetrance and expressivity, type, Arg-124, or Arg-555 mutations was transfected to HEK293 although autosomal recessive and X-linked inheritance are also cells. Cell-free media was incubated with amyloid-beta (Ab) (1- found. The genetic alterations (mutations) have been mapped 40) peptides with or without a chemical osmolyte, trimethyl- to more than 10 different chromosomes. Genotype-phenotype amine N-oxide (TMAO), for different time intervals. After correlations for CD development have been found in 13 genes, ultracentrifugation, protein aggregates were analyzed by including TGFBI (transforming growth factor, b-induced), denatured gel electrophoresis. The effect of TMAO on CHST6 (carbohydrate [N-acetylglucosamine 6-O] sulfotransfer- chemical and morphological properties of Ab aggregation ase 6), COL8A2 (collagen, type VIII, a2), DCN (decorin), GSN was examined. (gelsolin), KRT3 (keratin 3), KRT12 (keratin 12), PIP5K3 (likely ortholog of mouse phosphatidylinositol-4-phosphate 5- RESULTS. TGFBI sequencing analysis showed c.Arg124Cys in all kinase, type III), SLC4A11 (solute carrier family 4, sodium 6 lattice CD patients, c.Arg555Glu in all 11 granular CD type 1 borate transporter, member 11), TACSTD2 (tumor-associated patients, and c.Arg124His in 22 of 25 granular CD type 2 calcium signal transducer 2), TCF8 (transcription factor 8), patients. Double heterozygosity (c.307-308delCT and c.Ar- UBIAD1 (UbiA prenyltransferase domain containing 1), and g124His) was detected in one GCD2 patient. After transfection, VSX1 (visual system homeobox 1).4–9 cell-free media containing Arg-124 TGFBIp led to Ab aggrega- The TGFBI (initially called b-induced gene human clone 3, tion within 12 hours, whereas wild-type and Arg-555 mutant big-h3, or keratoepithelin, OMIM No. 601692) gene, which displayed aggregation after 24 hours. Western blot and Congo encodes TGFBIp (molecular mass ~68 kDa) is linked to protein red binding assays showed that TMAO dose-dependently deposits in the corneal epithelium and stroma, a main cause of suppressed Arg-124–induced Ab aggregation. Transmission corneal dystrophy.10,11 TGFBIp contains four conserved electron microscopy showed that TMAO reduced the fibrillar fasciclin 1 (FAS1) domains and a carboxyl-terminal Arg-Gly- aggregates caused by Ab and c.124R > H mutated TGFBIp. Asp (RGD) integrin-binding domain. It mediates integrin CONCLUSIONS. TGFBI sequence heterogeneity was observed in binding to extracellular matrix proteins for cell proliferation, Chinese CD patients. TMAO reduced amyloid aggregation adhesion, and migration.12 Specific mutations in two hot spots, caused by Arg-124 mutants, which suggests a potential Arg-124 in the first FAS1 domain and Arg-555 in the fourth FAS1 chemical-based treatment for CDs. (Invest Ophthalmol Vis domain, are related with distinct clinical phenotypes: c.124R > Sci. 2012;53:5890–5898) DOI:10.1167/iovs.11-9068 C in lattice CD type 1 (LCD1), c.124R > H in Avellino CD (or granular CD type 2, GCD2), c.124R > L in Reis-Buckler CD, c.124R > S in granular CD, c.555R > W in granular CD orneal dystrophy (CD) is characterized by a gradual Groenouw type 1 (GCD1), and c.555R > Q in Reis-Buckler CD Cprogression of noninflammatory and bilateral opacities in (Human Gene Mutation Database).8 In this study, we investi- a transparent cornea. It can cause severe visual impairment or gated the occurrence of exonic and intronic gene sequence variants of TGFBI in 42 Chinese patients with mixed subtypes of CDs. From the Departments of 1Ophthalmology and Visual Science We also explored the effect of human wild-type (WT), Arg- and 2Obstetrics and Gynecology, and the 3School of Pharmacy, The 124, or Arg-555 mutated TGFBIp on amyloid beta (Ab) peptide Chinese University of Hong Kong, Hong Kong; and 4Beijing Tongren aggregation in vitro. Although TGFBIp is expressed in various Eye Center, Beijing Tongren Hospital, Capital Medical University, mammalian tissues and organs (http://www.genecards.org/), Beijing, China. the pathologic deposition caused by mutated TGFBIp has been Supported by General Research Fund 478609 and Lim Por Yen observed only in the cornea. TGFBIp aggregation could occur Eye Foundation Endowment Fund, Hong Kong. specifically in the cornea.13-15 Pathologic amyloid deposits are Submitted for publication November 13, 2011; revised June 19, found with TGFBIp mutated at Arg-124 but not at Arg-555,16 2012; accepted July 25, 2012. and the mechanism of amyloid conversion remains elusive. Disclosure: G.H.-F. Yam,None;K. Wang,None;V. Jhanji, Besides its own deposition, mutated TGFBIp could cause other None; K.-W. Choy,None;L. Baum,None;C.-P. Pang,None 17 Corresponding author: Gary Hin-Fai Yam, Department of corneal proteins to aggregate. Due to the colocalization of Ophthalmology and Visual Science, The Chinese University of Hong apolipoproteins J and E in the congophilic corneal amyloid Kong, Hong Kong Eye Hospital, 147K Argyle Street, Kowloon, Hong deposits in CD, it has been proposed that amyloid conversion Kong; [email protected]. in CD corneas could share similarity with the brain tissue in

Downloaded from tvst.arvojournals.org on 09/30/2021 IOVS, August 2012, Vol. 53, No. 9 Amyloid Aggregation of TGFBI Mutants 5891

TABLE 1. Speciﬁc Primers and Conditions for Ampliﬁcation of TGFBI Coding Exons and Flanking Introns

Exon Forward Primers (5030) Reverse Primers (5030) Annealing Temperature (8C) Product Size (bp)

4 CCCCAGAGGCCATCCCTCCT CCGGGCAGACGGAGGTCATC 60 225 5 TAAACACAGAGTCTGCAGCC TTCATTATGCACCAAGGGCC 60 260 6 TGTGTTGACTGCTCATCCTT CATTCAGGGGAACCTGCTCT 60 317 7 TTCAGGGAGCACTCCATCTT ATCTAGCTGCACAAATGAGG 60 224 8 CTTGACCTGAGTCTGTTTGG AGATGGTGGGCCAGGCAGGG 52 286 9 ACTTTTGAACCCACTTTCTC CAATCTAACAGGGATGCCTT 55 200 10 TCTGGACCTAACCATCACCC CAGGAGCATGATTTAGGACC 58 206 11 CTCGTGGGAGTATAACCAGT GACATCCATGACAGTCCACAT 56 164 12 GTTGACAGGTGACATTTTCT TCTTTACCCAAGAGTCTGCT 60 174 13 TTGACCAGGCTAATTACCATTC CTGGGGAAATTTAGCCAGCC 61 225 14 CTACTTTCAACCACTACTCT TCATCATTGTTTCGGACAGT 61 229 15 CACTCTGGTCAAACCTGCCT GGCTAGGCGCAAACCTAGC 61 109 16 CAGTTGCAGGTATAACTTTC TAAACAGGTCTGCAATGACT 61 120

