Regulation of organelle dynamics by the Miro-GTPases
Christian Michael Covill-Cooke A thesis submitted to University College London for the degree of Doctor of Philosophy 14th September 2018
MRC Laboratory for Molecular Cell Biology
Department of Neuroscience, Physiology and Pharmacology
University College London
I, Christian Michael Covill-Cooke, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis.
1
Abstract
Eukaryotic cells are dependent on the ability to compartmentalise processes within membrane-bound organelles. For these organelles to function optimally within the cell they must be regulated in position, morphology and content, in response to alterations in subcellular microenvironments. The importance of maintaining organelles dynamics is emphasised by perturbations in these pathways leading to a wide range of diseases. The mitochondrial Rho-GTPases, Miro1 and Miro2, are critical regulators of many aspects of mitochondrial dynamics, including long-range, microtubule-dependent trafficking. To better understand how they carry out these functions a yeast-two hybrid with Miro1 as bait was carried out; identifying the previously undescribed protein, Fam54b, as a novel Miro interactor. Using a range of microscopy and biochemical techniques Fam54b is found to have a partial mitochondrial localisation dependent on the presence of functional GTPase activity and calcium binding of Miro1, but not Miro2. Furthermore, overexpression of Fam54b leads to defects in mitochondrial trafficking and mitochondrial morphology, providing additional mechanistic insight into how mitochondrial dynamics can be regulated through Miro1.
Alongside mitochondria as key sites of metabolism, peroxisomes are single-membrane organelles required for a multitude of processes, including fatty acid β-oxidation. Despite the importance of functional peroxisomes to cellular health, the mechanisms which underlie peroxisomal dynamics are poorly understood. This work describes that alongside its well documented localisation to mitochondria, Miro is also found to localise to peroxisomes.
Despite the role of Miro in microtubule-dependent trafficking of mitochondria, loss of Miro1 and Miro2 has only minor effects on long-range peroxisomal transport. Instead, loss of Miro leads to a reduction in shorter-range peroxisomal trafficking events and alters peroxisomal morphology. As a result, this study identifies a non-mitochondrial role for Miro, adding to the complexity of Miro function. Taken together, this study provides a broader appreciation of how
Miro regulates the dynamics of metabolic organelles.
2
Acknowledgements
Firstly, I’d like to thank Josef for his supervision and support over the last four years. Thanks to the entire Kittler lab, both past and present, I’ve had an absolute blast. I’d like to particularly acknowledge Guillermo (AKA Gmo) as you have been instrumental to everything I have done.
I once heard a saying: ‘for what is each day but a series of decisions between the right way and the easy way’. You’ve apparently taken that idea very seriously, and though you are slow, my God are you good. Keep it up mate. Huge thanks to Jack, James, Flavie and Dav. Morale is critical to Science and you guys have propped me up with it continually over the years.
Georgina has to get her own line as otherwise I seriously won’t hear the end of it. Thanks,
GK. From interview day until the very end you’ve been my colleague, my friend and general annoyance.
And finally, thank you to my family. The last ten years have been absolutely mental. Perhaps
I’ve used education as my escape from the madness but now I’m close to getting my final piece of paper certifying that I am indeed educated, I have no place to hide. Though I can’t promise I will slow down, let this serve as a written commitment that I will be in your lives as much as I possibly can. I love you all.
3
Impact statement
The work contained within this thesis contributes to our understanding of mitochondrial and peroxisomal dynamics; two processes with substantial relevance to human diseases. This work will be disseminated through publication.
