Lekas the Human Cytochrome P450 1A1 Mrna Is Rapidly Degraded In

Archives of Biochemistry and Biophysics Vol. 384, No. 2, December 15, pp. 311–318, 2000 doi:10.1006/abbi.2000.2115, available online at http://www.idealibrary.com on

The Human Cytochrome P450 1A1 mRNA Is Rapidly Degraded In HepG2 Cells

Poli Lekas, Kar Lok Tin, Chunja Lee, and Rebecca D. Prokipcak1 Department of Pharmacology, Medical Sciences Building, University of Toronto, Toronto, Canada M5S1A8

Received April 25, 2000, and in revised form September 14, 2000

The cytochromes P450 (P450s)2 are a superfamily of The cytochromes P450 are a superfamily of en- enzymes that can carry out a wide range of oxidative zymes that can carry out a wide range of oxidative reactions (1–3). They have an important biological role reactions. While the transcriptional control of the in metabolizing xenobiotics and aiding in their elimi- cytochrome P450 genes has been relatively well- nation from the body. Cytochromes P450 also contrib- studied, posttranscriptional regulatory mechanisms ute to the biosynthesis and degradation of endogenous that contribute to the regulation of P450s are much substrates including steroid hormones, vitamin D, and less well understood. We followed the decay of cholesterol (4). Of the 14 families of P450s identified to CYP1A1, CYP1A2, and CYP1B1 mRNAs after induc- date in humans (5), the first four carry out the majority tion by the AH receptor ligand 2,3,7,8,-tetrachlorod- of xenobiotic metabolism. In human liver, the P450s ibenzo-p-dioxin. CYP1A2 and CYP1B1 mRNAs were present in the highest concentration include CYP1A2, long-lived in this cell line (t 1 24 h). In contrast, the 2 > CYP2A6, CYP2C, CYP2E1, and CYP3A (4). CYP1A1 mRNA decays remarkably quickly. To deter- Early observations that the concentration of some mine if this rapid decay was unique to CYP1A1, we mammalian P450s could be induced upon exposure to assessed the decay of selected human P450 and liver- substrates lead to extensive work characterizing the specific mRNAs in HepG2 cells as a comparison. We regulation of this family of enzymes (2, 6). Induction of analyzed albumin, phosphofructokinase, and the CYP1A family genes by 2,3,7,8,-tetrachlorod- GAPDH mRNAs and found that they were long-lived, ibenzo-p-dioxin (TCDD), and the phenobarbital induc- with half-lives >24 h. We show that CYP2E1 mRNA tion of CYP2B genes, were found to occur at the level of can be detected in HepG2 cells by RT-PCR and that transcription (7, 8). From the study of these and other this mRNA also has a basal half-life of >24 h. Thus systems, a great deal is now known about the tran- the CYP1A1 mRNA with its half-life of 2.4 h was one scriptional control of cytochrome P450 genes (9, 10). In of the shortest-lived mRNA studied and is the most contrast, posttranscriptional regulatory mechanisms unstable of the cytochrome P450 mRNAs we have are much less well understood. Despite limited knowl- tested. The rapid decay of CYP1A1 mRNA is associ- edge, the potential importance of posttranscriptional ated with a rapid loss in poly(A) tail length, suggest- pathways is illustrated by the induction of CYP2E1 by ing that deadenylation is the first step in the decay ethanol and other substrates, which appears to occur pathway. The short half-life appears to be conserved at the levels of protein translation and stabilization across species, which suggests that this characteris- (11–16). tic of the CYP1A1 mRNA is important for its function. © 2000 Academic Press Key Words: cytochrome P450; mRNA stability; HepG2 2 Abbreviations used: ActD, actinomycin D; ACU, arbitrary cDNA cells; human hepatoma cells; CYP1A1; CYP1A2; unit; AHR, AH receptor; P450, cytochrome P450, CYP1A1, cyto- CYP1B1; CYP2E1; poly(A) tail; deadenylation. chrome P4501A1; CYP1A2, cytochrome P4501A2; CYP1B1, cytochrome P4501B1; CYP2E1, cytochrome P4502E1; CYP7; cytochrome P4507 (cholesterol 7 ␣-hydroxylase); DRB, 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole; GAPDH, glyceraldehyde-3-phosphate de- hydrogenase; kb, kilobase; nt, nucleotide; P450s, cytochromes P450; PFK-L, 6-phosphofructo-2-kinase, liver type; RT-PCR, reverse-tran- 1 To whom correspondence and reprint requests should be ad- scription polymerase chain reaction; TCDD, 2,3,7,8-tetrachloro- dressed. Fax: (416) 978-6395. E-mail: [email protected]. dibenzo-p-dioxin; 3ЈUTR, 3Ј untranslated region.