Alzheimer’s disease.18-20 In addition, increased Ab precursors phoretic mobility were further analyzed by direct sequencing using a are detected in corneas of Alzheimer’s mice.21 The question BigDye Terminator Cycle Sequencing Reaction Kit (version 3.1; arises as to whether WT and mutant TGFBIp modulate Ab Applied Biosystems, Foster City, CA) on an ABI 377 DNA sequencer aggregation. We therefore performed an in vitro study to (Applied Biosystems). Sequencing data were compared with the explore the Ab aggregation effect of CD-causing TGFBI published TGFB1 sequence (GenBank Accession Number AY149344). mutants. We also explored a novel screening methodology for determining the amyloidogenicity of TGFBIp mutants and Expression Constructs and Mutagenesis their possible rescue by trimethylamine N-oxide (TMAO), a small natural osmolyte with reported chaperoning activity. A C-terminal myc-FLAG-tagged full-length open reading frame clone of human TGFBI (NM_000,358.2), named pCMV6_TGFBI, was obtained from Origene (Rockville, MD). CD-causing mutations (c.417C > Tfor MATERIALS AND METHODS p.Arg124Cys, c.418G > A for p.Arg124His, c.418G > Tfor p.Arg124Leu, c.417C > A for p.Arg124Ser, and c.1710C > Tfor Study Subjects p.Arg555Trp) were introduced by PCR-based site-directed mutagenesis The study protocol was approved by the Ethics Committee on Human (Stratagene, La Jolla, CA) using specific oligonucleotides (Table 2), and Research, The Chinese University of Hong Kong, and was in the correctness of constructs was verified by direct sequencing. compliance with the tenets of the Declaration of Helsinki. Informed consent was obtained from all participants. After complete ophthalmic Cell Culture, Transfection, and Small Molecule examination, including fundoscopy, slit-lamp biomicroscopy, and Treatment specular and confocal microscopies, ophthalmologists diagnosed 42 CD patients as having paricular CD subtypes. A detailed history, Human embryonic kidney epithelial HEK293 cells (ATCC, Manassas, including family history and time of onset of symptoms, was recorded. VA), at a density of 5 3 104 cells/cm2, were transfected with Also recruited were 12 unaffected family members and 185 unrelated pCMV6_TGFBI (wild type or mutant) at a ratio of 3 lL FuGene HD healthy subjects older than 70 years, the latter of whom did not have reagent (Roche, Basel, Switzerland) per 1 lg DNA in Opti-MEM I medical or family history of any ocular disorders except senile cataracts supplemented with GlutaMAX-I (Invitrogen, Carlsbad, CA). After 1 day, or mild myopia. All subjects underwent complete ophthalmic the transfection medium was replaced with serum-free medium, which examinations. Intraocular pressure was measured by applanation was then collected after another 24 hours. Secreted TGFBIp was tonometry and visual fields examination was performed using a assayed after immunoprecipitation (IP) with anti-myc antibody (Sigma, perimeter (Humphrey Field Analyzer; Carl Zeiss Meditec, Dublin, St. Louis, MO), followed by Western blotting (WB) for FLAG epitope CA). Visual acuity was determined using a Snellen’s eye chart. (antibody from Sigma).

Genotyping Amyloid Beta Peptide Aggregation Analysis Peripheral venous blood was collected for genomic DNA extraction Cell-free medium containing WT or mutant TGFBIp was incubated with using a QIAamp DNA Blood kit (Qiagen, Valencia, CA) according to the 10 lMAb(1-40) peptides (>97% purity, rPeptide, Bogart, GA) for manufacturer’s protocol. All coding exons and flanking introns of different time intervals. TMAO was added to a final concentration of 0 TGFBI were amplified by PCR using specific oligonucleotide primers as to 450 mM. Protein aggregates were harvested by ultracentrifugation, shown in Table 1. The PCR product was subjected to conformation- denatured in buffer containing 20 mM Tris (pH 6.8), 9 M urea, 2% SDS, sensitive gel electrophoresis,22 and samples showing aberrant electro- 50 mM DL-dithiothreitol, and 10% glycerol, resolved with 12.5% SDS-

TABLE 2. Speciﬁc Oligonucleotides for Site-Directed Mutagenesis

Mutations Amino Acid Change Mutagenesis Oligos (sense) (50-30)

c.C417T Arg124Cys ACCACTCAGCTGTACACGGACTGCACGGAGAAGCTGAGGCC c.C417A Arg124Ser ACCACTCAGCTGTACACGGACAGCACGGAGAAGCTGAGGCC c.G418A Arg124His ACCACTCAGCTGTACACGGACCACACGGAGAAGCTGAGGCC c.G418T Arg124Leu ACCACTCAGCTGTACACGGACCTCACGGAGAAGCTGAGGCC c.C1710T Arg555Tyr GAGCCCTGCCACCAAGAGAACAGAGCAGACTCTTGGGAGATGC

Downloaded from tvst.arvojournals.org on 09/30/2021 5892 Yam et al. IOVS, August 2012, Vol. 53, No. 9

TABLE 3. Summary of TGFBI Mutations in Hong Kong Chinese CD Samples

TGFBI Genotypes

Arg124His þ Non-TGFBI CD Types No. Patients Arg124His c.307-308delCT Arg124Cys Arg555Tyr Mutation