4
Contents
1. Introduction ...... 8
Part I: The regulation of mitochondrial dynamics ...... 9
Structure and function of mitochondria ...... 9
Mitochondrial protein import ...... 11
Long-range mitochondrial trafficking ...... 13
Regulation of microtubule-dependent trafficking...... 17
Mitochondrial morphology: a balance of dynamics ...... 21
Mitochondrial quality control...... 25
Association of mitochondria with actin ...... 28
Multifaceted role of Miro at mitochondria ...... 29
Conclusion: Part I ...... 31
Part II: Modulating peroxisomal morphology, turnover and distribution ...... 32
Peroxisomes in health and disease ...... 32
Peroxisomal protein import and biogenesis ...... 33
Regulation of peroxisome proliferation by peroxisomal fission ...... 36
Pexophagy ...... 39
Maintenance of peroxisomal distribution through transport ...... 41
Interplay between peroxisomes and mitochondria ...... 45
Conclusion: Part II ...... 47
General conclusion and aims ...... 49
5
2. Materials and Methods ...... 50
Constructs, primers and antibodies ...... 50
Molecular biology ...... 52
Cell culture ...... 53
Biochemistry ...... 55
Fluorescence microscopy ...... 57
Analysis ...... 60
Statistical analysis ...... 61
3. Fam54b: a novel Miro interactor ...... 62
Introduction ...... 62
Results ...... 64
Fam54b is partially localised to the mitochondria in a Miro1-dependent way ...... 64
Miro is not required for mitochondrial localisation of other gene family 54 members ...... 70
Miro1 is required for the stability of Fam54b protein levels ...... 70
Recruitment of Fam54b to mitochondria requires the activity of the GTPase1 domain and
calcium binding ability of Miro1 ...... 72
Fam54b is phosphorylated on S103 and S238 ...... 75
Fam54b has a role in mitochondrial dynamics...... 80
Discussion ...... 85
4. The mitochondrial Rho-GTPases localise to peroxisomes...... 90
Introduction ...... 90
Results ...... 92
Miro1 and Miro2 localise to peroxisomes ...... 92
Miro interacts with the peroxisome-membrane protein chaperone, Pex19 ...... 92
The first GTPase domain of Miro1 modulates peroxisomal localisation ...... 96
6
Miro1 splice variants differentially localise to mitochondria and peroxisomes ...... 102
Discussion ...... 105
5. The role of Miro at peroxisomes ...... 109
Introduction ...... 109
Results ...... 110
Effect of Miro on peroxisomal distribution ...... 110
Miro does not mediate long-range peroxisomal trafficking ...... 115
Loss of Miro reduces short-range peroxisomal transport ...... 115
Miro regulates peroxisomal morphology ...... 125
Discussion ...... 129
6. Discussion ...... 137
Fam54b and mitochondrial dynamics ...... 137
A novel role for Miro in peroxisomal dynamics ...... 141
Miro as an integrator of organelle function and dynamics ...... 144
Bibliography ...... 147
7
1. Introduction
The complexity of eukaryotic life is achieved, in part, by the compartmentalisation of critical functions into membrane-bound organelles. In doing so, enzyme cascades can be separated and storage of biomolecules can occur. Furthermore, by separating cellular processes into these discrete subcellular units, more sophisticated processes can evolve. To maintain optimal organellar function in response to alterations in cellular signalling and environmental cues, organelles must be regulated in content, distribution, morphology, quality control and number (biogenesis vs. turnover). Additionally, though originally considered as separate, stand-alone entities, it is now appreciated that organelles must maintain complex cross-talk with one another to coordinate a range of cellular behaviours (Schrader et al., 2015). The significance of organelle dynamics is emphasised by perturbations in any of these homeostatic mechanisms leading to myriad pathologies affecting all aspects of physiology
(Cho et al., 2018; Liu et al., 2017; Mishra and Chan, 2014; Schrader et al., 2015; Stefan et al.,
2017). As a result, it is unsurprising that complex, inter-dependent machineries have evolved to regulate all aspects of organelle dynamics. Of particular interest to this thesis is the dynamics of mitochondria and peroxisomes; two organelles essential for many aspects of metabolism. As a result, these will be described in more depth in the pages to come.
Moreover, particular attention will be given to the mitochondria Rho-like GTPases (Miro), highlighting how this family of proteins regulates many aspects of mitochondrial dynamics and their interplay with other organelles.
Miro proteins are multi-domain in structure and ubiquitous to life
The mitochondrial Rho-GTPases (Miro) are a family of proteins anchored in the outer mitochondrial membrane (OMM) via a single transmembrane domain which have been found to be critical for mitochondrial homeostasis (Devine et al., 2016). The large N-terminal region of the protein extends into the cytoplasm and is characterised by two EF-hand domains, flanked by an N- and C-terminal GTPase domain (Fransson et al., 2003; Vlahou et al., 2011).
