UNIVERSITY of CALIFORNIA, SAN DIEGO BRICK1 Requires SCAR for Localization to the Plasma Membrane and Is Up-Regulated by Auxin A

UNIVERSITY OF CALIFORNIA, SAN DIEGO

BRICK1 Requires SCAR for Localization to the Plasma Membrane

and is Up-Regulated by Auxin

A Thesis submitted in partial satisfaction of the Requirements for the degree Master of Science

Biology

Mon-Ray Shao

Committee in charge:

Professor Laurie G. Smith, Chair Professor Julian I. Schroeder Professor Yunde Zhao

2008

The Thesis by Mon-Ray Shao is approved, and it is acceptable in quality and form for publication on microfilm:

______

Chair

University of California, San Diego

2008

iii

TABLE OF CONTENTS

Signature Page...... iii

Table of Contents...... iv

List of Figures...... v

List of Tables and Graphs...... vii

Acknowledgements...... viii

Abstract...... ix

Introduction...... 1

Materials and Methods...... 21

Results...... 29

Discussion...... 51

References...... 58

LIST OF FIGURES

Figure 1: Actin monomers assemble at the barbed/plus end and disassemble at the pointed/minus end...... 4

Figure 2: The ARP2/3 complex initiates a daughter filament at a 70° angle from the mother filament...... 7

Figure 3: General diagram of SCAR/WAVE domains and binding partners...... 11

Figure 4: Alternative models of SCAR/WAVE complex activation...... 12

Figure 5: Comparison of mammalian WAVE and Arabidopsis SCAR...... 13

Figure 6: Trichomes of Arabidopsis wild-type, brk1 , arp2 , and arp2 ;brk1 ...... 17

Figure 7: The actin cytoskeleton of trichomes in Arabidopsis wild-type, arp2 , and brk1 ...... 17

Figure 8: Arabidopsis pavement cell lobe formation...... 18

Figure 9: BRK1::YFP localization in various tissue types...... 30

Figure 10: Actin visualization... in wild-type and brk1 trichomes...... 31

Figure 11: The root cells of BRK1::YFP transformants in... FM 4-64...... 33

Figure 12: Roots of BRK1::YFP transformants incubated in... Brefeldin A...... 35

Figure 13: BRK1::YFP plants treated with... Wortmannin... results in a change in

BRK1::YFP localization...... 37

Figure 14: BRK1::YFP localizes distinctly at junctions between pavement cells and stomata in bombarded wild-type plants and arp2-1 mutants, but not in scar quadruple mutants...... 40

Figure 15: SCAR2p::GUS activity is seen weakly at the base of cotyledons and promordia, but strongly in stomata...... 42

Figure 16: SCAR3p::GUS activity is seen in primordia, cotyledons, stomata, the base of trichomes, trichomes themselves, emerging lateral roots, and the root tip...... 43

Figure 17: BRK1p::GUS activity is seen in primordia and cotyledons, trichomes, stomata, root hairs and root vasculature just below the hypocotyl, and the root tip...... 44

Figure 18: The BRK1 promoter is up-regulated by NAA...... 46

Figure 19: Polarized localization of PIN1::GFP is seen in the roots of plants with intact

BRK1 as well as with mutant brk1 ...... 48

Figure 20: Seedlings are dark grown on a vertically-standing medium plate, and then exposed to blue light from the left, leading to phototropic bending...... 49

LIST OF TABLES AND GRAPHS

Table 1: Primers used for scar genotyping...... 22

Table 2: Primers used for amplifying SCAR2 , SCAR3 , and BRK1 promoters...... 24

Graph 1: The percentage of junctions between a bombarded pavement cell and a neighboring stomate with a BRK1::YFP foci...... 41

Graph 2: The phototropic reponse of wild-type, brk1-1 mutants, and arp2-1 mutants to directional blue light...... 50

vii

ACKNOWLEDGEMENTS

I first and foremost would like to thank Laurie Smith for generously allowing me to work in her lab and under her guidance. Dr. Smith has given me such amazing opportunities and helped me through every step of this work, and she has my deepest gratitude. I would also like give a very special thanks to Julia Dyachok for all her ideas, advice, and inspiration, and without her I would never have been able to complete this study. I want to thank everyone in the Smith lab – all of whom are fantastic scientists and wonderful people – for their friendship. It has been my great pleasure to know each and every one of you. I would like to thank Youfa Chen for showing me how to perform the phototropic assays. Finally, I would like to thank my family for all their love and support, and for always having faith in me.

viii

ABSTRACT OF THE THESIS

BRICK1 Requires SCAR for Localization to the Plasma Membrane

and is Up-Regulated by Auxin

Mon-Ray Shao

Master of Science in Biology

University of California, San Diego, 2008

Professor Laurie G. Smith, Chair

The SCAR/WAVE complex is an activator of the ARP2/3 complex, which initiates actin filament formation important for normal morphology in numerous cell types. BRK1 is a subunit of the SCAR/WAVE complex, and BRK1 fused to YFP in ix

stable A. thaliana transformants localizes to the cell periphery, particularly at three-cell junctions. Plasmolysis experiments demonstrate that BRK1::YFP localization is associated with the plasma membrane, not with the cell wall. Despite this localization pattern, no reduction or disorganization of cortical actin filaments was observed via visualization of the actin-binding protein ABD2 fused to GFP in brk1 mutants. Treatment of cells with Brefeldin A, an inhibitor of the protein secretion pathway, also had no affect on BRK1::YFP localization, indicating that BRK1 is targeted through another mechanism. Instead, analysis of BRK1::YFP localization in scar1,2,3,4 mutants reveal that SCAR protein is required for BRK1 localization. Whether PtdIns(3,4,5)P 3, which is necessary for WAVE2 localization in animals, is also required for BRK1::YFP localization in A. thaliana could not be conclusively determined here. GUS reporter assays of SCAR2 , SCAR3 , and BRK1 show partially overlapping promoter activities, but that only the BRK1 promoter is activated by NAA, a member of the auxin hormone family. However, brk1 mutants showed no defects in the localization of the auxin transporter PIN1 fused to GFP. In addition, neither brk1 nor arp2 mutants had defects in phototropic bending, a process that involves auxin.

INTRODUCTION

The actin cytoskeleton

The cytoskeleton is a dynamic network of filaments that is necessary for proper

execution of many cellular processes. Actin is a critical component of the cytoskeleton

and well known for its role in mechanical support, cytokinesis, and cellular motility,

among other processes [Heidemann et al., 1999; Barr and Gruneberg, 2007; Welch et al.,

1997]. In plants cells, actin filaments are essential for normal cell morphogenesis,

specifically in regard to tip growth and diffuse growth [Smith and Oppenheimer, 2005].

Tip growth occurs in root hairs and pollen tubes, where actin filaments are used to deliver

Golgi-derived vesicles containing growth material to the specific site of expansion (the

tip) [Hepler et al., 2001]. Diffuse growth, where wall expansion and incorporation of new

wall material is distributed widely over the cell surface, is the primary method of

expansion in most plant cells, but it may also rely on actin filaments to direct material to

growth sites, similar to what is seen in tip growth [Baskin and Bivens, 1995]. Actin

filaments are also thought to be involved in a variety of other processes such as organelle and nuclear positioning, stomatal movement, plasmodesmata organization, gravity sensing, and fungus resistance [Romagnoli et al., 2007; Sakai and Takagi, 2005; Ketelaar et al., 2002; Hwang et al., 1997; White et al., 1994; Volkmann and Baluska, 1999;

Jarosch et al., 2005].

The role of actin in plant growth was demonstrated by experiments showing that treating plants with actin agonists results in reduced cell elongation, dwarfism, and deformed trichomes [Baluska et al., 2001; Mathur et al., 1999]. Arabidopsis has eight actin gene isoforms that are not all functionally equivalent [Kandasamy et al., 2002], despite being highly homologous. These genes can be divided into two groups based on their expression pattern: ACT2 , ACT7 , and ACT8 are strongly expressed in vegetative tissue, while ACT1 , ACT3 , ACT4 , ACT11 , and ACT12 are expressed more in reproductive tissue [Meagher et al., 1999]. Arabidopsis actin mutants display phenotypes such as dwarfism, misshapen root cells, deformed trichomes, and delayed flowering and bolting, depending on which actin gene is mutated [Gilliland et al., 2003; Nishimura et al., 2003;

Kandasamy et al., 2002]. Coinciding with these morphological defects are changes in either actin density or organization. Thus, genetic studies of actin function further support the conclusion that actin plays important roles in plant cell growth and its spatial regulation. However, the ways in which actin contributes to or regulates cell growth are just beginning to be understood.

Actin filament formation and actin-binding proteins

In cells, actin exists primarily as monomeric globular molecules (“G-actin”) about

42 kDa in size, rather than as polymerized filaments (“F-actin”). Indeed, the percentage of actin found in filamentous form is only 1-2% in tobacco suspension cells [Wang et al.,

2005]. These filaments are double helical strands with a diameter of 7-9 nm, and based on appearance one end of the filament is called the barbed end (or plus end) while the

3 other is called the pointed end (or minus end). Spontaneous assembly of actin monomers into polymers is unfavorable because actin dimers and trimers are inherently unstable

[Sept and McCammon, 2001], but filaments elongate quickly once initiated [Pollard,

1986]. The filament typically grows on the barbed end, where actin subunits can arrive by diffusion and bind upon properly-oriented collision [Drenckhahn and Pollard, 1986].

Actin molecules also contain ATP [Straub and Feuer, 1950], and following polymerization, actin intrinsically hydrolyzes ATP into ADP plus an inorganic phosphate. The inorganic phosphate molecule dissociates with a half-life of 350 seconds

[Carlier and Pantaloni, 1986], and this begins a process where the actin subunit favors separation from the filament and eventually leaves, usually from the pointed end.

Meanwhile, additional actin subunits can be added at the barbed end. The coupling of actin addition at the barbed end and actin loss from the pointed end results in a

“treadmill” model of actin filament assembly (see Figure 1).

Figure 1: Actin monomers assemble at the barbed/plus end and disassemble at the

pointed/minus end. From Southwick and Purich, 1996.

Although subunit loss from the pointed end occurs more slowly than subunit

addition at the barbed end, actin filament dynamics are complicated by regulation from

actin-binding proteins. One such regulator is profilin, a small protein that binds to ATP-

actin with high affinity [Carlsson et al., 1977]. This sequestration of actin monomers

helps prevent the spontaneous formation of new actin filaments or elongation at the

pointed end of existing filaments [Didry et al., 1998]. While in animals profilin has also

been found to exchange ADP in actin to ATP, this is not true in plants [Perelroizen et al.,

1996]. Another regulatory protein is ADF (actin-depolymerizing factor)/cofilin, which generally increases actin filament “treadmilling” [Carlier et al., 1997]. Furthermore, the barbed ends of filaments can be “capped” by a variety of so-called capping proteins such as CP and CapZ [Huang et al., 2006; Schafer et al., 1996], preventing further elongation

of the filament. However, capped filaments can be severed at some point in the filament

by proteins such as gelsolin, resulting in the restoration of a barbed end and the capacity

for further subunit addition [Sun et al., 1997]. Capping proteins and severing proteins can

work in coordination to direct actin filament growth [Barkalow et al., 1996]. The

combined actions of such regulatory proteins allow cells to control the pool of available actin monomers and control the growth of actin filaments.

Multiple filaments can be arranged into supra-molecular arrays resembling tight thick bundles, loose bundles, or fine networks by a variety of cross-linking proteins such as α-actinin, fascin, fimbrin, and villin [Blanchard et al., 1989; Edwards et al., 1995;

Nakano et al., 2001; Friederich et al., 1999]. Different types of actin arrays appear to be related to different actin functions and actin-related processes. Not much is known about such cross-linking proteins in plants, but fimbrin and villin-like proteins have been identified in plants as well [Kovar et al., 2000; Klahre et al., 2000].

The ARP2/3 complex and actin nucleation

Because de novo assembly of actin filaments is thermodynamically unfavorable, efficient in vivo filament assembly requires the presence of actin nucleating proteins.

While there have been other actin nucleating proteins identified (including in plants), such as formin [Deeks et al., 2002], the ARP2/3 (actin-related protein 2/3) complex is the best understood.