In our laboratory, we are interested in the regulation ing of nucleotides 1486 through 2081 of the human CYP1A1 cDNA of mRNA degradation, and the role this process plays sequence, containing both coding and 3ЈUTR sequences. The short CYP1A1 probe used, which consisted of only 3Ј untranslated region in cytochrome P450 expression. mRNA levels reflect a (3ЈUTR) sequences, was a 282-bp PCR-generated fragment consist- balance between the rate of mRNA synthesis and the ing of nucleotides 2221 through 2512 of the human CYP1A1 cDNA rate of mRNA decay. The decay rate for a given cyto- sequence. The CYP2E1 probe used was a 570 bp PCR-generated chrome P450 mRNA will influence its steady state fragment consisting of nucleotides 364 through 935 of the human concentration and determine how quickly it can re- CYP2E1 cDNA sequence. The albumin probe was a 1156-bp PCR- generated fragment consisting of nucleotides 426 through 1582 of the spond to environmental cues (17–19). The mRNA half- human albumin sequence. The PCR-generated probes for c-myc and lives may also vary under some circumstances. There GAPDH have been previously described (26). The probe for the liver is evidence to support a role of mRNA decay in regu- form of 6-Phosphofructo-2-kinase (PFK-L) was prepared by digesting lation of several cytochrome P450s. For example, the the cPFKL3.0 plasmid DNA (ATCC) with BamHI and gel-purifying mouse CYP2A5 mRNA can be stabilized by treatment the 1.0-kb fragment. For longer time courses, mRNA signals were normalized to 28 S ribosomal RNA, detected using an end-labeled with pyrazole; the increase in half-life from 1.5 to 6 h oligonucleotide probe as described (27). The CYP2E1 cDNA was results in a 20-fold increase in the steady-state kindly provided by Dr. Frank Gonzalez. The cDNAs for human CYP2A5 mRNA concentrations (20). The rat CYP2E1 albumin and human PFK-L were obtained from the American Type mRNA can be destabilized after treatment of hepato- Culture Collection. cytes or hepatoma cells in culture with insulin (21, 22); RNase H mapping of the 3Ј end of CYP1A1 mRNA. Poly(A) short- ␮ this alteration may contribute to the posttranscrip- ening was analyzed as previously described (28–30). A 15–20 g aliquot of total RNA was hybridized to 1 ␮g of the oligonucleotide tional control of CYP2E1 mRNA levels seen in diabetic CCTGTTTGTTCCTGCCTGCA which is complementary to nucleo- rats (23). tides 2191–2210 of the human CYP1A1 cDNA sequence. In some ␮ In this report, we show that many mRNAs in the reactions, 5 g of oligo(dT)12-18 (Pharmacia) was also added. The human hepatoma cell line HepG2 are long-lived, with hybrids were then treated with 0.8–1.0 unites of RNase H (USB) in half-lives in excess of 24 h. In contrast, the CYP1A1 20 mM Tris–HCl, 28 mM MgCl2, 0.5 nM EDTA, 25 mM KCl (pH 8.0) at 37°C for 30 min. After incubation, samples were precipitated in mRNA decays remarkably quickly. With a half-life of the presence of glycoblue (Ambion) and resuspended directly into 2.4 h, it was one of the shortest-lived mRNA studied loading buffer and analyzed by electrophoresis through 2% agarose and is the most unstable of the cytochrome P450 as describe above. After transfer to Zetaprobe membranes, the blots mRNAs we have tested. This rapid decay appears to be were probed with the CYP1A1 3ЈUTR probe. conserved across species (24), and this characteristic of Reverse transcription. For CYP1A1, CYP1A2, and CYP1B1, 1 ␮g total RNA was reverse transcribed using 200 pmol oligo(dT) primer the CYP1A1 mRNA may be important for its function. and M-MLV Reverse Transcriptase as previously described (25). As a double-check, some reactions were carried out using random hex- ␮ MATERIALS AND METHODS amers (150 pmol) as primers. For CYP2E1 mRNA, 4 g of total RNA was heated at 70°C with 200 pmol of random hexamers for 10 min. Cell culture. The human hepatoma cell line HepG2 was obtained Reverse transcription was carried out with Superscript II Reverse from the American Type Culture Collection (Rockville, MD). HepG2 Transcriptase (Gibco BRL) at 42°C for 4 or 20 h before inactivation of cells were grown as monolayers in ␣-minimal essential medium the enzyme at 70°C for 10 min and storage at Ϫ20°C until use. The (␣-MEM) containing 10% fetal bovine serum (without antibiotics) amount of reverse transcribed RNA (cDNA) input that went into and maintained in an atmosphere of 5% CO2/95% room air at 37°C. each PCR reaction was defined using arbitrary cDNA units (ACU) as Cell treatments and RNA isolation. Cells were treated with 5,6- previously described (26), where 1 ACU of template is the amount of dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) at a final con- cDNA synthesized from 1 ng of total RNA. centration of 100 ␮M in 0.1% DMSO or with Actinomycin D (ActD) at Polymerase chain reaction. Primers used in this study have been a final concentration of 5 ␮g/ml in 0.05% DMSO. Treatment times previously described for GAPDH (26), and for CYP1A1, CYP1A2, and are indicated in the figure legends. For induction of CYP1 family CYP1B1 (25). Primers specific for human CYP2E1 were designed mRNAs, cells were treated with 2 nM 2,3,7,8-tetrachlorodibenzo-p- from published cDNA sequences of the gene (31). The sequences of dioxin (TCDD) in ␣-MEM plus 10% fetal calf serum (25). TCDD the CYP2E1 primers used are as follows: CYP2E1 forward, 5Ј TG- treatment was for 2 or 17 h, after which time the media was replaced GAAGCACTCAGGAAGACC 3Ј; CYP2E1 reverse, 5Ј TCCATTGTG- by ␣-MEM with 10% FCS containing 100 ␮M DRB. Total RNA was TACAAGCGCTC 3Ј. isolated from cells using Trizol reagent (Gibco-BRL) as previously All primer sets amplify across multiple introns and therefore serve described (26). as a check for genomic DNA contamination. PCR was carried out in Northern blot analysis. Northern blot analysis was carried out a GeneAmp PCR System Thermal Cycler 2400 (PE Applied Biosys- essentially as described (26). Briefly, total cellular RNA was sepa- tems) in 50 ␮l reaction mixtures. For CYP1A1, CYP1A2, and rated by electrophoresis ina1to2%agarose–2.2 M formaldehyde CYP1B1, PCR was carried out with 100 ACUs using previously denaturing gel and transferred to Zetaprobe membranes (Bio-Rad). described buffer and temperature conditions (25) in the presence of 1 Blots were prehybridized for1hinhybridization buffer (125 mM ␮Ci [32P]dCTP. 32P-labeled products were separated on a 5% nonde- sodium phosphate pH 7.2/1 mM EDTA/125 mM NaCl/7% SDS/50% naturing polyacrylamide gel in 1X TBE. For each set of samples, the formamide). Hybridization was carried out in the same buffer con- cycle number was varied between 23 and 32 cycles to confirm that taining the radiolabeled probes for 16 to 24 h at 37°C (rat GAPDH product formation was not limited due to saturation of reaction probe) or 42°C (all other probes). For the 28S rRNA oligonucleotide components. In most cases, 28 to 30 cycles was optimal for CYP1A2 probe, hybridization was carried out at 45°C. and CYP1B1, while 23 to 25 cycles was optimal for CYP1A1. Probes for hybridization were in most cases prepared using PCR PCR using the GAPDH and CYP2E1 primers was carried out in 50