Identified as part of a search for small GTPases in the human genome, Miro was originally classified as an atypical Rho-like GTPase (Fransson et al., 2003). Despite this, Miro has since
8 been shown to lack conserved Rho features and therefore more likely forms its own family of
GTPases (Frederick et al., 2004). The C-terminal GTPase does however seem to share some homology to the Rheb GTPases (Klosowiak et al., 2013). Both GTPase domains contain intrinsic GTPase activity, with Vimar (RAP1GDS1) and the Vibrio cholerae protein VopE being proposed as potential guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP), respectively (Ding et al., 2016; Koshiba et al., 2011; Suzuki et al., 2014).
Calcium-coordination appears to occur via the first EF-hand domain and be critical for many of the roles of Miro (Fransson et al., 2006; Klosowiak et al., 2013; MacAskill et al., 2009;
Nemani et al., 2018). However, structural studies have found no calcium-induced conformational changes in Miro; therefore, it has been proposed that calcium-induced conformational changes likely require other factors (Klosowiak et al., 2013).
With the exception of organisms that have mitosomes or hydrogenosomes in lieu of mitochondria, one Miro orthologue is found in all eukaryotic organisms, and therefore likely arose before the divergence of eukaryotes (Vlahou et al., 2011). Moreover, in all species inspected so far for Miro function all orthologues have been found to localise to mitochondria by virtue of a C-terminal transmembrane domain (Yamaoka and Hara-Nishimura, 2014).
Mammals exhibit two Miro homologues, Miro1 and Miro2, which share a 60% sequence identity in humans (Fransson et al., 2003). The importance of Miro orthologues to mitochondrial homeostasis is emphasised not only by its presence in all mitochondria- containing life, but also the strict conservation of the structural features of Miro (Vlahou et al.,
2011). Importantly, minor deviations from this structure have only been identified in two organisms, highlighting the necessity of these structural and enzymatic features in Miro function.
Part I: The regulation of mitochondrial dynamics
Structure and function of mitochondria
Mitochondria arose from the endosymbiotic engulfment of an α-proteobacterium at the earliest stage of eukaryotic evolution (Andersson et al., 1998). Structurally, mitochondria are double membrane organelles that exhibit an intermembrane space (IMS) between the outer
9 mitochondrial membrane (OMM) and inner mitochondria membrane (IMM); alongside the mitochondrial matrix enclosed within the IMM. As sites of ATP provision by oxidative phosphorylation and β-oxidation of fatty acids, mitochondria are key metabolic organelles providing much of the ATP required by the cell. Alongside being critical for the bioenergetics of the cell, mitochondria also play a significant role in calcium buffering, lipid biosynthesis and apoptosis; thus mitochondria are essential organelles for many aspects of cellular health.
Unlike other organelles, mitochondria are semi-autonomous and therefore are produced by the proliferation of mitochondria already present. De novo mitochondrial biogenesis is not possible and therefore once lost from the cell they cannot be replaced. Consequently it is imperative to maintain the health of the mitochondrial network.
Mitochondria: the powerhouse of the cell
The best studied role of mitochondria is in the production of ATP through oxidative phosphorylation (OXPHOS) (Gautheron, 1984; Hroudová and Fišar, 2013). Though glycolysis can produce a small amount of ATP, to meet the high energetic demands of the cell pyruvate must be imported into the mitochondria and converted into acetyl-CoA. Here, through the
Kreb’s cycle (also known as the tricarboxylic acid cycle) - a series of enzymatic reactions in the mitochondrial matrix - more ATP is made alongside the reducing agents FADH2 and
NADH. These reducing agents can then be utilised by the electron transport chain (ETC) – complexes in the IMM – to generate a proton gradient across the IMM. Finally, this membrane potential is used to power the F1F0-ATP synthase. By protons passing through the F1F0-ATP synthase, ADP and inorganic phosphate are converted into ATP. Though most of the protein components required for mitochondrial ATP provision are imported from the cytoplasm into the mitochondria, mtDNA - a small, circular genome reminiscent of the mitochondria’s prokaryotic past – encodes some essential parts of the OXPHOS machinery (Chen and
Butow, 2005). mtDNA encodes for several proteins of the ETC along with the RNA components of the mitochondrial ribosome and mitochondria-tRNAs. As a result, loss of mtDNA integrity is associated with bioenergetics diseases such as Leigh syndrome, characterised by encephalopathy during childhood (Gorman et al., 2016).