The ARP2/3 complex was first discovered in amoebae [Machesky et al., 1994], where movement of the cell requires actin-dependent membrane extensions [Preston and

King 1984]; since then, it has been found in every eukaryotic organism studied. In yeast, the ARP2/3 complex localizes to discrete cortical patches corresponding to sites of endocytosis [Gachet and Hyams, 2005], but it is also needed for the intracellular motility of mitochondria [Boldogh et al., 2001]. It plays a crucial role in animals, where the

ARP2/3 complex is required for particular cell migratory events during development

[Sawa et al., 2003], and disruption of the complex results in lethal morphological defects

[Zallen et al., 2002]; in animals, it also necessary for the formation of structures such as lamellipodia and filopodia [Biyasheva et al., 2004; Rogers et al., 2003]. Almost all actin filament arrays nucleated by the ARP2/3 complex in animal and yeast cells are located in the cell cortex.

The ARP2/3 complex binds to the side of an existing filament and stimulates the growth of a “daughter” filament that extends at a 70° angle from the “mother” filament.

The complex itself consists of seven subunits – ARP2, ARP3, ARPC1, ARPC2, ARPC3,

ARPC4, and ARPC5 – all of which interact in some way with the mother filament. ARP2 and ARP3 are structurally similar to actin and act as a dimer template upon which actin monomers can bind and begin the daughter filament [Beltzner and Pollard, 2004; Egile et al., 2005]. The precise mechanism that allows the ARP2/3 complex to bind to an existing filament is under debate by two competing models, but the end result is a network of filaments (see Figure 2). The role of the other subunits, ARPC1 to ARPC5, appears to be for binding to the mother filament, complex stability, and facilitation of conformational

7 changes brought about by activation [Goley et al., 2004; Gournier et al., 2001; Beltzner and Pollard, 2004]. For nucleation to begin, ATP must also bind to the ARP2/3 complex

[Dayel et al., 2001]. Once the daughter filament begins to elongate, the ARP2/3 complex hydrolyzes ATP, and like in actin polymers this is related to the dissociation rate of the actin filament [Dayel and Mullins, 2004]. The ARP2/3 complex is inherently inactive and the ARP2 and ARP3 subunits require a conformational change for activation [Robinson et al., 2001]. Binding of several possible activator proteins induces the conformational changes in the complex that is believed to position ARP2 and ARP3 for nucleation

[Goley et al., 2004].

Figure 2: The ARP2/3 complex initiates a daughter filament at a 70° angle from the mother filament. From Millard et al., 2004.

Homologues for all seven subunits of the ARP2/3 complex have been found in

Arabidopsis, and with the exception of ARPC1, each is encoded by a single-copy gene

(ARPC1 has two gene copies arranged in reverse orientation) [Li et al., 2003]. Mutants

for four out of the seven ARP2/3 complex subunits have been generated – arp2 , arp3 , arpc2 , and arpc5 – and all show a reduced expansion of pavement cell lobes, deformed trichomes, and distorted root hairs [Le et al., 2003; Li et al., 2003; Mathur et al., 2003a;

Mathur et al., 2003b]. Trichomes have been closely scrutinized in actin-related mutants due to their distinct wild-type morphology of two to three uniformly-long branches connected to a single base stalk (see Figure 6). Under conditions promoting rapid growth, hypocotyls and petiole cells in ARP2/3 complex mutants also expand in an uncoordinated manner and fail to completely adhere to each other [Mathur et al., 2003b]. It is still not fully understood exactly why a mutation in the ARP2/3 complex leads to such phenotypes, but studies have indicated that it may be due to abnormal actin filament organization in the cytoplasm [Le et al., 2003, Li et al., 2003; Mathur et al., 2003a;

Mathur et al., 2003b]. However, these and more recent studies have found surprisingly little change in actin filament density and organization at the cell cortex [Djakovic et al.,

2006; Dyachok et al., unpublished], where actin defects could be expected based on the observed mutant phenotypes. Still, treatment of wild-type Arabidopsis plants with actin- interfering drugs such as cytochalasins, latrunculins, or phalloidin results in phenotypes similar to those seen in ARP2/3-complex mutants [Mathur et al., 1999; Szymanski et al.,

1999], indicating that actin is involved in the mutant phenotypes.

The SCAR/WAVE complex

As previously stated, ARP2/3 complex requires an activator for effective nucleation, and a number of such activators have been found [Goode et al., 2001; Welch

et al., 1998; Lee et al., 2000; Rohatgi et al., 1999]. However, the most studied ARP2/3

complex activator is the WASP (Wiskott-Aldrich syndrome protein) family and its

subfamily SCAR/WAVE (suppressor of cAMP receptor / WASP family verprolin-

homologous protein). SCAR/WAVE differs from WASP most significantly in that

WASP is auto-inhibited and can be activated by agonist binding to its CRIB (Cdc42 and

Rac interactive binding) domain, both features that SCAR/WAVE lacks. In vitro

experiments have demonstrated that SCAR/WAVE is an activator of the ARP2/3

complex [Machesky et al., 1999]. In Drosophila, SCAR/WAVE proteins are involved in

filopodia and lamellipodia formation [Biyasheva et al., 2004], which are involved in cell

motility and cell migration, and in specialized actin networks during particular phases of

development [Zallen et al., 2002], where SCAR/WAVE mutations are recessive lethal. In animals, WAVE proteins are similarly necessary for lamellipodia formation [Steffen et al., 2006], and for cell to cell adhesion [Yamazaki et al., 2007]. WAVE1 is also involved in the myelination of animal neuronal cells [Kim et al., 2006], and WAVE2-null mice die during early development [Eto et al., 2007].

As illustrated in Figure 3, SCAR/WAVE proteins contain a globular actin binding domain at the C-terminal end known as a WASP-homology 2 motif (WH2, or “V” region), as well as a connecting motif (“C” region), and an acidic ARP2/3-binding motif

(“A” region) [Marchand et al., 2001]. Combined, this is referred to as the VCA domain

(verprolin-homology / connecting-homology / acidic). Binding of the VCA domain to the

ARP2/3 complex induces a conformational change in the complex that brings together

10 globular actin, ARP2, and ARP3, leading to ARP2/3 activation [Pollard and Borisy,

2003; Machesky et al., 1999; Rohatgi et al., 1999; Yarar et al., 1999].

SCAR/WAVE proteins also feature a basic domain that binds to PtdIns(3,4,5)P 3

(phosphatidylinositol (3,4,5)-triphosphate) [Oikawa et al., 2004]. PtdIns(3,4,5)P 3 is generated by PI3K (phosphatidylinositol-3-OH kinase) and is necessary for the localization of WAVE to the leading edge of the membrane [Oikawa et al., 2004].

However, other factors such as Rac GTPase are also important for SCAR/WAVE localization [Miki et al., 1998].

In animals, SCAR/WAVE proteins have a proline-rich region (see Figure 3) that can bind to a number of proteins containing SH3 (Src homology 3) domains [Finan et al.,

1996]. Among these proteins is the p85 subunit of PI3K, which is necessary for WAVE3 activity [Sossey-Alaoui et al., 2005]. Another protein with a SH3 domain is the previously-discussed profilin, which may promote actin polymerization at the barbed end of filaments by association with SCAR/WAVE [Suetsugu et al., 1998]. Given the large number of other proteins containing a SH3 domain, the proline-rich region may be a significant mechanism for SCAR/WAVE regulation [Takenawa and Miki, 2001].

At the N-terminus, SCAR/WAVE proteins contain a SCAR-homology / WAVE- homology domain (SHD/WHD), which binds to the regulatory protein ABI (Abl- interactor) [Innocenti et al., 2004] as well as HSPC300 (haematopoietic stem cell progenitor cell 300) [Frank et al., 2004, Qurashi et al., 2007]. Through ABI,

SCAR/WAVE is associated with two more regulatory proteins: PIR121 (p53-inducible mRNA 121) also known as SRA1 (specifically Rac1-associated protein 1), and NAP1

(Nck associated protein 1) [Eden et al., 2002]. These five proteins – SCAR/WAVE, ABI,

PIR121/SRA1, NAP1, and HSPC300 – together form the SCAR/WAVE protein complex

[Eden et al., 2002; Stradal and Scita, 2006].

Figure 3: General diagram of SCAR/WAVE domains and binding partners.

Without the regulatory proteins, SCAR/WAVE is constitutively active in vitro

[Machesky et al., 1999]. When the entire SCAR/WAVE complex is retained, some studies have shown that SCAR/WAVE is inactive and does not promote actin polymerization [Eden et al., 2002] while other studies have shown that the intact complex is active [Steffen et al., 2004]. This has given rise to two proposed models on the activation mechanism of the SCAR/WAVE complex (see Figure 4). One model states that an active Rac GTPase or Nck protein binds to the inactive SCAR/WAVE complex via PIR121/SRA1 and results in the dissociation of PIR121/SRA1, NAP1, and ABI, leaving an activated SCAR/WAVE protein bound to HSPC300 that is then capable of

12 activating the ARP2/3 complex [Eden et al., 2002]. The other model states that Rac or

Nck binds to the SCAR/WAVE complex via PIR121/SRA1 but leaves an intact, activated

SCAR/WAVE complex without any of the regulatory proteins dissociating [Steffen et al.,

2004]. Most genetic and biochemical evidence appears to favor the latter model

[Innocenti et al., 2004; Kunda et al., 2003; Rogers et al., 2003].

Figure 4: Alternative models of SCAR/WAVE complex activation. From Bompard and

Caron, 2004.

SCAR/WAVE in plants

Thus far, four proteins distantly related to SCAR/WAVE (Arabidopsis SCAR1-4) have been the only identified activators of the ARP2/3 complex found in plants.

Arabidopsis SCAR proteins contain a SH domain (SHD) near the N-terminus, a basic domain, and a VCA domain at the C-terminus (see Figure 5). One more protein, SCAR-

LIKE, contains a SH domain and a basic domain, but no VCA domain [Frank et al.,

2004; Brembu et al., 2004]. Interestingly, all five proteins lack the proline rich region

found in animal SCAR/WAVE, and instead have a long, novel central region of unknown

function that makes Arabidopsis SCAR proteins significantly larger than animal and

yeast SCAR/WAVE proteins [Frank et al., 2004]. Arabidopsis SCARs are able to activate

the ARP2/3 complex in vitro [Frank et al., 2004; Basu et al., 2005], and scar2 mutants display morphological defects and actin and microtubule cytoskeleton patterns similar to those seen in Arabidopsis ARP2/3 complex mutants [Zhang et al., 2005], suggesting that they are involved in the same pathway.

Figure 5: Comparison of mammalian WAVE and Arabidopsis SCAR. SHD = Scar

homology domain, B = basic domain, PPPPP = proline-rich domain. From Frank et al.,

2004.

The existence of multiple SCAR/WAVE isoforms is not unprecedented; although

Drosophila only has one SCAR/WAVE protein [Zallen et al., 2002], mammals have three

SCAR/WAVE proteins [Suetsugu et al., 2002]. In Arabidopsis, RT-PCR experiments

indicated that SCAR /WAVE genes are expressed in mostly the same tissues – expanding

cotyledons, expanding rosette leaves, and expanding siliques – indicating functional

redundancy among the SCAR/WAVE proteins [Frank et al., 2004]. However, some

differential expression exists, such as a lack of SCAR2 expression in unopened flower buds; also, SCAR2 and SCAR4 are expressed in expanding root tips, while SCAR2 and

SCAR3 are not [Frank et al., 2004]. The expression of SCAR genes predominantly in growing regions is consistent with a role in cell expansion as ARP2/3 complex activators.

Proteins associated with SCAR/WAVE

The other proteins of the SCAR/WAVE complex – PIR121/SRA1, NAP1, ABI, and HSPC300 – have complicated roles that are not yet fully understood. It has been shown that the lack of any single one of these subunits results in a degradation of

SCAR/WAVE [Blagg et al., 2003; Rogers et al., 2003; Kunda et al., 2003; Djakovic et al., 2006]. In animals, there is also the possibility of interaction between SCAR/WAVE and WASP regulation [Bogdan and Klämbt, 2003]. Furthermore, subunits of the

SCAR/WAVE complex exhibit non-linear binding patterns. Both ABI and HSPC300 associate with SCAR/WAVE in vivo [Stovold et al., 2005], while PIR121/SRA1 is also able to bind to both NAP1 and ABI [Gautreau et al., 2004; Innocenti et al., 2004].

Distant homologues of PIR121 /SRA1 , NAP1 , ABI , and HSPC300 have been identified in plants [Saedler et al., 2004; El-Assal et al., 2004; Szymanski, 2005; Frank and Smith, 2002]. The binding patterns of these subunits mirrors what is seen in the animal SCAR/WAVE complex [Basu et al., 2004; Basu et al., 2005]. Furthermore,

15 mutations of the PIR121 or NAP1 gene in Arabidopsis causes the same defects in trichome morphology, root hairs, pavement cell lobe formation, and F-actin organization seen in Arabidopsis ARP2/3 complex mutants [Brembu et al., 2004].

