Extrathymic TCR Gene Rearrangement in Human Small

Extrathymic TCR Gene Rearrangement in Human Small Intestine: Identification of New Splice Forms of Recombination Activating Gene-1 mRNA with Selective Tissue This information is current as Expression of September 26, 2021. Anna Bas, Sten G. Hammarström and Marie-Louise K. C. Hammarström J Immunol 2003; 171:3359-3371; ; doi: 10.4049/jimmunol.171.7.3359 Downloaded from http://www.jimmunol.org/content/171/7/3359

References This article cites 46 articles, 15 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/171/7/3359.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Extrathymic TCR Gene Rearrangement in Human Small Intestine: Identiﬁcation of New Splice Forms of Recombination Activating Gene-1 mRNA with Selective Tissue Expression1

Anna Bas, Sten G. Hammarstro¬m, and Marie-Louise K. C. Hammarstro¬m2

Two new 5؅-untranslated region (5؅UTR) exons were identiﬁed in the human gene for the lymphocyte-speciﬁc endonuclease recombination activating gene-1 (RAG1) required for the somatic recombination yielding functional Ag receptors. These 5؅UTR exons were used in three different splice forms by jejunal lymphocytes of the T cell lineage. RAG1 mRNA containing the previously described 5؅UTR exon was not expressed in these cells. Conversely, one of the new 5؅UTR exons was not expressed in thymus. The new RAG1 mRNA splice forms were all expressed in immature T cells (CD2؉CD7؉CD3؊). This cell population also expressed high levels of mRNA for the pre-T ␣-chain. In situ hybridization demonstrated jejunal cells expressing the new splice forms of Downloaded from RAG1 mRNA, both intraepithelially and in lamina propria. Pre-T ␣-chain mRNA-expressing cells were detected at the same sites. These results strongly suggest ongoing TCR gene rearrangement in human small intestinal mucosa, yielding T cells specially adapted for this environment. This seems to be achieved by two parallel processes, extrathymic T cell development and peripheral Ag-driven TCR editing. The Journal of Immunology, 2003, 171: 3359Ð3371.

o develop a functional Ag receptor, the immature T lym- precursors suggests that the potential for ETCM exists in the in- http://www.jimmunol.org/ phocyte must rearrange its TCR genes by V(D)J-recom- testinal epithelium. In humans, the thymus regresses at puberty T bination (1, 2). Recombination activating gene (RAG)3 1 while T cell maturation seems to continue throughout life. Ongo- and RAG2 are responsible for the DNA cleavage during this pro- ing ETCM in the small intestinal mucosa of man was previously cess. RAG1 and RAG2 expression is a prerequisite for functional suggested by our observations of jejunal IEL with thymocyte-like Ag receptor genes, and they are exclusively expressed in lympho- phenotype and of RAG1 mRNA expression in IEL of the T cell cytes of both the T and B cell lineages. Another important protein lineage (10) and the demonstration of RAG1 and RAG2 mRNA in involved during V(D)J recombination in lymphocytes of the T cell RNA extracted from crude preparations of small intestinal epithe- lineage is the pre-T ␣-chain (pT␣), which associates with the ma- lium and LP (11).

ture TCR ␤-chain allowing rearrangement of the ␣-chain gene (3, To investigate whether human jejunal mucosa is indeed a site of by guest on September 26, 2021 4). T cell development mainly occurs in the thymus but can also ETCM, we analyzed expression patterns of RAG1 and pT␣ in take place outside this organ. In mice, small intestinal mucosa and jejunal IEL, and LP lymphocytes (LPL). Three new splice forms of liver are suggested sites for extrathymic T cell maturation (ETCM) RAG1 mRNA using two new 5Ј untranslated region (UTR) exons (5–7). Lymphocyte clusters located adjacent to the crypts in the were identified in jejunal IEL and LPL. RAG1 mRNA expression intestinal lamina propria (LP), so called cryptopatches, were was associated with immature T cells also expressing pT␣ mRNA. shown to be the sites for progenitor cells in ETCM yielding T cells that populate the intestinal epithelium (6, 8). Intraepithelial lym- Materials and Methods phocytes (IEL) expressing the stem cell marker CD34, receptors Tissue for the stem cell factor (c-kit/CD117), receptors for IL-7 (IL-7R/ Specimens from apparently normal duodenum/jejunum were obtained from CD127), CD122, CD16, and CD44 were identified in murine small seven male and six female patients (median age: 64 (37–76) years) under- intestine (9). This finding of IEL with the phenotype of pluripotent going bowel resection for cancer conditions, intestinal bleeding, ulcus, or strangi ileus. Duodenal/jejunal biopsies were collected from seven children as part of investigations of gastrointestinal symptoms, evaluation of asymp- tomatic growth-failure, or short stature. All had small intestinal mucosa Department of Clinical Microbiology, Division for Immunology, Umeå University, with normal histology. Thymus tissues were from a pediatric patient who Umeå, Sweden had to have part of the thymus removed during cardiac surgery for con- Received for publication March 11, 2003. Accepted for publication July 22, 2003. genital heart disease and from Clontech Laboratories (Palo Alto, CA). Bone marrow aspirates were collected from three men (age: 62–72 years) The costs of publication of this article were defrayed in part by the payment of page with colorectal carcinoma but with no disseminated tumor cells in the bone charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. marrow as determined by RT-PCR for carcinoembryonic Ag mRNA. One palatine tonsil was obtained from a child subjected to surgical treatment for 1 This work was supported by grants from the Swedish Research Council, Natural idiopathic tonsillar hypertrophy. Informed consent was obtained from the Sciences and Technical Sciences (B650-19981072), and the Medical Faculty of Umeå adult patients and from the parents of pediatric patients. University. 2 Address correspondence and reprint requests to Dr. Marie-Louise K. C. Ham- Antibodies marstro¨m, Department of Immunology, Umeå University, SE-90185 Umeå, Sweden. E-mail address: [email protected] mAbs used were: anti-CD1a mAb NA1/34, anti-CD2 mAb MT910, anti- CD3 mAb UCHT1, anti-CD7 mAb DK24, a mixture of anti-CD45 mAbs 3 ␣ Abbreviations used in this paper: RAG, recombination activating gene; pT , pre-T 2B11 and PD7/26, a mixture of anti-TdT mAbs HT-1/3/4, anti-epithelial ␣-chain; ETCM, extrathymic T cell maturation; LP, lamina propria; IEL, intraepithelial lymphocyte; LPL, LP lymphocyte; UTR, untranslated region; DIG, digoxige- cell Ag mAb BerEP4 (all from Dakopatts, Glostrup, Denmark), anti- nin; BMC, bone marrow mononuclear cell; MuLV, Moloney murine leukemia virus; CD117 mAb YB5.B8 (BD PharMingen, San Diego, CA), and anti-CD127 rTth, recombinant thermostable Thermus thermophilus; qRT-PCR, quantitative mAb R34.34 (Immunotech, Marseille, France). Polyclonal reagents were: RT-PCR. IgG fraction of two rabbit anti-RAG1 antisera (Santa Cruz Biotechnology,