with plasmid DNA containing cDNA clones as templates. The long ␮l reaction mixtures containing 2.0 mM MgCl2, 20 mM Tris–Cl (pH CYP1A1 probe used was a 596 bp PCR-generated fragment consist- 8.4), 50 mM KCl, 400 ␮M dNTPs, 4 pmol of forward and reverse SHORT HALF-LIFE OF HUMAN CYP1A1 mRNA 313 primers, various amounts of cDNA reaction mix (see figure legends), and 2.5 units Taq DNA polymerase (Gibco BRL). Samples were denatured at 94°C for 5 min and cycled 20–35 times through a 30-s denaturation step at 94°C, a 30-s annealing step at 58°C and a 30-s extension step at 72°C. After a final PCR extension of 5 min at 72°C the samples were stored at Ϫ20°C for further analysis. Optimized conditions for detection of CYP2E1 involved the use of 100 ACUs amplified over 27–30 cycles. For GAPDH, 0.5 ACUs for 27–29 cycles were found to be optimal. These GAPDH conditions were slightly different than previously reported (26) due to the different reverse transcription conditions used in the current study. The actual cycle number and ACU within this range that were optimal for a given set of samples was reconfirmed in each experiment; this approach min- imized the effects of day to day variation in RT and PCR efficiency. Quantitation and statistical analysis. Quantitation of hybridized 32P-labeled probes was determined using a STORM instrument (Mo- lecular Dynamics). Data were subsequently analyzed using Image- Quant computer software (Molecular Dynamics). For analysis of PCR products directly labeled with 32P (CYP1A1, CYP1A2, and CYP1B1), dried gels were exposed to a Phosphor screen and analyzed using the STORM. The identity of amplified CYP2E1 PCR products was initially confirmed by Southern blot analysis as described (26), and hybridized radioactive probes were quantitated using a Phosphor screen (Molecular Dynamics). For more routine analysis, quantitation was carried out after staining of PCR products with the fluorescent stain Vistra Green (Amersham). Gels were stained for 1 h using a 1:10,000 dilution of Vistra Green in 0.5X TBE (45 mM Tris–borate, 1 mM EDTA), and fluorescence was quantified using a STORM instrument FIG. 1. Decay of CYP1A1 mRNA after induction by TCDD. HepG2 (Molecular Dynamics). Comparable results were obtained using Vis- cells were grown to 70–80% confluence at which time they were fed tra Green staining and hybridization of Southern Blots with radio- fresh ␣-MEM plus 10% FCS alone (control) or ␣-MEM plus 10% FCS active probes (data not shown). containing 2 nM TCDD (TCDD treated). 17 h later, the media was All mRNA decay curves were analyzed individually using linear replaced by ␣-MEM plus 10% FCS containing 100 ␮M DRB. Total regression of a semilog plot of RNA concentration vs time (19). RNA was extracted at the indicated times after DRB addition and Half-lives obtained from separate experiments were then used to was separated by electrophoresis (15 ␮g per lane) on a 1% agarose/ calculate a mean half-life (Ϯ standard deviation). 2.2 M formaldehyde gel as described under Materials and Methods. The gel was transferred to Zetaprobe membrane and sequentially probed with the long CYP1A1 probe and with the GAPDH-specific RESULTS probe. (A) Northern blot analysis of CYP1A1 (upper) and GAPDH Decay of CYP1 Family mRNAs after Induction with (lower) specific signals. (B) Radiolabeled bands were quantitated by TCDD PhosphorImager analysis. The radioactivity associated with CYP1A1 was normalized to the GAPDH level in each lane and CYP1A1 is one of the best characterized cytochrome expressed as a percent of the TCDD treated t ϭ 0 (maximum) levels. P450s, and cell culture systems like HepG2 cells have Data shown are representative of three separate experiments. been shown to be good models for the in vivo regulation of this mRNA (25, 32, 33). We set out to assess the cells after TCDD treatment (Figs. 1 and 2). In contrast, mRNA decay properties of CYP1A1 mRNA. The tran- CYP1B1 was detectable in control cells and was in- scription of CYP1A1, CYP1A2, and CYP1B1 is con- duced only three- to fourfold after treatment with trolled by ligands acting through the AH receptor (25, TCDD (Fig. 2). To measure the decay rate of the 34). We induced these mRNAs in HepG2 cells with a mRNAs, the TCDD was removed after the induction 17 h pretreatment with 2 nM 2,3,7,8-tetrachlorod- period and replaced with media containing the tran- ibenzo-p-dioxin (TCDD). This concentration has been scriptional inhibitor DRB. RNA was isolated at in- shown to achieve good induction in human cell lines creasing times after the DRB treatment. (25). After TCDD treatment, CYP1A1 mRNA could be After transcriptional inhibition, the level of CYP1A1 readily observed by Northern blot analysis (Fig. 1A), mRNA decreased rapidly, with a half-life of 2.4 Ϯ but the concentrations of CYP1A2 and CYP1B1 in both 0.13 h (n ϭ 3) (Fig. 1 and Table I). In contrast, the control and treated cells were below the level of detec- CYP1A2 and CYP1B1 mRNAs were long-lived, with tion by this procedure (data not shown). We therefore decay rates of Ͼ24 h (Fig. 2 and Table I). We analyzed used the RT-PCR conditions described by Li et al. (25) the RT samples with the CYP1A1 primers and con- for the detection of CYP1A2 and CYP1B1 mRNAs in firmed that the decay of this mRNA measured using these cells. RT-PCR paralleled the rapid decay observed by North- Both CYP1A1 and CYP1A2 were essentially absent ern analysis (Figs. 1 and 2). As a further check, we in untreated cells and were induced up to 50-fold in carried out reverse transcription using random prim- 314 LEKAS ET AL.