GCD1 11 0 0 0 11 0 GCD2 25 22 1 0 0 3 LCD1 6 0 0 6 0 0

PAGE and immunoblotted for Ab(1-40) peptides using mouse PA). Band intensity was imaged and analyzed by Quantity One 4.6.2 monoclonal antibody 6E10 (Covance, Princeton, NJ). Media without (BioRad, Hercules, CA). transfected TGFBIp or with Ab scrambled peptide (rPeptide) were used as controls. The relative abundance of fibrillar Ab was determined by Congo red RESULTS assay. In brief, conditioned medium (without phenol red) was added with 20 lM Congo red solution for 4 hours. The absorbance was Single Nucleotide Polymorphism Association measured at a wavelength of 540 nm with reference to 630 nm using a Analysis plate reader (Powerwave XS; Bio-Tek Instruments, Winooski, VT). The We screened TGFBI for exonic and intronic sequence variants experiment was done in quadruplicate and means and SDs were and found that 39 (93%) of 42 CD patients had heterozygous calculated. TGFBI mutations. Of these mutations, most were associated Ab structure was visualized by transmission electron microscopy with either Arg-124 or Arg-555: p.Arg124Cys (R124C) in 6 of 6 (TEM). After ultracentrifugation, fibril aggregates were suspended in LCD patients, p.Arg124His (R124H) in 22 of 25 GCD2 patients, neutral phosphate buffer (10 lM) and added to 150-mesh formvar- and p.Arg555Trp (R555W) in 11 of 11 GCD1 patients (Table 3). coated copper grids for 2 minutes, washed in distilled water, and fixed Among these 42 patients, 30 were recruited from 10 different with 4% glutaraldehyde (EM Sciences, Hatfield, PA). The samples were families. Only one mutation was inherited within the family. negatively stained by 3% uranyl acetate (Sigma) in methanol, washed, The distributions of detected mutations are summarized in air-dried, and examined by TEM (Hitachi H-7100; Hitachi, Tokyo, Table 4. Three GCD2 patients were caused by non-TGFBI Japan). mutations after whole gene sequencing (data not shown). In a patient with GCD2, a second heterozygous mutation, a Cellular Protein Expression Study novel c.307_308delCT in exon 6, which results in a premature STOP codon at position 130, was identified in addition to After 24 hours of treatment with or without TMAO, transfected cells p.Arg124His in exon 4. This mutation has not previously been were lysed in a radioimmunoprecipitation assay (RIPA) buffer with reported. The patient was diagnosed with CD at the age of 28 freshly added Complete protease inhibitor cocktail (Roche) and 1 mM and presented with bilateral multiple granular, refractile, ice phenylmethylsulfonylfluoride (Sigma). Soluble proteins were immuno- flake–like gray-whitish opacities covering two-thirds of the blotted with mouse monoclonal antibodies against human caspase 3 cornea (Fig. 1). The morphology of deposits was different from (BD Biosciences, Franklin Lakes, NJ), p21Cip (Millipore, Billerica, MA), that observed in another female GCD2 patient, who was and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Sigma), heterozygous for p.Arg124His and who displayed diffuse followed by appropriate Ig horseradish peroxidase conjugate (Jackson granular deposits on the corneal surface. In the compound ImmunoLab, West Grove, PA). The immunoreactive signal was heterozygote, no filamentous lattice-type deposition was detected by enhanced chemiluminescence (GE Healthcare, Pittsburgh, observed. Her visual acuity dropped to 18/100 in both eyes

TABLE 4. TGFBI Mutations in the Studied CD Families

Family Recruited Members (Total) Proband (Sex/Age, Genotype) Other Members (Sex/Age, Genotype)

CD1 4 ACD (F/18, R124H) 1 ACD (F/39, R124H) 1 clear (M/13, R124H) 1 clear (F/15, WT) CD2 4 CDL1 (F/44, R124C) 2 CDL1 (M/14 & F76; both R124C) 1 clear (F/17, WT) CD3 2 ACD (M/70, R124H) 1 clear (M/61, WT) CD4 3 ACD (F/58, unknown) 1 ACD (F/55, R124H) 1 CDG1 (F/31, R124H) CD5 2 ACD (F/26, R124H) 1 clear (M/63, WT) CD6 5 CDG1 (M/35, R555W) 4 CDG1 (F/11, F/37, M/12, M/13; all R555W) CD7 2 ACD (F/36, R124H) 1 clear (M/37, WT) CD8 3 ACD (F/69, R124H) 1 ACD (F/71, unknown) 1 ACD (F/38, R124H) CD9 3 CDL1 (F/40, R124C) 1 CDL1 (F/31, R124C) 1 clear (F/38, WT) CD10 2 CDG1 (M/38, R124H) 1 clear (M/14, R124H) F, female; M, male.

Downloaded from tvst.arvojournals.org on 09/30/2021 IOVS, August 2012, Vol. 53, No. 9 Amyloid Aggregation of TGFBI Mutants 5893