10
Mitochondrial cristae formation
Another structural feature that is vital for mitochondrial function is the cristae. By folding the
IMM, the surface area can be increased and therefore adds significant OXPHOS capacity.
The folding of the IMM into cristae is promoted by the membrane potential, lipid composition of the IMM and protein composition (Khalifat et al., 2008; Kozjak-Pavlovic, 2017; Renken et al., 2002). Interestingly, the F1F0-ATP synthase is required for the maintenance of cristae shape (Paumard et al., 2002). One group of proteins that are critical for cristae formation is the mitochondrial contact site and cristae organising system (MICOS); a mega-Dalton protein complex in the IMM. In humans, MICOS is made up of Mitofilin (Mic60), MINOS1 (Mic10),
CHCHD3 (Mic19), CHCHD6 (Mic25), ApoO (Mic23), ApoOL (Mic27), Qil1 (Mic13), CHCHD10
(Mic14) and DNAJC11 and assembles at cristae junctions maintaining their shape; this promotes mtDNA stability, mitochondrial protein import and OXPHOS (Kozjak-Pavlovic,
2017). Cristae can also serve to hold the OMM and IMM in close apposition to one another.
This is promoted by the mitochondrial intermembrane space bridging complex (MIB): a bridge between the MICOS complex at the IMM and the SAM complex at the OMM. Here, it is proposed that import of proteins, and calcium, across both membranes can be coupled. As a result, is assumed that the ER can associate with mitochondria at these sites.
Mitochondrial protein import
Though mitochondria have their own genome, it encodes for less than 1% of the ~1,500 proteins that make up the mitochondrial proteome in mammals (Calvo et al., 2016). As a result, mechanisms exist to import proteins into the four subcompartments of the mitochondria: OMM, IMS, IMM and matrix (Dudek et al., 2013). Almost all mitochondrial proteins first need to transit through the OMM via the TOM complex, regardless of their ultimate destination. To do so, mitochondrial precursors bind the receptor components of the
TOM complex, Tomm20 and Tomm70 (in mammals), and pass through the pore-forming, β- barrel protein, Tomm40, to transverse the OMM (Brix et al., 1997; Künkele et al., 1998). This process is aided by the small Toms, Tomm5, Tomm6 and Tomm7 (in mammals) (Dudek et al., 2013). Proteins targeted for the OMM are thought to slide laterally out of the Tomm40 pore once their transmembrane domain is inside the OMM. Beyond the translocation across
11 the OMM, the protein must interact with one of three pathways depending on its final localisation. Firstly, the insertion of β-barrel proteins (including Tomm40, Porin and Samm50) into the OMM occurs by the SAM complex from the IMS (Becker et al., 2008). Interestingly, the presence of β-barrel proteins is a key feature of Gram-negative bacteria and has only been found in endosymbiotic organelles in eukaryotic cells (Dolezal et al., 2006). Proteins destined for insertion by the SAM complex harbour a β-signal composed of K/Q-G-φ motif. In mammals, the SAM complex is made up of Samm50 and Metaxin 1&2, with Samm50 making the pore forming region of the complex (Becker et al., 2008). Proteins that reside in the IMS are folded by the MIA pathway in an oxidative manner through their CXnC motifs (Mordas and
Tokatlidis, 2015).
To enter either the IMM or mitochondrial matrix, protein must be translocated using the TIM complex. The canonical targeting of proteins to these subcompartments relies on a cleavable,
N-terminal amphipathic helix of the nascent polypeptide (George et al., 1998). Given that the
OMM and IMM are held in close apposition by the MIB, the preprotein destined for the IMM or matrix is already close to the TIM complex immediately following translocation across the
OMM. In fact, the TOM and TIM complexes have been found to form a supercomplex
(Chacinska et al., 2010). Both Tim17 and Tim50 are thought to regulate the pore-forming region of Tim23 (Dudek et al., 2013). The energy provided by the membrane potential across the IMM is sufficient for insertion for the polypeptide into the pore of Tim23 (van der Laan et al., 2007). As a result, protein import across the IMM is dependent on the membrane potential generated by the electron transport chain. Once inside the pore, IMM proteins can laterally transverse into the IMM by their transmembrane domain. The final translocation step for proteins destined for the matrix, on the other hand, is carried out in an ATP-dependent way by mtHsp70 in the PAM complex (Dudek et al., 2013). Once in the matrix the matrix-targeting pro-sequence is cleaved by matrix proteases.