Over-expression of ROP2 (Rho-related GTPase of plants) in Arabidopsis also resulted in pavement cell shape phenotypes resembling those seen in ARP2/3 complex and SCAR/WAVE complex mutants [Fu et al., 2002]. Furthermore, activated ROP2 can interact in yeast with Arabidopsis SRA1 [Szymanski, 2005]. Thus, ROP2 may perform the same function in the plant SCAR/WAVE pathway that Rac does in animal

SCAR/WAVE, given that both are GTPases belonging to similar families.

BRICK1/HSPC300

Of the four proteins associated with SCAR/WAVE, BRK1/HSPC300 is the smallest. In one experiment with HeLa cell extracts, HSPC300 was found primarily in the cytoplasmic pool, not associated with the SCAR/WAVE complex [Gautreau et al., 2004].

Furthermore, an in vitro experiment found that SCAR/WAVE, ABI, NAP1, and

PIR121/SRA1 were able to form an ARP2/3-activating complex without the presence of

HSPC300, and that the subsequent addition of HSPC300 did not increase its activity

[Innocenti et al., 2004]. This suggests that BRK1/HSPC300 may have other functions independent of SCAR/WAVE. Indeed, the pavement cells of Arabidopsis BRK1 mutants display a reduction in cell lobe formation more severe than other Arabidopsis

SCAR/WAVE complex or ARP2/3 complex mutants [Djakovic et al., 2006].

Yet, RNAi-induced knockdown of HSPC300 in Drosophila cell cultures caused

cell morphological phenotypes and reduced cortical actin filaments similar to, albeit

weaker than, those seen in RNAi-induced knockdown of the other SCAR/WAVE

complex subunits [Kunda et al., 2003]. Furthermore, in Arabidopsis, loss or over-

expression of BRK1 causes trichome morphology defects similar to those in ARP2/3 complex mutants (see Figure 7), and subtle defects in actin filament organization are observed in the expanding trichomes of brk1 and arp2 mutants, although transversely aligned cortical F-actin is still present (see Figure 8) [Djakovic et al., 2006]. Also like in

ARP2/3 and SCAR/WAVE mutants, cotyledon cells in BRK1 mutants display adhesion defects [Djakovic et al., 2006]. Like the other regulatory subunits of the SCAR/WAVE complex, BRK1 protects SCAR2 from degradation in vivo, and analysis of brk1;arp2 double mutants suggests that they operate in the same pathway [Djakovic et al., 2006].

Additionally, it has been shown that BRK1 interacts with at least three of the four SCAR proteins in vitro [Frank et al., 2004; Zhang et al., 2005], and that BRK1 interacts at least with SCAR1 in vivo [Dyachok, unpublished]. Therefore, although BRK1 may have abilities that are independent of SCAR/WAVE and the ARP2/3 complex, it also appears to function in some way with them.

Figure 6: Trichomes of Arabidopsis (A, E) wild-type, (B, F) brk1 , (C, G) arp2 , and (D,

H) arp2 ;brk1 double mutants. From Djakovic et al., 2006.

Figure 7: The actin cytoskeleton of trichomes in Arabidopsis (C) wild-type, (G) arp2 , and

(J) brk1 plants. From Djakovic et al., 2006.

Figure 8: Arabidopsis pavement cell lobe formation. (A) Wild-type, (B) arp2 , (C) arpc5 ,

(D) pir /sra1 , (E) brk1 , (F) arp2 ;brk1 double mutant, and (G) arpc5 ;brk1 double mutant,

followed by (H) a quantitative analysis of “form factor” (higher form factor means a

greater amount of lobe formation). From Djakovic et al., 2006.

Actin and auxin

Recent reports have begun to establish a connection between actin and the auxin group of hormones. Plant growth and developmental patterning, governed either by developmental cues or environmental stimuli such as gravity and light, are often tightly coupled with the distribution of auxin [Teale et al., 2006]. For instance, during embryogenesis, establishment of the root apical meristem depends on a local accumulation of auxin at the basal end of the embryo [Friml et al., 2003], and this auxin maximum is needed after embryogenesis for maintenance of the meristem [Sabatini et al.,

1999]. Regulation of auxin distribution appears to involve both spatial regulation of auxin synthesis and directed movement of auxin through tissues by a system of transport proteins [Zhao, 2008]. The polar movement of auxin is controlled by the localization of these auxin transporters, which have asymmetric distributions [Müller et al., 1998;

Swarup et al., 2001]. The most intensively studied auxin transporters are auxin efflux carriers of the PIN family, which has eight members in Arabidopsis. PIN proteins play critical roles in embryogenesis, organogenesis, gravitropism, and phototropism [Benková et al., 2003; Friml et al., 2002; Müller et al., 1998; Blakeslee et al., 2004]. While members of the PIN family display some overlap in function and expression, certain differences exist. For example, PIN1 is notable for localizing to the basal end of vasculature bundle cells in the root [Geldner et al., 2001]. This polar localization is believed to be controlled by auxin itself in a positive feedback loop; in fact, auxin also controls PIN transcription and accumulation [Leyser, 2005]. Proper localization of auxin

transport proteins also appears to be dependent on vesicle trafficking guided by actin

filaments [Geldner et al., 2001; Muday and Murphy, 2002].

For example, actin inhibitors have been reported to disrupt the cycling of the

auxin-efflux transporter PIN1 between the plasma membrane and intracellular

compartments [Geldner et al., 2001]. Other reports also suggest a link between actin and

auxin. There are auxin response defects in transgenic plants expressing dominant-

negative or constitutively-active Rop GTPases [Li et al., 2001], which have been

implicated as upstream regulators of actin polymerization [Fu et al., 2002; Xu and

Scheres, 2005]. Furthermore, specific actin organization may be required for the auxin-

dependent synchrony of cell division [Maisch and Nick, 2007]. These studies point to

actin or actin organization as upstream factors in auxin-related processes. However, actin

may also act downstream of auxin in some cases. For example, auxin may reorganize

actin filaments in elongating rice coleoptiles [Holweg et al., 2004, Wang and Nick,

1998], and one Arabidopsis actin gene, ACT7 , responds directly to auxin through its promoter and gene products [McDowell et al., 1996]. This indicates that auxin, in turn, regulates actin and actin organization, creating a feedback loop between auxin and actin.

MATERIALS AND METHODS

Plant material

Unless otherwise noted, all Arabidopsis thaliana lines used are from the

Columbia background. brk1-1 mutants (ABRC stock CS_86544) and arp2-1 mutants

(ABRC stock SALK_077920) are described in Djakovic et al., 2006. All brk1-1 mutants used in our experiments had been backcrossed to Columbia three times and are homozygous wild-type at the ERECTA locus. The scar1,2,3,4 quadruple mutant line was

generated by James Ingham by combining a null scar1 T-DNA insertion allele

(FLAGdb/FST line 123F07, Wassilevskija background) [described in Djakovic et al.,

2006] with a scar2 insertion allele (ABRC stock Wisc-sLox423A4), a scar3 insertion

allele (ABRC stock SALK_036994), and a scar4 insertion allele (GABI-Kat stock

GK_605G03). The SCAR genotypes were determined by PCR with the gene-specific (G)

and T-DNA or Ds-specific (I) primers listed below in Table 1.

Table 1: Primers used for scar genotyping.

Allele Primer Name Sequence 34150-01 (G) 5' CACGAATTCCCCATCTGATCATTCCTCCGGAA 3' scar1 34150-02 (G) 5' GACCTCGAGAGATACCCTCTTCGGTTTCTCTCC 3' PFlag-LB (I) 5' CTACAAATTGCCTTTTCTTATCGAC 3' 34150-02 (I) 5' GACCTCGAGAGATACCCTCTTCGGTTTCTCTCC 3' 38440-04F (G) 5' GGCAATGATGGAAGAAAGGTGG 3' scar2 38440-04R6 (G) 5' AATGCTCTCACCAGGAGATTTGG 3' 38440-04F (I) 5' GGCAATGATGGAAGAAAGGTGG 3' LB-DsLox (I) 5' AACGTCCGCAATGTGTTATTAAGTTGTC 3' 036994-F1 (G) 5' GTTCACTCCAGGAAGACATTTGC 3' scar3 036994-R2 (G) 5' GTAGGAATTCTGCTCTGTTTCTTGC 3' SALK-TDNA (I) 5' CCGTCTCACTGGTGAAAAGAA 3' 036994-R2 (I) 5' GTAGGAATTCTGCTCTGTTTCTTGC 3' At01730GABI-GSF (G) 5' CTGAATTCCATGTGAAACTGAAGA 3' scar4 GK126B09-GSR (G) 5' TTTCTTGCCTTTGGTTCTGTATCT 3' At1730GABI-GSF (I) 5' CTGAATTCCATGTGAAACTGAAGA 3' GABI-Kat T-DNA (I) 5' CCCATTTGGACGTGAATGTAGACAC 3'

YPF and GFP protein fusions

The BRK1p::BRK1::YFP construct was created by amplifying the BRK1 coding region (At2g22640), plus 1.26 kb of upstream sequence, from Columbia genomic DNA using the primers 5’-GCGGAGCTCATGTCGGAGAGCAAACCAAAG-3’ and

5’-CCGGTACCGTCGCAAACAGAGAAGGATT-3’. An error-free PCR product was cloned into pEZRK-LNY upstream of and in frame with YFP. BRK1p::BRK1::YFP was introduced into brk1-1 mutants via Agrobacterium -mediated transformation using the floral dip method [described in Clough and Bent, 1998]. 35S::ABD2::GFP transgenic

plants [described in Wang et al., 2004] were provided by Elison Blancaflor of the Samuel

Roberts Noble Foundation. PIN1p::PIN1::GFP transgenic plants in the Ler background

[described in Heisler et al., 2005] were provided by Jeff Long of the Salk Institute.

GUS promoter fusions

SCAR2p::GUS, SCAR3p::GUS, and BRK1p::GUS constructs were created by

Julia Dyachok by amplifying upstream sequences of SCAR2 , SCAR3 , and BRK1 from genomic DNA using the primers listed in Table 2, and then cloning each of them into pGEM-T Easy vectors. From there, the SCAR2p::GUS construct was generated by excising the SCAR2 (At2g38440) promoter region (0.9 kb) from pGEM-NPSCAR2 with

NsiI and XbaI restriction enzymes, and the resulting fragment was then cloned into the

PstI and XbaI sites of the pDW137 vector, upstream of a UidA (GUS) gene. The

SCAR3p::GUS construct was generated by excising the SCAR3 (At1g29170) promoter

region (3 kb) from pGEM-NP29170 with NcoI/BglI (blunt) and PstI restriction enzymes,

and the resulting fragment was cloned into HindIII (blunt) and PstI sites of the pDW137

vector. Finally, the BRK1p::GUS construct was generated by excising the BRK1

(At2g22640) promoter region (1.4 kb) from pGEM-NPBrk with PstI and XbaI restriction

enzymes, and the resulting fragment was cloned into PstI and XbaI sites of the pDW137

vector. The GUS constructs were introduced into Columbia wild type plants via

Agrobacterium -mediated transformation using the floral dip method. DR5p::GUS

transgenic plants [described in Ulmasov et al., 1997] were provided by Yunde Zhao of

the University of California San Diego.

Table 2: Primers used for amplifying SCAR2 , SCAR3 , and BRK1 promoters.

Promoter Primer Name Sequence NP SCAR2 At2g38440F1 5’ ATGCATTGAATAGATAATCTTGTTGCGT 3’ At2g38440R1 5’ TCTAGATGTTTGAGCTTCTCTGTCTG 3’ NP SCAR3 At29170NPF 5’ GAGCTCATGGACAACACTTCATACAACC 3’ At29170NPR 5’ GAGCTCTTCTCTTAAAAGGTACAAAACTG 3’ NP BRK1 At2g22640NPF3 5’ AACTGCAGAGCAATGGAACAGCTTCTCG 3’ At2g22640NPR3 5’ GCTCTAGATATTAAACCCCAAAACTCTCTCTTC 3’

Confocal microscopy

PIN1::GFP and AB2::GFP proteins were excited at 488 nm, while BRK1::YFP proteins were excited at 514 nm, all using an Argon laser. DsRed proteins and FM 4-64 were excited at 568 nm by an Argon/Krypton laser. Fluorescence was viewed under a

Nikon TE-200U microscope equipped with a Yokogawa Nipkow spinning disk head,

Chroma HQ525/50 (GFP), HQ550/40 (YFP), and HQ620/60 (Red) band pass emission filters, and a Roper Cascade 512b EM CCD camera using on-chip gain and reading at 5

MHz. The confocal system is controlled by MetaMorph software (made by Universal

Imaging), and projections of image stacks were compiled by MetaMorph as well.