Santa Cruz, CA and Scandinavian Diagnostic Services, Falkenberg, Sweden) RNA extracted from PBMC stimulated with anti-CD3 mAb. This definition and one rabbit anti-CD3 antiserum (Dakopatts), alkaline phosphatase-conju- of a unit was chosen because it corresponds approximately to the 18S gated rabbit anti-digoxigenin (DIG; Boehringer Mannheim, Basel, Switzer- rRNA content of 100 freshly isolated intestinal IEL and LPL (mean Ϯ 1 Ј Ϯ ϭ ϩ Ϯ land), HRP-conjugated F(ab )2 of sheep anti-mouse Ig (Amersham, Bucking- SD: 0.8 0.5 U/cell; n 14) and CD3 cells thereof (1.1 0.9 U/cell; hamshire, U.K.), FITC-conjugated goat anti-mouse Ig, FITC-conjugated swine n ϭ 15), i.e., on average 1.0 Ϯ 0.7 U/cell (n ϭ 29). All analyses included anti-rabbit Ig, and biotinylated goat anti-rabbit Ig (all from Dakopatts). in the study contained Ͼ125 18S rRNA units in each PCR. Paramagnetic beads used for cell isolation were Dynabeads M-450 coated with goat-anti-mouse IgG (Dynal, Oslo, Norway) and charged with Rapid amplification of the 5ЈcDNA end (5Ј-RACE) anti-CD3 mAb, anti-CD7 mAb, or BerEP4 and Dynabeads M-450 directly Total RNA was converted into first-strand cDNA using the 5Ј-RACE coated with anti-CD2 mAb (Dynal Biotech). cDNA synthesis primer (5Ј-CDS) (Clontech Laboratories), SMART II Isolation of leukocytes Oligo (Clontech Laboratories) and Superscript II MuLV reverse transcriptase (Life Technologies, Rockville, MD) according to the manual for sam- Intestinal IEL and LPL were isolated from surgical samples as previously ples containing Ͻ200 ng of RNA. The gene-specific primer was placed in described (12, 13). Subpopulations of IEL and LPL were retrieved by se- the RAG1 exon 2 (5Ј-GCT TTG CCT CTT GCT TTC TCG-3Ј). The touch- quential positive selection using paramagnetic beads charged with anti- down PCR was extended to 40 cycles. The 5Ј-RACE product was purified CD3 mAb followed by beads charged with a mixture of anti-CD2 and by electrophoresis in 1.2% agarose gel, cloned, and sequenced (see below). anti-CD7 mAbs (14). IEL and LPL were isolated from intestinal biopsies of children as described (15) and cells of the T cell lineage were retrieved Cloning and sequencing by positive selection using paramagnetic beads charged with a mixture of After gel electrophoresis, RT-PCR products and the product from 5Ј- anti-CD2 and anti-CD7 mAbs. The isolation procedure was performed at RACE were isolated using Qiaex II gel extraction kit (150; Qiagen, Hilden, 4°C and positively selected cells were frozen within 1 h after exposure to ϩ Germany) and ligated into EcoRV-digested pBluescript SK II prepared mAb. Microscopic inspection of all positively selected samples was per- with dT overhang. The ligated vectors were transformed into competent Downloaded from formed to ascertain that only cells with surface-bound beads were present. ϩ Escherichia coli XL-1 Blue. Recombinants were selected on Luria-Bertani Less than 4.6% of the unbound cells were CD3 after treatment with anti- agar plates containing 100 ␮g of ampicillin/ml, 12.5 ␮g of tetracycline/ml, CD3 mAb-charged magnetic beads as determined by immunoflow cytom- 40 ␮g of isopropyl ␤-D-thiogalactopyranoside/ml, and 20 ␮g of 5-bromo- etry. Calculations based on proportions of marker-positive cells and cel- 4-chloro-3-indolyl-␤-D-galactopyranoside/ml. DNA was prepared from re- lular yields showed that Ͼ98% of the marker-positive cells were bound to combinant clones using the Quantum prep plasmid miniprep kit (Bio-Rad, the relevant beads. Bone marrow cells (BMC) from bone marrow aspirates Hercules, CA). Sequencing of dsDNA was performed using the AutoRead and PBMC were isolated by Ficoll-Paque (Amersham Pharmacia, Uppsala, kit (Amersham Pharmacia) with Cy5-labeled T7 forward primer and re- Sweden) gradient centrifugation. http://www.jimmunol.org/ verse sequencing primer. The reactions were analyzed using the automated RNA preparation laser fluorescent sequencing system (Pharmacia). Total RNA was extracted by the acid guanidinium thiocyanate-phenol- Preparation of copy standard RNAs chloroform method as described (16). Cloned and sequenced PCR products were expanded. DNA was purified Qualitative RT-PCR from minicultures, the products were linearized, extracted from the agarose gel, and thereafter, in vitro-transcribed to RNA at 37°C for 2 h using the T7 RT-PCR analysis of different splice variants of RAG1 mRNA was per- in vitro transcription kit (Riboprobe System-T7; Promega). After DNase formed using Moloney murine leukemia virus (MuLV) reverse transcrip- treatment, the RNA was purified by the protocol included in the kit and the tase and random hexamers (Applied Biosystems, Foster City, CA) for re- number of RNA copies was calculated based on OD , molecular mass,

260 by guest on September 26, 2021 verse transcription. Specific primer pairs (see Table I) and recombinant and Avogadro’s number. thermostable Thermus thermophilus (rTth) DNA polymerase (Applied Bio- systems) was used in the PCR. RT-PCR for RAG2 mRNA was performed Immunoflow cytometry using DNase-treated RNA (10) and the protocol and primers of Lynch et al. Indirect single color staining of cell surface molecules was performed on (11). Absence of signals from contaminating DNA was ascertained by PCR live total IEL and LPL and unbound cells after treatment with magnetic in which RNA was used as template. RT-PCR for ␤-actin mRNA served as beads charged with anti-CD3 or anti-CD2 plus anti-CD7 mAbs as de- control for intact quality of the RNA (for primer sequences, see Ref. 16). scribed (10). Real-time quantitative RT-PCR (qRT-PCR) Metachromatic staining for mast cells Real-time qRT-PCR assays were constructed for different splice forms of For identification of mast cells, sections were stained with toluidine blue RAG1 and pT␣a mRNA. Primers and probes are listed in Table I. Primers according to the protocol of Luna (17) (18). Air-dried sections of frozen or probes hybridize over exon boundaries. Three different protocols were jejunal tissue were incubated with a mixture of 5 ml 1% (w/v) toluidine used: 1) one step: TaqManEZ technology using the 3Ј-primer for reverse blue in 70% ethanol and 45 ml 1% sodium chloride for 1.5–2 min at room transcription and the rTth DNA polymerase both for reverse transcription temperature. The sections were then rinsed in distilled water, quickly de- and in the PCR with specific primers and probe; 2) two steps: reverse hydrated in 95% and absolute ethanol and finally cleared in xylene and transcription using MultiScribe reverse transcriptase and random hexamers mounted. Mast cells stained red-purple and other cells stained blue. followed by a PCR with specific primers and probe together with Ampli- Taq Gold DNA polymerase; 3) nested: cDNA was synthesized using Immunohistochemistry MuLV reverse transcriptase and random hexamers for 30 min at 42°C followed by 5 min at 99°C. Thereafter the outer primers were used with Fresh tissue was snap-frozen in liquid nitrogen and stored at Ϫ80°C. Four rTth DNA polymerase in a PCR with 20 amplification cycles of 1 min at micrometer-thick cryostat sections were subjected to staining by immuno- 94°C, 1 min at 57°C, 2 min at 72°C, for RAG1, and 1 min at 94°C, 1 min fluorescence or immunoperoxidase techniques. RAG1 and CD1a-express- at 64°C, 2 min at 72°C, for pT␣a. In both cases, the reaction was initiated ing cells were stained by immunofluorescence performed as described (13), by 2 min at 94°C and terminated with 5 min at 72°C. Finally, 2–5 ␮lofthe with two modifications. The slides were acetylated by incubation in 1.4% 50-␮l reaction mixture were subjected to real-time qPCR using rTth DNA triethanolamide/0.18% HCl/0.25% acetic anhydride before addition of pri- polymerase. All assays showed linear correlation between log mRNA con- mary Abs. Primary Abs and conjugate were diluted in PBS supplemented centration and numbers of PCR cycles over a Ͼ5 log concentration range with 0.05% saponin. Two immunoperoxidase techniques were used. c-kit/ and the sensitivity varied between 10 and 250 RNA copies. None of the CD117-expressing cells were stained by indirect technique. Acetone fixed RT-PCR assays gave signals when nuclear DNA was used as a template. and air-dried sections were blocked for endogenous peroxidase activity by

Release of the reporter dye from the probe during PCR was monitored by incubation in PBS/3% H2O2/2 mM NaN3 at room temperature for 25 min an ABI PRISM 7700 Sequence Detector (Applied Biosystems). For each and sticky sites were blocked by incubation in PBS with 0.2% BSA. There- system, a specific RNA copy standard was prepared (see below). Samples after, the sections were incubated with mAb followed by peroxidase-con- Ј were analyzed in triplicates and expressed as copies of mRNA per micro- jugated F(ab )2 of sheep anti-mouse Ig. IL-7R/CD127 and TdT-expressing liter using the external copy standard. The concentration of 18S rRNA cells were stained using the enhanced ABC peroxidase technique according (Applied Biosystems) was determined in each sample and the results ex- to the manufacturer’s protocol (Dakopatts) and blocking of endogenous ␣a pressed as RAG1 or pT mRNA copies per 18S rRNA unit. One 18S peroxidase activity by incubation in PBS/0.03% H2O2/0.1 mM NaN3 at rRNA unit was defined as the signal obtained by 10 pg of a pool of total 37°C for 1 h. Immunoperoxidase-stained sections were developed using The Journal of Immunology 3361 the 3,3Ј-diaminobenzidine substrate kit (Vector Laboratories, Burlingame, Results CA) and counterstained with methyl green. Sections incubated with isotype New RAG1 mRNA 5ЈUTR exons are used in T cells from human and concentration matched irrelevant mAb or IgG fraction of normal rabbit serum (both Dakopatts) served as negative controls. jejunum To quantify RAG1 mRNA expression, a real-time qRT-PCR assay with RNA copy standard was constructed on the basis of the pub- Morphometry lished organization of the RAG1 gene (21). The 5Ј-primer was Morphometry analyses were performed on toluidine blue-, immunoperox- placed in the 5ЈUTR exon 1, the 3Ј-primer in exon 2, and the probe ϫ idase-, and immunofluorescence-stained tissue sections using a 40 ob- over the exon boundary (assay 2, Table I). Even though the assay jective and the Leica Q500MC Computer Image Analysis System (Cam- bridge, U.K.). Frequencies of marker-expressing IEL were determined by was sensitive, detecting down to 250 RNA copies and giving strong calculating the ratio between the number of intraepithelial marker-positive signals in two samples of thymus RNA, no signal was obtained in 10 cells and the number of epithelial cells in a defined length of the epithelium jejunal samples previously shown to contain RAG1 mRNA using (19). Percentages of marker-expressing LPL were counted according to the DNase treatment and qRT-PCR assay 1. Furthermore, no signal was Weibel method as described (13). Ten to 15 randomly chosen ocular fields were counted for both IEL and LPL. Final results are given as the percent obtained even when a more sensitive, nested qRT-PCR assay, with marker-positive cells of CD45ϩ cells in sequential sections. the 5Ј-primer placed in exon 1 was used (assay 3, Table I). A5Ј-RACE was performed to investigate whether alternative 5ЈUTR RAG1 exon(s) were used by jejunal T cells. A sample of In situ hybridization jejunal CD2ϩCD7ϩCD3Ϫ cells was used. The product had a RNA probes for the 1B/2 RAG1 mRNA splice form and pT␣a mRNA were length of 607 nucleotides and contained the expected sequence of Downloaded from synthesized using the primers for real-time qRT-PCR. For information exon 2 (Fig. 1a). However, the entire sequence 5Ј of exon 2 was about primer positions and probe size/amplicon length see assay 5 for 1B/2 ␣ ␣ new. Four clones were sequenced with identical results. In the RAG1 and outer primers in the pTa assay for pTa (see Table I). An RNA Ј probe for the 1C/2 RAG1 mRNA splice form was synthesized using the gene data bank part of the 5 UTR sequence (177 nucleotides) was primers for qualitative RT-PCR (353 nucleotides, see Table I). The PCR present in one gene fragment and the other part (114 nucleotides) products were cloned into the plasmid vector EcoRV-digested pBluescript ϩ in the other fragment within contig no. 4 of the AC061999 working SK II prepared with dT overhang, amplified, purified, and sequenced. draft sequence of human chromosome 11. The previously pub- ␣a http://www.jimmunol.org/ Antisense and sense RAG1 and pT cRNAs were prepared and labeled Ј with DIG-UTP with the use of DIG RNA labeling kit (Boehringer Mann- lished 5 UTR exon 1 and exon 2 were present within the same heim) according to the protocol of the manufacturer. contig. The sequences of the new 5ЈUTR exons and the genomic In situ hybridization was performed according to the protocol of organization of the RAG1 gene, as deduced from sequence com- Panoskaltsis-Mortari and Bucy (20) with the following modifications: parison analysis, are given in Fig. 1a. We named the new 5ЈUTR 10-␮m cryosections were air-dried, incubated in chloroform for 5 min, and fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The exons 1A and 1B according to their order relative to exon 2. The hybridization was done at 56°C overnight. After RNase A treatment, the previously described exon 1 was located 3Ј to the new exons. It sections were incubated at 56°C for 30 min in 30 mM sodium citrate/0.3 M was renamed to 1C. Intron/exon splice junctions, according to the NaCl/50% formamide. The conjugate was diluted in 0.1 M Tris-HCl/0.15 GT/AG rule, flanked the intron between exons 1A and 1B, sup- M NaCl/4% normal horse serum. After incubation with substrate, the slides porting the notion that the new 5ЈUTR sequence was indeed en- by guest on September 26, 2021 were rinsed in dimethylformamide, counterstained with methylgreen, and mounted in Canada balsam. The corresponding sense DIG-labeled RNA coded in two different exons (Fig. 1a). probes were used as negative controls.