FIG. 2. Analysis of decay of CYP1A2, CYP1B1 and CYP1A1 by RT-PCR in samples from TCDD-treated HepG2 cells. HepG2 cells were treated with or without TCDD as described in the legend to Fig. 4. After 17 h, the media was replaced by ␣-MEM with 10% FCS containing 100 ␮M DRB. Total RNA was extracted at the indicated times after DRB addition. RNA was reverse-transcribed using oligo(dT) as a primer as described under Materials and Methods. (A) PCR was carried out with primers speciﬁc for CYP1A2 for 28 cycles in the presence of [32P]dCTP, and products were separated by polyacrylamide gel electrophoresis as described under Materials and Methods. The “C” (ﬁrst lane) indicates control samples that were not treated with TCDD. (B) As with A except using CYP1B1 primers. (C) As with A except using CYP1A1 primers and using 23 cycles of PCR. Data shown are representative of three separate experiments.

ers instead of oligo(dT). A similar decay pattern for the three mRNAs was observed in these samples (data not shown), confirming that there is a distinct difference in FIG. 3. Analysis of decay of liver-specific mRNAs in HepG2 cells. ␮ the decay pattern for CYP1A1 mRNA compared to the HepG2 cells (80 to 90% confluent) were treated with 100 M DRB. Total RNA was extracted at the indicated times after DRB addition. other CYP1 family members. (A through D) Total RNA (15 ␮g per lane) was separated by electrophoresis on a 1% agarose/2.2 M formaldehyde gel as described under Decay of Liver-Specific mRNAs in HepG2 Cells Materials and Methods. The gel was transfered to Zetaprobe membrane and sequentially probed with albumin, PFK-L, GAPDH and To determine if the rapid decay of CYP1A1 mRNA is 28S rRNA-specific probes. Radioactive signals from albumin (A), a common property of many mRNAs in HepG2 cells, we PFK-L (B), GAPDH (C), and 28S rRNA (D) signals at 4, 8, and 24 h assessed the half-lives of several liver-specific mRNAs after DRB addition are shown. (E) Total RNA (4 ␮g) was reverse transcribed to cDNA using random hexamers as primers as de- and house-keeping mRNAs as benchmarks for compar- scribed under Materials and Methods. PCR was carried out using ison. The Ϸ2.1-kb mRNA for albumin (35, 36) is abun- CYP2E1-specific primers and 200 ACUs of template amplified through 29 cycles. The PCR products were separated by electrophoresis, stained with Vistra Green, and fluorescence visualized TABLE I using the Molecular Dynamics STORM. (F) Radiolabeled bands were mRNA Half-Life Determinations in HepG2 Cells quantitated by PhosphorImager analysis. The radioactivity present in each lane is normalized to the 28S rRNA signal and expressed as a percentage of control (t ϭ 0) levels. PCR products were stained with mRNA Half-life Reference Vistra Green, and fluorescence visualized and quantitated using the Molecular Dynamics STORM. Fluorescence was expressed as a per- c-myc 55 Ϯ 5 min (26) centage of the control (t ϭ 0) level. Data shown are representative of MDR1 8 Ϯ 2 h (67) at least three separate experiments. GAPDH Ͼ24 h This study Albumin Ͼ24 h This study PFK-L Ͼ24 h This study CYP7 4.6 Ϯ 0.9 h (26) dant in HepG2 cells, being readily detectable by North- CYP2E1 Ͼ24 h This study ern blot analysis (Fig. 3A). The Ϸ3.0-kb mRNA encod- CYP1A1 2.4 Ϯ 0.013 h This study ing the liver form of phosphofructokinase (PFK-L) (37) CYP1A2 Ͼ24 h This study Ϸ Ͼ and the 1.3-kb mRNA encoding GAPDH (38) are also CYP1B1 24 h This study readily detectable (Figs. 3B and 3C). In a time course of SHORT HALF-LIFE OF HUMAN CYP1A1 mRNA 315 up to 24 h treatment with DRB, no decay of these three mRNAs that have been previously characterized, the mRNAs was observed (Fig. 3). We carried out extended rapid decay is associated with a rapid loss of the decay experiments out to 56 h of exposure to either poly(A) tail, making deadenylation the first and rate- DRB or ActD (data not shown). However, in exposures limiting step in decay (29, 39–41). To test if the rapid of HepG2 cells to greater than 24 h of the transcrip- decay of the CYP1A1 mRNA is also associated with tional inhibitors, we noted cell toxicity and a drop in rapid deadenylation, we analyzed the fate of the 3Јend total RNA yields. This was more pronounced with ActD of the CYP1A1 mRNA after TCDD-induced transcrip- than with DRB. For future experiments, therefore, we tion. confined our treatments to 24 h of DRB or less, where To facilitate analysis of the 3Ј end, we subjected the toxicity was not observed. For the mRNAs that did