Expression Profiling and Recombinant Production of Tomep, a Tomato Extensin

Expression Profiling and Recombinant Production of TomEP, a Tomato Extensin

Peroxidase

A dissertation presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Doctor of Philosophy

John W. Mishler-Elmore

May 2020

This dissertation titled

Expression Profiling and Recombinant Production of TomEP, a Tomato Extensin

Peroxidase

JOHN W. MISHLER-ELMORE

has been approved for

the Department of Chemistry and Biochemistry

and the College of Arts and Sciences by

Michael A. Held II

Associate Professor of Chemistry and Biochemistry

Florenz Plassmann

Dean, College of Arts and Sciences 3

ABSTRACT

MISHLER-ELMORE, JOHN W., Ph.D., May 2020, Chemistry

Expression Profiling and Recombinant Production of TomEP, a Tomato Extensin

Peroxidase

Director of Dissertation: Michael A. Held II

Extensin peroxidases play a critical role in plant cell growth and are believed to play equally important roles in defense from pathogenesis and mechanical stress. By catalyzing the covalent polymerization of extensin proteins, they participate in the formation of the cell plate for cell division and help to reinforce the wall—preventing pathogen infection. Due to it’s anionic character and catalytic processivity, TomEP is a particularly unique extensin peroxidase that requires much less time and enzyme than other extensin peroxidases to crosslink extensin substrate. Previous work identified the

TomEP gene, and established methods to produce functional enzyme through heterologous expression in E. coli. This work aimed to expand upon these previous efforts by characterizing TomEP expression, TomEP function in vivo, and design a purification scheme to produce milligram-level quantities of pure enzyme for crystallization.

An expression profile of TomEP was compiled using both qPCR analysis and promoter-GUS fusion experiments to provide data describing normal expression and response to wounding. Basal TomEP expression was demonstrated to be significantly higher in roots than in flowers, stems, or leaves. Through the same methods, wounding 4 treatments were shown to increase TomEP expression in tomato roots from one to four hours, followed by attenuation for the following sixteen hours.

The foundations of gain and loss-of-function experiments were pursued in an attempt to discern TomEP’s influence on di-isodityrosine and pulcherosine content in tomato cell walls, using overexpression and CRISPR knock-out strategies.

Overexpression lines of tomato and Arabidopsis were generated using Agrobacterium mediated methods, though these efforts failed to produce verifiable protein product, despite expression being observed on the RNA level. Transient expression in tobacco epidermal cells was successful however, allowing for in vivo analysis of TomEP activity, though no clear link between TomEP and di-isodityrosine or pulcherosine formation could be made. CRISPR knock-out lines of tomato were successfully generated, with two lines likely possessing homozygous or chimeric mutant alleles and fifteen others appearing to have heterozygous mutant alleles. No cell wall analysis of mutants could be performed without further breeding and characterization, but the path has been blazed for future research.

Utilizing an established oxido-shuffling strategy to fold protein extracted from E. coli inclusion bodies, milligram quantities of recombinant TomEP were produced and purified. The previous purification scheme was unable to accommodate larger reaction volumes and additional protein product and required alterations to scale up production.

Techniques utilized include ammonium sulfate precipitation, immobilized metal affinity purification, anion exchange chromatography, and size exclusion chromatography. Using 5 these methods, the milligram threshold was exceeded using the new purification scheme, enabling future x-ray crystallography.

DEDICATION

To my wife Beth, whose faith was unwavering, my parents Cindy and Bill who supported

us through this journey, and my grandparents Verda, Bill, and Liz who have always

believed in me.

A special mention goes to Shelby, Paddy, and most especially Louise for their

companionship and unending love.

ACKNOWLEDGMENTS

I would like to thank my advisor Dr. Michael Held for his endless support and advice that helped so much over the years, as well as during the production of this document. Overwhelming thanks goes to Dr. Marcia Kieliszewski and Dr. Allan

Showalter who provided feedback throughout the process to help elevate the quality of this work. Additionally, I would like to thank Dr. Lauren McMills for agreeing to aid in the final steps of this journey.

Thanks also goes to my peers and colleagues who provided both support and camaraderie. Tasleem Javaid for our continuing discussions on topics where our research overlapped and helping with plant care. Ali Aldhumani for technical assistance and friendship from beginning to end. And of course, my lab mates, past and present: Wen

Dong, Daniel Nething, Yadi Zhou, Dare Ogunsekan, and Abhijit Sukul.

TABLE OF CONTENTS

Page

Abstract ...... 3 Dedication ...... 6 Acknowledgments...... 7 List of Tables ...... 10 List of Figures ...... 11 List of Abbreviations ...... 13 Chapter 1: Introduction ...... 14 1.1 The Plant Cell Wall ...... 14 1.1.1 Function and Significance to Society ...... 14 1.1.2 Components and Organization ...... 16 1.1.3 Class III Plant Peroxidases...... 32 1.1.4 TomEP ...... 38 Chapter 2: Materials and Methods ...... 42 2.1. Plant Material and Growth Conditions ...... 42 2.1.1 Sterilization, Aseptic Culture, and Care of Tomato Seedlings ...... 42 2.1.2 Explant Collection and Plating for Tomato Transformations ...... 42 2.1.3 Sterilization, Aseptic Culture, and Care of Arabidopsis plants ...... 44 2.1.4 Tobacco Sowing and Care ...... 45 2.2 Cloning and Binary Vector Assembly ...... 45 2.2.1 Overexpression Construct Assembly ...... 45 2.2.2 Promoter-GUS Construct Assembly ...... 46 2.2.3 TomEP CRISPR Knock-out Construct Assembly ...... 48 2.2.4 Agrobacterium Transformation ...... 49 2.3 Transformations and Selection ...... 50 2.3.1 Transient Expression of TomEP-mGFP and Extensin Analogs in Tobacco Epidermal Cells ...... 50 2.3.2 Generation of Transgenic Tomato Lines ...... 51 2.3.3 Arabidopsis Transformation Using the Floral Dip Method ...... 53 2.3.4 PCR Genotyping of Transgenic Plant Lines ...... 54 2.4 RNA Preparation, cDNA Synthesis, RT-PCR, and qPCR...... 55 2.4.1 RNA Extraction ...... 55 2.4.2 Reverse Transcription of RNA Samples ...... 56 2.4.3 Semi-Quantitative RT-PCR and qPCR ...... 56 2.5 Analysis of Transgenic Plants and Tissues ...... 58 2.5.1 Live Cell Imaging by Confocal Laser Scanning Microscopy ...... 58 2.5.2 Fluorometric Detection of GUS Expression ...... 58 2.5.3 Preparation of Alcohol Insoluble Residue (AIR)...... 59 2.5.4 HPLC Analysis of Tyrosine Derivatives from AIR ...... 60 2.5.5 Western Blot Analysis of Overexpression Lines ...... 61 2.6 Heterologous Expression, Folding, and Purification of recombinant TomEP...... 62 9

2.6.1 ABTS Assay of POX Activity ...... 62 2.6.2 Inoculation of E. coli Cultures and Induction ...... 63 2.6.3 Preparation of Inclusion Bodies and Solubilization of Protein from E. coli 63 2.6.4 In vitro Folding of Recombinant TomEP ...... 64 2.6.5 Purification of Recombinant TomEP ...... 65 Chapter 3: Results ...... 68 3.1 In silico Analysis of TomEP ...... 68 3.1.1 Motif Predictions of TomEP Protein Sequence ...... 68 3.1.2 Phylogenetic Comparison of Protein Sequences with Known and Suspected EPs ...... 70 3.2 Expression Profile ...... 71 3.2.1 Expression Analysis via RNA-seq Database ...... 71 3.2.2 Promoter-GUS Fusion Experiments ...... 74 3.2.3. qPCR Analysis ...... 83 3.3 Gain- and Loss-of-Function Experiments ...... 86 3.3.1 Transient Expression and Subcellular Localization of TomEP in Tobacco Epidermal Cells ...... 87 3.3.2 Functional Analysis of TomEP by Infiltration in Tobacco Epidermal Cells 89 3.3.3 Overexpression of TomEP in Solanum lycopersicum ...... 93 3.3.4 Heterologous Expression of TomEP in Arabidopsis thaliana ...... 100 3.3.5 Editing the TomEP Gene Using Poly-Cistronic tRNA-gRNA (PTG) CRISPR ...... 106 3.4 Extraction, Folding, and Purification of Recombinant TomEP ...... 116 3.4.1 Extraction and Folding of recombinant TomEP ...... 118 3.4.2 Ammonium Sulfate Precipitation of TomEP Folding Reactions ...... 119 3.4.3 Immobilized Metal Affinity Chromatography ...... 119 3.4.4 Anion Exchange Chromatography ...... 119 3.4.5 Size-Exclusion Chromatography of Concentrated DEAE Fractions ...... 121 Chapter 4: Discussion and Conclusion ...... 124 4.1 In silico Analysis of TomEP ...... 124 4.2 Expression Analysis of TomEP ...... 125 4.2.1 GUS and qPCR Profiling of TomEP Expression ...... 125 4.3 Gain- and Loss-of-Function Experiments ...... 126 4.3.1 Transient Expression and Subcellular Localization of TomEP ...... 126 4.3.2 Overexpression of TomEP ...... 128 4.3.3 CRISPR Knock-Out of TomEP Expression ...... 131 4.4 Expression, Folding, and Purification of Recombinant TomEP ...... 134 4.5 Conclusion ...... 137 References ...... 140 Appendix A ...... 167 Appendix B ...... 168 Appendix C ...... 172

LIST OF TABLES Page

Table 2-1. Primers in the generation of the PTG gene targeting TomEP...... 49 Table 2-2. Oligonucleotide primers used in genotyping transgenic lines...... 55 Table 2-3. Primers used in RT-PCR detection of transgene transcript...... 57 Table 3-1. Purification accounting of rTomEP...... 118

LIST OF FIGURES

Page

Figure 1-1. Illustrated head-on view of a cellulose microfibril...... 17 Figure 1-2. Common plant cell wall polysaccharides...... 21 Figure 1-3. Three-dimensional depiction of extensin protein structure...... 26 Figure 1-4. Characteristic Extensin [Ser-Hyp3-5] motif and glycosylations...... 28 Figure 1-5. Atomic force microscopy image of Tomato P1 extensin self-assembly...... 29 Figure 1-6. Arrangement of side chains in various tyrosine derivatives...... 30 Figure 1-7. Peptide motifs of classical tomato extensin classifications...... 31 Figure 1-8. Structural features of Class III Plant POXs...... 33 Figure 1-9. Two catalytic cycles of class III (heme-containing) plant POXs...... 34 Figure 2-1. Diagram of tomato cotyledon and explant cuts...... 43 Figure 2-2. Cotyledon explants plated on shoot induction (D1) media...... 44 Figure 2-3. Assembly of the TomEP overexpression construct...... 46 Figure 2-4. Assembly of 1.0 and 1.5 Kb Promoter-GUS fusion construct...... 48 Figure 3-1. Protein domain analysis from Ensembl Plants...... 69 Figure 3-2. Phylogenetic analysis of known and suspected EPs...... 71 Figure 3-3. Graphical representations of in silico results describing TomEP expression. 73 Figure 3-4. Diagnostic digests of promoter-GUS constructs...... 75 Figure 3-5. PCR genotyping of promoter-GUS transformants...... 76 Figure 3-6. RT-PCR reactions targeting GUS and actin mRNA sequences...... 77 Figure 3-7. MUG substrate structure and preliminary methyl-umbelliferone glucuronide (MUG) assay ...... 79 Figure 3-8. Relative expression by MUG assay of vegetative organs from individuals 6- 16 months of age...... 81 Figure 3-9. Relative expression by MUG assay of tomato seedling tissues...... 82 Figure 3-10. Wounding time course of mature promoter-GUS tomato plant roots...... 83 Figure 3-11. Relative expression of TomEP in tomato organs by qPCR...... 84 Figure 3-12. Relative expression of TomEP during a 24-hour wounding time course by qPCR...... 86 Figure 3-13. Subcellular localization of TomEP in tobacco epidermal cells...... 88 Figure 3-14a. Confocal microscopy images of EXT crosslinking experiments in tobacco...... 90 Figure 3-14b. Confocal microscopy images of EXT crosslinking (cont’d.)...... 91 Figure 3-15. Comparison of tyrosine derivative content in air samples prepared from infiltrated tobacco leaf sections...... 93 Figure 3-16. PCR genotyping of tomato OX transformants...... 94 Figure 3-17. Laser scanning confocal microscopy images of young tomato leaves...... 95 Figure 3-18. (RT-)PCR analysis of tomato OX lines...... 97 Figure 3-19. Western blot of tomato OX lines using an anti-GFP antibody...... 98 Figure 3-20. Western blot detection of TomEP-mGFP5...... 100

Page

Figure 3-21. Laser scanning confocal microscopy images of Arabidopsis seedling leaves...... 102 Figure 3-22. (RT-)PCR analysis of Arabidopsis OX lines...... 103 Figure 3-23. Western blot of Arabidopsis OX lines using an anti-GFP antibody...... 104 Figure 3-24. Western blot detection of TomEP-mGFP5. (Top) ...... 105 Figure 3-25. Target regions, structure, and RNA product of PTG genes...... 107 Figure 3-26. Gel purification of assembled PTG gene PCR product...... 108 Figure 3-27. PCR genotyping of potential PTG-CRISPR transformants...... 109 Figure 3-28a. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence...... 112 Figure 3-28c. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence...... 114 Figure 3-28d. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence...... 115 Figure 3-29. Sanger sequencing chromatograms of suspected edits in the TomEP exon 3 sequence...... 116 Figure 3-30. Diethylaminoethyl anion-exchange chromatography trace...... 121 Figure 3-31. HPLC and LC traces of size-exclusion chromatography...... 123 Figure 4-1. Potential off-target sequence of exon 3 guide RNA...... 132 Figure S1. Transmembrane domain prediction from TMHMM ...... 167 Figure S2. Annotated sequence of TomEP-mGFP5 overexpression construct...... 168 Figure S3. Annotated sequence of 1.0 Kb PromoterTomEP-GUS construct...... 169 Figure S4. Annotated sequence of 1.5 Kb PromoterTomEP-GUS construct...... 170 Figure S5. Annotated sequence of PTG gene insert in pKSE401 vector...... 171 Figure S6. Diagram of TomEP overexpression construct used for in vivo crosslinking.172 Figure S7. Diagram comparing rTomEP construct with genomic TomEP...... 173

LIST OF ABBREVIATIONS

AGP – Arabinogalactan Protein CRISPR-Cas9 – Clustered regularly inter-spaced palindromic repeats-CRISPR associated 9 DEAE – Diethylaminoethyl chromatography resin Di-IDT – Di-isodityrosine DSB – Double stranded break (DNA) EP – Extensin Peroxidase EXT – Extensin FK9-EGFP – Non-crosslinking EXT analog containing 9 repeats of P3-type sequence, with Tyr replaced by Phe, and combined with an EGFP fluorescent protein tag. G/YFP – Green/Yellow fluorescent protein GUS – β-Glucuronidase HRGP – Hydroxyproline-Rich Glycoprotein Hyp – Hydroxyproline IDT – Isodityrosine KO – Knock-out MUG – 4-methylumbelliferone; a β-glucuronidase substrate ORF – Open Reading Frame OX – Overexpression POX – Peroxidase PTG – Polycistronic tRNA-gRNA (CRISPR) Pul – Pulcherosine RT-PCR – Reverse transcriptase - polymerase chain reaction TomEP – Tomato Extensin Peroxidase S12 & S6 – Superose 12TM and Superose 6TM size exclusion columns YK8-EGFP – Crosslinking EXT analog containing 8 repeats of P3-type sequence, combined with an EGFP fluorescent protein tag.

CHAPTER 1: INTRODUCTION

The Plant Cell Wall

1.1.1 Function and Significance to Society

For millions of years, plants have been synthesizing and weaving extracellular matrices composed primarily of polymerized sugars and, to a lesser degree, proteins.

Over millennia, the composition of these walls has evolved with the organisms themselves, and as a result diverged into two types of plants and cell walls, least specifically referred to as monocots and dicots. This unique organelle, the plant cell wall, is a distinguishing characteristic of plants, separating them from most other life on Earth.

Cell walls provide structure and rigidity that determine and maintain cell shape— and thus, plant stature. The structural advantage of having cell walls extends beyond holding the organism upright and in-place. The strength provided by cell walls also reinforces cells, preventing rupture of the plasma membrane in hypotonic conditions.1

Additionally, cell walls provide a physical barrier against pathogens, and help prevent water loss.2-4

Cell walls can have a metabolic role as well, including carbohydrate storage.5

Degraded cell wall polysaccharides are often re-incorporated into a plant’s metabolism.6

Pieces of cell walls, called oligosaccharins, can act as signaling molecules or hormones.7

Examples of cell wall signaling include the formation of a symbiotic relationship between nitrogen-fixing bacteria, mycorrhizae, and plant roots. Interactions between pollen and style are even mediated by chemical aspects of cell walls.8,9 15

Many of the same advantages cell walls and their constituents offer plants have been harnessed by heterotrophs both actively and gradually through evolution. They have been integral to our utilization of plant material in day to day lives by providing a workable, rigid material that could be shaped to purpose. Cell wall constituents also play critical roles in mammalian digestion, having co-evolved over the generations. The possibility of biofuels from plant cell walls has been explored as well, demonstrating the plausibility of reduced reliance on fossil fuels.

As the technological ability to influence the composition of, and the possibility to design cell walls comes into maturity, the potential impact of cell walls has not been fully realized. Humans have been harvesting, processing, and building with cell wall products for tens of thousands of years; but society’s grasp regarding the fine details of cell wall deposition, composition, and role in metabolism remain incomplete. One particular goal is to enhance the ability for plants to fend off pathogen invasion, which has indeed already become common place and is widely commercialized. Biofuel technology has advanced at a slower rate, as there is still much to understand about these complex matrices, primarily due to the very recalcitrance that aids in pathogen resistance.

Networks of structural protein play a role in both pathogen resistance and the availability of wall polysaccharides, which puts these proteins (and the enzymes that polymerize them) in a position to be integral in the effective utilization of cell walls for industry or agriculture.

1.1.2 Components and Organization

1.1.2.1 Polysaccharides

The primary components found in plant cell walls are cellulose, callose, hemicelluloses, pectins, (glyco-)proteins, and phenolic compounds (i.e. lignin, suberin).9

These diverse constituents combine to form complex and non-static matrices, from which all cell wall properties arise. In most cells, the primary scaffolding of these matrices is cellulose, which is comprised of (1,4)-β-D-glucan. Crosslinking and coating cellulose, you will find the hemicelluloses (or ‘crosslinking glycans’), whose structures can differ from cellulose in significant ways.

Hemicelluloses differ from cellulose in that they are comprised of a variety of monosaccharides. Their backbones are generally polymerized as (1,4)-β-D glycan chains like cellulose, however hemicellulose backbones are usually decorated with mono- or oligo-saccharide branches. In addition to hemicelluloses, plant cell wall polysaccharides can be found attached to proteinaceous elements as well.10,11 Two examples being the more extensive, branched polysaccharides that decorate arabinogalactan proteins (AGPs), and the shorter, unbranched polysaccharides that decorate extensin proteins (EXTs).

1.1.2.2 Cellulose

The first chemical work involving cellulose began in the first half of the 19th century, when Braconnot inadvertently created nitrocellulose by dissolving cell wall constituents in nitric acid in 1833.12 Braconnot’s work did not characterize cellulose, however; the work by Anselme Payen beginning in 1837, would eventually characterize cellulose. Payen’s investigations demonstrated the same fibrous material was present in 17 many different plant tissues and organs. Furthermore, they could be isolated through acid-ammonia treatment, before treating with alcohol, ether, and water. Experimental data led Payen to the conclusion that the fibrous substance was a uniform material composed of glucose12. The French Academy of Sciences would then name it Cellulose.13

Cellulose, unlike other cell wall components, is synthesized at the plasma membrane by hexameric complexes of Cellulose Synthase A (CesA) enzymes, known as rosettes.14,15 The hexameric structure of CesA rosettes is responsible for glucan chain self-association and the formation of microfibrils.16 Microfibrils are generally believed to be comprised of 18-36 individual glucan chains that adopt a paracrystalline structure

(Figure 1-1), brought on by their ability to form regular hydrogen bonds across the length of the polymer, though in recent years, computational evidence has supported 18.14-17

Figure 1-1. Illustrated head-on view of a cellulose microfibril. Chains of 1,4-β-D glucan layer and hydrogen bond to one another, forming a composite microfibril. Current evidence supports the 18- member CSC rosette, depositing microfibrils composed of as many glucan chains. Other constructions have been investigated as well, but overall the 3:4:4:4:3 formation is most favorable. Figure adapted from [18].

CesAs are part of the glycosyltransferase-2 (GT2) superfamily, meaning their structures include eight transmembrane domains and a conserved catalytic motif on the cytosolic side of the plasma membrane.19 The catalytic motif D,DxD,D,QXXRW rests on a cytosolic loop between transmembrane domains 2 and 3.20 Current models from bacterial CesA homologs have led to speculation that the QXXRW motif binds the terminal end of the nascent glucan, while the first two aspartates coordinate UDP, and the third provides a catalytic base close to the end of the glycan.21

Another characteristic of plant CesAs is conserved zinc-finger domains that are thought to participate in homo- and hetero-dimerization though other domains are also important for CesA protein:protein interactions.22-26 The rosettes that form the Cellulose

Synthase Complex (CSC) can vary in arrangement, but specific CesAs participate in formation of the primary versus secondary cell wall. CesAs 1, 2, 3, 5, 6, and 9 form CSCs that synthesize cellulose in the primary wall (1, 3, and 6 being critical), while CesAs 4, 7, and 8 produce secondary wall cellulose.19,27,28 These homo- and hetero- associations have been demonstrated to be reversible and form the basal blocks of the complexes.30

The orientation of microfibrils is driven by protein-mediated associations with microtubules that heavily influence their function. Cellulose deposition occurs in a fashion transverse to cell elongation and a single microfibril can encircle a cell several times.31,32,33 This orientation allows for turgor pressure, in conjunction with cell wall loosening enzymes, to conduct anisotropic growth whereby cells elongate perpendicular to the direction of microfibril deposition.34 19

Cellulose microfibrils can show varying degrees of crystallinity. Variation affects exactly how microfibrils function in structural support, as well as their involvement in cross-linking interactions which help hold the cell wall matrix together. Primary walls in particular tend to show a lower level of microfibril crystallinity, partially because primary walls have a limited number of less-ordered glucan chains on the surface of cellulose microfibrils, but may also be because of misalignment of internal chains which can lead to twisting of the entire microfibril bundle.35 Conversely, secondary cell wall cellulose is found to be more dense and ordered—providing superior reinforcement to the wall as the cell’s final shape is cast.18,35

1.1.2.1 Hemicelluloses

Hemicelluloses are a diverse group of polymers, composed of a multitude of different monosaccharides that include glucose, xylose, mannose, glucuronic acid, arabinose. Hemicelluloses are assembled from monosaccharides in a myriad of different ways, forming a variety of glycosidic linkages at carbons in their ring structures, producing combinations of physical and chemical properties that influence in cell wall assembly. 8,36

Most hemicellulosic polysaccharides possess a β-1,4 linked backbone, akin to cellulose. It follows logically that many hemicelluloses are synthesized by Cellulose

Synthase-Like (CSL) glycosyltransferases.37 These CesA-related enzymes are similar to

CesAs in both structure and topology. The main structural differences between CesAs and CSLs are generally the lack of zinc-finger domains and sometimes one to three fewer transmembrane domains.38,39 Any potential quaternary structures likely differ as well, as 20 there’s been no evidence of CSL rosettes, though associations and complex are suspected.40-42

The CSLs are structurally very similar to the CesAs, but their sub-cellular localization differs dramatically. Where CesAs are known to localize to the plasma membrane, the CSLs localize to the Golgi apparatus almost exclusively.39,43 Consistent with these data, hemicelluloses are generally thought to be synthesized within the Golgi apparatus, or at least partially so. There also exists the possibility of final polymer ligation in the apoplast, though experimental evidence is lacking.44-47

Further differentiating the CSLs from the CesAs, the polymers they produce do not lend themselves to the formation of microfibrils. Their structures discourage any sort of aggregation brought on by the potential for hydrogen-bonding.47 Examples of these structural idiosyncrasies may be observed in xyloglucan, heteroxylan, and heteromannan

(Figure 1-2). Here, branching along the polymer backbone hinders potential self- hydrogen bonding through steric interference.48-51 Instead, the hemicelluloses coat and tether cellulose microfibrils through hydrogen bonding, though differences in recalcitrance have not been observed or predicted due to side-chain content.52,53 Polymer branching is not the only method of preventing aggregation. Mixed-linkage glucan for example also demonstrates an aversion to homo-interactions, stemming from β-1,3 linkages distributed in a non-random fashion throughout the polymer backbone.54,55

There have been several theorized models regarding exactly how hemicelluloses participate as cross-linking cell wall components. The simplest crosslinking model suggests that while hemicelluloses cannot hydrogen-bond to each other in a significant 21 manner, they can hydrogen-bond along the microfibrils for a time, before branching away and doing the same along a different microfibril.9,34,56 In the same vein, modelling experiments have raised the possibility that hemicelluloses could be sandwiched between microfibril structures, making the cellulose formation less crystalline along the way.57

Better supported models suggest that hemicelluloses may only attach themselves to cellulose on one end of the glucan chain, hydrogen-bonding or covalently attached to other hemicelluloses with which the steric interactions are not as restrictive.18

Figure 1-2. Common plant cell wall polysaccharides. In addition to cellulose, common hemicelluloses include xyloglucan (XyG), (1,3;1,4)-β-glucan, heteroxylan, heteromannan. Pectic polysaccharides include homogalacturonan (HG), rhamnogalacturonan I (RGI), and rhamnogalacturonan II (RGII). Figure adapted from [58].

1.1.2.2 Pectins

Pectins are the most structurally complex cell wall polysaccharides. Pectin is made up of multiple galacturonic acid-rich polysaccharides that include: homogalacturonan, rhamnogalacturonans I and II, apiogalacturonan, and xylogalacturonan (Figure 1-2).50,59 They participate in a diverse set of cell wall functions. Primarily found in dicot primary walls, pectins can influence wall strength60,61, porosity62, elongation63,64, as well as participate in intercellular signaling.47

Pectins are a diverse group of polysaccharides that contain heterogenous, highly branched structures, rich in D-galacturonic acid. The abundance of galacturonic acid gives pectins a fairly strong net negative charge at wall pH. Negatively charged galacturonic acid residues can bind calcium ions (Ca2+), which is an identifying characteristic for pectins as they are often extracted using calcium chelators.65 The three main types of pectins, from those listed above, are homogalacturonan (HG), rhamnogalacturonan I (RG-I), and rhamnogalacturonan II (RG-II). Homogalacturonan

(HG) variants include xylogalacturonan (XGA) and apiogalacturonan (AGA).59

Rhamnogalacturonans-I and -II also undergo modifications. Rhamnogalacturonan-I modifications include components such as arabinans, galactans, or even branched, highly variable arabinogalactan polysaccharides attached to O-4 position of its rhamnose residues8. Rhamnogalacturonan-II, which has a highly conserved structure among flowering plants, has a diverse set of modifications that include apiose, aceric acid, 23 methyl-fucose, methyl-xylose, deoxy-D-manno-2-octulosonic acid, and deoxy-D-lyxo-2- heptulosaric acid that are attached to either C-2 or C-3 positions. Additionally, apiose residues participate in the formation of boron di-esters to dimerize rhamnogalacturonan units.