Thymocytes and jejunal T cells show distinct usage of RAG1 Combined in situ hybridization and immunohistochemistry 5ЈUTR exons In situ hybridization was conducted as described above. After the hybrid- Jejunal CD3ϩ cells were analyzed for usage of different splice ization signal became visible, the slides underwent Ag retrieval by micro- forms of RAG1 mRNA by qualitative RT-PCR in which the 5Ј- wave cooking three times for 5 min in 1 mM EDTA (effect, 750 W). After blocking with PBS/20% normal horse serum, the sections were incubated primer was placed either in exon 1A, exon 1B, or exon 1C, and the with rabbit anti-CD3 Ab and thereafter treated with avidin followed by 3Ј-primer in exon 2 (Table I). Three major amplicons were ob- biotin. Endogenous peroxidase activity was blocked by incubation in 2 mM tained when using a 5Ј-primer placed in exon 1A. Their molecular NaN /0.03% H O for1hat37°C. After blocking with PBS/20% normal 3 2 2 sizes (Ϸ235, 154, and 125 bp) agreed well with those calculated horse serum, the slides were incubated with biotinylated goat anti-rabbit IgG and thereafter with ABC complex (Dakopatts). After incubation with for the possible splice variants. The larger band had the sequence 3-amino-9-ethyl-carbazole, the slides were mounted in glycerol jelly. expected from amplification of the splice form obtained in the 5Ј-RACE, i.e., 1A/1B/2. One of the smaller bands had the expected sequence for amplification of exon 1A spliced directly to exon 2 Statistics (1A/2). The third band had no homology with the RAG1 gene. The significance of differences in RAG1 and pT␣ mRNA expression levels None of the bands contained the sequence of exon 1C. RT-PCR was evaluated by one-way ANOVA with post-tests of either Newman- with the 5Ј-primer placed in exon 1B yielded only amplicons with ␣ Keuls when comparing pT mRNA or different RAG1 mRNA splice forms 1B spliced directly to exon 2 (1B/2), and RT-PCR with the 5Ј- in cells from different tissue sources; Dunnett when comparing different mRNA species in a given cell type; or Bonferroni when comparing a par- primer placed in exon 1C yielded no detectable amplicons. Thus, ticular mRNA species in pairs of cell types. The significance of differences the two new exons can appear in at least two different splice forms in frequencies of samples with detectable levels of RAG1 mRNA splice of RAG1 mRNA in jejunal T cells, none of which includes the forms was estimated by Fisher’s exact test. Analyses of correlation be- previously published exon 1 (here renamed 1C). tween mRNA levels for RAG1 and pT␣ were performed using the Spear- man rank correlation test. Statistical analyses of differences in frequencies Two thymus RNA samples were subjected to similar analysis. between cells positive for different markers in immunomorphometry were No bands with sequence homology to the RAG1 gene were ob- performed using the Student t test and the paired Student t test was used tained with the 5Ј-primer placed in 1A. RT-PCR with the 5Ј-primer when comparing frequencies of marker-positive cells intraepithelially and placed in exon 1B yielded only amplicons with 1B spliced directly in LP. The variance of groups was tested for equality by F test before Ј ANOVA and Student’s t test analyses. Two-tailed analyses were used to exon 2 (1B/2). RT-PCR with the 5 -primer placed in the 1C throughout. A value of p Ͻ 0.05 was regarded as statistically significant. exon yielded only amplicons of 1C spliced directly to exon 2 (1C/ Values obtained by immunomorphometry are given as mean Ϯ 1 SEM. 2). Absence of a 1B/1C/2 splice form is in agreement with the 3362 TCR GENE REARRANGEMENT IN HUMAN SMALL INTESTINE

Table I. Sequences and positions of primers and probes used in RT-PCR assays for RAG1 and pT␣a mRNA

Gene/Splice 5Ј-Primer Variants Detected Type of RT-PCRa Sequenceb Exonc

RAG1 Quantitative, one step GCTGAGAACCTGGAACGTTATGA 2 Universale (Assay 1)

RAG1 Qualitative TGAGGATGGCGACGAGAAGAT 1A 1A/1B/1C/2f 1A/1B/2 1A/1C/2 1A/2

RAG1 Qualitative TACGGATTTTCCTGGTTCTCC 1B 1B/1C/2f 1B/2

RAG1f Qualitative CATCTCAACACTTTGGCCAGG 1C 1C/2 Downloaded from RAG1 Quantitative, one step TGAGGATGGCGACGAGAAGAT 1A 1A/2 (Assay 4)

RAG1 Quantitative, two step TACGGATTTTCCTGGTTCTCC 1B 1B/2

1A/1B/2 http://www.jimmunol.org/ (Assay 5)

RAG1 Quantitative, one step TTGGAATGAGGATGGCGAC 1A 1A/1B/2 (Assay 6)

RAG1 Quantitative, two step TCTCAACACTTTGGCCAGG 1C 1C/2 (Assay 2)

RAG1 Quantitative, nested TGCCTTCTCTTTGGTATTGA 1C by guest on September 26, 2021 1C/2 (Outer) (Assay 3) TCTCAACACTTTGGCCAGG 1C (Inner)

pT␣a Quantitative, nested AGGGTCACAGCAGGAGTACAC 2 2/3/4 (Outer) CATCTGTCAGGAGAGGCTTCT 2/3 (Inner)

a For details see Materials and Methods. b Sequence from 5Ј to 3Ј. c Exon(s) in which the primer or probe is placed. d Amplicon length in nucleotides. e RT-PCR was performed using DNase-treated RNA checked for elimination of possible contaminating DNA by PCR without reverse transcription. f Splice forms, which are theoretically possible to detect, deduced from the order of the RAG1 exons in contig no. 4 of the working draft AC061999 of human chromosome 11. observation that the intron sequence between exons 1B and 1C All but one IEL sample expressed the 1B/2 splice form. The ma- does not adhere to the GT/AG rule (Fig. 1a). jority of IEL samples also expressed the 1A/2 splice form. No IEL qRT-PCR assays with RNA copy standards were constructed to samples expressed the 1A/2 form only. Two-thirds of the LPL sam- analyze the expression levels of the new splice forms of RAG1 ples expressed either the 1A/2 or the 1B/2 splice form or both. Several mRNA. Assays 4 and 5 were designed to discriminate between LPL samples expressed the 1A/2 form only. Eight of the nine samples splice forms having exon 1A or 1B spliced to exon 2 (Table I, Fig. that had exon 1B spliced to exon 2 expressed the long (1A/1B/2) form 1b). Assay 6 was designed to estimate the frequency of mRNA of RAG1 mRNA. Three of these expressed the long form only. containing the long splice form with 1A exon spliced to the 1B The new forms of RAG1 mRNA (1A/2 and 1B/2) were not exon (Table I, Fig. 1b). Results were normalized by calculating the detected in RNA extracted from purified small intestinal epithelial ratios between RAG1 mRNA copies and units of 18S rRNA. One cells (n ϭ 1). unit of 18S rRNA corresponds approximately to the 18S rRNA content in 100 intestinal lymphocyte. The results from analysis of jejunal IEL and LPL of adults are shown in Table II and summa- Localization of RAG1 mRNA-expressing cells in jejunum rized in Fig. 1b. The majority of samples expressed splice forms RAG1 mRNA-expressing cells were localized in three jejunal containing either one of the 1A and 1B exons or both while no samples from adults by in situ hybridization. One RNA probe spe- samples contained detectable amounts of the splice form contain- cific for the 1B/2 junction, recognizing cells expressing the 1B/2 ing exon 1C ( p ϭ 0.02 and 0.009 for IEL and LPL, respectively). and/or 1A/1B/2 splice forms, and one probe specific for the 1C/2 The Journal of Immunology 3363