Plasmolysis and FM 4-64 staining

BRK1p::BRK1::YFP seedlings were grown to 4-6 days old on Murashige and

Skoog agar plates and then mounted on microscope slides in 5 µg/mL FM 4-64 (N-(3- triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium

dibromide) dissolved in either in 0.7 M sucrose for plasmolysis or in distilled H 2O as a negative control. Following a 5 minute waiting period for plasmolysis and FM 4-64 penetration, the seedlings were examined for fluorescence by confocal microscopy as described above.

Treatment with Brefeldin A

BRK1p::BRK1::YFP and PIN1p::PIN1::GFP seedlings were grown to 4-6 days old on MS-agar plates and then incubated on Whatman filter paper soaked with 50 µM

Brefeldin A (C 16 H24 O4) in 0.28% DMSO or in 0.28% DMSO alone as a control. After 30,

90, or 120 minutes of incubation, the seedlings were mounted onto microscopy slides and examined for fluorescence by confocal microscopy.

Treatment with PI3K inhibitors

BRK1p::BRK1::YFP seedlings were grown to 4-6 days old on MS-agar plates and then incubated for 2 hours or 6 hours in Whatman filter paper soaked with wortmannin (C 23 H24 O8), LY294002 (C 19 H17 NO 3), or DMSO (as a solvent control).

Concentrations of wortmannin and LY294002 used were 1 µM, 10 µM, 30 µM, and 100

µM, and corresponding concentrations of DMSO used were 0.01%, 0.1%, 0.3%, and 1%.

After incubation, the seedlings were mounted on microscope slides and examined for fluorescence by confocal microscopy.

DNA bombardment

Columbia wild-type, arp2-1, and scar1,2,3,4 seedlings were grown on circular

MS-agar plates laid flat down for 10 days. Each plate was then bombarded with 0.6 mg of

1 µg gold particles (Bio-Rad) coated with 20 ng BRK1p::BBRK1::YFP plasmid and 100 ng 35S::Nag::RFP plasmid (provided by Richard Cyr, and described in Dixit and Cyr

2002). Particle coating and bombardment using a Bio-Rad PDS-1000 helium biolistic system was carried out according to the manufacturer’s instructions with a helium pressure of 1100 psi. 48 hours later, bombarded leaf primordia were excised and mounted in distilled H 2O on microscope slides. Golgi localized red fluorescent signal (visualized under epifluorescence conditions using a rhodamine filter set) from Nag::RFP was used to identify transformed cells, which were then examined for BRK1::YFP fluorescence by confocal microscopy.

GUS reporter assay

SCAR2p::GUS, SCAR3p::GUS, BRK1p::GUS, and DR5p::GUS seedlings were grown to 6-8 days old on MS-agar plates and then pre-fixed in 90% cold (4° C) acetone for 20 minutes at room temperature. Following two wash steps with GUS buffer

(consisting of 25 mM KPO 4 at pH 7, 1.25 mM K 3FeCN 6, 1.25 mM K 4FeCN 6, 0.25 mM

EDTA, 0.25% Triton X-100, and 20% MeOH), the fixed seedlings were placed in GUS buffer containing 20 µL of X-Gluc stock per 10 mL GUS buffer and vacuum filtrating for

40 minutes. The X-Gluc stock solution was made with 100 mg X-Gluc (5-bromo-4-

chloro-3-indolyl-β-D-glucuronic acid cyclohexilammonium salt) in 1.92 mL N-N dimethylformamide. Incubating samples were kept at 37° C and in the dark for approximately 18 hours. Afterward, the samples were washed with 0.24N HCl in 20%

MeOH at 57° C for 15 minutes, then 60% EtOH at room temperature for 15 minutes, then rehydrated in 40%, 20%, 10% EtOH at room temperature for 5 minutes each, followed by

5% EtOH in 25% glycerol at room temperature for 15 minutes. The samples were then kept in 50% glycerol at 4° C.

Treatment with NAA

SCAR2p::GUS, SCAR3p::GUS, BRK1p::GUS, and DR5p::GUS seedlings were grown to 4-6 days old on MS-agar plates and then incubated on Whatman filter paper soaked with 5 ng/mL NAA (1-naphthaleneacetic acid) in liquid MS medium (or in liquid

MS medium with no NAA as a negative control) for 5 minutes, 30 minutes, or 60 minutes. Following incubation, the seedlings were washed in liquid MS medium, and then placed on MS-agar plates and kept in growth conditions for 3 hours to allow synthesis of GUS protein. The seedlings were subsequently stained for GUS using the procedure described in the above section.

Phototropic response assay

Columbia wild-type, brk1-1, and arp2-1 seeds were placed about 3 mm apart in a vertical line roughly 1.5 cm from the left edge of MS-agar plates. They were then placed

in a pre-made container (from the Yunde Zhao lab) that allowed the plates to be placed vertically; the apparatus was covered in foil and left in the dark for 3 days. The container also has transparent blue plastic covering one side of the box, and a 2 mm slit along that

side, so that the dark-grown seedlings could then be exposed to blue light filtered through

the plastic for 2 hours, 3 hours, 6 hours, or 9 hours. After the light treatment, the plates

were scanned into digital images, and the degree of hypocotyl bending was measured by

ImageJ image processing and analysis software.

RESULTS

BRK1::YFP localizes to the cell periphery in various tissue

Previous RT-PCR experiments have demonstrated that Arabidopsis BRK1 is expressed in cotyledons, leaves, flower buds, root tips, and expanding siliques [Djakovic et al., 2006]. To elucidate the specific cellular localization of BRK1, and thus the sites of

SCAR and ARP2/3 complex-dependent actin polymerization, we examined the localization of a BRK1::YFP fusion protein expressed from its native promoter. This construct was transformed into brk1-1 mutants and found to fully rescue all brk1 mutant phenotypes analyzed, including the trichome morphology phenotype, demonstrating that the BRK1-YFP fusion protein is functional. In 8 to 10 day-old seedlings, we observed expression of BRK1::YFP in all major tissues inspected, including cotyledons, the hypocotyl, leaf primordia, trichomes, and roots, particularly at the expanding region near the root tip (see Figure 9). In these tissues, BRK1::YFP localizes to the cell periphery, and this is especially clear in cotyledons, leaf primordia, and root tips. In the hypocotyl, root hairs, and expanded root cells, BRK1::YFP localization is weaker and more diffuse, but in trichomes BRK1::YFP is concentrated at the growing tips of the cell despite overall low expression levels. We see particularly high BRK1::YFP concentrations at the junctions between three neighboring cells in cotyledons, leaf primordia, and expanding root cells.

Figure 9: BRK1::YFP localization in various tissue types. In cotyledon pavement cells,

primordia pavement cells, and expanding root cells, localization is high at cell junctions

(arrowheads).

brk1 trichomes display no obvious cortical actin defects

As seen in Figure 9, BRK1::YFP localizes to the cell periphery in trichomes,

particularly to the growing tips. Because of this observation, we wanted to re-examine

whether brk1 mutants show loss or defects of cortical actin at the cell periphery. In previous studies, F-actin was visualized by fluorescent phalloidin or anti-actin antibody staining of fixed tissue. To view F-actin by a different approach, I examined young

expanding trichomes in wild-type or brk1 mutants expressing 35S::ABD2::GFP. ABD2 is the actin binding domain of the fimbrin. When fused to GFP, ABD2 allows the visualization of actin filaments in living cells. I saw no obvious differences in cortical

actin in expanding trichomes of wild type versus brk1 mutants; transversely aligned actin filaments were seen in both types of trichomes (see Figure 10), in agreement with the conclusions of previous studies [Djakovic et al., 2006]. Thus, in spite of the cortical localization of BRK1-YFP, polymerization of cortical F-actin appears to be normal.

However, there may be changes in cortical F-actin dynamics (growing and shrinking of filaments) in brk1 mutants that are functionally important for cell growth but that we are not able to visualize using these methods.

Figure 10: Actin visualization via ABD2::GFP fluorescence in wild-type and brk1 trichomes. The arrowheads indicate transversely aligned cortical actin filaments.

BRK1 is not associated with the cell wall

The three-way cell junctions where BRK1::YFP is concentrated correspond to areas where cell wall material is also deposited in greater amounts [Carpita and McCann

2000] , and labeling of cell wall molecules often produces images similar to those obtained for BRK1-YFP with concentration labeling seen at cell junctions. Thus, although BRK1 is not expected to be cell wall localized, I tested whether BRK1::YFP localizes to the cell wall or to the plasma membrane by partially plasmolysing cells and seeing if BRK1::YFP localization changes along with the retracted plasma membrane

(more extensive plasmolysis led to loss of BRK1-YFP signal for unknown reasons).

Seedlings expressing BRK1p::BRK1::YFP were mounted in 5µg/mL FM 4-64, a red- fluorescent plasma membrane dye, dissolved in water or in 0.7M sucrose for plasmolysis.

Subsequently, I examined the expanding portion of the root (due to its well-defined

BRK1::YFP localization and because FM 4-64 labels root plasma membranes very clearly). In the examined cells, BRK1::YFP appeared to localize to the plasma membrane whether in sucrose or in water (see Figure 11). Because BRK1::YFP localizes to areas of

FM 4-64 fluorescence even after cell plasmolysis, BRK1::YFP cannot be localized to the cell wall, and instead must be associated with the plasma membrane.

Figure 11: The root cells of BRK1::YFP transformants in 5 µg/mL FM 4-64 at low magnification (A, B) and at high magnification (C, D), in water (no plasmolysis, A and

C) or in 0.7 M sucrose (plasmolysis, B and D). BRK1::YFP is shown in green, while FM

4-64 staining in shown in red. The arrowheads indicate areas where BRK1-YFP remains associated with the plasma membrane even after plasmolysis.

BRK1 does not localize to the plasma membrane via the secretory pathway

Although BRK1 and other subunits of the SCAR complex lack a signal peptide, I investigated whether BRK1-YFP localization to the plasma membrane requires the secretory pathway. I incubated BRK1p::BRK1::YFP seedlings in 50 µM Brefeldin A, which disrupts transport from the endoplasmic reticulum to the Golgi, or in 0.28%

DMSO as a solvent control, and then examined them for fluorescence. As a positive control, I mounted PIN1p::PIN1::GFP seedlings in an equal fashion. Upon incubation in

Brefeldin A, PIN1::GFP is known to form what are called “BFA compartments” as the secreted proteins are unable to fuse with the Golgi apparatus and instead build up into aggregates in the cell [Geldner et al., 2001]. However, after 30, 90, or 120 minute incubations with Brefeldin A, BRK1::YFP did not aggregate into these BFA compartments (see Figure 12), suggesting that BRK1::YFP is not targeted by the same secretory pathway as PIN1::GFP is. Thus, other mechanisms appear to be responsible for

BRK1 localization to the plasma membrane.

Figure 12: The roots of BRK1::YFP transformants were incubated in 0.28% DMSO (A) or in 50 µM Brefeldin A (B) for 30 minutes. As a positive control, roots of PIN1::GFP transformants were incubated in 0.28% DMSO (C) or in 50 µM Brefeldin A (D) for 30 minutes, which led to the formation of BFA compartments (arrowheads).

BRK1::YFP localization may not be PtdIns(3,4,5)P 3-dependent

SCAR/WAVE proteins have a basic domain that binds to phosphotidylinositol

(3,4,5)-triphosphate molecules (abbreviated as PtdIns(3,4,5)P 3), and this binding is necessary for recruitment of WAVE2 to the plasma membrane in mammalian cells

[Oikawa et al., 2004]. Since Arabidopsis SCAR proteins also contain a homologous basic domain, PtdIns(2,3,4)P 3 may be necessary for the localization of Arabidopsis SCAR complex as well. As one of the subunits of the SCAR complex, BRK1 localization could therefore be affected if PtdIns(3,4,5)P 3 were disrupted. I tested this hypothesis by incubating BRK1p::BRK1::YFP transformants with inhibitors of phosphatidylinositol-3-

OH kinase (abbreviated as PI3K), the enzyme that produces PtdIns(3,4,5)P 3 from precursor molecules. If PtdIns(3,4,5)P 3 is important in SCAR complex localization in plants, BRK1::YFP localization should be disrupted following treatment with the PI3K inhibitors Wortmannin and LY294002.