Beyond intrinsic properties imparted by their structural features and the associated physical implications is an additional level of complexity that is brought forth by the methyl-esterification of homogalacturonan. As methyl transferases attach methyl groups to HG, the negative charges of the galacturonic acid are neutralized, disrupting Ca2+ ion coordination.66,67 Changes in methyl esterification lead to broader changes in the physical properties and molecular functions of pectins.47,63,64,67 Likewise, wall associated pectin methylesterases (PMEs) can remove methyl groups as needed in the wall to adjust the physical properties of the wall, as needed.68 The removal of methyl groups is necessary for the initiation of pectin digestion by the polygalacturonases, which influences the attachments between cells.69 This process takes place in tissues performing developmental functions like organ senescence and fruit-ripening, where cells need to be purposefully released from the organism or tissue is required to be more permeable allowing seeds to escape.69

1.1.2.3 Cell Wall Protein

Structural (glyco-)proteins can claim as much as 18% of the cell wall’s mass.

They play important roles in cell growth, signaling, defense, and environmental response.70,71 There are six major classes of structural protein that include: glycine-rich proteins (GRPs), solanaceous lectins, extensins, proline-rich proteins (PRPs), 24 proline/hydroxyproline-rich glycoproteins (P/HRGPs) and arabinogalactan proteins

(AGPs).8,70,71,72,73 While this does not exhaust the list of cell wall proteins, these six classes represent the majority of cell wall structural proteins and are the most studied.

The latter four make up the Hyp-rich glycoprotein (HRGP) family.8,70,73-76 As suggested by their name, these proteins contain numerous Hyp residues throughout their structures.

1.1.2.3.1 hydroxyproline-rich glycoproteins (HRGPs).

Extensins (EXTs), Arabinogalactan proteins (AGPs), and Proline/HRGPs

(P/HRGPs) all possess at least moderate levels of glycosylation, which appear to play direct roles in their structures and functions. Before these PTMs can occur, proline must be modified to allow for the ether bond of O-linked glycosylations. This process begins with proline hydroxylation at the fourth carbon of the prolyl ring, forming 4- hydroxyproline (Hyp, O) in the endoplasmic reticulum.77,78,79 Hydroxylation is followed by Hyp-O-glycosylation in the Golgi apparatus, which appears to proceed via the Hyp contiguity hypothesis.76 According to this hypothesis, the number and contiguity of Hyp residues ascribes the extent of glycosylation and type of glycan added to Hyp residues.

To date, the mechanism for discerning contiguous and non-contiguous Hyp residues has not been elucidated, but the patterns are well documented and consistent.80-82

AGPs also represent a large family of genes, with Arabidopsis having 85 members and rice (Oryza sativa) ~69 members, illustrating the fact they are present in both type I and type II cell walls.83,84 Their peptide sequences and glycan structures vary widely between different plant species, as well as different tissues in the same organism, and have been implicated in development85,86,87, cellular defense88,89, calcium chelation90, 25 and biochemical sensing of the extracellular environment90,91. AGPs generally possess repetitive di-peptide motifs like [-Ser-Hyp-]n, [-Thr-Hyp-]n, [-Ala-Hyp-]n, and [-Val-Hyp-

]n which direct Hyp-O-linked glycosylation with arabinogalactan polysaccharide in the

Golgi apparatus.91 These glycosylations are extensive when compared to other HRGPs and are added by the GALTs 2-692-94, HPGTs 1-395, GALTs 29 and 31A, GlcAT14a-c,

FUT4 and 6, and RAY191.

1.1.2.4 Extensin

The extensins comprise a large and fairly diverse family of proteins, all of which contain at least one of two EXT motifs that participate in either self-assembly, crosslinking, or both. The Arabidopsis genome contains at least 65 different EXT or

EXT-like genes, 20 of them resembling classical EXT structure, and others representing a spectrum of proteins containing their characteristics.96 Being HRGPs with contiguous

Hyp, EXTs have a rod-like structure and contribute to cell wall assembly (Figure 1-3)97, growth97-99 and pathogen defense or wounding.100-108 This is accomplished by their ability to form three-dimensional networks that either reinforce or lay additional scaffolding for the cell wall. True to their classification, extensins contain significant

72 amounts of Hyp, which manifests in repetitive [Ser-Hyp3-5] motifs. Multiple [Ser-Hyp3-5] repeats impart a polyproline II conformation secondary structure (Figure 1-3).

Polyproline II conformations adopt left-handed helices containing three residues per turn and are primarily responsible for extensins rod-like shape109.

Figure 1-3. Three-dimensional depiction of extensin protein structure. A) Illustration of associating and cross-linked extensin backbones, with close- up of isodityrosine (IDT), pulcherosine (Pul), and di-isodityrosine (Di-IDT). B) Center to mass distances between de-glycosylated and wild type extensins peptides, as influenced by the presence or absence of glycosylations. C, D) Three-dimensional structure of de-glycosylated and glycosylated extensins, illustrating the effect of glycosylations on quaternary structure and position of IDT residues to one another. Figure adapted from [110].

[Ser-Hyp3-5] motifs that dominate extensin protein sequences also boasts O- glycosylation on nearly all amino acids involved. Serine receives a lone O-linked galactose residue when followed by arabinosylated Hyp and a [Tyr-Lys-Tyr] motif. The

Hyps have short oligoarabinosides ranging from one to five residues in length, consistent with the Hyp-contiguity hypothesis.8,76,111,112 Oligoarabinosides are believed to help stabilize extensins’ rod-like structures2,113-115, facilitate intermolecular self-assembly of the cross-linked, glycoprotein network116-118, and protect against proteolytic degradation.117,119

Several GTs attach these PTMs to the extensin peptides—in a discreet order when it comes to the oligoarabinosides (Figure 1-4). Glycosylation of extensin occurs primarily in the Golgi apparatus. The galactose is attached to the serine in an α-4 conformation by the enzyme SERINE GALACTOSYLTRANFERASE1 (SGT1), which was first observed in

Chlamydomonas reinhardtii.120 The Hyp-O-glycosylation occurs in steps. It begins with the Hydroxy-Proline Arabinosyl Transferases 1-3 (HPATS 1-3), which attach the initial arabinose units in a β-4 configuration.121 Subsequently, the Reduced Residual Arabinose arabinosyl transferases 1-3 (RRAs 1-3) make the addition of a second arabinosyl unit in a

β-1,2 linkage, followed by a third β-1,2 linked arabinosyl unit added by

XYLOGLUCANASE113 (XEG113).122 The fourth arabinosyl unit, in the extensin oligoarabinosides, is then added in an α-1,3 linkage by EXTENSIN ARABINOSE

DEFICIENT (ExAD).123

Figure 1-4. Characteristic Extensin [Ser-Hyp3-5] motif and glycosylations. Hyp-O- oligoarabinosides, Serine-O-galactoside, and glycosyltransferases are shown. Glycosyltransferases responsible for additions are boxed in blue and defined in the top left. The glycosylations adorning the [Ser-Hyp3-5] motifs help maintain shape, as well as influence crosslinking in vitro. This figure is adapted from [8].

Extensins also contain short, hydrophobic [Tyr-X-Tyr] containing motifs. These tyrosine-rich motifs are capable of undergoing intramolecular crosslinking to form isodityrosine (IDT). Intramolecular IDT linkages add slight kinks to the extensin monomer structure, but also helps further stabilized their rod-like shape (Figure 1-3).

Both IDT and tyrosine can then participate in oxidative crosslinking to form additional intermolecular biphenyl linkages between extensin monomers.124-127

The hydrophobic portions containing tyrosine and IDT alternate with hydrophilic glycosylated [Ser-Hyp3-5] motifs to impart amphiphilic character to EXTs. Amphiphilicity is thought to help promote extensin monomer self-assembly that has been observed in vitro (Figure 1-5).118 The dendritic structures that arise are positively charged, due to the plentiful lysine residues also found in EXT sequences. These structures scaffold the 29 development of nascent wall construction, as well as reinforce existing architecture.

Networks reminiscent of this are hypothesized to self-assemble in vivo either at the wall or location of a nascent cell plate before being insolubilized either through developmental or defensive processes.97

Figure 1-5. Atomic force microscopy image of Tomato P1 extensin self-assembly. The monomers form dendritic structures in vitro when incubated in buffer on highly ordered pyrolytic graphite. Regions of hydrophobic character associate through hydrophobic interactions to drive the observed self-assembly, though Hyp-O-glycans are believed to participate as well through hydrophilic interactions. This figure adapted from [97].

Extensin network formation occurs via covalent linkages made by extensin peroxidases (EPs). After scaffold self-assembly, EPs catalyze the coupling of tyrosine derivatives to polymerize EXT monomers. These linkages can form di-IDT from two

IDT motifs or a Pulcherosine (Pul) from an IDT motif and a tyrosine, as well as IDT motif from two tyrosines (Figure 1-6).124,126,128 30

Figure 1-6. Arrangement of side chains in various tyrosine derivatives. (a-c) Representations of tyrosine derivatives observed through crosslinking with EP. The intramolecular IDT can couple with tyrosine or another IDT to form pulcherosine or di-IDT, respectively. (d-f) Tyrosine derivatives not observed in plants. This figure adapted from [128].

Extensin peroxidases generally catalyze intermolecular crosslinking via di-IDT linkage to produce the insoluble polymeric extensin network. However, not all extensins or extensin-like proteins are covalently cross-linked. The maize Threonine-

Hydroxyproline-Rich Glycoprotein and the tobacco HRGPnt3 provide examples in both monocots and dicots, respectively. They have been hypothesized to have either no or 31 different intermolecular linkages as compared to ‘traditional’ extensins.129,130,131 While these examples seem to have evolutionarily preserved the structural aspects of extensin proteins, extensin motifs can be found in less recognizable forms.

Arabidopsis is the most exhaustively studied regarding extensin genes, but much progress has been made involving tomato extensin monomers eluted from suspension cell cultures.113 There are three classical extensin monomer classes originally observed in dicot cell walls, which were classified by their peptide repeats (Figure 1-7).71,114 The first being the “P1” extensin monomer, the second “P2”, and the third is “P3”. All of these monomers are composed of repeat sequences that end with Tyr and Lys containing motifs

(e.g. Val-Tyr-Lys, Tyr-Lys-Tyr-Lys, and Tyr-Tyr-Tyr-Lys, respectively) that either contain the X-Tyr-X motif or at least participate in cross-linking. More current investigations have revealed a less discreet and more continuous model, with many different proteins also containing extensin motifs to varying degrees.96

P1- [Ser-Hyp-Hyp-Hyp-Hyp-Val-Lys-Pro-Tyr-His-Pro-Thr-Hyp-Val-Tyr-Lys]n

P2- [Ser-Hyp-Hyp-Hyp-Hyp-Val-Tyr-Lys-Tyr-Lys]n

P3- [Ser-Hyp-Hyp-Hyp-Hyp-Ser-Hyp-Ser-Hyp-Hyp-Hyp-Hyp-Tyr-Tyr-Tyr-Lys]n

Figure 1-7. Peptide motifs of classical tomato extensin classifications. Highlighted in cyan is the characteristic [Ser-Hyp3-5] motif that imparts the polyproline II helix to extensin proteins. In yellow are the crosslinking sites that previously differentiated the classical extensin types.

Based on peptide sequencing performed by making tryptic peptides, P1 type extensins were originally believed to lack the Tyr-X-Tyr amino acid motif.114 This would 32 have precluded it from having any intramolecular IDT, but were still able to be crosslinked by EP.114,127,132,133,134 This suggested that the Val-Tyr-Lys motif may participate in crosslinking, though genome sequencing has since revealed that many

‘classical’ P1 extensins do contain IDT motifs. Regardless, this idea—combined with previous investigations into Root- Shoot- Hypocotyl-deficient (rsh) extensin sequence and the fact that Arabidopsis walls are di-IDT-poor—raises the possibility that extensin monomers likely do not assemble “head on”, but in a more staggered fashion.97 By doing this, the presence of the tyrosine derivative Pulcherosine is made possible and allows for crosslinking of lone tyrosines with IDT residues.

Extensins are deposited developmentally in the cell wall during cell division, when the cell plate is initiated with an extensin scaffold, or just normal wall construction.97 The rapid insolubilization of extensin in the cell wall due to both abiotic and biotic stressors likely involves previously deposited and self-assembled extensin, as the insolubilization can occur before transcriptional response.135 However, expression of extensin genes themselves is also heightened since mechanical and pathogen stressors have been demonstrated to modulate extensin transcription in tomato, potato,

Arabidopsis, and others.98,101-103,136-138

1.1.3 Class III Plant Peroxidases

Class III plant peroxidases (POXs) (E.C. 1.11.1.7) are glycoproteins that are secreted to the apoplast or deposited into vacuoles, and participate in processes like cell elongation, cell wall assembly and differentiation, as well as pathogen defense.139-141

Differentiating themselves from other POX classes, Class III (or plant peroxidases) have 33 three distinct conserved helices in their structure. They also have conserved distal and proximal heme-binding sites, four di-sulfide bridges, and a central conserved domain

(Figure 1-8).140 This ‘conserved’ region of variable sequence and length is thought to dictate the substrate specificity of the different POXs.140

Figure 1-8. Structural features of Class III Plant POXs. Three highly conserved regions are present: proximal (Hp) and distal (Hd) heme-binding sites, as well as a conserved domain of unknown function (II). An N-terminal signal peptide (SP) is present, while vacuolar POXs also contain a C- terminal extension (CE). Four disulfide bridges are conserved (C1-C8), and a region of variable length and sequence between Hp and C7 (hatched region) is believed to impart specificity of catalytic activity by forming or influencing structure of the substrate access channel. Figure adapted from [140].

Class III POXs are often secreted.141 This class of POXs has a wide variety of purposes that stretch beyond cross-linking extensins, including: hormone catabolism142, suberization143, and salt tolerance.144 All these processes follow the same catalytic scheme that encompasses two complementary cycles: the peroxidative cycle and hydroxylic cycle (Figure 1-9).

Figure 1-9. Two catalytic cycles of class III (heme-containing) plant POXs. The peroxidative cycle is the path taken for oxidative crosslinking of extensin (EXTs 1 and 2) proteins through the production of tyrosine derivatives (e.g. di-isodityrosine (Di-IDT) from isodityrosines (IDTs) on separate EXT proteins). The hydroxylic cycle can be utilized to generate reactive oxygen species for wall remodeling or pathogen response. This figure adapted from [145].

1.1.3.1 Extensin Peroxidases

The first evidence supporting a role for POXs in extensin crosslinking was reported by Everdeen and colleagues in 1988, going so far as to develop the assay still used for assessing extensin crosslinking activity.132 While not isolating or directly identifying the enzyme, researchers prepared it from suspension cultured tomato cells by 35

132 clarifying, dialyzing, and sterile-filtering CaCl2 eluates. Early fractions of crosslinking reactions separated by gel-filtration chromatography showed extensin crosslinking activity by observing decreases in extensin monomer peaks, after treatment with enzymatic fractions, paired with detection of new peaks associated with oligomers.

When oligomers were observed directly using electron microscopy, the cross- linked extensins were observed to maintain their assembly even in the presence of ethylene glycol bis(2-aminoethyl)tetraacetic acid (EGTA) and 2-mercaptoethanol, demonstrating that covalent bonds hold the extensin monomers together.132 In order to demonstrate the enzyme responsible for crosslinking was a POX, separate enzymatic fractions were incubated with catalase before being assayed for crosslinking activity using P1 monomers that had been salt-eluted from tomato cell suspension cultures. The catalase-treated fractions eliminated all crosslinking activity, successfully demonstrating that the new-found extensin crosslinking enzyme was indeed a POX.132

In 1995, Brownleader et al. resolved two basic POXs from tomato that had EP activity, each weighing 34 and 37 kDa. These EPs had a pI of 9.0 and were cationic at native cell wall pH.146 Originally, four POXs were salt eluted from tomato cell suspension cultures. Peroxidase assays determined that only two of them displayed oxidative activity and were likely isoforms. Additionally, only one of these two displayed extensin crosslinking activity, using one µg of enzyme—while even 20 µg of the other was not sufficient. The amount of enzyme and substrate required to perform extensin crosslinking represented higher concentrations than could be expected in its 36 native environment, as the assays required microgram quantities of both EP, extensins, and more than 30 minutes to observe the crosslinking activity.146

Schnabelrauch et al. partially purified the pI 4.6 tomato EP and demonstrated its specificity for Tyr containing crosslinking motifs.133 Coinciding with this, Brady et al. discovered the tetra- and trimeric tyrosine derivatives di-IDT and Pul within tomato cell walls.124,126 Schnabelrauch et al suggested the possibility of tyrosine or lysine being the sites of crosslinking. Together, these works inspired efforts to try and describe the structure of what was thought to be covalent crosslinking of residues between extensins.

In 1999, Jackson et al. reported EP present in lupin (Lupinus albus). The tentatively named “B2” was detected through experiments using white-light inhibition of hypocotyl growth. Different from the tomato EP, B2 was shown to be a basic POX with a pI of 8.8, weighing 51 KDa.147 Akin to the basic POXs studied by Brownleader and colleagues in tomato, this tomato EP required micro-gram (35 µg) levels of enzyme to perform crosslinking assays. Subsequent experiments using exogenous extensin monomers from tomato, grape, and potato demonstrated specific crosslinking activity, and a somewhat selective substrate affinity to traditional POX assay substrates (guaiacol performing best). The resulting data led to the B2 fraction from Jackson’s 1999 paper being identified as Lupinus extensin peroxidase 1 (LEP1) in 2003.148

In 2001, another putative EP, with a MW of 40 kDa, was isolated from grape vine.149 Jackson et al. attempted to discern the difference made in the grape vine cell wall by oxidative bursts, in order to help understand and defend against pathogenic attacks against European grape varieties. While inducing oxidative bursts through different 37 methods in grape vine calli, the group reported the presence of an extensin monomer

(named GvP1, 89.9 KDa) and its response to the different types of stimuli.150 The work with GvP1 confirmed the necessity of having, an EP, extensins, and an oxidative burst in order to successfully observe defense reactions.150 This work amounted to the discovery of four basic POXs, one of which was identified as having extensin-specific activity, and was named GvEP1.149

While the number of isolated and characterized EPs remains few, more candidates exist and have been identified. The bulk of this work has been with Arabidopsis, as it generally leads the charge in cell wall studies because of its status as the dicot model organism of choice. And though the varying POX activities have not been confirmed in vitro, co-expression data from the bioinformatic resources BIO OHIO revealed as many as 32 POXs whose expression profiles match that of extensins.83 Additionally, proteomics has implicated one gene from BIO OHIO and two additional Arabidopsis EP candidates, though in vitro extensin crosslinking activity could not be confirmed.151

Among the numerous candidates in Arabidopsis, few have any experimental evidence supporting their identities as EPs. AtPRX71 has demonstrated the capability of producing protein radicals in vitro and overexpression (OX) lines saw increases in

AtEXT4 expression, suggesting that it may operate as an EP.152 AtPRXs 9 and 40 mutants have shown similar phenotypes to AtEXT18 mutants in the tapetum and microspore formation of pollen, while also crosslinking AtEXT23 when co-infiltrated in tobacco leaves.153 Beyond these three POXs, any suspected EPs in Arabidopsis have 38 been predicted by in silico analysis, which is not a consistently reliable method of identification.

The expression profiles of EPs remain incomplete, which stems from the lack of identified and confirmed EPs. However, class III plant POXs tend to be most expressed in roots, followed by stems, hypocotyls and internodes, with some small presence in leaf tissues.154 When examining suspected and confirmed EPs, this tendency becomes even more apparent. The expression profile of classical extensins identified in tomato from the

Solgenomics database correlates with this trend, as eighteen of twenty extensins whose expression profiles were examined using the eFP-BAR bioinformatic resource showed highest rates of transcription in the roots.155 Logically, it would follow that the enzymes responsible for crosslinking these proteins would also be most expressed in the root.

1.1.4 TomEP

The tomato EP (TomEP) is one of only three isolated EPs and was partially purified and characterized by Schnabelrauch et al.133 The study by Schnabelrauch et al confirmed EP activity, determined an optimum pH for activity of 5.5-6.0, and demonstrated the specificity of the pI 4.6 POX for the extensin monomers in vitro.133

This more newly observed anionic EP was more active than previous basic isozymes, with only nanogram quantities (5 ng) being required for extensin crosslinking assays.

Gel-filtration chromatography of cross-linked products indicated oligomerization to the degree at which extensin oligomers ceased migrating on the column. Then,

Schnalbelrauch’s group de-glycoslyated the oligomers using anhydrous hydrofluoric acid

(HF) and saw no change in chromatographic profile, indicating that the crosslinking was 39 not mediated by carbohydrate attachment, but was instead likely an intermolecular covalent bond between proteins.133

Almost a decade later, Held et al. made progress in this area using synthetic extensin analogues.127 The analogues were designed and expressed in BY-2 tobacco suspension cell cultures. Synthetic, glycosylated extensin proteins were secreted and purified from culture media. These substrates were then crosslinked using fractionated pI

4.6 tomato EP.127 Using HF, the crosslinked products were deglycosylated. Amino acid analysis of the deglycosylated, crosslinked products suggested di-IDT as the intermolecular linkage between P3-type extensin monomers.127

To identify the gene encoding the pI 4.6 tomato EP, Dong et al. began by using bioinformatics to identify 110 putative POXs in the tomato genome.134 Prediction software was used to detect signal sequences in the predicted proteins of these candidates.

Those lacking a signal sequence were removed from the list. These efforts left a pool of candidates that was further thinned out by organization based on the target protein’s pI.

Having removed all candidates whose predicted pI fell outside of a +/- 0.3 range of 4.6, eight candidate genes remained.134

To further narrow the candidate list, a proteomic approach was used. Anion- exchange chromatography followed by isoelectric focusing of tomato cell culture media was used to produce the pI 4.6 fraction containing EP activity. The pI 4.6 fraction was subjected to in-gel SDS-PAGE LC-MS/MS proteomics. This experiment identified peptides matching TomEP (previously known as CG5), CG3, and CG8.134 Efforts were focused on TomEP because its signature peptides were the most abundant. After the gene 40 locus Solyc02g094180 was confirmed to encode the pI 4.6 EP, it’s open reading frame

(ORF) was cloned from a tomato cell cDNA and ligated into the pET28A expression vector. Furthermore, in silico modeling experiments predicted that TomEP likely has two

N-linked glycosylations in it’s native form.134

TomEP was successfully produced in the heterologous Rosetta (DE3) E. coli system using the pET28A vector, incorporating a 6xHis tag on the C-terminal. Peptides harvested from inclusion bodies showed a mass of 37 kDa when assayed by SDS-PAGE.

After denaturation and re-folding using an oxido-shuffling system, active enzyme was acquired on the nanogram level.156 Assays testing the crosslinking rates of recombinant

TomEP on P1 and the YK20 P3 analogue resembled previous data from Held 2004, further suggesting that TomEP was the pI 4.6 tomato enzyme.134

The work of Dong et al not only identified and began characterization of TomEP, but also paved the way for future research by providing established methods for the recombinant production of TomEP. While some of the classical biochemistry work in vitro has been performed with the recombinant enzyme, certain questions still exist regarding its in vivo function and expression. Crosslinking assays with extensin monomers are very convincing evidence in demonstrating the catalytic function but are still a vastly simplified system when compared to the extracellular environment where

TomEP is believed to localize and function.

Observation and study of TomEP’s function and expression in its native environment would help to paint a much more complete and contextual understanding of its story. There are multiple examples of extensin and class III plant POX genes having 41 their expression modulated by pathogenic or mechanical stress. TomEP’s expedient rate of crosslinking, when compared to other EPs, highlights its potential as a fast-responding participant in reinforcement of the cell wall when tissue is damaged or infected. But which tissues? In silico analysis suggests that TomEP expression is mainly confined to the root, with some small amount in the stem and flower tissues, but this has not been investigated directly.

TomEP’s anionic character is, to date, unique among the observed EPs that have been identified. Other EPs having slower rates of catalysis and basic net charges makes it appear as though there could be minimal redundancy, but there could be yet unidentified players of confounding factors that require investigation. The goals of this dissertation are to examine TomEP’s influence on EXT content in the cell wall, elucidate when and in which organs TomEP is expressed, and to further previous efforts to study TomEP’s three-dimensional structure. Gain- and loss-of-function experiments help to begin probing the first line of questioning by attempting to make the connection between

TomEP and di-IDT or Pul formation in muro, as well as creating mutant lines for future work. Quantitative Real-Time PCR and promoter-GUS fusion experiments are employed to investigate the basal expression of TomEP, as well as wound modulation of this expression to try and discern if TomEP is primarily involved in development, and whether or not it is more of a wound-response element. Finally, several protein purification techniques are employed to obtain quantities of recombinant TomEP sufficient for x-ray crystallography, which will help to understand TomEP’s unique character on the whole and illustrate what makes this enzyme so processive. 42

CHAPTER 2: MATERIALS AND METHODS

2.1. Plant Material and Growth Conditions

2.1.1 Sterilization, Aseptic Culture, and Care of Tomato Seedlings

Sterilization and plating of seeds were performed according to McCormick et al

(1992) with minor alterations.157 Briefly, tomato seeds (Solanum lycopersicum cv.

“Bonnie Best”, or Promoter-GUS transgenic seed (cv. “Bonnie Best”) were sterilized by incubating each pack (approximately 50-60 seeds—multiples of 8 for Promoter-GUS

- lines) in 1 mL sterilization solution (1.05% ClO4 , 0.1% Tween) for 15 minutes, vortexing occasionally. After 15 minutes, the seeds were washed five times with 1 mL sterile MQ-grade water. While working in a laminar flow hood, sterile forceps were used to plate the seeds on half-strength Murashige and Skoog media supplemented with

Gamborgs B5 vitamins and 3% (w/v) sucrose (pH 5.8) in a single-file line across the plate approximately ¾ of the way down, allowing vertical space for seedling growth.

Plates were then sealed with parafilm, placed vertically (with seeds at the bottom) under fluorescent lighting (~100 µmol/m2/s) on a 16h/8h (light/dark) schedule at ~22˚C, and allowed to grow for 10-14 days for transformations, while seedlings used to examine

TomEP expression were grown for 14-21 days.

2.1.2 Explant Collection and Plating for Tomato Transformations

After 10-14 days of growth, working in a sterile hood, seedlings were clipped at mid-hypocotyl and transferred to a petri dish containing full-strength MSO media (4.44 g/L MS salts w/ vitamins, 30 g/L sucrose, pH 5.8)(Phytotechnology Laboratories, cat. #

M519) to prevent desiccation while working. Explants were taken by making two cuts 43 on each cotyledon, one at the tip of the cotyledon and one above the petiole (Figure 2-1), with efforts being taken to make the cuts with the cotyledon submerged in the MSO liquid. After freeing the explants from the petiole with the second cut, the waste materials were discarded, leaving the explants to float in the petri dish until plating.

