(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/033310 Al 7 March 2013 (07.03.2013) P O P C T

(51) International Patent Classification: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, H04N 9/07 (2006.01) C07D 409/00 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C07D 495/02 (2006.01) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (21) International Application Number: ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, PCT/US20 12/053006 NO, NZ, OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, 30 August 2012 (30.08.2012) TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, 61/529,433 31 August 201 1 (3 1.08.201 1) US UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (72) Inventors; and EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicants : KAMENECKA, Theodore Mark [US/US]; MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, 50 Stoney Drive, Palm Beach Gardens, Florida 33410 TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, (US). BURRIS, Thomas [US/US]; 163 10 75th Avenue ML, MR, NE, SN, TD, TG). North, Palm Beach Gardens, Florida 33418 (US). Published: (74) Agents: PERDOK SHONKA, Monique M., USPTO — with international search report (Art. 21(3)) Reg. No. 42,989 et al; Schwegman, Lundberg & Woess- ner, P.A., P. O. Box 2938, Minneapolis, Minnesota 55402 — before the expiration of the time limit for amending the (US). claims and to be republished in the event of receipt of amendments (Rule 48.2(h)) (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, — with sequence listing part of description (Rule 5.2(a)) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY,

(54) Title: MODULATORS OF REV-ERB

< ©

©

(57) Abstract: The subject matter herein concerns the identification and development of potent synthetic REV-ERB ligands, such as o in vivo agonists and antagonists. These compounds allow for characterization of the effects of modulation of this receptor in vivo specifically on circadian behavior and metabolism, and have suitable characteristics for development of medicinal compounds useful for treatment of malconditions such as diabetes, obesity, atherosclerosis, dyslipidemia, a circadian rhythm disorder, coronary artery disease, bipolar disorder, depression, cancer, a sleep disorder, an anxiety disorder, an addiction disorder, or an autoimmune disorder. MODULATORS OF REV-ERB

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority of U.S. provisional application serial number 61/529,433, filed August , 20 1, the disclosure of which is incorporated herein by reference in its entirety.

STATEMENT OF GOVERNMENT SUPPORT This invention was made with government support under grant number DK0802Q1, awarded by the National Institutes of Health. The U.S. government certain rights in the invention.

Synchronizing rhythms of behavior and metabolic processes is important for cardiovascular health and preventing metabolic diseases. The nuclear receptors RE V ERBa and -E play an integral role in regulating the expression of core clock proteins driving rhythms in activity and metabolism. Administration of synthetic REV-ERB ligands alters circadian behavior and the circadian pattern of core clock gene expression in the hypothalami of mice. The circadian pattern of expression of an array of metabolic genes in the liver, skeletal muscle, and adipose tissue was also altered resulting in increased energy expenditure. Treatment of diet -induced obese mice with a REV-ERB agonist decreased obesity by reducing fat mass and markedly improving dysiipidemia and hyperglycemia. These results suggest that ligands that pharmaco logically target the circadian rhythm may hold utility in the treatment of sleep disorders as we l as metabolic diseases. In mammals, most if not all tissues display a self-sustaining circadian molecular pacemaker that is responsible for aligning rhythms in various physiological functions. The suprachiasmatic nucleus (SCN) of the hypothalamus functions as the master circadian pacemaker synchronizing behavioral and physiological rhythms to the environmental light-dark cycle1. The regulation of clocks residing outside of the SCN in peripheral tissues is less clear. Optimal coordination of rhythms in metabolic processes with nutrient availability involves signals emanating from the SCN and hypothalamus, as well as autonomous inputs from nutrient-sensors responding to metabolic flux and body temperature 2. The mammalian molecular clock is composed of a transcriptional feedback loop where the heterodimers of the transcription factors BMAL1 (brain and muscle ARNT-iike protein 1) and CLOCK (circadian locomotor output cycles kaput) or NPAS2 (Neuronal PAS domain-containing protein 2) activate the transcription of the Period (Perl, Perl and Peri) and Crytochrome (Cry] and Cry!) genes. Subsequently the PER/CRY proteins feedback to inhibit BMALI /CLOCK activity resulting in a rhythmic, circadian pattern of expression of these genes3. Members of the REV-ERB group of nuclear receptors also have an important role in feedback regulation of the circadian oscillator. Both Bmail and Clock are direct REV-ERB target genes , and loss of REV-E B alters circadian behavior 4. The physiological iigand for REV-ERBa and β was recently identified as heme, and the suppression of expression of REV-ERB target genes is heme-dependent"' '. Based on observations that REV-ERB activity is regulated by a small molecule ligand, we and others have sought to identify and characterize synthetic ligand s. Unfortunately, the characteristics of the compounds identified thus far- ruled out evaluating their effects on modulating REV-ERB activity in vivo8 i j . Anxiety disorders are among the most common mental disorders and nearly 30% of individuals will be directly affected by an anxiety disorder at some point in their lifetime, thus these disorders significantly burden our society. Common pharmacological treatments for anxiety are γ-aminobutyric acid (GABA) receptor agonists (e.g. benzodiazapenes), selective serotonin and/or norepinephrine reuptake inhibitors (SSRls/SNRls; e.g. fiuoxitene, duloxitine) and serotonin (5-HT) receptor agonists (e.g. buspirone). GABA receptor agonists typically act very rapidly and exhibit very good efficacy, but are associated with dependence/tolerance and sedation. SSRI/SNRI antidepressants are utilized for long-term treatment of anxiety disorders and typically display broad anxiolytic activity, but their onset of anxiolytic activity

' takes several weeks. Similarly, buspirone, a 5- T A partial agonist, can take several weeks to display activity and is only effective in treatment of a subset of anxiety disorders. Given the predominance of anxiety disorders in our society, there continues to be a focus on development of novel anxiolytic agents with improved efficacy and/or side effect profiles. SUMMARY We describe the identification and development of potent synthetic EV-E B ligands, such as in vivo agonists and antagonists. These compounds allow for characterization of the effects of modulation of this receptor in vivo specifically on circadian behavior and metabolism, and have suitable characteristics for development of medicinal compounds useful for treatment of malconditions such as diabetes, obesity, atherosclerosis, dyslipidemia, circadian rhythm disorders, coronary artery disease, bipolar disorder, depression, cancer, sleep disorders, anxiety disorders, and autoimmune disorders. In various embodiments, the invention provides a modulator of a REV-ERB receptor in vitro and in vivo, The modulator of the invention can be a compound of formula (Ϊ),

wherein 2 2 is CR2, CO, S0 2, or CR with a (CR2) bridge wherein n = 1, 2, 3 to Ar , X Y, orX 3; 1 1 X is CR2, CO, S0 2, or CR with a (CR2) bridge wherein n = , 2, 3 to Ar , X Y, or X3; 3 1 X is CR2, CO, S0 2, or CR with a (CR2) bridge wherein n = , 2, 3 to Ar Ar2, X , or X2; or X3 is absent; each independently selected R is H or (Cl-C6)alkyl; Ar 1 is alkyl, alkoxy, cycloalkyl, cycioalkoxy, aryi, aryloxy, aryialkenyi, heterocyclyl, heterocylyloxy, heteroaiyi, or heteroaryloxy, wherein Ar 1 is substituted with 0-3 J ; or X l Arl is H ; Ar2 is cycloalkyl, aryl, or heteroaryl, wherein Ar2 is substituted with 0-3 J; Y is II, hydroxy(Cl-C6)alkyl, aryloxy(Cl-C6)alkyL arylalkoxy(Cl-C6)alkyl, heteroaryloxy(Cl-C6)alkyl, heteroarylalkoxy(Cl-C6)alkyl, wherein any alkyl, aryl, aryloxy, heteroaryl, or heteroaryloxy is substituted with 0-3 J; or Y is C(=0)W wherein W is OR or NR2; CN; cycloalkyi, heterocyclyi, aryl, arvlalkyl, heteroaryi, or heteroarylalkyi, wherein any cycloalkyi, heterocyclyi, aryl, arvlalkyl, heteroaryi, or hetero arvlalkyl, is substituted with 0-3 J;

J is R, hydr y(Cl -C6)aikyi, R2N-(C1 ~C6)aIkyl, halo, halo(Cl -C6)alkyL nitro, cyano, RS(0) or RN(R)S(0 )q wherein q = 0, 1, or 2, C(=0)OR, C( 0)R,

C(=0)NR 2, N(R)C(=0)OR, N(R)C(=0)R, or N(R)C(=0)NR 2; each independently selected R is II, (Cl-C6)alkyl, (Cl-C6)acyl, aryl, aroyl, or aryl(Cl -C6)alkyl, wherein any alkyl, acyl, aryl, aroyl, or aralkyl is substituted with 0- 3 J ; or a pharmaceutically acceptable salt thereof;

chlorophenyi or 3,4-dichlorophenyl. In various embodiments, the invention provides a pharmaceutical composition comprising a compound of the invention and a pharmaceutically acceptable excipient. In various embodiments, the invention provides a method of modulating a REV-ERB receptor, comprising contacting the receptor and an effective amount or concentration of a compound of the invention. Modulation can include the effects of an agonist or an antagonist on the receptor. In various embodiments, the invention pro vides a method of altering a circadian rhythm in a mammal comprising administering to the mammal an effective amount of a compound of the i vention In various embodiments, the invention provides a method of treating a malcondition in a mammal wherein modulation of a REV-ERB is medically indicated, comprising administering to the mammal an effective dose of a compound of the invention. Compounds of the invention can be useful in the treatment of maiconditions comprising diabetes, obesity, atherosclerosis, dysiipidemia, a circadian rhythm disorder, coronary artery disease, bipolar disorder, depression, cancer, a sleep disorder, an anxiety disorder, an addiction disorder, or an autoimmune disorder.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows: a, Chemical structures of SR9011 and SR9009. b, GAL4- REV-ERBcc and GAL4-REV-ERBp cotransfection assays in E 293 cells illustrating the acti vity of SR901 and 9009 and comparing the activity to GS 4 2 . c, Cotransfection assay in HEK293 cells with full-length REV-ERBa and a luciferase reporter driven by the Email promoter, d, Bioluniinescence record from a Per2 J SCN treated with 5 µΜ SR90 as indicated by the bar. The right panels display the period and amplitude of the oscillations prior to, during, and after treatment with SR9011. e, Expression of REV-ERB responsive genes after treatment with various doses of SR9011 or 100 g kg of SR9009 (i.p., b.i.d.) for 6-days. * indicates p<0.05. ** indicates jxO.05 vs. before SR9011 and during SR9011 treatment. Figure 2 shows: a, Actograms illustrating the effect of single injections of vehicie, SR90 (100 g kg, i.p.) or SR90 (100 mg/kg, i.p.) on circadian behavior. C57B16 mice were initially maintained on a 12h:12h L:D cycle and altered to constant darkness (D:D) after 7-days. After 12 days on D:D the animals were injected with vehicle or compound at CT6, which was calculated empirically based on the actogram of each individual mouse b, Normalized expression levels of several core clock genes following administration of SR9011 or vehicle under constant dark conditions. C57B16 mice were administered SR9011 (100 mg/kg, i,p.) at CT0 on a day of constant darkness. Hypothalami were collected at CT0, CT6, CT12, and CT18 and gene expression was determined and normalized to cyclophilin. Data were double plotted, c, Actograms illustrating the effect of single injections of vehicie, SR901 1, or SR9009 in mice maintained under 12:12 L:D conditions, d, Normalized expression levels of several core clock genes following administration of SR9011 or vehicle under L:D (12:12) conditions. Methods for c and d were otherwise identical to a and b. * indicates p<0.05. Figure 3 shows: a, Treatment of mice (Balb/c) with SR901 results in weight loss and fat mass loss. Animals were dosed with SR9011 (lOOmg/kg, i.p., b.i.d.) for 12 days, b, Oxygen consumption (VO ) is increased in mice treated with SR901 . Results were obtained in using CLAMS and C57B16 mice were dosed as described in a except that the duration of treatment was 10 days, c, Oxygen consumption (V0 ) is increased during both the diurnal and nocturnal phases of C57B16 mice when they are treated with SR901 . Data obtained from the experiment described in b was analyzed for time of day differences, d, Mice treated with S 901 are less active in the CLAMS as detected by the number of x-axis beam breaks, e, After completion of the 10-day CLAMS experiment animals fat mass was assessed by DEXA. f, Results from a CLAMS experiment illustrating the diurnal increase in oxygen consumption prior to and immediately after administration of SR901 . Note the ~3h delay in the diurnal peak in VO following administration of SR9011. * indicates p<0.05. Figure 4 depicts data showing that REV-ERB ligands alter the pattern of circadian expression of metabolic genes in the liver, skeletal muscle and adipose tissue. C57B16 mice were administered a single dose of SR9011 (100 mg kg, i.p.) at CT0 and groups of animals (n-6) were sacrificed at CT0, 6, 12, and and tissues isolated for analysis of gene expression by QPCR using cyclophilin expression as a normalizing control. Graphs were double plotted . a, Expression of core clock genes from the liver of vehicle treated vs. SR901 treated mice, b, Expression of metabolic genes from the liver of vehicle treated vs. SR90 treated mice, c, Expression of metabolic genes from the skeletal muscle of vehicle treated vs. SR901 1 treated mice, d, Expression of metabolic genes from the white adipose tissue (WAT) of vehicle treated vs. SR901 treated mice, * indicates p<0.05. Figure 5 shows SR9009 treatment results in a decrease in fat mass and in plasma lipids in diet-induced obese mice: a, Diet-induced obese mice on SR9009 treatment lose weight vs. vehicle treated mice. C57B16 mice on a high fat diet were administered SR9009 (lOOmg/kg, i.p., b.Ld) for 30 days, b Diet-induced obese mice on SR9009 treatment exhibit lower fat mass vs. vehicle treated mice, c, Fasting plasma triglycerides (TG), cholesterol (Choi), non-esterified fatty acids (NEFA) and glucoseare decreased in SR9009 treated DIO mice, d, Plasma Leptin and IL-6 levels from DIO mice treated with vehicle or SR9009. e, Fasting plasma TG and Choi are decreased by SR9009 treatment in lean C57B16 mice. Mice were administered 100 mg kg, i.p., b.i.d. SR9009 for 10 days f, Fasting plasma TG and Choi are decreased by SR90 treatment in lean C57B16 mice. Mice were administered 100 mg/kg, i.p., b.i.d. SR90I1 for 7 days g, Expression of metabolic genes in liver, white adipose tissue (WAT) and skeletal muscle of DIO mice treated with SR9009 as described in a. Gene expression was measured by QPC and normalized to cyclophilin expression. * indicates p<0,05, Figure 6 shows data demonstrating that an anxiolytic effect of SR901 i is observed in open field and elevated plus maze test a, Results from the open field assay demonstrating that mice administered SR901 spend a significantiy greater amount of time in the center field during the first 30 minutes after placing the animals in the apparatus than mice treated with vehicle, b, SR9011 treated mice display equivalent locomotor activity as vehicle treated mice in the open field assay. Results from elevated plus maze demonstrates that SR90 treated mice spend a greater percentage of time exploring the open quadrants (c) and exhibit a greater frequency of open arm entries (d) than vehicle treated mice. Results from the novel object (neophobia) assay demonstrating that SR9011 treated mice spend more time near the novel object (e) and travel more distance near the novel object (f) than vehicle treated mice. *P<().()5. Mean+ SEM, n=12 mice per group. Figure 7 shows results from the light-dark box assay demonstrating that mice treated with SR9011 spend considerably more time in the light box than vehicle- treated mice (a) while display no difference in the total number of transitions between the boxes (b). Results from the marble burying assay demonstrate that SR9011 treated mice bury fewer marbles than vehicle treated mice (c) and this effect is dose- responsive (d). *P<0.05. Mean+ SEM, n 2 mice per group. Figure 8 depicts data demonstrating that no sedation or condition place preference is observed with SR9011. Sleep-wake parameters (wakefulness, slow wave sleep (SWS) and rapid eye movement (REM) sleep) is not altered after SR9001 administration (a), injection time (CT1 8) is indicated by blue dotted line, SR9 does not alter SWS or REM sleep latecy (b). Data are expressed mean ± SEM. All graphs are plotted per h for a 24 h period. Values are mean + SEM (n =8). *P < 0.05 (c) Results from a conditioned-place preference assay demonstrates that SR901 does not display activity in this assay.. *P<0.05. Mean+ SEM, n=12 mice per group. Figure 9 is a bar graph showing SR90 clearly displays the ability to suppress the conditioned place preference activity of cocaine. Figure 10 is a bar graph showing that both REV-ERB agonists caused a decrease in reporter gene transcription consistent with REV-ERB playing an important role in regulation of L 7 DETAILED DESCRIPTION Definitions As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. The term "about" as used herein, when referring to a numerical value or range, allows for a degree of variability in the value or range, for example, within 10%, or within 5% of a stated value or of a stated limit of a range. All percent compositions are given as weight-percentages, unless otherwise stated. All average molecular weights of polymers are weight-average molecular weights, unless otherwise specified. As used herein, "individual" (as in the subject of the treatment) or "patient" means both mammals and non-mammals. Mammals include, for example, humans; non-human primates, e.g. apes and monkeys; and non-primates, e.g. dogs, cats, cattle, horses, sheep, and goats. Non-mammals include, for example, fish and birds. The term "disease" or "disorder" or "malcondition" are used interchangeably, and are used to refer to diseases or conditions wherein REV-ERB plays a role in the biochemical mechanisms involved in the disease or malcondition or symptom(s) thereof such that a therapeutically beneficial effect can be achieved by acting o REV-ERB. "Acting on" REV-ERB or "modulating" REV-ERB, can include binding to REV-ERB and/or inhibiting the bioactivity of REV-ERB and/or allosterically regulating the bioactivity of REV-ERB in vivo. The expression "effective amount", when used to describe therapy to an individual suffering from a disorder, refers to the amount of a compound of the invention that is effective to inhibit or otherwise act on REV-ERB in the individual's tissues wherein REV-ERB involved in the disorder is active, wherein such inhibition or other action occurs to an extent sufficient to produce a beneficial therapeutic effect. REV-ERB includes REV-ERBa, REV-ERBp, and other nuclear receptors of the family. "Substantially" as the term is used herein means completely or almost completely; for example, a composition that is "substantially free" of a component either has none of the component or contains such a trace amount that any relevant functional property of the composition is unaffected by the presence of the trace amount, or a compound is "substantially pure" is there are only negligible traces of impurities present.

"Treating" or "treatment" within the meaning herein refers to an alleviation of symptoms associated with a disorder or disease, or inhibition of further progression or worsening of those symptoms, or prevention or prophylaxis of the disease or disorder, or curing the disease or disorder. Similarly, as used herein, an "effective amount" or a "therapeutically effective amount" of a compound of the invention refers to an amount of the compound that alleviates, in whole or in part, symptoms associated with the disorder or condition, or halts or slows further progression or worsening o f those symptoms, or prevents or provides prophylaxis for the disorder or condition. In particular, a "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount is also one in which any toxic or detrimental effects of compounds of the invention are outweighed by the therapeutically beneficial effects. Phrases such as "under conditions suitable to provide" or "under conditions sufficient to yield" or the like, in the context of methods of synthesis, as used herein refers to reaction conditions, such as time, temperature, solvent, reactant concentrations, and the like, that are within ordinary skill fo r an experimenter to vary, that provide a useful quantity or yield of a reaction product. It is not necessary that the desired reaction product be the only reaction product or that the starting materials be entirely consumed, provided the desired reaction product can be isolated or otherwise further used. By "chemically feasible" is meant a bonding arrangement or a compound where the generally understood rules of organic structure are not violated; for example a structure within a definition of a claim that would contain in certain situations a pentavalent carbon atom that would not exist in nature would be understood to not be within the claim. The structures disclosed herein, in all of their embodiments are intended to include on y "chemically feasible" structures, and any recited structures that are not chemically feasible, for example in a structure shown with variable atoms or groups, are not intended to be disclosed or claimed herein. An "analog" of a chemical structure, as the term is used herein, refers to a chemical structure that preserves substantial similarity with the parent structure, although it may not be readily derived synthetically from the parent structure. A related chemical structure that is readily derived synthetically from a parent chemical structure is referred to as a "derivative." When a substituent is specified to be an atom or atoms of specified identity, "or a bond", a configuration is referred to when the substituent is "a bond" that the groups that are immediately adjacent to the specified substituent are directly connected to each other in a chemically feasible bonding configuration. All chiral, diastereomeric, racemic forms of a structure are intended, unless a particular stereochemistry or isomeric form is specifically indicated. Compounds used in the present invention can include enriched or resolved optical isomers at any or all asymmetric atoms as are apparent from the depictions, at any degree of enrichment. Both racemic and diastereomeric mixtures, as well as the individual optical isomers can be isolated or synthesized so as to be substantially free of their enantiomeric or diastereomeric partners, and these are all within the scope of the invention. As used herein, the terms "stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated herein. A "small molecule" refers to an organic compound, including an organometailic compound, of a molecular weight less than about 2 kDa, that is not a polynucleotide, a polypeptide, a polysaccharide, or a synthetic polymer composed of a plurality of repeating units. As to any of the groups described herein, which contain one or more substituents, it is understood that such groups do not contain any substitution or substitution patterns which are sterically impractical and/or synthetically non- feasible, n addition, the compounds of this disclosed subject matter include all stereochemical isomers arising from the substitution of these compounds. Selected substituents within the compounds described herein are present to a recursive degree. In this context, "recursive substituent" means that a substituent may recite another instance of itself. Because of the recursive nature of such substituents, theoretically, a large number may be present in any given claim. One of ordinary skill in the art of medicinal chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the compound intended. Such properties include, by of example and not limitation, physical properties such as molecular weight, solubility or log P, application properties such as activity against the intended target, and practical properties such as ease of synthesis. Recursive substituents are an intended aspect of the disclosed subject matter. One of ordinary skill in the art of medicinal and organic chemistry understands the versatility of such substituents. To the degree that recursive substituents are present in a claim of the disclosed subject matter, the total number should be determined as set forth above. When a group, e.g., an "alkyl" group, is referred to without any limitation on the number of atoms in the group, it is understood that the claim is definite and limited with respect the size of the alkyl group, both by definition; i.e., the size (the number of carbon atoms) possessed by group such as an alkyl group is a finite number, less than the total number of carbon atoms in the universe and bounded by the understanding of the person of ordinary skill as to the size of the group as being reasonable for a molecular entity; and by functionality, i.e., the size of the group such as the alkyl group is bounded by the functional properties the group bestows on a molecule containing the group such as solubility in aqueous or organic liquid media. Therefore, a claim reciting an "alkyl' ' or other chemical group or moiety is definite and bounded, as the number of atoms in the group cannot be infinite, The term "amino protecting group" or "N-protected" as used herein refers to those groups intended to protect an amino group against undesirable reactions during synthetic procedures and which can later be removed to reveal the amine. Commonly used amino protecting groups are disclosed in Protective Groups in Organic

Synthesis, Greene, T.W.; Wilts, P. G. ML, John Wiley & Sons, New York, NY, (3rd Fidition, 1999). Amino protecting groups include acyl groups such as formyl, acetyl, propionyl, pivaloyl, t-butylacetyi, 2-chloroacetyl, 2-bromoaeetyl, trilluoroacetyi, trichloro acetyl, o-nitrophenoxyacetyl, a-chlorobutyryl, benzoyl, 4-chlorobenzoyl, 4- bromobenzoyi, 4-nitrobenzoyl, and the like; sulfonyl groups such as benzenesulfonyl, p-toluenesulfonyl and the like; alkoxy- or aryloxy-carbonyl groups (which form urethanes with the protected amine) such as benzyioxycarbonyl (Cbz), p- chlorobenzyloxycarbonyl, p-methoxybenzyloxycarbonyl, p-nitrobenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl, p-bromobenzyioxyearbonyl, 3,4- dimethoxybenzyloxycarbonyl, 3,5-dimetb.oxybenzyloxycarbonyl, 2,4- dimethoxybenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, 2-nitro-4,5- dimethoxybenzyioxycarbonyl, 3,4,5-trnnethoxybenzyloxyearbonyl, 1-(p-biphenylyl)- -methyiethoxycarbonyl, a,a-dimethyl-3,5-dimethoxybenzyloxycarbonyl, benzhydryioxycarbonyi, t-butyloxycarbonyl (Boc), diisopropylmethoxycarbonyl, isopropyloxycarbonyl, ethoxycarbonyl, methoxycarbonyl, allyloxvcaibonyl (Alloc), 2,2,2-trichloroethoxyearbonyl, 2-triraethyisilylethyloxycarbonyl (Teoc), phenoxycarbonyl, 4-nilrophenoxycarbonyl, fiuorenyi-9-methoxycarbonyi (Fmoc), cyclopentyloxycarbonyi, adamantyloxycarbonyl, cyclohexyioxycarbonyi, phenylthiocarbonyl and the like; araikyl groups such as benzyl, triphenylmethyl, benzyloxymethyl and the like; and si y groups such as trimethyisilyl and the like. Amine protecting groups also include cyclic amino protecting groups such as phfhaloyi and dithiosuceinimidyl, which incorporate the amino nitrogen into a heterocycle. Typically, amino protecting groups include fbrmyl, acetyl, benzoyl, pivaloyi, t-butylacetyl, phenylsulfonyi, Alloc, Teoc benzyl, Fmoc, Boc and Cbz. It is well within the skill of the ordinary artisan to select and use the appropriate amino protecting group for the synthetic task at hand. The term "hydroxy! protecting group" or "O-protected" as used herein refers to those groups intended to protect an OH group against undesirable reactions during synthetic procedures and which can later be removed to reveal the amine. Commonly used hydroxy! protecting groups are disclosed in Protective Groups in Organic Synthesis, Greene, T.W.; Wuts, P. G. M., John Wiley & Sons, New York, NY, (3rd Edition, 1999). Hydroxy! protecting groups include acyl groups such as formyl, acetyl, propionyl, pivaloyi, t-butyiacety!, 2-chioroacetyl, 2-bromoacetyl, trifiuoroacetyl, trichioroacetyl, o-nitropbenoxyacetyl, a-chlorobutyryl, benzoyl, 4- ch!orobenzoyl, 4-bromobenzoyl, 4-nitrobenzoyl, and the like; su!fony! groups such as benzenesu!fony!, p-toluenesu!fony! and the like; acyioxy groups (which form urethanes with the protected amine) such as benzyloxycarbonyi (Cbz), p- ehlorobenzyloxycarbonyl, p-methoxybenzyloxycarbonyl, p-nitrobenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl, p-bromobenzyloxycarbonyl, 3,4- dimethoxybenzyioxycarbonyl, 3,5-dimethoxybenzyioxycarbonyl, 2,4- dimethoxybenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, 2-nitro-4,5- diraethoxybenzyloxycarbonyi, 3,4,5-trimethoxybenzyloxycarbonyl, l-(p-biphenylyl)- 1-methylethoxycarbonyi, a,a-dimethyl -3,5-di etho ybenzy ycarbony , benzbydryloxycarbonyi, t-butyloxycarbonyl (Boc), diisopropyinietboxycarbonyl, isopropyloxycarbonyl, ethoxycarbonyl, methoxycarbonyl, allyloxycarbonyl (Alloc), 2,2,2-trichloroeihoxycarbonyl, 2-trimethylsilylethyloxycarbonyl (Teoc), phenoxycarbonyl, 4-nitrophenoxycarbonyl, lTuorenyl-9-methoxycarbonyl (Fmoc), cyclopentyloxycarbonyl, adainantyloxycarbonyl, cyclohexyloxycarbonyl, phenylthiocarbonyl and the like; araikyl groups such as benzyl, triphenylmethyi, benzyioxymethyl and the like; and si y groups such as trimethylsiiyl and the like, t is well within the skill of the ordinary artisan to select and use the appropriate hydroxy! protecting group for the synthetic task at hand. n general, "substituted" refers to an organic group as defined herein in which one or more bonds to a hydrogen atom contained therein are replaced by one or more bonds to a non-hydrogen atom such as, but not limited to, a halogen (i.e., F, C , Br, and I); an oxygen atom in groups such as hydroxyl groups, aikoxy groups, aryloxy groups, aralkyloxy groups, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, and carboxylate esters; a sulfur atom in groups such as thiol groups, aikyi and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; a nitrogen atom in groups such as amines, hydroxylamines, nitriles, nitro groups, N-oxides, hydrazides, azides, and enamines; and other heteroatoms in various other groups. Non-limiting examples of substituents J that can be bonded to a substituted carbon (or other) atom include F, C ,

Br, I, OR', OC(0)N(R') 2, CN, NO, N0 , ON0 2, azido, CF3, OCF , R', O (oxo), S ' (thiono), methylenedioxy, ethylenedioxy, N(R )2, SR', SOR', S0 2R', S0 2N(R')2,

S0 3R C(0)R', .' K -. C(0)CH 2C(0)R', C(S)R\ C(0)OR', OC(0)R',

C(0)N(R') , OC(0)N(R'} , C(S)N(R') 2, (C 2) - N(R')C(O)R', (C 2)o- N(R')N(R') , * * * N(R )N(R')C(0)R', N(R')N(R')C(0)OR', N R )N(R')CON(R') 2, N(R')S0 2R ,

N(R')S0 2N(R')2, N(R')C(0)OR', N(R')C(0)R', N(R')C(S)R', N(R')C(0)N(R') 2, , * N(R')C(S)N(R ) , N(COR')COR', N(OR )R', C(=NH)N(R') 2, C(0)N(OR')R', or C(=NOR')R' wherein R' can be hydrogen or a carbon-based moiety, and wherein the carbon-based moiety can itself be further substituted; for example, wherein R' can be hydrogen, aikyi, aey!, cycioaikyl, aryl, aralkyl, beterocyclyl, beteroaryl, or heteroaryialkyl, wherein any ai y , acyl, cycioalkyl, ary , aralkyl, heterocyciyl, heteroaryl, or heteroaryialkyl or R can be independently mono- or mul i-substituted with J; or wherein two R' groups bonded to a nitrogen atom or to adjacent nitrogen atoms can together with the nitrogen atom or atoms form a heterocyciyl, which can be mono- or independently multi-substituted with J, When a substituent is monovalent, such as, for example, F or CI, it is bonded to the atom it is substituting by a single bond. When a substituent is more than monovalent, such as (), which is divalent, it can be bonded to the atom it is substituting by more than one bond, i.e., a divalent substituent is bonded by a double bond; for example, a C substituted with O forms a carbonyl group, C O, which can also be written as "CO", "C(O)", or "C(=0)", wherein the C and the O are double bonded. When a carbon atom is substituted with a double-bonded oxygen (=0) group, the oxygen substituent is termed an "oxo" group. When a divalent substituent such as NR is double-bonded to a carbon atom, the resulting C(=NR) group is termed an "imino" group. When a divalent substituent such as S is double -bonded to a carbon atom, the results C(=S) group is termed a "thiocarbonyl" or "thiono" group. Alternatively, a divalent substituent such as 0 or S can be connected by two single bonds to two different carbon atoms. For example, , a divalent substituent, can be bonded to each of two adjacent carbon atoms to provide an epoxide group, or the O can form a bridging ether group, termed an "oxy" group, between adjacent or non-adjacent carbon atoms, for example bridging the 1,4-carbons of a cyclohexyl group to form a [2.2. j-oxabicyclo system. Further, any substituent can be bonded to a carbon or other atom by a linker, such as (CH ) or (CR' )n wherein n is 1, 2, 3, or more, and each ' is independently selected. C(O) and (0 2groups can also be bound to one or two he eroatoms, such as nitrogen or oxygen, rather than to a carbon atom. For example, when a C(O) group is bound to one carbon and one nitrogen atom, the resulting group is called an "amide" or "carboxamide." When a C(O) group is bound to two nitrogen atoms, the functional group is termed a "urea." When a C(O) is bonded to one oxygen and one nitrogen atom, the resulting group is termed a "carbamate" or "urethane." When a S(0) 2 group is bound to one carbon and one nitrogen atom, the resulting unit is termed a