Table I. Continues

3Ј-Primer Probe Amplicon Sequenceb Exonc Sequenceb Exonc Lengthd

CAGTGGAGTGCATCTATGGAA 2 TGTGGAAGAACTGCGGGATCGGG 2 GG T 137

ATGTGGGTGCTGAATTTCATC 2 348 234 238 124

ATGTGGGTGCTGAATTTCATCT 2 255 145

GCTTTGCCTCTTGCTTTCTCG 2 353 Downloaded from ATGTGGGTGCTGAATTTCATC 2 CCCTCCCGGAATAACTTAATTTGG 1A/2 TACCTCA 124

ATGTGGGTGCTGAATTTCATC 2 ACCTCCATAATTGTACCTCAGCCA 1B/2 GCAT 144 http://www.jimmunol.org/

ATGTGGGTGCTGAATTTCATCT 2 ACCTCCATAATTGTACCTCAGCCA 1B/2 GCAT 244

ATGTGGGTGCTGAATTTCATC 2 AGCAAGGTACCTCAGCCAGCA 1C/2 115

TTGCTTTCTCGTTGTCGTGA 2 by guest on September 26, 2021 (Outer) 385 ATGTGGGTGCTGAATTTCATC 2 AGCAAGGTACCTCAGCCAGCA 1C/2 115 (Inner)

GGAGCAGGTCAAACAGCAG 4 (Outer) 159 ACCCGGTGTCCCCCT 3/4 AGCCAGGACCTGCCCCCA 366 (Inner)

junction, recognizing cells expressing the previously described 1.4–6.1% of the IEL, defined as intraepithelial CD45ϩ cells, were splice form, were used. positive for RAG1 (3.3 Ϯ 0.6%; n ϭ 7). RAG1ϩ cells with lym- Cells expressing mRNA hybridizing with the 1B/2 probe were phoid morphology were also seen in the LP. However, no quan- seen in all three samples. They were located both intraepithelially titative measurements were performed in LP, because cells with and in LP (Fig. 2, a and b). RAG1 mRNA-positive cells were macrophage and dendritic cell morphology exhibited an unspecific irregularly scattered throughout the epithelium, both in crypts (Fig. staining that could not be totally abolished. No unspecific staining 2b) and villi. RAG1 mRNA-expressing cells in LP were often was seen intraepithelially, which is consistent with the absence of found in small clusters (Fig. 2a) and in the vicinity of vessels. macrophages and dendritic cells in the epithelium (10). RAG1 mRNA-positive cells were abundant in some villi, while LP Samples were also stained for TdT, which is commonly ex- of other villi were empty or sparse in RAG1 mRNA-positive cells pressed in thymocytes during TCR gene rearrangement. No TdTϩ (Fig. 2a). Incubation with the sense probe gave no signal (Fig. 2e), cells were detected (n ϭ 6). nor were any positive cells detected in sections incubated with the ␣ 1C/2 RAG1 mRNA probe, although this probe gave strong signals pT mRNA is expressed in jejunal T cells in tonsillar tissue (not shown). pT␣ is expressed in two forms, a long form (pT␣a) with an extracellular domain that associates with the TCR␤ chain during TCR␣ RAG1-expressing cells constitute a minor population of IEL chain rearrangement forming a pre-TCR, and a short form which The location and frequency of cells expressing the RAG1 protein lacks the extracellular domain (pT␣b) (22, 23). A qRT-PCR assay was analyzed using two RAG1-specific antisera in immunohisto- with RNA copy standard was constructed for pT␣a mRNA (Table chemistry. The two reagents gave consistent results. Positively I) and expression levels were determined in IEL and LPL of adults stained cells were present both intraepithelially (Fig. 3a) and in (Table II). pT␣a mRNA was detected in all IEL samples analyzed LP. The staining pattern suggested intracellular location. Between and all but one of the LPL samples. The levels of pT␣a mRNA 3364 TCR GENE REARRANGEMENT IN HUMAN SMALL INTESTINE Downloaded from http://www.jimmunol.org/

FIGURE 1. a, Organization and nucleotide sequence of exons in the 5ЈUTR of the human RAG1 gene. The order and nucleotide sequence of the two newly identified RAG1 5ЈUTR exons 1A and 1B are shown (capital letters) flanked by the two nearest nucleotides in the introns (small letters) as deduced from sequence comparison with the gene data bank. Sequence comparison also revealed that exons 1A and 1B both lie upstream of the previously published 5ЈUTR exon (1C). Introns are marked with OFO and their lengths are indicated. The arrow shows the position of the 3Ј-primer used in the 5Ј-RACE, and the open box indicates the start codon. b, Expression levels of different RAG1 mRNA splice forms in lymphocytes of different tissue origin. Expression levels of RAG1 mRNA splice forms in jejunal lymphocytes (jejunum), thymus, bone marrow, blood, and a T cell leukemia line (Jurkat) were determined by using real-time qRT-PCR assays with primers (arrows) and probe (plain lines) placed as indicated to the left. The amount of the respective mRNA species was determined for each mRNA splice variant, and normalized to the amount of 18S rRNA in the sample. Expression levels are shown as median RAG1 mRNA copies/18S rRNA unit based on determination of five jejunum samples (IEL ϩ LPL), two thymus samples, three BMC samples, and four PBMC by guest on September 26, 2021 samples. correlated with the total levels of RAG1 mRNA, i.e., the sum of trieved. This population includes mature T cells and cells with the levels of 1A/2 and 1B/2 splice forms in the sample ( p ϭ 0.002, immature forms of the TCR/CD3 complex on the surface. Cells r ϭ 0.7). No signal for pT␣a mRNA was detected in RNA ex- expressing CD2 and/or CD7 were retrieved from the unbound cells tracted from small intestinal epithelial cells (n ϭ 1). by using magnetic beads charged with a mixture of anti-CD2 and The localization of cells expressing pT␣ mRNA was investi- anti-CD7 mAbs (CD2ϩCD7ϩCD3Ϫ cells). This population in- gated in three jejunal samples from adults by in situ hybridization, cludes immature cells of the T cell lineage with no surface expres- using a probe selective for the pT␣a form. pT␣a mRNA-expressing sion of the TCR/CD3 complex and possibly mature T cells with cells were detected in all three samples. The distribution of pT␣a Ag-induced surface down-regulation of the TCR/CD3 complex. mRNA-expressing cells showed great resemblance to cells hybrid- RAG1 mRNA was expressed both in CD3ϩ and CD2ϩCD7ϩ izing with the 1B/2 RAG1 probe (Fig. 2c). Positive cells were seen CD3Ϫ cells. All three new splice forms (1A/2, 1B/2, 1A/1B/2) both intraepithelially (Fig. 2d) and in LP. Furthermore, while the were expressed but varied significantly in proportions between dif- LP of some villi harbored numerous pT␣a mRNA-expressing cells, ferent samples (Fig. 4, aÐc). Five of six CD3ϩ IEL samples, four other villi were devoid of such cells (Fig. 2c). Incubation with the of six CD3ϩ LPL samples, all four CD2ϩCD7ϩCD3Ϫ IEL sam- sense probe did not give any signal (not shown). ples, and three of four CD2ϩCD7ϩCD3Ϫ LPL samples expressed the 1A/2 and/or 1B/2 RAG1 mRNA splice forms. The 1C/2 form The new RAG1 mRNA splice forms are expressed in immature was not detected. jejunal T cells There was a tendency for increased expression levels of both the In the T cell lineage, CD2 and CD7 are expressed earlier in de- 1A/2 and 1B/2 RAG1 mRNA forms in CD2ϩCD7ϩCD3Ϫ cells velopment than the TCR/CD3 complex and are retained on mature compared with CD3ϩ cells (Fig. 4, a and c) and unfractionated IEL T cells (24). Previously, we showed that a significant proportion of and LPL (not shown). Indeed, the expression level of the 1A/2 human jejunal IEL are CD2ϩCD3Ϫ (10). Immunoflow cytometry form was significantly higher in CD2ϩCD7ϩCD3Ϫ IEL compared analyses showed that CD2ϩ and CD7ϩ cells outnumber CD3ϩ with the total IEL population ( p ϭ 0.05). In addition, five of the cells both in IEL and LPL (not shown) indicating that six CD3ϩ IEL samples expressed the long 1A/1B/2 form (Fig. 4b). CD2ϩCD7ϩCD3Ϫ cells are present in both compartments. The The long form was also expressed in CD3ϩ LPL samples from expression levels of RAG1 mRNA splice forms were assessed in three of these individuals. There was a great variation between lymphocytes of the T cell lineage retrieved from IEL and LPL of samples in the proportion of 1B/2 that was in the long 1A/1B/2 adults by sequential positive selection. First, CD3ϩ cells were re- form, and as much as six samples had all the 1B/2 in the long form. The Journal of Immunology 3365