FIGURE 1. Slit lamp photographs showing (A) a GCD2 patient heterozygous for the p.Arg124His mutation and displaying diffused granular deposits on the corneal surface, and (B) a GCD2 patient compound heterozygous for p.Arg124His and c.307_308delCT and showing large granular whitish flake-ice like deposits covering two- thirds of the corneal surface. FIGURE 3. Ab(1-40) peptide aggregation. From Western blotting, four major immunoreactive bands of Ab aggregates and oligomers were by age of 31. Left penetrating keratoplasty was performed at quantified by Quantity One analysis. The relative abundance is age 34, with best-corrected acuity improving up to 20/40 calculated with reference to the in-gel signal. Arg-124 (R124) mutant TGFBIp showed the same degree of Ab aggregation in 12 hours that thereafter; however, recurrence occurred in the graft after 3 WT and Arg-555 (R555) mutant exhibited in 24 hours. This histogram years, with visual acuity dropping to 4/200 before a second shows the mean value of relative abundance obtained from 3 individual penetrating keratoplasty was performed. Later, she also experiments. *P < 0.05, Mann-Whitney U test. received phototherapeutic keratectomy to reduce the granular opacities in the right eye, with visual acuity improving to 20/ 50. She has regular follow up visits at our clinic. Because no molecular-weight aggregates (MMA, 80–100 kDa), small family member was willing to participate in this study, we were molecular-weight aggregates (SMA, 40–50 kDa), and oligomers unable to perform segregation analysis. (<20 kDa). More than 50% of Ab was detected in the Neutral single nucleotide polymorphisms of TGFBI were oligomeric form, with the remainder forming different sizes also detected. They were p.Leu217Leu in exon 6, p.Asn272Asn of aggregates (Fig. 3B). At 12 hours of incubation, unlike WT in exon 7, p.Val327Val in exon 8, c.IVS10-3C > T, p.Leu472Leu and R555 mutant, media with R124 mutant TGFBIp displayed in exon 11, p.Phe540Phe in exon 12, and p.Leu601Leu in exon Ab aggregate formation (P < 0.05, Mann-Whitney U test). This 13. Their occurrence rates were similar among CD patients and assay thus demonstrated the heightened amyloidogenicity of healthy subjects. R124 mutant TGFBIp, which has been reported to form an amyloid structure. R124 Mutant TGFBIp Accelerated Ab(1-40) TMAO Reduced Ab Peptide Aggregation Caused by Aggregation R124 Mutant TGFBIp Next, we investigated the amyloidogenic properties of the commonly occurring mutant TGFBIp (R124C, R124H, R124L, We tested if Ab aggregation could be alleviated by TMAO R124S, and R555W). IP-WB analysis of transfected HEK293 cell treatment. Ab(1-40) peptide (10 lM) was incubated in medium medium detected a single FLAG-immunoreactive band at with secreted R124C or R124H TGFBIp in the presence of approximately 68 to 70 kDa, representing secreted TGFBIp TMAO (0 to 450 mM) for 12 hours. Protein aggregates were (Fig. 2). In addition, intracellular TGFBIp was detected in harvested and resolved in 12.5% SDS-PAGE. After immunoblot- soluble RIPA cell lysates. By examining the band intensity per ting, we observed a dose-dependent decrease in Ab aggregates 105 cells, we found that TGFBI mutations did not affect the (Figs. 4A, 4B). In untreated samples, massive aggregation of Ab efficiency of protein secretion. Cell-free media from TGFBI peptides was detected, similar to that described before. Such aggregation was reduced with the addition of TMAO concen- transfectants was filtered through 22-lm micropores and trations above 50 mM ( 0.05, Mann-Whitney test) (Figs. incubated with Ab(1-40) peptides. Protein aggregates were P < U 4C, 4D). The relative abundances of HMA, MMA, and LMA collected by ultracentrifugation, resolved in urea-containing forms were collectively reduced, leaving most in-gel signals in sample buffer, and immunoblotted. At 24 hours, Ab aggregates the form of oligomers. The result was similar with WT TGFBIp. were detected in all TGFBIp-containing media (WT and TMAO also reduced Ab aggregation by R124L and R124S mutants) and nontransfected control medium (Fig. 3A). Four mutants (Figs. 4E, 4F). Fibrillar aggregates were detected after major immunoreactive bands in gel were found: high 12 hours incubation of Ab peptides with R124 mutant media, molecular-weight aggregates (HMA, >150 kDa), medium as revealed by increased absorbance in the Congo red binding assay (Fig. 5). In contrast, Ab only and Ab in WT or R555W mutant media did not show any absorbance changes, indicating the absence of b-sheet structures. When TMAO (50 and 200 mM) was added to R124 mutant media for 12 hours, a significant decrease of Congo red absorbance was observed (P < 0.05, paired Student’s t-test, n ¼ 4). Only a slight decrease was found for 10 mM TMAO treatment. TEM verified the mixed appearance of fibrillar and FIGURE 2. Immunoblotting analysis of FLAG representing TGFBIp aggregate morphology of Ab peptide in preparations incubated expression in HEK293 transfected with pCMV6_TGFBI plasmids containing WT, Arg-124 (R124), or Arg-555 (R555) mutants. IC, for 12 hours with R124H mutant medium. Electron dense intracellular lysate; EC, extracellular lysate after immunoprecipitation fibrillar aggregates were evident with a width of 400 to 500 with anti-myc antibody. Positive bands at approximately 68 to 70 kDa nm, and some were arranged in globular clusters (Fig. 6A). indicate the TGFBIp expression. With the presence of TMAO (50 mM), the samples predom-

Downloaded from tvst.arvojournals.org on 09/30/2021 5894 Yam et al. IOVS, August 2012, Vol. 53, No. 9

FIGURE 4. TMAO reduced Ab peptide aggregation caused by Arg-124 mutant TGFBIp. (A) and (C) Western blot analysis of Ab aggregate and oligomer formation by p.Arg124Cys (R124C) TGFBIp, their reduction by TMAO (5-450 mM) and the relative abundance measurements (mean of 3 experiments). (B) and (D) p.Arg124His (R124H); (E) p.Arg124Leu (R124L); and (F) p.Arg124Ser (R124S). *P < 0.05, Mann-Whitney U test. nt, non- treated; scb, Ab scrambled peptides.

inantly contained small fibrillar fragments and aggregates (Fig. DISCUSSION 6B). This resembled scrambled Ab peptides or Ab peptides treated with WT medium (Figs. 6C, 6D). Mutations in the TGFBI gene cause several types of autosomal- dominant corneal dystrophies. In this study, we conducted a genotypic study on 42 Chinese patients with several pheno- TMAO Reduced Caspase 3 Activation typically different CD subtypes. The c.417C > T(for HEK293 cells were transfected to express R124H TGFBIp. p.Arg124Cys), c.481G > A (p.Arg124His), and c.1710C > T These cells were incubated with 10 lMAb(1-40) peptide in (p.Arg555Trp) mutations of the TGFBI gene segregated with the presence of TMAO (0-200 mM) for 24 hours. Soluble cell LCD, GCD2, and GCD1, respectively. Although no TGFBI lysate was collected to study caspase 3 expression by WB. mutations were detected in three patients, our findings showed a similar causative effect of TGFBI mutations in Similar to apoptotic control cells (after overnight serum various subtypes of CD in the Chinese as in other ethnic depletion), WT and R124H mutant cells expressed active populations (Table 5). In Chinese, numerous studies have caspase 3 (15–20-kDa fragments) when incubated with Ab(1- reported on TGFBI-linked CD genotyping. Analyzed from the 40) peptide (Fig. 7A). By band densitometry analysis, cells literature with a total of 466 patients from 94 families and 13 incubated with Ab in the presence of the R124H mutant sporadic patients, the classic genotypes for TGFBI-linked CD exhibited almost a 2-fold higher level of active caspase 3 than are p.Arg124Cys for LCD1, p.Arg124His for GCD1, did cells incubated with WT TGFBIp (Fig. 7B). Cotreatment p.Arg555Trp for GCD2 (Avellino), and p.Arg555Gln for CDTB. with TMAO suppressed active caspase 3. Treatment with 50 Other nonclassical variants were also reported, including mM TMAO, but not other concentrations, resulted in up to p.Ala546Thr and p.Ala546Asp for GCD1; p.Pro501Thr, 25-fold reduction of caspase 3 activation (P < 0.05, paired p.Arg514Pro, p.Phe515Leu, p.Ile522Asn, and p.His572Arg for Student’s t-test, n ¼ 3). In addition, growth arrest p21 LCD1; and p.Gly623Asp for CDRB.23–25,41–60 expression was also decreased after TMAO treatment (Fig. We identified a novel deletion mutation, c.307_308delCT, in 7A). a GCD2 patient who also carried a heterozygous p.Arg124His

Downloaded from tvst.arvojournals.org on 09/30/2021 IOVS, August 2012, Vol. 53, No. 9 Amyloid Aggregation of TGFBI Mutants 5895