Targeting of tail-anchored proteins to the OMM
As many of the proteins critical for mitochondrial dynamics are tail-anchored, including Miro, this pathway of entry into organelles will be briefly discussed. Interestingly the insertion of tail- anchored proteins into membranes only occurs at the ER, mitochondria and peroxisomes. As
12 the transmembrane of tail-anchored proteins is at the C-terminus it is the last part of the newly synthesised protein to exit the ribosome. As a result, targeting of the nascent polypeptide must occur post-translationally. Though much of the mechanism for tail-anchored protein biogenesis is yet to be understood, what is clear is that insertion of tail-anchored proteins does not require ATP (Borgese et al., 2007). In fact, it is proposed that tail-anchored proteins can insert spontaneously into a range of phospholipid bilayers and therefore the chaperone- targeting to the correct organelle is the key step in their biogenesis (Borgese and Fasana,
2011; Brambillasca et al., 2006). Analysis of the amino acid sequences of tail-anchored proteins found that the biophysical properties of the transmembrane domain and C-terminal amino acids are a strong predictor of the subcellular localisation of tail-anchored proteins.
Targeting to the ER is predicted to require highly hydrophobic transmembrane domains coupled with non-charged C-termini (Rao et al., 2016). Whereas, proteins targeted to mitochondria only, mitochondria and peroxisomes or peroxisomes only are targeted by exhibiting increasingly more basic C-termini (Costello et al., 2017). Furthermore, proteins targeted for the OMM only are likely to have less hydrophobic transmembrane domains. The best-described mechanism is the GET/Bag6/TRC40 pathway which inserts tail-anchored proteins, post-translationally into the ER, and therefore is required for the biogenesis of tail- anchored proteins in the vesicular trafficking pathways in the cell (Hegde and Keenan, 2011).
Peroxisomal tail-anchored proteins are targeted by binding the cytosolic chaperone, Pex19
(Jones et al., 2004). Unlike, the ER and peroxisomes, less is known about the chaperones that target tail-anchored proteins to the OMM. To date, there are hints that OMM-targeting occurs by HSC70 (Hspa8) in mammals and ssc1/2 in yeast (Borgese and Fasana, 2011;
Borgese et al., 2007; Cichocki et al., 2018; Kemper et al., 2008). As a result, little is known about the import of Miro into the OMM.
Long-range mitochondrial trafficking
Fast, bi-directional, long-range trafficking of subcellular components is achieved through coupling to the microtubule cytoskeleton by molecular motors (van Bergeijk et al., 2016).
More specifically, plus-end and minus-end mediated transport is predominantly achieved by linking the cargo to either kinesin or dynein, respectively. Mitochondria exhibit both types of movement and therefore require the recruitment of both motors to the OMM. Much of the
13 fundamental machinery for microtubule-dependent mitochondrial trafficking was first established in Drosophila, whereby loss of dmiro (Miro1/2 in mammals), milton (Trak1/2 in mammals) and khc (KIF5A, B & C in mammals) in neurons led to perinuclear accumulations of mitochondria (Guo et al., 2005; Hurd and Saxton, 1996; Stowers et al., 2002). Furthermore, they have since been shown to be critical in mammalian cells (López-Doménech et al., 2016;
Nguyen et al., 2014; Tanaka et al., 1998; van Spronsen et al., 2013). Importantly, all three of these proteins have been shown to interact with one another, forming the core machinery to elicit mitochondrial transport (Glater et al., 2006; MacAskill et al., 2009; Macaskill et al., 2009; van Spronsen et al., 2013). The involvement of dynein in mitochondrial transport was originally inferred from loss of Miro and Trak reducing retrograde transport. Furthermore, dynein has been shown to interact with both Miro/Trak and inhibition of the dynein/dynactin complex is known to reduce mitochondrial trafficking (Russo et al., 2009; van Spronsen et al.,
2013). Despite this, much of the molecular mechanisms modulating the activity of dynein at the mitochondria have remained understudied. For completeness it should be noted that there is evidence that KIF1Bα modulates anterograde trafficking in neurons (Nangaku et al., 1994).