Table II. Expression levels of RAG1 mRNA splice forms and pT␣a mRNA in lymphocytes of different tissue origin

RAG1 mRNA Splice Form pT␣a mRNA

Source of RNA Sample 1A/2a 1B/2b 1A/1B/2 1C/2c 2/3/4

Jejunal IEL (adults) J67 0d 1.5 0 0 0.2 J71 0 0 0 0 0.3 J72 0.2 1.3 2.0 0 6.5 J73 4.0 3.6 0.8 0 39.7 J74 0.4 0.6 0.3 0 1.1 J77 0.4 2.8 0.1 0 23.2 Jejunal LPL (adults) J60 0.6 4.1 2.9 0 2.1 J63 5.8 0 0 0 2.9 J65 0 3.7 3.5 0 1.4 J71 0 0 0 0 0.2 J72 0.1 0 0 0 1.4 J73 1.1 2.1 0.2 0 23.7 J74 0 0 0 0 1.0 J77 3.5 1.5 2.0 0 20.7 J78 0 0 0 0 0 Jejunal CD2ϩCD7ϩ IEL (young children) J30 0 1.2 0.3 0 2.1 J31 3.5 0 0 0 7.3 Downloaded from J39 0 0.8 0.3 0 0.1 Jejunal CD2ϩCD7ϩLPL (young children) J19 0 0 0 0 0.1 J22 0 0 0 0 17.7 J30 0 0 0 0 1.3 J31 0 0 0 0 21.3 J32 0 1.3 0 0 0

J39 0 0 0 0 0 http://www.jimmunol.org/ Thymus T1 0 1.3 0 6,100 161.8 T2 0 1.4 0 7,170 347.0 Bone marrow mononuclear cells (adults) BMC1 0.2 1.5 0.1 0 6.5 BMC2 0.1 0.8 0.8 13.0 3.9 BMC3 0.2 0.7 0 9.8 3.7 Blood mononuclear cells (adults) PBMC1 0.4 0.2 0.1 0.3 10.1 PBMC2 0.3 0 0 0.2 7.8 PBMC3 0.1 0 0 0.5 27.1 PBMC4 0 0.3 0 0 2.1 a Ј

Exons in the splice form detected by the assay. Discrimination between RAG1 splice forms is achieved by the positions of the 5 -primer and the probe in the different assays by guest on September 26, 2021 (Fig. 1b and Table I). b This assay detects both the short 1B/2 and the long 1A/1B/2 splice forms. c Samples were analyzed with enhanced nested qRT-PCR (assay 3 in Table I). d Expression levels of RAG1 and pT␣a mRNAs as determined by speciﬁc real-time qRT-PCR. Results are normalized to the content of 18S rRNA in the individual samples and expressed as copies per unit of 18S rRNA. 0 ϭ below the detection level of the assay.

RAG1 1B/2 and/or 1A/1B/2 expression in CD3ϩ cells was also The new RAG1 mRNA splice forms and pT␣a mRNA are demonstrated by combination of in situ hybridization and immu- expressed in jejunal T cells of children ϩ nohistochemistry for CD3 cells. Double-stained cells were seen Table II shows the results from analysis of the total T cell lineage both intraepithelially and in LP (Fig. 2g). population retrieved from jejunal IEL and LPL of young children Independent evidence for TCR gene rearrangement was ob- by using magnetic beads charged with a mixture of anti-CD2 and ϩ ϩ Ϫ tained by analysis of CD2 CD7 CD3 cells for RAG2 mRNA anti-CD7 mAbs. All three IEL samples expressed RAG1 mRNA, expression. By RT-PCR, a single amplicon of the correct size and either the 1A/2 or the 1B/2 form, while no RAG1 mRNA was sequence was obtained. detected in LPL of the same individual. Only one of three additional LPL samples expressed RAG1 mRNA. The two IEL samples that had exon 1B spliced to exon 2 both expressed the long ␣a pT mRNA is preferentially expressed in immature T cells 1A/1B/2 splice form. The 1C/2 splice form was not detected. Virtually all CD3ϩ and CD2ϩCD7ϩCD3Ϫ IEL and LPL samples pT␣a mRNA was detected in all three IEL samples and in the were positive when analyzed for pT␣a mRNA (Fig. 4d). Expres- majority of LPL samples (Table II). Notably two of the LPL samples sion levels were high in CD2ϩCD7ϩCD3Ϫ cells both intraepithe- expressed high levels of pT␣a mRNA although no RAG1 mRNA was lially and in LP (Fig. 4d). Indeed, the pT␣ mRNA levels were detected. The expression levels of pT␣a mRNA did not correlate with signiﬁcantly higher in CD2ϩCD7ϩCD3Ϫ cells than in CD3ϩ IEL, the expression levels of RAG1 mRNA (1A/2 ϩ 1B/2). total IEL, CD3ϩ LPL, and total LPL, respectively ( p ϭ 0.001 in a all four cases). Expression levels of pT␣a and RAG1 (1A/2 ϩ Expression of RAG1 mRNA splice forms and pT␣ mRNA in 1B/2) mRNAs correlated in CD3ϩ cells ( p ϭ 0.04, r ϭ 0.6) but primary lymphoid organs and blood ϩ ϩ Ϫ not in CD2 CD7 CD3 cells. Two thymus samples, mononuclear immune cells from BMC of Combined in situ hybridization and immunohistochemistry dem- three adults and PBMC of four healthy adults were analyzed for onstrated pT␣a mRNA CD3 double-positive cells (Fig. 2f). However, expression of RAG1 and pT␣a mRNA. The results are shown in the majority of pT␣a mRNA-positive cells were CD3-negative. Table II and summarized in Fig. 1b. 3366 TCR GENE REARRANGEMENT IN HUMAN SMALL INTESTINE

FIGURE 2. RAG1- and pT␣ mRNA- expressing cells are present both intraepithelially and in LP of jejunal mucosa. In situ hybridization with DIG- labeled antisense probe for the 1B/2 and 1A/1B/2 RAG1 mRNA splice forms (a, b, and g) and pT␣a mRNA (c, d, and f) in normal jejunum of an ␣␣

adult. Both RAG1 mRNA and pT Downloaded from mRNA-expressing cells were seen in the epithelium (b and d) and in LP (a and c). No positive cells were detected using a DIG-labeled RAG1 sense probe (e). Arrows indicate examples of mRNA-expressing LPL in a and c

and IEL in b and d. f and g, Combined http://www.jimmunol.org/ in situ hybridization for RAG1 (g) and pT␣␣ mRNA (f) (blue) and immunohistochemistry for CD3 (red). Arrows in g and f indicate double-positive cells and arrowheads indicate cells positive only for RAG1 or pT␣ mRNA. E, epithelium; L, lumen; C, crypt. Micrographs were taken by using a ϫ10 objective (a, c, and e)ora ϫ40 objective (b, d, f, and g). Bars in- by guest on September 26, 2021 dicate 100 ␮mina, c, and e and 20 ␮minb, d, f, and g.

The 1C/2 splice form of RAG1 mRNA was dominating in thy- forms of RAG1 mRNA were similar to BMC, while the 1C/2 mus and expressed at very high levels significantly above those of splice form was significantly lower ( p Ͻ 0.001). Interestingly, all analyzed cell types of other tissue origins ( p Ͻ 0.001). The significant levels of pT␣a mRNA were detected in both BMC and 1B/2 splice form was also expressed albeit at significantly lower PBMC (Table II). levels ( p Ͻ 0.001) and were comparable to the levels in IEL and All four splice forms of RAG1 mRNA (Fig. 1b), as well as pT␣a LPL. mRNA for the 1A exon was not detected, either in the 1A/2 mRNA (15.5 copies/18S rRNA unit) were expressed in the human or the long 1A/1B/2 splice form. The expression level of pT␣a T cell leukemia cell line Jurkat, which has the phenotype of mature mRNA was high (median 254 copies/18S rRNA unit). ␣␤ T cells (TCRϪ␣␤ϩCD3ϩCD4ϩCD8ϪCD2ϩCD7ϩ). BMC expressed all four RAG1 mRNA splice forms. The 1C/2 splice form was dominating ( p Ͻ 0.001 compared with both 1A/2 Lymphocytes with immature phenotype are present in the jejunal and 1B/2). Still, the expression level of this splice form was Ϸ700 mucosa times lower than in thymus ( p Ͻ 0.001). The expression levels of The frequency and location of possible progenitor cells was ana- the 1A/2, 1B/2, and 1A/1B/2 splice forms were not significantly lyzed by morphometry analysis of anti-c-kit/CD117-stained jejunal different from the levels of these splice forms in jejunal lympho- mucosa. Because c-kit can also be expressed by mast cells (25), cytes. All splice forms of RAG1 mRNA could also be detected in sequential sections were stained with toluidine blue for identifica- PBMC. The average expression levels of the 1A/2 and 1B/2 splice tion of this cell type. CD1a was used as a marker for lymphocytes The Journal of Immunology 3367 Downloaded from FIGURE 3. RAG1, c-kit, IL-7R, and CD1a-expressing lymphocytes are present in the jejunal mucosa. a, IEL in villous epithelium of jejunum positively stained for RAG1 (indirect immunofluorescence). b, Numerous IL-7Rϩ cells can be seen both intraepithelially (arrowheads indicate examples) and in LP (arrows indicate ex-

amples; immunoperoxidase enhanced by the ABC meth- http://www.jimmunol.org/ od). c and d, and e and f, Sequential sections of jejunal mucosa, stained for c-kit by indirect immunoperoxidase technique (c and e) and for mast cells by toluidine blue (d and f). Fat arrows in c and e indicate c-kitϩ cells in LP not stained by toluidine blue. Arrowheads in c indicate c-kitϩ IEL. Arrowheads in e and f indicate one c-kit positive mast cell. Thin arrow in f indicates a c-kit negative mast cell. g and h, Frequencies of c-kitϩ, IL-7Rϩ, and CD1aϩ IEL (g) and LPL (h) as determined by immunomorphometry. Numbers of c-kitϩ, IL-7Rϩ, CD1aϩ, and by guest on September 26, 2021 CD45ϩ cells were determined in sequential sections and results are given as percent markerϩ cells/CD45ϩ cells. Each dot represents the result from one individual and horizontal bars indicate the mean values.