FIGURE 7. TMAO treatment reduced caspase 3 activation by p.Ar- g124His TGFBIp expression and Ab peptide. (A) Immunoblot analysis FIGURE 5. Detection of Ab fibrillar b-sheet aggregation by Congo red of pro- and active caspase 3 in HEK293 cells transfected with WT or binding analysis. TMAO treatment dose-dependently reduced Congo R124H (RH) TGFBIp. Incubation with 10 lMAb(1-40) peptide induced red binding to Ab aggregates caused by Arg-124 mutants after 12 hours caspase 3 activation. This was alleviated by TMAO treatment. Cells with of incubation. Reaction of Ab peptides with WT or p.Arg555Trp overnight serum depletion were used as control for caspase 3 (R555W) mutant and Ab scrambled peptides only did not exhibit activation. Expression of p21Cip was also reduced after TMAO fibrillar aggregates positive for Congo red binding. *P < 0.05, paired treatment. GAPDH was used as the internal control. (B) Histogram Student’s t-test, n ¼ 3. showing the relative percentage of active caspase 3 to pro-caspase 3 with treatments described in A. change on the other chromosome. This deletion leads to a frameshift starting from codon 103 and results in a premature have been reported. A 6-bp deletion removing Thr-125 and STOP at position 130. The amino acid sequence was changed Glu-126 was present with p.Arg124Leu on the same TGFBI from ‘‘LSNLYETLGVVGSTTTQLYTDRTEKLRP’’ (amino acids allele in a patient with atypical GCD.26 In an LCD patient, a 128 to 155) to ‘‘LKPLRDPGSRWIHHHSAVHGPHGEAEAX.’’ As missense p.Pro551Gln on the same allele as p.Ala546Asp was TGFBI-associated CD is inherited in an autosomal dominant identified.27 Three deletion mutations in the TGFBI gene have manner, a heterozygous mutation is sufficient to produce the been reported. One was a 6-bp deletion in compound disease phenotype, even though homozygous TGFBI mutations heterozygosity with p.Arg124Leu as mentioned above.62 A could give rise to a more phenotypically severe, early-onset Sardinian patient diagnosed with LCDI/IIIA had c.DF540.63 The disease variant. The presence of a STOP codon in one allele, third deletion, c.1926delG was found in an LCDIIIA patient.28 thus, represents a hemizygous situation that may alter or This resulted in a premature termination at codon 669. Both exaggerate the clinical phenotype. During her first visit at the compound heterozygosity and deletion mutations in TGFBI are age of 28, both corneas exhibited granular opacities in a dense rare. confluent pattern covering two-thirds of the corneal surface, Although the clinical and genetic information of this protein with white plaques extending to deep corneal stroma, aggregation disorder is well documented, relatively little is resembling features described in patients with homozygous known about this extracellular matrix protein, TGFBIp (or p.Arg124His.61 The visual acuity of both eyes deteriorated but keratoepithelin). Some CDs are characterized by amyloid was improved by penetrating keratoplasty. She responded well deposition in the corneal subepithelial or stromal region; to phototherapeutic keratectomy, with improved visual acuity however, the mechanisms of amyloid conversion remain and reduced granular opacities. Whether other carriers of unclear. TGFBIp is expressed in many tissues and organs c.307_308delCT show similar phenotypic changes is not (http://www.genecards.org/); however, the pathologic deposi- examined because no family member participated in this tion caused by mutant TGFBIp was observed only in the study. Several cases of double mutations associated with CDs cornea. This suggests a cornea-specific mechanism in the aggregation of mutated TGFBIp. TGFBIp with Arg-124 mutations can aggregate to form amyloid fibrils, whereas Arg-555 mutants have nonamyloid deposits.12 It has been shown that TGFBIp is proteolytically processed from the N-terminus and appears to be degraded in a highly orchestrated manner in human cornea with the resulting C-terminal fragments being retained in the cornea.15 Whether the mutated TGFBIp generates cornea-specific fragments that aggregate is yet to be investigated. An additional possibility is that mutated TGFBIp could cause other corneal proteins to aggregate.17 In this study, we found that mutated TGFBIp promoted Ab peptide aggregation. Ab fibrils were detected when the peptides were incubated for at least 24 hours at 378C; however, the presence of Arg-124 mutants (including p.Arg124Cys, p.Arg124His, p.Arg124Leu, and p.Arg124Ser) accelerated Ab fibrillar aggregate formation at 12 hours, whereas WT and the Arg-555 mutants did not. This is in accordance with the clinical observations that Arg-124 mutants are linked to amyloidosis.16 Under denaturation, Ab peptide aggregates existed predominantly in the forms of high (>150 FIGURE 6. Transmission electron micrographs showing Ab peptide aggregates in 12 hours. (A)Ab(1-40) peptide and R124H TGFBIp; (B) kDa), medium (80–100 kDa), and low (40–50 kDa) molecular Ab(1-40) peptide, R124H TGFBIp, and 50 mM TMAO; (C)Ab(1-40) mass aggregates as well as oligomers (<20 kDa). The relative peptide and WT TGFBIp; and (D)Ab scrambled peptide and R124H abundance of such Ab aggregates to oligomers was significantly TGFBIp. increased after incubation with Arg-124 mutants, when

Downloaded from tvst.arvojournals.org on 09/30/2021 5896 Yam et al. IOVS, August 2012, Vol. 53, No. 9

TABLE 5. Reported TGFBI Mutations in Different Types of CD reduce the solvent-accessible surface area and induce the peptide to adopt a tighter conformation and restrict the Disease Type Reported Mutations mobility between protein domains, leading to a stabilized LCD I Arg124Cys24,28–30; Val505Gln25; Leu518Pro31; conformation and oligomeric assembly. Ala546Asp27; Pro551Thr27; Leu569Arg32 In conclusion, our study conﬁrmed the tight genotype- LCD IIIA Pro501Thr33; Ala546Thr26; Asn622Lys28 phenotype relationship of TGFBI gene-linked CDs. Chinese CD LCD I/IIIA Leu518Arg28; Thr538Arg28; DPhe54028; patients share a similar causative effect of TGFBI mutations for Asn622His34; Gly623Asp28; His626Pro28; various CD subtypes as other ethnic populations. We also His626Arg24,28,34; p.629_630Ins35 demonstrated that Ab peptide aggregate formation was LCD IV Leu527Arg36 accelerated by the amyloidogenic Arg-124 mutants, when LCD-deep Val631Asp28 compared with WT or the Arg-555 mutants. This is a novel LCD-late onset Asn544Ser30 screening method for comparing the amyloidogenicity of GCDI Arg124Ser28; Arg124HisþDThr125-DGlu12626; TGFBI mutants. Furthermore, Ab peptide aggregate formation Arg555Trp3,23,37 by Arg-124 mutant TGFBIp could be alleviated by TMAO. Our GCDII Arg124His3,37–39 ﬁndings provide a basis for a novel chemical-based strategy to CDB1 (CDRB) Arg124Leu28,40 treat this protein aggregation disorder and improve visual CDB2 (TBCD) Arg555Trp3,40 function.