"sulfonamide." When a S(0) 2 group is bound to two nitrogen atoms, the resulting unit is termed a "sulfamate." Substituted a ky , alkenyl, alkynyl, cycloalkyl, and eycioaikenyl groups as well as other substituted groups also include groups in which one or more bonds to a hydrogen ato are replaced by one or more bonds, including double or triple bonds, to a carbon atom, or to a heteroatom such as, but not limited to, oxygen in carbonyl (oxo), carboxyl, ester, amide, imide, urethane, and urea groups; and nitrogen in imines, hydroxyimines, oximes, hydrazones, amidines, guanidines, and nitrites. Substituted ring groups such as substituted cycloalkyl, aryl, heterocyclyi and heteroaryl groups also include rings and fused ring systems in which a bond to a hydrogen atom is replaced with a bond to a carbon atom. Therefore, substituted cycloalkyl, aryl, heterocyclyi and heteroaryl groups can also be substituted with alkyi, alkenyl, and alkynyl groups as defined herein. By a "ring system" as the term is used herein is meant a moiety comprising one, two, three or more rings, which can be substituted with non-ring groups or with other ring systems, or both, which can be fully saturated, partially unsaturated, fully unsaturated, or aromatic, and when the ring system includes more than a single ring, the rings can be fused, bridging, or spirocyciic. By "spirocyciic" is meant the class of structures wherein two rings are fused at a single tetrahedral carbon atom, as is well known in the art. As to any of the groups described herein, which contain one or more substituents, it is understood, of course, that such groups do not contain any substitution or substitution patterns which are sterically impractical and/or synthetically non-feasible. In addition, the compounds of this disclosed subject matter include all stereochemical isomers arising from the substitution of these compounds. Selected substituents within the compounds described herein are present to a recursive degree. In this context, "recursive substituent" means that a substituent may recite another instance of itself or of another substituent that itself recites the first substituent. Because of the recursive nature of such substituents, theoretically, a large number may be present in any given claim. One of ordinary skill in the art of medicinal chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the compound intended. Such properties include, by way of example and not limitation, physical properties such as molecular weight, solubility or log P, application properties s ch as activity against the intended target, and practical properties such as ease of synthesis. Recursive substituents are an intended aspect of the disclosed subject matter. One of ordinary skill in the art of medicinal and organic chemistry understands the versatility of such substituents. To the degree that recursive substituents are present in a claim of the disclosed subject matter, the total number should be determined as set forth above. Alky! groups include straight chain and branched alkyl groups and cycloalkyl groups having from 1 to about 20 carbon atoms, and typically from 1 to 12 carbons or, in some embodiments, from to 8 carbon atoms. Examples of straight chain alkyl groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n- butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. Examples of branched alkyl groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethyipropyi groups. As used herein, the term "alkyl" encompasses n -alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl. Representative substituted alkyl groups can be substituted one or more times with any of the groups listed above, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups. Cycloalkyl groups are cyclic alkyl groups such as, but not limited to, cyciopropyl, cyciobutyl, cyciopentyi, cyclohexyi, cycloheptyl, and cyclooctyi groups, n some embodiments, the cycloalkyl group can have 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 4, 5, 6, or 7. Cycloalkyl groups further include polycyclic cycloalkyl groups such as, but not limited to, norbornyl, adamantyi, bornyi, camphenyl, isocamphenyl, and carenyi groups, and fused rings such as, but not limited to, decaiinyl, and the like. Cycloalkyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined above. Representative substituted cycloalkyl groups can be mono- substituted or substituted more than once, such as, but not limited to, 2,2-, 2,3-, 2,4- 2,5- or 2,6-disubstituted cyclohexyi groups or mono-, di- or tri-substituted norbornyl or cycloheptyl groups, which can be substituted with, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups. The term "cycloalkenyl" alone or in combination denotes a cyclic alkenyl group. The terms "carbocyclic," "earboeyelyl," and "earbocycle" denote a ring structure wherein the atoms of the sing are carbon, such as a cycloaikyl group or an aryl group, n so e embodiments, the earbocycle has 3 to 8 ring members, whereas in other embodiments the number of ring carbon atoms is 4, 5, 6, or 7. Unless specifically indicated to the contrary, the carbocyclic ring can be substituted with as many as N-i substituents wherein N is the size of the carbocyclic ring with, for example, alkyl, alkenyl, alkynyl, amino, aryl, hydroxy, cyano, carboxy, heteroaryl, heterocyclyl, nitro, thio, alkoxy, and halogen groups, or other groups as are listed above. A earboeyelyl ring can be a cycloaikyl ring, a cycloalkenyl ring, or an aryl ring. A earboeyelyl can be monocyclic or polycyclic, and if polycyclic each ring can be independently be a cycloaikyl ring, a cycloalkenyl ring, or an aryl ring. (Cycloaikyl) lkyl groups, also denoted cycloalkylalkyl, are alkyl groups as defined above in which a hydrogen or carbon bond of the alkyl group is replaced with a bond to a cycloaikyl group as defined above. Alkenyl groups include straight and branched chain and cyclic alkyl groups as defined above, except that at least one double bond exists between two carbon atoms. Thus, alkenyl groups have from 2 to about 20 carbon atoms, and typically from 2 to 2 carbons or, in some embodiments, from 2 to 8 carbon atoms. Examples include, but are not limited to vinyl, -CH=CH(CH 3), -CH=C(CH )2, -C(CH 3)=CH 2,

-C(CH 3)==CH(CH3), -C(CH2CH3)==CH2, cyciohexenyi, cyclopentenvl, cyclohexadienyl, butadienyl, pentadienyl, and hexadienyl among others. Cycloalkenyl groups include cycloaikyl groups having at least one double bond between 2 carbons. Thus for example, cycloalkenyl groups include but are not limited to cyciohexenyi, cyclopentenvl, and cyclohexadienyl groups. Cycloalkenyl groups can have from 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 5, 6, or 7. Cycloaikyl groups further include polycyclic cycloaikyl groups such as, but not limited to, norbornyi, adamantyi, bornyl, camphenyl, isocamphenyl, and carenyl groups, and fused rings such as, but not limited to, decaiinyl, and the like, provided they include at least one double bond within a ring. Cycloalkenyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined above. (Cyeloalkenyl)aikyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of the alkyl group is replaced with a bond to a cycloalkenyl group as defined above. Alkynyl groups include straight and branched chain alkyl groups, except that at least one triple bond exists between two carbon atoms. Thus, alkynyl groups have from 2 to about 20 carbon atoms, and typically from 2 to 12 carbons or, in some embodiments, from 2 to carbon atoms. Examples include, but are not limited to -

C , -C (CH ), -C C(C 2C ), -CH 2C H , -C 2 C(CH3), and

-C 2 S C 2C 3 among others. The term "heteroalkyl" by itself or in combination with another term means, unless otherwise stated, a stable straight or branched chain alkyl group consisting of the stated number of carbon atoms and one or two heteroatoms selected from the group consisting of , N, and S, and wherein the nitrogen and sulfur atoms may be optionally oxidized and the nitrogen heteroatom may be optionally quaternized. The heteroatom(s) may be placed at any position of the heteroalkyl group, including between the rest of the heteroalkyl group and the fragment to which it is attached, as well as attached to the most distal carbon atom in the heteroalkyl group. Examples include: -0-CH 2-CH2-CH3, -CH2-CH2CH2-OH, -CH2-CH2-NH-CH3,

-CH2 -S-CH2-CH5, -CH2CH2-S(=0)-CH , and -CH2CH2-0-CH 2CH -0-CH 3. Up to two heteroatoms may be consecutive, such as, for example, -CH2 -NH-OCH3, or -

A "cycloheteroalkyl" ring is a cycloalkyl ring containing at least one heteroatom. A cycloheteroalkyl ring can also be termed a "heterocyclyi," described below. The term "heteroalkenyl" by itself or in combination with another term means, unless otherwise stated, a stable straight or branched chain monounsaturated or di-unsaturated hydrocarbon group consisting of the stated number of carbon atoms and one or two heteroatoms selected from the group consisting of O, N, and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quaternized. Up to two heteroatoms may be placed consecutively. Examples include -CH=CH-0-CH 3, -CH=CH-CH2-OH,

- - -CH=CH-N(CH3)-CH3, -CH2-CH=CH-CH2-SH, and and -

CH=CH-0-CH 2CH2-0-CH . Aryl groups are cyclic aromatic hydrocarbons that do not contain heteroatoms in the sing. Thus aryl groups include, but are not limited to, phenyl, azuienyl, heptalenyl, biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylenyl, anthracenyl, and naphthyl groups. n some embodiments, aryl groups contain about 6 to about 14 carbons in the ring portions of the groups. Aryl groups can be unsubslituted or substituted, as defined above. Representative substituted aryl groups can be mono-substituted or substituted more than once, such as, but not limited to, 2-, 3-, 4-, 5-, or 6-substituted phenyl or 2-8 substituted naphthyl groups, which can be substituted with carbon or non-carbon groups such as tho e listed above. Aralkyl groups are a kyl groups as defined abo ve in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined above. Representative aralkyl groups include benzyl and phenylethyl groups and fused (cycloalkylaryl)alkyl groups such as 4-ethyl-indanyl. Aralkenyl group are alkenyl groups as defined above in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined above. Heterocyclyi groups or the term "heterocyclyl" includes aromatic and non- aromatic ring compounds containing 3 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, O, and S. Thus a heterocyclyl can be a cycioheteroaiky!, or a heteroarvl, or if polycvclic, any combination thereof. n some embodiments, heterocyclyl groups include 3 to about 20 ring members, whereas other such groups have 3 to about 15 ring members. A heterocyclyl group designated as a

C2-heterocyclyl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a (Vheterocyclyl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. A heterocyclyl ring can also include one or more double bonds. A heteroarvl ring is an embodiment of a heterocyclyl group. The phrase "heterocyclyl group" includes fused ring species including those comprising fused aromatic and non-aromatic groups. For example, a dioxolanyl ring and a benzdioxolanyl ring system (methylenedioxyphenyl ring system) are both heterocyclyi groups within the meaning herein. The phrase also includes polycyclic ring systems containing a heteroatom such as, but not limited to, quinuciidyi. Heterocyciyl groups can be unsubstituted, or can be substituted as discussed above. Heterocyciyl groups include, but are not limited to, pyrrolidinyi, piperidinyl, piperazinyi, morpboiinyl, pyrrolyl, pyrazolyl, triazoiyl, tetrazolyl, oxazolyl, isoxazoiyl, thiazolyl, pyridinyi, thiophenyl, benzothiophenyl, benzofuranyl, dihydrobenzofuranyl, indoiyl, dihydroindolyi, azaindolyl, indazolyl, benzimidazolyi, azabenzimidazoiyl, benzoxazoiyl, benzothiazolyi, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyi, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Representative substituted heterocyciyl groups can be mono- substituted or substituted more than once, such as, but not limited to, piperidinyl or quinolinyl groups, which are 2-, 3-, 4-, 5-, or 6-substituted, or disubstituted with groups such as those listed above. Heteroaryl groups are aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatorn such as, but not limited to, N, , and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members. A heteroaryl group is a variety of a heterocyciyl group that possesses an aromatic electronic structure. A heteroaryl group designated as a (Vheteroaryl can be a 5-ring with two carbon atoms and three hetero toms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a C -heteroaryl can be a 5-ring with one heteroatorn, a 6-ring with two heteroatoms, and so forth. 'The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazoiyl, tetrazolyl, oxazolyl, isoxazoiyl, thiazolyl, pyridinyi, thiophenyl, benzothiophenyl, benzofuranyl, indoiyl, azaindolyl, indazolyl, benzimidazolyi, azabenzimidazoiyl, benzoxazoiyl, benzothiazolyi, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyi, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Heteroaryl groups can be unsubstituted, or can be substituted with groups as is discussed above. Representative substituted heteroaryl groups can be substituted one or more times with groups such as those listed above. Additional examples of aryl and heteroaryl groups include but are not limited to phenyl, biphenvl, indenyi, naphthyl ( 1-naphthyl, 2-naphthyl), N-hydroxytetrazolyl,

N-hydroxytriazoiyl, N-hydrox yimidazolyl , anthracenyl ( 1-anthraeenyi, 2-anthracenyi, 3-anthracenyl), thiophenyl (2-fhienyl, 3-thienyl), furyi (2-furyi, 3-furyl , indolyl, oxadiazolyl, isoxazoiyl, quinazoiinyl, fluorenyi, xanthenyl, isoindaoyi, benzhydryl, acridinyl, thiazolyl, pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1- imidazolyl, 2-imidazoIyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1,2,3-triazol-l-yl, l,2,3-triazol-2-yl l,2,3-triazol-4-yl, l,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4 - oxazolyi, 5-oxazolyl), thiazolyl (2-thiazolyl, 4-thiazolyl, 5-thiazoiyl), pyridyl (2- pyridyl, 3-pyridyi, 4-py dy ) pyrimidinyl ( -pyrimidinyl, 4-pyrimidinyl, 5- pyrimidinyl, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3- pyfidazinyl, 4-pyridazinyl, 5- pyridazinyl), quinolyl (2-quinolyl, 3-quinolyl, 4-quinolyi, 5-quinolyl, 6-qumolyl, 7- quinolyl, 8-quinolyl), isoquinolyi ( 1-isoquinolyl, 3-isoquinolyl, 4-isoquinoiyl, 5- isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), benzo[b]furanyl (2- benzo [bj&ranyl, 3-benzo [b anyi, 4-benzo [bjfuranyl, 5-benzo [bj&ranyl, 6-benzo[b]furanyl, 7-benzo[b]furanyl), 2,3-dihydro-benzo [bjfuranyl (2-(2,3-dihydro- benzo [bjfuranyl), 3-(2,3-dihydro-benzo[b]furanyl), 4-(2,3-diliydro-benzo[b]furanyi), 5-(2,3-diliydro~benzo[b]furanyi), 6-(2,3-diliydro~benzo [bjfuranyl), 7-(2,3-dihydro- benzo[bJfuranyl), benzo [b]thiophenyl (2~benzo[bJthiophenyl, 3-benzo[bJthiophenyl, 4-benzo[b]thiophenyl, 5-benzo[bJthiophenyl, 6-benzo[bJthiophenyl, 7- benzo[b]thiophenyi), 2,3-dihydro-benzo[bJthiophenyl, (2-(2,3-dihydro- benzo[bjthiophenyl), 3-(2,3-dihydro-benzo[b]thiophenyi), 4-(2,3-dihydro- benzo[bjthiophenyl), 5-(2,3-dihydro-benzo[b]thiophenyi), 6-(2,3-dihydro- benzo[bJthiophenyi), 7-(2,3-dihydro-benzo[b]thiophersyl), indolyl ( 1-indolyl, 2-indolyl, -indolyl, 4-indolyl, 5-indoiyl, 6-indolyi, 7-indolyl), indazoie (1-indazolyl, 3-indaz.olyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazoiyl ( -benzin dazo y , 2-benzimidazolyl, 4-benzimidazolyl, 5-benzimidazoiyl, 6- benzimidazoiyl, 7-benzimidazolyl, 8-benzimidazoiyl), benzoxazoiyl -benzoxazoiyl,

2-benzoxazolyl), benzothiazolyi ( 1-benzothiazoiyl, 2-benzothiazolyi, 4- benzothiazolyl, 5-benzo thiazolyl, 6-benzothiazoiyl, 7-benzothiazolyl), carbazoiyl (1- carbazolyi, 2-carbazolyl, 3-carbazolyl, 4-carbazolyl), 5H-dibenz[b,fjazepme (5H- dibenz[b,fjazepin-l-yi, 5H-dibenz[b,fJazepine-2-yl, 5H-dibenz[b,fJazepine-3-yl, 5H- dibenz[b,f]azepine-4-yl, 5H-dibenz[b,f|azepine-5-yi), 10 , -dihydro-5H- dibenz[b,fjazepine (10,1 l-dihydro-5II-dibenz[b,†]azepine-l-yi, 10,1 l-dihydro-5H- dibenz[b,fjazepine-2-yl, 10,1 l-dihydro-5H-dibenz[b,fJazepine-3-yl, 10,1 1-diliydro- 5H-dibenz[b,fJazepine-4-yi, 10,ll-dihydro-5H-dibenz[b,fjazepine-5-yi), and the like. Heteroeyclylalkyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of an alkyl group as defined above is replaced with a bond to a heterocyclyl group as defined above. Representative heterocyciyl alkyl groups include, but are not limited to, furan-2-yl methyl, furan-3-yl methyl, pyridine-3-yl methyl, tetrahydrofuran-2-yl ethyl, and indoi-2-yi propyl. Heteroarylaikyl groups are alkyl groups as defined above in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heteroaryi group as defined abo e. The term "aikoxy" refers to an oxygen atom connected to an alkyi group, including a cycloalkyl group, as are defined above. Examples of linear aikoxy groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyioxy, and the like. Examples of branched aikoxy include but are not limited to isopropoxy, sec-butoxy, tert-butoxy, isopentyioxy, isohexyloxy, and the like. Examples of cyclic aikoxy include but are not limited to cyclopropyioxy, cyclobutyioxy, cyclopentyioxy, cyciohexyioxy, and the like. An aikoxy group can include one to about 12-20 carbon atoms bonded to the oxygen atom, and can further include double or triple bonds, and can also include heteroatoms. For example, an allyioxy group is an aikoxy group within the meaning herein. A methoxyethoxy group is also an aikoxy group within the meaning herein, as is a methylenedioxy group in a context where two adjacent atoms of a structures are substituted therewith. The terms "halo" or "halogen" or "halide" by themselves or as part of another substituent mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom, preferably, fluorine, chlorine, or bromine, A "haloalkyl" group includes mono-halo alkyi groups, poly-halo alkyl groups wherein all halo atoms can be the same or different, and per-halo alkyl groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro. Examples of haloalkyl include trifluoromethyl, ,1-dichloroethyl, 1,2-dicbloroethyl, 1,3- dibromo-3,3-difluoropropyi, periluorobutyl, and the like, A "haloalkoxy" group includes mono-halo aikoxy groups, poly-halo aikoxy groups wherein all halo atoms can be the same or different, and per-halo aikoxy groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro.

Examples of haloalkoxy include trifluoromethoxy, 1,1 -dichioroethoxy, 1,2- dicJiioroethoxy, l,3-dibromo-3,3-difluoropropoxy, perfluorobutoxy, and the like. The term "(C Cv)periluoroalkyl," wherein x < y, means an a ky group with a minimum of x carbon atoms and a maximum of y carbon atoms, wherein all hydrogen atoms are replaced by fluorine atoms. Preferred is -(Ci-Ceiperfluoroalkyl, more preferred is -(Ci-C3)perfluoroalkyi, most preferred is -CF3. The term "(C -Cy)perfluoroalkylene," wherein x < y, means an alkyl group with a minimum of x carbon atoms and a maximum of y carbon atoms, wherein all hydrogen atoms are replaced by fluorine atoms. Preferred is

-(Ci-C6)perfluoroaIkylene, more preferred is -(C -C3 )perfluoroalkylene, most preferred is -CF 2- . The terms "aryloxy" and "arylalkoxy" refer to, respectively, an aryl group bonded to an oxygen atom and an aralkyl group bonded to the oxygen atom at the alkyl moiety. Examples include but are not limited to phenoxy, naphthyloxy, and benzyloxy. An "acyl" group as the term is used herein refers to a group containing a carbonyi moiety wherein the group is bonded via the carbonyi carbon atom. The carbonyi carbon atom is also bonded to another carbon atom, which can be part of an alkyl, aryl, aralkyl cycloalkyl, cycloalkylalkyl, heterocyclyi, heterocyclylalkyi, heteroaryi, heteroaryialkyl group or the like. In the special case wherein the carbonyi carbon atom is bonded to a hydrogen, the group is a "formyl" group, an acyl group as the term is defined herein. An acy group can include 0 to about 12-20 additional carbon atoms bonded to the carbonyi group. An acyl group can include double or triple bonds within the meaning herein. An acryloyi group is an example of an acyl group. An acyl group can also include heteroatoms within the meaning here. A nicotinoyi group (pyridyl-3-carbonyl) group is an example of an acyl group within the meaning herein. Other examples include acetyl, benzoyl, phenylacetyl, pyrklylaeetyi, einnamoyl, and acryloyi groups and the like. When the group containing the carbon atom that is bonded to the carbonyi carbon atom contains a halogen, the group is termed a "haloacyl" group. An example is a trifluoroacetyl group. The ter "amine" includes primary, secondary, and tertiary amines having, e.g., the formula N(group ) 3 wherein each group can independently be H or non-H, such as alkyl, ary , and the like. Amines include but are not limited to R-N , for example, alkylamines, arylamines, alkylarylamines; R2NII wherein each is independently selected, such as dialkyiamines, diarylamines, aralkylamines, heterocyclyiamines and the like; and R N wherein each R is independently selected, such as trialkylamines, diaikyiaryiamines, alkyldiaryiamines, triarylamines, and the like. The term "amine" also includes ammonium ions as used herein.

+ An "amino" group is a substituent of the form -N¾, -NHR, -NR ¾ -NR , wherein each R is independently selected, and protonated forms of each, except for -

N R 3 , which cannot be protonated. Accordingly, any compound substituted with an amino group can be viewed as an amine. An "amino group" within the meaning herein can be a primary, secondary, tertiary or quaternary amino group. An "alkylamino" group includes a monoalkyiamino, diaikylamino, and trialkylamino group.

An "ammonium" ion includes the unsubstituted ammonium ion N .4+ , but unless otherwise specified, it also includes any protonated or quaternarized forms of amines. Thus, trimethyiamnionium hydrochloride and tetramethylammonium chloride are both ammonium ions, and amines, within the meaning herein.

The term "amide" (or "amido") includes C - and N-amide groups, i.e., C(())NR2, and -NRC(0)R groups, respectively. Amide groups therefore include but are not limited to primary carboxamide groups (-C(0)NH 2) and formamide groups (-

NHC(O)H). A "carboxamido" group is a group of the formula ) ·.. wherein R can be , alkyi, aryl, etc.

The term "azido" refers to an N 3 group. An "azide" can be an organic azide o r can be a salt of the azide (N 3 ) anion. The term "nitro" refers to an N 2 group bonded to an organic moiety. The term "nitroso" refers to an NO group bonded to an organic moiety. The term nitrate refers to an ONO 2 group bonded to an organic moiety or to a salt of the nitrate (NO 3 ) anion. The term "urethane" ("carbamoyl" or "carbamyl") includes N- and O-urethane groups, i.e., -NRC(0)OR and -OC(0)NR 2 groups, respectively. The term "sulfonamide" (or "suifonamido") includes S- and N-suifonamide groups, i.e., -SO2NR2 and -NRSO2R groups, respectively. Sulfonamide groups therefore include but are not limited to sulfamoyl groups (-SO2NH2). An organosulfur structure represented by the formula -S(0)(NR)- is understood to refer to a sulfoximine, wherein both the oxygen and the nitrogen atoms are bonded to the sulfur atom, which is also bonded to two carbon atoms. The term "amidine" or "amidino" includes groups of the formula -C NR NR .

Typically, an amidino group is ---C( )N 2. The term "guanidine" or "guanidino" includes groups of the formula

-NRC(NR)NR , Typically, a guanidino group is -NHC(NH)NH 2. Standard abbreviations for chemical groups such as are well known in the art are used; e.g., Me = methyl, Et = ethyl, i-Pr = isopropyi, Bu = butyl, t-Bu = tert-butyl, Ph = phenyl, Bn = benzyl, Ac = acetyl, Bz = benzoyl, and the like. A "salt" as is well known in the art includes an organic compound such as a carboxylic acid, a sulfonic acid, or an amine, in ionic form, in combination with a counterion. For example, acids in their anionic form can form salts with cations such as metal cations, for example sodium, potassium, and the like; with ammonium salts such as NF or the cations of various amines, including tetraalkyl ammonium salts such as tetramethyl ammonium, or other cations such as trimethylsuifonium, and the like. A "pharmaceutically acceptable" or "pharmacologically acceptable" salt is a salt formed from an ion that has been approved for human consumption and is generally non-toxic, such as a chloride salt or a sodium salt. A "zwitterion" is an internal salt such as can be formed in a molecule that has at least two ionizable groups, one forming an anion and the other a cation, which serve to balance each other. For example, amino acids such as glycine can exist in a zwitterionic form. A "zwitterion" is a salt within the meaning herein. The compounds of the present invention may take the form of salts. The term "salts" embraces addition salts of free acids or free bases which are compounds of the invention. Salts can be "pharmaceutically-acceptable salts." The term "pharmaceutically-acceptable salt" refers to salts which possess toxicity profiles within a range that affords utility in pharmaceutical applications. Pharmaceutically unacceptable salts may nonetheless possess properties such as high crystaliinity, which have utility in the practice of the present invention, such as for example utility in process of synthesis, purification or formulation of compounds of the invention. Suitable pharmaceutically-acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric, and phosphoric acids. Appropriate organic acids maybe selected from aliphatic, eycloaiiphatic, aromatic, araiiphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, giycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesuifonic, ethanesulfonic, henzenesuifonic, pantothenic, trifiuoromethanesulfonie, 2-hydroxyethanesulfonie, p-toiuenesulfonic, sulfaniiic, cyclohexylammosulfonic, stearic, aiginic, β-hydroxybutyric, salicylic, galactaric and galacturonic acid. Examples of pharmaceutically unacceptable acid addition salts include, for example, perchlorates and ietrafiuoroborates. Suitable pharmaceutically acceptable base addition salts of compounds of the invention include, for example, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N N -dibenzyleihylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglueamine) and procaine. Examples of pharmaceutically unacceptable base addition salts include lithium salts and eyanate salts. Although pharmaceutically unacceptable salts are not generally useful as medicaments, such salts may be useful, for example as intermediates in the synthesis of Formula (I) compounds, for example in their purification by recrystallization. A l of these salts may be prepared by conventional means from the corresponding compound according to Formula (I) by reacting, for example, the appropriate acid or base with the compound according to Formula (I). The term "pharmaceutically acceptable salts" refers to nontoxic inorganic or organic acid and/or base addition salts, see, for example, Lit et al., Salt Selection for Basic Drugs (1986), hit J. Phann. 33, 201-217, incorporated by reference herein. A "hydrate" is a compound that exists in a composition with water molecules. The composition can include water in stoichiometric quantities, such as a monohydrate or a dihydrate, or can include water in random amounts. As the term is used herein a "hydrate" refers to a solid form, i.e., a compound in water solution, while it may be hydrated, is not a hydrate as the term is used herein. A "solvate" is a similar composition except that a solvent other that water replaces the water. For example, methanol or ethanol can form an "alcoholate", which can again be stoichiometric or non-stoichiometric. As the term is used herein a "solvate" refers to a solid form, i.e., a compound in solution in a solvent, while it may be so!yated, is not a solvate as the term is used herein. A "prodrug" as is well known in the art is a substance that can be administered to a patient where the substance is converted in vivo by the action of biochemicals within the patients body, such as enzymes, to the active pharmaceutical ingredient. Examples of prodrugs include esters of carboxylic acid groups, which can be hydrolyzed by endogenous esterases as are found in the bloodstream of humans and other mammals. Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in "Design of Prodrugs", ed. H. Bundgaard, Elsevier, 1985. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. For example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, claims for X being bromine and claims for X being bromine and chlorine are fully described. Moreover, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any combination of individual members or subgroups of members of Markush groups. Thus, for example, if is described as selected from the group consisting of bromine, chlorine, and iodine, and Y is described as selected from the group consisting of methyl, ethyl, and propyl, claims for X being bromine and Y being methyl are fully described. If a value of a variable that is necessarily an integer, e.g., the number of carbon atoms in an a ky group or the number of substituents on a ring, is described as a range, e.g., 0-4, what is meant is that the value can be any integer between 0 and 4 inclusive, i.e., 0, 1, 2, 3, or 4. n various embodiments, the compound or set of compounds, such as are used in the inventive methods, can be anyone of any of the combinations and/or sub combinations of the above-listed embodiments. In various embodiments, a compound as shown in any of the Examples, or among the exemplary compounds, is provided. Provisos may apply to any of the disclosed categories or embodiments wherein any one or more of the other above disclosed embodiments or species may be excluded from such categories or embodiments. The present invention further embraces isolated compounds of the invention. The expression "isolated compound" refers to a preparation of a compound of the invention, or a mixture of compounds the invention, wherein the isolated compound has been separated from the reagents used, and/or byproducts formed, in the synthesis of the compound or compounds. "Isolated" does not mean that the preparation is technically pure (homogeneous), but it is sufficiently pure to compound in a form in which it can be used therapeutically. Preferably an "isolated compound" refers to a preparation of a compound of the invention or a mixture of compounds of the invention, which contains the named compound or mixture of compounds of the invention in an amount of at least percent by weight of the total weight. Preferably the preparation contains the named compound or mixture of compounds in an amount of at least 50 percent by weight of the total weight; more preferably at least 80 percent by weight of the total weight; and most preferably at least 90 percent, at least 95 percent or at least 98 percent by weight of the total weight of the preparation. The compounds of the invention and intermediates may be isolated from their reaction mixtures and purified by standard techniques such as filtration, liq id-liq d extraction, solid phase extraction, distillation, reerystaliization or chromatography, including flash column chromatography, or HPLC. Isomerism and Tautomerism in Compounds of the Invention Tautomerism

Within the present invention it is to be understood that a compound of the formula (I) or a sa t thereof may exhibit the phenomenon of tautomerism whereby two chemical compounds that are capable of facile interconversion by exchanging a hydrogen atom between two atoms, to either of which it forms a covalent bond. Since the tautomeric compounds exist in mobile equilibrium with each other they may be regarded as different isomeric forms of the same compo d. It is to be understood that the formulae drawings within this specification can represent only one of the possible tautomeric forms. However, it is also to be understood that the invention encompasses any tautomeric form, and is not to be limited merely to any one tautomeric form utilized within the formulae drawings. The formulae drawings within this specification can represent only one of the possible tautomeric forms and it is to be understood that the specification encompasses ail possible tautomeric forms of the compounds drawn not just those forms which it has been convenient to show graphically herein. For example, tautomerism may be exhibited by a pyrazolyl group bonded as indicated by the wavy line. While both substituents would be termed a 4- pyrazolyl group, it is evident that a different nitrogen atom bears the hydrogen atom in each structure.