not CYP1A1 mRNA to oligonucleotide-directed RNase H decay in this time frame, we designated their half-lives cleavage at position 2210 prior to Northern blotting. Ͼ as being 24 h (Table I). This procedure generates an RNA that contains the CYP2E1 mRNA is abundant in human liver and can last 355 nucleotides of the 3ЈUTR and the poly(A) tail be readily detected using Northern blot procedures. (referred to as the 3Ј CYP1A1 fragment). The smaller Under the same hydridization conditions, this mRNA size of this fragment allows for the easier experimental cannot be detected in RNA samples obtained from HepG2 cells (data not shown). Using RT-PCR, how- determination of poly(A) tail length and fate of the ever, we were able to detect the expected 394 bp PCR poly(A) tail during decay. As a comparison, the RNA product for CYP2E1 mRNA in both HepG2 cells and in samples were also digested with RNase H in the pres- human liver (data not shown). The identity of the ence of both the sequence-specific oligonucleotide and Ј CYP2E1 PCR product was verified by both restriction oligo(dT), which generates the deadenylated 3 digest patterns and hybridization with sequence-spe- CYP1A1 fragment. cific probes (data not shown). In order to determine We first analyzed the samples from our standard relative quantitation of CYP2E1 mRNA to measure its 17–18 h TCDD treatment, which had been used for decay rate, we optimized the PCR conditions by assay- determination of CYP1 mRNA decay rates (Figs. 1 and ing the product formation over a range of both cycle 2). In this population, the 3Ј CYP1A1 fragment is het- number and template concentration. Optimized condi- erogenous in length (Fig. 4A, lane 1). The same sample tions for detection of CYP2E1 involved the use of 100 that is deadenylated generates a tighter band of Ϸ400 ACUs amplified over 27–30 cycles. Using these condi- nt in size (Fig. 4A, lane 6). This suggests that, at a time tions, we then measured the decay of the CYP2E1 when both synthesis and degradation of the CYP1A1 mRNA under “basal” conditions. As shown in Fig. 3E, the mRNA is occurring, the population of CYP1A1 mRNAs human CYP2E1 mRNA has a half-life Ͼ24 h (Table I). have different poly(A) tail lengths. When transcription Many of the cytochrome P450 mRNAs are expressed is inhibited with DRB, the average length of the at low levels in HepG2 cells, and we required RT-PCR poly(A) tail of the population shrinks as the mRNAs for their detection. We have previously shown that are degraded (Fig. 4A, lanes 2 through 5), suggesting RT-PCR can be reliably used for the analysis of mRNA that loss of the poly(A) tail is an early step in the decay decay as judged by its ability to accurately measure process. c-myc mRNA decay in HepG2 cells (26). In these ex- To get a clearer indication of the temporal relation- periments, we were able to detect decay of CYP7 ship between poly(A) tail loss and degradation of the mRNA by RT-PCR (t 1 of 4 h; Table I) even though the 2 rest of the CYP1A1 mRNA molecule, we treated starting levels for this mRNA were low (26). Given HepG2 cells for a brief period (2 h) with TCDD fol- these previous results, it is unlikely that the lack of lowed by removal of the inducer and addition of DRB. decay of CYP1A2, CYP1B1, and CYP2E1 is due to lack We hypothesized that the population of mRNAs syn- of ability of the RT-PCR assay to detect changes in CYP mRNA levels, but is instead an accurate reflection of thesized in this brief period would be more homoge- the stability of these mRNAs in this cell line. neous in the length of their poly(A) tail. As illustrated in Fig. 4B, this appears to be the case. The 3Ј CYP1A1 fragment is much less heterogenous in size Analysis of the Fate of the CYP1A1 Poly(A) Tail (Fig. 4B lane 1). It has a total length of Ϸ600–700 nt, during Degradation suggesting that the poly(A) tail is Ϸ300 nt long. Most of the mRNAs we studied in HepG2 cells were When transcription is inhibited, the length of the 3Ј long-lived (Figs. 2 and 3), and therefore it is unlikely CYP1A1 fragment decreases over time (Fig. 4B) in a that the rapid decay of the CYP1A1 mRNA is due to manner that parallels the decay of the full length over-expression of a general ribonuclease in HepG2 mRNA (Fig. 1). These data support a model where cells. Instead, our results suggest a more targeted deg- loss of the poly(A) tail is an early step in the degra- radation process for this mRNA. For many unstable dation of the CYP1A1 mRNA. 316 LEKAS ET AL.

