ECCB 2014 Demo IFB 2

Total Page：16

File Type：pdf, Size：1020Kb

Bringing the tools to the data - Providing scientists with personalized and on-demand bioinformatics services on the cloud of the French Institute of Bioinformatics! ! ! Christophe BLANCHET, Jean-François GIBRAT (Institut Français de Bioinformatique , !IFB-core CNRS UMS3601)! ! Life science researchers, thanks to the continuous tools R BLAST improvement of experimental technologies, face a deluge of FastA OMSSA ClustalW2 SSearch data whose exploitation requires large computing resources PeptideShaker ARIA X!tandem HMMer BWA and appropriate software tools. They simultaneously use many TopHat samtools Galaxy Clustal Muscle fastQC of the bioinformatics tools from the arsenal of thousands Omega Create available from the international community. Usually they new cloud services + combine their data with public data that are too large to be Linux system moved easily. So the computational infrastructure need to be Virtual Machines tightly connected to public biological databases.! Bioinformatics Marketplace Structures Galaxy ! Sequences Proteomics ... At the French Institute of Bioinformatics (IFB), we developed several bioinformatics cloud services available as cloud appliances. A cloud appliance is a predefined virtual machine that can be run on a remote cloud infrastructure. As cloud appliances have size usually of gigabytes, this is more efficient to moved them where the terabytes of biological data to analyse are stored instead of moving the data. But that requires to have at least few computing resources close to the stored data.! ! We have created bioinformatics appliances Bioinformatics Marketplace providing, for example, an user-devoted Galaxy Select tools Structures Galaxy ... Scientists can filter (1) Sequences Proteomics the appliances through a portal, a virtual desktop environment for (2) Web interface to identify Move and launch (2) the cloud appropriate ones. proteomics analysis or a bioinformatics cluster data VMs tools: BLAST, ClustalW2, BI R, Galaxy… with a lot of standard tools (BLAST, ClustalW2, public data (1) user data UNIPROT Z R, Samtools, Bowtie, TopHat, etc.). Scientists EMBL shared B Genomes PDB W A PROSITE can run their own appliances through an user- Cloud @ IFB Analyze (3) adapted web interface. To connect our cloud data Use tools (3) infrastructure to existing public biological Scientists have access to their own cloud resources through web portal, remote virtual desktop or SSH. databases, we have configured it to connect Cloud Galaxy portal Remote virtual desktop for NGS analyses with proteomics tools automatically all virtual machines to a local repository with public databases like UNIPROT ! or EMBL.! IFB is currently running an academic cloud infrastructure with the appropriate biological data and bioinformatics! tools to meet the needs of the life science community. ! ! ! ! French Institute of Bioinformatics - http://www.france-bioinformatique.fr !.

Copy Link

Recommended publications

De Novo Genomic Analyses for Non-Model Organisms: an Evaluation of Methods Across a Multi-Species Data Set
De novo genomic analyses for non-model organisms: an evaluation of methods across a multi-species data set Sonal Singhal [email protected] Museum of Vertebrate Zoology University of California, Berkeley 3101 Valley Life Sciences Building Berkeley, California 94720-3160 Department of Integrative Biology University of California, Berkeley 1005 Valley Life Sciences Building Berkeley, California 94720-3140 June 5, 2018 Abstract High-throughput sequencing (HTS) is revolutionizing biological research by enabling sci- entists to quickly and cheaply query variation at a genomic scale. Despite the increasing ease of obtaining such data, using these data effectively still poses notable challenges, especially for those working with organisms without a high-quality reference genome. For every stage of analysis – from assembly to annotation to variant discovery – researchers have to distinguish technical artifacts from the biological realities of their data before they can make inference. In this work, I explore these challenges by generating a large de novo comparative transcriptomic dataset data for a clade of lizards and constructing a pipeline to analyze these data. Then, using a combination of novel metrics and an externally validated variant data set, I test the efficacy of my approach, identify areas of improvement, and propose ways to minimize these errors. I arXiv:1211.1737v1 [q-bio.GN] 8 Nov 2012 find that with careful data curation, HTS can be a powerful tool for generating genomic data for non-model organisms. Keywords: de novo assembly, transcriptomes, suture zones, variant discovery, annotation Running Title: De novo genomic analyses for non-model organisms 1 Introduction High-throughput sequencing (HTS) is poised to revolutionize the field of evolutionary genetics by enabling researchers to assay thousands of loci for organisms across the tree of life.