Such tautomerism can also occur with substituted pyrazoles such as 3-methyl, 5-methyl, or 3,5-dimethylpyrazoles, and the like. Another example of tautomerism is amido-imido (lactam-lactim when cyclic) tautomerism, such as is seen in heterocyclic compounds bearing a ring oxygen atom adjacent to a ring nitrogen atom. For example, the equilibrium:

is an example of tautomerism. Accordingly, a structure depicted herein as one tautomer is intended to also include the other tautomer.

Optical Isomerism It will be understood that when compounds of the present invention contain one or more chiral centers, the compounds may exist in, and may be isolated as pure enantiomeric or diastereomeric forms or as racemic mixtures. The present invention therefore includes any possible enantiomers, diastereomers, racemates or mixtures thereof of the compounds of the invention. The isomers resulting from the presence of a chirai center comprise a pair of non-superimposable isomers that are called "enantiomers." Single enantiomers of a pure compound are optically active, i.e., they are capable of rotating the plane of plane polarized light. Single enantiomers are designated according to the Cahn-Jngold-Prelog system. The priority of substituents is ranked based on atomic weights, a higher atomic weight, as determined by the systematic procedure, having a higher priority ranking. Once the priority ranking of the four groups is determined, the molecule is oriented so that the lowest ranking group is pointed away from the viewer. Then, if the descending rank order of the other groups proceeds clockwise, the molecule is designated (R) and if the descending rank of the other groups proceeds counterclockwise, the molecule is designated (S). In the example in Scheme , the Cahn-Jngold-Prelog ranking is A > B > C > D. The lowest ranking atom, D is oriented away from the

( ) configuration (S) configuration The present invention is meant to encompass diastereomers as well as their racemic and resolved, diastereomerically and enantiomencally pure forms and salts thereof. Diastereomeric pairs may be resolved by known separation techniques including normal and reverse phase chromatography, and crystallization. "isolated optical isomer" means a compound which has been substantially purified from the corresponding optical isomer(s) of the same formula. Preferably, the isolated isomer is at least about 80%, more preferably at least 90% pure, even more preferably at least 98% pure, most preferably at least about 99% pure, by weight. Isolated optical isomers may be purified from racemic mixtures by well-known chiral separation techniques. According to one such method, a racemic mixture of a compound of the invention, or a chiral intermediate thereof, is separated into 99% w pure optical isomers by ITPLC using a suitable chiral column, such as a member of the series of DAICEL ® C IRALPA ® family of columns (Daicel Chemical Industries, Ltd., Tokyo, Japan). The column is operated according to the manufacturer ' instructions. Rotational Isomerism It is understood that due to chemical properties (i.e., resonance lending some double bond character to the C-N bond) of restricted rotation about the amide bond linkage (as illustrated below) it is possible to observe separate retainer species and even, under some circumstances, to isolate such species (see below). It is further understood that certain structural elements, including steric bu k or substituents on the amide nitrogen, may enhance the stability of a rotamer to the extent that a compound may be isolated as, and exist indefinitely, as a single stable rotamer. The present invention therefore includes any possible stable rotamers of formula (I) which are biologically act e in the treatment of cancer or other proliferative disease states.

Regioisornerism The preferred compounds of the present invention have a particular spatial arrangement of substituents on the aromatic rings, which is related to the structure activity relationship demonstrated by the compound class. Often such substitution arrangement is denoted by a numbering system; however, numbering systems a e often not consistent between different ring systems. In six-membered aromatic systems, the spatial arrangements are specified by the common nomenclature "para' ' for 1,4-substitution, "meta" for 1,3-substitution and "ortho" for ,2 -substitution as shown below.

"para--" "meta--" "ortho-"

In various embodiments, the compound or set of compounds, such as ai e among the inventive compounds or are used in the inventive methods, can be any one of any of the combinations and/or sub-combinations of the above-listed embodiments.

Detailed Description The present invention is directed in various embodiments to inventive compounds for modulating a REV-ERB receptor; to methods of using the compounds in treatment of various malconditions: and to methods of synthesizing the compounds. In various embodiments, the invention provides a compound of formula (I) wherein

1 2 2 X is CR.2, CO, SO 2, or CR with a (CR 2)n bridge wherein n - 1, 2, 3 to Ar , X , Y, or X3;

1 1 X is CR2, CO, S0 2, or CR with a (C 2)» bridge wherein n = 1, 2, 3 to Ar , X , Y, or X3;

X3 is CR , CO, SO - or CR with a (CR )„ bridge wherein n = , 2, 3 to Ar 1' Ar2, X 1, or X2; or X3 is absent; each independently selected R is H or (Cl-C6)alkyl; Ar' is alkyl, alkoxy, cvcloalkyl, cycloalkoxy, aryi, aryloxy, aryialkenyi, heterocyclyl, heterocylyloxy, heteroaiyl, or hetero aryloxy, wherein Ar 1 is substituted with 0-3 J ; or X'Ar is II; Ar2 is cvcloalkyl, aryl, or heteroaryl, wherein Ar2 is substituted with 0-3 J ; Y is II, hydroxy(Cl-C6)alkyl, aryloxy(Cl-C6)alkyL arylalkoxy(Cl-C6)alkyl, heteroaryloxy(Cl-C6)alkyl, heteroarylalkoxy(Cl-C6)alkyl, wherein any alkyl, aryi, aryloxy, heteroaryl, or hetero aryloxy is substituted with 0-3 J; or Y is C(=0)W wherein W is OR or NR2; CN; cvcloalkyl, heterocyclyl, aryl, aryialkyl, heteroaryl, or hetero ary alkyi, wherein any cycloalkyl, heterocyclyl, aryl, aryialkyl, heteroaryl, or hetero aryialkyl, is substituted with 0-3 J;

J is R, hydro xy(C]-C6)aikyi, R2N-(Cl-C6)alkyL halo, halo(Cl-C6)alkyl, nitro, cyano, RS(0) or RN(R)S(0) wherein q = 0, , or 2 , C(=0)OR, C(=0)R,

C(=0)NR 2, N(R)C(=0)OR, N(R)C(=0)R, or N(R)C(=0)NR 2; each independently selected R is , (Cl-C6)aJkyl, (Cl-C6)acyl, aryl, aroyl, or aryl(Cl-C6)aikyi, wherein any alkyl, acyl, aryl, aroyl, or aralkyl is substituted with 0- 3 J ; or a pharmaceutically acceptable salt thereof; provided the compound is not of formula (II) wherein X is =0 or II?., and either (a) R is p-chlorophenyl and is CCValkyl or CON(alkyl)2, or (b) wherein one of ' and R2 is phenyl and the other is p- chlorophenyl or 3,4-dichlorophenyl. For example, A can be heteroaryl substituted with 0-3J. More specifically, 1 A can be thienyl substituted with nitro, RS(0) q, halo, or haloalkyl, Or, Ar can be pyridyl, furyi, oxazolyl, thiazolyl, benzothioazolyl, furyi, benzofuryi, quinolyl, or isoquinolyl, any of which is substituted with 0-3 J, Alternatively, Ar1 can be phenyl, naphthyl, or styryl, any of which is substituted with 0-3 J, In various embodiments, the invention provides a compound of formula (I) wherein Ar2 is phenyl or naphthyl, substituted with 0-3 J. In various embodiments, the invention provides a compound of formula I) wherein Y is C(=0)W, or is heteroeyciyl substituted with 0-3 J, More specifically, Y can comprise a pyrrolidinyl or piperidinyl group. In various embodiments, the invention pro vides a compound of formula (I) wherein X 1 is CO or Cl¾. In various embodiments, the invention provides a compound of formula (I) wherein X2 is € ? or SO?.. In various embodiments, the invention provides a compound of formula I) 3 3 wherein X is absent, or wherein X is CH with a CH2 bridge to Ar , In various embodiments, the invention provides a compound of formula (II)

wherein X', Ar , R, and J are as defined above for formula (I), p = 0, 1, 2, 3, or 4, Z 2 3 is O or NR, Z is CR2 or a bond, and R is H, (Cl-C6)alkyl; C(=0)W wherein W is OR or NR _; CN; or R is cycloalkvl, heterocyclyl, aryl, or heteroaryl, wherein any alkyl, cycloalkvl, heterocyclyl, aryl, or heteroaryl is substituted with 0-3 J , In various embod me ts, the invention provides a compound of formula (I) wherein the compound is any of those shown in Table except compounds 1 or 9. Table 1: Specifically Claimed Compoimds Comp. comparative compound Y - ethoxycarbonyl Y = ethoxycarbonyl Y = ethoxycarbonyl Y = ethoxycarbonyl

piperidin-3-yl piperidin-4-yl

Y = ethoxycarbonyl methyl ester of 232

Y hydroxymethyl

m ethyl phenoxymethyi Synthetic Methods Compounds of the invention can be prepared by persons of ordinary skill in the art using the matter disclosed herein in conjunction with the knowledge of the person of ordinary skill in synthetic organic chemistry. General and specific synthetic schemes are shown below Scheme 1 , .

X X 1

Reaction CondiSons: a . Na3H(OAc) , HOAc, Ci(CH ) CI, H N(CH^ C<¾tBu; b. RCHO, NaBH(OAe) , HOAc, CI(CH ) CI; c . RCOCI, TEA; d .

RS Ci, TES; e. RNCO, toluene; f.NaBH(OAc) , HOAc, Ci(C )2C!, 2 (C H2).,4-Ci-Ph; g. 4-C!-PbCHQ, NaBH(OAc) , HOAc, CI(CH ) Ci.

Sc errse

b.c.d or e ; then f

Experiments! Protocol: a . BOH, H S¾; b. RCHO, aBH Ac ; 0 ROOCI, TEA;

-((4 -chlorobenzyl )(( 5 -nilTolMophen-2 -yl)meLhyl)arnmo)acetic acid (2) To a solution of 5-nitrotliiophene-2-carbaldehyde (377 mg) i dichloroethane (5mL) at 0° C was added t-butyi glycine (365 mg) followed by HOAc (0.5mL) and NaBHiOAc) (696 mg). The reaction was allowed to come to room temperature with stirring overnight. The reaction mixture was diluted with EtOAc, and sat aq NaHC(¾, and the layers were separated . The organic layer was washed with sat aq NaHCOs (2x), brine (lx), dried (MgS(¾), and concentrated to give tert-butyl 2-(((5- nifromiophen-2-yl)methyl)amino)acetate as a pale yellow oi . This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. Step 2 : tert-butyl 2-((4-chlorobenzyl)((5 -nLtrothiophen-2-yl)methyl)amino)acetate To a solution of the crude tert-butyl 2-(((5-nitrothiophen-2- yi)methyl)amino)acetate from Step , 1 in dichloroethane (lOmL), at 0° C was added 4- chlorobenzaldehyde (336 mg) followed by HOAc (0.5mL) and NaBH(OAc) 3 (696 mg). The reaction was allowed to come to room temperature with stirring overnight.

The reaction mixture was diluted with EtOAc, and sat aq N SHC 3, and the layers were separated. The organic layer was washed with sat aq N aH 'O , (2x), brine (lx), dried (MgSO^), and concentrated to give tert-butyl 2-((4-chlorobenzyi)((5- nitrothiophen-2-yl)methyi)amino)acetate as a pale yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound as a light yellow oil, which crystallized. MS (EST) 396.9 (M+); NMR δ (400 MHz, CD2a 2) (ppm) 7.8 (d, 1H), 7.4-7.3 (m, 4H), 6.9 (d, 1H), 4.1 (s, 2H), 3.9 (s, 2H), 3.3 s, 2H), 1.5 (s, 9H). Step 3: 2-((4-chlorobenzyl)((S-nitrothiophen-2-yl)methyl)amino)acetic acid To a solution of tert-butyl 2-((4-cMorobenzyl)((5-nitrotMophen-2- yl)methyi)amino)acetate (mg, mniol) in CH2C 2 was added TEA (mL). When the starting ester was consumed, as judged by analytical reverse -phase HPL.C, the reaction was concentrated in vacuo, to provide the title compound.

2-((4-chlorobe zyl)((5-ni rothiophen-2.-yl methyl)am ;no aceta id (3) The title compound was prepared following the same general protocol as described in compound 4 using chloroacetamide. MS (ESI) 339.8 (M+).

2-((4-cMorobenzyl)((5-nitrotMophen-2-yl)methyl)amino)acetonitrile (4)

To a solution of compound 224 (50 mg) in EtOH ( nL) was added chloroacetonitrile (7 mg). The reaction was heated to reflux for 48h, cooled and concentrated. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. MS (ESI) 321.8 (M+).

Tert-butyl 2-(((5-nitrothiophen-2-yl)methyl)amino)acetate

To a solution of 5-mtrothiophene-2-carbaldehyde in dichloroethane at 0° € was added t-butyl glycine (1.0 equiv) followed by HOAc (catalytic amount) and NaBH(OAe) (1.5 equiv). The reaction was allowed to come to room temperature with stirring overnight. The reaction mixture was diluted with EtOAc, and sat aq

NaHC0 3, and the layers were separated. The organic layer was washed with sat aq NaHC03 (2K), brine ( x), dried (MgSO ), and concentrated to give tert-butyl 2-(((5- nitrothiophen-2-yl)methyi)amino)acetate as a pale yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. Tert-butyl 2-((4-methoxybenzyl)((5-nitrotMophen-2-yl)methyl)amino)acetate To a solution o f tert-butyl 2-(((5-nitrotliiophen-2-yl)methyl)amino)acetate in dichioroethane at 0 C was added 4-methoxybenzaldehyde ( .0 equiv) followed by HOAc and aBH OAc (1.5 equiv). The reaction was allowed to come to room temperature with stirring overnight. The reaction mixture was diluted with EtOAc, and sat aq NaH X , and the layers were separated. The organic layer was washed with sat aq Na (2x), brine ( ), dried (MgS0 4), and concentrated to give tert- butyl 2-((4-methoxyberizyi)((5-nitrotMophen-2-yl)methyi)amino)acetate as a pale yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound as a light yellow oil, which crystallized. MS (ESI) 393 (M + H).

Tert-butyl 2-((3-flm^robenzyl)((5-nitTothiOphen-2-yl)methyl )arnmo)acetate (6)

The title compound was prepared following the same general protocol as described for compound 5, using 3-iluorobenzaidehyde. MS (ESI) 3 (M + H)

Ethyl 2-(5-(niethylsulio carboxylate (7) To a solution of ethyl 1 ,2,3,4-tetrahydroisoquinoline-3-carboxylate (50 mg) in

CH2CI2 (I mL) was added diisopropylethylamine (70 µ .) followed by 5- (methylsulfonyl)thiophene-2-carboxylic acid (56 mg) and HATU (139 mg). After stirring at room temperature for 8h, the reaction was diluted with EtOAc and sat aq Na C , and the layers were separated. The organic layer was washed with sat aq

Na CO (2x), 1M HC1 (2x), brine ·; . dried (MgS() 4), and concentrated to give the title compound as a pale yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford ethyl 2-(5~ (methylsulfonyl)thiophene-2-carbonyl)-l ,2,3,4-tetrahydroisoquinoline-3-carboxylate.

MS (ESI) 393.8 (M+).

Ethyl 2-(5-(methyltMo)tMophene-2-cat bonyl)- l ,2,3,4-tetrahydroisoquinoline-3-

The title compound was prepared following the same general protocol as described for compound 7 using l ,2,3,4-tetrahydroisoquinoline-3-carboxylate and 5- (methylthio)thiophene-2-carbonyl chloride. MS (ESI) 361 .9 (M+).

Methyl 2-((4-chk robenzyl)((5-nit ol iophe -2-yl)methyl)ammo)acetat.e (9) The title compound was prepared following the same general protocol as described for compound 2 using 5-nitrothiophene-2-caifc aldehyde, glycine methyl ester, and 4-Cl-benzaldehyde. MS (ESI) 354.95 (M+).

The title compound was prepared following the same general protocol as described for compound 7 using ethyl ,2,3,4-tetrahydroisoquino3ine-3-carboxylate and p-toluenesulfonylchloride. MS (ESI) 359.95 (M+H).

-benzoy - ,2 ,4-tetrahydroisoquino JAne-3-earboxylate ( )

The title compound was prepared following the same general protocol as described for compound 7 using ethyl ,2,3,4-tet a iydroisoquinoline-3-ca boxyiate and benzoyl chloride. MS (ESI) 310.0 (M+H).

-isonicotinoyl-l ,2,3,4- etraiiydroisoquinoline-3-carboxylate (12)

The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,4-tetrahydroisoquinoline-3-carboxylate and isonieotinoyi chloride. MS (ESI) 3 . (M+H).

Eth yl 2 The title compound was prepared following the same general protocol as described for compound 7 using ethyl l 2,3,4-tetrahydroisoquinoline-3-ca boxylate and picolinoyl chloride. MS (ESI) 310.99 (M+H).

The title compound was prepared following the same general protocol as described for compound 7 using l,2,3,4-tetrahydroisoquinoline-3-carboxylate and 3- bromobenzoyi chloride. MS (ESI) 388, 390 (M+H).

2-(4-nitrobenzoyl)-l,2,3/4-tetrahydroisoquinoline-3-carboxylate (15)

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3,4-tetrahydroisoqumoline-3-carboxylate and 4- itrobenzoyl chloride. MS (ESD354.89 (M+H).

Ethyl 2-(l-naphthoyl)-1,2,3,4-tetrahydroisoquinoline-3-carboxylate (16) The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,4-tetrahydroisoqumoline-3-carboxylate and 1-naphthoyl chloride. MS (ESI) 359.96 (M+H).

The title compound was prepared following the same general protocol as described for compound 7 using ethyl ,2,3,4-tetrahydroisoquinoline-3-carboxylate and 5-methylfuran-2-carbonyl chloride. MS (ESI) 313.93 (M+H).

carbonyl)-l 2 4-tetra hydroisoquinoline-3-carboxylate (18)

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3,4-tetrahydroisoqumoline-3-carboxylate and isoxazole-5-earbonyi chloride. MS (ESI) 300.85 (M+H).

Ethyl 2-(5-methylisoxazole-3-carbonyl)-l,2,3,4-teti^ydroisoquinoline-3-carboxylate

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3 ,4-tetrahydroisoqumoline-3-carboxylate and 5-methylisoxazole-3-carbonyl chloride. MS (ESI) 4.87 (M+H).

Ethyl 2.-(2-chlorobenz.oyl)-1 .2,3/j-teirahydroisoquinoline-3-carboxylate (20) The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,44etrahydroisoquinoline-3-carboxylate and 2-chlorobenzoyl chloride, MS (ESI) 343.92, 345.92 (3 : ) (M+H).

The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,4-tetrahydroisoquinoline~3~carboxylate and cyclohexanecarbonyl chloride. MS (EST) 315.94 (M+H).

(S)-ethyl 2-(5-(methylMo)thiophene-2^

The title compound was prepared following the same general protocol as described for compound 7 using ethyl (S)-l,2,3,4-tetraliydroisoquinoline~3- carboxyiate and 5-(methylthio)thiophene-2-carbonyl chloride. MS (ESI) 361.87 (M+H).

Tert-butyl 2-((naphthalen-l-y (23) The title compound was prepared following the same general protocol as described for compound 2 using 1-naphthaldehyde . MS (ESI) 412,9 (M+H),

Tert-butyl 2-((naphtlialen-2-ylnietliyl)((S-rdtrothiophen-2-yl)methyl)animo)acetate

The title compound was prepared following the same general protocol as described for compound 2 using 2-naphthaldehyde. MS (ESI) 4 2.83 (M+H).

Tert-butyl 2 - 4- ethyl-N (S--nitrothiophen-2-yl)methyl)phenylsulfonamido)acetate

The title compound was prepared following the same general protocol as described for compound 32 using tert-butyl 2-(((5-nitrothiophen-2- yl)methyl)amino)acetate and p-toluenesulfonylchloride, MS (EST) 426.7 (M+H).

Tert-butyl 2-(N- ((5--nitrothiophen-2- yl) ethyl)-1-naphthamklo)acetate (26) The title compound was prepared following the same general protocol as described for compound 32 using tert-butyl 2~(((5-nitrothiophen-2- yl)methyi)amino)acetate and 1-naphthoyl chloride. MS (ESI) 426.6 (M+H).

Tert-butyl 2-(N-((5-nitrotMophen-2-yl)methyl)naphthalene-l-sulfonamido)acetate

The title compound was prepared following the same general protocol as described for compound 32 using tert-butyl 2-(((5-nitrotbiopben-2- yl)methyi)amino)acetate and 1-naphthalenesulfonyl chloride.

l -(be thiaz l-2-yl)-N-(4-ch orobenzyl)me hana me (28)

I

The title compound was prepared following the same general protocol as described in for compound 224 using 4-chlorobenzylamine and benzo[d]thiazoie-2- carbaldehyde. MS (ESI) 288.91 (M+).

y met yl)me hanamine ( 9) To a solution of N-(4-chlorobenzyl)-l -(5-nltiOthiophen-2-yl)methanainine (70 mg) in dichloroethane (lmL) at 0° C was added 2-naphthaldehyde (58 mg) followed by HOAc (0. 1mL) and NaBH(OAe) (106 mg). The reaction was allowed to come to room temperature with stirring overnight. The reaction mixture was diluted with EtOAc, and sat aq Na C , and the layers were separated. The organic layer was washed with sat aq NaHC(¾ (2x), brine (Ix), dried (MgS0 ), and concentrated to give tert-butyi 2~((4-chiorobenzyl)((5~nitrothiophen-2-yi)methyl)amino)acetate as a pale yellow oil. This cmde residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound as a light yellow oil, which crystallized. δ MS (ESI) 423.0 (M+); M (400 MHz, CDCi3): (ppm) 7.9-7.8 (m, 5H), 7.6 (d, 1H), 7.45-7.55 (ra, 2H), 7.35 (q, 4H), 6.8 (d, 1H), 3.8 (s, 4H), 3.65 (s, 2H).

yDmethyDmethanamine (30)

The title compound was prepared following the same general protocol as described in for compound 29 using -naphthaldehyde. MS (ESI) 422.95 (M+); ¾ δ NMR (400 MHz, CDC13) : (ppm) 8.1 (br s,lH), 7.9-7.7 (m, 3H), 7.6-7.3 (m, 8H), 6.8 (br s,lH), 4. 1 (s, 2H), 3.8 (s, 2H), 3.7 (s, 2H).

N-(4-chlorobenzyl)- l-cvclohexyl-N-((5-nltiOtMophen-2-yl)methyl)methanamine (31) The title compound was prepared following the same general protocol as described in compound 29 using cyelohexaneearboxaldehyde. MS (ESI) 379.1 (M+).

-(4-chlorobenzyl -N- 5-nitrothiophe -2-yl)me hyl -l -naphthamide (32)

To a solution of N-(4-chlorobenzyl)-l-(5-nitrothiophen-2-yl)methanamine (60 nig) in C C ( mL) was added trietbylamine (100 L) followed by 1-naphthoyl chloride (100 mg). After stirring at room temperature for 18h, the reaction was diluted with EtOAc and sat aq NaHC(¾, and the layers were separated. The organic layer was washed with sat aq NaHC (2x), 1M HCl (2x), brine (Ix), dried (MgSQzO, and concentrated to give the title compound as a pale yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford N-(4- chlorobenzyl)-N-((5-nitrothiophen-2-yl)methyl)-l-naphthaniide. MS (ESI) 436.9 (M+).

N-(4-chlorobenzyl)-4-methyl-N-((5-nitiotMophen-2-yl )metliyl)benzenesulfonamide 031 The title compound was prepared following the same general protocol as described for compound 3 using p-toluenesuifonylchioride. MS (ESI) 436.9 (M+).

N-(4-chlorohenzyl)-l-(23

The title compound was prepared following the same general protocol as described in compound 29 using 2,3-dihydrobenzo[b] [ ,4]dioxme-2-carbaldehyde,

MS (ESI) 431.1 (M+).

Terf-butyl 3-(((4-chlorobenzyl)((5-nitrothiophen-2- yl)methyl)amino")methyl)pyrrolidine- -carboxylale (35) The title compound was prepared following the same general protocol as described in compound 29 using tert-butyl 3-formylpynrolidine- 1-carboxylate. MS (ESI) 465.7 (M+).

)- (5 ol ·;ορ ·η· ?. - ; (trifluoromethyiibenzyl)methanamine (36)

The title compound was prepared following the same general protocol as described in compound 29 using 4-(tri†luoromethy3)benzaldehyde. MS (ESI) 4 4 1.0 (M+). l -(benzo dloxazol-2-yl)-N-(4-chlorobenz yl)-N-((5-nitro Iiiophe -2- yl)methyl)methanamine (37)

The title compound was prepared following the same general protocol as described in compound 29 using benzo[d]thiazole-2-carbaldehyde. MS (ESI) 414.0 (M+). N-(4-chlorobeT)zyl ")-N-(eyclohexyimethyi)butan-l -amine (38) The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaldehyde, and 1-butanal. MS (ESI) 294,1 (M+).

N-(4-ehlorobenzyl)- -cyclohexyl-N-(cyclooct y1methyi)methanamine (39)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaldehyde and cyclooctanecarbaldehyde. MS (ESI) 362.3 (M+).

Methyl 3-(((4-chlorobenzyl)(cyelohexylmethyi)amino)methyl)benzoatemethanamine

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaldehyde, and methyl 3-formylbenzoate.

Methyl 4-(((4-chlorobenzyl)(cyclohexylmethyl)amino)methyl)benzoale (41) The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobeiizylamine, cyclohexanecarboxaidehyde, and methyl 4-formyibenz.oate.

N-(4-chlorobenzyl)-l-cyclohexyl-N-(4-(trifliR romethyl)benzyl)methan (42)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and 4-(trifluoromethyl)benzaldehyde.

Ten-butyl -(((4-chlorobenzyl)(cyclohexylmethyl)aniino)methyl)pyrrolidine- 1- carboxylate (43) The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyciohexanecarboxaldehyde, and tert-butyi 3-formylpyrrolidine- l -carboxylate. MS (EST) 421 .0 (M+).

Tert-butyl 4-(((4-chlofobenzyl)(cyclohe^ carboxylate (44)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine cyclohexanecarboxaidehyd and tert-butyl 4-formylpipe:ridine-l -carboxylate.

carboxylate (45)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyciohexanecarboxaldehyde, and tert-butyi 3-formylpiperidine-l -carboxylate. The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and 2-naphthaidehyde. MS (ESI) 378.1 (M+). l-(2-bromop\Tidm-4-yl)-N-(4-eMorobenzy^ (47)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and 2-bronioisonicotinaldehyde. MS (ESI) 408.1 (M+).

5-(((4-chlorobenzyl)(cyck^hexylmethyl)amino)methyl)thiophene-2-ca acid (48)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and 5-formyithiophene-2-carboxyiic acid. MS (ESI) 378.1 (M+). N-(4-cMorobenzyl)-l-c>¾lohexyl-N-(piperidin-4-ylmethyl)methana --itne (49)

The title compound was prepared following the same general protocol as described for compound 2 using compound 44. MS (ESI) 335.2 (M+).

N-(4-chlorobenzyl)-l-cyclohexyl-N-(pyrrolidin-3-ylmethyl)methanamine (50)

The title compound was prepared following the same general protocol as described for compound using compound 43. MS (ESI) 321.2 (M+).

N-(4-cMorobenzyl)-l-cyclohexyl-N-(piperidm-3-ylmethyl)methanamine (51)

The title compound was prepared following the same general protocol as described for compound 2 using compound 45. MS (ESI) 335.2 (M+).

4-(((4-chlorobenzyl)(cyclohexylmeth yl)amino The title compound was prepared following the same general protocol as described for compound 2 using p-chlorohenzylamine, cyclohexanecarboxaidehyde and 4-formylbenzoic acid, MS (ESI) 372.1 (M+).

3-((¾4-cMorobenzyl)(cyclohexylmethyl)ammo)methyr;benzoic acid (53)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and 3-formylbenzoic acid. MS (ESI) 372.1 (M+).