Figure 2-1. Diagram of tomato cotyledon and explant cuts. Cotyledons were held upside down with forceps, submerging them in the liquid MSO media. A sterile scalpel was used to make an abaxial cut at the tip of the cotyledon, followed by a cut above the petiole which frees the explant. Explants were floated in the MSO until all explants were taken, and then placed abaxial side up on D1 plates with no antibiotics.

Explants were plated on shoot induction (D1) media (4.44 g/L MS salts w/ vitamins, 30 g/L glucose, 1.0 mg/L zeatin, 4 g/L gelzan, pH 5.8) with no antibiotics

(Figure 2-2). The top of each explant was put in contact with the media, exposing the bottom side of the cotyledon, as shown in image 1. On average, 40-50 explants were placed on each plate, allowing space for cotyledons to swell in size and not encroach on one another. Plates were then sealed with parafilm and allowed to pre-condition for 24-48 hours at 26˚C, 40-45 µmol/m2/sec. 44

Figure 2-2. Cotyledon explants plated on shoot induction (D1) media. Efforts were made to ensure contact of the cut tissue with the media. Plates were sealed with parafilm before being placed in the incubation chamber.

2.1.3 Sterilization, Aseptic Culture, and Care of Arabidopsis plants

Arabidopsis (Col-0) seed was incubated in sterilization solution (300 µL/mL 6.0%

(v/v) bleach, 0.1% (v/v) Triton X-100 (Sigma)) for ten minutes, followed by three successive washings with sterile milli-Q water. Seeds were stratified at 4˚C for at least three days, before being plated on half-strength MSG 1% (w/v) sucrose plates (2.22 g/L

Muraschige and Skoog Basal salts w/ vitamins (Phytotechnology Labs cat.#M519 ), 10 g/L sucrose, 4 g/L gelzan(Phytotechnology Labs, cat.#G3251), pH 5.7), with the addition of 100 µg/mL kanamycin (Phytotechnology Labs, cat.#K378) and 150 µg/mL timentin

(Phytotechnology Labs, cat.#T869) when selecting for transformant plants. Seedlings were grown under fluorescent lighting on a 18/6 photoperiod for two weeks before being 45 transplanted to 2-inch pots, containing pro-mix amended with 7.2 g/4L OsmocoteTM

(Scotts, Ohio) Slow-Release (14-14-14) fertilizer.

2.1.4 Tobacco Sowing and Care

Tobacco seeds (cv. Bright Yellow-2; BY-2) were sown on a damp Pro-Mix BX

(Premier Tech, Pennsylvania) bed and covered with a humidity dome until seedlings emerged. Two plantlets were transplanted to each 4-inch pot containing Pro-Mix amended with 7.2g OsmocoteTM (Scotts, Ohio) (14-14-14) Slow-Release fertilizer per 4L planting medium. Plants used for infiltration were ~2-5 weeks old. Pots were kept well- watered from the bottom of the tray, helping to ensure leaf turbidity and receptiveness to infiltration.

2.2 Cloning and Binary Vector Assembly

2.2.1 Overexpression Construct Assembly

The open ORF of TomEP was amplified using cDNA generated from RNA extracted from suspension-cultured tomato cells using the iScript cDNA Synthesis Kit

(Bio-Rad). The primers 5’-ATATAAGCTTTCATGGAGAGATTGAGGGGCTTG-3’,

5’- TGTAGAATTCTGAGTTAAACCTGGTGCAGTCCAG-3’ were used to amplify the

ORF from start codon to Ser325, which added the HindIII and EcoRI restriction enzyme sites to the 5’ and 3’ end respectively and excluded the stop codon. The PCR product was separated by agarose gel electrophoresis (1% w/v), purified using the Zymoclean gel purification kit (Zymo Research, California), and then ligated into a pSAT6 vector already harboring the mGFP5 gene 3’ to the multiple cloning site (MCS). The expression cassette present in the pSAT6::TomEP::GFP construct (Figure 2-3) was then subcloned 46 to the pPZP101 binary vector using PI-PspI restriction sites.158 The assembled plasmid was then used to transform TOP10 chemically-competent E. coli via heat-shock.159

Colonies were screened using cloning primers, and later verified via confocal microscopy.

Figure 2-3. Assembly of the TomEP overexpression construct. The fusion-protein expression cassette was subcloned into the vector pPZP backbone from pSAT6 using the pre-existing PI-PspI sites that were present in either vector. Blue arrows indicate the priming sites of genotyping primers in Table 2-2, and a more detailed diagram of this construct is available in Appendix B.

2.2.2 Promoter-GUS Construct Assembly

Sections of DNA 1.0 kb and 1.5 kb directly upstream of the transcription start site

(TSS) of TomEP were amplified using the Phusion High-Fidelity DNA Polymerase

(ThermoFisher Scientific, USA) according to manufacturer’s instructions. The primers

5’- ATTAAGCTTATAAATTAATAGCTCCCACA-3’ and 5’-

GCCAAGCTTAAAATGTTATTAAATAACAAACA-3’ were used as forward primers for the 1.0 kb and 1.5 kb fragments respectively, with 5’- 47

GCCTCTAGAAGTAGCAGAATAAATAAA-3’ being used as the reverse primer for both reactions. which added the restriction enzyme sites XbaI (5’) and HindIII (3’) to the

DNA amplification product. The fragments were separated by agarose gel electrophoresis (1%w/v) for 30 minutes at 100V, and then gel purified using the

Zymogen DNA Clean and Concentrate kit (Zymo Research, Mass.).

Concurrently, the pBI121 plasmid and both promoter fragments were digested with XbaI and HindIII using NEB Cutsmart buffer then separated by agarose gel electrophoresis (Figure 2-4). Gel purified fragments were quantified using a NanodropTM

2000 (ThermoScientific). The promoter DNA fragment was ligated into the pBI121 vector 5’ of the β-Glucuronidase (GUS) ORF using T4 DNA ligase (Promega, WI) with a vector to insert ratio of 7:1, calculated using the Promega Biomath Calculator

(https://www.promega.com/resources/tools/biomath/). The ligation reaction was incubated for 20 minutes on the benchtop prior to E. coli transformation as mentioned in section 2.2.1. Colonies were screened using the cloning primers listed above.

Figure 2-4. Assembly of 1.0 and 1.5 Kb Promoter-GUS fusion construct. The 1518 base pair promoter gDNA amplicon was ligated into the pBI121 vector using HindIII and XbaI restriction sites added by the cloning primers described above. Blue arrows indicate the priming sites of genotyping primers in Table 2-2, and a more detailed diagram of these constructs is available in Appendix B.

2.2.3 TomEP CRISPR Knock-out Construct Assembly

Targets for guide RNAs were chosen by cross-referencing information supplies by the websites CRISPR-P and CRISPR.Tefor.net.160-163 Specificity to the target took highest priority, with predicted gRNA secondary structure, efficiencies, and target position also being considered. Two targets were chosen, one in the first exon, and one in the third exon.

Two modular pieces of DNA were generated in two separate PCR reactions as previously described by Yang et al using oligonucleotides for reactions 1 and 2 from Table 2-1 with the plasmid pGTR as the PCR template.164 49

Table 2-1. Primers in the generation of the PTG gene targeting TomEP. Two separate PCR reactions were used to generate modular pieces of the PTG gene targeting exons 1 and 3 of TomEP. After golden gate assembly, the two “End Linker” primers were used to amplify the assembled gene, which was subsequently ligated into the pKSE401 vector. A detailed diagram of the construct is available in Appendix B. Reaction 1 Forward 5’- CGGGTCTCAATTGAACAAAGCACCAGTGG Reaction 2 5’- CGGGTCTCACTGAAGGGGAGCTGCACCAGCCGGG Reverse Reaction 2 5’- TAGGTCTCCTCAGCTCCGCCGGTTTTAGAGCTAGAA Forward Reaction 2 5’- GCCTGGGAGATGAGCTGCACCAGCCGGGAA Reverse End Linker 5’- CGGGTCTCAATTGAACAAAGCACCAGTGG Forward End Linker 5’-ATGGTCTCCAAACGAGATGCCTGGGAGATGAGCTG Reverse

The modular pieces were gel purified and ligated in a Golden Gate assembly reaction containing 50 ng of each piece, 1.0 µL BsaI, 1.0 µL T4 Ligase, 2.0 µL Ligase buffer, 1.0 µL 1 mg/mL BSA in a total volume of 20 µL. The reaction was incubated for

50 cycles of 37˚C 10 minutes, 25˚C 5 minutes, and diluted to a final volume of 120 µL.

The diluted product was used as a PCR template with the “End Linker” primers described in Table 2-1 to amplify the assembled PTG gene and add BsaI recognition sites. Both the newly assembled product and pKSE401 were digested with the type II endonuclease

BsaI, gel purified, ligated as before, and used to transform TOP10 E. coli as mentioned in section 2.2.1. Colonies were screened via PCR with the previously used end-linker primers.

2.2.4 Agrobacterium Transformation

Transformation of the Agrobacterium strain GV3101 was carried out essentially using the previously described freeze-thaw method.165 Briefly, aliquots of competent 50 cells were thawed on ice, in the presence of approximately 1 µg (7 µL maximum) binary plasmid, vortexing 2-3 times throughout to promote thawing. Thawed tubes were then snap-frozen in liquid nitrogen for 1 minute and heat-shocked at 37˚C for 5 minutes in a water bath. LB media was added to a final volume of 1 mL, and cells were incubated in a

28˚C shaker, with continuous shaking at 180 rpms, for 2-4 hours. Cells where then pelleted by centrifugation for one minute at maximum speed, and 900 µL supernatant removed before resuspension in the remaining 100 µL. Half the concentrated cells were then cultured on selective LB plates supplemented with appropriate antibiotics and incubated at 28˚C for 48 hours.

2.3 Transformations and Selection

2.3.1 Transient Expression of TomEP-mGFP and Extensin Analogs in Tobacco

Epidermal Cells

Transient expression in tobacco (Nicotiana tabacum cv. Petit Havana) leaves was performed according to previously described methods with minor alterations. Plants were used for infiltration at ~2-5 weeks old. Leaf sections were infiltrated with

Agrobacterium suspensions diluted to an OD600 of 0.1.166 When co-infiltration was performed, as necessary with in vivo crosslinking experiments, Agrobacterium suspensions were mixed in a fresh 1.7 mL Eppendorf tube at a 1:1 ratio. If appropriate, infiltrated leaf sections were excised, snap frozen in liquid nitrogen, and lyophilized.

2.3.2 Generation of Transgenic Tomato Lines

2.3.2.1 Agrobacterium-Mediated Transformation of Tomato Cotyledon Explants

Transformation of tomato explants was carried out similar to previously described with some alteration.157 Two days before planned transformations, Agrobacterium tumefaciens (strain GV3101) harboring appropriate constructs were inoculated into LB

(5ml) from glycerol stocks and grown under antibiotic selection (100 µg/mL spectinomycin or kanamycin with 50 µg/mL rifampicin and 25 µg/mL gentamycin). The cultures were incubated at 28˚C with continuous shaking at 180 rpms for ~48 hours, at which point they could be used for transformations. On the day of transformation, cell density was measured, and an aliquot of each culture diluted to OD600nm of 3.5-4.0 in a final volume of 1 mL in Eppendorf tubes. Adjusted aliquots of culture were then pelleted at 5000 x g for 5 minutes at room temperature, followed by removal of the supernatant and resuspension in LB media (no antibiotics). The resuspended bacterial pellet was then diluted 1:20 in MSO (pH 5.8) media containing 375 µM acetosyringone.

Sterile transfer pipettes were used to drop 5 mL of the 1:20 diluted culture over the explants on each petri dish. The plates were swirled to ensure complete contact of the explants, then covered and incubated for 1.5 hours. Excess diluted cultures were removed by tilting the plates slightly and aspirating the liquid (usually recovering ~4 mL), with sterile transfer pipettes. Cotyledons were straightened as needed to avoid contact with each other. The plates were then sealed with parafilm and placed in a growth chamber running a 16/8 light/dark photoperiod, at ~40 µmol/m2/s, 26˚C, and allowed to co-cultivate for 2 days. 52

After two days of co-cultivation, the explants were aseptically transferred to D1 selective plates (4.44 g MS Salts w/ vitamins, 30 g/L glucose, 1.0 mg/L zeatin, 100

µg/mL kanamycin, 300 µg/mL timentin, pH 5.8). Plates containing newly transferred explants were sealed again with parafilm and placed in the growth chamber for 3 weeks.

At the end of three weeks, the transformation was deemed either successful or unsuccessful based on the presence of light brown/green callus tissue and/or nascent shoots arising from the explants. Explants showing callus formation on their cut edges were then transferred to D2 media (4.44 g/L MS salts w/ vitamins, 30 g/L glucose, 0.1 mg/L zeatin, 100 µg/mL kanamycin, 300 µg/mL timentin, pH 5.8). When it was time to transfer explants from their first D2 plate to a second (three weeks after initial transfer), calli were excised away from the dying cotyledon explants with a sterile scalpel and cultured directly onto the fresh D2 plate, with subsequent transfers occurring every 3 weeks (~21 days).

2.3.2.2 Rooting and Care of Regeneration Shoots

When nascent shoots reached 1-2cm in length, they were clipped from the callus and stuck upright in rooting jars containing ~1/3 their volume of rooting media (4.44 g/L

MSG salts w/ vitamins, 500 µg/L IAA, 100 µg/mL kanamycin, 150 µg/mL timentin, 4 g/L gelzan). Lids were placed on the jars, which were then sealed with parafilm and returned to the growth chamber, along with explant plates. Several roots (~1 cm or larger) generally developed on successful transformants within 2-4 weeks, at which point the plantlets were transformed to 2-inch pots containing Pro-Mix. New transplants were 53 kept under humidity domes for up to 1 week to allow establishment of a sufficiently developed root system.

2.3.3 Arabidopsis Transformation Using the Floral Dip Method

Two days before transformation, 3 mL “starter cultures” of Agrobacterium strain

GV3101 were started from glycerol stock and incubated for 20-24 hours at 28˚C, with continuous shaking at 180 rpms (LB media + 100 µg/mL spectinomycin, 50 µg/mL

Rifampicin, 25 µg/mL gentamycin). Approximately 28-30 hours before transformation,

300 mL of LB + antibiotics was inoculated using the 3 mL cultures and grown under the same conditions. At noon on the day of transformation, the cell density was measured to ensure OD600 = >2.0. The Agrobacterium cultures were then pelleted using a preparatory centrifuge set to 5000 xg for 10 minutes at room temperature. The pellets were gently resuspended in Infiltration media (2.22 g/L MS Basal salts + B5 vitamins, 50 g/L sucrose, 0.5 g/L MES, 0.044 µM 6-BenzylAminoPurine, 0.2 mL/L Silwet-77, pH to

5.7 with 1M KOH) until no clumps of cells remained.

Jars containing Agrobacterium-Infiltration media solution were placed into a desiccation jar, with the plants placed upside down—aerial organs submerged in the solution. A light vacuum was applied for 5-10 minutes, and then quickly released. Plants were laid on their side and kept under humidity domes for a 24-hour recovery period.

Following recovery, T0 plants were grown to maturity, dried, and the seed collected.

The resulting seeds were screened on half-strength MSG 1% (w/v) sucrose plates as before, with the addition of 100 µg/mL kanamycin and 150 µg/mL timentin. Fourteen days post plating, T1 seedlings were scored against positive (wt; no antibiotics) and 54 negative (wt; with antibiotics) controls to select for potential transformants. Upon transplant from plate to soil, a leaf was clipped from each plant into a labeled Eppendorf tubes containing milli-Q water. Collected leaves were screened via confocal microscopy to confirm either GFP (empty vector control; “EV”) or fusion protein expression. After approximately two more weeks of growth, true leaves were harvested for further downstream analysis.

T1 plants showing evidence of expression were then grown to maturity and dried, at which point T2 seed was collected. Seed from the T2 generation was sterilized as previously described and plated on selective half-strength MSG media in two well-spaced lines to allow for unimpeded germination. The plates were placed under fluorescent lighting for 7 and 14 days at which point germination rate was scored to check for multiple T-DNA insertions. Plates showing approximately ¾ germination rate of seedlings could be counted as having one T-DNA insertion, in accordance with mendelian inheritance of traits that dictates ¼ of progeny will not inherit a heterozygous trait (i.e. single T-DNA insertion). Seedlings were transplanted inch pots and grown to seed, acquiring the T3 generation. Seed from each T2 plant was sterilized and plated on selective media and grown for 7-14 days, at which point they were scored for homozygosity, selecting lines where all seedlings were germinated and healthy.

2.3.4 PCR Genotyping of Transgenic Plant Lines

Genomic DNA was prepared from young leaves of plants generated with transformation protocols using the Qiagen DNeasy Plant Mini Kit (Qiagen, California).

Approximately 50-100 mg of tissue was clipped from the plants, snap frozen, and 55 powdered in 1.7 mL Eppendorf tubes using a mini-pestle, after which the samples were processed according to manufacturer’s instructions. G2 GoTaq polymerase (Promega,

Wisconsin) was utilized according to manufacturer’s instructions to assemble PCR reactions, using 1 µL of the previously prepared gDNA as template and primers appropriate to the construct being detected (Table 2-2). PCR products were then resolved by gel electrophoresis on a 1% (w/v) agarose gel, running at 100V for 30-35 minutes.

Table 2-2. Oligonucleotide primers used in genotyping transgenic lines. Priming sites of genotyping primers indicated by blue arrows on their respective diagrams in Sections 2.2 and 3.3.5. Expected Construct Primers Amplicon Size (bp) pPZP::TomEP- 5’-GCAGGAGGCCCTTCATACAA 680 mGFP5 5’-TCACCCTCTCCACTGACAGAA pBI121::PromTomEP 5’-GTGGAATTGTGAGCGGA 1615 and 1115 3’-TGATCGTTAAAACTGCCTGG pKSE401::PTGgene 5’-GGACTTCCTGGACAACGAGG 507 5’-CCCTTCTGCGTGGTCTGATT

2.4 RNA Preparation, cDNA Synthesis, RT-PCR, and qPCR

2.4.1 RNA Extraction

RNA was extracted from frozen tissue (for Arabidopsis, whole seedlings or leaves; for tomato, leaves) using the TriZOL method in conjunction with mortar and pestle for the grinding of tissue.167 Briefly, samples were ground in mortars pre-chilled with liquid nitrogen, after which 50-100 mg of powdered tissue were added to 1 mL

TriZOL. Samples were then processed according to manufacturer’s instructions to yield

RNA that was resuspended in 50 µL DEPC-treated water. Resuspended RNA was 56 quantified by OD 260nm using a Nano-drop (Thermo-Fisher), and RNA sample quality was assessed by electrophoresis of 0.5 µg total RNA on a 1% (w/v) agarose gel.

2.4.2 Reverse Transcription of RNA Samples

2.4.2.1 RT-PCR cDNA Synthesis

Reverse transcription and RT-PCR were performed essentially as described previously.64 RNA samples used for RT-PCR detection of OX transcripts were treated using the standard procedure for the Ambion Turbo DNase kit (Thermo-Fisher). The

SuperScript IV (Invitrogen, Massachusetts) was used to reverse transcribe 600 ng of total

RNA template using random hexamers. cDNA products were stored at -20˚C until use.

2.4.2.2 qPCR cDNA Synthesis

Immediately following the confirmation of RNA integrity as described in section

2.4.1, samples reflecting three biological replicates of each tissue or time point were reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen, California) as directed. Template total RNA (600ng) was used in each 14 µL gDNA Wipeout reaction to remove genomic contamination from the sample. This was followed by a 20 µL reverse transcription reaction that included the original 14 µL gDNA Wipeout reaction plus 4 µL 5x reverse transcription Buffer, 1 µL reverse transcriptase, and 1 µL dNTPs .

Samples were then stored at -20˚C until use.

2.4.3 Semi-Quantitative RT-PCR and qPCR

2.4.3.1 Semi-Quantitative RT-PCR

PCR detection of transcripts was carried out using G2 Go-Taq Green (Promega,

Wi) according to manufacturer’s instructions. Reactions of 25 µL, using either the OX 57 construct-specific oligonucleotides or the GUS-specific oligonucleotides. Actin-specific oligonucleotides were chosen as a loading control for tomato experiments because of actin’s stable expression across a variety of situations and stresses. Ubiquitin-specific oligonucleotides were chosen as a loading control for Arabidopsis experiments for the same reason. Reactions were cycled 35 times, using a denaturation temperature of 98˚C for 30 seconds, annealing temperature of 60˚C for 30 seconds, and extension temperature of 72˚C for ~1 minute/kb of amplicon. Aliquots of were taken at 25, 30, and 35 cycles, which were run on a 2.0% (w/v) agarose gels at 100v for 35 minutes.

Table 2-3. Primers used in RT-PCR detection of transgene transcript. Expected Target Primers Amplicon Size Sequence (bp) OX 5’-GCAGGAGGCCCTTCATACAA 680 Forward 5’-TCACCCTCTCCACTGACAGAA GUS 5’-TACGGCGTGGATACGTTAGC 300 Forward 5’-TCATTGTTTGCCTCCCTGCT SlActin 5’-GAGCAGGAACCTTGAAACCG 100 Forward 5’-AACGGAACCTCTCAGCACCA AtUbi 5’-GGCCTTGTATAATCCCTGATGAATAAG 77 Forward 5’-AAAGAGATAACAGGAACGGAAACATAGT

2.4.3.2 Quantitative PCR (qPCR) Detection of TomEP

Transcript levels were measured using six times diluted cDNA template from reverse transcriptase reactions described in 2.4.2.2. Four microliters of diluted cDNA were added to Qiagen SYBR Green master mix (Qiagen, California) for a total reaction volume of 20 µL, and analysis performed using the Rotor Gene-Q System (Qiagen,

California). The primers 5’-GCAGGAGGCCCTTCATACAA-3’ and 5’- 58

GTGTGTGAGCCCCTGAAAGA-3’ were used to measure TomEP expression, and the previously established primers 5’-GAGCAGGAACCTTGAAACCG-3’ and 5’-

AACGGAACCTCTCAGCACCA-3’ were used to measure actin expression (Table 2-3) for use as a house-keeping gene, because of its stable expression in all conditions.168

Each biological replicate was run in quadruplicate. Data was processed using the Pfaffl method to relate transcript levels of TomEP transcript with that of actin transcript, while taking primer efficiencies into account.169 All data is representative of three biological replicates, collected on three separate days.

2.5 Analysis of Transgenic Plants and Tissues

2.5.1 Live Cell Imaging by Confocal Laser Scanning Microscopy

Infiltrated tobacco sections (2 days post-infiltration) were excised and floated in water. Excised tissue (~1 cm2) was wet-mounted on slides and viewed using a Plan-

NeoFluar 40x/1.3 oil-immersion objective on a Zeiss LSM 510 laser-scanning confocal microscope. Wavelengths used to excite mGFP and vYFP fusion proteins were 458 nm

(25%) and 514 nm (25%) respectively, using a band-pass filter of 475 nm-525nm with the pinhole set to 456 µm to compensate for the weakened intensity of an old laser.

Images were collected using the Zeiss Zen 2009 software, and later processed using the

Zen 2009 Light edition.

2.5.2 Fluorometric Detection of GUS Expression

Fluorometric detection and measurement of GUS expression was performed as previously reported, with modifications.170 Fresh tissue was taken from plants harboring the promoter-GUS T-DNA, weighed, and homogenized in 1-2 µL GUS extraction buffer 59

(50 mM NaPO4 pH 7.0, 10 mM dithiothreitol (DTT), 1 mM Na2EDTA, 0.1 % sodium v/v lauryl sarcosine, 0.1 % v/v Triton X-100) per milligram tissue, using mini-pestles

(Sigma) with eppendorf tubes. Samples were kept on ice until homogenization was complete, at which point the homogenates were centrifuged at maximum speed for ten minutes. The resulting supernatants were transferred to fresh, labeled tubes, snap-frozen using liquid nitrogen, and stored at -80˚C until use.

Before the assay, GUS extract protein was quantified using the Bicinchoninic

Acid (BCA) method (Thermo Fisher, USA) and adjusted to 1 mg/mL. For each sample,

15 µg (15 µL) of GUS extract was added to 150 µL of pre-warmed (37˚C) assay buffer

(22 mg MUG dissolved in 50 mL GUS extraction buffer). Incubation periods lasted for

10, 30, or 60 minutes as well as 24 hours. At the end of each incubation period, 25 µL aliquots were combined with 250 µL of 0.2 M Na2CO3 in flat-bottomed black 96 well- plates (VWR Cat. # 76221-764). Fluorescence was measured using a Molecular Devices

SpectraMax M5 fluorometer with an excitation wavelength of 365 nm and emission wavelength of 455 nm. All samples were performed in triplicate and results were expressed as relative fluorescence to the lowest expressed sample.

2.5.3 Preparation of Alcohol Insoluble Residue (AIR)

AIR preparation was performed as previously described, with some alterations.171

Briefly, freeze-dried tissue was placed into a tared Sarstedt tube and weighed, adding two milling balls to each tube after recording the mass. The tissue was powdered in a Retsch mill for two minutes at 25 Hz. One mL of 70% (v/v) ethanol was added to each tube, and the tubes capped, then vortexed. Samples were heated for 30 minutes at 70˚C and cooled 60 to room temperature. The suspension in each tube was transferred to 15 mL conical tubes, followed by successive 1 mL rinses of Sarstedt tubes to ensure transfer of all plant material. Additional 70% (v/v) ethanol was added to each conical tube to a final volume of 10 mL, which were then vortexed well, before milling balls were removed using a magnet.

Fifteen milliliter conical tubes containing ethanol-plant material suspensions were centrifuged in an Eppendorf 5804 table-top centrifuge at 3750 x rpm for 5 minutes. The supernatant was decanted from each tube, and the samples were washed twice more in

70% (v/v) ethanol. After washing, a 1:1 by vol mixture of chloroform:methanol was added to each tube for a final volume of 10 mL, and the tubes capped then vortexed thoroughly. The samples were centrifuged again for 5 minutes at 3750 x rpms, and the supernatant aspirated away. One mL of acetone was then added to each of the tubes, which were again vortexed thoroughly, and the suspension transferred to a new Sarstedt tube. Samples were then centrifuged in a mini-fuge for 10 minutes at 14,000 x g, after which the supernatant was aspirated, and the open tubes placed in a speed-vac for 2 hours. After being thoroughly dried, a milling ball was added to each tube, and any clumps of powder disrupted by the Retsch mill for 10 seconds at 25 Hz.

2.5.4 HPLC Analysis of Tyrosine Derivatives from AIR

AIR samples were weighed on a microbalance before being resuspended in 6N HCl + 10 mM phenol at a concentration of 2 mg/mL. Five hundred micrograms

(250 µL) of each suspension was added to screw-top glass tubes with polytetrafluoroethylene (PTFE) lined caps. Tubes were sealed and heated to 110˚C for 61

20 hours, after which they were removed and brought to room temperature. After cooling, samples were dried under a stream of nitrogen gas while being gently heated at

34˚C before being dissolved in 50 mM formate to a concentration of 10 mg/mL (50 µL) and filtered using Spin-X columns to remove particulate matter.