[Show full text]
Comparative Analysis of Multiple Sequence Alignment Tools
I.J. Information Technology and Computer Science, 2018, 8, 24-30 Published Online August 2018 in MECS (http://www.mecs-press.org/) DOI: 10.5815/ijitcs.2018.08.04 Comparative Analysis of Multiple Sequence Alignment Tools Eman M. Mohamed Faculty of Computers and Information, Menoufia University, Egypt E-mail: [email protected]. Hamdy M. Mousa, Arabi E. keshk Faculty of Computers and Information, Menoufia University, Egypt E-mail: [email protected], [email protected]. Received: 24 April 2018; Accepted: 07 July 2018; Published: 08 August 2018 Abstract—The perfect alignment between three or more global alignment algorithm built-in dynamic sequences of Protein, RNA or DNA is a very difficult programming technique [1]. This algorithm maximizes task in bioinformatics. There are many techniques for the number of amino acid matches and minimizes the alignment multiple sequences. Many techniques number of required gaps to finds globally optimal maximize speed and do not concern with the accuracy of alignment. Local alignments are more useful for aligning the resulting alignment. Likewise, many techniques sub-regions of the sequences, whereas local alignment maximize accuracy and do not concern with the speed. maximizes sub-regions similarity alignment. One of the Reducing memory and execution time requirements and most known of Local alignment is Smith-Waterman increasing the accuracy of multiple sequence alignment algorithm [2]. on large-scale datasets are the vital goal of any technique. The paper introduces the comparative analysis of the Table 1. Pairwise vs. multiple sequence alignment most well-known programs (CLUSTAL-OMEGA, PSA MSA MAFFT, BROBCONS, KALIGN, RETALIGN, and Compare two biological Compare more than two MUSCLE).
[Show full text]
MATCH-G Program
MATCH-G Program The MATCH-G toolset MATCH-G (Mutational Analysis Toolset Comparing wHole Genomes) Download the Toolset The toolset is prepared for use with pombe genomes and a sample genome from Sanger is included. However, it is written in such a way as to allow it to utilize any set or number of chromosomes. Simply follow the naming convention "chromosomeX.contig.embl" where X=1,2,3 etc. For use in terminal windows in Mac OSX or Unix-like environments where Perl is present by default. Toolset Description Version History 2.0 – Bug fixes related to scaling to other genomes. First version of GUI interface. 1.0 – Initial Release. Includes build, alignment, snp, copy, and gap resolution routines in original form. Please note this project in under development and will undergo significant changes. Project Description The MATCH-G toolset has been developed to facilitate the evaluation of whole genome sequencing data from yeasts. Currently, the toolset is written for pombe strains, however the toolset is easily scalable to other yeasts or other sequenced genomes. The included tools assist in the identification of SNP mutations, short (and long) insertion/deletions, and changes in gene/region copy number between a parent strain and mutant or revertant strain. Currently, the toolset is run from the command line in a unix or similar terminal and requires a few additional programs to run noted below. Installation It is suggested that a separate folder be generated for the toolset and generated files. Free disk space proportional to the original read datasets is recommended. The toolset utilizes and requires a few additional free programs: Bowtie rapid alignment software: http://bowtie-bio.sourceforge.net/index.shtml (Langmead B, Trapnell C, Pop M, Salzberg SL.
[Show full text]
"Phylogenetic Analysis of Protein Sequence Data Using The
Phylogenetic Analysis of Protein Sequence UNIT 19.11 Data Using the Randomized Axelerated Maximum Likelihood (RAXML) Program Antonis Rokas1 1Department of Biological Sciences, Vanderbilt University, Nashville, Tennessee ABSTRACT Phylogenetic analysis is the study of evolutionary relationships among molecules, phenotypes, and organisms. In the context of protein sequence data, phylogenetic analysis is one of the cornerstones of comparative sequence analysis and has many applications in the study of protein evolution and function. This unit provides a brief review of the principles of phylogenetic analysis and describes several different standard phylogenetic analyses of protein sequence data using the RAXML (Randomized Axelerated Maximum Likelihood) Program. Curr. Protoc. Mol. Biol. 96:19.11.1-19.11.14. C 2011 by John Wiley & Sons, Inc. Keywords: molecular evolution r bootstrap r multiple sequence alignment r amino acid substitution matrix r evolutionary relationship r systematics INTRODUCTION the baboon-colobus monkey lineage almost Phylogenetic analysis is a standard and es- 25 million years ago, whereas baboons and sential tool in any molecular biologist’s bioin- colobus monkeys diverged less than 15 mil- formatics toolkit that, in the context of pro- lion years ago (Sterner et al., 2006). Clearly, tein sequence analysis, enables us to study degree of sequence similarity does not equate the evolutionary history and change of pro- with degree of evolutionary relationship. teins and their function. Such analysis is es- A typical phylogenetic analysis of protein sential to understanding major evolutionary sequence data involves ﬁve distinct steps: (a) questions, such as the origins and history of data collection, (b) inference of homology, (c) macromolecules, developmental mechanisms, sequence alignment, (d) alignment trimming, phenotypes, and life itself.