many of which have half-lives too long to measure (Table I). The rapid degradation of CYP1A1 mRNA is therefore unlikely to be due to over-expression of a general ribonuclease in these cells, but instead appears to involve a relatively specific process. The long-lived mRNAs we studied included mRNAs involved in “house-keeping” functions and liver-specific functions. The long half-lives of these mRNAs may reflect the need within the liver of maintaining relatively high concentrations of the corresponding pro- teins (17). The human CYP2E1 mRNA is also stable in this cell line. CYP2E1 is an abundant cytochrome P450 in human liver (44), yet little is known about how this gene is regulated in humans. Although previous reports have shown that HepG2 cells do not express high enough levels of CYP2E1 mRNA for detection by Northern blot analysis (45, 46), we were able to detect the mRNA using the more sensitive RT-PCR procedure. The long half-life we detect for this mRNA is consistent with measurements of rat CYP2E1 mRNA FIG. 4. Loss of the CYP1A1 poly(A) tail after transcriptional inhi- in liver in vivo, which suggest that it is very long-lived bition. (A) HepG2 cells were treated with TCDD as described in the legend to Fig. 1. After 17 h, the media was replaced by ␣-MEM with (47). However, a shorter half-life of 6 h was reported for 10% FCS containing 100 ␮M DRB. Total RNA was extracted at the rat CYP2E1 mRNA in Fao cells (21). The rat and rabbit indicated times after DRB addition. RNA samples (20 ␮g) were CYP2E1 mRNAs have been shown to be regulated at incubated with the CYP1A1 3ЈUTR specific oligonucleotide with the level of mRNA decay (21, 48). For example, treat- (lane 6) or without (lanes 1–5) oligo(dT) followed by digestion with ment of Fao cells with insulin decreases the stability of RNase H. Samples were separated by electrophoresis on a 2% agarose/2.2 M formaldehyde gel as described under Materials and Meth- the rat CYP2E1 mRNA and lowers its steady state ods. The gel was transferred to Zetaprobe membrane and probed level (21). Further work will be required to determine if with the short CYP1A1 (3ЈUTR only) probe. Sizes of RNA markers the human CYP2E1 mRNA is regulated at the level of are indicated on the left. (B) HepG2 cells were treated with 2 nM mRNA stability. ␣ TCDD in -MEM plus 10% fetal calf serum. TCDD treatment was for The sequence of the CYP1A1 mRNA does not provide 2 h, after which time the media was replaced by ␣-MEM with 10% FCS containing 100 ␮M DRB. Total RNA was extracted at the any immediate clues as to how its decay is ensured. indicated times. RNA samples (20 ␮g) were incubated with the The CYP1A1 3ЈUTR is long (Ϸ950 nt) and overall has CYP1A1 3ЈUTR specific oligonucleotide with (lane 9) or without a GC content of 50%. Therefore, unlike many unstable (lanes 1–8) oligo(dT), followed by digestion with RNase H. Samples mRNAs (39, 49–51), the CYP1A1 does not have a were separated by electrophoresis on a 2% agarose/2.2 M formalde- Ј hyde gel as described under Materials and Methods. The gel was 3 UTR that is highly AU-rich. The last 150 nt of the transferred to Zetaprobe membrane and probed with the CYP1A1 3ЈUTR does contain two AUUUA motifs; however, 3ЈUTR probe. Sizes of RNA markers are indicated on the left. these lack the full nonomer structure thought to be important in targeting rapid decay (UUAUUUAUU, (52, 53)), and are not in a U-rich context (39). Further DISCUSSION work will be required to determine which sequence The CYP1 family mRNAs are induced in many cell elements within the CYP1A1 mRNA target it for rapid types after exposure to AH receptor ligands such as destruction, and whether these instability motifs are TCDD or 3-methylcholanthrene (25, 34, 42). The time unique. course of induction of the different CYP1 family mem- Although the CYP1A1 3ЈUTR lacks AU-rich ele- bers, and the differences between transcription and ments, the decay appears to involve rapid loss of the steady state levels, have lead to suggestions that the poly(A) tail as the first step. At early times after stability of rodent CYP1A1 and CYP1A2 mRNAs are TCDD-induced transcription, the CYP1A1 poly(A) tail quite different (43). We have shown that human appears to be more homogenous in size. In contrast, CYP1A1 and CYP1A2 mRNAs also have very different after 17 h of exposure to the TCDD inducer, the decay behavior, with the CYP1A2 mRNA being much CYP1A1 mRNA population consists of mRNAs with longer-lived than the CYP1A1 mRNA. The long half- different poly(A) tail lengths, suggesting that they are life of the CYP1A2 mRNA may influence its constitu- at different stages of decay. When transcription is in- tive levels in human liver. hibited, the poly(A) tail loss is an early event that is The short half-life for CYP1A1 mRNA is in sharp associated with the decrease in the levels of the full- contrast to most of the mRNAs that we have analyzed, length mRNA. Although an endonucleolytic cleavage SHORT HALF-LIFE OF HUMAN CYP1A1 mRNA 317 event cannot be ruled out, it is likely that deadenyla- 2. Okey, A. B. (1990) Pharmacol. Ther. 45, 241–298. tion is the first and rate-determining step in the rapid 3. Lewis, D. F. V., Watson, E., and Lake, B. G. (1998) Mutat. Res. decay of CYP1A1 mRNA (39–41, 54). 