References compared with incubation with WT or the Arg-555 mutants. This demonstrated for the first time that TGFBIp could cause 1. Dogru M, Katakami C, Nishida T, Yamanaka A. Alteration of Ab peptides to aggregate. ocular surface with recurrence of granular/avellino corneal TGFBIp was previously shown to bind to collagen I, dystrophy after phototherapeutic keratectomy: report of 5 integrins, and extracellular glycans.12,64 In normal human cases and literature review. Ophthalmology. 2001;108:810– corneas, amyloid is occasionally detected in the sub-Bowman 817. and stromal regions. The vascularization in CD corneas could 2. Stone EM, Mathers WD, Rosenwasser GO, et al. Three allow more amyloid precursors or Ab to be transported to the autosomal dominant corneal dystrophies map to chromosome cornea,65 leading to progressive amyloid deposition. In LCDII 5q. Nat Genet. 1994;6:47–51. patients, amyloid deposition was reported in cornea, sclera, 3. Munier FL, Korvatska E, Djemal A, et al. Kerato-epithelin lacrimal gland, and ciliary nerve.66 Although there is no report mutations in four 5q31-linked corneal dystrophies. Nat Genet. conclusively proving the presence of Ab in human corneas, 1997;15:247–251. increased immunoreactivity to the Ab region of amyloid 4. Klintworth GK. Corneal dystrophies. Orphan J Rare Dis. precursors was detected in corneas of transgene mice models 2009;4:7. of Alzheimer’s disease.21 Ab could serve as an important 5. Biswas S, Munier FL, Yardley J, et al. Missense mutations in substrate for TGFBIp-induced protein aggregation. In addition COL8A2, the gene encoding alpha2 chain of type VIII collagen, to retinal ganglion cell loss, our finding of corneal opacity cause two forms of corneal endothelial dystrophy. Hum Mol formation further suggested that the vision deficits in some Genet. 2001;10:2415–2423. Alzheimer’s patients could be an ophthalmic pathology, rather 6. Mehta JS, Vithana EN, Tan DT, et al. Analysis of posterior than cognitive confusion and brain deterioration. CD screening polymorphous corneal dystrophy 3 gene, TCF8, in late-onset for these patients might help in the design of better Fuchs endothelial corneal dystrophy. Invest Ophthalmol Vis therapeutic interventions to improve their quality of life. Sci. 2008;49:184–188. Next, we investigated whether Ab aggregation could be 7. Vithana EN, Morgan PE, Ramprasad V, et al. SLC4A11 inhibited by TMAO. Chemical chaperoning is known to mutations in Fuchs endothelial corneal dystrophy. Hum Mol stabilize proteins, reduce their aggregation, and improve their Genet. 2008;17:656–666. cellular trafficking, leading to cell survival and correction of 8. Weiss JS, Moller HU, Lisch W, et al. IC3D classification of tissue defects.67–69 Although the exact mechanisms are still not corneal dystrophies. Cornea. 2008;27(suppl 2);S1–83. defined, chemical chaperones likely stabilize the native folding 9. Riazuddin SA, Eghrari AO, Al-Saif A, et al. Linkage of a mild late- equilibrium of substrate proteins, reduce nonproductive onset phenotype of Fuchs corneal dystrophy to a novel locus aggregation, or enhance the resident chaperoning environ- at 5q33.1-q35.2. Invest Ophthalmol Vis Sci. 2009;50:5667– ment. This has been demonstrated in correction of various 56671. misfolded proteins associated with pathological conditions and 10. El Kochairi I, Letovanec I, Uffer S, Munier FL, Chaubert P, renders the chaperone-assisted protein rescue a tempting Schorderet DF. Systemic investigation of keratoepithelin strategy for the management of protein conformational deposits in TGFBI/BIGH3-related corneal dystrophy. Mol Vis. diseases.70–74 Removal of aberrant protein aggregates thus 2006;12:461–466. could reduce cellular and tissue toxicity and enhance tissue 11. Runager K, Enghild JJ, Klintworth GK. Focus on molecules: function.70,75,76 Our work illustrated that TMAO dose-depen- transforming growth factor beta induced protein (TGFBIp). dently reduced the Ab aggregation caused by Arg-124 TGFBI Exp Eye Res. 2008;87:298–299. mutants. This was evidenced by suppressed levels of Ab 12. Kim JE, Park RW, Choi JY, et al. Molecular properties of wild- aggregates by WB, and reduced Ab fibrillar structure contain- type and mutant betaIG-H3 proteins. Invest Ophthalmol Vis ing b-sheet conformation by Congo red assay and by TEM. Sci. 2002;43:656–661. TMAO has been shown to stabilize proteins against the 13. Kawasaki S, Nishida K, Quantock AJ, Dota A, Bennett K, action of urea and hydrostatic pressure.77 This protein Kinoshita S. Amyloid and Pro501Thr-mutated Bigh3 gene stabilization effect could be due to its hydrophobic nature to product colocalize in lattice corneal dystrophy type IIIA. Am J propel water molecules to the surface of proteins and increase Ophthalmol. 1999;127:456–458. their hydration capacity. The Gibbs free energy between native 14. Korvatska E, Henry H, Mashima Y, et al. Amyloid and non- and denatured states becomes larger and this drives the amyloid forms of 5q31-linked corneal dystrophy resulting from equilibrium toward a more native state.78 This might further kerato-epithelin mutations at Arg-124 are associated with

Downloaded from tvst.arvojournals.org on 09/30/2021 IOVS, August 2012, Vol. 53, No. 9 Amyloid Aggregation of TGFBI Mutants 5897