-cye hex l- -(3-nitrobenzy N- (5-nitrothiophen-2-yl methyl methanamme (54)

The title compound was prepared following the same general protocol described for compound 5, using 5-nitrotMophene-2-carbaldehyde, cyclohexyimethylamine, and 3-nitrobenzaldehyde. MS (ESI) 390 (M + ) l-cyelohexyl-N -(4 -mtrobenzyl)-N-^ (55) The title compound was prepared following the same general protocol as described for compound 5 , using -nitrothiophene- -carb aldehyde, cyclohexyimethyl amine, and 4-nitrohenzaldehyde, MS (EST) 390 (M + H)

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and 3-methoxybenzaldehyde. MS (ESI) 375 (M + II) l-cyOlohexyl-N-(4-methoxybenzyl)-N-((5-nto^

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and 4-methoxybenzaldehyde. MS (ESI) 375 (M + H)

12.5 -cyclohexyl-N-(34Ii3orobe^ (58)

The title compound was prepared following the same general protocol as described for compound 5, using 5-nilrothiophene-2-carbaldehyde, cyclohexylmethylamine, and 3-fluorobenzaldehyde. MS (ESI) 363 (M + H)

-(benzo d i1,3 ]dloxoi-5-yl)-N-(cyclohexylmethyl)-N-((5-nitTothlophen-2-

The title compound was prepared following the same general protocol described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and piperonaldehyde; MS (ESI) 389 (M + II)

4-(((eyclohexylmei hyl)( dimethylaniline (60)

The title compound was prepared following the same general protocol as described for compound 5, using 5-nilrothiophene-2-carbaldehyde, cyclohexylmethylamine, and 4-dimethylaminobenzaldehyde. MS (ESI) 388 (M + H) l-(benzo[dloxazol-2-yl)-N-(cyclohexy^ ypmethyDmethanamine (6

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrotMophene-2-carbaldehyde, and cyclohexylmethylamine, benzo[d]oxazole-2-carbaldehyde. MS (ESI) 386 (M + H)

-yl)met yDmethanamine (62)

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and 2,3-dihydrobenzofb] [1,4]dioxine-2-carbaldehyde. MS

l-cyclohexyl-N-(naphihalen-l-ylmethyl)-N-((5-mtrothiophen-2- The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexymiethylamine, and 1-naphthyialdehyde. MS (ESI) 395 (M + H)

i »' N nanii ai v i; N iS;i i n n 2

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethyl amine, and 2-naphthylaldehyde. MS (ESI) 395 (M + II) l-cyclohexyl-N-(cyclooctylmethyl)-N-((5-nLtiOtMophen-2-yl)methyl)metlianamine

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and cycloociylaldehyde. MS (ESI) 379 (M + H)

.: cfo hex (66) The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyelohexylmethylamine, and 2-furanylaldehyde. MS (ESI) 335 (M + H)

1-cyelohexyl-N-((5-nitrothiopfe

The title compound was prepared following the same general protocol as described for compound 5, using S-niirothiophene-2-carbaldehyde, cyelohexylmethylamine, and 2-thiophenyiaidehyde. MS (ESI) 351 (M + ) l-cyclohexyl-N-((5-iutrothiophen-2-yl)methyl)-N-(pyridin-3-yhnethyl)methanainme

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrotliiophene-2-carbaldehyde, cyelohexylmethylamine, and nicotinaklehyde, MS (ESI) 346 (M + H) l-cyclohexyl-N-((5-nitrotMophen^ The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and isonicotmaldehyde. MS (ESI) 346 (M + H) l-cyclohexyl-N-((l-methyl-lH-indol-3-yl)methyl)-N-((5-nitrotfalophen-2- yPmethyl )methanamine (70

G

The title compound was prepared following the same general protocol as described for compound 5, using S-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and l-methyl-lH-mdole-3-carbaldehyde. MS (ESI) 398 (M

+ I )

N-(3-(benzyloxy)benzyl)-l-cyclohexyl-N-((5-nitrothiophen-2-

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrotliiophene-2-carbaldehyde, cyclohexylmethylamine, and 3-(benzyloxy)benzaldehyde. MS (ESI) 45 (M + II) l -(2-cliloro-6-methoxyquinolin-3-yl)-N-(cyclohexylmethyl)-N-((5-nitrotMophen-2-

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrotliiophene-2-carbaldehyde, cyclohexylmethylamine, and 2-chloro-6-methoxyqumolme-3-caibaldehyde. MS (ESI) 460 (M + H) l -(bicyclo 2 1hept-5-en-2-yl)-N-(cyclohexylmethylh yl)methyl)methanamine (73)

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, andbicyclo [2.2. 1]hept-5-ene-2-earbaldehyde. MS (ESI) 361 (M + ) The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and lH-imidazole-5-carbaldehyde. MS (ESI) 335 (M + )

Benzyl 3-ffcyciohexymieth^ (75)

The title compound was prepared following the same general protocol as described or compound 5, using 5-nitrotMophene-2-carbaldehyde, cyclohexylmethylamine, and benzyl 3-oxopropy carbamate MS (ESI) 446 (M + H)

2-(((cyclohexylmethyl)((5-nitroMophe

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrotMophene-2-carbaldehyde, cyclohexylmethylamine, and 3-fluoro-6-hydroxybenzaldehyde. MS (ESI) 379 (M + I ) l-cyclohexyl-N-(3-fluoro-5-methoxybenzyi)-N-((5-nitrothiophen-2- yl)methyl)methanamine (77) The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethyl amine, and 3-fluoro-5-methoxybenzaldehyde. MS (EST) 393 (M + H)

2-(((cycIohexylmethylX(5 - t

The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrotMophene-2-carbaldehyde, cyclohexylmethylamine, 3,6-dihydroxybenzaidehyde. MS (ESI) 377 (M + H) l-cyclohexyl-N-(cyclopentylm

The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrothiophene-2-carbakiehyde, cyclohexylmethylamine, and cyclopeniylaldehyde. MS (ESI) 337 (M + II) l-cyclohexyl-N-((2-fluorop>Tldin-3-yrjmethyl)-N-((5-nltrothiophen-2-

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and 2-fluounicotinic aldehyde. MS (ESI) 364 (M + H)

N- 2,4-bis(trifl oromethyl)benzyl)-l -cyc hexyl-N- 5-nilrothiophen-2-

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexyimethyi amine, and 2,4~di(trifluoromethyl)benzaldehyde, MS (ESI) 481 (M + H)

1-cye hexen -N-(eyclo exy ethyl)-N

The title compound was prepared following the same general protocol described for compound 5, using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and cyclohex-l-enecarbaidehyde. MS (ESI) 349 (M Methyl 4-(((eyelohexytoethyD((5-aitro^ (83)

The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrothiophene-2-carbaldehyde, eyciohexylmethylamme, and methyl 4-formylbenzoate. MS (ESI) 403 (M + )

Methyl 3-(((cyclohexylmethyl)((5-nitrotMophen-2-yl)methyl)aniino)methyl)benzoate

The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrothiophene-2-carbaldehyde, cyclohexyimethyi amine, and methyl 3-formyibenzoate. MS (ESI) 403 (M + H)

Tert-butyl 3-(((cyclohexylmethyl)((5-nitrothiophen-2--

; i i . r o >; . (85)

The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethylamine, and tert-butyl 3-formylpiperidine-l-carboxylate. MS (ESI)

452 (M + H)

5-(((cyelohexylmethyl)((5-iHtro^ carboxylic acid (86)

The title compound was prepared following the same general protocol as described or compound 5, using 5-nitrotMophene-2-carbaldehyde, cyclohexylmethylamine, and 5-fbnnylfuran-2-earboxylic acid. MS (ESI) 379 (M +

H)

N-(4-chlorobenzyl) -N- (cyclohexylmethyl)-2-phenylethanamine (87)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, eyelohexanecarboxaidehyde, and 2-phenylaeetaldehyde. MS (ESI) 342.2 (M+).

N-(4-cMofobenzyl)4-cyclohexyl-N-(3-iutrobenzyl)methanainine (88) The title compound was prepared following the same general protocol as described for compound 2 using p-chlorohenzylamine, cyclohexanecarboxaidehyde, and 3-nitrobenzaidehyde. MS (ESI) 373.1(M+).

N-(3-(benzyloxy)benzyl)-N-(4-cMorobenzyl)-l-cyclohexylmethanam (89)

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and 3- (benzyioxy)benzaidehyde. MS (ESI) 434.2 (M+). l-(2-chtoro-6-methoxyquinolin-3-yi)-N-(4-chlorobenzyl)-N-

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaldehyd and 2-chloro-6-methoxyquinoline-3-carb aldehyde. MS (E ST) 443,2 (M+). The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde and benzyl (3-oxopropyl)carbainate. MS (ESI) 429.2 (M+).

T'ert-butyl 3-((4-chjorobenzyl)(cyclohexylmethyl)am

The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyclohexanecarboxaidehyde, and tert-butyl 3-oxopiperidine-l-carboxylate. MS (ESI) 421.1 (M+).

(E)-N-(4-chlorobenzyl)-N-(cyclohexylmethyl)-3-phenylprop-2-en-l-amine (93) The title compound was prepared following the same general protocol as described for compound 2 using p-chlorobenzylamine, cyeiohexanecarboxaldehyde, and cinnamaldehyde, MS (ESI) 354. (M+).

N-(4-chlorobem hydrochloride (

N-(4-chlorobenzyl)-1-(5-nitrothiophen-2-yl)methanamine

To a solution of 5-nitro-2-thiophenecarboxaldehyde and 4-ch orobenzy ar ne (1.0 equiv) in dichloroethane, sodium triacetoxvborohydride (1.5 equiv) was added with catalytic amount of AcOH. The reaction mixture was stirred at room temperature overnight. Sat'd NaHCOs solution was added and the organic phase was separated and dried with MgSO.-. The solvent was removed in vacuo to obtain the crude which was purified by flash chromatography to obtain the title compound; MS (ESI) 283 (M+H) Step 2: tert-butyl 3-(((4-chlorobenzyl){{5- To solution of N-(4-chlorobenzyl)-l-(5-nitrotliiophen-2-yl)methanamine in diehloroefhane, l-Boc-pyrrolidine-3-carboxaldehyde (l.O equ v) and sodium triacetoxyborohydride ( 1.5 equiv) was added with catalytic amount of AcOH. The reaction mixture was stirred at room temperature overnight. Sat'd Na C solution was added and the organic phase was separated and dried with MgS0 4. The solvent was removed in vacuo to obtain the crude which was purified by flash chromatography to obtain the title compound; MS (ESI) 466 (M+H) Step 3: N-(4-chloroberizyl)-l-(5-nitrothiophen-2-yl)-N-(pyrrolidin-3- y¾methyl)methanam;ne hydrochloride To a mixture of tert-huty! 3-(((4-chlorobenzy])((5-nitrothiophen-2- yl)methyI)amino)methyI)pyrroIidine-l-carboxyIate, 6M H in MeOH was added. The reaction mixture v/as stirred at rt for overnight. After the reaction was completed, the solvent was removed in vacuo to obtain the the title compound; MS (ESI) 366 (M+H)

1-(3-(( (4- chlorobenzyl (5-nitrotMophen-2-yl)methyl)amino)methyl)pyfroUdin- - yPiethanone (97)

To a solution of N-(4-chlorobenzyl)-l-(5-nitrothiophen-2-yl)-N-(pyrrolidin-3- ylniefhyl)methanamine hydrochloride in CH2Q2, acetyl chloride (1.05 equiv), E N (2.5 equiv) were added. The reaction mixture was stirred at rt for 1 . After the reaction was completed, the solvent was removed in vacuo to obtain the crude which was purified by flash chromatography to obtain the title compound; MS (ESI) 406 (M+H).

Tert-butyl 3-(((4-chlorobenzyl)((5-nitrothiophen-2- yl)methyl)amino)methyl)piperidme-l-carboxylate (98) The title compound was prepared following the same general protocol as described in compound 29 using tert-butyl 3-formylpiperidine-l -carboxylate. MS (ESI) 479.9 (M+).

Phenyl 3-(((4-chlorobenzyl)((5- trothk phen-2-yl)m -carboxylate (99)

The title compound was prepared following the same general protocol as described for compound 97, using phenyl chloroforraate instead of acetyl chloride; MS (ESI) 486 (M + ).

Tert-butyl 4-(((4 C orobenzyl)((S-nitrothiophen--2-- y eth ) ino)meth )piperi dine- -carboxylate ( 00) The title compound was prepared following the same general protocol as described in compound 29 using tert-butyl 4-fbrmylpiperidine-l -carboxylate. MS (ESI) 479.7 (M+).

Ethyl 3-¾((4 -chlorobenzyl)¾¾5 carboxylate (101)

The title compound was prepared following the same general protocol as described for compound 97, using ethyl chloroformate instead of acetyl chloride; MS δ (ESI) 438 (M + H); H NMR (400 MHz, CDC13) : (ppm) 7.77 (d, J = 4.4 Hz, III), 7.33-7.23 (m, 4H), 6.86 (d, J = 4.0 Hz, 1H), 4. (m, 2H), 3.75 (m, 2H), 3.65-3.52 (m,

3H), 3.39-3.24 (m, 2H), 3.00 ( , H), 2.46 (m, 3H), 2.01 (m, 1H), 1.58 (m, H), 1.2.5 (m, 3H); C NMR (400 MHz, CDCI3): δ (ppm) 155.1, 153.5(d), 150.8, 136.6, 133.2, 130.0, 128.8, 128.7, 124.4, 61.0, 58.1, 56.6(d), 53.6(d), 50.0(d), 45.1(d), 36.7(d), 29.5(d), 14.9.

3-(((4-cMorobenzyl)((5-mtrothiophen-2-yl )methyl )ainino)methyl)-N- phenylpyrrolidine- -carboxamide (102) The title compound was prepared following the same general protocol as described for compound 97, using phenyl isocyanate i stead of acetyl chloride; MS (ESI) 485 (M + H)

3-$ i $ - ii · ί i ) n } · i ; )- -

The title compound was prepared following the same general protocol as described for compound 97 using n-pentyl isocyanate instead of acetyl chloride; MS δ (ESI) 479 (M + H); Ή NMR (400 MHz, CDC13) : (ppm) 7,72 (d, J = 3.6 Hz, H), 7.28-7.24 (m, 4H), 6.85 (d, J = 4.0 Hz, IH), 4.25 (t, J = 5.6 Hz, IH), 3.73 (s, 2H), 3.58 (d, J = 1.2 Hz, 2H), 3.51 (m, IH), 3.25 (m, 2H), 3. 6 (m, 2 ) , 2.95 (m, ), 2.43 (in, 3H), 2.01(m, Hi), 1.62 (m, IH), 1.47 (m, 2H), 1.29-1.21 (m, 4H), 0.85 (t, J = 7.2 Hz,

: C NMR (400 MHz, CDCI3): δ (ppm) 156.8, 153.6, 150.7, 136.6, 133.2, 130.0, 128.8, 128.7, 124.4, 58.1, 56.6, 53.6, 49.6, 44.6, 40.6, 36.8, 30.2, 29.7, 29.1, 22.4, 14.0

Ally! 3-(((4-chlorobenzy )((5-nitro hiophen-2 carboxylate (104)

The title compound was prepared following the same general protocol as described for compound 97, using ally! chioroformate instead of acetyl chloride; MS (ESI) 450 (M + H)

N-(4-chlorobenzyl)-1-(l-(methylsulfonyl )pyrrol;din-3-yl)--N

The title compound was prepared following the same general protocol as described for compound 97, using methansulfonvl chloride instead of acetyl chloride; MS (ESI) 444 (M + H)

N-(4-cMorobenzyl)-l -(5-nttrothiophen-2-yl)-N-((l-tosylpyrrolidm -3- yl)methyl)methanamine (106) The title compound was prepared following the same general protocol as described for compound 97, using tosyl chloride instead of acetyl chloride; MS (ESI) 5 0 (M +

N-(4-ehlorobeazyI)- -(5-mtrothiophen-2-yf)-N-((l -(thiophen-2-yl8ulfonyl)pyrrolidin- -y et ethanamine ( 08)

The title compound was prepared following the same general protocol as described for compound 97, using 2-tMophenylsulfonyl chloride instead of acetyl chloride; MS (ESI) 512 (M + )

N-(4-clilorobenzyl)-l-(l-(isopropy yDmethyDmethanamine (309) The title compound was prepared following the same general protocol as described for compound 97 using isopropylsuifonyl chloride instead of acetyl chloride; MS (ESI) 472 (M + H)

N-(4-chlorobenzyl)- -( -(naphthalen- 1-ylsulfonyl)pyrrolidin-3-yl)-N-((5- nitrothiophen--2-yl)methyi)methanamine (110)

The title compound was prepared following the same general protocol as described for compound 97, using 1-naphthylsulfonyi chloride instead of acetyl chloride; MS (ESI) 556 (M + H)

N-(4-chlorobenzyl)- 1- -{naphthalen-2-ylsulfonyl)pynx>l;din-3-yl)-N-((5- nitrothiophen-2-yl)methyi)methanamine (1 1) The title compound was prepared following the same general protocoi as described for compound 97, using 2-naphthylsulfonyl chloride instead of acetyl chloride; MS (ESI) 556 (M ÷ H) l-(l-(benzylsuifonyi)pyTrol;din-3-yl)-N-(4-chlorobenzyl)-N-((

The title compound was prepared following the same general protocol as described tor compound 97, using benzylsulfonyi chloride instead of acetyl chloride;

N-(4-chlorobenzyl)-1-(l-(3-nitrophenylsulfonyl)pym>lidin-3-y 2--yl)methyl)methanamine (113) The title compound was prepared following the same general protocol as described for compound 97, using 3-nitrophenyisuifonyi chioride instead of acetyl chloride; MS S ) 520 (M ÷ H) i : i- buiylsu fo

The title compound was prepared following the same general protocol as described for compound 97, using n-butylsulfonyi chloride instead of acetyl chloride; MS (ESI) 486 (M + H)

N-(4-chk robenzy )-l - l -(4-e oro nitrothiophen-2-yl)methyi)methanamine (115) The title compound was prepared following the same general protocol as described for compound 97, using 4-ehiorobenzylsuifonyl chloride instead of acetyl chloride; MS S ) 554 (M ÷ H)

3-(((4-chlorobenzyl)((5-mtrothiophen-2-yl)niethyl)amino)methyl)-N- ;sopropylpynOlid;ne-l -carboxaniide (116)

The title compound was prepared following the same general protocol as described for compound 97, using isopropyi isocyanate instead of acetyl chloride; MS

(ESI) 45 (M -i- H)

3-(((4-chlorobenzyl)((5-mtrotMophen-2-yl)methyi)aniino)methy nitrophenyppyrrolidine-l-caiboxamide (117) The title compound was prepared following the same general protocol as described for compound 97, using 4-nitophenyl isocyanate instead of acetyl chloride; MS (ESI) 530 (M + H)

3-(((4-chlorobenzyl )( 5-mtrotMophen-2-yl)methyi)aniino)methyl)

The title compound was prepared following the same general protocol as described for compound 97, using cyclohexyl isocyanate instead of acetyl chloride; MS (ESI) 49 (M + )

Ethyl 2-(5-(methylsuUmyrKMophene-2-carbonyl)-l,2,3,4-tetrahydfolsoqumoline-3- carboxylate (119 and 120 diastereomers) To a solution of ethyl 1 ,2,3,4-tetrahydroisoquinoline-3-carboxylate (50 mg) in

CH2CI2 (ImL) was added diisopropylethylamine (70 µ .) followed by 5- (methylsulfonyl)thiophene-2-carboxylic acid (56 mg) and HATU (139 mg). After stirring at room temperature for 8h, the reaction was diluted with EtOAc and sat aq Na C , and the layers were separated. The organic layer was washed with sat aq

Na CO (2x), 1M HC1 (2x), brine ·; . dried (MgS0 4), and concentrated to give the title compound as a pale yellow oil. This crude residue was purified by reverse phase preparative HPLC to afford as the major product ethyl 2-(5- (methylsulfonyl)thiophene-2-earbonyl)-l ,2,3,4-tetrahydroisoquinoline-3-carboxylate (the product from Example 50), however, there v/as also isolated two diastereomeric sulfoxides. The first compound off the column was 9, and the second was 120. 119 MS (ESI) 377.9 (M+); 120 MS (ESI) 377.8 (M+).

2-(quinoiine-8-carbonyl)-l,23.4-tetra¾ydroisoquinoline-3-carboxylate (121)

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3,4-tetrahydroisoquinoline-3-carboxylate and quinoline-8-carbonyl chloride. MS (ESI) 361.0 (M+).

Ethyl 2-(l ,2,3,4-tetrahydronaphthalene-2-carbonyl)-l ,2,3,4-tetrahydroisoq inoline-3 carboxylate (122) The title compound was prepared following the same general protocol as described for compound 7 using ethyl ,2,3,4-tetrahydroisoquinoline-3-carboxyiate and l,2,3,4-tetrahydronaphthalene-2-carbonyl chloride, MS (ESI) 363.97 (M+).

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3,4-tetrahydroisoquinoline-3 -carboxylate and 2-methylbenzoluran-4--carbonyi chloride. MS (ESI) 363.96 (M+).

\ :. i ?. 6 ,7. i a i i; n p ie n - >r \ . ?. ,3. a s : n

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3 ,4-tetrahydroisoquinoline-3-carboxylate and 5,6,7,8-tetrah}dronaphthalene-2-carbonyl chloride, MS (ESI) 364.0 (M+).

Ethyl 2-(2,3-dihydrobenzo[¾lil,41dioxine-2-caii)onyl)-l,23,4-tetrahydroLsoquinoli -carboxylate (125)

The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,4-tetrahydroisoquinoline-3-carboxylate and 2,3-dihydrobenzo [b] [1,4]dioxine-2-carbonyl chloride. MS (ESI) 367.9 (M+). -(hydroxy e hyl 3 4-dihyd

To a solution of compound 16 (500 mg) in T F ( mL) at 0° C was added LiB¾ (2M in TIIF, 0.87 mL). The reaction was allowed to come to room temperature and stirred for 4h. The reaction mixture was diluted with EtOAc, and sat aq Na C , and the layers were separated. The organic layer was washed with sat aq

NallCOs (2x), brine (lx), dried (MgSQ4), and concentrated to give (3- (hydroxymethyl)-3,4-dmydroisoqumolin-2(lH)-yl)(naphthalen-l-yl)methanone as a paie yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/he a es) to afford the title compound as a beige solid. MS (ESI) 318.0 (M+H).

- chloro ethyl 3 4-dihydroisoqu

To a solution of compound 126 (16 mg) in C 2C 2 l(mL) at room temperature was added TEA (8mg), followed by MsC (7mg). After stirring for 18b, the reaction was concentrated in vacuo and purified by reverse-phase prep-HPLC to afford the title compound as a colorless solid. MS (ESI) 336.12 (M+H).

(2-( -naphtho yi .2,3,4-tetrahydro soquinol -3-ypmethyl aceta e ( 8) To a solution of compound 126 (16mg) n CH2CI2 ( L) at room temperature was added DIEA (lOnig) followed by acetyl chloride (4.3 µ . After stirring for lh, the reaction was concentrated in vacuo and purified by reverse -phase prep-HPLC to afford the title compound as a colorless solid. MS (ESI) 359.97 (M+H).

(3- benzylox y)methyl 3,4-dihydroisoquinolin-2(l H)-yl)(naphthalen-l -

Γο solution of compound 126 (16mg) in DMF ( L) at room temperature was added NaH ( 8 mg). After stirring for 20min, benzyl bromide (9 µί ) was added.

The suspension was stirred fo r l h at room temperature, concentrated in vacuo, and purified by reverse-phase prep-HPLC to afford the title compound as a colorless solid. MS (ESI) 408.06 (M+H).

2-((2-(l -naphtho y1)-l ,2,3,4-tetraliydroisoquinoiin-3-yl)methyi)isoindoline-1 ,3-dione To solution of compound 126 (318 mg) in THF (lOmL) at room temperature was added D AD (303 mg) followed by Ph3P (393 mg) and phthalimide (220 mg). The reaction was stirred for 8h and then concentrated in vacuo onto silica gel. This crude residue was purified y chromatography on silica gel (EtOAc/hexanes) to afford the title compound. MS (ESI) 447.1 (M+H).

(3-(aniinometliyl)-3,4-dmydroisoqumolm-2(lH)-yl)(naphthalen-l-yl)methanone

Step 1 (3--(azidomethyi)--3^-4¾ydroisoqumoiin--2(lH)-yl)(naphthalen- -

To a solution of compound 126 ( 1.6 g) in ΤΉ Ε (20mL) at 0° C was added

DIAD ( 1.2 g) followed by Ph3P (393 mg) and then diphenylphosphorylazide (1.65 g). The reaction was stirred for 8h and then concentrated in vacuo onto silica gel. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. MS (ESI) 447.1 (M+H). ypmethanone

A mixture of the product from Step 1 and 10% Pd/C in MeO ( 15 mL) was stirred under a balloon of hydrogen. After 3h, the reaction was filtered through celite and concentrated in vacuo to give the title compound as a beige solid. MS (ESI) 316.98 (M+H).

ypmethanone (133) The title compound was prepared following the same general protocol as described for compound 128 using (3-(hydroxy ethyI)-3,4- ihy roisoqu oJin- 2(lH)-yl)(naphihalen-I-yl)methanone and l-(chloromethyl)naphthalene. MS (EST) 458.24 (M+H).

Naphthalen-l-yl(3-¾phenoxyT^

The title compound was prepared following the same general protocol as described for compound 130 using (3-(hydroxy ethy )-3,4-dihydroisoqu oJin- 2(lH)-yl)(naphthalen-l-yl)methanone and phenol. MS (ESI) 394.01 (M+H). l-((2-(l-naphthoyl)-l,2,3,4-tetrahydro (13 The title compound was prepared following the same general protocol as described for compound 164 using (3-(aminomethyl)-3 ,4-dihydroisoquinolin-2(l H)- yl)(naphthalen-l -yl)methanone and phenyl isocyanate. MS (ESI) 435.94 (M+H).

N-((2-(l -naphthoyl)-

The title compound was prepared following the same general protocol as described or compound 164 using (3-(aminomethyl)-3,4-dihydroisoquinolin-2(lII)- yl)(naphthalen- -yl)methanone and benzenesulfonyl chloride. MS (ESI) 457.06 (M+H).

-((2--(l-naphthoyl)-4,234--tetraiiydroisoquinolin--3-yl)methyl)benzamide (137)

The title compound was prepared following the same general protocol as described for compound 164 using (3-(aminoinethyl)-3,4-dihydroisoquinolin-2(lH)- yl)(naphthalen-l-yl)methanone and benzoyl chioride. MS (ESI) 421.07 (M+H).

(3-((¾enzylamino)metfayl)-3,4-dihydroisoquinolin-2(l )-yl)(naphthalen- 1- yPimethanone and (3-((dibenzyiamino)methyl)-3,4-dihydroisoquinolin-2(lII)- yl)(naphthalep- -yl)melhanone (138 and 139) BnBr (18 mL) was added to a mixture of the product from Example 03 (32 mg) in 0.02mL C 2C 2/ 0.2 mL 2M NaQH. The mixture was stirred vigorously at room temperature for 2.5h and then quenched with several drops of TFA. The crude residue was purified by reverse-phase prep-HPLC. The first fraction collected contained unreacted starting material. The second fraction isolated was the mono- alkylated product (MS (ESi) 407.01 (M+H)). The third fraction isolated contained the bis-alkylated product (MS (ESi) 497. 1 (M+H)).

N-(4-chlorobenzyl)- -(l -(5-ch rothiophen-2-ylsulfo nyl)pyn lidi

The title compound was prepared following the same general protocol as described for compound 97, using 2-chlorothiophenylsulfonyl chloride instead of acetyl chloride; MS (ESI) 546 (M + H)

N-(5-(3-(((4-chloroberi?.yl)((5-nitrothiophen-2-yl)methyl) - ylsuifonyi)thiazol-2-yDacetarriide (141) The title compound was prepared following the same general protocol as described for compound 97, using 2-acetamidothiazole-5-sulfonyl chloride instead of acetyl chloride; MS (EST) 584 (M + H)

The title compound was prepared following the same general protocol as described for compound 97 using 2-furanyisulfonyi chloride instead of acetyl chloride; MS (ESI) 496 (M ÷ )

ylsulfonyl)pyrrolidin-3-yl)methyl)methanamine (143) The title compound was prepared following the same general protocol as described for compound 97, using 2-phenylthiophenylsulfonyl chloride instead of acetyl chloride; MS (ESI) 588 (M 4- H)

(2S.5R)-ethyl l-((5-nltrotliiophen-2-yl)methyl)-5-phenylpyffoMlne-2-carboxylate

A solution of 3-(dimethylamino)-i-phenylpropan-i-one (4.34 g, 24.5 mmol) and ethyl nitroacetate (3.3g, 24.5 mmol) was heated to reflux in toluene (50mL) for 5h. The reaction was cooled to room temperature and concentrated to give the crude product as a pale yellow oil which was used without purification. Step 2: ethyl 5-phenyl-3,4-dihydro-2H-pyrrole-2-carboxylate To a solution of the crude product from step i in THF ( 20mL) was added N C (3.93g, 74 mmol) followed by Zn dust (24g, 368 mol). The reaction mixture was stirred at room temperature for 9h, filtered, and then concentrated in vacuo. The crude residue was dissolved in EtOAc and washed with sat aw Na CC (2x), brine (2x), dried (Mgsi¾) and concentrated. Purification on silica gel (EtOAcmexanes) afforded the desired product as a pale yellow oil (2g). Step 3: (2S.5R)-ethyl 5--phenylpyrrolidine-2-carboxylate and (2R.5R)-ethyl 5 -

NaB 3CN (2.8g, 45 mmol) was added portionwise to a solution of the product from Step 3 in c.HCl/iPrOH (9mIJ 100mL) at room temperature. The resulting suspension was stirred at room temperature for 2h, and then concentrated to remove most of the iP O . The crude residue was diluted with EtOAc and sat aq Na CO , and the layers were separated. The organic layer was washed with N- HCO3 fix), brine (Ix), dried (MgSCU), and concentrated. The crude residue was chromatographed on S1O2 (EtOAc/hexanes) to yield the title compounds. The trans isomer was the first to e te off the column, followed by the cis isomer. Step 4 : (2S,5R)-eth\l l-((5-nitrothk^phen-2-yl¼iethyl)-5-phenylpyrrolidine-2- carboxylate The title compound was prepared following the same general protocol as described for compound 2 using the cis product from Step 3 and 5-mtrothiophene-2- carbaidehyde, MS (ESI) 361.0 (M+H), (2S,5S)-ethyl l -((5-nitrotfaiophen-2-yl)metliyl)-5-phenylpyrfolidine-2-carboxylate

The title compound was prepared following the same general protocol described for compound 144 using the trans product from Step 3 and 5- nitrothiophene-2-carhaldehyde MS (ESI) 360.98 (M+H).

N-(4-cMorobenzylM-(l-(methylsulfo yl)methyl)methanamme (146)

The title compound was prepared following the same general protocol as described for compound 29 using 1-(methylsulfonyl)-] H-imidazole-4-carbaldehyde. MS (ESI) 441.03 (M+H). l-(5-bromo-l -(methyisulfonyl)-l H-indoi-3-yl)-N-(4-cMorobenzyl)-N-((5- The title compound was prepared following the same general protocol as described for compound 29 using 5-bromo-l-(metbylsulfonyl)-l H-indole-3- carbaldehyde. MS (ESI) 567.8 (M+H).

Ethyl 6-(4 -fluorophenyl) -1-(( -nitrothiophen- -yi)methyl)piperidine- 2-earboxylate

A mixture of ethyl 6-bromopicolinate (230mg, 1 mmol), 2-(4-fluorophenyl)- 4,4,5,5 -tetramethyl- 1,3,2-dioxaborolane (440mg, 2 mmol), Pd(Pl¾P)4 (llOmg), and

K2CO 3 (830 mg) in toSuene/EtOH (4mL/ L) was microwaved at 110° € for .5h. The reaction was cooled, and the supernatant was concentrated to a brown oil. This crude residue was purified by chromatography on silica gel (EtOAc/hex) to give the title compound as a colorless oil. MS (ESI) 245.94 (M+H). Step 2: ethyl 6-(4-fluorophenyl)piperidine-2-carboxylate

A mixture of the product from Step in HOA (4 mL) and Pt2 (30 mg) was shaken in a Parr shaker apparatus at room temperature under 60 psi for 3h. The reaction was filtered through eelite, and concentrated. The crude residue was diluted with EtOAc and washed with sat aq N HCO3 (3x), brine (Ix), dried (MgSO^ and concentrated. The pale yellow oil was used without further purification. Step 3: ethyl -(4-fluorophenyl)- l-((5-nitrothiophen-2-yl)methyripiper¾dine-2- carboxylate The title compound was prepared following the same general protocol as described for compound 2 using the crude product from Step 2 and 5-nitrothiophene- 2-carbaldehyde. MS (ESI) 393.0 (M+H).

carboxylate (149)

The title compound was prepared following the same general protocol as described in compound 29 using tert-butyl 4-oxopiperidine-l-carboxylate. MS (ESI) 466.1 (M+).

Tert-butyl 3-((4-chlorobenzyl)((5-nitroth;ophen-2-yl)methyl)amino)piperidine-1- carboxylate (150)

The title compound was prepared following the same general protocol as described for compound 29 using tert-butyl 3-oxopiperidine-1 -carboxylate. MS (ESI) 465.89 (M+H).