with thymocyte phenotype. We also performed immunomorphom- c-kitϩ cells were present both in LP and within the epithelium etry analyses of cells expressing receptors for IL-7 (IL-7R/ (Fig. 3, c and e). Their frequency was signiﬁcantly higher in LP CD127ϩ cells), a cytokine that has been shown to be required for than in the epithelium with a mean of 15% c-kitϩ LPL, compared development of ␥␦ T cells and a key factor for T cell development with 3.3% c-kitϩ IEL ( p Ͻ 0.05; Fig. 3, g and h). Mast cells were in general (26, 27). detected in LP (Fig. 3f) where they constituted 4.9 Ϯ 1.9% (n ϭ 3368 TCR GENE REARRANGEMENT IN HUMAN SMALL INTESTINE

c-kit-positive (Fig. 3, e and f). Thus, at least 10% of the LPL of the jejunal mucosa are likely to be c-kitϩ, immature progenitor cells. Numerous cells (Ϸ40% of the CD45ϩ cells) showing surface staining for IL-7R were present both intraepithelially and in LP (Fig. 3b). However, full revelation of IL-7Rϩ cells required am- pliﬁcation by the ABC technique suggesting that the surface expression is low on a large proportion of these cells. IL-7Rϩ cells signiﬁcantly outnumbered c-kitϩ cells at both locations ( p Ͻ 0.001; Fig. 3, g and h). Lymphocytes expressing CD1a were also more frequent than c-kitϩ cells and constituted approximately one- third of both IEL and LPL (Fig. 3, g and h).

Discussion In this study, we identify two new 5ЈUTR exons in the human RAG1 gene and show that lymphocytes of the T cell lineage use one of these, exon 1A, selectively outside the thymus and particularly in the small intestinal mucosa. The second new 5ЈUTR exon, exon 1B, was shown to be used by immature T cells both Downloaded from within and outside the thymus, and lymphocytes expressing splice forms of RAG1 mRNA containing the 1B exon were demonstrated both intraepithelially and in LP of the small intestine. We also demonstrate, for the ﬁrst time, the presence of pT␣ mRNA-expressing lymphocytes in the small intestinal mucosa of adults and

show that expression levels of pT␣a mRNA are particularly high in http://www.jimmunol.org/ immature T cells. pT␣ is expressed in T lymphocytes undergoing FIGURE 4. The new RAG1 mRNA splice forms and pT␣a mRNA are ϩ TCR gene rearrangement (3, 4). Thus, the demonstration of con- expressed in jejunal lymphocytes with mature T cell phenotype (CD3 ) and ␣a immature, thymocyte-like phenotype (CD2ϩCD7ϩCD3Ϫ). Expression levels comitant RAG1 and pT mRNA expression is highly suggestive of the 1B/2 RAG1 (a), the 1A/1B/2 RAG1 (b), and the 1A/2 RAG1 mRNA of ongoing TCR gene rearrangement. These findings strongly sug- splice form (c) and pT␣a mRNA (d) were determined in CD3ϩ cells (triangles) gest that the small intestinal mucosa is indeed a site for ETCM in and CD2ϩCD7ϩCD3Ϫ cells (circles) retrieved from IEL (filled) and LPL man. This notion is further supported by the demonstration of c- (open) by sequential positive selection. Lines connect CD3ϩ cells and kitϩ cells indicating the presence of pluripotent precursors and ϩ ϩ Ϫ ϩ ϩ CD2 CD7 CD3 cells from the same individual. CD3 IEL and CD3 LPL lymphocytes with a surface marker profile resembling thymocytes, were retrieved from samples J71, J72, J73, J74, J77, and J78; e.g., expression of CD1a, simultaneous expression of CD4 and by guest on September 26, 2021 CD2ϩCD7ϩCD3Ϫ IEL were retrieved from samples J71, J72, J73, and J77; ϩ ϩ Ϫ CD8, expression of CD2 and/or CD7 without expression of the and CD2 CD7 CD3 LPL of samples J72, J73, J77, and J78 (see Table II). CD3/TCR complex (this study and Refs. 10, 19, 28, 29). We found that ϳ40% of IEL and LPL expressed receptors for IL-7. A similar high frequency of IL-7Rϩ cells was reported for 6) of the CD45ϩ cells but were scarce within the epithelium (0.3 Ϯ LPL of human colon (30) even though RAG1 mRNA was not 0.3% of intraepithelial CD45ϩ cells; p Ͻ 0.01 comparing the fre- detected at this site (Ref. 10 and M.-L. K. C. Hammarstro¨m, un- quencies of mast cells intraepithelially and in LP). The extremely published observation). Thus, additional lymphocyte subsets to low frequency of mast cells within the epithelium excludes the immature T cells must express IL-7R. At any rate, it has been possibility that intraepithelial c-kitϩ cells are mast cells ( p Ͻ shown that small intestinal epithelial cells produce IL-7 (31) and 0.001 comparing frequencies of intraepithelial c-kitϩ cells and IL-7R are present on the lymphocytes, thus, one condition for local mast cells). Analysis of LPL in sequential sections revealed that differentiation is fulfilled. c-kitϩ cells significantly outnumbered mast cells ( p Ͻ 0.05). Most The new splice forms of RAG1 mRNA were also expressed in c-kitϩ cells were not mast cells as judged by staining with toluidine small intestinal IEL of the T cell lineage in young children (median blue (Fig. 3, c and d), and only a fraction of the mast cells were age 1.5 years) and at similar expression levels to those in IEL of

FIGURE 5. Schematic drawing of the expression pattern of different RAG1 mRNA splice forms in T cell development and in T cell precursors during migration in man as suggested from the results of the present study. The Journal of Immunology 3369 adults. However, only occasional LPL samples of children ex- Several groups have demonstrated expression of pT␣ in the pressed RAG1 mRNA (one of six), while the majority of LPL small intestine of mice (3, 6, 40); however, only once has it been samples of adults did (six of nine). These data suggest that extra- demonstrated in human intestinal tissues, where pT␣ mRNA was thymic TCR rearrangement occurs preferentially within the epi- demonstrated in IEL and LPL of the fetal intestine (29). In this thelium and that the extent of extrathymic TCR rearrangement study, mRNA for the long form of pT␣ was demonstrated in small increases with age with signiﬁcant involvement of the LP later in intestinal lymphocytes of the T cell lineage of both young children life. Because thymus involutes at puberty and RAG1 mRNA-ex- and adults by real-time qRT-PCR and in IEL and LPL in jejunal ϩ pressing cells as well as pluripotent precursor cells, c-kit cells, mucosa of adults by in situ hybridization. Detection of pT␣ mRNA were readily detected in the LP of adults, it is tempting to speculate required an enhanced nested qRT-PCR, which also allowed detec- that the importance of the small intestinal mucosa as a site for T tion of pT␣a mRNA in Jurkat cells. Previously, pT␣ mRNA could cell maturation is increasing with age. This notion is well in line not be detected in this cell line probably due to lower sensitivity of ϩ with the previously reported increase of CD8␣␣ intestinal lym- the assay used (22). In addition to jejunum and thymus, pT␣a phocytes in aging athymic as well as euthymic mice (32, 33). mRNA was also detected in mononuclear cells of bone marrow All four RAG1 mRNA splice forms were demonstrated in and blood. In a mouse strain with human CD25 as a pT␣- PBMC although at very low expression levels. This is in good controlled reporter gene, it was recently shown that the bone mar- agreement with the recent reports on RAG1 and 2 mRNA expres- row harbors the CD19Ϫ ␣ ϩ lymphoid precursor that expresses pT sion and TCR gene rearrangement in blood CD4 T cells (34, 35, mRNA (41). However, these cells were not committed for devel- 36), although these studies did not allow distinction between RNA opment into ␣␤ T cells and pT␣ was even expressed before onset Downloaded from splice forms. of TCR gene rearrangement. Thus, it is possible that most, if not Ј The four variants of RAG1 mRNA differ in their 5 UTRs but all, pT␣ mRNA detected in BMC and PBMC is derived from splice into the same site upstream of the translation start site. Thus, lymphocyte precursors destined for the T cell lineage that are gen- they encode the same protein. The function(s) of the different erated in the bone marrow and migrate via the blood. The local Ј 5 UTR mRNA splice forms is yet to be determined. There are milieu of the thymus and gut may drive them to differentiate fur- examples of a posttranscriptional regulatory role for the 5ЈUTR.