Filtered samples were separated and analyzed using an Agilent 1100 series HPLC system with a polyhydroxyethyl-A column (inner diameter, 9.4 x 200 mm, 10 nm pore size, Poly LC Inc., Columbia, MD) in 50 mM formate, using an Agilent FLD (Ex:

280nm, Em:420nm) detector to measure tyrosine derivatives. Lacking standards for Di-

IDT and Pul, standards of IDT and Tyr were used in conjunction with previously recorded retention times of Di-IDT and Pul to identify peaks. Peak areas were recorded for di-IDT, Pul, IDT, and Tyr and used to compare samples.

2.5.5 Western Blot Analysis of Overexpression Lines

Samples of tissue were snap frozen in liquid nitrogen, weighed, and pulverized in a 1.7 mL Eppendorf tube, using a mini-pestle (Sigma). Homogenization buffer was added to each tube (2 µL/mg tissue), and samples homogenized as they thawed. The resulting slurry was centrifuged at 14,000 x g for 20 minutes in a cold room (4˚C).

Supernatant was transferred to labeled tubes, and an aliquot added to 2x SDS loading buffer, which was heated at 95˚C for five minutes. Samples were then crash cooled on ice and centrifuged at 14,000 xg for five minutes.

SDS-PAGE was carried out in the mini-protean (BioRad), using 12% (v/v) polyacrylamide (Biorad) gels, being run at 120V for approximately 1.5 hours. When the loading buffer had cleared the bottom of the gel, the protein was transferred to a 62 nitrocellulose membrane. The liquid transfer method was run for 18-20 hours, at 30V in a cold room. Membranes were washed with 1x phosphate buffered saline (pH 7.4) containing 0.1% (v/v) Tween-20 (1x PBST-0.1%) and blocked overnight at 4˚C with a

5% (w/v) non-fat dry milk solution in 1x PBST-0.1%. The blocked membranes were washed five times, five minutes each with cold PBST-0.1%. Primary antibody solution

(1% BSA (w/v), 0.02% sodium azide (w/v), in 1x phosphate buffered saline (pH7.4)

(PBS), 1:3000 Ab-290 (anti-GFP; AbCam)) was used to label the membranes overnight at 4˚C. After collecting the primary antibody solution, primary-labeled membranes were washed five times, five minutes each with 1x PBST-0.1%. The secondary antibody solution (1:5000, Goat anti-Rabbit HRP conjugate, Sigma) was used to treat washed membranes for 30 minutes at room temperature. Membranes were then washed as before, developed using 1:1 mixture of in-house enhanced chemiluminescence solutions

(solution 1: 100 mM Tris-HCl pH 8.5, 2.5 mM luminol, 0.4 mM p-coumarate; solution 2:

100 mM Tris-HCl pH 8.5, 0.02% H2O2) and imaged with a gel doc (BioRad).

2.6 Heterologous Expression, Folding, and Purification of recombinant TomEP

2.6.1 ABTS Assay of POX Activity

Peroxidase activity was assayed as previously described132,133, using the reagent

(2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)) (ABTS) at a concentration of 6 mM and hydrogen peroxide at 2.7 mM in MacIlvaine buffer pH 4.0. Nine hundred microliters of ABTS assay reagent was added to 100 µL of sample and incubated for 30 seconds or 1 minute, at which point the reaction was stopped with a solution of 0.05% sodium azide in Macilvaine buffer pH 4.0. Absorbance was then read at 410 nm and the 63 activity calculated by using an equation, established in the previous work cited above, where 12 nanograms of enzyme will bring absorbance at 410 nm from 0.0 to 1.0 in one minute:

Abs. * (12 ng enzyme/1.0 Abs@410nm/min.) (minutes incubated) * (µL assayed)

2.6.2 Inoculation of E. coli Cultures and Induction

Three 15 mL cultures of E. coli (DH5-α) harboring pET28a::TomEP-6x-His were started in LB supplemented with 50 µg/mL antibiotic the day before induction of protein production. The cultures were then incubated at 37˚C for 16-20 hours, with continuous shaking at 225 RPMs. The next morning, three 2 L flasks containing 833 mL LB were inoculated with the previous day’s 15 mL cultures and returned to the shaker. At an

OD600 of 0.6-0.8 (usually 3.5-4.5 hours post inoculation), IPTG was added to the cultures for a final concentration of 0.5 mM, which were then incubated at 25˚C, with continuous shaking at 225 RPMS for 20-24 hours.

2.6.3 Preparation of Inclusion Bodies and Solubilization of Protein from E. coli

Cultures were pelleted in surface sanitized 500 mL Nalgene centrifuge tubes at

7,500 xg, for 10 minutes at 4˚C. The supernatant was discarded, and pellets were resuspended in 400 mL lysis buffer (20 mM Tris-HCl pH 8.0, 2 M urea, 1% w/v Triton

X-100). The resuspended cells were then lysed by sonication while on ice for one minute, followed by a one-minute break. This was repeated 14 more times, using a transfer pipette to agitate the suspension 3-4 times throughout, for a total time of 30 minutes. 64

Sonicated suspensions were then distributed to 35 mL Oak Ridge tubes and centrifuged at

20,000 xg for 10 minutes at 4˚C, in a Beckman JA-17 rotor.

The supernatant was discarded after taking a 0.5 mL aliquot, and pellets were resuspended in lysis buffer. Sonication was repeated as performed originally, and the suspension pelleted again in Oak Ridge tubes. The subsequent pellets were each washed three times with 35ml wash buffer (20 mM Tris-HCl pH 8.0, 2 M urea). After each wash, the suspensions were pelleted again at 20,000 xg.

All washed pellets were resuspended in the same 50 mL volume of solubilization buffer (50 mM Tris-HCl pH 9.2, 8.6 M urea) and placed in an ice-cold ultrasonic bath for

15 minutes. The cell debris was separated from solubilized protein by centrifuging at

20,000 xg for 15 minutes at 4˚C. The supernatant was then collected and placed on ice until in vitro folding commenced.

2.6.4 In vitro Folding of Recombinant TomEP

Folding reactions were performed as previously described, with minor alterations.134 Protein from section 2.6.3 was assayed using the Bradford Method

(BioRad), adjusting the volume of the folding reaction to achieve a concentration of 0.2 mg/mL. The folding reaction buffer (20 mM Tris-HCl pH 9.2, 2.3 M urea, 5 mM CaCl2,,

5 µM hemin, 0.25 mM glutathione, 0.45 mM glutathione di-sulfide) was assembled in 5

L containers placed on ice. Solubilized protein was then rapidly diluted into the folding reaction buffer by pouring folding reagent into a container already containing the protein, and gently stirring to ensure homogeneity. The complete folding reaction was slowly decanted into 2-3 L glass bottles, and the headspace purged with N2 gas prior to capping. 65

Sealed folding reactions were incubated at 4˚C, in the dark, for 16-20 hours with no stirring or agitation.

2.6.5 Purification of Recombinant TomEP

2.6.5.1 Ammonium Sulfate Precipitation and Dialysis

Folding reactions were raised to a temperature of 10˚C, and ammonium sulfate was slowly added to 95% saturation. The headspace of bottles used for precipitation were again purged with gaseous N2 and capped before being incubated in the dark at 10˚C, with stirring on a stir plate (~60 rpms) overnight. The now-precipitated protein was then pelleted by centrifugation in a Beckman JA-10 rotor at 13,600 xg for 50 minutes at 4˚C, with the brake off. The supernatant was decanted away, and the pellets were all resuspended in the same 20 mL volume of HEPES binding buffer (50 mM HEPES pH

8.0, 0.5 M NaCl, 20 mM imidazole). Tubes were all washed an additional two times with

20 mL of binding buffer, yielding approximately 70 mL of resuspended pellet fraction.

The pellet fraction was then dialyzed using 14 kDa MWCO dialysis tubing in 3 x

1.6 L changes of HEPES binding buffer, already cooled to 4˚C. Initial volume was generally allowed to dialyze overnight, while successive buffer changes were allowed to dialyze for at least 2 hours apiece. After 24-36 hours of dialysis, the dialyzed pellet fraction was centrifuged in 50 mL conical tubes at 4000 xrpm for 5 minutes, with the brake off. The cleared dialyzed pellet was collected as the supernatant, leaving the pellet to be disposed of.

2.6.5.2 Ni-Affinity Purification by Batch Elution

The cleared, dialyzed pellet was then divided between 3-4 50 mL conical tubes, each containing 1 mL of Ni-Resin (2 mL of 50:50 v/v suspension of Ni-Resin:HEPES buffer) (GE Healthcare, Wisconsin), leaving very little head space and capped. The tubes were then wrapped in paper towel and agitated overnight at 4˚C, using a tube rotator.

The next morning, the Ni-resin was pelleted through centrifugation at 500 x g for 5 minutes, at 4˚C. The supernatant (unbound fraction) was mostly removed, leaving a small volume to avoid collection of any resin. The unbound fraction was assayed for peroxidative activity by ABTS assay as described in section 2.6.1, and an additional 4-8 hour binding step was added if necessary.

The recovered resin pellets were then washed once with an additional 1 mL of binding buffer and swirled gently for a few seconds, before being pelleted again as before. After the supernatant was collected and saved as “Ni-Resin Wash”, 1 mL elution buffer (50 mM HEPES pH 8.0, 0.5 M NaCl, 0.5 mM imidazole) was added to each tube and gently swirled for 2-3 seconds before pelleting again. Elution was repeated up to 6 times for each 1 mL volume of Ni-Resin. Elutions were then pooled and dialyzed as before in three 1.6 L changes of anion-exchange Buffer A (20 mM NaOAc pH 6.0) at

4˚C—generally overnight.

2.6.5.3 Anion-Exchange Chromatography

A column of diethylaminoethyl (DEAE) (volume ~20 mL) was equilibrated for

1.5-2 hours at a flow rate of 1 mL/ min with Buffer A, after which the flow rate was reduced to 0.8 mL/min. and the absorbance at 220 nm was monitored with a range of 2.0 67 arbitrary fluorescent units (AFU). The dialyzed elutions from section 2.5.4.2 were pumped directly onto the column (~80-100 mL). The column was washed until the void had completely passed (as judged by the OD220nm absorbance returning to baseline), at which time a salt gradient was started (50 mL Buffer A: 50 mL Buffer B (20 mM NaOAc pH 6.0, 1M NaCl)) and continued to run at 0.8 mL/min. Fractions were collected starting at the beginning of the salt gradient, at a rate of 2 minutes/tube. At the completion of the salt gradient, 10 µL of each fraction was assayed for peroxidative activity using ABTS as described in section 2.5.1. POX-positive fractions were then pooled and concentrated using 10 kDa MWCO Centricon devices (EMD Millipore) to a final volume of <500 µL.

2.6.5.4 Gel-Filtration

A SuperoseTM-12 column (~50 mL volume) was equilibrated overnight in Buffer

A (20 mM NaOAc pH 6.0) at a rate of 0.2 mL/min. to remove any residual azide from storage. The purification trace was monitored via HPLC (Agilent Technologies), tracking both 405 nm and 220 nm absorbances, to detect the heme content and protein content, respectively. Using a flow rate of 0.5 mL/min. the sample was injected, and fraction collector started, separating the fractions by 1 tube/minute. The major peak detected at both wavelengths was then collected, assayed for peroxidative activity and protein content, then concentrated using 10 kDa MWCO Centricon devices as before, pausing at 5-minute intervals to gently agitate the concentrate by pipetting to avoid localized pockets of higher concentration along the membrane.

CHAPTER 3: RESULTS

3.1 In silico Analysis of TomEP

3.1.1 Motif Predictions of TomEP Protein Sequence

The bioinformatic resource Ensembl Plants protein domain prediction software was used to analyze the protein domains of TomEP. A query of the database returned domain predictions matching a class III plant POX, as it contains a heme prosthetic group

(Figure 3-1). Additionally, a 23 amino acid signal sequence was predicted, matching previous analysis that suggested a secretory POX.134 Interestingly, a trans-membrane helix was also predicted to stretch from Leu7 to Phe29, which is a region of particularly hydrophobic character. This feature was also observed in the POX SlCG3, though with additional helices predicted, (according to the prediction TMHMM 2.0 online software;

Appendix A), though not in SlCG8. 172,173 While signal sequences can often appear to be transmembrane helices because of their generally hydrophobic content, the inconsistency between these three examples leaves open the possibility that TomEP may indeed have an authentic N-terminal transmembrane helix.

Figure 3-1. Protein domain analysis from Ensembl Plants. Alternating shades of purple describe separate exons. Predicted transmembrane helix shown in green, extending from Leu7 to Phe29 in TomEP, and the predicted cleavage site of the signal sequence in pink. Domains illustrated in blue and red that represent a heme plant POX. Additional examples of POX domain prediction shown for comparison purposes. This figure adapted from [173]. 3.1.2 Phylogenetic Comparison of Protein Sequences with Known and Suspected EPs

Known and suspected EPs from Solanum lycopersicum and Arabidopsis thaliana were included in the phylogenetic analysis, which resulted in multiple clades of interest

(Figure 3-2). The suspected EP AtPRX53 shared 98% sequence similarity to LEP1 and

FBP1, though this POX has an overall anionic character. The known EP AtPRX1 showed

95% sequence similarity with GvEP1. The protein sequence found to most resemble

TomEP was StPOX55, a POX in the Solanum tuberosum (potato) genome, having a 98% sequence similarity. Previously it was believed that TomEP did not have a direct homolog in Arabidopsis, but the Arabidopsis locus At5g14130 shares an 81% sequence similarity and is now suggested by The Arabidopsis Information Resource (TAIR) and

Ensembl plants to be a potential homolog of TomEP.173,174

Figure 3-2. Phylogenetic analysis of known and suspected EPs. Members are present from Arabidopsis, tomato, and potato, with known EPs from other species included. Most similar in sequence to TomEP was the potato POX StPOX55, followed by the Arabidopsis POX At5G14130, which is suggested by TAIR (The Arabidopsis Information Resource) to be a homolog of TomEP.

3.2 Expression Profile

3.2.1 Expression Analysis via RNA-seq Database

Bioinformatics database The Bio-Analytic Resource for Plant Biology eFP

Tomato browser was utilized to examine expression of the Solyc02g094180 gene product

(TomEP). Using RNA-seq data provided by the Tomato Genome Consortium, the absolute expression (Figure 3-3) graphic showed TomEP is primarily expressed in root tissues, with only marginal expression in breaker fruit, leaves, and open flowers. The relative expression graphic depicts a slightly more complex profile. Comparing 72 expression to that of open flowers, it maintains roots as having the highest TomEP expression, with open flowers being the next highest—while still bordering on negligible.

This slightly elevated value is interesting though, as a predicted anther-specific LAT52 promoter element can be observed in the TomEP promoter region.

Figure 3-3. Graphical representations of in silico results describing TomEP expression. (Top) absolute expression pattern of TomEP and (bottom) expression pattern relative to opened flowers are shown. The values used for visualization were derived from RPKM-normalized RNA-seq data and visualized by the eFP-BAR bioinformatics resource. This figure adapted from [155].

3.2.2 Promoter-GUS Fusion Experiments

3.2.2.1 Vector-Construct Assembly

Using the primers described in 2.2.2, two DNA fragments were generated containing 1.0 and 1.5 kb of TomEP promoter-region sequence, including HindIII and

XbaI restriction sites on the 5’ and 3’ ends of the fragments. These fragments were then ligated into the pBI121 vector, directly upstream of the β-glucuronidase (GUS) ORF and transformed into TOP10 E. coli that was plated on LB plates supplemented with kanamycin. Two colonies of each ligation were selected to be checked for the promoter insert though diagnostic digestion. Insert sizes of approximately 1.0 and 1.5 kb were released from the constructs (Figure 3-4). Plasmids were then sequenced via Sanger sequencing to confirm the presence of unchanged promoter sequences.

Figure 3-4. Diagnostic digests of promoter-GUS constructs. Plasmid was extracted from selected E. coli colonies, and approximately 5 µg of plasmid was loaded into each HindIII – XbaI double digestion. The reactions were then separated on an agarose (1.0%) gel for 30 minutes. Both copies for either construct show release of 1.0 kb and 1.5 kb inserts, suggesting clean ligation of inserts, though bands that were more diffuse than expected were thought to be a result of excessive sample or bacterial nucleic acid contamination. Bands labeled with an asterisk (*) were presumed to be supercoiled cut vector or also bacterial nucleic acid contamination.

3.2.2.2 Transformation Analysis of GUS Lines

Transformation efforts with cotyledon explants yielded a low efficiency for promoter-GUS lines, though no apparent physiological defects or phenotypes were observed with transformant individuals. Low recovery of transformant individuals appeared to arise from technical issues and inexperience, as efficiency improved as other projects included in this dissertation were pursued. From approximately 225 and 180 explants, five CaMV35S::GUS (positive control) and 1.5 Kb PromoterTomEP::GUS

(treatment) lines were generated, resulting in an estimated efficiency of 2.2% and 2.7% respectively.

3.2.2.3 (RT-)PCR Analysis of GUS Transformants

Five independent transformations were initially identified for CaMV35S::GUS

(positive control) and 1.5 Kb PromoterTomEP::GUS (treatment) lines via PCR using gDNA extracted from putative transformants (Figure 3-5). Out of the five original independent transformations obtained from the successful transformation efforts, three lines of each were shown to have sufficient expression of the promoter-GUS transgene. An additional

PromoterTomEP line was acquired after initial efforts and confirmed via RT-PCR as well.

(Figure 3-6).

Figure 3-5. PCR genotyping of promoter-GUS transformants. Reactions were separated on an agarose (1%) gel for 30 minutes. Using primers that were approximately 50 bp upstream and downstream of the pBI121 multi-cloning site, 1.5 kb PromoterTomEP::GUS lines yielded an amplicon approximately 1.6 kb in size, while the CaMV35S::GUS lines yielded an approximately 1.1 kb amplicon. Five independent lines were generated for each construct. Vectors used for transformation were used as positive control (+), while wild type (Wt(-)) tomato gDNA was used as negative control.

Both positive control (35S-GUS) and treatment (1.5 Kb-GUS) samples contained enough GUS transcript to produce detectable bands after thirty cycles of PCR. Primers 77 meant to detect the presence of GUS transcript sequence yielded a predicted amplicon size of 300 base pairs, while the loading control primers against actin produced 100 base pair fragments. Three biological replicates for positive control and four for

PromoterTomEP samples were found to be expressing the GUS gene (Figure 3-6). Band intensity varied somewhat with both positive control and treatment samples, a common phenomenon that is likely linked to the position of the T-DNA insertion upon transformation.

Figure 3-6. RT-PCR reactions targeting GUS and actin mRNA sequences. Thirty nanograms of cDNA, generated from transformant tomato roots approximately one month before MUG assays began, was used as the template for each reaction. Reactions were separated on an agarose (2.0%) gel for 35 minutes. (Left) Positive control lines with GUS under the control of the CaMV35S promoter followed by PromoterTomEP lines with GUS under control of the 1.5 Kb section of DNA upstream of the TomEP transcription start site. (Right) Additional PromoterTomEP line acquired later. Accompanying controls are gDNA from a successful promoter-GUS transformant as a positive control (+), wild type gDNA negative (-), and no reverse transcriptase (NRT).

3.2.2.4 Methyl-Umbelliferone Glucuronide (MUG) Assay of GUS Activity

Though RT-PCR had confirmed the expression of GUS enzyme on the RNA level, it was necessary to confirm GUS enzyme was present and the assay functional. To demonstrate GUS activity, preliminary visualization assays were performed using the fluorescent GUS substrate MUG (Figure 3-7). These reactions were visualized using a long-wave UV transilluminator wand (380 nm), ensuring no truncation events had 78 interrupted the GUS ORF (Figure 3-7). Both positive control and treatment samples showed plainly visible fluorescence in samples using root protein. Some variation was observed between different organs with positive control samples, likely resulting from differences in CaMV35S expression in different organs.

PromoterTomEP root samples showed a clear, intense fluorescence that surpassed that of other organs. A moderate amount of fluorescence with protein from stem was observed, while leaf protein yielded little to no fluorescence. Wild-type protein preparations showed some fluorescence, which was taken into consideration during analysis. While the preliminary assay provided some insight, it does not appear to be consistent with more quantitative studies, which could have arisen from differing levels of lighting adjustment in the photo images and the large amount of enzyme used which would have increased interfering and potentially fluorescent compounds.

Figure 3-7. MUG substrate structure and preliminary methyl-umbelliferone glucuronide (MUG) assay. (Left) Structure of methyl-umbelliferone glucuronide (MUG).175 (Right) To confirm GUS activity in mature transgenic plants, 100 µg of protein extracts were added to 0.5 mL MUG assay buffer and incubated overnight at 37˚C, after which 50 µL aliquots of each reaction were added to TomEP 450 µL of 0.2 M Na2CO3. Promoter root samples showed the most intense fluorescence among the three organs assayed: roots, leaves, and stems (Top, middle, bottom).

3.2.2.5 Relative Expression by MUG Assay

The preliminary assay of TomEP expression using MUG assay visualization provided some insights, but quantitation using a fluorometer was required to obtain a more objective and exacting profile. Additionally, due to the predicted presence of a

LAT52 promoter element that is generally present in pollen-specific genes, both open and closed flowers were assayed for GUS activity. PromoterTomEP samples displayed higher levels of fluorescence in roots approximately nine times higher, when compared to any other tissue type assayed, indicating roots have the highest expression of TomEP (Figure

3-8). Roots showed a less exaggerated difference of TomEP expression in seedlings that were assayed, showing a factor of approximately 1.5 higher expression than leaves

(Figure 3-9). 80

Wild type roots appeared to have higher endogenous GUS than other tissues in mature plants, which is consistent with preliminary results, though the GUS activity of transformant plants was still clearly higher in the root. Seedlings seemed to show some endogenous MUG activity in the leaves, which differs from mature plants, but did not change the fact that roots showed the highest expression. In general, all other organs from mature plants were comparable in their relative expression of TomEP, and mature plants appeared to agree best with in silico results from section 3.2.1. While expression values did not line up exactly with in silico data, the takeaway was the same: that roots are the primary expressors of the TomEP gene. Conversely, the preliminary results did not agree with the quantitative assays, though more sources of error were introduced in preliminary results and as a result the quantitative assay is likely to be more reliable.

Figure 3-8. Relative expression by MUG assay of vegetative organs from individuals 6-16 months of age. Fifteen µg of protein was incubated for four hours in 150 µL of MUG assay buffer, before 25 µL aliquots were added to wells containing 250 µL 0.2 M Na2CO3. Relative expression between tissues of the same plant were calculated relative to leaf tissue of each line. Control values shown for comparison and accounting of endogenous activity.

Figure 3-9. Relative expression by MUG assay of tomato seedling tissues. Fifteen µg of protein extracted from the organs of 17-19 day old seedlings was incubated for 24 hours in 150 µL of MUG assay buffer, before 25 µL aliquots were added to wells containing 250 µL 0.2 M Na2CO3. Relative expression between tissues of the same plant were calculated relative to leaf tissue of each line. Control values shown for comparison and accounting of endogenous activity.

3.2.2.6 Wounding Response by MUG Assay

Having demonstrated roots as the organ producing the most TomEP, wounding experiments were conducted using roots of T0 lines to discern whether it is inducible by mechanical stress. PromoterTomEP samples extracted from wounded tissues showed some basal expression of GUS under the TomEP promoter at the zero-hour time point. At the four-hour time point there was an increase of GUS activity in PromoterTomEP samples that was accompanied by an elevation of wild type fluorescence, due to variability in the wild type samples (Figure 3-10). By the six-hour time point, fluorescence of the wild type samples had abated, while PromoterTomEP levels remained somewhat elevated. Despite the increase that was observed for the negative control, TomEP expression does appear to 83 be increased by the crushing treatment to the roots, though corroborative evidence from qPCR is necessary to confirm this.

Figure 3-10. Wounding time course of mature promoter-GUS tomato plant roots. Reactions were assembled as before, using protein extracted from the treated roots of individuals 6-16 months of age, and fluorescence values presented as relative expression to the “0h” point of each line. At four hours post-wounding, GUS activity appeared to have increased more than fifty percent. By the six- hour time point, the TomEP promoter-driven GUS activity had begun to attenuate.

3.2.3 qPCR Analysis

3.2.3.1 Basal Expression

Basal expression of TomEP had yet to be measured on the RNA level, so qPCR analysis was performed to further strengthen the expression profile. The results, as measured via the Rotor-Gene Q system, indicated TomEP was most highly expressed in the root of 17-19-day old tomato seedlings (Figure 3-11). Stem and closed flowers showed marginal expression, while leaves showed essentially none. TomEP root 84 expression was more than 100-fold higher than in any other organ assayed, with the next highest being in open flower tissues. Ct values were so low for any other organ than root, that their expression runs close to the lower limit of detection. These facts reinforce the notion that TomEP is a POX that is primarily expressed in root tissues and are consistent with GUS (section 3.2.2.3) and in silico expression analysis (section 3.2.1).

Figure 3-11. Relative expression of TomEP in tomato organs by qPCR. Expression of TomEP was compared among aseptically grown seedling leaves, stems, and roots of 17-19 day old seedlings as well as closed/open flowers of 6 month old mature plants. Values were calculated relative to actin using the Pfaffl method to compare expression relative to actin (while taking primer efficiency into account) and displayed as a log2 transformation. Root levels of TomEP transcript outnumber any other organ by more than 100-fold.

3.2.3.2 Wounding Time Course

Quantitative measurement of TomEP transcript levels throughout a 24-hour time course was performed to provide a wide-ranging, higher resolution picture of this wound response (Figure 3-12). TomEP expression over the time-course exhibited clear 85 upregulation as a result of mechanical stress caused by the crushing with hemostats. An elevated response to the treatment was observed within one hour of treatment. This trend continued through the four-hour time point, at which time TomEP expression had appeared to have reached its maxima. Six hours post-treatment, transcription had already begun to attenuate, though was still higher than basal levels. Expression continued to decrease at 12 hours post-treatment, returning to slightly above zero-hour levels. At 24 hours post-treatment, TomEP expression had increased again, though the difference from

12 hours was marginal. These results appeared to represent a fast-acting response to mechanical stress because of the response observed at one hour, showing TomEP is rapidly upregulated. The 24-hour time point also shows there may be a continuing role in the following hours or days, as expression appears to creep upward to some small degree.

Figure 3-12. Relative expression of TomEP during a 24-hour wounding time course by qPCR. RNA was extracted from wounded roots of 17-19 day old tomato seedlings that were snap frozen after crushing and incubation in R/O water. Values were calculated relative to actin using the Pfaffl method to compare expression relative to actin (while taking primer efficiencies into account). TomEP transcript levels peak at the four-hour time point and begin to attenuate by the six-hour time point.

3.3 Gain- and Loss-of-Function Experiments

TomEP was previously shown to catalyze the oxidative coupling of extensin monomers in vitro.134 However, TomEP’s behavior in vivo has yet to be studied and characterized fully. Ascertaining this information is often done by generating both OX and knock-out (KO) lines that allow for measurement of resulting changes in the wall.

For this set of experiments, the intention was to monitor and quantify the amount of di-

IDT and Pul linkages present in the walls of OX and KO lines. Tomato was chosen as a model system for these experiments because it is the native environment for TomEP and 87 is also known to have more di-IDT present in its cell walls, when compared to

Arabidopsis.