Tert-butyl 3-((4-cMorobenzyl)((5-nitrothiophen-2-yl)methyl)amino)pyrrolidine-l- carboxylateXlSlj . The title compound was prepared following the same general protocol as described for compound 29 using tert-butyl 3-oxopyrrolidine-l-earboxylate. MS

(ESI) 395,95 (M+H).

-¾4-c orohenzyl)-l -¾li a

The title compound was prepared following the same general protocol as described for compound 29 using furan-2-carbonyl chloride. MS (ESI) 362.97 (M+H).

- -c orobe

The title compound was prepared following the same general protocol as described for compound 29 using 4-pyridine carboxaldehyde. MS (ESI) 374.1 (M+H). N-((lH-indol-7-yl)methyl)-N-(4-cMorob^

The title compound was prepared following the same general protocol as described for compound 29 using 1H-indoie-7-carbaldehyde. MS (ESI) 411.83 (M+H).

Benzyl (3-((4-cMorobenzyl){(5-iTitrothiophen-2-yl)me hy )a ino)propyl)earbamatc (155)

The title compound was prepared following the same general protocol as described for compound 29 using benzyl (3-oxopropyi)carbamate. MS (ESI) 474 5 (M+H).

N-(4-clilorobenzyl)-l-(5-iutrofl^ y methy methanarr ine (ί 56) The title compound was prepared following the same general protocol as described for compound 29 using 5-nitrothiophene-2-carbaldehyde. MS (ESI) 423.85 (M+H).

-i ; r - -i - >;hi p n-?. - j ii iin pip ia - am j

The title compound was prepared following the same general protocol as described in compound 2 using compound 149. MS (ESI) 366.1 (M+).

N-(4-cMorobenzyl)-N-((S-iutroMophen-2-yl)methyl)piperidin-3-amine (158)

The title compound was prepared following the same general protocol as described for compound 2 using compound 0. MS (ESI) 366.03 (M+H).

-(4-ehlorobe zyI -N-((5- trot (159)

The title compound was prepared following the same general protocol as described for compound using compound 150. MS (ESI) 352.03 (M+H). Ethyl 4-((4-chlorobenzyl)((5 -nitrothiophen- 2 -yl)methyl)amino)pipef idine- 1- carbox y ate ( )

To a solution of N-(4-chlorobenzyl)-N-((5-nitrothiophen-2- yl)methyl)piperidin-4-amine (50 mg) in (¾.€¾ (ImL) was added diisopropyiethylamine (30 ) followed by ethyl chloro formate (14 µ After 12b, the reaction was diluted with EtOAc, and sat aq NaHCO , and the layers were separated. The organic layer was washed with sat aq Na CO (2x), brine ( ), dried (M gSOz), and concentrated to give ethyl 4-((4-chlorobenzyl)((5-nitrothiophen-2- yl)methyI)amino)piperidine-l -carboxylate as a pale yellow oil. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. M S (ESI) 438.1 (M+).

4-((4-c¾lorobenzyi)((5-niirothiophen-2.-yl)methyl)amino)-N-penty^ 1- carboxamide (164)

To a solution of N-(4-chlorobenzyl)-N-((5-nitrothiophen-2- yl)methyl)piperidin-4-amine (50 mg) in C C 2 (ImL) was added n-pentylisocyanate (30 µ ). After 12h, the reaction was concentrated in vacuo and purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. MS (ESI) 478.98 (M+). 4-((4-cMoroberffiyl)((5-mtrotMoph^

The title compound was prepared following the same general protocol as described for compound 164 using m-tolyl isocyanate. MS (ESI) 498.97 (M+).

carboxamide (166)

The title compound was prepared following the same general protocol described for compound 164 using phenyl isocyanate. MS (ESI) 485.1 (M-f).

N-(4-cMofobenzyl) -1-(methyisulfonyl)-N-((5-nitrothiophen-2 y e hy p ro idin-3- amine (167)

The title compound was prepared following the same general protocol as described for compound 97, using methansulfonyl chloride instead of acetyl chloride and compound 159; MS (ESI) 430 (M + H) 3-((4-chlorobenzyl)((5 -nitroMophen-2-yl)metfayl)amino)-N-cyclohexylpyrrolidine- 1-

The title compound was prepared following the same general protocol as described for compound 97, using cyclohexyl isocyanate instead of acetyl chloride and compound 159; MS (ESI) 477 (M + H)

carboxamide (169)

The title compound was prepared following the same general protocol as described for compound 97, using pentyl isocyanate instead of acetyl chloride and compound 159; MS (ESI) 477 (M + H)

3-((4-cMorobenzyl)((5-nitrothiophen-2-yl)metIiyl)animo)-N-phenylpyrrolidme-l-

.boxarnide .(170) The title compound was prepared following the same general protocol as described for compound 97, using phenyl isocyanate instead of acetyl chloride and compound 159; MS (ESI) 471 (M + )

The title compound was prepared following the same general protocol as described for compound 97, using o-tolyl isocyanate instead of acetyl chloride and compound 59; MS (ESI) 485 (M + H)

3-((4-cMorobenzyl)((5-maOthiophen-2-yl)methyl)ainino)-N-m-tolylpyiTolidine-l - carboxamide (172) The title compound was prepared following the same general protocol as described for compound 97, using m-tolyl isocyanate instead of acetyl chloride and compound 159; MS (ESI) 485 (M + H) l-(3-((4-chlorobenzy1)((5-nitrothfo^

The title compound was prepared following the same general protocol as described for compound 97, using acetyl chloride and compound 159; MS (ESI) (M + H)

Ethyl 3-((4-ch orobenzyl)((5- othiophen carboxylate (174) The title compound was prepared following the same general protocol as described for compound 97, using ethyl chloroformate instead of acetyl chloride and compound 159; MS (ESI) 424 (M + H)

N-(4-chlorobenzyl)-1-(meihylsulfonyl)-N-((5-nitro amine (176)

The title compound was prepared following the same general protocol as described for compound 97, using methansulfonyl chloride instead of acetyl chloride and compound 158; MS (ESI) 444 (M + II).

3-((4-cMorobenzyi)((5-nitrot¾o carboxamide (177) The title compound was prepared following the same general protocol as described for compound 97, using cyclohexyl isocyanate instead of acetyl chloride chloride and compound 158; MS (ESI) 491 (M + H)

3-((4-cMoroberffiyl)((5-mtrotMophen^ 1- carboxamide (178)

The title compound was prepared following the same general protocol as described for compound 97, using pentyl isocyanate instead of acetyl chloride chloride and compound 158; MS (ESI) 479 (M + H).

3-((4-chlorobenz yl)((5^ carboxamide (179) The title compound was prepared following the same general protocol as described for compound 97, using phenyl isocyanate instead of acetyl chloride chloride and compound 158; MS (ESI) 485 (M + H)

3-((4-chlorobenzyl)((5 -nitroMophen-2-yl)metfayl)amino)-N-o-tolylpiperidine- - carboxamide (180)

The title compound was prepared following the same general protocol as described for compound 97, using o-tolyl isocyanate instead of acetyl chloride chloride and compound 158; MS (ESI) 499 (M + II)

3-((4-e orobe y )((5- tro o carboxamide (181) The title compound was prepared following the same general protocol as described for compound 97, using m-tolyi isocvanate instead of acetyl chloride chloride and compound 158; MS (ESI) 499 (M + H).

1-(3-((4-cMorobenzyl)((5-nttrotMophen-2 -yl)methyl)amino)piperidm 1-yl)ethanone

The title compound was prepared following the same general protocol as described for compound 97, using acetyl chloride chloride and compound 1S8 MS (ESI) 408 (M ÷ H).

Ethyl 3--((4--chlorobenzyl)((5--nitrothiophen-2.-yl)methyl) c rboxy a e ( ) The title compound was prepared following the same general protocol as described for compo d 97, using ethyl chioroformate instead of acetyl chloride chloride and compound 158; MS (ESI) 438 (M + H).

:: 4-chlor ben amine (184)

The title compound was prepared following the same general protocol as described for compound 163 using methane sulfonyi chloride. MS (ESI) 443.9 (M+).

4-((4-c orohenzyi)((5-nitro hiophen carboxamide (185)

The title compound was prepared following the same general protocol as described tor compound 164 using o-tolyl isocyanate. MS (ESI) 498.98 (M+H). 4-((4-c oroberfi yl)((5-mtrot ophe carboxamide (18

The title compound was prepared following the same general protocol as described for compound 164 using cyclohexyi isocyanate. MS (ESI) 491.1 (M+). l-(4-((4-chlorobenzylX(5-nitrolhiopfe

The title compound was prepared following the same general protocol described for compound 163 using acetyl chloride. MS (ESI) 407.9 (M+).

N -(4 Chloi benzyl) l -((4 Ch oi phenyl)sulfon yPmeth yl)piperidin-3-amine (188)

Step : tert-butyl 3-({4-chlorobenzyl)amino)piperidine-l-carboxylaie To a solution of tert-butyi 3-oxopiperidine- 1-carboxylate (5.47 g, 27.45 mmol) and 4-chiorobenzylamine (3.89 g, 2.7.45 mmol) in diehloroethane (40 mL), sodium triacetox borohydri de (7.0 g, 32.94 mmol) was added with catalytic amount of AcOH (0. 16 mL, 2.745 mmol). The reaction mixture was stirred at room temperature overnight. Sat'd N a CC solution was added and the organic phase was separated and dried with MgS0 . The solvent was removed in vacuo to obtain the crude which was purified by flash chromatography to obtain the title compound. MS (ESI) 325

(M+H) Step 2: tert-butyi 3-((4-chlorobenzyl)((5 -nitrotM -carboxylate

The. title compound was prepared following the same general protocol as described in Step 1 using tert-butyi 3-(((4-chlorobenzyl)amino)methyl)piperidine~l- carboxylate and 5-nitro-2-thiophenecarboxaidehyde. MS (ESI) 466 (M+H) Step 3: N-¾4-cMorobenzyl)-N-(¾ 5-nitrothiophen-2-yi)methyl)piperidin-3-aniine The mixture of tert-butyi 3-((4-chlorobenzyl)((5-nitrothiophen-2- yI)methyi)amino)piperidine- -carboxyiate was dissolved in 2.0% TFA in DCM. The reaction mixture was stirred at rt for 2h. After the reaction was completed, the solvent was removed in vacuo to obtain the crude, which was dissolved in EtOAC. The organic phase was washed with Sat'd N aHCC , brine and dried over anhydrous

Na2S0 , The solvent was removed to give the title compound which was used with no further purification in the next step, MS (ESI) 366 (M+H) Step 4 : N-(4-chlorobenzyl)- -((4-chlorophenyl)sulfonyl)-N-((5-nitrotMophen-2- y )methyl)ptperidin-3-amine To a solution N-(4-chlorobenzyi)-N-((5-nitrothiophen-2-yi)methyi)piperidin-

3-amine (30 mg, 0.082 mmoi) in C 2CI2 (1.0 mL) was added triethylamine (excess) followed by 4-chlorobenzene-l-sulfonyl chloride (19 mg, 0.09 mmol). After 12h, the reaction was diluted with EtOAc, and sat aq N C0 3, and the layers were separated. The organic layer was washed with sat aq NaHC<¾ (2x) and concentrated to the crude. This crude residue was purified by preparative HPLC prep-HPLC (MeOH/Acetonitrile/water) to obtain the title compound as TFA salt. MS (ESI) 540 (M+H)

N-(4-chlorobenzyl)-l-((4-chioroben^ yl)methyl)piperidin-3-amine (189)

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using (4-chlorophenyl)methanesulfonyl chloride instead of 4-chlorobenzene-l-sulfonyl chloride. MS (ESI) 554 (M+H) l-(¾utylsulfonyl)-N-(4-cMorobenzyl)-N-((5-nitrothiophen-2-yl)methyl)pipe amine (190) The title compound was prepared following the same general protocol as described in Step 4, compound 188 using butane-1-su bny chloride instead of 4- chlorobenzene-l-sulfonyl chioride MS (ESI) 486 (M+H)

N-(4-cMofobenzyl)4-(naphtfaalen-2-ylsulibnyl)-N-((5-nitrotfatophen-2- yl)methyl)piperidin-3-am;ne (191)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using naphthalene-2-sulfonyl chloride instead of 4-chlorobenzene4-suifonyl chloride. MS (ESI) 556 (M+H)

N-(4-chk robe zyl)- -(isopropyls lfo y 3-amine (192) The title compound was prepared following the same general protocol as described in Step 4, compound 188 using propane-2-sulfonyl chloride instead of 4- chlorobenzene-i-sulfonyi chloride. MS (ESI) 472 (M+H)

N-(4-cMorobe^ ethyl)piperidin-3-amine (193)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using 6- o -pholinopy idine-3-sulfonyi chlorid instead of 4-chlorobenzene-l-sulf onyi chloride. MS (ESI) 592 (M+H)

N-(4-chk robenzyl)-N-((5-nitrothiophen-2-yl)methyl)-1-(pyridin-3- ylsuIfonyDpiperidm-3 -amine (194)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using pyridine-3-sulfonyl chloride instead of 4- chlorobenzene-l -sulfonyi chloride. MS (ESI) 507 (M+H) N-(4-bromophenyl)-3-((4-chlorobenzyl)((5-nitrothiophen-2- yl)methyl)amino)piperidiiie-l -carboxamide (195) The title compound was prepared following the same general protocol as described in Step 4, compound 188 using 1-bromo-4-isocyanatobenzene instead of 4- chlorobenzene-l-sulfonyi chioride, MS (ESI) 565 (M+H)

N-(4-bromobenzyl)-3-((4-cMorobenzyl)((5-nitrotl¾iophen-2- yl)methyljammo piperidine l -ca boxamide (196)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using l--bromo-4-(isocyanatomethyl)benzene instead of 4-chlorobenzene- -sulfonyl chloride. MS (ESI) 579 (M+H)

N-(j 1J'-biphenyll-4-yl)-3-((4-chlorobeiizyr;((5-nitrothiophen-2- yl)methyI)amino)piperidine-l -carboxamide (197)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using 1 4-isocyanato-l,l'-biphenyl instead of 4- chlorobenzene-l -sulfonyi chioride. MS (ESI) 5 (M+H) N-(4-bromo-2-fluorophenyl)-3-((4-chlorobenzyl)((5-nitrothlophen-2- yl)methyl)amino)piperidine-1 -carboxamide (198)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using 4-bromo-2-fluoro-l-isocyanatobenzene instead of 4-chlorobenzene- 1-sulfonyl chloride, MS (ESI) 583 (M+H)

yDpiperidine-- 1-carboxamide (199)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using 2-isocyanato-3-methyiiurane instead of 4- chlorobenzene-i -sulfonyl chloride. MS (ESI) 489 (M+H)

N-(2-chloro-6-methylphenyl)-3-( 4-chlorobenzyl)( (5-nitiOthiophen-2 The title compound was prepared following the same general protocol as described in Step 4, compound 188 using l-cMoro-2-isoeyanato-3-rnethylbenzene instead of 4-chlorobenzene-l-sulfonyi chloride, MS (ESI) 533 (M+H)

carboxamide (20 )

The title compound was prepared following the same general protocol described in Step 4, compound 188, using 1-isocyanatopropane instead of 4- chlorobenzene-l-sulfonyl chloride, MS (ESI) 451 (M+H)

N-(3-chk ro-2-fluorophenyl)-3-((4-chlorobenzy )((5- itrothiophen-2- yl)methyl)ainino)piperidlne-l -carboxamide (202)

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using l-chloro-2-fluoro-3-isocyanatobenzene instead of 4-chiorobenzene- -sulfonyl chloride, MS (ESI) 537 (M+H).

3-((4-chlorobenzyl)((5-nitrothioph^ yppiperidine-l -carboxamide (203) The title compound was prepared following the same general protocol as described in Step 4, compound 188, using 4-(4-isocyanatop}Tidin-2-yl)moipholine instead of 4-ehlorobenzene-l-sulfonyi chloride. MS (ESI) 571 (M+H)

3-((4-cMorobenzyl)((5-nltrotMophen-2-yl)metfayl)amino)tetrahydrotMophene 1,1- dioxide (204)

Ste 1: 3-((4 C orobenz)i amino)tetrahydrothiophene 1 -dioxide

The title compound was prepared following the same general protocol as described in Step 1, compound 188, using 4-ehlorobenzaidehyde and 3- aminotetrahydrothiophene 1, -dioxide. MS (E S T) 260 (M+H) Step 2: 3-((4-cMorobenzyl)((5-mtrotMophen-2-yl)methyl)aimno)tetrahydrotliiophene 1.1 -dioxide The title compound was prepared following the same general protocol as described in Step , compound 188, using 3-((4- chlorobenzyl)amino )tetrahydrothiophene ,1-dioxide and S-nitro-2- thiophenecarboxaldehyde. MS (ESI) 401 (M+H) Methyl 3-(( -((4-chlorobeBzyI)sulfoByl)piperidin-3-yl)((5-nitrothiophen-2- yl)methyi)amino)methyi)benzoate (205)

Step 1 tert-butyl 3-{(3-(rnetl xycarbonyl)benzyl)arm o)piperi dine-l -carboxylate

The title compound was prepared following the same general protocol as described in Step 1, compound 188, using methyl 3-(ammomethyl)benzoate instead of of 4-chlorobenzylamine, MS (ESI) 349 (M+H) η St p 2: i rs b : i -{ - >·..·¾¾ <_ · | :· · ni ph 2

The title compound was prepared following the same general protocol as described in Step 1, compound 188, using tert-butyl 3-((3- (methoxycarbonyl)benzyl)amino)piperidine- 1-carboxylate and 5-nitro-2- thiophenecarboxaldehyde. MS (ESI) 490 (M+H) Step 3; methyl 3-((((5-^ y )amino)methy )benzoate The title compound was prepared following the same general protocol as described in Step 3, compound 188, using tert-butyl 3-((3- (methoxycarbonyl)benzyl)((5-nitrotMophen-2-yl)methyl)amino)piperidine-l- carboxylate instead of of N-(4-chiorobenzyl)-N-((5-nitrothiophen-2- yl)methyl)piperidin -3-amine. MS (ESI) 390 (M+H) Step 4: methyl 3-(( -((4-chlorobenzyl)sulfonyl)p^ yl)methyl )ainino)methyl)benzoate The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitiOthiophen-2- yl)methyi)(piperidin-3-yl)amino)methyl)benzoate and (4- chiorophenyI)methanesuifonyI chloride instead of N~(4-chiorobenzyi)-N-((5~ nitrothiophen-2-yl)methyi)piperidin-3-amine and 4-chlorobenzene- -sulfonyl chloride. MS (ESI) 578 (M+H)

Methyl 3-(((l-(methylsulfonyi)piperidin-3-yl)¾¾5-nitrothiophen-2- yl)methyi)amino )methyi)benzoate (206 )

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrothiophen-2- yl)methyi)(piperidin~3~yl)amino)methyl)benzoate and methanesulfonyl chloride. MS (ESI) 468 (M+H) Methyl 3-((((5-nitrothiophen-2-yl)methyl)(l-(phenylcarbamoyl)piperidin-3- y ¾)amino)methy )benzoate (20 )

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrothiophen-2- y1)methyi)(piperidin-3-yl)arnino)niethy3)benzoate and isocyanatobenzene instead of N-(4-clilorobenzyl)-N-((5-nitroMophen-2-yl)methyl)piperidin-3-ainine and 4- chlorobenzene-l -sulfonyi chloride. MS (ESI) 509 (M+H)

Methyl 3-(((l-(naphthalen-2-ylsulfonyripiperidin-3-yl)((5-nitrothiophen-2- yl)meihyi|aminojmethyi)benzoate (208)

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrothiophen-2- yl)methyl)(piperidin-3-yl)aniino)mefhyl)benzoate and naphthalene-2-sulfonyl chloride. MS (ESI) 580 (M+H)

Methyl 3-(((l-((4-cMorobenzyl)sulfonyl)piperidm-4-yl )((5-nltiOthiophen-2- yl)methyi)amino)methyi)benzoate (209) Step : tert-butyl 4-((3-(methoxycarbonyl)benzy3¼mino)piperidme- -carboxylate

The title compound was prepared following the same general protocol as described in Step 1, compound 188, using methyl 3-(aminomethy3)benzoate and tert- butyl 4-oxopiperidine-l -carboxylate. MS (ESI) 349 (M+II) Step 2: tert-butyl 4-((3-(methoxycarbony3)benzyl)((5-ni trothiophen-2- y eth y )amino)piperidine- -carboxy ate

The title compound was prepared following the same general protocol a described in Step 1, compound 188, using tert-butyl 4-((3- (methoxycarbonyl)benzyl)ammo)piperidine- -carboxylate and 5-nitro-2- thiophenecarboxaldehyde. MS (ESI) 490 (M+H) Step 3: methyl 3-((((5-nitrothiophen-2-yl)methyl)(piperidin-4- vDamino)methvl)benzoate The title compound was prepared following the same general protocol as described in Step 3, compound 188, using using tert-butyl 4-(((3- (methoxycarbonyl)benzyl)((5--nitro carboxylate. MS (ESI) 390 (M+H) Step 4 : methyl 3-((( -((4-chlo obenzyl)sul onyl)piperidin-4-yl)((5-nitroth phe -2-

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3~((((5~nitrothiophen-2- yl)meth}4)(piperidin-4-yl)amino)methyl)benzoate and (4- chlorophenyi)methanesuifonyl chloride. MS (ESI) 578 (M+H)

Methyl 3-((((5-nitrothiophen-2-yl)methyl)(1-(pentylcarbanioyl)piperid

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrotliiophen-2- yi)methyl)(piperidin-4-yi)amino)methyl)benzoate and l-isocyanatopentane instead of N-(4-chlorobenzyl)-N-((5-nitrothiophen-2-yl)methyl)piperidin-3-amine and 4- chlorobenzene-l-sulfonyl chloride. M S (ESI) 503 (M+H)

Methyl 3-(((1 -(methylsulfonyl)piperidin-4-yl)((5-nitrothiophen-2.- ypmethyl) amino)methyl)benzoate (2 ) The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrothiophen-2- yl)methyi)(piperidin-4~yl)amino)methyl)benzoate and methanesulionyl ehioride. MS

(ESI) 468 (M+H)

Methyl 3-((((5-nitrotMophen-2-yl)meth yl)amino)methyl)benzoate (212)

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrotliiophen-2- yl)methyl)(piperidin-4-yl)amino)methyl)benzoate and isocyanatobenzene. MS (ESI) 509 (M+H)

Methyl 3-(((1 -(naphthalen-2-yisuJfonyl)piperidin-4-yl)((5-nitTothiophen-2-

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrofhiophen-2- yl)methyi)(piperidin-4~yl)amino)methyl)benzoate and naphthalene- chloride. MS (EST) 580 (M+H)

yDmethyljamino 'imethyi ibeiizoate (214)

Step 1 tert-butyl 3-(((3-(methoxyearbonyI)beazyQ ar xvlate

The title compound was prepared following the same general protocol as described in Step 1, compound 188, using methyl 3-(aminomethyl)benzoate and test- butyl 3-formylpyrrolidine- -carboxylate. MS (ESI) 349 (M+H)

Stop : i r - ; \ 3--( 3 i i » ; i , si . i n >; hit >p h n- ?. yl)methyl)amino)methyl)pyrrolid;ne- l -carboxylaie

The title compound was prepared following the same general protocol as described in Step 1, compound 188, using tert-butyl 3-(((3- (methoxycarbonyl)benzyl)amino)methyl)pyrrolidine-l ~carboxylate and 5-nitro-2- thiophenecarboxaldehyde. MS (ESI) 490 (M+H) Step 3: methyl 3-((((5-nitrotfaiophen-2-yr)methyl)(p>Trolidin-3- y¾methyl)amino)methyi)beiizoate

The title compound was prepared following the same general protocol as described in Step 3, compound 188, using tert-butyl 3· ίίί 3· (methoxycarbonyl)benzyl)((5-mtrot carboxylate instead of N-(4-chlorobenzyl)-N-((5-nitrotbiophen-2- yl)methyl)piperidin-3-amine. MS (ESI) 390 (M+H) nitrothiophen-2-yl)methyi)amino)methyl)benzoate The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitfothiophen-2- yl)methyi)(pyrrolidin-3 -ylmethy3)amino)methyl)benzoate and (4- chlorophenyi)methanesuifonyl chloride, MS (ESI) 578 (M+H)

Methyl 3-((((5-nilTotMophen-2-yl)mefhyi)((l-(penl;ylcarbamoyi)pyrro3Mm-3- yl)methyl)amino)methyl)benzoaie (215)

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrotliiophen-2- yl)methyl)(pyrrolidin-3-ylmethyl)amino)methyl)benzoate and I -isocyanatopentane. MS (ESI) 503 (M+H) Methyl 3-((( - mefhyls l ny¾pyrro yl)methyi)amino)methyi)benzoate (216)

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitfothiophen-2- yl)methyi)(pyrroiidin-3-yimethyl)amino)methyl)benzoate and methanesulfonyi chloride. MS (ESI) 468 (M+H)

Methyl 3-((((5-niirothiophen-2.-yl)methyi)((l-(phenyicarbamoyl)p y meth ) ino)meth y )benzoale (2 7

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrotliiophen-2- yi)methyl)(pyrrolidin-3-ylmethyl)amino)methyl)benzoate and isocyanatobenzene. MS (ESI) 509 (M+H)

Methyl 3-((((1 -(riaphthalen-2-yisu31bnyl)pyTrolidm-3-yl)met.hyl)((5-nitrothiophen-2- yl)methyi)amino)methyi)benzoate (218) The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5 -nitrothiophen-2- yl)metliyl)(pyrrolidin-3-ylmethyl)amiiio)methyl)benzoate and and naphthalene-2- sulfonyi. MS (ESI) 580 (M+H)

N-(4-chlorobenzyl)- -(naphthalen- -ylsulfonyl)-N-¾ ¾5-nitrothiophen-2- yl)methyljpiperidin-3-amine (219)

The title compound was prepared following the same general protocol as described in Step 4, compound 188 using naphthalene- -sulfonyi chloride instead of 4-chlorobenzene-l -sulfonyi chloride, MS (ESI) 556 (M+H)

3-((4-ehlorohenzy!)((5-nito carboxamide (220) The title compound was prepared following the same general protocol described in Step 4, compound 188, using 2-isocyanatopropane instead of 4- chlorobenzene-i-sulfonyl chloride. MS (ESI) 45 (M+H)

Methyl 3 (((1-(naphthalen- -y s libnyl)piperidiii- 4 -yi)((5 -nitrothiophen--2- yl)methyl)amino)methyl)benzoaie (22 )

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrotIiiophen-2- yl)methyi)(piperidin-4-yl)amino)methyl)benzoate and naphthalene- 1-sulfonyl chloride, MS (ESI) 580 (M+H)

Methyl 3-i((l-(isopropylcarbamoyl)piperidin-4-yl)((5-nitrothiophen-2-

The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrotliiophen-2- yi)methyl)(piperidin-4-yi)amino)methyl)benzoate and 2-isocyanatopropane. MS (ESI) 475 (M+H)

Meth yl 3-((((l -(is^ y methy!)amino m ethyPbenzoate (223 The title compound was prepared following the same general protocol as described in Step 4, compound 188, using methyl 3-((((5-nitrothiophen-2- yl)niethyl)(pwrolidin-3-ylmethyl)amino)methyl)benzoate and 2-isocyanatopropane MS (ESI) 475 (M+H)

N-(4-chlorobenzy¾)-l-(5-nitroth;ophen-2-yl)methanamine (224)

The title compound was prepared following the same general protocol described for compound 2 using p-chlorobenzylamine and 5-nitrothiophene-2 carbaldehyde. MS (ESI) 283 (M+).

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3,4-tetrahydroisoqumoline-3-carboxylate and 5-bromothiophene--2-carbonyl chloride. MS (ESI) 393.93/395.83 (M+). Ethyl 2-(5-r.itrotMophene-3-carbonyl)4,23 »4-tetrahydroisoquinoline-3-carboxylate

The title compound was prepared following the same general protocol as described for compound 7 using ethyl 1,2,3 ,4-tetrahydroisoquinoline-3-carboxylate and 5-nitrothiophene-3-cafbonyl chloride. MS (ESI) 360.87 (M+).

Ethyl 2-(5 -methoxyf uran-2-carbonyTi- ,2,3 ,4-tetrahydroisoquinoline-3-carboxylate

The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,4-tetrahydroisoqumoline-3-carboxylate and 5-methoxyfuran-2-carbonyi chloride. MS (EST) 329.98 (M+).

Ethyl 2--(thienof3.2^|thiophene--2--carbonyi)- l ,2,3 4 -tetiahydroisoquinoline 3-

The title compound was prepared following the same general protocol as described for compound 7 using ethyl l,2,3,4-tetrahydfoisoquinoline-3-carboxylate and tliieno[3,2-b]thiophene-2-carbonyl chloride. MS (ESI) 371.94 (M-h). ethyl 2-(6-methylimidazor2, 1-bltfaiazole-S-carbonyl)- 1,2,3,4-tetrahydroisoquinoline- The title compound was prepared following the same general protocol as described for compound 7 using ethyl l 2,3,4-tetrahydroisoquinoline-3-ca boxylate and 6-methylimidazo[2,i-b]thiazole-5-carbonyi chloride. MS (ESI) 370.16 (M+).

Ethyl 2-(2-(thiophene-2-carboxamido)acetyl)-l,2,3,4-tetraliydroisoquinoline-3-

The title compound was prepared following the same general protocol as described for compound 7 using ethyl ,2,3,4-tetrahydroisoquino3ine-3-carboxylate and 2

-( -naphthoyl)- l ,2,3,4-tetrahydroisoqumolme-3-carboxylic acid (231)

To a solution of compound 16 (1.12g) in T F/MeOH/ O (8:1 : by volume) was added 1M LiO . The reaction mixture was stirred at room temperature overnight and then diluted with EtOAc and acidified with 2M HCi until pH~5. The layers were separated, and the aqueous layer was extracted with EtOAc (2x). The combined organics were washed with brine (lx), dried (MgS0 ), and concentrated. The crude residue was purified by chromatography on silica gel (EtOAc/hex) to afford the title compound as a beige solid. MS (ESI) 331.89 (M+).

(R)-2-(l-naphthoyl)-1 ,2.3,44etrahydroisoquinol;ne-3-carboxylic acid (232) To a solution of ( )-l ,2,3,4-tetrahydroisoqumoline-3-carboxylate (500 mg) in CH2CI2 (lOmL) at 0°C was added trieihyla ne (590 \iL) followed by l-naphthoyl chloride (510 \iL), The reaction was allowed to come to room temperature overnight, and stirred for 14h. The reaction was diluted with EtOAc and acidified with 1MHC1. The layers were separated, and the organic layer was washed with M HCi (2x), brine (lx), dried (MgS0 ) and concentrated. The crude residue was purified by chromatography on silica gel (EtOAe/hex) to afford the title compound as a pale yellow solid. MS (ESI) 331.9 (M+H).

methyl 2-(l -naphthoyl)- 1,2,3,4-tetrahydroisoquinoline-3-carboxyiate (233)

To a solution of the product from compound 232 (80 mg) in MeOH(lmL)/benzene(lniL) was added excess TMS-diazomethane (160 uL). After 4h at room temperature, the reaction was quenched with HOAc (mL) and the reaction was concentrated in vacuo to give the title compound. MS (ESI) 345.93 (M+H).