abnormal turnover of the protein. J Biol Chem. 2000;275: 34. Stewart H, Black GC, Donnal D, et al. A mutation within exon 11465–11469. 14 of TGFBI (BIGH3) gene on chromosome 5q31 causes an 15. Stix B, Leber M, Bingemer P, et al. Hereditary lattice corneal asymmetric, late-onset form of lattice corneal dystrophy. dystrophy is associated with corneal amyloid deposits Ophthalmology. 1999;106:964–970. enclosing C-terminal fragments of keratoepithelin. Invest 35. Schmitt-Bernard CF, Guittard C, Arnaud B, et al. BIGH3 exon Ophthalmol Vis Sci. 2005;46:1133–1139. 14 mutations lead to intermediate type I/IIIA of lattice corneal 16. Schmitt-Bernard CF, Chavanieu A, Herrada G, et al. BIGH3 dystrophies. Invest Ophthalmol Vis Sci. 2000;41:1302–1308. (TGFBI) Arg124 mutations influence the amyloid conversion 36. Fujiki K, Hotta Y, Nakayasu K, et al. A new L527R mutation of of related peptides in vitro. FEBS. 2002;269:5149–5156. BIGH3 gene in patients with lattice corneal dystrophy with 17. Tai TY, Damami MR, Vo R, et al. Keratoconus associated with deep stromal opacities. Hum Genet. 1998;103:286–289. corneal stromal amyloid deposition containing TGFBIp. 37. Cung le X, Ha NT, Chau HM, et al. Mutation analysis of TGFBI Cornea. 2009;28:589–593. gene in Vietnamese with granular and Avellino corneal 18. Matsubara E, Frangione B, Ghiso J. Characterization of dystrophy. Jpn J Ophthalmol. 2004;48:12–16. apolipoprotein J-Alzheimer’s A beta interaction. J Biol Chem. 38. Mashima Y, Konishi M, Nakamura Y, et al. Severe form of 1995;270:7563–7567. juvenile corneal stromal dystrophy with homozygous R124H 19. Oda T, Wals P, Osterburg HH, et al. Clusterin (apoJ) alters the mutation in keratoepithelin gene in five Japanese patients. Br J aggregation of amyloid beta-peptide (1-42) and forms slowly Ophthalmol. 1998;82:1280–1284. sedimenting A beta complexes that cause oxidative stress. Exp 39. El-Ashry MF, El Aziz MM, Larkin DF, et al. A clinical, Neurol. 1995;136:22–31. histopathological, and genetic study of Avellino corneal 20. Nishida K, Quantock AJ, Dota A, Choi-Miura NH, Kinoshita S. dystrophy in British families. Br J Ophthalmol. 2003;87:839– Apolipoproteins J and E co-localise with amyloid in gelatinous 842. drop-like and lattice type I corneal dystrophies. Br J 40. Okada M, Yamamoto S, Tsujikawa H, et al. Two distinct kerato- Ophthalmol. 1999;83:1178–1182. epithelin mutations in Reis-Bucklers corneal dystrophy. Am J 21. Dutescu RM, Li QX, Crowston J, Masters CL, Baird PN, Ophthalmol. 1998;126:535–542. Culvenor JG. Amyloid precursor protein processing and retinal 41. Yu J, Zou LH, He JC, et al. Analysis of mutation of BIGH3 gene pathology in mouse models of Alzheimer’s disease. Graefe’s in Chinese patients with corneal dystrophies [in Chinese]. Arch Clin Exp Ophthalmol. 2009;247:1213–1221. Zhonghua Yan Ke Za Zhi. 2003;39:582–586. 22.LeungYF,TamPO,TongWC,etal.High-throughput 42. Jin T, Zou LH, Yang L, Dong WL, Yu J, Lu L. Identification of conformation-sensitive gel electrophoresis for discovery of BIGH3 gene mutations in patients with two types of corneal SNPs. Biotechniq. 2001;30:334–335, 338–340. dystrophies [in Chinese]. Zhonghua Yi Xue Yi Chuan Xue Za 23. Hou YC, Hu FR, Chen MS. An autosomal dominant granular Zhi. 2004;21:32–34. corneal dystrophy family associated with R555W mutation in 43. Tian X, Liu ZG, Li Q, et al. Analysis of gene mutation in the BIGH3 gene. J Formos Med Assoc. 2003;102:117–120. Chinese patients with Reis-Bucklers corneal dystrophy [in 24. Dong WL, Zou LH, Pan ZQ, Jin T, Yu J. Molecular genetic study Chinese]. Zhonghua Yan Ke Za Zhi. 2005;41:239–242. on patients with lattice corneal dystrophy in China [in 44. Qi YH, He HD, Li Y, et al. A research on TGFBI gene mutations Chinese]. Zhonghua Yan Ke Za Zhi. 2005;41:523–526. in Chinese families with corneal dystrophies [in Chinese]. 25. Tian X, Fujiji K, Wang W, et al. Novel mutation (V505D) of Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2006;23:310–312. TGFBI gene found in a Chinese family with lattice corneal 45. Yu P, Zou LH, He JC, et al. A clinical and molecular-genetic dystrophy, type I. Jpn J Ophthalmol. 2005;49:84–88. analysis of Chinese patients with lattice corneal dystrophy and 26. Dighiero P, Drunat S, D’Hermies F, Renard G, Delpech M, novel Thr538Pro mutation in TGFBI (BIGH3) gene. J Genet. Valleix S. A novel variant of granular corneal dystrophy caused 2006;85:73–76. by association of 2 mutations in TGFBI gene-R124L and 46. Tian X, Fujiji K, Zhang Y, et al. A novel variant lattice corneal DeltaT125-DeltaE126. Arch Ophthalmol. 2000;118:814–818. dystrophy caused by association of mutation (V625D) in 27. Klintworth GK, Bao W, Na A. Two mutations in TGFBI gene TGFBI gene. Am J Ophthalmol. 2007;144:473–473. associated with lattice corneal dystrophy in an extensively 47. Qi YH, He HD, Li Y, et al. TGFBI gene mutation analysis in a studied family. Invest Ophthalmol Vis Sci. 2004;45:1382– Chinese family with Thiel-Behnke corneal dystrophy [in 1388. Chinese]. Zhonghua Yan Ke Za Zhi. 2007;43:718–721. 28. Munier FL, Frueh BE, Othenin-Girard P, et al. BIGH3 mutation 48. Li D, Qi Y, Wang L, Lin H, Zhou N, Zhao L. An atypical spectrum in corneal dystrophies. Invest Ophthalmol Vis Sci. phenotype of Reis-Bucklers corneal dystrophy caused by 2002;43:949–954. G623D mutation in TGFBI. Mol Vis. 2008;14:1298–1302. 29. Gupta SK, Hodge WG, Damji KF, Guernsey DL, Neumann PE. 49. Liu Z, Wang YQ, Gong QH, Xie LX. R124C mutation in TGFBI Lattice corneal dystrophy type 1 in a Canadian kindred is caused lattice corneal dystrophy type I with variable associated with Arg124Cys mutation in kerato-epithelin gene. phenotype in 3 Chinese families. Mol Vis. 2008;14:1234–1239. Am J Ophthalmol. 1998;125:547–549. 50. C Cao W, Ge H, Cui X, et al. Reduced penetrance in familial 30. Mashima Y, Yamamoto S, Inoue Y, et al. Association of Avellino corneal dystrophy associated with TGFBI mutations. autosomal dominantly inherited corneal dystrophies with Mol Vis. 2009;15:70–75. BIGH3 gene mutations in Japan. Am J Ophthalmol. 2000; 51. Chang L, Zhiqun W, Shijing D, et al. Arg124Cys mutation of 130:516–517. TGFBI gene in 2 Chinese families with Thiel-Behnke corneal 31. Endo S, Nguyen TH, Fujiki K, et al. Leu518Pro mutation of dystrophy. Arch Ophthalmol. 2009;127:641–644. Bigh3 gene causes lattice corneal dystrophy type I. Am J 52. Hu L, Xu F, Ma WJ, Zhang H, Sui RF. R555W mutation of TGFBI Ophthalmol. 1999;128:104–106. related to granular corneal dystrophy in Chinese patients. 32. Warren JF, Abbott RL, Yoon MK, Crawford JB, Spencer WH, Chin Med J. 2009;122:2691–2694. Margolis TP. A new mutation (Leu569Arg) within exon 13 of 53. Li DD, Qi YH, Han Q, Lin H, Zhao LM, Zhang CM. Analysis of TGFBI (BIGH3) gene causes lattice corneal dystrophy type I. TGFBI gene mutation in a Chinese family with atypical Reis- Am J Ophthalmol. 2003;136:872–878. Buckler corneal dystrophy [in Chinese]. Zhonghua Yi Xue Yi 33. Yamamoto S, Okada M, Tsujikawa M, et al. A kerato-epithelin Chuan Xue Za Zhi. 2009;26:245–248. (Bigh3) mutation in lattice corneal dystrophy type IIIA. Am J 54. Wang LM, Wang YC, Qiu DL, Ying M, Li ND. TGFBI gene Hum Genet. 1998;62:719–722. mutations in three Chinese families with autosomal dominant