3.3.1 Transient Expression and Subcellular Localization of TomEP in Tobacco

Epidermal Cells

Before expending the time and resources of producing stable native and heterologous transformant lines, validation of the assembled OX construct was needed.

Transient expression in tobacco leaves and subsequent confocal microscopy provided this validation, ensuring that the constructs used downstream were functional and produced

‘in-frame’ fusion protein. While performing this validation, subcellular localization of

TomEP was also studied to understand it’s trafficking and destination within the cell.

Infiltration of tobacco leaves with two different constructs harboring TomEP fusion proteins produced the intended temporary expression of TomEP and the fluorescence of the Y/GFP fused tag protein. In conjunction with FM4-64 (a lipophilic fluorescent dye), TomEP-mGFP5 was shown to localize to the outermost membrane of the observed cells (Figure 3-13). This almost undoubtedly represented the plasma membrane, and agreed with previous work.176 The SSTob-TomEP-SP7-EYFP (construct illustration available in Appendix B) verification indeed colocalized with the plama membrane marker “Plama Membrane – Cyan Kanamycin-resistant” (PM-CK), demonstrating the plasma membrane to be TomEP’s target location in the cell, confirming it’s utility for in vivo crosslinking experiments.

Figure 3-13. Subcellular localization of TomEP in tobacco epidermal cells. Agrobacterium strain GV3101 was infiltrated using a final cell density of OD600=0.05, allowed to sit for 48 hours at ~22˚C, and viewed by laser scanning confocal microscopy. (Top) TomEP-mGFP5 colocalizing with the lipophilic dye FM4-64. (Middle) TomEP-EYFP colocalizing with PM-CK (Plasma Membrane – Cyan Kanamycin resistant; a common plasma membrane marker) at the plasma membrane. (Bottom) Infiltrated sections showing plasmolyzed cells, treated for 30 minutes with 0.5 M mannitol before mounting in the same solution. Extracellular space revealed by plasmolysis indicated by a white arrow. All results represent at least three biological replicates.

While it seemed that TomEP-mGFP5 was associated with the plasma membrane, it was important to discern whether there was any secretion into the apoplastic space, as its signal sequence would suggest. Plasmolysis treatment with 0.5 M Mannitol was performed to see if TomEP was secreting past the plasma membrane, but found the 89 fusion protein closely associated with the membrane (Figure 3-13). With little to no fluorescence present in the apoplastic space exposed by plasmolysis, it seemed that the

TomEP fusion protein was remaining attached or associated to the plasma membrane somehow. Three independent transformants were treated by crushing before the plasmolysis treatment as well, which had no effect. These data were not expected as native TomEP is secreted from tomato cell cultures and harvested from the tomato culture medium133,134, suggesting either some part of its function is not yet understood, or some artifact of overexpression was preventing secretion.

3.3.2 Functional Analysis of TomEP by Infiltration in Tobacco Epidermal Cells

With transient expression in tobacco as the only viable method to demonstrate in vivo crosslinking of EXT monomers by TomEP, (co-)infiltration experiments were undertaken using TomEP, SlCG3, and EXT analogs that had been produced by previous work.127,133 Each construct (TomEP-EYFP, SlCG3-EYFP, YK8-EGFP, FK9-EGFP) were expressed alone in leaf sectors of tobacco, as well as pairing TomEP-EYFP and SlCG3-

EYFP each with both YK8-EGFP (functional EXT analog) and FK9-EGFP (non- functional EXT analog).

Before harvesting leaf sectors for AIR preparation, small sections were examined by confocal microscopy to confirm expression and co-localization (Figure 3-14). All constructs appeared to express readily in tobacco epidermal leaves, as they showed fluorescence at the expected wavelengths. Co-infiltrations appeared to have resulted in co-localization near or at the plasma membrane of the epidermal cells as well, making it likely that TomEP and SlCG3 were close enough in proximity to perform crosslinking. 90

Figure 3-14a. Confocal microscopy images of EXT crosslinking experiments in tobacco. Agrobacterium strain GV3101 was infiltrated using a final cell density of OD600=0.05, allowed to sit for 72 hours at ~22˚C, and viewed by laser scanning confocal microscopy. Combinations for co-infiltration included (top to bottom): a) Blank, TomEP-EYFP, SlCG3-EYFP, YK8-EGFP, FK9- EGFP, b) TomEP-EYFP + YK8-EGFP, TomEP-EYFP + FK9-EGFP, SlCG3-EYFP + YK8-EGFP, and SlCG3-EYFP + FK9-EGFP. All image sets represent at least three biological replicates. Continued on next page. 91

Figure 3-14b. Confocal microscopy images of EXT crosslinking (cont’d.).

Hydrolyses of AIR produced from tobacco leaf sections successfully released tyrosine derivatives from the material, which were able to be detected by HPLC. Levels of each derivative were examined in comparison between samples to elucidate whether

TomEP catalyzes formation of di-IDT in vivo (Figure 3-15). No significant differences showed themselves between samples that had been infiltrated with Agrobacterium, though TomEP and SlCG3 each infiltrated alone showed different levels of di-IDT that 92 suggested TomEP was crosslinking extensins where SlCG3 was not. The “blank” samples that were infiltrated with media only consistently showed higher levels of tyrosine monomers and dimers, which could be expected from tissues not undergoing

Agrobacterium infection.

Samples that had been infiltrated with combinations of POXs and EXT analogs appeared to have elevated levels of di-IDT, IDT and Tyr, especially samples containing

FK9-GFP, which would not have been anticipated. This finding cannot necessarily be trusted however, as there was no real measurable difference outside of normal variation.

TomEP alone did show less free tyrosine than the “Blank” and SlCG3 but was not significantly different. Taken together, these results suggest there may be some in vivo crosslinking of EXT occurring due to experimental efforts, but native response and AIR sample content appear to have provided enough background that the differences are indiscernible. However, given the similar results observed in samples infiltrated with

Agrobacterium, it is possible that any apparent differences are due to native response of the tobacco tissue. 93

Figure 3-15. Comparison of tyrosine derivative content in air samples prepared from infiltrated tobacco leaf sections. Hydrolyzed samples of alcohol insoluble residue (AIR) were analyzed using an Agilent 1100 HPLC system, separating products using a polyhydroxyethyl-A column with a flow rate of 0.8 mL/min. Compounds were detected using an Agilent FLD detector (Ex: 280, Em:420) and peak areas integrated using Agilent software for comparison.

3.3.3 Overexpression of TomEP in Solanum lycopersicum

3.3.3.1 Generation of Transgenic Tomato Lines

For the purpose of studying TomEP’s activity in its native environment, OX lines expressing the TomEP-mGFP5 fusion protein were generated using Agrobacterium- mediated transformation. Cotyledon explants were co-cultivated on shoot-induction medium for two days before being transferred to selective media, and regenerated shoots were rooted in selective root-induction media to help separate any plants that survived initial antibiotic selection. The initial efforts using a combination of benzyleaminopurine

(BAP) and indole-3-acetic acid (IAA) produced no transgenic shoots from 170 explants, while zeatin-supplemented plates produced six independent transformations from 94 approximately 168 explants (Figure 3-16). These efforts reflect an estimated 3.6% efficiency for transformation of explants using the pPZP::TomEP-mGFP OX construct, which made it clear that zeatin was the optimal hormone for the regeneration of transgenic shoots when working with the “Bonnie Best” cultivar (Baker Heirloom Seeds).

This efficiency showed an improvement from the promoter-GUS transformations, attributed to an increase in technical expertise. Plants from lanes 3, 12-15 were utilized for further analysis.

Figure 3-16. PCR genotyping of tomato OX transformants. An agarose (1.0%) gel separated PCR reactions for 30 minutes showing 15 potential overexpressing or empty vector (“EV”; mGFP5 only) transformants. One microliter of gDNA preparation was used as template for reactions. Using 100 bp ladder the bands were identified as the predicted 729 bp PCR product from mGFP5 sequence. Lanes marked with an asterisk (*) represent independent TomEP-mGFP5 transformants. Lanes 1, 2, 4, 6, 8, and 11 represent EV transformants, while lanes 9 and 11 represent non-independent transformations. Lanes 5 and 7 represent failed transformants. Wild-type gDNA negative control is represented by Wt (-), vector positive control by V (+), and a no template control by NTC.

3.3.3.2 Laser Scanning Confocal Microscopy (LSCM) of Tomato Overexpression Lines

As a facile method of detecting successful transformants, LSCM generally proves invaluable when used in conjunction with fluorescent protein tags. The visualization of tomato epidermal cells proved challenging however, as the tissue had a very three- dimensional character to it, especially when compared to the undersides of tobacco and

Arabidopsis leaves. Cells found on the epidermis of abaxial vasculature provided the best opportunity for imaging of the fluorescent proteins. 95

Empty-vector control lines clearly showed expression of mGFP5, which was present throughout the cells viewed (Figure 3-17). TomEP-mGFP5 lines did not display any fluorescence or any discernable phenotype, closely resembling the wild type condition (Figure 3-17). This apparent silencing or quenching of TomEP-mGFP5 fluorescence was observed in five independent lines.

Figure 3-17. Laser scanning confocal microscopy images of young tomato leaves. Approximately one cm2 leaf sections from the primary or secondary branches of 1-2 month old plants were wet mounted leaves and the epidermal cells of their vasculature observed. (Top) Overexpression lines produced no fluorescence anywhere within or out of the cells, resembling the wild type negative controls (bottom). (Middle) mGFP5-only control lines produced easily visible fluorescent signal throughout the cells. Results are representative of five independent lines. Scale bar = 10 µm.

3.3.3.3 (RT-) PCR Analysis of Transgenic Tomato Plants

The five independent lines specified from the pool of identified transformants above, found to be producing enough fusion protein transcript, were selected for further analysis. The initial primers used in both PCR and RT-PCR analysis spanned TomEP and

GFP ORFs, giving a single product for each. The fusion protein amplicon was 680 base pairs, while the actin loading control produced a 100 base pair fragment, showing bands for both by the end of 30 PCR cycles (Figure 3-18). These data confirm that the transgene is indeed being transcribed, despite the lack of observable fusion protein.

Figure 3-18. (RT-)PCR analysis of tomato OX lines. (Top) Diagrams of annealing sites for primers used, spanning the TomEP and mGFP5 ORFs to yield a 680 bp fragment (left) and amplifying the mGFP5 ORF only to yield a 729 bp fragment (right). (Middle top) gDNA genotyping gel (1.0% agarose) of five independent transformations. (Middle bottom) RT-PCR reactions using the same primers that span TomEP and mGFP5 were separated on an agarose (2.0%) gel for 35 minutes. (Bottom) RT-PCR reactions using primers to amplify the entire mGFP5 ORF. Thirty nanograms of cDNA, generated from the RNA of young leaf tissue, was used form each sample for the PCR reactions, which were run for thirty cycles. Transformant individuals represented by numbers 1-5, the gDNA positive control from a successful transformant by (+), the wild type cDNA negative control by Wt(-), and the no reverse transcriptase control by NRT.

Because of difficulties detecting the fusion protein by either confocal microscopy or western blotting, a second round of RT-PCR was performed using the same cDNA, but different primers. The targeted amplicon was the GFP ORF alone (729 bp), ensuring that there was no truncation of the T-DNA. Unfortunately, only four of the initial five transformants survived to this point but were still examined by RT-PCR. All five lines were again positive for the 729 bp mGFP5 amplicon (Figure 3-18), which confirmed the 98 presence of intact and functional T-DNA inserts. This suggested that the difficulty detecting TomEP-mGFP was occurring at some point after transcription of the fusion protein.

3.3.3.4 Western Blot Analysis of Tomato Overexpression Lines

After unsuccessful attempts to visualize the presence of TomEP fusion protein by laser scanning confocal microscopy, it was necessary to try detection by a western blot.

At times, the GFP fluorescence can be quenched by acidic environments, such as the apoplast to which TomEP is believed to secrete. Five independent lines were initially assayed for the protein product of the transgene with a simplified homogenization buffer containing no protease inhibitors. No GFP epitopes outside of wild-type background levels were detected by the anti-GFP antibody (Figure 3-19). The expected mass of the fusion protein was approximately 64 kDa, though protein prepared from tobacco leaves expressing OX construct produced bands slightly above the 50 kDa and well below the

75 kDa bands of the protein standard.

Figure 3-19. Western blot of tomato OX lines using an anti-GFP antibody. (Ab290, AbCam) Ten micrograms of protein extracted from leaves on the primary or secondary branches of 2-3 month- old plants were loaded per sample lane of 12% polyacrylamide PAGE gels. Five independent lines showed no signal slightly above 50 kDa when compared to 20, 30, and 40 µg of a positive control sample expressing TomEP-mGFP5, which was expected to weigh at ~64 kDa, but ran slightly above 50 kDa. Protein extracted from a wild type plant was used as a negative control (Wt(-)) and BioRad precision dual plus was used as a protein standard (L).

An additional round of western blotting was performed in conjunction with the second round of RT-PCR. The second attempt included protease inhibitors in the homogenization buffer used to preserve any GFP epitopes that may have been degraded in the first and as before, no fusion protein was detected (Figure 3-20). From this, two possibilities emerged: that the protein was somehow being post-translationally silenced and degraded, or that it was somehow confined the insoluble fraction of the protein preparation and stuck in the pellet (possibly through ionic interactions), though some signal would likely be seen if this were the case. The non-specific bands observed just below the positive control seems likely to be rubisco, and not the target fusion protein, because it is present in the wild type sample as well.

100

Figure 3-20. Western blot detection of TomEP-mGFP5. (Top) Ponceau-stained membrane and (bottom) western blot using an anti-GFP antibody (Ab290, AbCam). Ten micrograms of protein were loaded per sample lane of 12% polyacrylamide PAGE gels. Four independent lines (left) lack bands slightly above 50 kDa when compared to varying masses of a positive control sample (+), extracted from tobacco leaves transiently expressing TomEP-mGFP5. Transformants indicated by numbers 1-4, wild type negative by Wt(-), and protein standards by “L”.

3.3.4 Heterologous Expression of TomEP in Arabidopsis thaliana

Heterologous expression systems are often useful for studying an enzyme or protein’s function, especially if the new environment lacks any homologous or redundant proteins. To date, no definite homologue of TomEP has been identified in Arabidopsis thaliana, making for a good heterologous system. Additionally, Arabidopsis has been at the forefront of cell wall proteomics, perhaps providing a better characterized backdrop 101 for TomEP’s activity. Comparison between TomEP activity in both native and non- native environments that have extensin present was another avenue of interest.

3.3.4.1 Laser Scanning Confocal Microscopy of Arabidopsis Overexpression Lines

The well-established process of selecting for fusion protein expressing

Arabidopsis lines using laser scanning confocal microscopy was utilized to screen seedlings that had survived the antibiotic selection process. Examining the abaxial epidermal cells of 14-17 day old seedlings, the TomEP-mGFP5 lines produced results similar to the tomato lines, which resembled the wild type condition (Figure 3-21).

Empty-vector control lines clearly showed expression of mGFP5, which was present throughout the cells viewed. This apparent silencing or quenching of TomEP-mGFP5 fluorescence was observed in nine independent lines, further confirming that some post- translational silencing or quenching event was responsible for the lack of fluorescent signal.

102

Figure 3-21. Laser scanning confocal microscopy images of Arabidopsis seedling leaves. Single- leaf sections were wet mounted from 14-17 day old Arabidopsis plants and their abaxial epidermis observed. (Top) Overexpression lines produced no fluorescence beyond wild type levels anywhere within or out of the cells (bottom). (Middle) mGFP5-only control lines produced easily visible fluorescent signal throughout the cells. Results are representative of nine independent lines. Scale bar = 10 µm.

3.3.4.2 (RT-)PCR Analysis of Transgenic Arabidopsis Plants

Nine independent transformations that survived the antibiotic screening process were subjected to further analysis, after having failed to produce fluorescent signal during

LSCM. Because they survived the selection process, the seedlings were likely harboring and expressing genes on the T-DNA insert, but a truncation at the 3’ end could not be ruled out, which could be responsible for the lack of GFP signal. Primers that span the 103 mGFP5 ORF produced a 729 base pair fragment, and the primers for the ubiquitin loading control yielded a 77 bp fragment.

All nine lines produced bands indicating the presence of mGFP5 transcript, with intensities varying somewhat with levels of expression (Figure 3-22). The presence of the intact mGFP5 coding sequence, taken with the fact there was any transcript at all, confirmed the presence of intact and functional T-DNA inserts. These results suggested that the difficulty detecting TomEP-mGFP was occurring at some point after transcription of the transgene.

Figure 3-22. (RT-)PCR analysis of Arabidopsis OX lines. (Top) RT-PCR product from the mGFP5 ORF of nine independent transformations. (Bottom) Ubiquitin loading control bands corresponding to the above sample. Thirty nanograms of cDNA generated from the RNA of Arabidopsis vegetative tissue was used form each sample for the PCR reactions, which were run for thirty cycles. Transformant individuals represented by numbers 1-9, the gDNA positive control from a successful transformant by (+), the wild type cDNA negative control by Wt(-), and the no reverse transcriptase control by NRT.

3.3.4.3 Western Blot Analysis of Arabidopsis Overexpression Lines

After unsuccessful attempts to visualize the presence of TomEP fusion protein by laser scanning confocal microscopy, it was necessary to try detection by western blot as was performed with tomato lines. Three independent lines were initially assayed for the protein product of the transgene with a simplified homogenization buffer containing no protease inhibitors. No GFP epitopes outside of wild-type background levels were detected by the anti-GFP antibody. Expected mass of the fusion protein was 104 approximately 64 kDa, though protein prepared from tobacco leaves expressing OX construct produced bands slightly above the 50 kDa and well below the 75 kDa bands of the protein standard (Figure 3-23).

Figure 3-23. Western blot of Arabidopsis OX lines using an anti-GFP antibody. (Ab290, AbCam) Ten micrograms of Arabidopsis seedling protein were loaded per sample lane of 12% polyacrylamide PAGE gels. Three independent lines (left) lack signal slightly above 50 kDa when compared to varying masses of a positive control (+). The positive control sample was extracted from tobacco leaves transiently expressing the same TomEP-mGFP5 construct, and was expected to weight ~64 kDa, and ran slightly above 50 kDa. Wild type Arabidopsis protein extracted from seedlings of the same age were used as a negative control (Wt(-)), and BioRad Precision Dual Plus ladder was used as a protein standard (L).

An additional round of western blotting was performed, including protease inhibitors in the homogenization buffer used to preserve any GFP epitopes that may have been degraded in the first. The repeated effort produced results similar to the first, as no fusion protein was detected (Figure 3-24). These results indicated that whatever phenomenon was occurring in the native lines was likely to be present in the heterologous lines as well.

105

Figure 3-24. Western blot detection of TomEP-mGFP5. (Top) Ponceau-stained membrane and western blot (bottom) using an anti-GFP antibody (Ab290, AbCam) to detect the TomEP Fusion protein in Arabidopsis OX lines. Ten micrograms of protein from Arabidopsis vegetative tissues were loaded per sample lane of 12% polyacrylamide PAGE gels. Nine independent lines lack signal slightly above 50 kDa when compared to 10 µg of a positive control sample (+) mentioned above in Figure 3-23. Protein from wild type seedlings was a wild type negative control (Wt(-)), and BioRad Precision Dual Plus Ladder was used as a protein standard (L).

106

3.3.5 Editing the TomEP Gene Using Poly-Cistronic tRNA-gRNA (PTG) CRISPR

With efforts toward generating stable overexpressor lines for TomEP in both tomato and Arabidopsis appearing to have been unsuccessful, the next step was to attempt the generation of KO lines. By removing TomEP’s activity from its native environment, the resulting effects could be monitored for further characterization.

Unfortunately, the very quality of Arabidopsis that helped make it ideal for heterologous expression (lack of a clear TomEP homologue), made it impossible to carry out any analogous study in that model organism. For that reason, tomato CRISPR-Cas9 KO lines were generated, incorporating the recently developed Polycistronic tRNA-gRNA strategy.164

3.3.5.1 Construction of the PTG Gene Targeting TomEP

Two DNA fragments were generated using the primers described in section 2.2.3 with the vector pGTR as a template, 113 and 193 base pairs in size. When ligated together in a Golden Gate reaction, a ligation product of 292 base pairs was present in the reaction, due to having lost some sequence from digestion and ligation. The Golden Gate reaction was then utilized as a template with end-linker primers listed in section 2.2.3 to generate a 294-base pair PTG gene that would target exons 1 and 3 of the TomEP gene

(Figures 3-25, 3-26). Sixteen bases were then lost to digestion on the 5’ and 3’ ends of the PTG gene to produce a final insert size of 278.

107

Figure 3-25. Target regions, structure, and RNA product of PTG genes. (Top) TomEP ORF showing color-coded target sites for the two guide RNAs. (Middle) Color-coded representation of the PTG gene assembly in the context of the CRISPR-Cas9 construct T-DNA, with genotyping primers (Table 2-2) specific to the Zea mays-optimized Cas9 being shown as blue arrows. The nptII gene that confers kanamycin resistance is shown 3’ to the Cas9 sequence (Bottom) Color- coded representation of RNA transcript produced by the TomEP PTG gene, showing tRNA and guide RNA scaffold secondary structure, as well as endogenous RNase cleavage sites. This figure was adapted from [164].

108

Figure 3-26. Gel purification of assembled PTG gene PCR product. An agarose (1.5%) gel was used to separate products for 30 minutes. Two primers with overhanging BsaI sites complementary to vector overhangs were used to amplify the golden gate ligated DNA fragment to yield the 294 bp PTG gene shown in Figure 3-27, with BsaI recognition sites on either end. “OTF” indicates an off-target PTG band that is standard to PTG gene generation as previously shown by [164]. The PCR product was gel purified and ligated into the pKSE401 vector previously digested with BsaI.

3.3.5.2 PCR Genotyping of Potential Transformant Plants

Like any other transformation procedure, it was necessary to screen and confirm potential transformants. This proves especially true when the downstream analysis of individuals is cost or time intensive, as the extraction of gDNA and Sanger sequencing are. To eliminate non-transformant ‘escapes’ from the pool of Cas9-positive lines, primers specific to the Zea mays-optimized Cas9to identify plants harboring the T-DNA insert were used in gDNA PCR genotyping reactions.

Out of 38 plants generated from Agrobacterium-mediated transformations, 17 plants showed a significant, predicted 507 base pair DNA fragment generated by primers designed against the Cas9 gene (Figure 3-27). An additional ten plants showed light or 109 errant banding by 35 cycles of PCR and were included in the pool of plants for potential double-stranded breaks (DSBs) to avoid false negatives (Figure 3-27). Considering the plants showing pronounced banding (not all independent), approximately 45% of plants harbored the T-DNA insert.

Figure 3-27. PCR genotyping of potential PTG-CRISPR transformants. Reactions were separated on an agarose gel (1.0 %) for 30 minutes, showing 38 potential transformants. One microliter of gDNA preparation was used as template in 25 µL PCR reactions. Using 100 bp ladder the bands were identified as the predicted 507 bp PCR product from Cas9 sequence, though additional higher molecular weight bands were detected at approximately 800 bp in the positive control and potential transformants. The positive control sample (+) used pKSE401 empty vector as a template, while wild type tomato gDNA was used as a negative control (Wt), and a reaction with no template as a non-template control (NTC).

3.3.5.3 Identification of Successful DSBs by Sanger Sequencing

A critical step in the identification of Cas9 mutants is identifying the desired (or undesired) double-stranded breaks generated using the gene editing system. From the beginning of the CRISPR-Cas9 system, Sanger sequencing has been an invaluable tool.

It is indispensable for confirming gene edits, as well as learning the sequence produced by the error-prone repair process of non-homologous end joining. Other techniques have been developed, like the PCR-Restriction Enzyme (RE) assay or high-resolution melt analysis (HRMA), but these require either the presence of a restriction enzyme 110 recognition site or extensive optimization to utilize properly. For these reasons, direct sequencing of PCR products produced from the gDNA template was used to screen and identify successful double-stranded breaks.

Sanger sequencing of PCR reactions amplified sections of TomEP, 191 (Exon 1) and 582 (Exon 3) base pairs in length from gDNA prepared from potential mutants.

Three lines showed evidence of possible homozygous or chimeric edits from successful double stranded breaks (DSBs) (either both copies of the gene edited in the same way, or both copies of the gene having different edits, respectively)(Figure 3-28: PTG 4; Figure

3-28: PTG 6; Figure 3-29: PTG 8). This was discerned from Sanger sequencing chromatograms showing simple one base pair insertion and deletions with no overlapping peaks that are indicative of heterozygous DSBs (one copy of the gene in the diploid genome edited, while the other remains wild type).

Exon 3 of TomEP showed potentially chimeric or homozygous edits in two lines,

PTG 6 and 8. The PTG 6 line seems likely to be chimeric, as there appears to be a single base pair deletion followed by an apparent jumbling of peaks, while PTG 8 appears to be homozygous for a single base pair insertion (with no doubling peaks). In all, a 7.4% efficiency in generating putatively homozygous or chimeric mutants for the exon 1 target, and a 3.7% efficiency for the exon 3 target were calculated from these results.

Multiple lines showed evidence for heterozygous edits, displaying the previously mentioned overlapping peaks that suggest the presence of two distinct alleles present in the diploid genomes. Out of 27 lines, the exon 1 target yielded 19 lines with putative

DSBs, with an overall editing efficiency of 70% (Figure 3-28). From the same pool of 27 111 lines, the exon 3 target produced 2 lines with putative DSBs, with a lower editing efficiency of 11% (Figure 3-29).

112

(-G)

Figure 3-28a. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence. (Top) Region of exon 1 that was targeted for sequencing and orientation if the sequencing primer. (Bottom) Shown is the exon 1 target sequence region of wild type (WT) and 19 regenerated individuals potentially harboring edited TomEP sequences. The predicted Cas9 cleavage site is indicated by a red arrow on each chromatogram. PTGs 4, 6, and 8 show a likely homozygous single base pair deletion or some chimeric combination of edits. Chromatograms of other individuals show characteristic overlapping peaks of potentially heterozygous editing events. Continued on next page. 113

(-G)

Figure 3-28b. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence. Shown is the exon 1 target sequence region of wild type (WT) and 19 regenerated individuals potentially harboring edited TomEP sequences. The predicted Cas9 cleavage site is indicated by a red arrow on each chromatogram. PTGs 4, 6, and 8 show a likely homozygous single base pair deletion or some chimeric combination of edits. Chromatograms of other individuals show characteristic overlapping peaks of potentially heterozygous editing events. Continued on next page.

114

Figure 3-28c. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence. Shown is the exon 1 target sequence region of wild type (WT) and 19 regenerated individuals potentially harboring edited TomEP sequences. The predicted Cas9 cleavage site is indicated by a red arrow on each chromatogram. PTGs 4, 6, and 8 show a likely homozygous single base pair deletion or some chimeric combination of edits. Chromatograms of other individuals show characteristic overlapping peaks of potentially heterozygous editing events. Continued on next page. 115

Figure 3-28d. Sanger sequencing chromatograms of suspected edits in TomEP exon 1 sequence. Shown is the exon 1 target sequence region of wild type (WT) and 19 regenerated individuals potentially harboring edited TomEP sequences. The predicted Cas9 cleavage site is indicated by a red arrow on each chromatogram. PTGs 4, 6, and 8 show a likely homozygous single base pair deletion or some chimeric combination of edits. Chromatograms of other individuals show characteristic overlapping peaks of potentially heterozygous editing events.