-2-(1-naphthoyl)-! ,2,3,44etrahydroisoqu;noline-3-carboxylic acid (234)

The title compound was prepared following the same general protocol as described for compound 231 using (S)-l,2,3,4-tetrahydroisoquinoline-3-carboxylate.

(S)-methyl 2-(l -naphtho yl)- ,2,3,4-teirahydroi soqumo me-3-carbox v e (235) The title compound was prepared following the same general protocol as described or compound 232 using compound 234.

-2-(l -naphthoyl)-N-benzy -l 2,3 4 te (236)

The title compound was prepared following the same general protocol as described or compound 4 using compound 234 and benzylamine. MS (ESI) 420.67

(M+).

T'ert-butyl 2-((4-nitrobenzyl)(¾5-mtrothioph (237)

The title compound was prepared following the same general protocol as described for compound 5, using 4-nitrobenzaldehyde. MS (ESI) 408 (M + H)

-cyclohexyl-N-(2 -nitrobenzyl)-N-((5-nitrothiophen 2 y methyl)me hanamine (238) The title compound was prepared following the same general protocol as described for compound 5 , using 5-nitrothiophene-2-carbaldehyde, cyclohexylmethyl amine, and 2-nitrobenzaldehyde, M S (ESI) 390 (M + H)

e; hu; i 3 : . | 2.2. i p S 5 ;i c ί { - n t inph

The title compound was prepared following the same general protocol described for compound 5 , using S-niirothiophene-2-carbaldehyde, tert-butyl (aminomethyl)pyrrolidine- -carboxylate, and bicycio[2.2. 1]hept-5-ene-2- carbaldehyde, MS (ESI) 448 (M + )

Tert-butyl 3 -(((4-(methoxycarbonyl)benzyl)((5 --nitrothiophen-2.- ypmethyDamino )methyl)pyrrol;dine- -carboxylate (240)

The title compound was prepared following the same general protocol as described for compound 5 , using S-niirothiophene-2-carbaldehyde, tert-butyl 3- (ammomethyl)pyrrolidine- l -carboxylate, and methyl 4-formyibenzoate. M S (ESI) 490 (M + )

Tert-butyl 3-((((5-nitrotMophen-2-yl)methyl)(3-(2.- phenylacetamido )propyl)arm^o)meihyl)pyrrolidine-l -carboxylate (241 ) The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, tert-butyl 3- (aminomethyi)pyrrolidine- -carboxyiate, and N-(3-oxopropyl)-2-phenylacetamide.

MS (ESI) 533 (M + H)

Te -butyl 3-((((5-nitrotbiopben-2- yl)methy1)(py din-3- ylmeth yl) min )meth y )p yrrolidine- -carboxyl te (242)

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, tert-butyl 3- (ara inor ethyJ)pyrrolidme-l -carboxyiate, and nicotinaidehyde. MS (ESI) 433 (M )

Tert-butyl 3-(((2,5-dihydroxybenzyi)((5-nitrothiophen-2- met l)amino) ethyPpyrrolidine- -carboxyiate (243) The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaidehyde, test-butyl 3- (aminomethyl)pyT5Olidine-i-carboxylate, and 3,6-dibydroxybenzaldehyde. MS (EST) 464 (M + H)

Terl-butyl 3-(((benzordlthiazol-2-ylmethyl )((5-rdtrolhiophen-2-

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-carbaldehyde, tert-butyl 3- (aminomethyl)pyrrolidine- -carboxylate, and benzo[d]thiazole-2-carb aldehyde. MS (ESI) 489 (M ÷ H)

Tert-butyl 3-(((cyclooctyunethyl)((5-nitrotMophen-2-

The title compound was prepared following the same general protocol as described for compound 5, using 5-nitrothiophene-2-earbaldehyde, tert-butyl 3- (aminomethyl)pyrrolidine- -carboxylate, and cyclooctyialdehyd e. MS (ESI) 466 (M + H)

iS)-i3-(h ydroxymethyl)-3.4-dihydroisoquinolin-2( yDmethanone (246) To a solution of (S)-2-(l -naphthoyl)- 1,2,3,4-tetraliydroisoquinoline-3- carboxylic acid (0.500 g) in anliydrous THF (3 mL) at 0° C was added borane- methyl sulfide (10 M in THF, 0.181 mL, 1.2 eq.). The reaction was allowed to return to room temperature and stir for 24h and where it was quenched with 2 mL MeOIL The reaction mixture was diluted with EtOAc (100 mL), and washed with sat. a C (2 x 50 mL), brine (50 mL), dried over N 2S and concentrated to an oil. The oil was separated by silica gel (EtOAc / hexanes) to afford the title compound as a white solid. ESI-MS (m/z): 318 [M+ .

(R)-(3-(bydroxymethyl)-3^-dmydroisoquinolm-2(1H)-yl)(naphthaien-1-

The title compound was prepared following the same general synthetic procedure as described fo compound 246 using (R)-2-(l-naphthoyl)-l ,2,3,4- tetrahydroisoquinoline-3-carhoxylic acid.

2-((2-(l-naphti3oyl)- .23.4-tetrahydroisoquinolm-3-yl)methvl)isoindoline- 1.3-dione

To a solution of compound 126 ( 18 mg) in THF (lOmL) at room temperature was added DIAD (303 mg) followed by Pi¾P (393 mg) and phthalimide (220 mg). The reaction was stirred for 8h and then concentrated in vacuo onto silica gel. This crude residue was purified by chromatography on silica gel (EtOAc/hexanes) to afford the title compound. M S (E S T) 447.1 (M+H)

Naphthalen-l-yl(3-(phenoxym

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxymethyl)-3,4-dihydroisoquinolin- 2(lH)-yl)(naphthalen-l-yl)methanone and phenol. MS (ESI) 394.01 (M+H).

(3-((benzyloxy)methyl)-3,4-dihydroisoquinolln-2(lH)-yl)(naphthalen-l- vDmefhanone (250)

To a solution of compound 126 (16mg) in DMF (mL) at room temperature was added Nail (18 mg), After stirring for 20min, benzyl bromide (9 was added. The suspension was stirred for l h at room temperature, concentrated in vacuo, and purified by reverse-phase prep-HPLC to afford the title compound as a colorless solid. MS (ESI) 408.06 (M+H).

(S)-2-(tert-butoxycarbonyl)-l,23,4-tetrahydroisoquinoline-3-carboxyIic acid (251) To a solution of (S)-l,2,3,4-tetfahydroisoquinoline-3-carboxylate (2.00 g) in MeCN (10 mL) at rt v/as added TEA (5 eq) followed by di- -buty dicarbonate (3.0 g, 1.2 eq.) and allowed to stir overnight at rt. The reaction mixture was diluted with

EtOAc (200 mL) and washed with 0.05 M HC1 (3 x 100 mL), dried over Na2S0 4 and concentrated to a white solid. The crude product was used in the next synthetic step without further purification.

soquinolin-3-yl)methanol TFA salt (252)

To solution of (S)-2-(tert-butoxycarbonyi)-l ,2,3,4-tetrahydroisoqumoline-3- carboxylic acid (2.75 g) in anhydrous THE (10 mL) at 0° C was added borane-methyl sulfide (10 M in THE, 1.2 mL, 1.2 eq.). The reaction was allowed to return to room temperature and stir for 24h and then quenched with 5 mL MeOH. The reaction mixture was diluted with EtOAc (200 mL), and washed with sat. NaHC(¼ (2 x 00 mL), brine (2 x 50 mL), dried over 2S and concentrated to an oil. The crude oil was isolated by flash ciiromatography on silica gel (EtOAc/hexanes) and concentrated to a white solid, (S)-tert-butyi 3-(hydroxymethyl)-3,4-diliydroisoquinoline-2(lH)~ carboxylate. This was then dissolved into 10 mL methylene chloride (DCM) : TFA ( :1) and allowed to stir for 4 hours. The reaction mixture was aspirated until dry and concentrated to afford the TFA salt (S)-(l ,2,3,4-tetrahydroisoquinolin-3- yi)methanoi as a pale yellow crystalline,

(R)-2-(tert-butoxycarbonyl) ,2,3,4-te ahydroisoqu oline-3-carboxylic acid (253) O^OH The title compound was prepared following the same general synthetic procedure as described for compound 251 using (R)-l,2,3,4-tetrahydroisoquinoHne-3-carboxyiate.

-(l ,2,3.4 etraliydroisoquino ii -3-yl)methanol TFA salt (254)

The title compound was prepared following the same general synthetic procedure as described for compound 252 using (R)-2-(tert-butoxycarbonyl)-1,2,3,4- tetrahydroisoquinoline-3-carhoxylic acid.

-(2-(naphtha en -y su fonyl)-1.2 .3 (255)

To a solution of (S)-(l,2,3,4~tetrahydroisoquinoiin-3-yl)methanol TFA salt (0.100 g) in MeCN (5 mL) at 0°C was added pyridine (0.1 10 mL, 2.2 eq) followed by naphthalene- 1-sulfonyl chloride (0.156 g , 1.1 eq.). The reaction was allowed to return to rt and stir for an additional 1 hour. The reaction mixture was diluted with EtOAc (50 mL) and washed with 0.5 M HCI (2 x 50 mL) followed by brine (50 mL). The organic phase was then dried over N S0 and concentrated to a crude solid. The title compound was isolated by flash chromatography o silica gel (EtOAc / hexanes) and concentrated to a white solid. ESI-MS (m/z): 354 [ + .

) ?. ios . ?. ,} A i ; ·· ; n ί > : \ ; :o l i 256 i The title compound was prepared following the same general synthetic procedure as described for compound 255 using (S)-(l,2,3,4-tetrahydroisoquinolin-3- yljmethanol TFA salt and 4-toluenesulfonyl chloride. EST-MS (m/z): 3 8 [Μ+1] .

The title compound was prepared following the same general synthetic procedure as described for compound 255 using (R)-(l ,2 ,3 ,4-tetrahydroisoqumolin-3- yl)methanoi TFA salt and naphthalene- 1-sulfonyl chloride. ESI-MS (m/z): 354 [M+l] .

(R)-(2-tosyl-l,2,3,4-tetrahydroisoquinolin-3-yl)methanol (258)

The title compound was prepared following the same general synthetic procedure as described for compound 256 using (R)-(l ,2 ,3 ,4-tetrahydroisoquinoli yl)methanoi TFA salt and 4-toluenesulfonyl chloride, ESI-MS (m/z): 3 8 [M+l]

3 - i - nox )n i;- .4 d ir lr iso uino 2¾I )- )(naphthalen-l -ypmethanone (259) The title compound was prepared following the same general protocol as described for compound 248 using (S)-(3-(hydroxymethyl)-3,4-dihydroisoquinoiin- 2(lH)->l)(naphthalen-I->l)methanone and 4-tert-butoxy-phenol. ESI-MS 466 (M+H).

s i pi hai n-1-yDmethanone (260)

The title compound was prepared following the same general protocol as described for compound 248 using (S)-(3-(hydroxymethyl)-3,4-diliydroisoquinolin- 2(l H)-yl)(naphthalen-l -yJ)methanone and 4-tert-butoxy-phenol. ESI-MS 466 (M+H).

(S)-2-(naphtlialen-l -ylsulfonyl)-3-((4-propoxyphenoxy)methyl)- 1,2,3 4-

The title compound was prepared following the same general protocol as described for compound 248 using (S)-(2-(naphthalen-l-ylsu3fonyl)-l ,2,3,4- tetrahydroisoquinolm-3-yl)methanol and 4-propoxy-phenol. ESI-MS 488 (M+H).

(R)-2-(naphthalen-1-ylsulfonyI)-3-((4-propox\phenoxy)methyl)- 1,2,3,4-

The title compound was prepared following the same general protocol as described for compound 248 using (R)-(2-(naphthalen-l -ylsulfonyl)-] ,2,3,4- tetrahydroisoquinolin-3-yl)methanoI and 4-propoxy-phenol. ESI-MS 488 (M+H). The title compound was prepared following the same general protocol as described for compound 248 using (S)-(2-tosyl-l 2,3,4-tetrahydroisoquinolin-3- yl)methanoi and 4-propoxy-phenol. ESI-MS 452 (M+H).

(R)-3-{(4-propox3phenoxy)methyi)-2-tosyl-l,23,4-tetraliydroisoquinoline 264)

The title compound was prepared following the same general protocol as described for compound 248 using (R)-(2-tosyl-l,2,3,4-tetrahydfoisoquinolin-3- yl)methanol and 4-propoxyphenoi. ESI-MS 452 (M+H),

S -naphthalen-l -yl(3-(((4- t ¾

The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxymethyl)-3,4-dihydroisoquinolin- 2(lH)-yl)(naphthalen-l-yl)methanone and 3-trifluoromethoxybenzyl bromide. ES3-

M S 492 (M+H).

(S)-(3-(((3-fiuorobenzyl)oxy)rnethyl)-3,4-dihydroisoquino3in- 1-ypmethanone (266) The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxyraethyl)-3,4-dihydroisoquinolin- 2(1 H)-yl)(naphthaien- -yl)methanone and 3-iluorobenzyl bromide. ESI-MS 426 (M+H).

(S)-naphthalen-l-yl(3-(((3-(lrifluoromelhyl)benzyl )oxy)methyl)-3,4-

The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxymethyl)-3,4-dihydroisoquinoiin- and 3-trifluoromethylbenzyl bromide, ESI-MS 476 (M+ )

(S)-(3-(((4-chlorobenzyl)oxy)methyj>3,4-dm^ -yl)methanone (268)

The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxymethyl)-3,4-dihydroisoqumolm- 2(lH)-yl)(naphthalen-l-yl)methanone and 4-chlorobenzyl bromide. ESI-MS 443 (M+H). (SV(3-(((3-bromobenzyl)oxy)methyl)-3,4-dihydroi8oqumolin-2(iro -yDmetbanone (269)

The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxymethyl)-3,4-diliydroisoquinolin- 2(lH)-yl)(naphihalen- I -yl)methanone and 3-bromobenzyl bromide. ESI-MS 487 (M+H).

(S)-(3-(((4-methoxybenzyl)oxy)m^

The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxymethyl)-3 ,4-dihydroisoquinolin~2(l H)- yl)(naphthalen-I -yl)methanone and 4-methoxybenzyl bromide. ESI-MS 438 (M+H).

(S)-naphthalen- -yl(3-((p ri din-4-ylmet oxy) e H)-

The title compound was prepared following the same general protocol as described for compound 250 using (S)-(3-(hydroxymethyl)-3,4-diliydroisoquinolin- 2(lH)-yl)(naphthalen-l -yDmethanone and 4-pyridinylmethyl bromide. ESI-MS 409 (M+H).

(3-((4-ftuorophenoxy)methy

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxyniethyl)-3,4-dihydroisoquinolin- 2(1 H)-yl)(naphthaien- -yl)methanone and 4-F-phenol. MS (ESI) 412 (M+H). (3-¾¾4-methoxyphenoxy)methyiy^

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxymethyl)-3,4-dihydroisoquinolin- 2(lH)-ylXnaphthalen-l-yl)methanone and 4-MeO-phenol. MS (ESI) 424 (M+H).

(3-((4-ethoxyphenoxy)methyt)-3,4-dihydroisoquinolin-2(lH)-yl)(na yDmethanone (274) The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxymethyl)-3,4-dihydroisoquinolin- 2(lH)-yl)(naphthalen-l-yl)methanone and 4-EtO-phenol. MS (ESI) 438 (M-i-H). naphthalen- -yi(3-((4-propoxyphenoxy)methyl )-3 ,4-diliydroisoqu inolin-2(l H)-

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxyinethyI)-3,4-dihydroisoquiiiolin- 2(lII)-yl)(naphthalen-I-yl)methanone and 4-nPrO-phenol. MS (ESI) 452 (M+II),

(3-((4-(tert-butoxy)phenoxy)methyl)-3.4-dihydroisoquinolm-2( The title compound was prepared following the same general protocol as described for compound 248 using (3~(hydroxymethyi)-3o4-dihydroisoquinoiin- 2(lH)-yl)(naphthalen-I-yl)methanone and 4-t-BuO-phenol. MS (ESI) 466 (M+H).

Naphthalen- 1 -yDmethanone (277)

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxyniethyl)-3,4-dihydroisoquinolin-

2(lH)-yl)(naphthalen-l-yl)methanone and 4-CF 30-phenol. MS (ESI) 478 (M+H).

(3-((4-C - .2.,4-triazol- -yl)phenoxy)methyl)-3 ,4-dihydro;soquinolin-2{ H)-

The title compound was prepared following the same general protocol as described or compound 248 using (3-(hydroxymethyl)-3,4-dihydroisoquinolin- 2(lH)-yl)(naphthalen-l-yl)methanone and 4-(lH-l,2,4-triazol-l-yl)phenol. MS (ESI) 461 (M+H). (3-((2-methoxyphenoxy)methyl)-3,4-dihydroisoquinolin-2(lH)-yl)(napM

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxyniethyl)-3,4-dihydroisoquinolin- 2(1 H)-yl)(naphthalen-l -yl)methanone and 2-MeO-phenol. MS (ESI) xxxx (M+H).

(3-((3-metfaoxyphenoxy)metfayl)-3.4-dihydroisoquinolin-^

The title compound was prepared following the same general protocol as described for compound 248 using (3~(hydroxymethyi)-3,4-dihydroisoquinoiin- 2(lH)-yi)(naphthalen- 1-yDmethanone and 3-MeO-phenoi. MS (ESI) 424 (M+H).

3- 3:(dimethylam The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxymethyi)-3,4-dihydroisoqumolin-

2(lH)->l)(naphthalen-i->l)methanone and 3-Me2N~phenoI. MS (ESI) 422 (M+H).

(3-((3 4-d^

The title compound was prepared following the same general protocol as described for compound 248 using (3~(hydroxymethyi)-3,4-dihydroisoquinoiin- 2(lH)-yl)(naphihalen-I-yl)meihanone and 3,4-dimethoxyphenoi. MS (ESI) 454 (M+H),

(3-((2,4-difluorophenoxy)metM H)-yl)(Baphthalen- 1- yl)methanone (283)

The title compound was prepared following the same general protocol as described for compound 248 using (3-(hydroxymethyl)-3,4-dihydroisoquinolin- 2(lH)-yl)(iraphthalen-l-yl)methanone and 2,4-difluorophenol, MS (ESI) 430 (M+H).

Pharmaceutical Compositions In various embodiments, the invention provides a pharmaceutical composition comprising a compound of the invention and a pharmaceutically acceptable excipient. Accordingly, the invention provides compositions of the compounds of the invention, alone or in combination with another medicament. As set forth herein, compounds of the invention include stereoisomers, tautomers, solvates, prodrugs, pharmaceutically acceptable salts and mixtures thereof. Compositions containing a compound of the invention can be prepared by conventional techniques, e.g. as described in Remington: The Science and Practice of Pharmacy, 19th Ed., 1995, or later versions thereof, incorporated by reference herein. The compositions can appear in conventional forms, for example capsules, tablets, aerosols, solutions, suspensions or topical applications. Typical compositions include a compound of the invention and a pharmaceutically acceptable excipient which can be a carrier or a diluent. For example, the active compound will usually be mixed with a carrier, or diluted by a carrier, or enclosed within a carrier which can be in the form of an ampoule, capsule, sachet, paper, or other container. When the active compound is mixed with a carrier, or when the carrier serves as a diluent, it can be solid, semi-solid, or liquid material that acts as a vehicle, excipient, or medium for the active compound. The active- compound can be adsorbed on a granular solid earner, for example contained in a sachet. Some examples of suitable carriers are water, salt solutions, alcohols, polyethylene glycols, polyhydroxyethoxylated castor oil, peanut oil, olive oil, gelatin, lactose, terra alba, sucrose, dextrin, magnesium carbonate, sugar, cyciodextrin, amylose, magnesium stearate, talc, gelatin, agar, pectin, acacia, stearic acid or lower a ky ethers of cellulose, silicic acid, fatty acids, fatty acid amines, fatty acid monogiyeerides and diglyeerides, pentaerythritol fatty acid esters, polyoxyethyiene, hydroxymethylceilulose and polyvinylpyrrolidone. Similarly, the carrier or diluent can include any sustained release material known in the art, such as glyceryl monostearate or glyceryl distearate, alone or mixed with a wax. The formulations can be mixed with auxiliary agents which do not deleteriously react with the active compounds. Such additives can include wetting agents, emulsifying and suspending agents, salt for influencing osmotic pressure, buffers and/or coloring substances preserving agents, sweetening agents or flavoring agents. The compositions can also be sterilized if desired. The route of administration can be any route which effectively transports the active compound of the invention to the appropriate or desired site of action, such as oral, nasal, pulmonary, buccal, subdermal, intradermal, transdermal or parenteral, e.g., rectal, depot, subcutaneous, intravenous, intraurethral, intramuscular, intranasal, ophthalmic solution or an ointment, the ora route being preferred. f a solid carrier is used for oral administration, the preparation can be tableted, placed in a hard gelatin capsule in powder or pellet form or it can be in the form of a troche or lozenge. If a liquid carrier is used, the preparation can be in the form of a syrup, emulsion, soft gelatin capsule or sterile injectable liquid such as an aqueous or non-aqueous liquid suspension or solution. Injectable dosage forms generally include aqueous suspensions or oil suspensions which can be prepared using a suitable dispersant or wetting agent and a suspending agent injectable forms can be in solution phase or in the form of a suspension, which is prepared with a solvent or diluent. Acceptable solvents or vehicles include sterilized water, Ringer's solution, or an isotonic aqueous saline solution. Alternatively, sterile oils can be employed as solvents or suspending agents. Preferably, the oil or fatty acid is non-volatile, including natural or synthetic oils, fatty acids, mono-, di- or tri-glycerides. For injection, the formulation can also be a powder suitable for reconstitution with an appropriate solution as described above. Examples of these include, but are not limited to, freeze dried, rotary dried or spray dried powders, amorphous powders, granules, precipitates, or particulates. For injection, the formulations can optionally contain stabilizers, pH modifiers, surfactants, bioavailability modifiers and combinations of these. The compounds can be formulated for parenteral administration by injection such as by bolus injection or continuous infusion. A unit dosage form for injection can be in ampoules or in multi-dose containers. The formulations of the invention can be designed to provide quick, sustained, or delayed release of the active ingredient after administration to the patient by employing procedures well known in the art. Thus, the formulations can also be formulated for controlled release or for slow release. Compositions contemplated by the present invention can include, for example, micelles or liposomes, or some other encapsulated form, or can be administered in an extended release form to provide a prolonged storage and/or delivery effect. Therefore, the formulations can be compressed into pellets or cylinders and implanted intramuscularly or subcutaneously as depot injections. Such implants can employ known inert materials such as silicones and biodegradable polymers, e.g., polylactide- polyglycolide. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). For nasal administration, the preparation can contain a compound of the invention, dissolved or suspended in a liquid carrier, preferably an aqueous carrier, for aerosol application. The carrier can contain additives such as soiubilizing agents, e.g., propylene glycol, surfactants, absorption enhancers such as lecithin (phosphatidylcholine) or cyclodextrin, or preservatives such as parabens. For parenteral application, particularly suitable are injectable solutions or suspensions, preferably aqueous solutions with the active compound dissolved in polyhydroxylated castor oil. Tablets, dragees, or capsules having talc and/or a carbohydrate carrier or binder or the like are particularly suitabie for orai application. Preferable carriers for tablets, dragees, or capsules include lactose, corn starch, and/or potato starch. A syrup or elixir can be used in cases where a sweetened vehicle can be employed. A typical tablet that can be prepared by conventional tabletting techniques can contain:

Core: Active compound (as free compound or salt thereof)250 Colloidal silicon dioxide (Aerosil)® 1.5 mg Cellulose, microcryst. (Avicei)® 70 mg Modified cellulose gum (Ac-Di-Sol)® 7.5 mg Magnesium stearate Ad. Coati g: HPMC approx. 9 mg *Mywacett 9-40 T approx. 0.9 mg

*Acylated monoglyceride used as plasticizer for film coating. A typical capsule for oral administration contains compounds of the invention (250 mg), lactose (75 mg) and magnesium stearate (15 mg). The mixture is passed through a 60 mesh sieve and packed into a No. 1 gelatin capsule. A typical injectable preparation is produced by asepticaiiy placing 250 mg of compounds of the invention into a vial, asepticaiiy freeze-drying and sealing. For use, the contents of the vial are mixed with 2 mL of sterile physiological saline, to produce an injectable preparation. The compounds of the invention can be administered to a mammal, especially a human in need of such treatment, prevention, elimination, alleviation or amelioration of a malcondition. Such mammals include also animals, both domestic animals, e.g. household pets, farm animals, and non-domestic animals such as wildlife. The compounds of the invention are effective over a wide dosage range. For example, in the treatment of adult humans, dosages from about 0.05 to about 5000 mg, preferably from about 1 to about 2000 mg, and more preferably between about 2 and about 2000 mg per day can be used. A typical dosage is about 10 mg to about 1000 mg per day. In choosing a regimen for patients it can frequently be necessary to begin with a higher dosage and when the condition is u der control to reduce the dosage. The exact dosage will depend upon the activity of the compound, mode of administration, on the therapy desired, form in which administered, the subject to be treated and the body weight of the subject to be treated, and the preference and experience of the physician or veterinarian in charge. Generally, the compounds of the invention are dispensed in unit dosage form including from about 0.05 mg to about 1000 mg of active ingredient together with a pharmaceutically acceptable carrier per unit dosage. Usually, dosage forms suitable for oral, nasal, pu onai or transdermal administration include from about 25 g to about 1250 mg, preferably from about 250 to about 500 mg, and more preferably from about 2.5 mg to about 250 mg, of the compounds admixed with a pharmaceutically acceptable carrier or diluent. Dosage forms can be administered daily, or more than once a day, such as twice or thrice daily. Alternatively dosage forms can be administered less frequently than daily, such as every other day, or weekly, if found to be advisable by a prescribing physician. Biological Activity of Compounds with respect to REV-ERB Two REV-ERB β agonist compounds of the invention were found to possess sufficient plasma/brain exposure to allow evaluation of their effects in vivo. Both 1)

ble 1)

dose-dependently increased the REV-ERB-dependent repressor activity assessed in HE 293 cells expressing a chimeric GaI4 DNA Binding Domain (DBD) - REV-ERB ligand binding domain (LBD) a or β and a Gal4-responsive luciferase reporter (Fig. β lb) (SR9009: REV-ERBa IC5 =670 M, REV-ERB IC5o=800 nM; SR9011: REV- ERBa IC =790 nM, REV-ERBp IC =560 nM). The REV-ERB ligand SR6452 (compound 1, Table 1) which exhibits no plasma exposure 8 displays limited activity (Fig. lb). Both S 90 1 and SR9009 potently and efficaciously suppressed transcription in a eotransfection assay using full-length RE -ERB along with a uci erase reporter driven by the Bmall promoter (Fig. lc) (SR9009 IC o=710 nM; SR901 1 IC50=620 nM). We confirmed direct binding of the ligand to REV-ERBa using circular dichroism analysis (SR9009 d=800 nM). Neither SR9009 nor SR901 exhibited activity at other nuclear receptors when examined in a specificity panel of all human nuclear receptors we previously described 12' 3 SR9011 also exhibited ability to inhibit the activity of the SCN clock, with a reversible inhibition of circadian oscillations in SCN expiants cultured from the Per2:hic reporter mouse 14 (Fig. Id). Treatment of the SCN expiants suppressed the amplitude of the oscillations, but had no effect on the period (Fig. Id). After determining that SR9011 and SR9009 displayed reasonable plasma exposure, we examined the expression of REV-ERB responsive genes in the liver of mice treated with various doses of SR901 1. The plasminogen activator inhibitor type 1 gene (Serpinel) is characterized as direct REV-ERB target gene ' and displayed dose-dependent suppression of expression in response to SR901 1 (Fig. e). The cholesterol 7'cc-hydroxylase (Cyp7al) and sterol response element binding protein (Srepf ) genes have also been shown to be responsive to REV-ERB 6'1' and were dose-dependently suppressed with increasing amounts of SR9011 (Fig. le). SR9009 displayed a similar effect on these genes when it was administered at 100 mg/kg (Fig. le). Circadian Rhythm Based on the effects of these compounds on SCN clock activity, we predicted that administration of these compounds would alter circadian behavior. Circadian locomotor activity was examined in mice released into constant dark : ) ;· conditions after 1 week of housing in wheel cages in a standard iightxlark (L:D) setting. After 12 days in D:D conditions mice were injected with a single dose of SR9011, SR9009 or vehicle at CT6 (peak expression of Rev-erh . Vehicle injection caused no disruption in circadian locomotor activity (Fig. 2a - upper panels). However, administration of single dose of either REV-ERB agonist resulted in loss of locomotor activity during the subject dark phase (Fig. 2a - lower panels). Normal circadian locomotor activity returned the next circadian cycle, consistent with relatively rapid clearance of the drags, injection of a closely related compound (GSK41 12, 100 mg/kg i.p.) with limited plasma exposure did not affect locomotor activity (data not shown). We next assessed the expression of core clock genes in hypothalami isolated from mice in D:D conditions. Mice were injected with a single dose of SR90 1 or SR9009 at CT0 and hypothalami collected for expression analysis at CI , 6, 12, and

18. A range of effects were noted on the pattern of expression of the core clock genes. 'The amplitude of Perl expression was enhanced while C ry ?. was suppressed (Fig. 2b). Bmall expression was affected more subtly with a left shift in the phase of the circadian pattern (Fig. 2b). The circadian pattern of expression of Npas2 was completely eliminated (Fig. 2b). The pattern of expression of Clock was also altered with SR901 1 treatment resulting in enhanced amplitude of the oscillation, but also altering the phase so that the Clock oscillation was in phase with the Per oscillation (Fig. 2b). SR9009 treatment resulted in similar effects on gene expression (Supplemental Fig. 5). We also examined the effect of both REV-ERB iigands under L:D (12h:12h) conditions. Instead of complete loss of nocturnal locomotor activity, we noted a 1-3 h delay in the onset of nocturnal locomotor activity (Fig. 2c). Consistent with the more subtle effects on circadian behavior the effects of SR9011 and SR9009 on core clock gene expression in the hypothalamus were less severe than observed under constant darkness (Fig. 2d). The amplitude of Clock gene expression oscillation was suppressed with SR90 treatment and Bmall expression pattern displayed a left shift in phase (Fig. 2d). The expression of Per2, Cry2 and Npas2 were not effected by SR901 treatment. Similarly, SR9009 treatment affected Clock and Bmall expression but not other core clock genes. Genetic perturbation of the core clock genes leads to a range of metabolic phenotypes '18 In addition, REV-ERB has been shown to directly regulate genes involved in lipid and glucose metabolism '' 9'20. We observed clear metabolic effects when S 90 was chronically administered to mice (Balb/c, twice per day for 12 days). Mice displayed weight loss due to decreased fat mass (Fig. 3a). Food intake was not affected during this duration of treatment. Similar results were obtained in S 9009 treatment of C57B16 mice, We examined the metabolic effects of SR901 in more detail using a comprehensive laboratory animal monitoring system (CLAMS). Mice were acclimated for 3 days prior to initiation of dosing and during this time the vehicle-treated controls and the group to be treated with SR9011 exhibited no difference in oxygen consumption (V ), food intake or activity (x-axis beam breaks) during this time (data not shown). After acclimation, the animals were administered