ther along the T cell line. In contrast, the observed RAG1 mRNA http://www.jimmunol.org/ Ј The 5 UTR of human heat shock protein 70 mRNA contains an expression in bone marrow is probably derived from immature B element that increases the translation efficiency at 42°C compared cells. Two findings in the present study are compatible with the with at 37°C (37). Relatively little is known about the role(s) of recent observation in mice that pT␣ is expressed both early in T selective expression of mRNAs differing only in the 5ЈUTR. In cell development and during TCR gene rearrangement. First, T cell analogy with RAG1, Drosophila ferritin mRNA was shown to lineage LPLs in the jejunal mucosa of young children commonly have four different mRNA splice forms generated by alternative expressed pT␣ mRNA, but not RAG1 mRNA. Second, there was splicing of 5ЈUTR exons (38). Only one of them contained the a poor correlation between pT␣ and RAG1 mRNA levels in im- iron-responsive element and exhibited regulation of translation activ- ϩ ϩ Ϫ mature (CD2 CD7 CD3 ) T cells while these mRNA species ity depending on iron concentration. Developmental and tissue-spe- by guest on September 26, 2021 correlated well in CD3ϩ cells. It is conceivable that the cific regulation of expression of the human growth hormone receptor CD2ϩCD7ϩCD3Ϫ cells comprise a mixture of pT␣ mRNA-ex- was shown to correlate with alternative use of 5ЈUTR exons (39). pressing cells, one undergoing TCR gene rearrangement and one in Thus, the different 5ЈUTR splice forms of RAG1 mRNA may regulate which this process has not yet been initiated. RAG1 mRNA-ex- both tissue specific expression and the amounts of protein produced. pressing CD3ϩ cells are expected to be cells expressing a pre- It is noteworthy that the total expression level of RAG1 mRNA ␣ was only slightly lower in lymphocytes from jejunum compared TCR/CD3 complex while rearranging the TCR chain. with bone marrow, an established site for B cell maturation. How- Based on the expression pattern of RAG1 mRNA splice forms ␣a ever, the RAG1 expression levels at both sites were Ͼ100 times and pT mRNA in the small intestine, bone marrow, thymus, and lower than in the thymus. This difference can partly be explained blood, we propose a model for T cell maturation in man (sche- ␣a by the difference in frequency of RAG1-expressing cells, on av- matically drawn in Fig. 5). pT mRNA-expressing common lym- erage 3.3% of the IEL compared with virtually all thymocytes. The phoid precursors develop in the bone marrow and migrate either to relative physiological importance of the different splice forms also the small intestine or to the thymus. The 1A/2 and 1A/1B/2 splice depends on mRNA half-life and rate of translation. It is possible forms of RAG1 mRNA are expressed in jejunum and bone marrow but not in the thymus, yet expressed in cells of the T cell lineage that the splice forms selectively expressed in the jejunal mucosa ϩ ϩ ϩ Ϫ have a longer half-life and/or induce higher translation activity. as shown in purified CD3 cells, CD2 CD7 CD3 cells, and a ϩ The frequencies of RAG1-expressing cells in human jejunal mu- TCR␣␤ leukemia cell line. Therefore, we suggest that T cell cosa as revealed by in situ hybridization and immunohistochem- precursors expressing these two splice forms migrate directly from istry are high, compared with the recently reported minute amounts the bone marrow to the small intestine and that these splice forms (Ͻ0.01%) of RAG1 mRNA-expressing IEL and cryptopatch cells are used during de novo TCR gene recombination at this site. in murine small intestine (40). These authors used cell sorting in Conversely, the 1C/2 splice form of RAG1 mRNA is expressed in combination with RT-PCR with a 5Ј-primer placed in the 5ЈUTR thymus and bone marrow but not in the small intestine. Therefore, exon 1, and the 3Ј-primer in exon 2, which also in mice contains we suggest that T cell precursors expressing this splice form mi- the entire coding sequence. Given the similar gene organization grate directly to the thymus and use this splice form during de and the high sequence homology between the human and the mu- novo TCR gene recombination in the thymus. rine RAG1 exon 2; i.e., 80% at the nucleotide level and as much The 1B/2 splice form of RAG1 mRNA was expressed both in as 96% at the protein level, it seems likely that the murine RAG1 the small intestine and in the thymus, suggesting a shared function. gene also contains additional 5ЈUTR exons, and that differential We propose that cells using this splice form are undergoing TCR expression of RAG1 mRNA splice forms explains the difficulties revision in both tissues. Previously reported data suggest that cor- in demonstrating significant amounts of RAG1 mRNA-expressing tical thymocytes expressing an autoreactive TCR can undergo a cells in murine small intestine. secondary rearrangement by which it edits its receptor specificity 3370 TCR GENE REARRANGEMENT IN HUMAN SMALL INTESTINE