Downloaded from tvst.arvojournals.org on 09/30/2021 5898 Yam et al. IOVS, August 2012, Vol. 53, No. 9

corneal dystrophy [in Chinese]. Zhonghua Yi Xue Yi Chuan 67. Kolter T, Wendeler M. Chemical chaperones—a new concept Xue Za Zhi. 2009;26:179–182. in drug research. Chembiochem. 2003;4:260–264. 55. Zhang C, Zeng G, Lin H, et al. A novel mutation I522N within 68. Ulloa-Aguirre A, Janovick JA, Brothers SP, Conn PM. Pharma- TGFBI gene caused lattice corneal dystrophy I. Mol Vis. 2009; cologic rescue of conformationally-defective proteins: impli- 15:2498–2502. cations for the treatment of human disease. Traffic. 2004;5: 56. Ma K, Liu G, Yang Y, et al. TGFBI gene mutation analysis in a 821–837. Chinese pedigree of Reis-Bucklers corneal dystrophy. Mol Vis. 69. Leandro P, Gomes CM. Protein misfolding in conformational 2010;16:556–561. disorders: rescue of folding defects and chemical chaperoning. 57. Zhong X, Chen S, Huang W, et al. Novel and known mutations Mini Rev Med Chem. 2008;8:901–911. of TGFBI, their genotype-phenotype correlation and structural 70. Yam GH, Gaplovska-Kysela K, Zuber C, Roth J. Sodium 4- modeling in 3 Chinese families with lattice corneal dystrophy. phenylbutyrate acts as a chemical chaperone on misfolded Mol Vis. 2010;16:224–230. myocilin to rescue cells from endoplasmic reticulum stress 58. Long Y, Gu YS, Han W, Li XY, Yu P, Qi M. Genotype-phenotype and apoptosis. Invest Ophthalmol Vis Sci. 2007;48:1683– correlations in Chinese patients with TGFBI gene-linked 1690. corneal dystrophy. J Zhejiang Univ Sci B. 2011;12:287–292. 59. Zhang T, Yan N, Yu W, et al. Molecular genetics of Chinese 71. Jia LY, Gong B, Pang CP, et al. Correction of disease phenotype families with TGFBI corneal dystrophies. Mol Vis. 2011;17: of myocilin-causing glaucoma by a natural osmolyte. Invest 380–387. Ophthalmol Vis Sci. 2009;50:3743–3749. 60. Zhu Y, Shentu X, Wang W. The TGFBI R555W mutation 72. Ono K, Kamai T, Koizumi H, et al. A chemical chaperone, induces a new granular corneal dystrophy type I phenotype. sodium 4-phenylbutyric acid, attenuates the pathogenic Mol Vis. 2011;17:225–230. potency in human alpha-synuclein A30P þ A53T transgenic 61. Okada M, Yamamoto S, Inoue Y, et al. Severe corneal mice. Parkinsonism Relat Disord. 2009;15:649–654. dystrophy phenotype caused by homozygous R124H keratoe- 73. Gong B, Zhang LY, Lam DS, Pang CP, Yam GH. Sodium 4- pithelin mutations. Invest Ophthalmol Vis Sci. 1998;39:1947– phenylbutyrate ameliorates the effects of cataract-causing 1953. mutant gammaD-crystallin in cultured cells. Mol Vis. 2010; 62. Dighiero P, Schorderet DF, Chaaubert P, et al. Clinical, 16:997–1003. histologic, and ultrastructural features of corneal dystrophy 74. Sauer T, Patel M, Chan CC, Tuo J. Unfolding therapeutic caused by R124L mutation of BIGH3 gene. Ophthalmology. potential of chemical chaperones for age-related macular 2000;107:1353–1357. degeneration. Expert Rev Ophthalmol. 2008;3:29–42. 63. Rozzo C, Fossarello M, Galleri G, et al. A common Bigh3 gene 75. Bonapace G, Waheed A, Shah GN, Sly WS. Chemical mutation (delta f540) in a large cohort of Sardinian Reis chaperones protect from effects of apoptosis-inducing muta- Bucklers corneal dystrophy patients. Hum Mutat. 1998;12: tion in carbonic anhydrase IV identified in retinitis pigmentosa 215–216. 17. Proc Natl Acad Sci U S A. 2004;101:12300–12305. 64. Kim JE, Kim SJ, Lee BH, Park RW, Kim KS, Kim IS. Identification of motifs for cell adhesion within repeated 76. Ozcan U, Yilmaz E, Ozcan L, et al. Chemical chaperones domains of transforming growth factor-beta-induced gene, reduce ER stress and restore glucose homeostasis in a mouse Bigh3. J Biol Chem. 2000;275:30907–30915. model of type 2 diabetes. Science. 2006;313:1137–1140. 65. Deane R, Du Yan S, Submamaryan RK, et al. RAGE mediates 77. Yancey PH, Fyfe-Johnson AL, Kelly RH, Walker VP, Aunõn´ MT. amyloid-beta peptide transport across blood-brain barrier and TMAO counteracts effects of hydrostatic pressure on proteins accumulation in brain. Nat Med. 2003;9:907–913. of deep-sea teleosts. J Exp Zool. 2001;289:172–176. 66. Rosenberg ME, Tervo TM, Gallar J, et al. Corneal morphology 78. Qu Y, Bolen CL, Bolen DW. Osmolyte-driven contraction of a and sensitivity in lattice dystrophy type II (familial amyloidosis, random coil protein. Proc Natl Acad Sci U S A. 1998;95:9268– Finnish type). Invest Ophthalmol Vis Sci. 2001;42:634–641. 9273.

Downloaded from tvst.arvojournals.org on 09/30/2021