I incubated BRK1p::BRK1::YFP seedlings in 1 µM, 10 µM, 30 µM, and 100 µM

Wortmannin or LY294002 for a period of 2 hours and 6 hours. I also incubated

BRK1p::BRK1::YFP transformants in 0.01%, 0.1%, 0.3%, and 1% DMSO for equivalent periods of time as a solvent control. Afterward, the treated plants were examined at the expanding portion of the root for BRK1::YFP fluorescence. Plants treated with 1 µM, 10

µM, or 30 µM Wortmannin or LY294002 for 2 hours or 6 hours showed no change in the localization of BRK1::YFP (data not shown). Only plants treated with 100 µM

Wortmannin for either 2 hours or 6 hours showed a change in BRK1::YFP, which appeared to de-localize from the plasma membrane to the cytoplasm when compared to

37 control samples (see Figure 13). However, plants treated with 100 µM LY294002 for 2 hours or 6 hours did not display such a change in BRK1::YFP localization. Because such a high concentration of Wortmannin was necessary for any effect (typical Wortmannin treatments use concentrations of 33 µM or less), and because LY294002 treatment did elicit a similar change, we cannot definitively conclude whether or not PtdIns(3,4,5)P 3 is necessary for Arabidopsis SCAR localization, and thus BRK1::YFP localization.

Figure 13: BRK1::YFP plants treated with 100 µM Wortmannin for 2 or 6 hours results in a change in BRK1::YFP localization. Similar treatments with 100 µM LY294002 failed to cause a similar change.

SCAR is necessary for specific BRK1 localization

Observations of stable BRK1::YFP expressing plants show that BRK1::YFP

localizes at the plasma membrane, and very distinctly at sites of pavement cell corners

and junctions (see Figure 9). However, the mechanism by which the SCAR/WAVE

complex is recruited to the plasma membrane is not yet known, and I could not conclude

whether or not PtdIns(3,4,5)P 3 is necessary for this. Here, I tested whether BRK1::YFP

localization depends on SCAR by bombarding the BRK1p::BRK1::YFP construct, along

with a DsRed fluorescent marker, into expanding epidermal pavement cells of scar1,2,3,4 quadruple mutants, arp2-1 mutants, and wild-type plants. Forty-eight hours after bombardment, leaf primordia were examined for cells with DsRed and BRK1::YFP expression, which indicated successful bombardment. Even at low bombardment concentrations of BRK1p::BRK1:YFP DNA, I saw BRK1::YFP localization near the cell periphery but also saw fluorescence within cytoplasmic strands, indicating the presence of BRK1::YFP in the cytoplasm as well, which was not observed in stable

BRK1p::BRK1::YFP transformants. However, one feature of the localization of

BRK1::YFP in transgenic plants that was consistently observed in bombarded cells was the brighter BRK1::YFP fluorescence at cell junctions where pavement cells are adjacent to stomata, a feature that cannot be attributed to cytoplasmic localization. I examined a total of 84 junctions between bombarded pavement cells and stomata, which are easily identifiable and where I expect to see BRK1::YFP localization, at least in wild-type samples.

Indeed, in bombarded wild-type samples I saw well-defined bright foci of

BRK1::YFP at 75% of junctions between pavement cells and stomata. I also found a

similar proportion (76.5%) of this specific BRK1::YFP localization in arp2 mutant samples, indicating that the ARP2/3 complex is not involved in BRK1 localization, as expected since the ARP2/3 complex is believed to function downstream of the SCAR complex. On the other hand, bombarded scar quadruple mutants had a significantly

smaller proportion (11.54%) of concentrated BRK1::YFP in such junctions compared to

bombarded wild-type cells (see Figure 14 and Graph 1), demonstrating that SCAR

protein is needed for proper BRK1 localization.

Figure 14: BRK1::YFP localizes distinctly at junctions between pavement cells and

stomata (arrowheads) in bombarded wild-type plants (A) and arp2-1 mutants (B), but not in scar quadruple mutants (C and D).

Graph 1: The percentage of junctions between a bombarded pavement cell and a

neighboring stomate with a BRK1::YFP foci. In arp2-1 mutants, this value is not significantly different from that in wild-type (P = 0.90), but in scar quadruple mutants the value is significantly lower compared to in wild-type (P < 0.0001).

SCAR2, SCAR3, and BRK1 promoter expression patterns have overlaps and differences

Another method I used to examine BRK1 expression, and compare it to SCAR expression, was GUS (β-glucuronidase) reporter assays. Plants were obtained that expressed GUS protein from sequences upstream of SCAR2, SCAR3, and BRK1. I stained

6 to 8 day-old seedlings for GUS activity and compared the results between the three constructs. Very weak SCAR2 promoter activity was seen at the base of cotyledons and

primordia, but strong activity was found in stomata (see Figure 15). In contrast, strong

SCAR3 promoter activity was seen in primordia, emerging lateral roots, and the root tip

(see Figure 16), while weaker activity was seen in cotyledons (with more activity at the growing tip), stomata, and often in trichomes and at the base of trichomes. BRK1 promoter activity was similar to SCAR3 promoter activity in several ways – both showed similar GUS assay results in cotyledons, the root tip, stomata, and often in trichomes (see

Figure 17). However, BRK1 promoter activity was also seen in root hairs and the root vasculature near the hypocotyl, while lacking activity at the base of trichomes and in emerging lateral roots as seen for the SCAR2 promoter. These results demonstrate the similarities and differences between SCAR2, SCAR3, and BRK1 promoter activities.

Figure 15: SCAR2p::GUS activity is seen weakly at the base of cotyledons and

promordia (A, arrowhead), but strongly in stomata (B).

Figure 16: SCAR3p::GUS activity is seen in primordia (A), cotyledons (B), stomata (C, arrowhead), the base of trichomes (D), trichomes themselves (E), emerging lateral roots

(F), and the root tip (G).

Figure 17: BRK1p::GUS activity is seen in primordia and cotyledons (A), trichomes (B), stomata (C, arrowhead), root hairs and root vasculature just below the hypocotyl (D), and the root tip (E).

The BRK1 Promoter is activated by auxin

We found promoter activity at the root tip for SCAR2, BRK1, and our positive control, DR5 . The DR5 promoter contains an artificial auxin response element and is therefore used as a reporter for auxin distribution. Interestingly, the Arabidopsis actin gene ACT7 is auxin-responsive as well [McDowell et al., 2006]. This raises the question of whether auxin could regulate SCAR or BRK1 promoter activity like it does of ACT7.

This idea is bolstered by the fact that SCAR/WAVE, BRK1, and auxin are all linked to actin-dependent processes, including cell growth. To test this idea, I incubated the roots of BRK1p::GUS, SCAR2p::GUS, and SCAR3p::GUS seedlings in 5 ng/mL

1-naphthaleneacetic acid (NAA), a member of the auxin hormone family, and then assayed the samples for promoter activity. I also included DR5p::GUS seedlings as a positive control. As expected, DR5p::GUS promoter activity clearly increased in the root after 30 minutes of incubation in NAA, and perhaps slightly increased after only 5 minutes. BRK1p::GUS promoter activity also clearly increased in the root after as little as

5 minutes of NAA treatment, with even more promoter activity after 30 minutes of NAA treatment (see Figure 18). However, neither SCAR2p::GUS nor SCAR3p::GUS showed any increase in promoter activity following treatment with NAA, even after a prolonged

60 minute treatment (data not shown for SCAR2p::GUS). This provides clear evidence that BRK1 promoter activity is upregulated by auxin, whereas SCAR2 and SCAR3 promoter activities are not.

Figure 18: The BRK1 promoter is up-regulated by NAA. DR5p::GUS promoter activity with no NAA treatment (A), 5 minutes of NAA treatment (B), and 30 minutes of NAA treatment (C). BRK1p::GUS promoter activity with no NAA treatment (E), 5 minutes of

NAA treatment (F), and 30 minutes of NAA treatment (G). SCAR3p::GUS promoter activity with no NAA treatment (D) and 60 minutes of NAA treatment (H).

BRK1 is not necessary for PIN1::GFP localization

Because BRK1 expression is promoted by auxin, I investigated a possible relationship between BRK1 and PIN1. PIN1 belongs to a family of PIN proteins that transport auxin through tissues, but the distribution of auxin feeds back to affect PIN expression [Leyser, 2005]. Auxin also affects actin organization and vice versa, creating another feedback loop. Interestingly, PIN1::GFP localization is similar to BRK1::YFP localization in that both are concentrated at the transverse ends of root cells. Since BRK1 is involved in actin polymerization, it may also affect PIN1 if the latter localizes via actin-guided vesicles or through auxin-mediated pathways. To explore this possibility, I examined PIN1::GFP localization in brk1 mutants.

My results show that there is no difference in PIN1::GFP expression or localization between brk1 mutants and wild-type plants (see Figure 19). There is some variation in PIN1::GFP expression levels between plants of either line, but high

PIN1::GFP expressing individuals were found in both lines, and overall no consistent difference in expression levels was observed. The typical polarized localization pattern of

PIN1::GFP was also seen in brk1 mutant plants, indicating that BRK1 is not necessary for the polar localization of PIN1::GFP.

Figure 19: Polarized localization of PIN1::GFP is seen in the roots of plants with intact

BRK1 (A) as well as with mutant brk1 (B).

BRK1 and ARP2 are not required for phototropic responses

Auxin is known to be involved in plant phototropic responses [Muday, 2001], so a defect in BRK1, which we have found is up-regulated by auxin and may also affect actin organization in relevant cells, could impact such phototropic responses. To test this, the phototropic response was compared in brk1 mutants, arp2 mutants, and in wild-type

plants. Seeds were let to germinate and grow in the dark for 1 day, and then exposed to

directional blue light for two hours. Following this light exposure, the angle of hypocotyl

bending from the vertical axis towards the direction of the blue light was measured (see

Figure 20). This was repeated for three, six, and nine hour light exposures as well; in

total, 289 samples were measured. However, the results showed no statistically

significant difference between the average bending of wild-type, brk1 , and arp2 plants in response to blue light (see Graph 2), indicating that BRK1 and the ARP2/3 complex are not required for phototropism.

Figure 20: (A) Seedlings are dark grown on a vertically-standing medium plate, and then

exposed to blue light from the left, leading to phototropic bending. (B) This bending is

then measured by the angle between the hypocotyl and the vertical axis, as indicated by

the arrow; a higher angle indicates a greater amount of bending.

Graph 2: The phototropic reponse of wild-type, brk1-1 mutants, and arp2-1 mutants to directional blue light over 2, 3, 6, or 9 hour exposures. No statistically significant difference (P < 0.05) was found between the wild-type and the mutants.

DISCUSSION

The SCAR/WAVE complex has been extensively studied, but many aspects of its function and regulation has remained poorly understood, especially in plants where it was only recently discovered. This includes, among others things, the specific roles of each of its subunits; how the complex is assembled and recruited; and exactly how its loss leads to the observed mutant phenotypes. In these series of experiments, I attempted to address some of these questions.

I observed that BRK1::YFP localizes to the cell periphery in the tissues examined, and the plasmolysis experiments indicate that this localization is not associated with the cell wall, but rather with the plasma membrane. Other experiments have shown that

BRK1::YFP and SCAR1 are found in microsomal fractions of cell extracts, and solubilization experiments indicated that BRK1 and SCAR2 are peripheral membrane proteins [Dyachok et al., unpublished]. These findings are consistent with the lack of a signal peptide or a transmembrane domain in BRK1 and SCAR1. In animal cells,

SCAR/WAVE and ARP2/3 complex subunits are localized at the plasma membrane as well [Machesky et al., 1997; Welch et al., 1997; Stovold et al., 2005]. However, previous studies have suggested that in plant cells, SCAR and APR2/3 complex-dependent actin polymerization occurs in the cytoplasm [Uhrig et al., 2007]. Thus, my localization results were not entirely expected and have lead to new ideas for SCAR complex function, though it remains unclear what those functions are. Interestingly, our lab has found that the cell walls of brk1 and arp2 mutants have abnormally low pectin content, and that the 51

junctions of root cells in these mutants display structural anomalies [Dyachok et al.,

unpublished]. These properties have been suggested to be the result of defective

endocytosis or exocytosis at the plasma membrane due to lack of SCAR and ARP2/3

complex-complex actin nucleation.