(42). The marked difference between the 1B/2 and the 1C/2 splice 13. Yeung, M. M.-W., S. Melgar, V. Baranov, Å.O¨ berg, Å. Danielsson, S. Ham- forms in thymus is compatible with this idea because TCR editing marstro¨m, and M.-L. Hammarstro¨m. 2000. Characterisation of mucosal lymphoid aggregates in ulcerative colitis: immune cell phenotype and TcR-␥␦ expression. supposedly is much less frequent than de novo TCR gene rear- Gut 47:215. rangement at this site. In small intestine, TCR editing is probably 14. Lundqvist, C., S. Melgar, M. M.-W. Yeung, S. Hammarstro¨m, and M.-L. Ham- induced upon Ag encounter and may involve both intra- and ex- marstro¨m. 1996. Intraepithelial lymphocytes in human gut have lytic potential and a cytokine profile that suggest T helper 1 and cytotoxic functions. J. Immu- trathymically matured T lymphocytes. Previous studies in mice nol. 157:1926. have suggested that positive, but not negative, selection of T cells 15. Forsberg, G., O. Hernell, S. Melgar, A. Israelsson, S. Hammarstro¨m, and M-L. occurs in the small intestinal mucosa (43–45). Thus, TCR editing Hammarstro¨m. 2002. Paradoxical co-expression of pro-inflammatory and down- regulatory cytokines in intestinal T cells in childhood celiac disease. Gastroen- at this site may serve to increase the TCR affinity. Another inter- terology 123:667. esting possibility is that TCR editing serves to decrease reactivity 16. Lundqvist, C., V. Baranov, S. Teglund, S. Hammarstro¨m, and M.-L. Ham- against food Ags thereby playing a role in oral tolerance induction. marstro¨m. 1994. Cytokine profile and ultrastructure of intraepithelial ␥␦ T cells In agreement with what was previous reported (46), TdT was not in chronically inflamed human gingiva suggest a cytotoxic effector function. J. Immunol. 153:2302. detected in jejunal lymphocytes. This suggests that N-region ad- 17. Luna, L. 1968. In Manual of Histologic Staining Methods from the AFIP, 3rd Ed. dition does not take place during TCR gene rearrangement in the McGraw-Hill, New York, p. 162. gut. The average expression level of the 1B/2 splice form was 18. Bancroft, J. D., and A. Stevens. 1996. In Theory and Practice of Histological slightly higher than that of the 1A/2 form. These two observations Techniques, 4th Ed. Churchill Livingstone, New York, p. 164. 19. Melgar, S., A. Bas, S. Hammarstro¨m, and M.-L. Hammarstro¨m. 2002. Human suggest that the creation of the TCR repertoire in the gut is ϩ small intestinal mucosa harbours a small population of cytolytically active CD8 achieved exclusively by recombination and that renewed TCR ␣␤ T lymphocytes. Immunology 106: 476. gene rearrangement is an important mechanism in this process. 20. Panoskaltsis-Mortari, A., and P. R. Bucy. 1995. In situ hybridization with digoxi- Downloaded from The high degree of oligoclonality in human intestinal IEL is com- genin-labeled RNA probes: facts and artifacts. BioTechniques 18:300. patible with this notion (47, 48). 21. Zarin, A. A., I. Fong, L. Malkin, P. A. Marsden, and N. L. Berinstein. 1997. Cloning and characterization of the human recombination activating gene 1 Taken together these results strongly suggest ongoing TCR gene (RAG1) and RAG2 promoter regions. J. Immunol. 159:4382. rearrangement in human small intestinal mucosa; thus, it is a hith- 22. Saint-Ruf, C., O. Lechner, J. Feinberg, and H. von Boehmer. 1998. Genomic erto unrecognized site for T cell development as well as for Ag- structure of the human pre-T cell receptor ␣ chain and expression of two mRNA isoforms. Eur. J. Immunol. 28:3824. driven TCR editing. This probably reflects two parallel phenomena http://www.jimmunol.org/ 23. Barber, D. F., L. Passoni, L. Wen, L. Geng, and A. C. Hayday. 1998. Cutting working in concert to yield T cells adapted specially for this edge: the expression in vivo of a second isoform of pT␣: implications for the environment. mechanism of pT␣ action. J. Immunol. 161:11. 24. Haynes, B. F., S. M. Denning, K. H. Singer, and J. Kurtzberg. 1989. Ontogeny of T-cell precursors: a model for the initial stages of human T-cell development. Immunol. Today 10:87. Acknowledgments 25. Horie, K., J. Fujita, K. Takakura, H. Kanzaki, H. Suginami, M. Iwai, We express our sincere gratitude to Dr. Åke O¨ berg and colleagues at the H. Nakayama, and T. Mori. 1993. The expression of c-kit protein in human adult Department of Surgery, Dr. Go¨te Forsberg at the Department of Pediatrics, and fetal tissues. Hum. Reprod. 8:1955. and Dr. Katarina Olofsson at the Department of Otorhinolaryngology, 26. Watanabe, Y., T. Sudo, N. Minato, A. Ohnishi, and Y. Katsura. 1991. Interleukin 7 preferentially supports the growth of ␥␦ T cell receptor-bearing T cells from Umeå University Hospital for supplying tissue samples. The skillful tech- by guest on September 26, 2021 fetal thymocytes in vitro. Int. Immunol. 3:1067. nical assistance of Marianne Sjo¨stedt is gratefully acknowledged. 27. He, W., and D. Kabelitz. 1994. Cytokines involved in intrathymic T cell development. Int. Arch. Allergy Immunol. 105:203. 28. Eiras, P., E. Roldan, C. Camarero, F. Olivares, A. Bootello, and G. Roy. 1998. References Flow cytometry description of a novel CD3Ϫ/CD7ϩ intraepithelial lymphocyte 1. Schatz, D. G. 1997. V(D)J recombination moves in vitro. Semin. Immunol. 9:149. subset in human duodenal biopsies: potential diagnostic value in coeliac disease. Cytometry 34:95. 2. Nemazee, D. 2000. Receptor selection in B and T lymphocytes. Annu. Rev. Im- munol. 18:19. 29. Howie, D., J. Spencer, D. DeLord, C. Pitzalis, N. C. Wathen, A. Dogan, A. Akbar, and T. T. MacDonald. 1998. Extrathymic T cell differentiation in the 3. Bruno, L., B. Rocha, H. von Boehmer, and H.-R. Rodewald. 1995. Intra- and extra-thymic expression of the pre-T cell receptor ␣ gene. Eur. J. Immunol. 25: human intestine early in life. J. Immunol. 161:5862. 1877. 30. Watanabe, M., Y. Ueno, T. Yajima, Y. Iwao, M. Tsuchiya, H. Ishikawa, S. Aiso, 4. von Boehmer, H., and H. J. Fehling. 1997. Structure and function of the pre-T cell T. Hibi, and H. Ishii. 1995. Interleukin 7 is produced by human intestinal epi- receptor. Annu. Rev. Immunol. 15:433. thelial cells and regulates the proliferation of intestinal mucosal lymphocytes. J. Clin. Invest. 95:2945. 5. Rocha, B., P. Vassalli, and D. Guy-Grand. 1991. The V␤ repertoire of mouse gut homodimeric ␣ CD8ϩ intraepithelial T cell receptor ␣/␤ϩ lymphocytes reveals a 31. Madrigal-Estebas, L., R. McManus, B. Byrne, S. Lynch, D. G. Doherty, major extrathymic pathway of T cell differentiation. J. Exp. Med. 173:483. D. Kelleher, D. P. O’Donoghue, C. Feighery, and C. O’Farrelly. 1997. Human small intestinal epithelial cells secrete interleukin-7 and differentially express two 6. Kanamori, Y., K. Ishimaru, M. Nanno, K. Maki, K. Ikuta, H. Nariuchi, and different interleukin-7 mRNA transcripts: implications for extrathymic T-cell dif- H. Ishikawa. 1996. Identification of novel lymphoid tissues in murine intestinal ϩ ϩ ϩ ferentiation. Hum. Immunol. 58:83. mucosa where clusters of c-kit IL-7R Thy1 lympho-hemopoietic progenitors develop. J. Exp. Med. 184:1449. 32. Takeuchi, M., H. Miyazaki, K. Mirokawa, T. Yokokura, and Y. Yoshikai. 1993. 7. Abo, T., T. Kawamura, and H. Watanabe. 2000. Physiological responses of ex- Age-related changes of T cell subsets in intestinal intraepithelial lymphocytes of trathymic T cell in the liver. Immunol. Rev. 174:135. mice. Eur. J. Immunol. 23:1409. 8. Oida, T., K. Suzuki, M. Nanno, Y. Kanamori, H. Saito, E. Kubota, S. Kato, 33. Rozing, J., and B. de Geus. 1995. Changes in the intestinal lymphoid compart- M. Itoh, S. Kaminogawa, and H. Ishikawa. 2000. Role of gut cryptopatches in ment throughout life: implications for the local generation of intestinal T cells. early extrathymic maturation of intestinal intraepithelial T cells. J. Immunol. Int. Rev. Immunol. 12:13. 164:3616. 34. Bruno, L., P. Res, M. Dessing, M. Cella, and H. Spits. 1997. Identification of a 9. Woodward, J., and E. Jenkinson. 2001. Identification and characterization of committed T cell precursor population in adult human peripheral blood. J. Exp. lymphoid precursors in the murine intestinal epithelium. Eur. J. Immunol. 31: Med. 185:875. 3329. 35. Lantelme, E., B. Palermo, L. Granziero, S. Mantovani, R. Campanelli, 10. Lundqvist, C., V. Baranov, S. Hammarstro¨m, L. Athlin, and M.-L. Ham- V. Monafo, A. Lanzavecchia, and C. Giachino. 2000. Cutting edge: recombinase- ϩ marstro¨m. 1995. Intra-epithelial lymphocytes: evidence for regional specializa- activating gene expression and V(D)J recombination in CD4 CD3low mature T tion and extrathymic T cell maturation in the human gut epithelium. Int. Immunol. lymphocytes. J. Immunol. 164:3455. 7:1473. 36. Li, T-T., S. Han, M. Cubbage, and B. Zheng. 2002. Continued expression of 11. Lynch, S., D. Kelleher, R. McManus, and C. O’Farrellly. 1995. RAG1 and RAG2 recombination-activating genes and TCR gene recombination in human periph- expression in human intestinal epithelium: evidence of extrathymic T cell dif- eral T cells. Eur. J. Immunol. 32:2792. ferentiation. Eur. J. Immunol. 25:1143. 37. Vivinus, S., S. Baulande, M. van Zanten, F. Campbell, P. Topley, J. H. Ellis, 12. Lundqvist, C., M.-L. Hammarstro¨m, L. Athlin, and S. Hammarstro¨m. 1992. Iso- P. Dessen, and H. Coste. 2001. An element within the 5Ј untranslated region of lation of functionally active intraepithelial lymphocytes and enterocytes from human Hsp70 mRNA, which acts as a general enhancer of mRNA translation. human small and large intestine. J. Immunol. Methods 152:253. Eur. J. Biochem. 268:1908. The Journal of Immunology 3371

38. Lind, M. I., S. Ekengren, O¨ . Melefors, and K. So¨derha¨ll. 1998. Drosophila fer- 44. Rocha, B., H. von Boehmer, and D. Guy-Grand. 1992. Selection of intraepithelial ritin mRNA: alternative RNA splicing regulates the presence of the iron-respon- lymphocytes with CD8 ␣/␣ co-receptors by self-antigen in the murine gut. Proc. sive element. FEBS Lett. 436:476. Natl. Acad. Sci. USA 89:5336. 39. Goodyer, C. G., G. Zogopoulos, G. Schwartzbauer, H. Zheng, G. N. Hendy, and 45. Yamada, H., T. Ninomiya, A. Hashimoto, K. Tamada, H. Takimoto, and R. K. Menon. 2001. Organization and evolution of the human growth hormone K. Nomoto. 1998. Positive selection of extrathymically developed T cells by receptor gene 5Ј-ﬂanking region. Endocrinology 142:1923. self-antigens. J. Exp. Med. 188:779. 40. Lambolez, F., O. Azogui, A. M. Joret, C. Garcia, H. von Boehmer, J. Di Santo, 46. Taplin, M. E., M. E. Frantz, C. Canning, J. Ritz, R. S. Blumberg, and S. P. Balk. S. Ezine, and B. Rocha. 2002. Characterization of T cell differentiation in the 1996. Evidence against T-cell development in the adult human intestinal mucosa murine gut. J. Exp. Med. 195:437. based upon lack of terminal deoxynucleotidyl transferase expression. Immunol- 41. Gounari, F., I. Aifantis, C. Martin, H. J. Fehling, S. Hoeﬂinger, P. Leder, ogy 87:402. H. von Boehmer, and B. Reizis. 2002. Tracing lymphopoiesis with the aid of a 47. Holtmeier, W., T. Wittho¨ft, A. Hennemann, H. S. Winter, and M. F. Kagnoff. pT␣-controlled reporter gene. Nat. Immunol. 3:489. 1997. The TCR-␦ Repertoire in human intestine undergoes characteristic changes 42. McGargill, M. A., J. M. Derbinski, and K. A. Hogqvist. 2000. Receptor editing during fetal to adult development. J. Immunol. 158:5632. in developing T cells. Nat. Immunol. 1:336. 48. Balas, A., M. D. Garcia-Novo, J. Martinez, F. Garcia-Sanchez, S. Santos, and 43. Lefrancois, L., R. LeCorre, J. Mayo, J. A. Bluestone, and T. Goodman. 1990. J. L. Vicario. 2000. Intestinal ␣␤ T cells of symptomatic celiac disease patients Extrathymic selection of TCR ␥␦ϩ T cells by class II major histocompatibility show oligoclonal TCRBV repertoire but polyclonal rearrangement patterns. Hum. complex molecules. Cell 63:333. Immunol. 61:247. Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021