[Show full text]
Performance Evaluation of Leading Protein Multiple Sequence Alignment Methods
International Journal of Engineering and Advanced Technology (IJEAT) ISSN: 2249 – 8958, Volume-9 Issue-1, October 2019 Performance Evaluation of Leading Protein Multiple Sequence Alignment Methods Arunima Mishra, B. K. Tripathi, S. S. Soam MSA is a well-known method of alignment of three or more Abstract: Protein Multiple sequence alignment (MSA) is a biological sequences. Multiple sequence alignment is a very process, that helps in alignment of more than two protein intricate problem, therefore, computation of exact MSA is sequences to establish an evolutionary relationship between the only feasible for the very small number of sequences which is sequences. As part of Protein MSA, the biological sequences are not practical in real situations. Dynamic programming as used aligned in a way to identify maximum similarities. Over time the sequencing technologies are becoming more sophisticated and in pairwise sequence method is impractical for a large number hence the volume of biological data generated is increasing at an of sequences while performing MSA and therefore the enormous rate. This increase in volume of data poses a challenge heuristic algorithms with approximate approaches [7] have to the existing methods used to perform effective MSA as with the been proved more successful. Generally, various biological increase in data volume the computational complexities also sequences are organized into a two-dimensional array such increases and the speed to process decreases. The accuracy of that the residues in each column are homologous or having the MSA is another factor critically important as many bioinformatics same functionality. Many MSA methods were developed over inferences are dependent on the output of MSA.
[Show full text]
Large Scale Genomic Rearrangements in Selected Arabidopsis Thaliana T
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Large scale genomic rearrangements in selected 2 Arabidopsis thaliana T-DNA lines are caused by T-DNA 3 insertion mutagenesis 4 5 Boas Pucker1,2+, Nils Kleinbölting3+, and Bernd Weisshaar1* 6 1 Genetics and Genomics of Plants, Center for Biotechnology (CeBiTec), Bielefeld University, 7 Sequenz 1, 33615 Bielefeld, Germany 8 2 Evolution and Diversity, Department of Plant Sciences, University of Cambridge, Cambridge, 9 United Kingdom 10 3 Bioinformatics Resource Facility, Center for Biotechnology (CeBiTec, Bielefeld University, 11 Sequenz 1, 33615 Bielefeld, Germany 12 + authors contributed equally 13 * corresponding author: Bernd Weisshaar 14 15 BP: [email protected], ORCID: 0000-0002-3321-7471 16 NK: [email protected], ORCID: 0000-0001-9124-5203 17 BW: [email protected], ORCID: 0000-0002-7635-3473 18 19 20 21 22 23 24 25 26 27 28 29 30 page 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
[Show full text]
HMMER User's Guide
HMMER User's Guide Biological sequence analysis using pro®le hidden Markov models http://hmmer.wustl.edu/ Version 2.1.1; December 1998 Sean Eddy Dept. of Genetics, Washington University School of Medicine 4566 Scott Ave., St. Louis, MO 63110, USA [email protected] With contributions by Ewan Birney ([email protected]) Copyright (C) 1992-1998, Washington University in St. Louis. Permission is granted to make and distribute verbatim copies of this manual provided the copyright notice and this permission notice are retained on all copies. The HMMER software package is a copyrighted work that may be freely distributed and modi®ed under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. Some versions of HMMER may have been obtained under specialized commercial licenses from Washington University; for details, see the ®les COPYING and LICENSE that came with your copy of the HMMER software. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the Appendix for a copy of the full text of the GNU General Public License. 1 Contents 1 Tutorial 5 1.1 The programs in HMMER . 5 1.2 Files used in the tutorial . 6 1.3 Searching a sequence database with a single pro®le HMM . 6 HMM construction with hmmbuild . 7 HMM calibration with hmmcalibrate . 7 Sequence database search with hmmsearch . 8 Searching major databases like NR or SWISSPROT .
[Show full text]
An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identiﬁcation and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging ﬁeld of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs.