116

(-A)

(+C)

Figure 3-29. Sanger sequencing chromatograms of suspected edits in the TomEP exon 3 sequence. Shown is target sequence region of wild type (WT) and 2 regenerated individuals potentially harboring edited TomEP sequences. The predicted Cas9 cleavage site is indicated by a red arrow on each chromatogram. PTGs 6 and 8 each show a likely homozygous mutation or some chimeric combination of edits. PTG 6 shows a single base pair deletion while PTG 8 shows a single base pair insertion.

3.4 Extraction, Folding, and Purification of Recombinant TomEP

TomEP was previously shown to likely be a class III plant peroxidase.177 Because of this, it is clear a heme group is necessary for extensin crosslinking activity and that a conserved variable region likely dictates substrate specificity. Beyond this, and some previous modelling work based on horseradish POX, the shape of the TomEP tertiary structure is uncharacterized.177 Until the amino acids composing the substrate binding pocket and catalytic site (and their positions) are identified, the exact mechanisms of substrate binding and resulting crosslinking will remain unclear. 117

X-ray crystallography affords the opportunity to describe and characterize the tertiary structure of proteins, allowing researchers to further understand enzyme-substrate interactions as well as catalytic activity. Previous work has established and optimized an oxido-shuffling strategy for refolding a 6XHis-tagged, recombinant TomEP protein expressed in Rosetta (DE3) E. coli cells.134 The scale of TomEP folding reactions was originally on the milliliter scale, producing only nanograms of active rTomEP per folding reaction.

To produce the quantities required for x-ray crystallography, the folding reactions needed to be scaled to whole liters. While this did very little to change the folding procedure, it mandated changes to the original purification scheme, as certain procedures became either unwieldly or impossible at these volumes. Table 3-1 lists the steps of the purification, along with protein content, activity, and specific activity of a typical preparation.

118

Table 3-1. Purification accounting of rTomEP. Protein product was quantified and assayed for POX activity at each purification step, with specific activity and purification level being calculated from these values. Abbreviations: Amm. Sulf.- Ammonium Sulfate, His-Tag – 6x Histidine tag, DEAE- Diethylaminoethyl column, S12- Superose12TM size-exclusion column. Specific Purification Total Protein Total Activity Purification Activity Step (mg) (µg) Level (µg/mg) Folding 295 19,250 65.26 1 Reaction Amm. Sulf. N/A 11,380 N/A N/A Pellet His-Tag 3,177 N/A N/A Elutions N/A Dialyzed His- 9.09 1,745 192 2.95 Tag Elutions Pooled DEAE 2.70 1,080 401 6.15 fractions Concentrated DEAE 2.80 320 113 1.73 Fractions Pooled S12 1.2 767 639 9.79 Fractions Concentrated 1.11 547 494 7.58 S12 Fractions

3.4.1 Extraction and Folding of recombinant TomEP

The largest volume prepared was 2.6 L, which was limited by the amount of induced E. coli that could be prepared at one time and the efficiency of inclusion body protein extraction. A typical POX activity—as measured by ABTS assay—that could be found in a folding reaction is approximately 0.044 µg/mL. Such a low concentration of functional protein in a large volume necessitated a concentration step. 119

3.4.2 Ammonium Sulfate Precipitation of TomEP Folding Reactions

After the overnight folding reaction, the original volumes could be directly purified through nickel ion-affinity chromatography, but this proved impossible for such large volumes and limited amounts of Ni Sepharose resin. To concentrate the folded enzyme, ammonium sulfate precipitation was performed. At 4˚C the supernatant retained

POX activity, but when adjusted to 10˚C for the 24-hour precipitation in 95% saturated solution this activity was eliminated. A typical preparation can recover ~84% of the enzyme activity as measured by ABTS assay when comparing the supernatant and pellet total activities.

3.4.3 Immobilized Metal Affinity Chromatography

To prevent undesired redox reactions between still-present glutathione and the nickel resin, resuspended pellets were dialyzed in nickel-resin binding buffer. Two to three rounds of binding, washing, elution, and re-equilibration were usual to remove POX activity from the unbound fraction. Elutions can typically retain ~92% of the POX activity when compared to the combined total activities of the elutions, washes, and unbound. Efforts to quantitate the protein concentration were only successful when quantifying the dialyzed elutions from this step because of high imidazole concentration in the elution buffer, and dilution of the sample to lower the concentration brought protein content to a level below detection.

3.4.4 Anion Exchange Chromatography

His-tag elutions were dialyzed in acetate buffer, to remove high salt concentrations, in preparation for fractionation through anion exchange chromatography. 120

Initial efforts relied upon the use of centricon devices to concentrate the sample and exchange buffers, but POX activity was lost to the unbound fraction, despite using 10k

MWCO filters. As a result, instead of concentrating first, the sample was pumped directly onto a DEAE column from a beaker nested in ice, which simplified and improved efficiency of the purification scheme.

After the void had cleared and the salt gradient initiated, POX activity typically eluted after another ~17 minutes and continued through 55 minutes after gradient start

(Figure 3-30). ABTS assay of DEAE fractions was carried out with each preparation to identify POX-positive fractions. Total protein recovery was typically ~30%, with much of the extraneous sample protein being removed. Retention of ~62% of the enzymatic activity was usual, which drastically increased specific activity since so much non-POX protein had been fractionated out, despite the apparent decrease in activity from the dialyzed elutions.

Examination of the trace (Figure 3-30) made it apparent that more than one product was present in the pooled DEAE fraction, which could have been the case for multiple reasons. The method of pumping dialyzed His-tag elutions may have influenced how the anionic fraction bound to the column and is subsequently eluted. It is also possible that the column was overloaded with anionic protein. One final possibility is that some small amount of degradation had occurred with the protein (e.g. His-tag missing), or that a prosthetic group (i.e. heme or Ca2+) was not properly incorporated.

Regardless of what has occurred, this necessitates the use of size-exclusion chromatography to help ensure the acquisition of a pure product. 121

Figure 3-30. Diethylaminoethyl anion-exchange chromatography trace. Protein content was monitored at 220 nm. Representative of normal peak shapes and sizes when purifying dialyzed His- tag eluates. Flow rate 0.8 mL/min, arbitrary fluorescence unites (AFU) range 2.0, 50 mL:50 mL gradient, 20 mM NaOAc pH 6.0, 1 M NaCl Buffer B.

3.4.5 Size-Exclusion Chromatography of Concentrated DEAE Fractions

Purity of the protein sample is imperative when preparing for crystallization.

Because of this, it was problematic two peaks consistently appeared in the POX-positive anion-exchange fractions. Size exclusion chromatography was incorporated to ensure the presence of a single product, and while the levels of contaminating protein fluctuated, every preparation to date has required this step. Collaborators have assured that a single peak collected from this final step would likely be pure enough for crystallography, though future preparations may benefit from further validation like SDS-PAGE.

The recombinant TomEP protein generally eluted between ~24 and ~32 minutes post-injection when running on a Superose6TM column, while it eluted between ~11 and 122

19 minutes post-injection on a Superose12TM column (Figure 3-31). After determining that the major product was POX-positive using a Superose6TM column, Superose12TM column separation was used occasionally. With both column types, it is evident there is more than one product present in the injected sample, but that this final step allows for the separation of the target product from the undesired. When observing either trace in

Figure 3-31, a leading peak of protein is observed before the target product but is devoid of peroxidative activity. Succeeding the desired product, a substantial level of heme content (containing no peroxidative activity) is observed in the Superose6TM trace, associated with a small peak of protein that is also present in the Superose12TM.

Desired product consistently dominates the sample content, often preserving as much as 45% of the input material. Enzyme activity usually retained ~71% of the starting material, and specific activity rose accordingly. A standard preparation, using

~300-500 milligrams of inclusion body protein for folding can yield a final product in the hundreds of micrograms to milligram level. An exceptional preparation starting with

0.295 g of inclusion body protein has produced 1.11 mg of rTomEP.

123

Figure 3-31. HPLC and LC traces of size-exclusion chromatography. (Left) Concentrated fractions from anion-exchange chromatography were separated using a Superose6TM column with an Agilent 1100 HPLC system and monitored at 220 nm and 405 nm to detect protein and heme-content, respectively. Fractions spanning 25-30 minutes show POX activity, identifying this peak as TomEP-6XHis. Flow rate 0.5 mL/min, 20 mM NaOAc pH 6.0. (Right) Separation of concentrated anion-exchange fractions using a Superose12TM column, monitored at 220 nm using the same mobile phase conditions. Fractions spanning 11-19 minutes post-injection showed POX activity, though fractions spanning 12-17 minutes post-injection were collected to ensure a single product, which is indicated by an asterisk (*).

124

CHAPTER 4: DISCUSSION AND CONCLUSION

4.1 In silico Analysis of TomEP

TomEP has remained conspicuous when compared with other identified and confirmed EPs, both because of its negative net charge and exceptionally high crosslinking activity. The purpose or relevance of these defining characteristics has yet to be revealed, and efforts to elucidate them may have been stymied by the lack of a clear-cut homolog in the Arabidopsis genome. The Arabidopsis Information Resource (TAIR) lists the locus At5G14130 as a likely homolog of TomEP.174 However, the expression profile supplied by the eFP-BAR resource does not closely resemble that of TomEP.156

This line of research may warrant at least cursory investigation, as work with Arabidopsis can generally be performed more quickly, in larger numbers, and have a better characterized context.

There is also the interesting possibility of a homolog in potato, which was found to be very similar in sequence to TomEP, and could be investigated as a potential EP.

Given potato being more closely related to tomato, it seems more likely that it would have a functional homolog in its genome. Regardless of whether Arabidopsis or potato have a TomEP homolog, the work presented here begins the characterization of TomEP in vivo and facilitates future work that will hopefully help further the understanding of why TomEP stands apart from other EPs. 125

4.2 Expression Analysis of TomEP

4.2.1 GUS and qPCR Profiling of TomEP Expression

Data from eFP-BAR (which utilizes RNA-Seq data) suggested TomEP would primarily be expressed in roots, with some marginal expression in open flowers, leaves and stems.155 Both qPCR and GUS data support this prediction, showing higher expression in both seedling and mature plant roots. The qPCR relative expression data demonstrated that TomEP transcript levels are as much as 100-fold higher than any other tissue. Because of this disparity, and the predominance of class III plant POX expression in roots, investigating wounding response in roots seemed more justified than in any other organ.

Both qPCR and GUS assay data agree that wounding increases the expression of

TomEP. The qPCR wounding time course provided a higher resolution to the response time, which was integral to showing the uptick in TomEP transcript present within one hour of the wounding treatment. This suggested that it may be a fast-acting response factor to mechanical stressors. Much more speculatively, this increase of transcription could be replenishing and reinforcing initial banks of TomEP that were activated from tissue damage and released to the cell wall, similar to previously described responses of

POXs.178-181 Experiments using external stimuli, such as white-light inhibition demonstrate that class III (and even extensin) POXs can be both induced and attenuated, but thorough studies of specifically EP response to wounding warrant further pursuit.

The continuation of elevated TomEP transcript levels through 24 hours post- treatment suggests a more complex response to wounding than a simple quick-response 126 factor. Response to the mechanical stress attenuated somewhat after the initial burst of

TomEP transcript but more slowly than what would be expected for a strictly fast-acting agent. The wounded condition persisted throughout the entirety of the incubation, as the treatment was extreme in the way that the entirety of the root length underwent crushing.

It appears TomEP’s expression remained at a ‘maintenance level’, that could persist until the tissue recovers enough to allow stress-response signals to abate, if it ever would.

4.3 Gain- and Loss-of-Function Experiments

4.3.1 Transient Expression and Subcellular Localization of TomEP

Previous and current studies have reported that TomEP remains associated with the plasma membrane when transiently expressed in tobacco epidermal cells. It has been theorized the close association of TomEP fusion proteins to the plasma membrane is a defect or artifact related to the heterologous expression system or overexpression, perhaps due to a lack of signal peptidase, or even the fusion with a hydrophobic fluorescent protein tag that causes hydrophobic interactions with the plasma membrane.

While either may be the case, not previously considered is the possibility this could be the native state of TomEP. It could be acting as a membrane-bound bank of EP, prepared to be released as a fast-moving response to pathogen or mechanical stress, which would be consistent with the previous observations of pre-transcriptional response from some class III POXs that include at least one example of oxidative crosslinking.135,178-180

Current bioinformatic findings have predicted a transmembrane domain (Figure

3-1) that makes up a portion of the signal peptide and extends two amino acids past the predicted signal peptide cleavage site. The two residues that extend past the signal 127 peptide are leucine and valine, being of hydrophobic character. This brings to mind the subtilisin-like serine proteases that are secreted to the extracellular space and commonly have a specificity to hydrophobic cleavage sites.182 It is possible TomEP is released from the plasma membrane by a proteolytic response to pathogen and mechanical stressors, at which point it can quickly catalyze the formation of Pul and di-IDT to reinforce the cell wall, though it is important to stress that this is highly speculative.

There is currently is no direct evidence of TomEP interacting with any other apoplastic biomolecules other than extensin, but examples of such interactions exist. The

P69 subtilisin-like proteases, which themselves require activation from zymogen form, have been demonstrated to process the LRP protein in tomato (a leucine-rich repeat containing protein involved in molecular recognition and protein-protein interactions.183

Proteases like the P69s are quickly activated by salicylic acid and ROS signaling, which is one of the first signs of distress during pathogenesis. It is difficult to not consider the concept of ROS (such as H2O2) not only serving as the secondary substrate for TomEP, but also as an upstream signal molecule that indirectly causes its activation or release.

This would be consistent with the fact that TomEP is secreted to the media of tomato cell cultures, which are constantly in a wounded condition while in tobacco it remains associated with the plasma membrane.

Another example of an apoplastic proteases responding to pathogen attack, by interacting with or activating another protein, is the Rcr3 cysteine-protease also found in tomato. Rcr3 interacts either directly or indirectly with Cf-2, a membrane bound protein involved in pathogen defense that is leucine-rich, like the LRP protein mentioned 128 above.184,185 Mutant lines have been shown to lack resistance to the pathogen

Cladosporium fulvum, but resistance is restored upon complementation.185 This line of evidence makes it clear that Rcr3 proteolytic activity is critical at some point in the cell’s response to pathogenesis.

Taken with the reluctance of TomEP to secrete in tobacco epidermal cells, this line of research justifies further investigation. A good initial set of experiments that are accessible would be protease protection assays using the disrupted cell membranes of tobacco transiently expressing the TomEP fusion protein, likely starting with Proteinase

K as the treatment (for its preference of hydrophobic substrate). Using the fusion protein as an avenue of detection, a western blot would then be performed to try and resolve the difference in molecular weight of cleaved versus uncleaved TomEP.

Another line of research that could help to begin elucidating whether TomEP is cleaved away from the plasma membrane, or activated some other way, would be to run wounding experiments using tissue treated with cycloheximide similar to that previously described.178 Fortunately, detection and analysis of TomEP’s contribution to di-IDT and

Pul formation in wounded and unwounded states could be made easier by using the

CRISPR mutant lines generated in this work. Depending on the amount of redundant

EXT crosslinking activity, wounding experiments (using cycloheximide to stop translational response) could demonstrate a post-translational activation.

4.3.2 Overexpression of TomEP

Gain-of-function experiments in tomato and Arabidopsis have failed to detect any fusion protein. Transgenic lines were examined from DNA to protein, attempting to 129 elucidate the point at which expression broke down. T-DNA insertions were identified, and RT-PCR results even indicated the presence of transcript in four and nine independent lines of tomato and Arabidopsis, respectively. However, western blot analysis and confocal microscopy showed a clear lack of fusion protein, whether by recognition of GFP epitopes or lack of fluorescence, respectively. Fortunately, tobacco epidermal cells did show expression of the TomEP-mGFP5 fusion protein, though no significant amount of crosslinking was detected (Figure 3-14).

When initial screening of tomato and Arabidopsis fusion protein fluorescence yielded no signal or detectable protein, it was hypothesized that the apoplastic space was too acidic for the excitation of mGFP to yield detectable emission. It is a common statement that this acidic environment will quench the GFP signal, but other studies have demonstrated apoplastic localization either without issue, or with only reduced fluorescence.186,187 The possibility of TomEP fusion protein being sequestered into organelles like the peroxisome or vacuoles was also considered, but it could still be expected for some signal to appear with western blot analysis.

The lack of binding in western blot analysis using anti-GFP antibodies maintains that neither TomEP-mGFP or mGFP are present anywhere within the cells. Even if within the apoplastic space or membrane compartments, the fusion protein would provide some sort of signal. Silencing or suppression of gene expression commonly occurs at the

RNA level, using machinery like Argonaut and Dicer-like proteins. Because the transcript is removed, protein is not present, but the silencing would also be visible on the

RNA level by RT-PCR and transcript of the fusion protein was plainly present. Having 130 sequenced the transgene before commencing transformations, and observed fluorescent protein in tobacco cells infiltrated with culture from the same glycerol stock as transformations throughout, it was reasonable to conclude there were no mutations present that would prevent expression of the TomEP fusion protein. Having ruled out a problem with the construct, it seemed reasonable that some physiological issue impaired expression in stable transformants.

Post-translational regulation within the cell is often a response to stress factors as well though and may cause the lack of fusion protein.188,189 Phosphorylation, sumoylation, and ubiquitination are all potential responses to factors causing disruptions within the cells.188 Considering the promiscuity of class III plant POX activity, it is possible that the TomEP fusion protein was being ubiquitinated and degraded almost as fast as it could be produced. Furthermore, there is precedence to overexpression of class

III POXs potentially deleterious phenotypes in tobacco and tomato.142,190 Efforts were made to express TomEP transiently in tomato leaves (as done in tobacco), with both GFP and YFP constructs, but this proved unsuccessful. In order to proceed with efforts to generate native OX lines, it may be necessary to pursue either an inducible promoter system or a lower-copy constitutive promoter.

The question remains though, as to why tobacco epidermal cells expressed the

TomEP fusion protein using the same construct as other OX transformations, and why there was no significant increase in di-IDT or Pul if TomEP was being produced. Native

EXT crosslinking activity, as a result of Agrobacterium infection, likely played some role in obscuring any TomEP activity. Another confounding factor could be SlCG3 131 potentially crosslinks EXT in vivo, despite lacking activity in vitro.177 But it is also possible that some fraction of the fusion proteins produced were fluorescent, though not functional, and that is why tobacco continued to produce it—thus providing retarded cross-linking activity. If these experiments were to be reattempted, it would be prudent to bulk tissue in amounts sufficient for preparation of cell walls and HF deglycosylation.

Acquisition of the HF-insoluble fraction has traditionally been a way to acquire cross- linked EXT for analysis and would help to reduce any non-crosslinked EXT or non-EXT material that contributes to background.

Mutant lines will be advantageous to these prospects for multiple reasons.

Biomass will be more easily acquired in larger masses, as plants can be grown and harvested much more easily than tobacco can be infiltrated. Related to this, contention with the background of non-transformant cells that is problematic with transient expression would be eliminated, as all cells would contain the mutation. Finally, mutant lines will be able to show TomEP’s activity in a native background with no T-DNA insertion, and therefore no inadvertent disruption of genes that may be relevant to it’s effects in muro—creating an environment as close to wild type as possible.

4.3.3 CRISPR Knock-Out of TomEP Expression

While no biochemical analysis was performed for this section of work, these efforts represent one of the first—if not the first utilization of the polycistronic tRNA- gRNA (PTG) CRISPR in tomato. The Yang group originally developed the PTG system using rice as an expression system and observed as much as 20% higher efficiency of indel generation.164,191 Because the purpose of the experiment was not to compare 132 efficiencies, constructs were not assembled as a control to compare the efficiencies of the pKSE401 vector system with or without the PTG gene system.

Regardless, the most conservative of estimates places the editing efficiency at

33% for exon 1 and 7.4% for exon 3, with one line having indels present in both exons.

It is difficult to identify and document completely the total edits made in the T0 generation, because of chimeric, heterozygous, and large-scale deletions. Targeted regions are not the only sections of DNA that are difficult to screen for edits either, as the potential for off target editing is inherent to the CRISPR-Cas9 system. The targets selected for this work were chosen partially because of the unique character of their sequences. Only one potential off target edit was predicted between the two target sequences, which was close in sequence to the exon 3 target (Figure 4-1). Conveniently, the potential off target sequence is an intergenic region, unlikely to disrupt any known gene function should an indel inadvertently be generated. Furthermore, the potential off- target sequence has four mismatches to the exon 3 guide RNA sequence, making any unintentional edits unlikely.

Figure 4-1. Potential off-target sequence of exon 3 guide RNA. The intergenic region between gene loci Solyc01g011070.1.1 – Solyc01g011080.3.1 contains a 20 base pair sequence similar to that of the exon 3 guide RNA directly upstream of a protospacer-adjacent motif (PAM). The target sequence and off-target sequence are directly compared, with an asterisk (*) indicating the mismatches between the two sequences. Four mismatches is considered to be the lowest risk of off-target editing between similar sequences, making an unintended edit at this region unlikely.

133

Other studies using the pKSE401 vector in tomato, not incorporating the PTG strategy, have achieved efficiencies as high as 69 and 84%.192,193 The disparity between this work and others in editing efficiency could have arisen from two sources: the inclusion of any lines with even the slightest genotyping band (which could cause inclusion of false-positives), as well as the inclusion of a guide-RNA sequence that was predicted to be inefficient after transformations had been made. As with most new technology, resources evolve and improve rapidly, allowing for the selection of the exon

3 target sequence before the resource predicted the sequence as likely inefficient because of the four nucleotides that immediately precedes the protospacer-adjacent motif (PAM).

The wide disparity between the exon 1 and 3 targets lends credence to this prediction, reinforcing the idea that the 4 nucleotides before the PAM are critical in determining whether the target sequence will be efficient or not.

Efficiencies aside however, the PTG-CRISPR system has proven itself as a convenient, fast, and effective method of targeting multiple sites for genome editing.

Cloning time can be cut down by approximately half in respect to editing multiple targets in a genome, due to the nature of Golden Gate assembly and it’s use in creating PTG genes. While the transformation process itself can not be made to be more expedient, the

CRISPR-Cas9 system in general benefits from being able to sidestep the screening necessary with random mutagenesis with compounds like ethyl methanesulfonate.

Furthermore, the technology is more specific to particular sequences than other technologies like zinc-finger nucleases and transcription activator-like effector nucleases, and prediction software allows for facile checking of potential off target edits. In all, it is 134 possible to produce rooted T0 shoots, ready for screening of mutations, 3 months from the date of transformation—with additional shoots following in the subsequent 1-2 months of culture.

Using PTG CRISPR in this work, two lines were identified as potentially homozygous or chimeric for indels, confirming that at least two alleles can be acquired for future study without complementation being necessary. Moving forward, the main objective is to breed true the different alleles created by DSBs, while also segregating out the T-DNA insertion from the populations. With homozygous, Cas9-free mutants in hand, the first order of business should be to compare the amount of di-IDT and Pul present in the root wall tissues, as well as the ratio of the two oxidatively cross-linked tyrosine derivatives. Wounding experiments would also be prudent as mentioned above, with the purpose of measuring the change in di-IDT and Pul levels, which could help to illustrate how much redundancy surrounds TomEP’s function as an EP. In addition to biochemical characterization, side-by-side experiments comparing aseptically grown wild type and mutant seedlings could show a difference in root length. Previous experiments involving EXTs and EPs have shown this sort of phenotype in other organs, like the overexpression of an EXT affecting stem thickness and length, or the white-light inhibition of an EP slowing the growth in tomato seedling hypocotyls.194,195

4.4 Expression, Folding, and Purification of Recombinant TomEP

Increasing the scale of the previously documented folding reactions required several modifications to the original protocol, as many methods were only suitable for the nanogram quantities previously generated. The rapid dilution of protein extracted from 135 inclusion bodies may merit further study, as within this work, the protein was simply transferred to the full volume of folding buffer with a transfer pipette prior to gently stirring. It is possible that other methods may yield a more efficient folding ratio, generally by controlling how quickly the protein is diluted or the buffer exchanged.196

After the initial folding, the ammonium sulfate precipitation became necessary, as such large volumes would have greatly hindered the use of the Ni-NTA resin. This technique also offers up additional advantages, as the suspension can be stored at 4˚C for a day or two, while an additional preparation of the folded protein is performed, allowing for a ‘doubling up’ of production. However, dialysis was necessary to proceed to binding incubations with the nickel resin because of the reduction of nickel ions by glutathione.

As previously mentioned, the his-tagged rTomEP did not bind tightly to the nickel ion using the traditional buffer of sodium phosphate pH 7.4. The issue proved so problematic that the unbound fraction was never cleared of POX activity. Utilizing the strong buffering capacity of HEPES however, which can hold a slightly higher pH, the buffer being at a pH 8.0 proved successful in clearing unbound fractions after a series of two to three rounds of binding, washing, eluting, and re-equilibrating. The increased pH of the buffer likely improved the affinity of the histidine tag to the nickel ions, allowing for tighter and more complete binding.

Affinity chromatography elutions are invariably high in salts, which make techniques like anion-exchange chromatography impossible until some sort of buffer- change as occurred. The initial strategy of using centricon filtration devices introduced too much loss of target protein, even though the pore size is appropriate, as their retention 136 of protein above the MWCO rating is still below 100%. As a result, when attempting to concentrate large volume and low concentration samples, loss of target protein is largely exacerbated from a more standard use of concentration devices. The only method to combat this was to dialyze again in anion exchange buffer A. Using concentration devices was avoided yet again, saving both time and protein, by pumping the dialyzed elutions directly onto the anion-exchange column. This allowed for the anion exchange chromatography step to act as both a purification and concentration step.

Anion exchange chromatography traces show that a significant amount of protein is lost at this stage in the purification. The affinity chromatography that comes before leaves much of the extracted protein behind and red-colored aggregates form during the ammonium sulfate precipitation, but this material was easily pelleted and removed.

Because the chromatography was monitored at 220 nm, it can be trusted that what is seen being sorted out on the trace is indeed undesired protein product. The POX-positive portion of the trace indicated more than one peak however, whether it be from column overloading, small variations in the protein like loss of His-tag from degradation, or unincorporated heme and calcium ions. Regardless of the cause, the presence of >1 product confirmed the need for size-exclusion chromatography.

The separation of protein product by size did require that the anion-exchange fractions be concentrated to <500 µL, but no buffer change. Considering the original protocol required four rounds of centricon use, bringing this down by half preserves significant amounts of recombinant TomEP. By monitoring both 410nm and 220nm, it was possible to discern misfolded protein of similar size to properly formed TomEP. 137

When performing the size exclusion separation, either the S6TM or S12TM Superose columns can be used, though the former provides better resolution of the target protein.

Fortunately, the major peak was TomEP, showing strong POX activity, with minimal protein loss from the anion-exchange fractions. Post gel-filtration, the pure

TomEP protein was then concentrated to 5-10 mg/mL using centricon devices, and it was necessary to run shorter concentration times and agitate the solution to prevent localized areas of higher concentrations against the membranes. This became particularly necessary at concentrations above 5 mg/mL. The final product of this purification scheme has not be tested for EXT cross-linking activity, but the initial work that established the expression, folding, and purification verified this. However, before moving forward with extensive preparation of rTomEP for crystallization, it may be worthwhile to recheck in future work.