SR901 1 twice per day for days. A 5% increase in oxygen consumption (VO¾ was observed suggesting increased energy expenditure (Fig. 3b). The increase in V0 2 was evident in the diurnal and nocturnal phases (Fig. 3c). The increases VG2 were not due to increased activity since mice displayed a 15% decrease in movement (Fig. 3d). Treatment also had no effect on food intake or in the respiratory exchange ratio. Consistent with increased metabolic rate, we observed a decrease in fat mass with SR901 1 vs. vehicle treatment (Fig. 3e). Treatment of mice housed in wheel cages in a L:D setting indicated a delayed onset of physical activity (Fig. 2d) and a similar l-3h delay in peak V0 2 was observed with administration of SR901 1 (Fig. 3f). Given the association between the circadian rhythm and metabolic regulation, and in order to understand the potential mechanism underlying the alterations in metabolic rate, we examined the effect of the REV-ERB ligands on the circadian expression of various genes in the liver, muscle and adipose tissue. Following a single injection of SR901 1, we monitored the expression of clock genes in the liver over a 24h period. When examining the effects of SR90 treatment on core clock gene expression the pattern of expression of Perl was altered, but others such as Binall and Npas2 were unaffected (Fig. 4a). Thus, SR9011 treatment results in alterations in the pattern of circadian expression of clock genes in both the hypothalamus (Fig. 2a, 2c) and liver, but there are clear distinctions in which genes are affected. These data suggest that the REV-ERB ligands differentially affect the central and peripheral clocks. We also assessed the expression of an array of genes involved in metabolism in the liver in response to SR901 treatment. The expression of lipogenic genes (Srehfl), fatty acid synthase (Fasn), and stearoyl-CoA-desaturase 1 (Scdl) were clearly altered with SR9 treatment (Fig. 4b). Both Srebfl and Scdl expression were suppressed whereas the phase of Fasti was phase shifted (Fig. 4b). Expression of genes involved in cholesterol and bile acid metabolism were also altered. Srebf2 and cholesterol 7a-hydroxylase expression (Cyp7al) were decreased (Fig. 4b). 3- hydroxy-3 -methyl-glutaryl-CoA reductase (Hrngcr) was unaffected in this acute model (Fig. 4b). Peroxisome pro liferator- activated receptor gamma coactivator 1- alpha and 1-beta (Ppargcla and Ppargclb) both displayed a strong circadian pattern of expression that was suppressed with S 90 treatment (Fig. 4b). Examination of gene expression in skeletal muscle revealed a potential mechanism for the increased metabolic rate that we observed in the CLAMS experiments. Expression of the genes that encode the rate limiting enzyme for β-oxidadon of fatty acids, carnitine palmitoyltransferase l b (Cptlb), as well as fatty acid transport into the skeletal muscle, fatty acid transport protein 1 (Fatpl), were elevated (Fig. 4c). Pppargclb expression was also elevated along with uncoupling protein 3 (lJcp3) consistent with altered fatty acid metabolism in skeletal muscle (Fig. 4c). The pattern of expression followed the expected diurnal increase in expression of genes involved in fatty acid oxidation, but the increases in expression were amplified (Fig. 4c). When we examined the expression key enzymes in the glycolytic pathway {hexokinase (Hfei) and pyruvate kinase (Pkm2)) we noted an increase in both (Fig. 4c) suggesting that treatment resulted increased glucose oxidation in addition to fatty acid oxidation. In contrast to the muscle where there was amplification of the circadian expression of genes coupled to fatty acid oxidation and glycolysis, in the white adipose tissue (W AT) we observed a suppression of circadian expression of key genes involved in lipid storage. The expression of both diglyceride acy ransf ra e 1 and 2 (Dgail and Dgat 2) the genes encoding the enzyme that catalyzes the terminal and committed step in triglyceride synthesis, were suppressed with SR901 treatment (Fig. 4d). Consistent with this pattern, the circadian expression of another gene involved in triglyceride synthesis, rnonoacylglycerol acyltransfease ( gai) is also disturbed (Fig. 4d). Expression of lipid droplet associated protein genes including perilipin 1 (Plinl) and hormone sensitive lipase (Hsl) were also suppressed with SR901 treatment (Fig. 4d). Similar results were noted in animals treated with SR9009. Clearly, modulation of REV-ERB activity by a synthetic agonist alters the pattern of expression of many genes involved in metabolism in several tissues including the liver, skeletal muscle and WAT. The alterations that we observed are consistent with decreased lipogenesis and cholesterol/bile acid synthesis in the liver, increased lipid and glucose oxidation in the skeletal muscle, and decreased triglyceride synthesis and storage in the WAT. We have developed synthetic REV-ERB β agonists with sufficient pharmacokinetic properties to examine their activity in vivo. We report that these compounds alter the circadian pattern of expression of core clock genes as well as circadian locomotor behavior in mice. A single injection of either SR901 or SR9009 results in loss of the subsequent active period in mice maintained under constant dark conditions. Consistent with this major alteration in circadian behavior the circadian pattern of core clock gene expression in the hypothalamus is perturbed. In Rev-erba null mice circadian locomotor activity is also disturbed with the mice displaying a decreased period relative to wt mice under constant dark or constant light conditions4. We would not necessarily expect to mimic the phenotype of either constant over- or under-expression of REV-ERB with a pharmacological REV-ERB ligand since modulation of the receptors' activity would be only transient. This is also the likely reason that on the ay following administration of the REV-ERB agonist, normal circadian behavior is completely restored. We also administered the REV-ERB agonists under L:D conditions to mimic a therapeutic situation as well as the metabolic studies where mice were maintained on this standard L:D cycle. In this case the effects of administration of the REV-ERB ligands were considerably more subtle both in terms of alterations in patterns of core clock gene expression in the hypothalamus and in circadian locomotor behavior. A single injection of either SR9009 or SR901 resulted in a 1 to 3 h delay in initiation of diurnal activity. Consistent with this observation, when we examined oxygen consumption we observed a similar delay in the nocturnal peak in VO - Thus, synthetic REV-ERB ligands effectively alter the physiological time of day of mice suggesting that this class of compound may be useful for the treatment of sleep disorders. Additionally, synthetic REV-ERB ligands may ho d utility for jet lag where the compounds could be used to realign both the central and peripheral clocks to a new time zone. The core clock machinery is closely associated with metabolic regulation and there are myriad examples of genetic alterations to clock genes leading to metabolic disturbances and even metabolic diseases in rodent models 18 1 23 . In addition to its role in direct modulation of the positive arm of the mammalian circadian oscillator, REV-ERB has also been demonstrated to play a direct roie in regulation of an array of metabolic genes 2". The Rev-erb n Y mouse has also been demonstrated to display a perturbations in lipid metabolism 0' ''2 . Bile acid synthesis is suppressed in the Rev-erbamill mice, an effect that has been attributed to indirect regulation of Cyp7al expression by REV-ERB either via alterations in the level of oxvsterols available for activation of LXR 6 or by direct suppression of the expression of transcription factors (Shp and E4bp) that inhibit the expression of CypJal 1 . Our data clearly indicate that pharmacological activation of REV-ERB β by e her SR9009 or SR90 suppresses the expression of CypJal We observed this both in lean and diet-induced obese mice. In rodents, CypJal expression and bile acid synthesis is closely coupled to cholesterologenesis where an increase in cholesterol synthesis leads to activation of LXR via oxysterols and subsequent activation of CypJal expression leading to cholesterol elimination via an increase in bile synthesis 28. The expression of key components of the cholesterol synthetic pathway are inhibited with REV-ERB agonist treatment including Sreb and Hmgcr that is consistent with the decrease in plasma cholesterol we observe in both lean and obese mice. Thus, it is likely that the decrease in cholesterol may drive the decrease in Cyp Jal expression. Feng et a . observed hepatic steatosis as well as an increase in de novo lipogenesis in the Rev- erh mice2' This is consistent with our observation that activation of REV ERB / β leads to suppression of iipogenic genes in the liver and also suggests that these compounds may be useful in the treatment of non-alcoholic hepatitis. Additionally, our observations hat the REV-ERB agonists increase energy expenditure, decrease fat mass and plasma TGs and cholesterol suggest that these compounds may hold utility in the treatment of obesity, type 2. diabetes, and atherosclerosis. Obesity Based on the alterations in energy metabolism and gene expression we observed in normal C57BL6 and Balb/c mice, we sought to examine whether a REV ERB β agonist would be efficacious in a rodent model of obesity. We initiated the study with 20- week old C57BL6 mice (average weight = 4 1g) that had been maintained on a high fat diet for 14 weeks 20 9 carbohydrate 60% fat). The mice continued on the HF diet and we initiated twice per day dosing (i.p.) of SR9009. While the stress of handling and twice-daily injections caused weight loss in vehicle- treated controls, weight loss of SR9009 treated animals was 60% greater (Fig. 5a). During the treatment period, there was no significant difference in the food intake of SR9009 and vehicle treated animals, although handling itself reduced food intake explaining the weight loss observed in the controls. SR9009 treated mice exhibited a more severe reduction in adiposity (Fig. 5b). In addition to the decrease in fat mass we also observed a 12% decrease in plasma triglycerides (TGs) and a 47% decrease in plasma total cholesterol (Choi) (Fig. 5c). Plasma non-esterified fatty acids (NEFA) were also reduced (23%) along with plasma glucose (19%) in the S 9009 treated animals (Fig. 5c). There was also a trend toward a decrease in plasma insulin levels

(35%). Consistent with the decrease in adipocity we also noted an 80 % decrease in plasma leptin and a decrease (72%) in the proinflammatory cytokine IL-6 (Fig. 5d). Examination of plasma triglycerides and total cholesterol in lean mice also demonstrated the ability of SR9009 and SR901 to reduce the levels of these lipids (Figs. 5e, 5f). Consistent with the decreased plasma TGs and total Choi we observed a significant decrease in the expression of genes encoding lipogenic enzymes (Fasn and Scdl) as well as cholesterologenic regulatory proteins {Htngcr and Srebfl) with SR9009 treatment (Fig. 5g). In the WAT, SR9009 treatment resulted in a decrease in expression of genes encoding enzymes involved in TG synthesis (Fig. 5g) as was also observed in lean mice (Fig. 4d). Similar to our observations in lean mice (Fig. 4c), we observed that the REV-ERB agonist induced the expression of genes involved in fatty acid and glucose oxidation (Cptlb, Ucp3 Ppargclb, Pkm2 and Hkl) (Fig. 5g). Taken together with the results from the CLAMS experiments (Fig. 3), these data suggest that REV-ERB agonists increase energy expenditure by increasing fatty acid and glucose oxidation in the skeletal m scle. The gene expression data is also consistent with decreased TG synthesis in the liver and WAT' as well as a reduction in hepatic cholesterol synthesis. Sleep Disorders It has been unexpected discovered that compounds of the invention can be used in the treatment of sleep disorders. We directly assessed the effect of SR9009 on sleep in mice by measuring eiectoencephalography (EECi) analysis over a 72h period. We injected mice with SR9009 or vehicle during the middle of their inactive period (daytime) under L:D conditions (Cireadian Time 6). Wakefulness, SWS, and REM sleep were quantitated from the EEG. As shown in Fig, 6 the animals alter their sleep pattern in response to injection of SR9009. What is immediately apparent is that wakefulness is induced for several hours post injection and then during the beginning of the subsequent dark period the wakefulness is suppressed for ~3h. This is consistent with the locomotor data indicating that there is a delay in activity during the nocturnal phase subsequent to injection. Sleep (SWS and REM sleep) is significantly suppressed for several hours after injection and at the initiation of the subsequent dark phase it is enhanced for several hours. Normal sleep pattern returns to the drag treated animals after ~ .h . These data clearly indicate that synthetic RE - E B iigands can modulate sleep behavior and suggest that REV-ERB agonists may represent a novel class of wakefulness inducing agents distinct from typical CNS stimulants. Electroencephalogram (EEG) EEG analysis was performed as previously described. 29 EEG data are recorded from stainless steel screw electrodes implanted on the frontal and parietal bone over the hippocampus (coordinates: 2.0 mm posterior and 2.0 mm lateral to bregma according to The Mouse Brain in Stereotaxic Coordinates from Franklin and Paxinos, 1977), and under general anesthesia (1-1.5% isoflurane). A fourth EEG electrode is implanted over the cerebellum, used to ground the animal to reduce signal artifacts, insulated leads from the EEG electrodes are crimped to male pins (220-P02) and then cemented to the skull with dental acrylic. Following surgical implantation mice are allowed 1-2 weeks to recover prior to the study. To record EEG, mice are connected to commutators (PlasticOne) with flexible recording cables allowing their unrestricted movements within the cage and habituated to the recording cages for 48h. Compounds will be administered and recording will continue for another 48h. The EEG and EMG signals were amplified in a Grass Model 7D polygraph in a frequency range of 0.3 to KHz. The EEG and EMG are displayed on a computer monitor and stored with a resolution of 28 Hz in the hard drive of a computer for the off-line analysis of the vigilance states and spectral analysis using software supplied by Kisses Comptec. The polygraphia results are analyzed semiautomatically by 5-second epochs and classified as W, SWS and REM sleep. The total time of these vigilance states is calculated in periods of 12 hours. The number and duration of the individual W, SWS and REM sleep episodes are evaluated. In addition to standard sleep analysis, EEG spectral analysis in the different states of vigilance is performed by Fourier fast transformer (FF'T) analysis using 4-second epochs. Anxiety Disorders During the course of our analysis of SR90 action in vivo we noted alterations in the behavior of the mice that would be consistent with anxiolytic activity. Based on the links between the circadian rhythm and anxiety discussed above, we examined this in greater detail. Mice were administered SR901 1 for 3-5 days (100 g kg, b.i.d., i.p.) prior to beginning an open field assay to assess anxiety- like behavior n an open field assay, mice treated with SR901 spent considerably more time in the center of the field, but displayed no change in total distance traveled (Figs. 6a, 6b, 6c). This effect, which is consistent with an anxiolytic effect, was confirmed in several other behavioral assays that assess anxiety. Consistent with the potential anxiolytic activity of SR901 1, mice treated with the drug spent considerably more time in the open arms in an elevated plus maze assessment (Fig. 6d). We also assessed the effect of SR901 on neophobia exhibited by mice in a novel object assay. Mice treated with SR901 1 spent 6.5 -fold more time near- the novel object consistent with anxiolytic activity (Figs. 6e & 6f). Anxiolytic activity was also assessed in a light-d ark box assay and as shown in Fig 7a, mice administered SR901 spent considerably more time in the light portion of the box, again consistent with anxiolytic activity of the REV-ERB agonist. Mice displayed no change in the number of transitions between the two boxes in this assay (Fig. 7b). Finally, we assessed the effect of the drug in the marble burying assay, where mice are introduced into cages with marbles on the surface of the bedding. Mice will naturally bury the marbles under conditions of stress/anxiety and the effects of anxiolytics can be readily assessed. As demonstrated in Fig. 7c, mice administered SR901 buried only 50% of the marbles that mice administered vehicle did. This anxiolytic effect was dose -dependent (Fig. 7d) and the potency (EDso=61 mg/kg) compares favorable to the potency of SR901 1 effects on circadian rhythm (ED.5o=56 mg kg) and gene expression in vivo (ED 67 mg kg). Anxiolytic drugs are typically associated with sedation and/or abuse/dependence, thus we sought to determine if SR901 1 would display these activities associated with the side effect profiles of commonly used anxiolytic drugs. We noted that in the open field assay that we observed no decrease in locomotor activity (no alteration in total distance traveled) at a dose of S 9 11 that displayed anxiolytic efficacy (Fig. 6c) and furthermore, we previously demonstrated tha SR901 did not affect latency to failure in the rotorod assay/ These data are consistent with the absence of sedative activity associated with common anxiolytics such as the benzodiazapenes, 5- T receptor agonists, and anti-histamines. To investigate this further, we assessed the effect of SR901 on sleep architecture. As shown in Fig. 8a, injection of SR9011 during the active period of the mice (circadian time 18; night) resulted in no alterations in wakefulness, slo wave sleep (SWS) or rapid eye movement (REM) sleep consistent with SR901 lacking CNS depressant activity. No significant effect was noted for SWS or REM sleep latency (Fig. 8b). Anxiolytics such as benzodiazapenes are associated with abuse liability since related to their positive reinforcing ability. T s can be detected in rodents using a condition place preference (CPP) assay." 38 We assessed the activity of SR90 in the CPP assay using an identical dose that displayed anxiolytic activity and found no condition place preference or aversion (Fig. 8c) suggesting that anxiolytics that target REV-ERB may display lower ab se potential than benzodiazapenes. Addiction Disorders Drug addition is a significant public health problem and costs the United States hundreds of billions of dollars per year.40 Current pharmacological treatments to reduce addictive behavior are limited. Based on the association of alterations of circadian rhythms with addiction/reward pathways in the brain,39 we assessed the ability of the REV-ERB agonist to reduce the conditioned place preference activity of the addictive drug cocaine. Administered alone, SR9011 displays no conditioned place preference or aversion activity (Fig.9). However, SR9011 clearly displays the ability to suppress the conditioned place preference activity of cocaine (Fig. 9) suggesting that REV-ERB agonists may have utility in the treatment of addiction. Autoimmune Disorders

T H17 cells are crucial effector cells implicated in the pathology of numerous autoimmune diseases, including multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, and systemic lupus erythematosus. These cells produce a number of cytokines, including IE- 7, which are known to enhance inflammatory processes. ·' · ' The discovery of these cells as critical mediators of autoimmune disorders provides a unique opportunity to develop focused therapeutics that act by inhibiting the function of these ceils. An essential roie for two nuclear receptors

(NRs), RORa and RORyt, has been established in the development of Ή17 ceils. Both of these NRs are required for the full differentiation of naive CD4 T cells into

ΤΉ 7 cells.43'"*4'46,49 RORs regulate the expression of key genes involved in T H cel differentiation and function including IL-17. '' ' ' An attractive strategy for the development of novel therapeutics for treatment of T 7-mediated autoimmune disorders is targeting RORa and RORyt with synthetic ligands that inhibit their activity resulting in decreased T H17 cell differentiation and/or function, which we recently demonstrated with SRI 001 (a mixed R R inverse agonist). 48 Based on the observation that both RORs and REV-ERBs bind to identical DNA response elements and thus share many target genes42 and both classes of receptors are expressed in T H17 cells, we hypothesized that REV-ERB ligands may also regulate

T 17 ceil development and/or function. To investigate this we used the synthetic REV-ERB agonists SR9009 and SR901 1 as well as a REV-ERB antagonist SR8278 to determine if modulation of REV-ERB activity could modulate transcription driven by the IL 7 promoter. As shown in Figure 10, the both REV-ERB agonists caused a decrease in reporter gene transcription consistent with REV-ERB playing an important role in regulation of IL 7. The antagonist caused an increase in IL1 driven reporter expression suggesting that there is a REV-ERB-dependent basal contribution of this receptor to 1L17 expression. These data suggest that, since the REV-ERB agonists suppress IL17 promoter driven transcription, REV-ERB agonists may hold utility in suppression of IL 7 expression and Τ 7 cell development and/or function and thus may be useful to treat autoimmune diseases. Accordingly, in various embodiments, the invention provides a method of modulating a REV-ERB receptor, comprising contacting the receptor and an effective amount or concentration of a compound of the invention. More specifically, the receptor can be REV-ERBa or REV-ERBp. More specifically, the compound can be a receptor agonist or a receptor antagonist. In various embodiments, the invention provides method of altering a circadian rhythm in a mammal comprising administering to the mammal an effective amount of a compound of the invention. The mammal can be a human. In various embodiments, the invention provides a method of treating a malcondition in a mammal wherein modulation of a REV-ERB is medically indicated, comprising administering to the mammal an effective dose of a compound of the invention. More specifically, the malcondition can comprise diabetes, obesity, atherosclerosis, dys!ipidemia, a circadian rhythm disorder, coronary artery disease, bipolar disorder, depress n, cancer, a sleep disorder, an anxiety disorder, an addiction disorder, or an autoimmune disorder

Bioassay Results In Tables 2 and 3, below, the first value given for each indicated compound µΜ number is the C50 ( ) generated from the full dose response curve. The value in parentheses is the maximum repression of transcription at 0 uM drug. Rev-erb is a transcriptional repressor. Rev-erb agonists lead to recruitment of co-repressors, which ieads to repression of transcription. The lower the value, the more efficacious the agonist is at repressing transcription. A value of 1.0 effectively means no repression. A value greater than 1 indicates relief of repression and is indicative of an antagonist. HEK293 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum at 37 C under 5% C02. HepG2 cells were maintained and routinely propagated in minimum essential medium supplemented with 10% fetal bovine serum at 37 °C under 5% C02. 24 hprior to transfection, HepG2 ce ls were plated in 96-well plates at a density of 15 x 103 ceils/well. Transfections were performed using LipofectamineTM 2000 (Invitrogen). Sixteen h post-transfection, the cells were treated with vehicle or compound. 24 h post-treatment, the uci erase activity was measured using the Dual-GioTM uci erase assay system (Promega). The values indicated represent the means ± S.E. from four independently transfected wells. The experiments were repeated at least three times. For assays assessing the activity of full-length REV-ERBcc an expression vector directing the expression of the entire REV-ER coding sequence was utilized along with a reporter vector composed of the Bmall promoter (~2kb) fused to a luciierase reporter gene was used. For assays using the Gai4-REV-ERB chimeric system, a mammalian expression vector directing the expression of the Gal4 DNA binding domain - REV-ERB ligand binding domain protein was cotransfected along with a reporter vector containing 5 copies of a Gal4 upstream activating sequence upstream of a luciferase reporter was utilized. Bioassay results, obtained as described herein, are provided in Tables 2 and 3, below, for exemplary compounds of the invention. Compounds are considered potent if Cs s < 10 µΜ , even better if < 1 µΜ , with preferred <0.3 µΜ .

Table 2 : ICso.values for selected compounds o the invention

Results are average of two or more experiments. Value in ( ) = fold change relative to µΜ DMSO control; * not saturated at 10 , unable to determine IC50 ; NA = not active; NT - not tested.

Table 3 : C values for selected compounds of the invention 261 0.33 (0.9) NT 262 0.61 (0.65) NT 263 0.68 (0.8) NT 264 0.62 (0.9) NT

265 1.5 (0.7) NT 266 0.44 (0.4) NT 267 0.73 (0.45) NT 268 0.49 (0.5) NT 269 0.66 (0.45) NT 270 0.42 (0.5) NT 271 1.3 (0.5) NT 272 0.84 (0.37) NT 273 0.12 (0.38) NT 274 0.097 (0.45) NT 275 0.077 (0.45) NT 276 0.14 (0.5) 0.17 277 0.6 (0.4) NT 278 0.12 (0.35) NT 279 2 (0.4) NT 280 0.62 (0.45) NT 28 0.78 (0.3) NT 0.33 (0.55) NT 283 0.71 (0.45) NT Results are average of two or more experiments. Value in ( ) = fold change relative to DMSO control; NA = not active; NT = not tested.

Documents Cited Welsh, D. ., Takahashi, J.S., & Kay, S.A., Suprachiasniatic nucleus: Cell autonomy and network properties. Annual Review of Physiology 72, 551 -577 (2010). Bass, J. & Takahashi, J.S., Orcadian integration of metabolism and energetics. Science 330 (6009), 1349-1354 (2010). Ko, C.H. & Takahashi, J.S., Molecular components of the mammalian circadian clock. Human Molecular Genetics 15, R271-R277 (2006). Preitner, N. et al, The orphan nuclear receptor rev-erb alpha controls circadian transcription within the positive limb of the mammaiian circadian oscillator. Cell 10 (2), 251-260 (2002). Crumbley, C. & Burns, T.P., Direct regulation of clock expression by rev-erb.

PloS One 3) (20 ). Raghuram, S. et al.. Identification of heme as the ligand for the orphan nuclear receptors rev-erbalpha and rev-erbbeta. Nat Struct Mol Biol 14 (12), 1207-1213 (2007). Yin, L. et al., Rev-erb {alpha}, a heme sensor that coordinates metabolic and circadian pathways. Science 318 (5857), 1786-1789 (2007). Kojetin, D., Wang, Y., Kamenecka, T.M., & Burris, T.P., Identification of sr8278, a synthetic antagonist of the nuclear heme receptor rev-erb. ACS Chemical Biology 6 (2), 131-1 34 (2011). Kumar, N. et al., Regulation of adipogenesis by natural and synthetic rev-erb ligands. Endocrinology 51, 3015-3025 (2010). ' Grant, D. et al., Gsk4112, a small molecule chemical probe for the ceil biology of the nuclear heme receptor rev-erbce±. ACS Chemical Biology 5 (10), 925- 932 (2010). 11 Meng, Q.J. et al, ligand modulation of rev-erb [alpha} function resets the peripheral circadian clock in a phasic manner. J Cell Sci 121 (21), 3629-3635 (2008). Kumar, N. et al, The benzenesulfonamide t0901317 is a novel ror{ alpha}/'{gamma} inverse agonist. Molecular Pharmacology 77, 228-236 (2010). Busby, S.A. et al, Identification of a novel non-retinoid pan inverse agonist of the retinoic acid receptors. ACS Chemical Biology, null-null (20 ).

1 Yoo, S.H. et al, Period2 :: Luciferase real-time reporting of circadian dynamics reveals persistent circadian oscillations in mouse peripheral tissues. Proceedings of th National Academy of Sciences of the United States of America 101 (15), 5339-5346 (2004). Wang, J., Yin, L., & Lazar, M.A., The orphan nuclear receptor rev-erb alpha regulates circadian expression of plasminogen activator inhibitor type 1. Journal of Biological Chemistry 281 (45), 33842-33848 (2006). Le Martelot, G. et aL, Rev-erba participates in circadian srebp signaling and bile acid homeostasis. PLoS Biol 7 (9), el000181 (2009). ' Duez, H. et at.., Regulation of bile acid synthesis by the nuclear receptor rev erb alpha. Gastroenterology 135 (2), 689-698 (2008). Green, C.B., Takahashi, J.S., & Bass, J., The meter of metabolism. Cell 134 (5), 728-742 (2008). 1 Ramakrishnan, S.N., Lau, P., Burke, L.J., & Muscat, G.E.O., Rev-erb beta regulates the expression of genes in volved in lipid absorption in skeletal muscle cells - evidence for cross-talk between orphan nuclear receptors and myokines. Journal of Biological Chemistry 280 (10), 8651-8659 (2005). Raspe, E. el a , Identification of rev-erb alpha as a physiological repressor of apoc-iii gene transcription. Journal of Lipid Research 43 (12), 2172-2179 (2002). Bray, M.S. & Young, M.E., Regulation of fatty acid metabolism by cell autonomous circadian clocks: Time to fatten up on information? Joumal of Biological Chemistry 286 (14) (201 1). Asher, G. & Schibler, II., Crosstalk between components of circadian and metabolic cycles in mammals. Cell Metabolism 13 (2), 125-137 (2011). Gimble, J.M., Sutton, G.M., Bunnell, B.A., Ptitsyn, A.A., & Floyd, Z.E., Prospective influences of circadian clocks in adipose tissue and metabolism. Nature Reviews Endocrinology 7 (2), 98-107 (201 ). 2 Duez, II. & Staels, B., Rev-erb-aipha: An integrator of circadian rhythms and metabolism. Journal of Applied Physiology 107 (6), 1972-1980 (2009). Burris, T.P., Nuclear hormone receptors for heme: Rev-erbalpha and rev- erbbeta are ligand-regulated components of the mammalian clock. Mol Endocrinol 22 (7), 1509-1520 (2008).

Yin, L.., Wu, N., & Lazar, M.A., Nuclear receptor rev-erbalpha: A heme receptor that coordinates circadian rhythm and metabolism. Nucl Recept Signal. 8, eOOi (2010). 2 ' Feng, D , et al, A circadian rhythm orchestrated by histone deacetylase 3 controls hepatic lipid metabolism. Science 33 (6022), 3 5- 9 (20 11). Russell, D.W., Fifty years of advances in bile acid synthesis and metabolism. Journal of Lipid Research 50, S120-S125 (2009). L. A, Solt et a , Regulation of Orcadian Behavior and Metabolism by Synthetic REV-ERB Agonists. Nature 485, 62 (2012). P. B. Hedlund, S. Huitron-Resendiz, S. J. Henriksen, J. G. Sutciiffe, 5-HT7 receptor inhibition and mactivation induce antidepressantlike behavior and sleep pattern. Biological Psychiatry 58, 831 (Nov 15, 2005). S. Huitron-Resendiz et al., Urotensin modulates rapid eye movement sleep through activation of brainstem cholinergic neurons. J Neurosci 25, 5465 (Jun 8, 2005). 2 S. Huitron-Resendiz, M. Sanchez-Alavez, D. N. Wills, B. F. Cravatt, S. J. Henriksen, Characterization of the sleep-wake patterns in mice lacking fatty acid amide hydrolase. Sleep 27, 857 (Aug 1, 2004). P. Bourgin et aL, Hypocretin-1 modulates rapid eye movement sleep through activation of locus coeruleus neurons. J Neurosci 20, 7760 (Oct 5, 2000). 4 L. A. Solt et al., Regulation of Orcadian Behavior and Metabolism by Synthetic REV-ERB Agonists. Nature 485, 62 (2012). A. Gray, C. Allison, J. A. Pratt, A role for AMPA/kainate receptors in conditioned place preference induced by diazepam in the rat. Neurosci Lett 268, 127 (J m 25, 1999). C. Spyraki, A. Kazandjian, D. Varonos, Diazepam -induced place preference conditioning: appetitive and antiaversive properties. Psvchopharmacologv (Beri) 87, 225 (1985). ' ' C. Spyraki, H. C. Fibiger, A role for the mesolimbic dopamine system in the reinforcing properties of diazepam. Psychopharmacology (Beri) 94, 33 (1988). G. G. Nomikos, C. Spyraki, Effects of ritanserin on the rewarding properties of d -amphetamine, morphine and diazepam revealed by conditioned place preference in rats. Pharmacol Biochem Behav 30, 853 (Aug, 1988). Falcon, E., and McClung, C.A. (2009). A role for the circadian genes in drug addiction. Neuropharmacology 56, 91-96. Potenza, M.N., Sofuoglu, M., Carroll, .M., and Rounsaviile, B.J. (2011). Neuroscience of behavioral and pharmacological treatments for addictions. Neuron 69, 695-712. Bettelli, E., Korn, T., Oukka, M., and Kuchroo, V. . (2008). Induction and effector functions of T(H)17 cells. Nature 453, 1051-1057. Burris, T.P. (2008). Nuclear hormone receptors for heme: REV-ERBalpha and REV-ERBbeta are ligand-regulated components of the mammalian clock. Mol Endocrinol 22, 1509-1520. Ivanov, , McKenzie, B.S., Zhou, L., Tadokoro, C.E., Lepelley, A., Lafaille, J.J., Cua, D.J., and Littman, D.R. (2006). The orphan nuclear receptor ROR gamma t directs the differentiation program of proinflammatory IL-17(+) T helper cells. Cell 126, 1121-1133. Ivanov, II, Zhou, L., and Littman, D.R. (2007). Transcriptional regulation of Th 7 cell differentiation. Seminars in Immunology 19, 409-417. littman, D.R., and Rudensky, A.Y. (2010). Thl7 and Regulatory T Cells in Mediating and Restraining Inflammation. Cell 40, 845-858. Manel, N., Unutmaz, D., and Littman, D.R. (2008). The differentiation of human T-H-17 cells requires transforming growth factor-beta and induction of the nuclear receptor ROR gamma t. Nature Immunology 9, 641-649.