The observations of BRK1-YFP localization to the plasma membrane are

consistent with previous studies that maize brk1 mutants lack cortical actin enrichments associated with epidermal lobe outgrowth [Frank and Smith, 2002; Frank et al., 2004].

Studies with Arabidopsis have shown subtle differences in the cortical actin distribution of pavement cells in SCAR and ARP2/3 complex subunit mutants, but no changes in cortical actin in expanding trichomes [Mathur et al., 2003a; Le et al., 2003; Li et al.,

2003; Basu et al., 2004; El-Assal et al., 2004; Djakovic et al., 2006]. Because of the pattern of BRK1::YFP localization seen in trichomes, I re-examined cortical actin in expanding trichomes by visualizing ABD2::GFP bound to actin filaments. As in previous studies, I saw no clear reduction of cortical actin in the trichomes of brk1 mutants compared to those of wild-type plants. However, changes in cortical actin dynamics could exist that are not observable using the methods we have employed. The conclusion

that the SCAR and ARP2/3 complexes promote actin polymerization at the plasma

membrane is supported by the observation by others in our lab that cortical F-actin

density is reduced in expanding root cells of brk1 and arp2 mutants [Dyachok et al., unpublished].

I utilized arp2 and scar1,2,3,4 quadruple mutants to investigate the requirements for BRK1::YFP localization at the plasma membrane. Transient expression of

BRK1::YFP following particle bombardment resulted in cytoplasmic expression that

made distinguishing plasma membrane localization difficult. Therefore, I instead focused

on three-way junctions between pavement cells and stomata, where plasma membrane

localization of BRK1::YFP could be consistently observed after particle bombardment.

The results demonstrated that SCAR is indeed necessary for this cell junction-specific

localization, and therefore must be involved in the localization of BRK1. An examination

of stable expression of BRK1::YFP in scar quadruple mutants would be desirable to further confirm this finding. Whether BRK1 is similarly necessary for the localization of

SCAR has not been determined and may be immaterial, since SCAR is degraded in the absence of BRK1 or any other SCAR/WAVE complex subunits [Djakovic et al., 2006;

Blagg et al., 2003; Kunda et al., 2003]. This necessity of SCAR for BRK1 localization fits with the finding that Brefeldin A, which disrupts protein transport from the endoplasmic reticulum to the Golgi, has no effect on BRK1::YFP localization. Thus,

BRK1 is targeted to the plasma membrane independently of the secretion pathway.

Instead, BRK1 may first bind with the other subunits of the Arabidopsis SCAR complex before the entire complex is targeted to the plasma membrane.

Other studies have demonstrated that PtdIns(3,4,5)P 3 is necessary for the recruitment of mammalian WAVE2 to the leading edge of lamellipodia [Oikawa et et.,

2004]. PtdIns(3,4,5)P 3 binds to WAVE2 via its basic domain, a domain that Arabidopsis

SCAR proteins also have. If Arabidopsis SCARs behave similarly to mammalian WAVE, then PtdIns(3,4,5)P 3 could be necessary for SCAR localization. If this is so, then

PtdIns(3,4,5)P 3 would be necessary for BRK1::YFP localization as well, since as I have

shown, BRK1 localization is dependent on SCAR. I found that high concentrations of

Wortmannin, an inhibitor of PI3K (which produces PtdIns(3,4,5)P 3), caused changes in the distribution of BRK1::YFP. However, typical treatments with Wortmannin only employ concentrations of 100 nM to 33 µM, whereas I found that a concentration of 100

µM was needed to alter BRK1::YFP localization. Furthermore, similar treatments with high or low concentrations of LY294002, another PI3K inhibitor, did not elicit any changes in BRK1::YFP localization. While LY294002 is less specific for PI3K than

Wortmannin is, it was used successfully at a concentration of 25 µM in the study of

WAVE2 recruitment mentioned above. Therefore, my results regarding the involvement of PI3K in BRK1-YFP localization experiment are inconclusive.

In the GUS reporter assays of SCAR2 , SCAR3 , and BRK1 promoters, I found similarities as well as differences in their activities. All three promoters were active in stomata, while SCAR3 and BRK1 promoters (but not the SCAR2 promoter) were additionally active throughout cotyledons and primordia (especially at the growing tip), at the root tip, and in trichomes as well. However, only the SCAR3 promoter was also active at the base below trichome cells and in emerging lateral roots, whereas only BRK1 promoter was active in root hairs and in some of the root vasculature. The similarity of

SCAR2 , SCAR3 , and BRK1 promoter expression in stomata suggests some particular importance of the SCAR/WAVE complex in these cells. Interestingly, in another study in our lab it was observed that stomata of arp2 , brk1 , and scar1,2,3,4 mutants have larger apertures than wild type stomata under standard growth conditions, consistent with a role

for SCAR and ARP2/3 complex-dependent actin polymerization in the regulation of

stomatal aperture [James Ingham, unpublished].

I also noticed in the GUS reporter assays that SCAR2 and BRK1 promoter activity in the root tip was shared by the positive control, the DR5 promoter. The DR5 promoter contains an artificially engineered auxin response element, and its activity is related to the distribution of auxin in the root [Muday and DeLong, 2001]. Furthermore, the finding of an Arabidopsis actin gene promoter modulated by auxin [McDowell et al., 1996], as well as studies showing that actin filaments are necessary for the localization of an auxin transporter [Geldner et al., 2001], led us to speculate that auxin may affect promoters of the Arabidopsis SCAR complex subunit genes. I found that this is indeed the case with the BRK1 promoter, which showed an increase in activity in the root following incubation in NAA. I did not see a similar change with the SCAR2 or SCAR3 promoters; however, this was not unexpected for the SCAR2 promoter, which exhibited no activity in the root

to begin with. The discovery that auxin induces the BRK1 promoter, but not the SCAR2

or SCAR3 promoters, suggests a specific and potentially unique role for BRK1 in the

SCAR/WAVE complex. Since SCAR proteins are degraded in the absence of BRK1

function [Djakovic et al., 2006], up-regulation of BRK1 by auxin could be a means to

rapidly stabilize SCAR and thereby permit participation of SCAR and ARP2/3 complex-

dependent actin polymerization in auxin responses. Possible future studies involving

auxin induction in the promoters of the other SCAR/WAVE complex regulatory subunits

ABI , PIR121 , and NAP1 , would clarify the significance of my finding.

Auxin induction of the BRK1 promoter raises the possibility of a role for the

SCAR complex in auxin responses or auxin transport. As an initial approach to this question, I investigated whether BRK1 could affect auxin transport or tropic responses. I did not observe any defects in the localization of the auxin-transporter PIN1 in brk1 mutants. However, this does not rule out the possibility that BRK1 and SCAR/WAVE complex-mediated actin nucleation have an effect on other regulators of auxin distribution. I also did not notice any difference between the bending of dark-grown brk1 or arp2 mutants towards directional blue light compared to wild-type plants, suggesting that actin nucleation via the ARP2/3 complex is not required for phototropism. Another similar study found that brk1 and arp2 mutants had no defects in gravitropic responses either [Lauren Clarke, unpublished]. Both phototropism and gravitropism are known to be regulated by auxin [Blakeslee et al., 2004; Müller et al., 1998]. In summary, SCAR and ARP2/3 complexes do not appear to be required for two important, auxin- independent tropic responses. Further work will be needed to determine what role the

SCAR-ARP2/3 pathway might play in mediating auxin responses or regulating auxin transport.

Previous studies have demonstrated that the SCAR complex found in Arabidopsis operates in an ARP2/3 complex pathway similar to the one seen in animals. However, the special characteristics of plants give rise to properties and relationships involving actin not seen in other types of eukaryotes. In this work, I have provided evidence showing that

Arabidopsis BRK1, a SCAR complex subunit, localizes to the plasma membrane of various cell types and is contingent upon SCAR instead of the secretion pathway to do so.

This finding implies that SCAR complex-dependent actin polymerization occurs at the

plasma membrane. Many questions remain to be answered concerning how SCAR

complex-dependent actin nucleation participates in cell morphogenesis and other cellular processes. In particular, my finding of a connection between a SCAR complex subunit and the essential plant hormone auxin leaves a host of interesting possibilities to explore.

REFERENCES

Barr, F.A., and Gruneberg, U. (2007). Cytokinesis: placing and making the final cut. Cell 131 , 847-860. Baluska, F., Jasik, J., Edelmann, H.G., Salajová, T., and Volkmann, D. (2001). Latrunculin B-induced plant dwarfism: Plant cell elongation is F-actin-dependent. Dev. Biol. 231 , 113-124. Barkalow, K., Witke, W., Kwiatkowski, D.J., and Hartwig, J.H. (1996). Coordinated regulation of platelet actin filament barbed ends by gelsolin and capping protein. J. Cell Biol. 134 , 389-399.

Baskin, T.I., and Bivens, N.J. (1995). Stimulation of radial expansion in arabidopsis roots by inhibitors of actomyosin and vesicle secretion but not by various inhibitors of metabolism. Planta 197 , 514-521

Basu, D., El-Assal, Sel-D., Le, J., Mallery, E.L., and Szymanski, D.B. (2004). Interchangeable functions of Arabidopsis PIROGI and the human WAVE complex subunit SRA1 during leaf epidermal development. Development 131 , 4345-4355.

Basu, D., Le, J., El-Essal, Sel-D., Huang, S., Zhang, C., Mallery, E.L., Koliantz, G., Staiger, C.J., and Szymanski, D.B. (2005). DISTORTED3/SCAR2 is a putative arabidopsis WAVE complex subunit that activates the Arp2/3 complex and is required for epidermal morphogenesis. Plant Cell 17 , 502-524.

Beltzner, C.C., and Pollard, T.D. (2004). Identification of functionally important residues of Arp2/3 complex by analysis of homology models from diverse species. J. Mol. Biol. 336 , 551-565.

Benková, E., Michniewicz, M., Sauer, M., Teichmann, T., Seifertová, D., Jürgens, G., and Friml, J. (2003). Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 115 , 591-602.

Biyasheva, A., Svitkina, T., Kunda, P., Baum, B., and Borisy, G. (2004). Cascade pathway of filopodia formation downstream of SCAR. J. Cell Sci. 117 , 837-848.

Blagg, S.L., Stewart, M., Sambles, C., and Insall, R.H. (2003). PIR121 regulates pseudopod dynamics and SCAR activity in Dictyostelium. Curr. Biol. 13 , 1480-1487.

Blakeslee, J.J., Bandyopadhyay, A., Peer, W.A., Makam, S.N., and Murphy, A.S. (2004). Relocalization of the PIN1 auxin efflux facilitator plays a role in phototropic responses. Plant Physiol. 134 , 28-31.

Blanchard, A., Ohanian, V., and Critchley, D. (1989). The structure and function of alpha-actinin. J. Muscle Res. Cell Motil. 10 , 280-289.

Bogdan, S. and Klämbt, C. (2003). Kette regulates actin dynamics and genetically interacts with Wave and Wasp. Development 130 , 4427-4437.

Boldogh, I.R., Yang, H.C., Nowakowski, W.D., Karmon, S.L., Hays, L.G., Yates 3rd, J.R., and Pon, L.A. (2001). Arp2/3 complex and actin dynamics are required for actin- based mitochondrial motility in yeast. Proc. Natl. Acad. Sci. U.S.A. 98 , 3162-3167.

Bompard, G., and Caron, E. (2004). Regulation of WASP/WAVE proteins: making a long story short. J. Cell Biol. 166 , 957-962.

Brembu, T., Winge, P., Seem, M., and Bones, A.M. (2004). NAPP and PIRP encode subunits of a putative wave regulatory protein complex involved in plant cell morphogenesis. Plant Cell 16 , 2335-2349.

Carlier, M.F. and Pantaloni, D. (1986). Direct evidence for ADP-Pi-F-actin as the major intermediate in ATP-actin polymerization. Rate of dissociation of Pi from actin filaments. Biochemistry 25 , 7789-7792.

Carlier, M.F., Laurent, V., Santolini, J., Melki, R., Didry, D., Xia, G.X., Hong, Y., Chua, N.H., and Pantaloni, D. (1997). Actin depolymerizing factor (ADF/cofilin) enhances the rate of filament turnover: implication in actin-based motility. J. Cell Biol. 136 , 1307- 1322.

Carlsson, L., Nyström, L.E., Sundkvist, I., Markey, F., and Lindberg, U. (1977). Actin polymerizability is influenced by profilin, a low molecular weight protein in non-muscle cells. J. Mol. Biol. 115 , 465-483.