Collaborations to try and crystallize the protein proved problematic, despite the success in producing approximately one milligram per preparation. The sample was two- day shipped to Leipzig, Germany in a cold pack, but in the end failed circular dichroism tests when it arrived. In the future, it is likely that more local collaborators will be necessary. An ideal situation would be same-day delivery of purified TomEP to the laboratory intended to perform the crystallization.

4.5 Conclusion

The expression profile reported here appears to describe a fast-acting agent in the reinforcement of the tomato root cell wall that maintains a level of basal expression, even in non-stressed conditions. On the transcriptional level, responding within one hour to 138 the mechanical stress treatment represents a rapid reaction. This response is complemented by the fact that previous work has shown extensin expression is also upregulated in similar situations (i.e. mechanical stress and pathogen attack).100-108 In agreement with the concept of TomEP being a fast actor in wound response is the previously mentioned processivity of the enzyme, which may arise from its net negative charge encouraging interactions with positively charged EXT. With a larger capacity for cross-linking EXT proteins than any other observed EP, TomEP is the best-known EP suited for such a purpose. But this doesn’t explain how EXT insolubilization occurs faster than de novo protein synthesis can occur, as enzyme needs to be present for this to occur.

A point of interest that may point toward an answer is the bioinformatic prediction of a transmembrane helix, combined with the transient expression results that indicate TomEP-mGFP5 remains associated with the plasma membrane. Apoplastic, defense-related proteases have been well documented to respond to pathogenesis and wounding, subtilisin-like serine proteases being part of this response.182,183,197,198 One speculative but interesting possibility is that TomEP’s response to wounding may be an immediate extracellular response, where systemic activation may come before the transcription and delivery of additional TomEP to the plasma membrane. Wounding experiments using mutant lines will be best suited to reveal any activation response of

TomEP, followed by protease protection assays to begin characterizing the mode of activation. 139

Because gain-of-function experiments failed to show detectable fusion protein or crosslinking activity, the direct link of TomEP to EXT crosslinking in vivo has yet to be made. CRISPR KO lines show promise toward characterizing TomEP’s catalytic activity since, with at least two identified KO alleles in hand, the need for complementation experiments can be avoided. Measurements of both basal and wounded activity would be good strategies with mutant lines for two reasons. Not only would they make the connection from TomEP to in vivo EXT crosslinking, but they’d also expand on the wounding time course work presented here to correlate extensin crosslink formation with

TomEP expression—allowing for the detection of any idiosyncrasies (like the activation mentioned above) and any functionally redundant POXs.

The eventual crystallization of TomEP will prove useful in answering the question of why EP is so processive. Currently, it is only confirmed that the heme-ligand participates in the reaction, though some modeling work has predicted amino acids localized to the catalytic site.177 Previous attempts at computer modeling are not a replacement for direct observation using x-ray crystallography though, and the structural knowledge gained would help to better understand how the EXT substrate is processed in the three-dimensional structure of the enzyme-substrate complex. Beyond this, it will also be possible to plan experiments that probe further into the structure-function relationship of TomEP, as targeted changing of certain amino acid resides will be more feasible.

140

REFERENCES

1. Cosgrove, D. J., Wall relaxation and the driving forces for cell expansive growth. Plant

physiology 1987, 84(3), 561-4.

2. Esquerré-Tugayé, M. T., Lafitte, C., Mazau, D., Toppan, A., & Touzé, A., Cell surfaces

in plant-microorganism interactions: I. A structural investigation of cell wall

hydroxyproline-rich glycoproteins which accumulate in fungus-infected plants. Plant

Physiology 1979, 64(2), 314-19.

3. Esquerré-Tugayé, M. T., Lafitte, C., Mazau, D., Toppan, A., & Touzé, A., Cell surfaces

in plant-microorganism interactions: II. Evidence for the accumulation of

hydroxyproline-rich glycoproteins in the cell wall of diseased plants as a defense

mechanism. Plant Physiology 1979, 64(2), 320-26.

4. Joly, R. J., & Zaerr, J. B., Alteration of cell-wall water content and elasticity in

Douglas-fir during periods of water deficit. Plant Physiology 1987, 83(2), 418-22.

5. Buckeridge, M. S., Dietrich, S. M. C., & Maluf, A. M., Galactomannan in seeds of

different populations of Leucaena leucocephala. Rev Brasil Bot 1987, 10, 25-7.

6. Buckeridge, M. S., Rocha, D. C., Reid, J. G., & Dietrich, S. M., Xyloglucan structure

and post‐germinative metabolism in seeds of Copaifera langsdorfii from savanna and

forest populations. Physiologia Plantarum 1992, 86(1), 145-51.

7. Sharp, J. K., Valent, B., & Albersheim, P., Purification and partial characterization of

a beta-glucan fragment that elicits phytoalexin accumulation in soybean. Journal of

Biological Chemistry 1984, 259(18), 11312-11320. 141

8. Carpita N, M. M., The Cell Wall. In Biochemistry and Molecular Biology of Plants,

American Society of Plant Physiologists: Rockville, MD, 2000; pp 52-109.

9. Carpita, N. C., & Gibeaut, D. M., Structural models of primary cell walls in flowering

plants: consistency of molecular structure with the physical properties of the walls

during growth. The Plant Journal 1993, 3(1), 1-30.

10. Anderson, R. L., Clarke, A. E., Jermyn, M. A., Knox, R. B., & Stone, B. A., A

carbohydrate-binding arabinogalactan-protein from liquid suspension cultures of

endosperm from Lolium multiflorum. Functional Plant Biology 1977, 4(1), 143-58.

11. Lamport, D. T., Hydroxyproline-O-glycosidic linkage of the plant cell wall

glycoprotein extensin. Nature 1967, 216(5122), 1322-24.

12. Hon, D. N. S., Cellulose: a random walk along its historical path. Cellulose 1994, 1(1),

1-25.

13. Brongniart, A., Pelouze, T. J., & Dumas, A. B., Rapport sur un mémoire de M. Payen,

relatif à la composition de la matière ligneuse. CR Hebd Seances Acad Sci 1839, 8, 51-

14. Mueller, S. C., Brown, R. M., & Scott, T. K., Cellulosic microfibrils: nascent stages of

synthesis in a higher plant cell. Science 1976, 194(4268), 949-51.

15. Mueller, S. C., & Brown, R. M., Evidence for an intramembrane component associated

with a cellulose microfibril-synthesizing complex in higher plants. The Journal of cell

biology 1980, 84(2), 315-26.

16. Sugiyama, J., Harada, H., Fujiyoshi, Y., & Uyeda, N., High resolution observations of

cellulose microfibrils. Journal of the Japan Wood Research Society 1984, (Japan). 142

17. Nixon, B. T., Mansouri, K., Singh, A., Du, J., Davis, J. K., Lee, J. G., ... & Roberts, A.

W., Comparative structural and computational analysis supports eighteen cellulose

synthases in the plant cellulose synthesis complex. Scientific reports 2016, 6, 28696.

18. Cosgrove, D. J., Re-constructing our models of cellulose and primary cell wall

assembly. Current opinion in plant biology 2014, 22, 122-31.

19. McFarlane, H. E., Döring, A., & Persson, S., The cell biology of cellulose synthesis.

Annual review of plant biology 2014, 65, 69-94.

20. Pear, J. R., Kawagoe, Y., Schreckengost, W. E., Delmer, D. P., & Stalker, D. M.,

Higher plants contain homologs of the bacterial celA genes encoding the catalytic

subunit of cellulose synthase. Proceedings of the National Academy of Sciences 1996,

93(22), 12637-42.

21. Morgan, J. L., Strumillo, J., & Zimmer, J., Crystallographic snapshot of cellulose

synthesis and membrane translocation. Nature 2013, 493(7431), 181.

22. Kurek, I., Kawagoe, Y., Jacob-Wilk, D., Doblin, M., & Delmer, D., Dimerization of

cotton fiber cellulose synthase catalytic subunits occurs via oxidation of the zinc-

binding domains. Proceedings of the National Academy of Sciences 2002, 99(17),

11109-14.

23. Doblin, M. S., Kurek, I., Jacob-Wilk, D., & Delmer, D. P., Cellulose biosynthesis in

plants: from genes to rosettes. Plant and cell physiology 2002, 43(12), 1407-20.

24. Jacob-Wilk, D., Kurek, I., Hogan, P., & Delmer, D. P., The cotton fiber zinc-binding

domain of cellulose synthase A1 from Gossypium hirsutum displays rapid turnover in 143

vitro and in vivo. Proceedings of the National Academy of Sciences 2006, 103(32),

12191-196.

25. Wang, J., Howles, P. A., Cork, A. H., Birch, R. J., & Williamson, R. E., Chimeric

proteins suggest that the catalytic and/or C-terminal domains give CesA1 and CesA3

access to their specific sites in the cellulose synthase of primary walls. Plant physiology

2006, 142(2), 685-95.

26. Timmers, J., Vernhettes, S., Desprez, T., Vincken, J. P., Visser, R. G., & Trindade, L.

M., Interactions between membrane-bound cellulose synthases involved in the

synthesis of the secondary cell wall. FEBS letters 2009, 583(6), 978-82.

27. Ha, M. A., MacKinnon, I. M., Šturcová, A., Apperley, D. C., McCann, M. C., Turner,

S. R., & Jarvis, M. C., Structure of cellulose-deficient secondary cell walls from the

irx3 mutant of Arabidopsis thaliana. Phytochemistry 2002, 61(1), 7-14.

28. Fagard, M., Desnos, T., Desprez, T., Goubet, F., Refregier, G., Mouille, G., & Höfte,

H., PROCUSTE1 encodes a cellulose synthase required for normal cell elongation

specifically in roots and dark-grown hypocotyls of Arabidopsis. The plant cell 2000,

12(12), 2409-23.

29. Arioli, T., Peng, L., Betzner, A. S., Burn, J., Wittke, W., Herth, W., & Cork, A.,

Molecular analysis of cellulose biosynthesis in Arabidopsis. Science 1998, 279(5351),

717-20.

30. Olek, A. T., Rayon, C., Makowski, L., Kim, H. R., Ciesielski, P., Badger, J., Ghosh,

S., Kihara, S., Himmel, M. E., Bolin, J., Carpita, N.C., The structure of the catalytic 144

domain of a plant cellulose synthase and its assembly into dimers. The Plant Cell 2014,

26(7), 2996-3009.

31. Heath, I. B., A unified hypothesis for the role of membrane bound enzyme complexes

and microtubules in plant cell wall synthesis. Journal of Theoretical Biology 1974,

48(2), 445-49.

32. Wick, S. M., Seagull, R. W., Osborn, M., Weber, K., & Gunning, B. E.,

Immunofluorescence microscopy of organized microtubule arrays in structurally

stabilized meristematic plant cells. The Journal of cell biology 1981, 89(3), 685-90.

33. Gunning, B. E., & Hardham, A. R., Microtubules. Annual Review of Plant Physiology

1982, 33(1), 651-98.

34. Bashline, L., Lei, L., Li, S., & Gu, Y., Cell wall, cytoskeleton, and cell expansion in

higher plants. Molecular Plant 2014, 7(4), 586-600.

35. Park, Y. B., Lee, C. M., Koo, B. W., Park, S., Cosgrove, D. J., & Kim, S. H., Monitoring

meso-scale ordering of cellulose in intact plant cell walls using sum frequency

generation spectroscopy. Plant physiology 2013, 163(2), 907-13.

36. Dhugga, K. S., Biosynthesis of non-cellulosic polysaccharides of plant cell walls.

Phytochemistry 2012, 74, 8-19.

37. Pauly, M., Gille, S., Liu, L., Mansoori, N., de Souza, A., Schultink, A., & Xiong, G.,

Hemicellulose biosynthesis. Planta 2013, 238(4), 627-42.

38. Yin, Y., Huang, J., & Xu, Y., The cellulose synthase superfamily in fully sequenced

plants and algae. BMC plant biology 2009, 9(1), 99. 145

39. Richmond, T. A., & Somerville, C. R., The cellulose synthase superfamily. Plant

physiology 2000, 124(2), 495-98.

40. Zhou, Y., The Subcellular Localization and Protein-protein Interactions of Barley

Mixed-Linkage-(1- 3),(1- 4)-ß-D-Glucan Synthase CSLF6 and CSLH1. Doctoral

dissertation, Ohio University, 2018.

41. Zeng, W., Jiang, N., Nadella, R., Killen, T. L., Nadella, V., & Faik, A., A glucurono

(arabino) xylan synthase complex from wheat contains members of the GT43, GT47,

and GT75 families and functions cooperatively. Plant physiology 2010, 154(1), 78-97.

42. Liepman, A. H., & Cavalier, D., The cellulose synthase-like A and cellulose synthase-

like C families: recent advances and future perspectives. Frontiers in plant science

2012, 3, 109.

43. Dhugga, K. S., Plant Golgi cell wall synthesis: from genes to enzyme activities.

Proceedings of the National Academy of Sciences 2005, 102(6), 1815-16.

44. Ray, P. M., Shininger, T. L., & Ray, M. M., Isolation of β-glucan synthetase particles

from plant cells and identification with Golgi membranes. Proceedings of the National

Academy of Sciences 1969, 64(2), 605-12.

45. Bowles, D. J., & Northcote, D. H., The sites of synthesis and transport of extracellular

polysaccharides in the root tissues of maize. Biochemical Journal 1972, 130(4), 1133-

45.

46. Doblin, M. S., Pettolino, F. A., Wilson, S. M., Campbell, R., Burton, R. A., Fincher,

G. B., & Bacic, A. A barley cellulose synthase-like CSLH gene mediates (1, 3; 1, 4)- 146

β-D-glucan synthesis in transgenic Arabidopsis. Proceedings of the National Academy

of Sciences 2009, 106(14), 5996-6001.

47. Burton, R. A., Gidley, M. J., & Fincher, G. B., Heterogeneity in the chemistry, structure

and function of plant cell walls. Nature chemical biology 2010, 6(10), 724.

48. Vliegenthart, J. F. G., Viëtor, R. J., Hoffmann, R. A., Angelino, S. A. G. F., Voragen,

A. G. J., & Kamerling, J. P., Structures of small oligomers liberated from barley

arabinoxylans by endoxylanase from Aspergillus awamori. Carbohydrate research

1994, 254, 245-55.

49. Hayashi, T., Xyloglucans in the primary cell wall. Annual review of plant biology

1989, 40(1), 139-68.

50. Mohnen, D., Pectin structure and biosynthesis. Current opinion in plant biology 2008,

11(3), 266-77.

51. Reid, J. G., Edwards, M., Gidley, M. J., & Clark, A. H., Enzyme specificity in

galactomannan biosynthesis. Planta 1995, 195(4), 489-95.

52. Hanus, J., & Mazeau, K., The xyloglucan–cellulose assembly at the atomic scale.

Biopolymers: Original Research on Biomolecules 2006, 82(1), 59-73.

53. Mazeau, K., & Charlier, L., The molecular basis of the adsorption of xylans on

cellulose surface. Cellulose 2012, 19(2), 337-49.

54. Woodward, J. R., Phillips, D. R., & Fincher, G. B., Water-soluble (1→ 3),(1→ 4)-β-

D-glucans from barley (Hordeum vulgare) endosperm. I. Fine Structure. Carbohydrate

Polymers 1983, 3(2), 143-56. 147

55. Woodward, J. R., Phillips, D. R., & Fincher, G. B., Water-soluble (1→ 3),(1→ 4)-β-

D-glucans from barley (Hordeum vulgare) endosperm. II. Physicochemical properties.

Carbohydrate Polymers 1983, 3(2), 143-56.

56. Keegstra, K., Talmadge, K. W., Bauer, W. D., & Albersheim, P., The structure of plant

cell walls: III. A model of the walls of suspension-cultured sycamore cells based on the

interconnections of the macromolecular components. Plant physiology 1973, 51(1),

188-197.

57. Zhao, Z., Crespi, V. H., Kubicki, J. D., Cosgrove, D. J., & Zhong, L., Molecular

dynamics simulation study of xyloglucan adsorption on cellulose surfaces: effects of

surface hydrophobicity and side-chain variation. Cellulose 2014, 21(2), 1025-1039.

58. Doblin, M. S., Pettolino, F., & Bacic, A., Plant cell walls: the skeleton of the plant

world. Functional Plant Biology 2010, 37(5), 357-381.

59. Atmodjo, M. A., Hao, Z., & Mohnen, D., Evolving views of pectin biosynthesis.

Annual review of plant biology 2013, 64.

60. Grant, G. T., Morris, E. R., Rees, D. A., Smith, P. J., & Thom, D., Biological

interactions between polysaccharides and divalent cations: the egg‐box model. FEBS

letters 1973, 32(1), 195-8.

61. Ezaki, N., Kido, N., Takahashi, K., & Katou, K., The role of wall Ca2+ in the regulation

of wall extensibility during the acid-induced extension of soybean hypocotyl cell walls.

Plant and cell physiology 2005, 46(11), 1831-38.

62. Baron-Epel, O., Gharyal, P. K., & Schindler, M., Pectins as mediators of wall porosity

in soybean cells. Planta 1988, 175(3), 389-95. 148

63. Derbyshire, P., McCann, M. C., & Roberts, K., Restricted cell elongation in

Arabidopsis hypocotyls is associated with a reduced average pectin esterification level.

BMC Plant Biology 2007, 7(1), 31.

64. Held, M. A., Be, E., Zemelis, S., Withers, S., Wilkerson, C., & Brandizzi, F., CGR3: a

Golgi-localized protein influencing homogalacturonan methylesterification. Molecular

plant 2011, 4(5), 832-844.

65. Jarvis, M. C., The proportion of calcium-bound pectin in plant cell walls. Planta 1982,

154(4), 344-346.

66. Kohn, R., Markovič, O., & Machová, E., Deesterification mode of pectin by pectin

esterases of Aspergillus foetidus, tomatoes and alfalfa. Collection of Czechoslovak

Chemical Communications 1983, 48(3), 790-797.

67. Liners, F., Thibault, J. F., & Van Cutsem, P., Influence of the degree of polymerization

of oligogalacturonates and of esterification pattern of pectin on their recognition by

monoclonal antibodies. Plant physiology 1992, 99(3), 1099-1104.

68. Catoire, L., Pierron, M., Morvan, C., du Penhoat, C. H., & Goldberg, R., Investigation

of the action patterns of pectinmethylesterase isoforms through kinetic analyses and

NMR spectroscopy IMPLICATIONS IN CELL WALL EXPANSION. Journal of

Biological Chemistry 1998, 273(50), 33150-6.

69. Daher, F. B., & Braybrook, S. A., How to let go: pectin and plant cell adhesion.

Frontiers in plant science 2015, 6, 523. 149

70. Burke, D., Kaufman, P., McNeil, M., & Albersheim, P., The structure of plant cell

walls: VI. A survey of the walls of suspension-cultured monocots. Plant physiology

1974, 54(1), 109-115.

71. Showalter, A. M., Structure and function of plant cell wall proteins. The Plant Cell

1993, 5(1), 9.

72. Lamport, D. T., Oxygen fixation into hydroxyproline of plant cell wall protein. Journal

of Biological Chemistry 1963, 238(4), 1438-1440.

73. Chen, J., & Varner, J. E., An extracellular matrix protein in plants: characterization of

a genomic clone for carrot extensin. The EMBO journal 1985, 4(9), 2145-2151.

74. Kieliszewski, M., & Lamport, D. T., Purification and partial characterization of a

hydroxyproline-rich glycoprotein in a graminaceous monocot, Zea mays. Plant

physiology 1987, 85(3), 823-827.

75. Showalter, A. M., & Rumeau, D. (1990). Molecular biology of plant cell wall

hydroxyproline-rich glycoproteins (Vol. 247). New York: Academic Press.

76. Kieliszewski, M. J., & Lamport, D. T., Extensin: repetitive motifs, functional sites,

post‐translational codes, and phylogeny. The Plant Journal 1994, 5(2), 157-172.

77. Hieta, R., & Myllyharju, J., Cloning and characterization of a low molecular weight

prolyl 4-hydroxylase from Arabidopsis thaliana effective hydroxylation of proline-rich,

collagen-like, and hypoxia-inducible transcription factor α-like peptides. Journal of

Biological Chemistry 2002, 277(26), 23965-71. 150

78. Tiainen, P., Myllyharju, J., & Koivunen, P., Characterization of a second Arabidopsis

thaliana prolyl 4-hydroxylase with distinct substrate specificity. Journal of Biological

Chemistry 2005, 280(2), 1142-48.

79. Hijazi, M., Velasquez, S. M., Jamet, E., Estevez, J. M., & Albenne, C., An update on

post-translational modifications of hydroxyproline-rich glycoproteins: toward a model

highlighting their contribution to plant cell wall architecture. Frontiers in plant science

2014, 5, 395.

80. Shpak, E., Leykam, J. F., & Kieliszewski, M. J., Synthetic genes for glycoprotein

design and the elucidation of hydroxyproline-O-glycosylation codes. Proceedings of

the National Academy of Sciences 1999, 96(26), 14736-41.

81. Shpak, E., Barbar, E., Leykam, J. F., & Kieliszewski, M. J. Contiguous hydroxyproline

residues direct hydroxyproline arabinosylation in Nicotiana tabacum. Journal of

Biological Chemistry 2001, 276(14), 11272-78.

82. Tan, L., Qiu, F., Lamport, D. T., & Kieliszewski, M. J., Structure of a hydroxyproline

(Hyp)-arabinogalactan polysaccharide from repetitive Ala-Hyp expressed in transgenic

Nicotiana tabacum. Journal of Biological Chemistry 2004, 279(13), 13156-65.

83. Showalter, A. M., Keppler, B., Lichtenberg, J., Gu, D., & Welch, L. R., A

bioinformatics approach to the identification, classification, and analysis of

hydroxyproline-rich glycoproteins. Plant physiology 2010, 153(2), 485-513.

84. Ma, H., & Zhao, J., Genome-wide identification, classification, and expression analysis

of the arabinogalactan protein gene family in rice (Oryza sativa L.). Journal of

experimental botany 2010, 61(10), 2647-68. 151

85. Pennell, R. I., & Roberts, K., Sexual development in the pea is presaged by altered

expression of arabinogalactan protein. Nature 1990, 344(6266), 547-49.

86. Pennell, R. I., Janniche, L., Kjellbom, P., Scofield, G. N., Peart, J. M., & Roberts, K.,

Developmental regulation of a plasma membrane arabinogalactan protein epitope in

oilseed rape flowers. The Plant Cell 1991, 3(12), 1317-26.

87. Gao, M., & Showalter, A. M. Immunolocalization of LeAGP-1, a modular

arabinogalactan-protein, reveals its developmentally regulated expression in tomato.

Planta 2000, 210(6), 865-74.

88. Fragkostefanakis, S., Dandachi, F., & Kalaitzis, P., Expression of arabinogalactan

proteins during tomato fruit ripening and in response to mechanical wounding, hypoxia

and anoxia. Plant Physiology and Biochemistry 2012, 52, 112-8.

89. Li, S. X., & Showalter, A. M., Cloning and developmental/stress-regulated expression

of a gene encoding a tomato arabinogalactan protein. Plant molecular biology 1996,

32(4), 641-52.

90. Lamport, D. T., & Várnai, P., Periplasmic arabinogalactan glycoproteins act as a

calcium capacitor that regulates plant growth and development. New Phytologist 2013,

197(1), 58-64.

91. Showalter, A. M., & Basu, D., Extensin and arabinogalactan-protein biosynthesis:

glycosyltransferases, research challenges, and biosensors. Frontiers in plant science

2016, 7, 814.

92. Basu, D., Liang, Y., Liu, X., Himmeldirk, K., Faik, A., Kieliszewski, M., ... &

Showalter, A. M., Functional identification of a hydroxyproline-O- 152

galactosyltransferase specific for arabinogalactan protein biosynthesis in Arabidopsis.

Journal of Biological Chemistry 2013, 288(14), 10132-43.

93. Basu, D., Tian, L., Wang, W., Bobbs, S., Herock, H., Travers, A., & Showalter, A. M.,

A small multigene hydroxyproline-O-galactosyltransferase family functions in

arabinogalactan-protein glycosylation, growth and development in Arabidopsis. BMC

plant biology 2015, 15(1), 295.

94. Basu, D., Wang, W., Ma, S., DeBrosse, T., Poirier, E., Emch, K., ... & Showalter, A.

M., Two hydroxyproline galactosyltransferases, GALT5 and GALT2, function in

arabinogalactan-protein glycosylation, growth and development in Arabidopsis. PLoS

One 2015, 10(5).

95. Ogawa‐Ohnishi, M., & Matsubayashi, Y., Identification of three potent hydroxyproline

O‐galactosyltransferases in Arabidopsis. The Plant Journal 2015, 81(5), 736-746.

96. Liu, X., Wolfe, R., Welch, L. R., Domozych, D. S., Popper, Z. A., & Showalter, A. M.,

Bioinformatic identification and analysis of extensins in the plant kingdom. PloS one

2016, 11(2).

97. Cannon, M. C., Terneus, K., Hall, Q., Tan, L., Wang, Y., Wegenhart, B. L., ... &

Kieliszewski, M. J., Self-assembly of the plant cell wall requires an extensin scaffold.

Proceedings of the National Academy of Sciences 2008, 105(6), 2226-31.

98. Merkouropoulos, G., & Shirsat, A. H., The unusual Arabidopsis extensin gene atExt1

is expressed throughout plant development and is induced by a variety of biotic and

abiotic stresses. Planta 2003, 217(3), 356-66. 153

99. Marzol, E., Borassi, C., Bringas, M., Sede, A., Garcia, D. R. R., Capece, L., & Estevez,

J. M., Filling the gaps to solve the extensin puzzle. 2018. Molecular plant, 11(5), 645-

58.

100. Chen, J., & Varner, J. E., Isolation and characterization of cDNA clones for carrot

extensin and a proline-rich 33-kDa protein. Proceedings of the National Academy of

Sciences 1985, 82(13), 4399-403.

101. Zhou, J., Rumeau, D., & Showalter, A. M., Isolation and characterization of two

wound-regulated tomato extensin genes. Plant molecular biology 1992, 20(1), 5-17.

102. Showalter, A. M., Butt, A. D., & Kim, S., Molecular details of tomato extensin and

glycine-rich protein gene expression. Plant molecular biology 1992, 19(2), 205-15.

103. Niebel, A., Engler, J. D. A., Tire, C., Engler, G., Van Montagu, M., & Gheysen,

G., Induction patterns of an extensin gene in tobacco upon nematode infection. The

Plant Cell 1993, 5(12), 1697-710.

104. Shirsat, A. H., Bell, A., Spence, J., & Harris, J. N., The Brassica napus extA

extensin gene is expressed in regions of the plant subject to tensile stresses. Planta

1996, 199(4), 618-24.

105. Wei, G. U. O., & Shirsat, A. H., Extensin over‐expression in Arabidopsis limits

pathogen invasiveness. Molecular Plant Pathology 2006, 7(6), 579-92.