[Show full text]
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
[Show full text]
Assembly Exercise
Assembly Exercise Turning reads into genomes Where we are • 13:30-14:00 – Primer Design to Amplify Microbial Genomes for Sequencing • 14:00-14:15 – Primer Design Exercise • 14:15-14:45 – Molecular Barcoding to Allow Multiplexed NGS • 14:45-15:15 – Processing NGS Data – de novo and mapping assembly • 15:15-15:30 – Break • 15:30-15:45 – Assembly Exercise • 15:45-16:15 – Annotation • 16:15-16:30 – Annotation Exercise • 16:30-17:00 – Submitting Data to GenBank Log onto ILRI cluster • Log in to HPC using ILRI instructions • NOTE: All the commands here are also in the file - assembly_hands_on_steps.txt • If you are like me, it may be easier to cut and paste Linux commands from this file instead of typing them in from the slides Start an interactive session on larger servers • The interactive command will start a session on a server better equipped to do genome assembly $ interactive • Switch to csh (I use some csh features) $ csh • Set up Newbler software that will be used $ module load 454 A norovirus sample sequenced on both 454 and Illumina • The vendors use different file formats unknown_norovirus_454.GACT.sff unknown_norovirus_illumina.fastq • I have converted these files to additional formats for use with the assembly tools unknown_norovirus_454_convert.fasta unknown_norovirus_454_convert.fastq unknown_norovirus_illumina_convert.fasta Set up and run the Newbler de novo assembler • Create a new de novo assembly project $ newAssembly de_novo_assembly • Add read data to the project $ addRun de_novo_assembly unknown_norovirus_454.GACT.sff
[Show full text]
Supplemental Material Nanopore Sequencing of Complex Genomic
Supplemental Material Nanopore sequencing of complex genomic rearrangements in yeast reveals mechanisms of repeat- mediated double-strand break repair McGinty, et al. Contents: Supplemental Methods Supplemental Figures S1-S6 Supplemental References Supplemental Methods DNA extraction: The DNA extraction protocol used is a slight modification of a classic ethanol precipitation. First, yeast cultures were grown overnight in 2 ml of complete media (YPD) and refreshed for 4 hours in an additional 8 ml YPD to achieve logarithmic growth. The cultures were spun down, and the pellets were resuspended in 290 µl of solution containing 0.9M Sorbitol and 0.1M EDTA at pH 7.5. 10 µl lyticase enzyme was added, and the mixture was incubated for 30 minutes at 37oC in order to break down the yeast cell wall. The mixture was centrifuged at 8,000 rpm for two minutes, and the pellet was resuspended in 270 µl of solution containing 50mM Tris 20mM EDTA at pH 7.5, and 30 µl of 10% SDS. Following five minutes incubation at room temperature, 150 µl of chilled 5M potassium acetate solution was added. This mixture was incubated for 10 min at 4oC and centrifuged for 10 min at 13,000 rpm. The supernatant was then combined with 900 µl of pure ethanol, which had been chilled on ice. This solution was stored overnight at -20oC, and then centrifuged for 20 minutes at 4,000 rpm in a refrigerated centrifuge. The pellet was then washed twice with 70% ethanol, allowed to dry completely, and then resuspended in 50 µl TE (10mM Tris, 1mM EDTA, pH 8).
[Show full text]
Providing Bioinformatics Services on Cloud
Providing Bioinformatics Services on Cloud Christophe Blanchet, Clément Gauthey InfrastructureC. Blanchet Distributed and C. Gauthey for Biology IDB-IBCPEGI CF13, CNRS Manchester, FR3302 - LYON 9 April - FRANCE2013 http://idee-b.ibcp.fr Infrastructure Distributed for Biology - IDB CNRS-IBCP FR3302, Lyon, FRANCE IDB acknowledges co-funding by the European Community's Seventh Framework Programme (INFSO-RI-261552) and the French National Research Agency's Arpege Programme (ANR-10-SEGI-001) Bioinformatics Today • Biological data are big data • 1512 online databases (NAR Database Issue 2013) • Institut Sanger, UK, 5 PB • Beijing Genome Institute, China, 4 sites, 10 PB ➡ Big data in lot of places • Analysing such data became difficult • Scale-up of the analyses : gene/protein to complete genome/ proteome, ... • Lot of different daily-used tools • That need to be combined in workflows • Usual interfaces: portals, Web services, federation,... ➡ Datacenters with ease of access/use • Distributed resources ADN Experimental platforms: NGS, imaging, ... • ADN • Bioinformatics platforms BI Federation of datacenters M ➡ BI CC ADN ADN BI ADN EGI CF13, Manchester, 9 April 2013 ADN ADN BI ADN ADN M M Sequencing Genomes Complete genome sequencing become a lab commodity with NGS (cheap and efficient) source: www.genomesonline.org source: www.politigenomics.com/next-generation-sequencing-informatics EGI CF13, Manchester, 9 April 2013 Infrastructures in Biology Lot of tools and web services to treat and vizualize lot of data EGI CF13, Manchester, 9 April 2013
[Show full text]