Carpita, N., and McCann, M. (2000). The cell wall. American Society of Plant Physiologists, Rockville, MD. Biochem. and Mol. Biol. of Plants. 52-108.

Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J. 16 , 735-743.

Dayel, M.J., Holleran, E.A., and Mullins, R.D. (2001). Arp2/3 complex requires hydrolyzable ATP for nucleation of new actin filaments. Proc. Natl. Acad. Sci. U.S.A. 98 , 14871-14876.

Dayel, M.J., and Mullins, R.D. (2004). Activation of Arp2/3 complex: addition of the first subunit of the new filament by a WASP protein triggers rapid ATP hydrolysis on Arp2. PLoS. Biol. 2, E91.

Deeks, M.J., Hussey, P.J, and Davies, B. (2002). Formins: intermediates in signal- transduction cascades that affect cytoskeletal reorganization. Trends Plant Sci. 7, 492- 498.

Didry, D., Carlier, M.F., and Pantaloni, D. (1998). Synergy between actin depolymerizing factor/cofilin and profilin in increasing actin filament turnover. J. Biol. Chem. 273 , 25602-25611.

Djakovic, S., Dyachok, J., Burke, M., Frank, M.J., and Smith, L.G. (2006). BRICK1/HSPC300 functions with SCAR and the ARP2/3 complex to regulate epidermal cell shape in Arabidopsis. Development 133 , 1091-1100.

Drenckhahn, D. and Pollard, T.D. (1986). Elongation of actin filaments is a diffusion- limited reaction at the barbed end and is accelerated by inert macromolecules. J. Biol. Chem. 261 , 12754-12758.

Eden, S., Rohatgi, R., Podtelejnikov, A.V., Mann, M., and Kirschner, M.W. (2002). Mechanism of regulation of WAVE1-induced actin nucleation by Rac1 and Nck. Nature 418 , 790-793.

Edwards, R.A., Herrera-Sosa, H., Otto, J., and Bryan, J. (1995). Cloning and expression of a murine fascin homolog from mouse brain. J. Biol. Chem. 270 , 10764-10770.

Egile, C., Rouiller, I., Xu, X.P., Volkmann, N., Li, R., and Hanein, D. (2005). Mechanism of filament nucleation and branch stability revealed by the structure of the Arp2/3 complex at actin branch junctions. PLoS Biol. 2005 3, e383.

El-Assal, Sel-D., Le, J., Basu, D., Mallery, E.L., and Szymanski, D.B. (2004). Arabidopsis GNARLED encodes a NAP125 homolog that positively regulates ARP2/3. Curr. Biol. 14 , 1405-1409.

Eto, K., Nishikii, H., Ogaeri, T., Suetsugu, S., Kamiya, A., Kobayashi, T., Yamazaki, D., Oda, A., Takenawa, T., and Nakauchi, H. (2007). The WAVE2/Abi1 complex differentially regulates megakaryocyte development and spreading: implications for platelet biogenesis and spreading machinery. Blood 110 , 3637-3647.

Finan, P.M., Soames, C.J., Wilson, L., Nelson, D.L., Stewart, D.M., Truong, O., Hsuan, J.J., and Kellie, S. (1996). Identification of regions of the Wiskott-Aldrich syndrome protein responsible for association with selected Src homology 3 domains. J. Biol. Chem. 271 , 26291-26295.

Frank, M.J., and Smith, L.G. (2002). A small, novel protein highly conserved in plants and animals promotes the polarized growth and division of maize leaf epidermal cells. Curr Biol. 12 , 849-853.

Frank, M., Egile, C., Dyachok, J., Djakovic, S., Nolasco, M., Li, R., and Smith, L.G. (2004). Activation of Arp2/3 complex-dependent actin polymerization by plant proteins distantly related to Scar/WAVE. Proc. Natl. Acad. Sci. U.S.A. 101 , 16379-16384.

Friederich, E., Vancompernolle, K., Louvard, D., and Vandekerckhove, J. (1999). Villin function in the organization of the actin cytoskeleton. Correlation of in vivo effects to its biochemical activities in vitro. J. Biol. Chem. 274 , 26751-26760.

Friml, J., Wi śniewska, J., Benková, E., Mendgen, K., and Palme, K. (2002). Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415 , 806-809.

Friml, J., Vieten, A., Sauer, M., Weijers, D., Schwarz, H., Hamann, T., Offringa, R., and Jürgens, G. (2003). Efflux-dependent auxin gradients establish the apical-basal axis of Arabidopsis. Nature 426 , 147-153.

Fu, Y., Li, H., and Yang, Z. (2002). The ROP2 GTPase controls the formation of cortical fine F-actin and the early phase of directional cell expansion during Arabidopsis organogenesis. Plant Cell. 14 , 777-794.

Gachet, Y., and Hyams, J.S. (2005). Endocytosis in fission yeast is spatially associated with the actin cytoskeleton during polarised cell growth and cytokinesis. J. Cell Sci. 118 , 4231-4242.

Gautreau, A., Ho, H.Y., Li, J., Steen, H., Gygi, S.P., and Kirschner, M.W. (2004). Purification and architecture of the ubiquitous Wave complex. Proc. Natl. Acad. Sci. U.S.A. 101 , 4379-4383.

Geldner, N., Friml, J., Stierhof, Y.D., Jürgens, G., and Palme, K. (2001). Auxin transport inhibitors block PIN1 cycling and vesicle trafficking. Nature 413 , 425-428.

Gilliland, L.U., Pawloski, L.C., Kandasamy, M.K., and Meagher R.B. (2003). Arabidopsis actin gene ACT7 plays an essential role in germination and root growth. Plant J. 33 , 319-328.

Goley, E.D., Rodenbusch, S.E., Martin, A.C., and Welch, M.D. (2004). Critical conformational changes in the Arp2/3 complex are induced by nucleotide and nucleation promoting factor. Mol. Cell. 16 , 269-279.

Goode, B.L., Rodal, A.A., Barnes, G., and Drubin, D.G. (2001). Activation of the Arp2/3 complex by the actin filament binding protein Abp1p. J. Cell. Biol. 153 , 627-634.

Gournier, H., Goley, E.D., Niederstrasser, H., Trinh, T., and Welch, M.D. (2001). Reconstitution of human Arp2/3 complex reveals critical roles of individual subunits in complex structure and activity. Mol. Cell. 8, 1041-1052.

Heidemann, S.R., Kaech, S., Buxbaum, R.E., and Matus, A. (1999). Direct observations of the mechanical behaviors of the cytoskeleton in living fibroblasts. J. Cell Biol. 145 , 109-122. Heisler, M.G., Ohno, C., Das, P., Sieber, P., Reddy, G.V., Long, J.A., and Meyerowitz, E.M. (2005). Patterns of auxin transport and gene expression during primordium development revealed by live imaging of the Arabidopsis inflorescence meristem. Curr Biol. 15 , 1899-1911. Hepler, P.K., Vidali, L., and Cheung, A.Y. (2001). Polarized cell growth in higher plants. Annu. Rev. Cell Dev. Biol. 17 , 159-187. Holweg, C., Süsslin, C., and Nick, P. (2004). Capturing in vivo dynamics of the actin cytoskeleton stimulated by auxin or light. Plant Cell Physiol. 45 , 855-863. Huang, S., Gao, L., Blanchoin, L., and Staiger, C,J. (2006). Heterodimeric capping protein from Arabidopsis is regulated by phosphatidic acid. Mol. Biol. Cell. 17 , 1946- 1958.

Hwang, J.U., Suh, S., Yi, H., Kim, J., and Lee, Y. (1997). Actin Filaments Modulate Both Stomatal Opening and Inward K+-Channel Activities in Guard Cells of Vicia faba L. Plant Physiol. 115 , 335-342.

Innocenti, M., Zucconi, A., Disanza, A., Frittoli, E., Areces, L.B., Steffen, A., Stradal, T.E., Di Fiore, P.P., Carlier, M.F., and Scita, G. (2004). Abi1 is essential for the formation and activation of a WAVE2 signalling complex. Nat. Cell Biol. 6, 319-327.

Jarosch, B., Collins, N.C., Zellerhoff, N., and Schaffrath, U. (2005). RAR1, ROR1, and the actin cytoskeleton contribute to basal resistance to Magnaporthe grisea in barley. Mol. Plant Microbe Interact. 18 , 397-404.

Kandasamy, M.K., McKinney, E.C., and Meagher, R.B. (2002). Functional nonequivalency of actin isovariants in Arabidopsis. Mol. Biol. Cell. 13 , 251-261.

Ketelaar, T., Faivre-Moskalenko, C., Esseling, J.J., de Ruijter, N.C., Grierson, C.S., Dogterom, M., and Emons, A.M. (2002). Positioning of nuclei in Arabidopsis root hairs: an actin-regulated process of tip growth. Plant Cell 14 , 2941-2955).

Kim, H.J., DiBernardo, A.B., Sloane, J.A., Rasband, M.N., Solomon, D., Kosaras, B., Kwak, S.P., and Vartanian, T.K. (2006). WAVE1 is required for oligodendrocyte morphogenesis and normal CNS myelination. J. Neurosci. 26 , 5849-5859.

Klahre, U., Friederich, E., Kost, B., Louvard, D., and Chua, N.H. (2000). Villin-like actin-binding proteins are expressed ubiquitously in Arabidopsis. Plant Physiol. 122 , 35- 48.

Kovar, D.R., Staiger, C.J., Weaver, E.A., and McCurdy, D.W. (2000). AtFim1 is an actin filament crosslinking protein from Arabidopsis thaliana. Plant J. 24 , 625-636.

Kunda, P., Craig, G., Dominguez, V., Baum, B. (2003). Abi, Sra1, and Kette control the stability and localization of SCAR/WAVE to regulate the formation of actin-based protrusions. Curr. Biol. 13 , 1867-1875.

Le, J., El-Assal, Sel-D., Basu, D., Saad, M.E., and Szymanski D.B. (2003). Requirements for Arabidopsis ATARP2 and ATARP3 during epidermal development. Curr Biol. 13 , 1341-1347.

Lee, W.L., Bezanilla, M., and Pollard, T.D. (2000). Fission yeast myosin-I, Myo1p, stimulates actin assembly by Arp2/3 complex and shares functions with WASp. J. Cell Biol. 151 , 789-800.

Leyser, O. (2005). Auxin distribution and plant pattern formation: how many angels can dance on the point of PIN? Cell 121 , 819-822.

Li, H., Shen, J.J., Zheng, Z.L., Lin, Y., and Yang, Z. (2001). The Rop GTPase switch controls multiple developmental processes in Arabidopsis. Plant Physiol. 126 , 670-684.

Li, S., Blanchoin, L., Yang, Z., and Lord E.M. (2003). The putative Arabidopsis arp2/3 complex controls leaf cell morphogenesis. Plant Physiol. 132 , 2034-2044.

Machesky, L.M., Atkinson, S.J., Ampe, C., Vandekerckhove, J., and Pollard, T.D. (1994). Purification of a cortical complex containing two unconventional actins from Acanthamoeba by affinity chromatography on profilin-agarose. J. Cell Biol. 127, 107- 115.

Machesky, L.M., Reeves, E., Wientjes, F., Mattheyse, F.J., Grogan, A., Totty, N.F., Burlingame, A.L., Hsuan, J.J., and Segal, A.W. (1997). Mammalian actin-related protein 2/3 complex localizes to regions of lamellipodial protrusion and is composed of evolutionarily conserved proteins. Biochem J. 328 , 105-112.

Machesky, L.M., Mullins, R.D., Higgs, H.N., Kaiser, D.A., Blanchoin, L., May, R.C., Hall, M.E., and Pollard, T.D. (1999). Scar, a WASp-related protein, activates nucleation of actin filaments by the Arp2/3 complex. Proc. Natl. Acad. Sci. U.S.A. 96 , 3739-3744.

Maisch, J., and Nick, P. (2007). Actin is involved in auxin-dependent patterning. Plant Physiol. 143 , 1695-1704.

Marchand, J.B., Kaiser, D.A., Pollard, T.D., Higgs, H.N. (2001). Interaction of WASP/Scar proteins with actin and vertebrate Arp2/3 complex. Nat. Cell Biol. 3, 76-82.

Mathur, J., Spielhofer, P., Kost, B., and Chua, N. (1999). The actin cytoskeleton is required to elaborate and maintain spatial patterning during trichome cell morphogenesis in Arabidopsis thaliana. Development 126 , 5559-5568.