106. Balaji, V., & Smart, C. D., Over-expression of snakin-2 and extensin-like protein

genes restricts pathogen invasiveness and enhances tolerance to Clavibacter

michiganensis subsp. michiganensis in transgenic tomato (Solanum lycopersicum).

Transgenic research 2012, 21(1), 23-37. 154

107. Portieles, R., Canales, E., Hernández, I., López, Y., Rodríguez, M., Rodríguez, M.,

... & Zhu, D. NmEXT Extensin Gene: a Positive Regulator of Resistance Response

Against the Oomycete Phytophthora nicotianae. Plant Molecular Biology Reporter

2018, 36(3), 484-90.

108. Tiré, C., De Rycke, R., De Loose, M., Inzé, D., Van Montagu, M., & Engler, G.,

Extensin gene expression is induced by mechanical stimuli leading to local cell wall

strengthening in Nicotiana plumbaginifolia. Planta 1994, 195(2), 175-81.

109. van Holst, G. J., & Varner, J. E., Reinforced polyproline II conformation in a

hydroxyproline-rich cell wall glycoprotein from carrot root. Plant Physiology 1984,

74(2), 247-51.

110. Velasquez, S. M., Marzol, E., Borassi, C., Pol-Fachin, L., Ricardi, M. M.,

Mangano, S., ... & Knox, J. P., Low sugar is not always good: impact of specific O-

glycan defects on tip growth in Arabidopsis. Plant physiology 2015, 168(3), 808-13.

111. Lamport, D. T., & Clark, L., Isolation and partial characterization of

hydroxyproline-rich glycopeptides obtained by enzymic degradation of primary cell

walls. Biochemistry 1969, 8(3), 1155-63.

112. Velasquez, S. M., Salgado Salter, J., Petersen, B. L., & Estevez, J. M., Recent

advances on the posttranslational modifications of EXTs and their roles in plant cell

walls. Frontiers in plant science 2012, 3, 93.

113. Smith, J. J., Muldoon, E. P., & Lamport, D. T., Isolation of extensin precursors by

direct elution of intact tomato cell suspension cultures. Phytochemistry 1984, 23(6),

1233-39. 155

114. Smith, J. J., Muldoon, E. P., Willard, J. J., & Lamport, D. T., Tomato extensin

precursors P1 and P2 are highly periodic structures. Phytochemistry 1986, 25(5), 1021-

30.

115. Stafstrom, J. P., & Staehelin, L. A., The role of carbohydrate in maintaining

extensin in an extended conformation. Plant physiology 1986, 81(1), 242-6.

116. Lamport, D. T., & Northcote, D. H., Hydroxyproline in primary cell walls of higher

plants. Nature 1960, 188(4751), 665-6.

117. Varner, J. E., Song, Y. R., Lin, L. S., & Yuen, H., The role of wall proteins in the

structure and function of plant cell walls. In UCLA symposia on molecular and cellular

biology (USA) 1989.

118. Lamport, D. T., Kieliszewski, M. J., Chen, Y., & Cannon, M. C., Role of the

extensin superfamily in primary cell wall architecture. Plant physiology 2011, 156(1),

11-19.

119. Slusarenko, A. J., Fraser, R. S., & van Loon, L. C. (Eds.). (2012). Mechanisms of

resistance to plant diseases. Springer Science & Business Media. pp.248

120. Saito, F., Suyama, A., Oka, T., Yoko-o, T., Matsuoka, K., Jigami, Y., & Shimma,

Y. I., Identification of novel peptidyl serine α-galactosyltransferase gene family in

plants. Journal of Biological Chemistry 2014, 289(30), 20405-420.

121. Ogawa-Ohnishi, M., Matsushita, W., & Matsubayashi, Y. Identification of three

hydroxyproline O-arabinosyltransferases in Arabidopsis thaliana. Nature Chemical

Biology 2013, 9(11), 726. 156

122. Gille, S., Hänsel, U., Ziemann, M., & Pauly, M., Identification of plant cell wall

mutants by means of a forward chemical genetic approach using hydrolases.

Proceedings of the National Academy of Sciences 2009, 106(34), 14699-704.

123. Møller, S. R., Yi, X., Velásquez, S. M., Gille, S., Hansen, P. L. M., Poulsen, C. P.,

... & Wandall, H. H., Identification and evolution of a plant cell wall specific

glycoprotein glycosyl transferase, ExAD. Scientific reports 2017, 7(1), 1-16.

124. Brady, J. D., Sadler, I. H., & Fry, S. C., Di-isodityrosine, a novel tetrametric

derivative of tyrosine in plant cell wall proteins: a new potential cross-link.

Biochemical Journal 1996, 315(1), 323-27.

125. Brady, J. D., & Fry, S. C., Formation of di-isodityrosine and loss of isodityrosine

in the cell walls of tomato cell-suspension cultures treated with fungal elicitors or

H2O2. Plant Physiology. 1997, 115(1), 87-92.

126. Brady, J. D., Sadler, I. H., & Fry, S. C., Pulcherosine, an oxidatively coupled trimer

of tyrosine in plant cell walls: its role in cross-link formation. Phytochemistry 1998,

47(3), 349-53.

127. Held, M. A., Tan, L., Kamyab, A., Hare, M., Shpak, E., & Kieliszewski, M. J., Di-

isodityrosine is the intermolecular cross-link of isodityrosine-rich extensin analogs

cross-linked in vitro. Journal of Biological Chemistry 2004, 279(53), 55474-82.

128. Epstein, L., & Lamport, D. T., An intramolecular linkage involving isodityrosine

in extensin. Phytochemistry 1984, 23(6), 1241-46. 157

129. Kieliszewski, M., & Lamport, D. T., Purification and partial characterization of a

hydroxyproline-rich glycoprotein in a graminaceous monocot, Zea mays. Plant

physiology 1987, 85(3), 823-27.

130. Domingo, C., Gomez, M. D., Cañas, L., Hernández-Yago, J., Conejero, V., & Vera,

P., A novel extracellular matrix protein from tomato associated with lignified

secondary cell walls. The Plant Cell 1994, 6(8), 1035-47.

131. Vera, P., Lamb, C., & Doerner, P. W., Cell‐cycle regulation of hydroxyproline‐rich

glycoprotein HRGPnt3 gene expression during the initiation of lateral root meristems.

The Plant Journal 1994, 6(5), 717-727.

132. Everdeen, D. S., Kiefer, S., Willard, J. J., Muldoon, E. P., Dey, P. M., Li, X. B., &

Lamport, D. T., Enzymic cross-linkage of monomeric extensin precursors in vitro.

Plant Physiology 1988, 87(3), 616-21.

133. Schnabelrauch, L. S., Kieliszewski, M., Upham, B. L., Alizedeh, H., & Lamport,

D. T., Isolation of pl 4.6 extensin peroxidase from tomato cell suspension cultures and

identification of Val—Tyr—Lys as putative intermolecular cross‐link site. The Plant

Journal 1996, 9(4), 477-89.

134. Dong, W., Kieliszewski, M., & Held, M. A., Identification of the pI 4.6 extensin

peroxidase from Lycopersicon esculentum using proteomics and reverse-genomics.

Phytochemistry 2015, 112, 151-59.

135. Brisson, L. F., Tenhaken, R., & Lamb, C., Function of oxidative cross-linking of

cell wall structural proteins in plant disease resistance. The Plant Cell 1994, 6(12),

1703-12. 158

136. Rumeau, D., Maher, E. A., Kelman, A., & Showalter, A. M., Extensin and

phenylalanine ammonia-lyase gene expression altered in potato tubers in response to

wounding, hypoxia, and Erwinia carotovora infection. Plant Physiology 1990, 93(3),

1134-39.

137. Merkouropoulos, G., Barnett, D. C., & Shirsat, A. H., The Arabidopsis extensin

gene is developmentally regulated, is induced by wounding, methyl jasmonate, abscisic

and salicylic acid, and codes for a protein with unusual motifs. Planta 1999, 208(2),

212-9.

138. Alfano, G., Ivey, M. L., Cakir, C., Bos, J. I. B., Miller, S. A., Madden, L. V., ... &

Hoitink, H. A. J., Systemic modulation of gene expression in tomato by Trichoderma

hamatum 382. Phytopathology 2007, 97(4), 429-37.

139. Passardi, F., Penel, C., & Dunand, C., Performing the paradoxical: how plant

peroxidases modify the cell wall. Trends in plant science 2004, 9(11), 534-40.

140. Hiraga, S., Sasaki, K., Ito, H., Ohashi, Y., & Matsui, H., A large family of class III

plant peroxidases. Plant and Cell Physiology 2001, 42(5), 462-68.

141. Cosio, C., & Dunand, C., Specific functions of individual class III peroxidase

genes. Journal of experimental botany 2009, 60(2), 391-408.

142. Lagrimini, L. M., Joly, R. J., Dunlap, J. R., & Liu, T. T. Y., The consequence of

peroxidase overexpression in transgenic plants on root growth and development. Plant

molecular biology 1997, 33(5), 887-95.

143. Espelie, K. E., Franceschi, V. R., & Kolattukudy, P. E., Immunocytochemical

localization and time course of appearance of an anionic peroxidase associated with 159

suberization in wound-healing potato tuber tissue. Plant Physiology 1986, 81(2), 487-

92.

144. Amaya, I., Botella, M. A., de la Calle, M., Medina, M. I., Heredia, A., Bressan, R.

A., ... & Valpuesta, V., Improved germination under osmotic stress of tobacco plants

overexpressing a cell wall peroxidase. Febs Letters 1999, 457(1), 80-4.

145. Passardi, F., Cosio, C., Penel, C., & Dunand, C., Peroxidases have more functions

than a Swiss army knife. Plant cell reports 2005, 24(5), 255-65.

146. Brownleader, M. D., Ahmed, N., Trevan, M., Chaplin, M. F., & Dey, P. M.l.,

Purification and partial characterization of tomato extensin peroxidase. Plant

physiology 1995, 109(3), 1115-23.

147. Jackson, P., Paulo, S., Ricardo, C. P. P., Brownleader, M., & Freire, P. O., An

extensin peroxidase is associated with white-light inhibition of lupin (Lupinus albus)

hypocotyl growth. Functional Plant Biology 1999, 26(1), 29-36.

148. Price, N. J., Pinheiro, C., Soares, C. M., Ashford, D. A., Ricardo, C. P., & Jackson,

P. A., A biochemical and molecular characterization of LEP1, an extensin peroxidase

from lupin. Journal of Biological Chemistry 2003, 278(42), 41389-399.

149. Jackson, P. A., Galinha, C. I., Pereira, C. S., Fortunato, A., Soares, N. C., Amâncio,

S. B., & Ricardo, C. P. P., Rapid deposition of extensin during the elicitation of

grapevine callus cultures is specifically catalyzed by a 40-kilodalton peroxidase. Plant

physiology 2001, 127(3), 1065-76.

150. Ribeiro, J. M., Pereira, C. S., Soares, N. C., Vieira, A. M., Feijó, J. A., & Jackson,

P. A., The contribution of extensin network formation to rapid, hydrogen peroxide- 160

mediated increases in grapevine callus wall resistance to fungal lytic enzymes. Journal

of experimental botany 2006, 57(9), 2025-35.

151. Ye, D. Extensins, Extensin Peroxidases and the Crosslink Behavior. Doctoral

dissertation, Ohio University, 2014.

152. Raggi, S., Ferrarini, A., Delledonne, M., Dunand, C., Ranocha, P., De Lorenzo, G.,

... & Ferrari, S., The Arabidopsis class III peroxidase AtPRX71 negatively regulates

growth under physiological conditions and in response to cell wall damage. Plant

physiology 2015, 169(4), 2513-25.

153. Jacobowitz, J. R., Doyle, W. C., & Weng, J. K., PRX9 and PRX40 are extensin

peroxidases essential for maintaining tapetum and microspore cell wall integrity during

Arabidopsis anther development. The Plant Cell 2019, 31(4), 848-61.

154. Francoz, E., Ranocha, P., Nguyen-Kim, H., Jamet, E., Burlat, V., & Dunand, C.,

Roles of cell wall peroxidases in plant development. Phytochemistry 2015, 112, 15-21.

155. Tomato Genome Consortium. The tomato genome sequence provides insights into

fleshy fruit evolution. Nature 2012, 485(7400), 635.

156. Teilum, K.; Ostergaard, L.; Welinder, K. G., Disulfide bond formation and folding

of plant peroxidases expressed as inclusion body protein in Escherichia coli thioredoxin

reductase negative strains. Protein expression and purification 1999, 15 (1), 77-82.

157. McCormick, S., Transformation of tomato with Agrobacterium tumefaciens.Plant

tissue culture manual 1991 (pp. 311-319). Springer, Dordrecht. 161

158. Hajdukiewicz, P., Svab, Z., & Maliga, P., The small, versatile pPZP family of

Agrobacterium binary vectors for plant transformation. Plant molecular biology 1994,

25(6), 989-994.

159. Hanahan, D., Studies on transformation of Escherichia coli with plasmids. Journal

of molecular biology 1983, 166(4), 557-80.

160. Yang Lei, Li Lu, Hai-Yang Liu, Sen L, Feng Xing, Ling-Ling Chen*, CRISPR-P:

A web tool for synthetic single-guide RNA design of CRISPR-system in plants. Mol

Plant 2014, 7(9), 1494-96.

161. Yuduan Ding, Hong Li, Ling-Ling Chen*, Kabin Xie*, Recent advances in genome

editing using CRISPR/Cas9. Front Plant Sci. 2016, 7, 703.

162. Hao Liu, Yuduan Ding, Yanqing Zhou, Wenqi Jin, Kabin Xie*, Ling-Ling Chen*,

CRISPR-P 2.0: an improved CRISPR/Cas9 tool for genome editing in plants. Mol Plant

2017, 10(3), 530-32.

163. Haeussler, M., Schönig, K., Eckert, H., Eschstruth, A., Mianné, J., Renaud, J. B.,

... & Joly, J. S., Evaluation of off-target and on-target scoring algorithms and

integration into the guide RNA selection tool CRISPOR, Genome biology 2016, 17(1),

148.

164. Xie, K., Minkenberg, B., & Yang, Y., Boosting CRISPR/Cas9 multiplex editing

capability with the endogenous tRNA-processing system. Proceedings of the National

Academy of Sciences 2015, 112(11), 3570-75.

165. An, G., Ebert, P. R., Mitra, A., & Ha, S. B. (1989). Binary vectors. In Plant

molecular biology manual (pp. 29-47). Springer, Dordrecht. 162

166. Zheng, H., Camacho, L., Wee, E., Batoko, H., Legen, J., Leaver, C. J., ... & Moore,

I., A Rab-E GTPase mutant acts downstream of the Rab-D subclass in biosynthetic

membrane traffic to the plasma membrane in tobacco leaf epidermis. The Plant Cell

2005, 17(7), 2020-36.

167. Chomczynski, P., A reagent for the single-step simultaneous isolation of RNA,

DNA and proteins from cell and tissue samples. Biotechniques 1993, 15(3), 532-4.

168. Bar-Or, C., Kapulnik, Y., & Koltai, H., A broad characterization of the

transcriptional profile of the compatible tomato response to the plant parasitic root knot

nematode Meloidogyne javanica. European Journal of Plant Pathology 2005, 111(2),

181.

169. Pfaffl, M. W., A new mathematical model for relative quantification in real-time

RT–PCR. Nucleic acids research 2001, 29(9), e45-e45.

170. Gallagher, S. R. (Ed.). (2012). GUS protocols: using the GUS gene as a reporter

of gene expression. Academic Press.

171. Cavalier, D. M., Lerouxel, O., Neumetzler, L., Yamauchi, K., Reinecke, A.,

Freshour, G., ... & Raikhel, N. V., Disrupting two Arabidopsis thaliana

xylosyltransferase genes results in plants deficient in xyloglucan, a major primary cell

wall component. The Plant Cell 2008, 20(6), 1519-37.

172. Krogh, A., Larsson, B., Von Heijne, G., & Sonnhammer, E. L., Predicting

transmembrane protein topology with a hidden Markov model: application to complete

genomes. Journal of molecular biology 2001, 305(3), 567-80. 163

173. Hunt, S. E., McLaren, W., Gil, L., Thormann, A., Schuilenburg, H., Sheppard, D.,

... & Cunningham, F. (2018). Ensembl variation resources. Database, 2018.

174. Berardini, T. Z., Reiser, L., Li, D., Mezheritsky, Y., Muller, R., Strait, E., & Huala,

E., The Arabidopsis information resource: making and mining the “gold standard”

annotated reference plant genome. Genesis 2015, 53(8), 474-85.

175. Kim S, Chen J, Cheng T, Gindulyte A, He J, He S, Li Q, Shoemaker BA, Thiessen

PA, Yu B, Zaslavsky L, Zhang J, Bolton EE. PubChem 2019 update: improved access

to chemical data. Nucleic Acids Res. 2019 Jan 8; 47(D1):D1102-1109.

doi:10.1093/nar/gky1033

176. Nelson BK, Cai X, Nebenfuhr A., A multicolored set of in vivo organelle markers

for co-localization studies in Arabidopsis and other plants. Plant J 2007, 51, 1126–113

177. Dong, W. Extensin Peroxidase Identification and Characterization in Solanum

lycopersicum. Doctoral dissertation, Ohio University, 2015.

178. Nair, A. R., & Showalter, A. M., Purification and characterization of a wound-

inducible cell wall cationic peroxidase from carrot roots. Biochemical and biophysical

research communications 1996, 226(1), 254-60.

179. Mika, A., Boenisch, M. J., Hopff, D., & Lüthje, S., Membrane-bound guaiacol

peroxidases from maize (Zea mays L.) roots are regulated by methyl jasmonate,

salicylic acid, and pathogen elicitors. Journal of experimental botany 2010, 61(3), 831-

41.

180. Roach, T., Colville, L., Beckett, R. P., Minibayeva, F. V., Havaux, M., & Kranner,

I., A proposed interplay between peroxidase, amine oxidase and lipoxygenase in the 164

wounding-induced oxidative burst in Pisum sativum seedlings. Phytochemistry 2015,

112, 130-8.

181. Minibayeva, F., Beckett, R. P., & Kranner, I., Roles of apoplastic peroxidases in

plant response to wounding. Phytochemistry 2015, 112, 122-9.

182. Antão, C. M., & Malcata, F. X., Plant serine proteases: biochemical, physiological

and molecular features. Plant Physiology and Biochemistry 2005, 43(7), 637-50.

183. Tornero, P., Mayda, E., Gómez, M. D., Cañas, L., Conejero, V., & Vera, P.,

Characterization of LRP, a leucine‐rich repeat (LRR) protein from tomato plants that

is processed during pathogenesis. The Plant Journal 1996, 10(2), 315-30.

184. Dixon, M. S., Golstein, C., Thomas, C. M., Van der Biezen, E. A., & Jones, J. D.,

Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato

gene required specifically by Cf-2. Proceedings of the National Academy of Sciences

2000, 97(16), 8807-14.

185. Krüger, J., Thomas, C. M., Golstein, C., Dixon, M. S., Smoker, M., Tang, S., ... &

Jones, J. D., A tomato cysteine protease required for Cf-2-dependent disease resistance

and suppression of autonecrosis. Science 2002, 296(5568), 744-47.

186. Rojo, E., Sharma, V. K., Kovaleva, V., Raikhel, N. V., & Fletcher, J. C., CLV3 is

localized to the extracellular space, where it activates the Arabidopsis CLAVATA stem

cell signaling pathway. The Plant Cell 2002, 14(5), 969-77.

187. Kroumova, A. B., Sahoo, D. K., Raha, S., Goodin, M., Maiti, I. B., & Wagner, G.

J., Expression of an apoplast-directed, T-phylloplanin-GFP fusion gene confers 165

resistance against Peronospora tabacina disease in a susceptible tobacco. Plant cell

reports 2013, 32(11), 1771-82.

188. Guerra, D., Crosatti, C., Khoshro, H. H., Mastrangelo, A. M., Mica, E., &

Mazzucotelli, E., Post-transcriptional and post-translational regulations of drought and

heat response in plants: a spider’s web of mechanisms. Frontiers in plant science 2015,

6, 57.

189. Merchante, C., Stepanova, A. N., & Alonso, J. M., Translation regulation in plants:

an interesting past, an exciting present and a promising future. The Plant Journal 2017,

90(4), 628-53.

190. Lucena, M. A., Romero‐Aranda, R., Mercado, J. A., Cuartero, J., Valpuesta, V., &

Quesada, M. A., Structural and physiological changes in the roots of tomato plants

over‐expressing a basic peroxidase. Physiologia Plantarum 2003, 118(3), 422-29.

191. Dong, F., Xie, K., Chen, Y., Yang, Y., & Mao, Y., Polycistronic tRNA and CRISPR

guide-RNA enables highly efficient multiplexed genome engineering in human cells.

Biochemical and biophysical research communications 2017, 482(4), 889-95.

192. D’Ambrosio, C., Stigliani, A. L., & Giorio, G., CRISPR/Cas9 editing of carotenoid

genes in tomato. Transgenic research 2018, 27(4), 367-78.

193. Li, T., Yang, X., Yu, Y., Si, X., Zhai, X., Zhang, H., ... & Xu, C., Domestication of

wild tomato is accelerated by genome editing. Nature biotechnology 2018, 36(12),

1160-63. 166

194. Roberts, K., & Shirsat, A. H., Increased extensin levels in Arabidopsis affect

inflorescence stem thickening and height. Journal of experimental botany 2006, 57(3),

537-45.

195. Brownleader, M. D., Hopkins, J., Mobasheri, A., Dey, P. M., Jackson, P., & Trevan,

M., Role of extensin peroxidase in tomato (Lycopersicon esculentum Mill.) seedling

growth. Planta 2000, 210(4), 668-76.

196. Clark, E. D. B., Protein refolding for industrial processes. Current opinion in

biotechnology 2001, 12(2), 202-7.

197. Jashni, M. K., Mehrabi, R., Collemare, J., Mesarich, C. H., & De Wit, P. J., The

battle in the apoplast: further insights into the roles of proteases and their inhibitors in

plant–pathogen interactions. Frontiers in plant science 2015, 6, 584.

198. Figueiredo, A., Monteiro, F., & Sebastiana, M., Subtilisin-like proteases in plant–

pathogen recognition and immune priming: a perspective. Frontiers in plant science

2014, 5, 739.

167

APPENDIX A

Figure S1. Transmembrane domain prediction from TMHMM. Predictions of three proteins previously cloned and studied, scored along their length for the probability of a transmembrane helix.172,177 TomEP and SlCG3 show predicted domains while SlCG8 does not.

168

APPENDIX B

Figure S2. Annotated sequence of TomEP-mGFP5 overexpression construct. The sequence of the overexpression fusion protein used in this work, including key labeled components. A dual CaMV35S promoter sequence in the pSAT6 drives the expression of the construct that is ligated into the vector using the labeled multi-cloning site. Highlighted in yellow are the sites where restriction enzymes were used to ligate the insert into the construct. No untranslated region of sequence was included in the construction of the fusion protein, beginning with the start codon of TomEP (highlighted in cyan). Beginning with the EcoRI restriction site, the mGFP5 sequence begins, which was already present in the pSAT6 vector. The mGFP5 ORF ends with the stop codon printed in red type, immediately preceding the XbaI restriction site and CaMV35S terminator sequence. A bracket 60 base pairs into the mGFP5 ORF denotes the extent of Sanger sequence 169 verification of this construct, while sequencing on the 5’ end extended an additional 229 base pairs beyond the HindIII restriction site. Sequencing was performed at Ohio University Genomics Facility.

Figure S3. Annotated sequence of 1.0 Kb PromoterTomEP-GUS construct. The sequence of the 1.0 Kb promoter-GUS construct with key portions labeled. The 1.0 Kb fragment was ligated on the 5’ end to the multi-cloning site of the pBI121 using the HindIII restriction site, highlighted in yellow. The 3’ end was ligated to the pBI121 vector using the XbaI site 24 base pairs upstream of the β-glucuronidase start codon, highlighted in cyan. A bracket five base pairs upstream of the HindIII restriction site denotes the beginning of the region verified by Sanger sequencing, which extends 97 base pairs downstream of the XbaI restriction site. Sequencing was performed at the Ohio University Genomics Facility.

170

Figure S4. Annotated sequence of 1.5 Kb PromoterTomEP-GUS construct. The sequence of the 1.5 Kb promoter-GUS construct with key portions labeled. The 1.5 Kb fragment was ligated on the 5’ end to the multi-cloning site of the pBI121 using the HindIII restriction site, highlighted in yellow. The 3’ end was ligated to the pBI121 vector using the XbaI site 24 base pairs upstream of the β-glucuronidase start codon, highlighted in cyan. A bracket four base pairs upstream of the HindIII restriction site denotes the beginning of the region verified by Sanger sequencing, which extends 129 base pairs downstream of the XbaI restriction site. Sequencing was performed at the Ohio University Genomics Facility. 171

Figure S5. Annotated sequence of PTG gene insert in pKSE401 vector. The insert sequence labeled with the different components necessary to make a PTG-CRISPR gene. Expression is driven by the Arabidopsis ubiquitin-6 promoter, meant for use in dicots. Highlighted yellow are the ligation sites of the PTG gene generated via Golden Gate assembly and subsequent PCR. Leading the PTG gene is the tRNA-Glycine genomic sequence, followed by the exon 1 target sequence and it’s gRNA scaffold. Immediately after the first gRNA scaffold, a second tRNA-Glycine sequence leads to the exon 3 target sequence, which was extended by a primer overhang to contain a BsaI site with the appropriate “GTTT” overhang for ligation into pKSE401. Exon 3 target sequence utilizes the gRNA scaffold sequence that was already part of the pKSE401 vector, which is immediately followed by the terminator sequence. The entire sequence shown was verified by Sanger sequencing at the OU Genomics Facility.

172

APPENDIX C

Figure S6. Diagram of TomEP overexpression construct used for in vivo crosslinking. The predicted signal sequence of TomEP was removed (23 amino acids) and the SStob signal sequence (meant to target TomEP for secretion in tobacco) ligated on the 5’ end, while the SP7 glycomodule was ligated to the 3’ end. The construct expression is driven by an enhanced Cauliflower Mosaic Virus 35S (enCaMV35S) promoter preceding the Tobacco Mosaic Virus 5’ leading sequence (Ω) and the terminator is the Nopaline Synthase terminator (TermNOS). Not shown are nptII hand hptII antibiotic resistance genes. Left and right border sequences (LB, RB) flank the T-DNA construct.

173

Figure S7. Diagram comparing rTomEP construct with genomic TomEP. (Top) The pET28A sequence of the multi-cloning site and surrounding region (adapted from [177]). Restrictions sites used are circled in black. (Middle) The recombinant construct of TomEP, including signal sequence, was cloned into the pET28A E. coli expression vector using the EcoRI and NotI restriction sites in the multi-cloning site to add a 6xHis tag to the C-terminus. Recombinant TomEP production is inducible by the lac operator, which then allows constitutive expression via the T7 promoter sequence and transcription is terminated by the T7 terminator. No untranslated region (UTR) was included in the recombinant gene. (Bottom) The genomic copy of TomEP for comparison with the recombinant version. Elements not included in the recombinant gene include the TomEP promoter region, 5’ and 3’ UTRs, and the TomEP terminator region.

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Thesis and Dissertation Services ! !