The importance of functional mitochondrial trafficking through this Miro/Trak machinery is emphasised by global knockout of many of these genes being lethal.
The kinesin-1 family are the main motor proteins mediating anterograde mitochondrial transport (Macaskill et al., 2009; Tanaka et al., 1998; Wang and Schwarz, 2009). As the kinesin-1 family is critical for the long-range transport of several cargoes within the cell, they are not directly targeted to the mitochondria. Instead, to associate with the mitochondria they interact with the N-terminal region of the Trak family (Glater et al., 2006; Stowers et al., 2002).
This family of proteins share some homology in sequences with myosin/tropomyosins/paramyosins as well as significant similarity to the trafficking protein
HAP-1 (Stowers et al., 2002). Milton, the single fly Trak homologue, interacts with khc recruiting it to the OMM in a KLC-independent way (Glater et al., 2006). Importantly, overexpression of Milton has been shown to recruit more khc to mitochondria (Glater et al.,
2006). In the case of Drosophila, it is proposed that Milton does not interact with dynein
(Stowers et al., 2002). Functionally, Milton overexpression leads to a perinuclear collapse of the mitochondrial network; however, when overexpressed with khc it promotes the peripheral
14 accumulation of mitochondria (Glater et al., 2006; López-Doménech et al., 2018). Mammals, on the other hand, have two orthologues of Trak, Trak1 and Trak2, showing 30% and 28% overall sequence identity with Milton (Brickley and Stephenson, 2011; Stowers et al., 2002).
Interestingly, in the context of neuronal trafficking, it has been shown that Trak1 and Trak2 predominantly localise to the axon and dendrites, respectively, by virtue of their differential binding to kinesin-1 (van Spronsen et al., 2013). Trak2 predominantly exists in a closed conformation which is not permissive of kinesin-1 binding, resulting in Trak2 binding to dynein; whereas, Trak1 exhibits a more open conformation and therefore can bind to kinesin-
1 (van Spronsen et al., 2013). This differential binding to kinesin-1 likely manifests in a dendritic localisation of Trak2 and axonal targeting of Trak1 as it is proposed that kinesin-1- dependent trafficking promotes an axonal localisation (Kapitein et al., 2010; Tas et al., 2017).
Despite this, it is likely that kinesin-1 still has a role in dendritic mitochondrial trafficking as blocking kinesin-1 using an antibody halts mitochondrial motility in both the dendrites and axon (Macaskill et al., 2009).
None of the Trak homologues contain a transmembrane domain or predicted mitochondrial- targeting sequences; consequently how does Trak associate with the OMM? Anchored in the
OMM, alongside early descriptions of a role in mitochondrial transport, Miro is an obvious candidate for Trak recruitment to the mitochondria. In fact, Miro has been shown to interact with both the Traks and kinesin-1 (MacAskill et al., 2009; Macaskill et al., 2009). In flies, loss of dmiro has been shown to cause a significant reduction in both anterograde and retrograde mitochondrial transport (Russo et al., 2009). There are two Miro genes in mammals, Miro1 and Miro2; however, only knockout of Miro1 appears to abolish microtubule-dependent mitochondrial motility (López-Doménech et al., 2018, 2016). With Miro being embedded in the
OMM and able to bind Trak and kinesin, early models proposed that mitochondria can associate with microtubules by Miro recruiting Trak and kinesin to the mitochondria (Figure
1.1) (Birsa et al., 2013; Schwarz, 2013). Indeed, overexpression of Miro1 can recruit more
Trak2 to mitochondria (MacAskill et al., 2009). Furthermore, overexpression of dmiro lacking its C-terminus is localised to the cytoplasm, where it recruits Milton from the mitochondria
(Glater et al., 2006). Therefore, it was widely accepted that mitochondrial trafficking could be
15 elicited or arrested by simply coupling and uncoupling these interactions, respectively. Further evidence for this model has been found in the case of mitochondrial transport arresting during
Figure 1.1: Microtubule-dependent trafficking of mitochondria. Miro1/2, Trak1/2, kinesin- 1 and dynein all interact to form the core machinery for long-range, microtubule dependent mitochondrial trafficking.