410, 245–270. The rapid decay of CYP1A1 appears to be a con- 4. Rendic, S., and Di Carlo, F. J. (1997) Drug Met. Rev. 29, 413–580. served feature. Previous reports suggest that the 5. Nelson, D. R., Koymans, L., Kamataki, T., Stegeman, J. J., Feyereisen, R., Waxman, D. J., Waterman, M. R., Gotoh, O., mouse (24) and rat (55, 56) CYP1A1 mRNAs are short- Coon, M. J., Estabrook, R. W., Gunsalus, I. C., and Nebert, D. W. lived, and in all cases, CYP1A1 mRNA appears to (1996) Pharmacogenetics 6, 1–42. decay more quickly than CYP1A2 (43, 55, 57). In chick- 6. Gonzalez, F. J. (1989) Pharmacol. Rev. 40, 243–288. ens, the related family members CYP1A4 and 7. Kemper, B. (1998) Prog. Nucleic Acid Res. Mol. Biol. 61, 23–64. CYP1A5, which share only 60% identity to mammalian 8. Whitlock, J. P. J. (1999) Annu. Rev. Pharmacol. Toxicol. 39, CYP1A1 (58), encode mRNAs that are also degraded 103–125. quickly (59). Is there a selection pressure to conserve 9. Dogra, S. C., Whitelaw, M. L., and May, B. K. (1998) Clin. Exp. this characteristic, and if so, what is the biological role Pharmacol. Physiol. 25, 1–9. for a rapid decay of this mRNA? We propose that the 10. Morgan, E. T., Sewer, M. B., Iber, H., Gonzalez, F. J., Lee, Y.-H., short half-life of the CYP1A1 mRNA is an important Tukey, R. H., Okino, S., Vu, T., Chen, Y.-H., Sidhu, J. S., and Omiecinski, C. J. (1998) Drug Met. Dispos. 26, 1232–1240. feature of AHR signaling. Previous reports support a 11. Roberts, B. J., Song, B.-J., Soh, Y., Park, S. S., and Shoaf, S. E. model where the CYP1A1 enzyme is involved in feed- (1995) J. Biol. Chem. 270, 29632–29635. back inhibition through catabolism of an endogenous 12. Park, K. S., Sohn, D. H., Veech, R. L., and Song, B. J. (1993) Eur. AHR ligand (60–62). This catabolism would serve to J. Pharmacol. 248, 7–14. attenuate the response. However, as long as the 13. Yang, M.-X., and Cederbaum, A. I. (1997) Arch. Biochem. Bio- CYP1A1 enzyme persists, a cell would be refractory to phys. 341, 25–33. a second exposure to the endogenous ligand. The rapid 14. Lieber, C. S. (1997) Physiol. Rev. 77, 517–544. fall of CYP1A1 mRNA (and protein) would allow the 15. Hu, Y., Ingelman-Sundberg, M., and Lindros, K. O. (1995) Bio- system to “reset” itself to baseline in preparation for a chem. Pharmacol. 50, 155–161. second signal. The AHR itself is down-regulated by 16. Kim, S. G., and Novak, R. F. (1990) Biochem. Biophys. Res. exposure to ligands (63, 64). Although this repression Commun. 166, 1072–1079. is extended after treatment with TCDD, the AHR lev- 17. Hargrove, J. L., and Schmidt, F. H. (1989) FASEB J. 3, 2360– 2370. els start to rebound 24–48 h after exposure to 3-meth- 18. Hargrove, J. L., Hulsey, M. G., and Beale, E. G. (1991) BioEssays ylcholanthrene, a ligand that can be metabolized by 13, 667–674. CYP1A1 (65). As part of our model, we would hypoth- 19. Ross, J. (1995) Micro. Rev. 59, 423–450. esize a relatively quick rebound of receptor concentra- 20. Aida, K., and Negishi, M. (1991) Biochem. 30, 8041–8045. tions after exposure to endogenous ligand(s), providing 21. de Waziers, I., Garlatti, M., Bouguet, J., Beaune, P. H., and sufficient AHR for interaction with a second signal. Barouki, R. (1995) Mol. Pharmacol. 47, 474–479. Interestingly, a recent report suggests that there is a 22. Woodcroft, K. J., and Novak, R. F. (1997) Chemico-Biol. Interac. brief period in early development of the fertilized 107, 75–91. mouse ovum, where the CYP1A1 mRNA may be stabi- 23. Song, B.-J., Matsunaga, T., Hardwick, J. P., Park, S. S., Veech, lized; the authors speculate that this may reflect a R. L., Yang, C. C., Gelboin, H. V., and Gonzalez, F. J. (1987) Mol. situation where CYP1A1 mRNA (and protein) levels Endocrinol. 1, 542–547. 24. Chen, Y.-H., Riby, J., Srivastava, P., Bartholomew, J., Denison, are kept high in order to prevent inappropriate activa- M., and Bjeldanes, L. (1995) J. Biol. Chem. 270, 22548–22555. tion of AHR-responsive genes by an endogenous ligand 25. Li, W., Harper, P. A., Tang, B. K., and Okey, A. B. (1998) (61). The CYP1A1 mRNA decay rate has also been Biochem. Pharmacol. 56, 599–612. shown to be altered after exposure to the steroid hor- 26. Andreou, E. R., and Prokipcak, R. D. (1998) Arch. Biochem. mone dehydroepiandrosterone (66). Analysis of Biophys. 357, 137–146. CYP1A1 mRNA sequence elements involved in its 27. Masters, D. B., Griggs, C. T., and Berde, C. B. (1992) BioTech. rapid degradation may provide insight into mecha- 12, 902–911. nisms for altering its decay rate under some circum- 28. Brewer, G., and Ross, J. (1988) Mol. Cell. Biol. 8, 1697–1708. stances. 29. Mercer, J. F. B., and Wake, S. A. (1985) Nucleic Acids Res. 13, 7929–7943. 30. Shyu, A.-B., Belasco, J. G., and Greenberg, M. E. (1991) Genes ACKNOWLEDGMENTS Dev. 5, 221–231. This work was supported from a grant from the Medical Research 31. Song, B.-J., Gelboin, H. V., Park, S.-S., Yang, C. S., and Gonza- Council of Canada. We thank Dr. Allan B. Okey for the TCDD. lez, F. J. (1986) J. Biol. Chem. 261, 16689–16697. 32. Hankinson, O. (1994) Adv. Enzyme Regul. 34, 159–171. 33. Israel, D. I., and Whitlock, J. P. (1983) J. Biol. Chem. 258, REFERENCES 10390–10394. 1. Porter, T. D., and Coon, M. J. (1991) J. Biol. Chem. 266, 13469– 34. Okey, A. B., Riddick, D. S., and Harper, P. A. (1994) Trends 13472. Pharmacol. Sci. 15, 226–232. 318 LEKAS ET AL.