Mathur, J., Mathur, N., Kirik, V., Kernebeck, B., Srinivas, B.P., and Hülskamp, M. (2003a). Arabidopsis CROOKED encodes for the smallest subunit of the ARP2/3 complex and controls cell shape by region specific fine F-actin formation. Development 130 , 3137-3146.

Mathur, J., Mathur, N., Kernebeck, B., and Hülskamp, M. (2003b). Mutations in actin- related proteins 2 and 3 affect cell shape development in Arabidopsis. Plant Cell 15 , 1632-1645.

McDowell, J.M., An, Y.Q., Huang, S., McKinney, E.C., and Meagher, R.B. (1996). The arabidopsis ACT7 actin gene is expressed in rapidly developing tissues and responds to several external stimuli. Plant Physiol. 111 , 699-711.

Meagher, R.B., McKinney, E.C., and Vitale, A.V. (1999). The evolution of new structures: clues from plant cytoskeletal genes. Trends Genet. 15 , 278-284.

Miki, H., Suetsugu, S., and Takenawa, T. (1998). WAVE, a novel WASP-family protein involved in actin reorganization induced by Rac. EMBO J. 17 , 6932-6941.

Millard, T.H., Sharp, S.J., and Machesky, L.M. (2004). Signalling to actin assembly via the WASP (Wiskott-Aldrich syndrome protein)-family proteins and the Arp2/3 complex. Biochem J. 380 , 1-17.

Muday, G.K. (2001). Auxins and tropisms. J. Plant Growth Regul. 20 , 226-243.

Muday, G.K., and DeLong, A. (2001). Polar auxin transport: controlling where and how much. Trends Plant Sci. 6, 535-542.

Muday, G.K., and Murphy, A.S. (2002). An emerging model of auxin transport regulation. Plant Cell 14 , 293-299.

Müller, A., Guan, C., Gälweiler, L., Tänzler, P., Huijser, P., Marchant, A., Parry, G., Bennett, M., Wisman, E., and Palme, K. (1998). AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J. 17 , 6903-6911.

Nakano, K., Satoh, K., Morimatsu, A., Ohnuma, M., and Mabuchi, I. (2001). Interactions among a fimbrin, a capping protein, and an actin-depolymerizing factor in organization of the fission yeast actin cytoskeleton. Mol. Biol. Cell. 12 , 3515-3526.

Nishimura, T., Yokota, E., Wada, T., Shimmen, T., and Okada, K. (2003). An Arabidopsis ACT2 dominant-negative mutation, which disturbs F-actin polymerization, reveals its distinctive function in root development. Plant Cell Physiol. 44 , 1131-1140.

Oikawa, T., Yamaguchi, H., Itoh, T., Kato, M., Ijuin, T., Yamazaki, D., Suetsugu, S., and Takenawa, T. (2004). PtdIns(3,4,5)P3 binding is necessary for WAVE2-induced formation of lamellipodia. Nat. Cell Biol. 6, 420-426.

Perelroizen, I., Didry, D., Christensen, H., Chua, N.H., and Carlier, M.F. (1996). Role of nucleotide exchange and hydrolysis in the function of profilin in action assembly. J. Biol. Chem. 271 , 12302-12309.

Pollard, T.D. (1986). Assembly and dynamics of the actin filament system in nonmuscle cells. J. Cell Biochem. 31 , 87-95.

Pollard, T.D., and Borisy, G.G. (2003). Cellular motility driven by assembly and disassembly of actin filaments. Cell 112 , 453-465.

Preston, T.M., and King, C.A. (1984). Amoeboid locomotion of Acanthamoeba castellanii with special reference to cell-substratum interactions. J. Gen. Microbiol. 130 , 2317-2323.

Qurashi, A., Sahin, H.B., Carrera, P., Gautreau, A., Schenck, A., and Giangrande, A. (2007). HSPC300 and its role in neuronal connectivity. Neural Develop. 2, 18.

Robinson, R.C., Turbedsky, K., Kaiser, D.A., Marchand, J.B., Higgs, H.N., Choe, S., and Pollard, T.D. (2001). Crystal structure of Arp2/3 complex. Science 294 , 1679-1684.

Rogers, S.L., Wiedemann, U., Stuurman, N., and Vale, R.D. (2003) Molecular requirements for actin-based lamella formation in Drosophila S2 cells. J. Cell Biol. 162 , 1079-1088.

Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T., and Kirschner, M.W. (1999). The interaction between N-WASP and the Arp2/3 complex links Cdc42- dependent signals to actin assembly. Cell 97 , 221-231.

Romagnoli, S., Cai, G., Faleri, C., Yokota, E., Shimmen, T., Cresti, M., (2007). Microtubule- and actin filament-dependent motors are distributed on pollen tube mitochondria and contribute differently to their movement. Plant Cell Physiol. 48 , 345- 361.

Sabatini, S., Beis, D., Wolkenfelt, H., Murfett, J., Guilfoyle, T., Malamy, J., Benfey, P., Leyser, O., Bechtold, N., Weisbeek, P., and Scheres, B. (1999). An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell 99 , 463-472.

Saedler, R., Zimmermann, I., Mutondo, M., and Hülskamp, M. (2004). The Arabidopsis KLUNKER gene controls cell shape changes and encodes the AtSRA1 homolog. Plant Mol Biol. 56 , 775-782.

Sakai, Y., and Takagi, S. (2005). Reorganized actin filaments anchor chloroplasts along the anticlinal walls of Vallisneria epidermal cells under high-intensity blue light. Planta 221 , 823-830.

Sawa, M., Suetsugu, S., Sugimoto, A., Miki, H., Yamamoto, M., and Takenawa, T. (2003). Essential role of the C. elegans Arp2/3 complex in cell migration during ventral enclosure. J. Cell Sci. 116 , 1505-1518.

Schafer, D.A., Jennings, P.B., and Cooper, J.A. (1996). Dynamics of capping protein and actin assembly in vitro: uncapping barbed ends by polyphosphoinositides. J. Cell. Biol. 135 , 169-179.

Sept, D., and McCammon, J.A. (2001). Thermodynamics and kinetics of actin filament nucleation. Biophys J. 81 , 667-674.

Smith, L.G., and Oppenheimer, D.G. (2005). Spatial control of cell expansion by the plant cytoskeleton. Annu. Rev. Cell Dev. Biol. 21 , 271-295. Sossey-Alaoui, K., Li, X., Ranalli, T.A., and Cowell, J.K. (2005). WAVE3-mediated cell migration and lamellipodia formation are regulated downstream of phosphatidylinositol 3-kinase. J. Biol. Chem. 280 , 21748-21755. Southwick, F.S., and Purich, D.L. (1996). Intracellular pathogenesis of listeriosis. N. Engl. J. Med. 334 , 770-776. Steffen, A., Rottner, K., Ehinger, J., Innocenti, M., Scita, G., Wehland, J., and Stradal, T.E. (2004). Sra-1 and Nap1 link Rac to actin assembly driving lamellipodia formation. EMBO J. 23 , 749-759. Steffen, A., Faix, J., Resch, G.P., Linkner, J., Wehland, J., Small, J.V., Rottner, K., and Stradal, T.E. (2006). Filopodia formation in the absence of functional WAVE- and Arp2/3-complexes. Mol. Biol. Cell 17 , 2581-2591. Stovold, C.F., Millard, T.H., and Machesky, L.M. (2005). Inclusion of Scar/WAVE3 in a similar complex to Scar/WAVE1 and 2. BMC Cell Biol. 6, 11. Stradal, T.E., and Scita, G. (2006). Protein complexes regulating Arp2/3-mediated actin assembly. Curr. Opin. Cell Biol. 18 , 4-10. Straub, F.B., and Feuer, G. (1950). Adenosine triphosphate, the functional group of actin. Kiserl Orvostud. 2, 1411-51.

Suetsugu, S., Miki, H., and Takenawa, T. (1998). The essential role of profilin in the assembly of actin for microspike formation. EMBO J. 17, 6516-6526. Suetsugu, S., Miki, H., and Takenawa, T. (2002). Spatial and temporal regulation of actin polymerization for cytoskeleton formation through Arp2/3 complex and WASP/WAVE proteins. Cell Motil. Cytoskeleton 51 , 113-122. Sun, H., Lin, K., and Yin, H.L. (1997). Gelsolin modulates phospholipase C activity in vivo through phospholipid binding. J. Cell Biol. 138 , 811-820. Swarup, R., Friml, J., Marchant, A., Ljung, K., Sandberg, G., Palme, K., and Bennett, M. (2001). Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes Dev. 15 , 2648- 2653. Szymanski, D.B., Marks, M.D., and Wick, S.M. (1999). Organized F-actin is essential for normal trichome morphogenesis in Arabidopsis. Plant Cell 11 , 2331-2347. Szymanski, D.B. (2005). Breaking the WAVE complex: the point of Arabidopsis trichomes. Curr. Opin. Plant Biol. 8, 103-112. Takenawa, T., and Miki, H. (2001). WASP and WAVE family proteins: key molecules for rapid rearrangement of cortical actin filaments and cell movement. J. Cell Sci. 114 , 1801-1809. Teale, W.D., Paponov, I.A., and Palme, K. (2006). Auxin in action: signalling, transport and the control of plant growth and development. Nat. Rev. Mol. Cell Biol. 7, 847-859. Ulmasov, T., Murfett, J., Hagen, G., and Guilfoyle, T.J. (1997). Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9, 1963-1971. Uhrig, J.F., Mutondo, M., Zimmermann, I., Deeks, M.J., Machesky, L.M., Thomas, P., Uhrig, S., Rambke, C., Hussey, P.J., and Hülskamp, M. (2007). The role of Arabidopsis SCAR genes in ARP2-ARP3-dependent cell morphogenesis. Development 134 , 967-977. Volkmann, D., and Baluska, F. (1999) Actin cytoskeleton in plants: from transport networks to signaling networks. Microsc. Res. Tech. 47 , 135-154. Wang, H.Y., Yu, Y., Chen, Z.L., and Xia, G.X. (2005). Functional characterization of Gossypium hirsutum profilin 1 gene (GhPFN1) in tobacco suspension cells. Characterization of in vivo functions of a cotton profilin gene. Planta 222 , 594-603. Wang, Q.Y., and Nick, P. (1998). The auxin response of actin is altered in the rice mutant Yin-Yang. Protoplasma 204 , 22-33. Wang, Y.S., Motes, C.M., Mohamalawari, D.R., and Blancaflor, E.B. (2004). Green fluorescent protein fusions to Arabidopsis fimbrin 1 for spatio-temporal imaging of F- actin dynamics in roots. Cell Motil. Cytoskeleton 59 , 79-93.

Welch, M.D., Mallavarapu, A., Rosenblatt, J., and Mitchison, T.J. (1997). Actin dynamics in vivo. Curr. Opin. Cell Biol. 9, 54-61. Welch, M.D., Rosenblatt, J., Skoble, J., Portnoy, D.A., and Mitchison, T.J. (1998). Interaction of human Arp2/3 complex and the Listeria monocytogenes ActA protein in actin filament nucleation. Science 281 , 105-108. White, R.G., Badelt, K., Overall, R.L., and Vesk, M. (1994). Actin associated with plasmodesmata. Protoplasma 180 , 169-184. Yamazaki, D., Oikawa, T., and Takenawa, T. (2007). Rac-WAVE-mediated actin reorganization is required for organization and maintenance of cell-cell adhesion. J. Cell Sci. 120 , 86-100. Yarar, D., To, W., Abo, A., and Welch, M.D. (1999). The Wiskott-Aldrich syndrome protein directs actin-based motility by stimulating actin nucleation with the Arp2/3 complex. Curr. Biol. 9, 555-558. Xu, J., and Scheres, B. (2005). Cell polarity: ROPing the ends together. Curr. Opin. Plant Biol. 8, 613-618. Zallen, J.A., Cohen, Y., Hudson, A.M., Cooley, L., Wieschaus, E., and Schejter, E.D. (2002). SCAR is a primary regulator of Arp2/3-dependent morphological events in Drosophila. J. Cell Biol. 156 , 689-701. Zhang, X., Dyachok, J., Krishnakumar, S., Smith, L.G., and Oppenheimer, D.G. (2005). IRREGULAR TRICHOME BRANCH1 in Arabidopsis encodes a plant homolog of the actin-related protein2/3 complex activator Scar/WAVE that regulates actin and microtubule organization. Plant Cell 17 , 2314-2326. Zhao, Y. (2008). The role of local biosynthesis of auxin and cytokinin in plant development. Curr. Opin. Cell Biol. 11 , 16-22.