4 McGeachy, M.J., and Cua, D.J. (2008). Thl7 cell differentiation: The long and winding road. Immunity 28, 445-453. Solt, L.A., Kumar, N., Nuhant, P., Wang, Y.J., Lauer, J.L., Liu, J., Istrate, M.A., Kamenecka, T.M., Roush, W.R., Vidovic, D., et a . (2011). Suppression of T(H)17 differentiation and autoimmunity by a synthetic ROR ligand. Nature 472, 491-494. Yang, X.X.O., Pappu, B.P., Nurieva, R., Akimzhanov, A., Kang, U.S., Chung, Y., Ma, L., Shah, B., Panopoulos, A.D., Schluns, K.S., et a . (2008). T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity 28, 29-39.

Examples Bioassay Methods Cell Culture and Cotransfections HEK293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum at 37 °C under 5% C02. HEK293 cells were plated in 96-well plates at a density of 5 x 10 cells/well. Transiections were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) with vectors previously described! Kumar, 2010 #990}. Twenty-four h post-transfection, the ceils were treated with vehicle or compound. Twenty-four h post-treatment, the luciierase activity was measured using the Dual-Gio luciierase assay system (Promega, Madison, WI). The values indicated represent the means ± S.E. from four independently transfected wells. The experiments were repeated at least three times.

Data were analyzed using GraphPad Prizm software, and IC 50 values were determined by nonlinear regression analysis. Mouse studies For circadian gene expression experiments male C57BL6 mice (8-10 weeks of age) were either maintained on a L:D (12h:12h) cycle or on constant darkness ( 1 day). At circadian time (CT) 0 animals were administered a single dose of 100 mg/kg SR9009 or SR9011 (i.p.) and groups of animals (n=6) were harvested at CT0, T6 , CT12 and CT18. Gene expression was determined by real time QPCR as described in the Supplementary Methods. The effects of SR9011 and SR9009 were assessed in both C57BL6 and Balb/c mice (male, 8-10 weeks of age). Baib/c mice were administered SR9011 (100 mg/kg, Lp., b.i.d.) for 12 days. In male C57BL6 mice (DIO, 22 weeks of age) SR9011 or SR9009 was administered (100 mg/kg, Lp., b.i.d) for 30 days. SR901 1 and SR9009 were formulated in 15% cremophor for all animal studies unless otherwise indicated. Cotransfection assays Cotransfection assays were performed as we have previously described in E 293 cells (Gal4 cotransfection assay) or in HepG2 cells (full-length REV ERB ). ~ 5 SCN culture and treatments SCN cultures from Per2! i mice was performed as previously described.^ SR901 was administered at 5 µΜ, Mice Male mice were obtained from Jackson Laboratories (Bar Harbor, ME). Ail the procedures were conducted in the Scripps vivarium, which is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care, and were approved by the Scripps Florida Institutional Animal Care and Use Committee. General mouse studies For dose-response experiments male C57BL6 mice (8-10 weeks of age) were administered various doses of S 90 1 or 100 mg/kg SR9009 (i.p., b.i.d.) for 6 days. At termination of the experiment livers were harvested and gene expression was examined by real time QPCR using methods previously described. 354 For circadian gene expression experiments male C57BL6 mice (8-10 weeks of age) were either maintained on a L:D (12h:12h) cycle or on constant darkness ( 1 day). At circadian time (CT) 0 animals were administered a single dose of 100 mg/kg SR9009 or SR901 (i.p.) and groups of animals (n=6) were harvested at CT0, CT6, CT12 and CT 8. Gene expression was determined by real time QPCR as previously described. 14 Gene expression was normalized to Cyclophin b in all experiments. The effects of SR901 1 and SR9009 were assessed in both C57BL6 and Balb/c mice (male, 8-10 weeks of age). Balb/c mice were administered SR9011 (100 mg/kg, i.p., b.i.d.) for 12 days n male C57BL6 mice (DIO, 22 weeks of age) SR9011 or SR9009 was administered (100 mg/kg, i.p., b.i.d) for 30 days. Food intake and body weight was monitored daily in these experiments and body composition was measured prior to initiation and at the end of the experiments by DEXA. Plasma was also collected for triglyceride and cholesterol measurements. Circadian locomotor behavior Assessment of circadian locomotor activity was performed in Behavior Core in The Scripps Research Institute, Scripps Florida. A Coulbourn Instruments (Whitehall, PA) ClockLab System with mouse running wheel cages was utilized. C57BL6 mice were housed individually. For the constant dark experiments animals were first maintained for 7 days in a 12h:12 iight:dark (LD) cycle. The LD cycle was then changed to constant dar for 2 weeks. Animals were checked for health and food status daily, water bottles were changed every week, and bedding was changed every 3 weeks. The vehicle, SR9011, SR9009, or GS 4 were administered by i.p. injection at CT6. For normal L:D studies mice were maintained on a L:D 12h:12h cycle and after 4-5 days the animals were injected with vehicle or compound at CT6. Compounds were administered at 100 mg/kg (single injection). Comprehensive laboratory animal monitoring system (CLAMS) The Columbus Instruments (Columbus, OH) CLAMS system was utilized to monitor the metabolic parameters of mice (male C57BL6, 8- 10 weeks of ag) administered SR90 (100 mg kg, i,p., b.i.d.). Mice were acclimated for 3 days in the CLAMS prior to administration of SR9011 or vehicle 15% cremophor). During these 3 days mice were administered injected with vehicle (i.p.) to acclimate them to the twice-daily injections. The administration of S 9 was continued for 10 days. Seven animals were included per group. Diet induced obesity model Twenty-two week old male C57BL6 mice were maintained on a high fat diet (20% carbohydrate and 60% fat) for 14 weeks (average weight = 41g) and were used for the DIO studies. The mice were sustained on the high fat diet and SR9009 treatment was initiated and continued for 30 days (100 mg/kg, b.i.d., i.p.). At the termination of the study tissues were harvested for determination of gene expression. Gene expression was assessed by real time QPCR as described abo ve. Plasma was also collected. Pharmacokinetic studies Pharmacokinetic studies of SR9009 and SR90 in mice were performed as previously described 157 . Nuclear receptor specificity assay SR9009 and SR9011 were assessed for their ability to modulate the activity of all 48 human nuclear receptors using a Gal4 eotransfection assay system we have- previously described. Both compounds were tested at 0 µΜ and positive controls were included for nuclear receptors with characterized ligands. ' Hormone assays Leptin and IL-6 were measured using a multiplexed kit (Millipore, Mouse Metabolic Magnetic Bead Panel) and a Luminex® 200 xPONENT 3.1 instrument (Luminex Corp), insulin was measured byELISA (Millipore). Manufacturer protocols were followed. Lipid assays Plasma triglycerides and total cholesterol were assessed using an Analox (GM7 Micro-Stat) instrument and kits provided by the same manufacturer following their protocols. Circular Dichroism (CD) Spectroscopy CD spectroscopy was performed on REV-ERBa as previously described. 0

The , was determined by methods described by Layton and Hellmga. Addiction Studies Animals Male C57BL6 mice at seven weeks of age were obtained from Jackson Laboratories (Bar Harbor, ME). Ail mice were housed in an environmentally controlled vivarium on a 12h:12 h reversed light iar cycle. Food and water were provided ad libitum. All procedures were conducted in strict accordance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of The Scripps Research Institute - Florida. Drugs Cocaine hydrochloride (National institute on Drug Abuse) was dissolved in sterile 0.9% saline solution. SR9011 was provided at a dose of OO g kg i.p.

Conditioned Place Preference (CPP) Studies were conducted using a three-compartment apparatus with two equal- sized chambers (17x12.7x12.3 cm) separated by a neutral gray chamber (8.5x12.7x12.3 cm) (ENV-3013; Med Associates, St. Albans, VT). The large compartments differed in the wall color (black or white) and flooring (wire bars or wire mesh) and were separated from the center gray compartment by sliding doors. Mice were first assessed for baseline preference across two 30-min sessions. Each animal was placed in the center gray chamber and permitted to freely move through the chambers. Time spent in each chamber was recorded utilizing Med PC software. Based on the time spent in either the white or black chamber during the baseline sessions, the non-preferred chamber was assigned as the drug-paired chamber, while the preferred chamber was paired with saline. Mice were subsequently trained across six consecutive days. For each session, animals were injected prior to being confined to the assigned white or black chamber for 30 rain. For the first experiment, the mice were injected with either R90 or vehicle 5 min prior to being placed in the chamber, whereas for the second experiment, injections consisted of either (1) SR901 (15 min prior) and cocaine (10 mg/kg; 10 min prior); (2) vehicle ( 5 min prior) and cocaine (10 mg kg; 10 min prior); or (3) vehicle ( 5 min prior) and saline (10 min prior). Al injections were administered i.p. Injection and chamber parings were counterbalanced across training sessions. On the final test day, mice were placed in the center gray compartment and permitted to freely move throughout the apparatus for 30 mill. The time spent in each chamber was recorded as above, and the data from the test day was compared to the baseline level to obtain a preference score (post- training/pre-traming). * indicates p<0.05 by students t test. Autoimmune Studies HEK293 ceils (American Type Culture Collection) were maintained in Dulbecco's modified Eagle's medium supplemented with 0% FBS and antibiotics (penicillin and streptomycin; Invitrogen). The IL-17 reporter construct was purchased from ATCC and previously described. 24 h prior to transfection, IIE 293 cells were plated in 96-well plates at a density of 15 x ' cells/well. Transfeetions were performed using Lipofectamine M 2000 (Invitrogen). 24 h post-transfection, the cells were treated with vehicle or compound. 24 h post-treatment, the luciferase activity was measured using the Dual-Glo™ luciferase assay system (Promega). Results were analyzed using GraphPad Prism software. Compounds were tested at a concentration of 5 µΜ. Differences between groups were evaluated by the students t test and a p value of less than 0.05 was deemed significant. Statistical Analysis A l data are expressed as the mean +/- s.e.m. (n=3 or more). Statistical analysis was performed using aStudent's t-test. QPC Primers Utilized Table 2" Primers used in qPCR Cypb Forward GCAAGTTCCATCGTGTCATCAAG SEQ ID NO: 1 Reverse CCAT.AGATGCTCTTTCCTCCTG SEQ ID NO: 2 Serpinei Forward ATGTTT.AGTGCAACCCTGGC SEQ ID NO: 3 Reverse TTTTGCAGTGCCTGTGCTAC SEQ ID NO: 4 Cyp7al Forward ACAGAGTGCTGGCCAAGAGCTC SEQ ID NO: 5 Reverse GATGCACTGGAGAGCCGCAGA SEQ ID NO: 6 Srebfl Forward TCCAGTGGCAAAGGAGGCA SEQ ID NO: 7 Reverse ATAGCAGGATGCCAACAGCA SEQ ID NO: 8 Rev-erba Forward GGGCACAAGCAACATTACCA SEQ ID NO: 9 Reverse CACGTCCCCACACACCTTAC SEQ ID NO: 10 Bma Forward CTCCAGGAGGCAAGAAGATTC SEQ ID NO: f Reverse ATAGTCCAGTGGAAGGAATG SEQ ID NO: 2 Per2 Forward ACCGACCTCCCCTCATGGGC SEQ ID NO: 3 Reverse CTGGCACTGCGGTGGGGAAG SEQ ID NO: 14

Clock Forward GCCTCAGCAGCAACAGCAGC SEQ D NO: 15 Reverse ACCGCATGCCAACTGA GCG A SEQ ID NO: 16 Npas2 Forward TGGCCTGAGCCTCACCACGA SEQ ID NO: 17 Reverse GCAACAGCCTGAGCTGCCGA SEQ ID NO: 18 Cry2 Forward GCTGGAAGCAGCCGAGGAACC SEQ ID NO: 9 Reverse GGGCTTTGCTCACGGAGCGA SEQ ID NO: 20

Srebf2 Forward CATCTGCCGGTGGTGGACGT SEQ ID NO: 2 1 Reverse GCGC ACA GCTGC ATCGTCTC SEQ ID NO: 22

Ppargc-la Forward TGCAAGACCGTGGTGCCACC SEQ ID NO: 23 Reverse TCCTCGGCTGAGCCCTGAGG SEQ ID NO: 24 Ppargc-lb Forward AGCTGCTTCTGTCTGTGAGTTTCC SEQ ID NO: 25 Reverse AAGGGGCGATGGGTGACGGA SEQ ID NO: 26 Fasrs Forward GTCACCACAGCCTGGACCGC SEQ ID NO: 27 Reverse CTCGCCATAGGTGCCGCCTG SEQ ID NO: 28

Scdl Forward CGCTGGTGCCCTGGTACTGC SEQ ID NO: 29 Reverse CAGCCAGGTGGCGTTGAGCA SEQ ID NO: 30 Hmgcr Forward ATGGCTGGGAGCATAGGCGG SEQ ID NO: 3 1

Reverse CTGCATCCTGGCCACATGCG SEQ ID NO: 32.

Cpt-lb Forward ACCGTGAAG GATC AGCCGGT SEQ ID NO: 33 Reverse TCTCTTTGCCTGGGATGCGTGT SEQ ID NO: 34 Ucp2 Forward TTTGCCTCCGTCCGCATTGG SEQ ID NO: 35 Reverse CTCCCGATGCCTGCATGCTC SEQ ID NO: 36

Ucp3 Forward CTCCCCTAGGCAGGTACCGC SEQ ID NO: 37 Reverse CGTTCCAAGCTCCCAGACGC SEQ ID NO: 38 Fatpl Forward CGGCTCCTGCGGCTTCAACA SEQ ID NO: 39 Reverse CTG GCACGG GATGC A GAGGC SEQ ID NO: 40

Cycs Forward AGGGGCATGTCACCTCAAACCT SEQ ID NO: 4 1 Reverse AGGCCAGTGAACACAAACTGAAACA SEQ ID NO: 42

! i Forward A . A.. A G ¾A A A.. SEQ ID NO: 43

Reverse i . i GGG ί AG S SEQ ID NO: 44 Pkm2 Forward TGGATGTTGGCAAGGCCCGA SEQ ID NO: 45 Reverse AGGGCCATCAAGGTACAGGCACT SEQ ID NO: 46 Dgatl Forward CCTGCGGATGTTCCGCCTCT SEQ ID NO: 47 Reverse ACCCACACAGCTGCATTGCC SEQ D NO: 48 Dgat2 Forward CGGATGCCTGTGCTTCGCGA SEQ ID NO: 49 Reverse CAGCTGCACCTCCCACCACG SEQ ID NO: 50 Piinl Forward TGGCCTCTGGAGGGGCTGAT SEQ ID NO: Reverse GGCCTTGGGAGCCTTCTGGG SEQ ID NO: 52 Hsl Forward AGGCCTCAGTGTGACCGCCA SEQ ID NO: 53 Reverse GCCCCACGCAACTCTG GGTC SEQ ID NO: 54 Mgatl Forward TGGGGGAGGTGCGGGTACAG SEQ ID NO: 55 Reverse GCCGGCCCCGAAACTGGAAA SEQ ID NO: 56 Gpat Forward CCCAGCACAACTGTCCCGTCA SEQ ID NO: 57 Reverse CAGCGGACCCTCCAGAGCAC SEQ ID NO: 58 Agpatl Forward GCTTCACCTCGCCTGGACGT SEQ ID NO: 59 Reverse TGGTGAGCATGGAGTGCCGG SEQ ID NO: 60 Agpat2 Forward GCAGATCGCCAAGCGTGAGC SEQ ID NO: 6 1 Reverse AGTTCTGGCTTGCTGGCGGT SEQ ID NO: 62 Agpat6 Forward AGGACACCAATGCCAGGCGT SEQ ID NO: 63 Reverse AGAGCCCCAGCCTTTGCC AG SEQ ID NO: 64

Examples: Documents Cited

Kojetin, D., Warsg, Y., Kamenecka, T.M., & Burns, T.P., Identification of sr8278, a synthetic antagonist of the nuclear heme receptor rev-erb, ACS Chemical Biology 6 (2), 131-134 (2011). Kumar, N. et al. Regulation of adipogenesis by natural and synthetic rev-erb ligands. Endocrinology 151, 3015-3025 (2010). Chandra, V. et al, Structure of the intact ppar-gamma-rxr-alpha nuclear receptor complex on DNA. Nature, 350-356 (2008). Solt, L.A. et al, Suppression of t(h)17 differentiation and autoimmunity by a synthetic ror ligand. Nature 47 (7344), 491-U547 (20 ). Zhang, J. et al., DNA binding alters coactivator interaction surfaces of the intact vdr-rxr complex. Nat. Struct. Mol. Biol. 18 (5), 556-U172 (2011). Buhr, E.D., Yoo, S.H., & Takahashi, J.S., Temperature as a universal resetting cue for mammalian circadian oscillators. Science 330 (6002), 379-385 (2010). Wang, Y. et ah, identification of s 078, a synthetic agonist for the orphan nuclear receptors rora and rorg. ACS Chemical Biology, null-null (2010). Busby, S.A. et at, Identification of a novel non-retinoid pan inverse agonist of the retinoic acid receptors. ACS Chemical Biology, null-null (2011). Kumar-, N. et αί , The benzenesulfonamide t0901317 is a novel

fo { lph }/{ gamma} inverse agonist. Molecular Pharmacology 77, 228-236 (2010). Raghuram, S. et ah, Identification of heme as the ligand for the orphan nuclear receptors rev-erbalpha and rev-erbbeta. Nat Struct MoI Biol 14 (12), 1207- 1213 (2007). Layton, C.J. & e inga, H.W., Thermodynamic analysis of ligand-induced changes in protein thermal unfolding applied to high-throughput determination of ligand affinities with extrinsic fluorescent dyes. Biochemistry 49 (51), 10831-10841 (2010). £ 2 Zhang, F.P., Meng, G.X., and Strober, W. (2008). Interactions among the transcription factors Runxl, ROR gamma t and Foxp3 regulate the differentiation of interleukin 17-producing T ceils. Nature immunology 9, 1297-1306.

All patents and publications referred to herein are incorporated by reference herein to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference in its entirety. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. CLAIMS What is claimed is:

1. m o d of formula (I) Ar1 X2 Ar2

wherein

X1 is C , (X), S0 , or CR with a (CR )„ bridge wherein n = 1, 2, 3 to Ar2, X2, Y, or X3; 2 1 1 X is CR2, CO, SO2, or CR with a (CR2)n bridge wherein n - I , 2, 3 to Ar , X , Y, orX 3;

3 1, X is CR2, CO, S0 2, or CR with a (C 2)» bridge wherein n = 1, 2, 3 to Ar Ar2, X1, or X2; or X' is absent; each independently selected R is II or (Cl-C6)alkyl; Ar1 is alkyl, alkoxy, cycioaikyi, cycioalkoxy, aryi, aryloxy, aryialkenyi, heterocvclvl, heterocvlyioxy, heteroaryl, or heteroaryloxy, wherein Ar is substituted with 0-3 J; or x V is H; Ar2 is cycioaikyi, aryi, or heteroaryl, wherein Ar2 is substituted with 0-3 J; Y is H, hydroxy(C 1-C6)alkyl, aryioxy(Cl-C6)aikyl, arylaikoxy(Cl-C6)alkyl, heteroaryioxy(C1 -C6)aikyi, heteroarylalkoxyfCl -C6)aikyl, wherein any alkyl, aryi, aryloxy, heteroaryl, or heteroaryloxy is substituted with 0-3 J; or Y is C(=0)W wherein W is OR or NR ; CN; cycioaikyi, heteroevciyl, aryi, aryialkyl, heteroaryl, or heteroarylalkyi, wherein any cycioaikyi, heierocyclyl, aryi, aryialkyl, heteroaryl, or heteroarylalkyi, is substituted with 0-3 J; J is (Cl-C6)alkyl, (Cl-C6)acyl, aryi, heteroaryl, aroyl, aryl(Cl-C6)alkyl, hydroxy(Cl-C6)alkyl, R2N-(C1-C6)alkyl, halo, haIo(Cl-C6)aikyi, nitro, cyano,

RS(0) or RN(R)S(0) wherein q = 0, I , or 2, C(=0)OR, C(=0)R, C(=0)NR2,

N(R)C(=0)OR, N(R)C(=0)R, or N(R)C(=0)NR2; each independently selected R is H, (Cl-C6)alkyl, (Cl-C6)acyi, aryl, aroyl, or aryl(C1-C6)aikyl, wherein any alkyi, acyl, aryl, aroyl, or aralkyl is substituted with 0- 3 J ; or a pharmaceutically acceptable salt thereof; provided the compound is not of formula (II)

R

2 ( )

2 wherein X is =0 or 2, and either (a) R is p-chlorophenyl and is CC)2-alkyI or CON(alkyl)2, or (b) wherein one of R and R2 is phenyl and the other is p- chlorophenyl or 3,4-dichlorophenyl.

2. The compound of claim 1, wherein Ar 1 is heteroaryl substituted with 0-3J.

3. The compound of claim 2 wherein Ar is thienyl substituted with nitro, RS(0)q, halo, or haloalkyl,

4. The compound of claim 2 wherein A is phenyl, naphthyl, or styryl, any of which is substituted with 0-3 J , or wherein Ar is pyridyl, furyl, oxazolyl, thiazolyl, benzothioazolyl, furyl, benzofuryl, quinolyl, or isoquinolyl, any of which is substituted with 0-3 J.

5. The compound of claim comprising a compound of formula (II)

wherein X Ar', R, and J are as defined in claim l , p = 0, 1, 2, 3, or 4, Z is O or NR.,

2 3 Z is CR2 or a bond, and R is H, (Cl-C6)a!kyl; C(=0)W wherein W is OR or NR2; CN; or R is cycioaikyl, heterocyclyl, aryl, or heteroaryl, wherein any alkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is substituted with 0-3 J.

6. The compound of claim wherein Ar2 is phenyl or naphthyl, substituted with 0-3 J.

7. The compound of claim 1 wherein Y is C(=0)W, or is heterocyclyl substituted with 0-3 J.

8. The compound of claim 7 wherein Y comprises a pyrrolidinyl or piped dinyl group.

9. The compound of claim wherein X1 is CO or CH .

2 10 The compo d of claim 1 wherein X is CH2 or S0 2.

. The compound of claim 1 wherein X is absent, or wherein X is C with a CH bridge to Ar2.

The compound of claim 1 wherein the compound is any of the follow 254

260 261 262 263

265 266 267

270 271

273

275

277

279 280 281 282 283

286

290

3. A pharmaceutical composition comprising a compound of any one of claims 1-12 and a pharmaceutically acceptable excipient.

14. A method of modulating a REV-ERB receptor, comprising contacting the receptor and an effective amount or concentration of a compound of any of claims 1- 12

15. The method of claim 4 wherein the receptor is REV-ERBa or REV-ΕΚΒβ.

16. The method of claim 4 wherein the compound is a receptor agonist or a receptor antagonist.

17. A method of altering a circadian rhythm in a mammal comprising administering to the mammal an effective amount of a compound of any one of claims 1-12.

18. The method of claim 7 wherein the mammal is a human. 19, A method of treating a malconditsor! in a mammal wherein modulation of a REV-ERB is medically indicated, comprising administering to the mammal an effective dose of a compound of any one of claims 1-12 .

20. The method of claim 19 wherein the malcondition comprises diabetes, obesity, atherosclerosis, dyslipidemia, a circadian rhythm disorder, coronary artery disease, bipolar disorder, depression, cancer, a sleep disorder, an anxiety disorder, an addiction disorder, or an autoimmune disorder.

nternat onal application No.

PCT/US 12/53006

A . CLASSIFICATION OF SUBJECT MATTER IPC(8) - H04N 9/07; C07D 495/02; C07D 409/00 (2012.01) USPC - 348/336.1 According to International Patent Classification (IPC) or to both national classification B . FIELDS SEARCHED

Minimum documentation searched (classification system followed by classification symbols) USPC: 348/336.1

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched USPC: 549/50, 59, 472 (keyword limited; terms below)

Electronic data base consulted during the international search (name o f data base and, where practicable, search terms used) PatBase, Google Patents/Scholar Search Terms Used: Rev-erb, benzoamino, thiophenyl, amine based, acetate, GSK41 12, T0507

C. DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

PubChem compound CID 39361392; 30 May 2009 (30.05.2009) (retrieved from 1-2, 6-7, 9-10 http://pubchem.ncbi.nlm.nih.gov/summary/summary.cgi?cid=39361392 on 26 October 2012) pg 1 12

Grant et al. 'GSK41 12, a Small Molecule Chemical Probe for the Cell Biology of the Nuclear 1-3, 6-7, 9-10 Heme Receptor Rev-erbalpha' ACS Chemical Biology vol 5, pg 925-932; 02 August 201 0 (02.08.2010) abstract, Fig. 1A 12

US 7,932,281 B2 (Saitou et al.) 26 April 201 1 (26.04.201 1) whole doc.

US 2006/0154268 A 1 (Yamamoto et al.) 13 July 2006 (13.07.2006) whole doc.

Crumbley et al. 'Direct Regulation of CLOCK Expression by REV-ERB' PloS One vol 6 pg e17290; 29 March 201 1 (29.03.201 1) whole doc.

I I Further documents are listed in the continuation of Box C. | |

* Special categories of cited documents: "T" later document published after the international filing date or priority "A" document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand to be of particular relevance the principle or theory underlying the invention "E" earlier application or patent but published on or after the international "X" document of particular relevance; the claimed invention cannot be filing date considered novel or cannot be considered to involve an inventive "L" document which may throw doubts on priority claim(s) or which is step when the document is taken alone cited to establish the publication date o f another citation or other "Y" document of particular relevance; the claimed invention cannot be special reason (as specified) considered to involve an inventive step when the document is "O" document referring to an oral disclosure, use, exhibition or other combined with one or more other such documents, such combination means being obvious to a person skilled in the art "P" document published prior to the international filing date but later than "&" document member o f the same patent family the priority date claimed Date of the actual completion of the international search Date of mailing of the international search report 04 January 2013 (04.01 .2013) 2 4 JAN 2013

Name and mailing address of the ISA/US Authorized officer: Mail Stop PCT, Attn: ISA/US, Commissioner for Patents Lee W . Young P.O. Box 1450, Alexandria, Virginia 22313-1450 PCT Helpdesk: 571-272-4300 Facsimile No. 571-273-3201 PCT OSP: 571-272-7774 Form PCT SA 2 10 (second sheet) (July 2009) INTERNATIONAL SEARCH REPORT International application No.

PCT/US 12/53006

Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of First sheet)

This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons:

1. Claims Nos.: because they relate to subject matter not required to be searched by this Authority, namely:

Claims Nos.: because they relate to parts of the international application that do not comply with the prescribed requirements to such extent that no meaningful international search can be carried out, specifically:

Claims Nos.: because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a).

Box No. ΠΙ Observations where unity of invention is lacking (Continuation of item 3 of first sheet)

This International Searching Authority found multiple inventions in this international application, as follows: - Please see extra sheet for continuation -

As all required additional search fees were timely paid by the applicant, this international search report covers all searchable claims.

As all searchable claims could be searched without effort justifying additional fees, this Authority did not invite payment of additional fees.

□ As only some of the required additional search fees were timely paid by the applicant, this international search report covers only those claims for which fees were paid, specifically claims Nos.:

No required additional search fees were timely paid by the applicant. Consequently, this international search report restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 1-3, 6-7, 9-10 and 12 restricted to the first compound of claim 1

The additional search fees were accompanied by the applicant's protest and, where applicable, the payment of a protest fee. The additional search fees were accompanied by the applicant's protest but the applicable protest fee was not paid within the time limit specified in the invitation. No protest accompanied the payment of additional search fees.

Form PCT/ISA/210 (continuation of first sheet (2)) (July 2009) .

PCT/US 12/53006

Continuation of: Box NO III. Observations where unity of invention is lacking

Group l+: claims 1-12, drawn to a compound of formula (I). The first invention is restricted to the first compound of claim 12 (Claims 1-3, 6-7, 9-10 and 12). Should an additional fee(s) be paid, Applicant is invited to elect an additional compound(s) to be searched. The exact claims searched will depend o Applicant's election.

Group II: claims 13-20, drawn to the pharmaceutical composition and the use of a compound of formula (I).

The inventions listed as Groups l+ and II do not relate to a single general inventive concept under PCT Rule 13.1 because, under PCT Rule 13.2, they lack the same or corresponding special technical features for the following reasons:

The inventions of Group l+ do not include the inventive concept of the pharmaceutical composition and the use of a compound of formula (I), as required by Group II.

The inventions of Groups l+ and II share the technical feature of a compound of formula (I). However, this shared technical feature does not represent a contribution over prior art as being anticipated by PubChem compound CID 39361392 (hereinafter 'CID 39361 392') (Create date: 30 May 2009) (retrieved from http://pubchem.ncbi.nlm.nih.gov/summary/summary.cgi?cid=39361392 on 26 October 2012). CID 39361392 teaches a compound of formula (I) wherein X 1 is CR2; X2 is CR2; X3 is CR2; each R is independently selected from H; Ar1 is heteroaryl; Ar2 is aryl; Y is C(=0)W wherein W is OR and R is selected form H, providied that the compound is not of formula (II) (pg 1). As said composition was known in the art at the time of the invention, this cannot be considered a special technical feature that would otherwise unify the groups.

Groups l+ and II therefore lack unity under PCT Rule 13 because they do not share a same or corresponding special technical feature.

Form PCT/ISA/210 (extra sheet) (July 2009)