35. Dugaiczyk, A., Law, S. W., and Dennison, O. E. (1982) Proc. Natl. 51. Xu, N., Loﬂin, P., Chen, C.-Y. A., and Shyu, A.-B. (1998) Nucl. Acad. Sci. USA 79, 71–75. Acids Res. 26, 558–565. 36. Lawn, R. M., Adelman, J., Bock, S. C., Franke, A. E., Houck, 52. Lagnado, C. A., Brown, C. Y., and Goodall, G. J. (1994) Mol. Cell. C. M., Najarian, R. C., Seeburg, P. H., and Wion, K. L. (1981) Biol. 14, 7984–7995. Nucleic Acids Res. 9, 6103–6114. 53. Zubiaga, A. M., Belasco, J. G., and Greenberg, M. E. (1995) Mol. 37. Elson, A., Levanon, D., Brandeis, M., Dafni, N., Bernstein, Y., Cell. Biol. 15, 2219–2230. Danciger, E., and Groner, Y. (1990) Genomics 7, 47–56. 54. Decker, C. J., and Parker, R. (1994) Trends Biol. Sci. 19, 336– 38. Tokunaga, K., Nakamura, Y., Sakata, K., Fujimori, K., Ohkubo, 340. M., Sawada, K., and Sakiyama, S. (1987) Cancer Res. 47, 5616– 5619. 55. Barker, C. W., Fagan, J. B., and Pasco, D. S. (1992) J. Biol. Chem. 267, 8050–8055. 39. Chen, C.-Y. A., and Shyu, A.-B. (1995) Trends Biol. Sci. 20, 465–470. 56. Lee, I. J., Jeong, K. S., Roberts, B. J., Kallarakal, A. T., Fernan- dez-Salguero, P., Gonzalez, F. J., and Song, B. J. (1996) Mol. 40. Chen, C.-Y. A., Xu, N., and Shyu, A.-B. (1995) Mol. Cell. Biol. 15, 5777–5788. Pharmacol. 49, 980–988. 41. Shyu, A.-B., Greenberg, M. E., and J, G., Belasco. (1989) Genes 57. Daujat, M., Clair, P., Astier, C., Fabre, I., Pineau, T., Yerle, M., and Dev. 3, 60–72. Gellin, J., and Maurel, P. (1991) Eur. J. Biochem. 200, 501–510. 42. Chung, I., and Bresnick, E. (1994) Arch. Biochem. Biophys. 314, 58. Gilday, D., Gannon, M., Yutzey, K., Bader, D., and Rifkind, A. B. 75–81. (1996) J. Biol. Chem. 271, 33054–33059. 43. Kimura, S., Gonzalez, F. J., and Nebert, D. W. (1986) Mol. Cell. 59. Mahajan, S. S., and Rifkind, A. B. (1999) Toxicol. Appl. Pharma- Biol. 6, 1471–1477. col. 155, 96–106. 44. Shimada, T., Yamazaki, H., Mimura, M., Inui, Y., and 60. Chang, C.-Y., and Puga, A. (1998) Mol. Cell. Biol. 18, 525–535. Guengerich, F. P. (1994) J. Pharmacol. Exp. Ther. 270, 414–423. 61. Dey, A., and Nebert, D. W. (1998) Biochem. Biophys. Res. Comm. 45. Dai, Y., Rashba-Step, J., and Cederbaum, A. I. (1993) Biochem. 251, 657–661. 32, 6928–6937. 62. Schaldach, C. M., Riby, J., and Bjeldanes, L. F. (1999) Biochem- 46. Le Jossic, C., Glaise, D., Corcos, L., Diot, C., Dezier, J.-F., Fau- istry 38, 7594–7600. trel, A., and Guguen-Guillouzo, C. (1996) Eur. J. Biochem. 238, 63. Pollenz, R. S. (1996) Mol. Pharmacol. 49, 391–398. 400–409. 64. Prokipcak, R. D., and Okey, A. B. (1991) Can. J. Physiol. Phar- 47. Kren, B. T., Trembley, J. H., and Steer, C. J. (1996) Am. J. macol. 69, 1204–1210. Physiol. 270, G763–G777. 48. Peng, H.-M., and Coon, M. J. (1998) Mol. Pharmacol. 54, 740– 65. Giannone, J. V., Li, W., Probst, M., and Okey, A. B. (1998) 747. Biochem. Pharmacol. 55, 489–497. 49. Chen, C.-Y. A., and Shyu, A.-B. (1994) Mol. Cell. Biol. 14, 8471– 66. Ciolino, H. P., and Yeh, G. C. (1999) J. Biol. Chem. 274, 35186– 8482. 35190. 50. Peng, S. S.-Y., Chen, C.-Y. A., Xu, N., and Shyu, A.-B. (1998) 67. Prokipcak, R. D., Raouf, A., and Lee, C. (1999) Biochem. Biophys. EMBO J. 17, 3461–3470. Res. Commun. 261, 627–634.