16 rises in intracellular calcium. Mechanistically, calcium binds to the EF-hand domain of Miro1, leading to a proposed conformational change in Miro that uncouples the mitochondria from the microtubules (Macaskill et al., 2009; Wang and Schwarz, 2009). Two competing models suggested that this occurs by Miro1 uncoupling from kinesin or by kinesin itself dissociation from the microtubules, remaining bound to Miro. Though these models contradict on the exact mechanism of calcium-induced mitochondrial arrest, both are predicated on the idea that Miro is required to establish the mitochondrial pool of KIF5.
Despite the evidence for the paradigm described above, recent work has shown that when both Miro1 and Miro2 are knocked out the trafficking machinery is still able to associate with the mitochondria to the same extent as wild-type cells (López-Doménech et al., 2018). This might be explained by Trak being able to interact with mitofusin, another OMM protein, even in the absence of Miro (Lee et al., 2018; López-Doménech et al., 2018). Moreover, overexpression of Trak1 with KIF5C could still peripherally distribute mitochondria in Miro1/2 knockout cells, emphasising that Miro is not required for motor recruitment to the mitochondria and for microtubule-dependent trafficking to occur (López-Doménech et al.,
2018). Therefore, it is more likely that Miro proteins regulate the activity of the trafficking machinery as opposed to recruiting it. This is further supported by KO of Miro in all models still having some motile mitochondria (López-Doménech et al., 2018, 2016; Russo et al.,
2009). It is therefore possible that the perinuclear distribution of mitochondria observed upon loss of Miro is not just a collapse of the mitochondria, or an inability to traffic mitochondria away, but could also have an active component where mitochondrial trafficking is dysregulated, leading to continual transport towards the microtubule organising centre.
Regulation of microtubule-dependent trafficking
Establishing and maintaining an optimal mitochondrial distribution within a cell does not simply require the ability to couple to the microtubules via the mechanism described above.
Instead, mitochondria must be selectively trafficked and anchored in response to the metabolic demands of the cell. Therefore, what are the regulatory mechanisms for controlling mitochondrial motility? Unsurprisingly, many of the cues that impact upon mitochondrial transport are coupled to the functions of mitochondria, including calcium buffering and ATP
17 provision (Sheng, 2017). Though the mechanism of calcium-induced stopping was described above, it is worth briefly elaborating on the function of arresting mitochondria at sites of high calcium. Firstly, mitochondria are able to buffer calcium modulating calcium signalling and helping to prevent excitotoxicity (Rizzuto et al., 2012). Secondly, mitochondria provide energy for ion pumps to return calcium concentrations back to their basal levels. The importance of mitochondria arresting at sites of high calcium has been best shown at the presynapse, whereby mitochondria can modulate the presynaptic calcium response (Sun et al., 2013;
Vaccaro et al., 2017).
As the main source of ATP, mitochondria need to be localised to areas of high energetic demand. Indeed, local ATP depletion significantly reduces mitochondrial motility (Mironov,
2007). As a result, another mechanism by which mitochondrial transport can be regulated is by decreases in the ATP:ADP ratio. Increases in this ratio are sensed by ADP and AMP binding the regulatory subunits of AMPK: a serine/threonine kinase that phosphorylates a host of proteins critical for cell metabolism to rescue the availability of ATP (Carling, 2017).
Two processes where AMPK signalling has been shown to be critical for cellular functions are in axonal branching and cell migration (Courchet et al., 2013; Cunniff et al., 2016; Tao et al.,
2014). Interestingly, Miro1 has been shown to aid cell migration through its role in mitochondrial trafficking and distribution, preserving the ATP concentration at the leading edge of the cell (Schuler et al., 2017). Unlike calcium, however, the exact targets for AMPK signalling in mitochondrial trafficking are not known. Further to the increases in cytosolic calcium and AMPK activity, cellular stress influence mitochondrial trafficking and distribution.
The best described are reactive oxygen species (ROS) and loss of membrane potential across the IMM. ROS has been shown to halt mitochondrial motility in vitro and in vivo, through activation of the JNK kinase cascade pathway (Debattisti et al., 2017; Liao et al.,
2017). Furthermore, proteotoxic stress following blockage of the proteasome also leads to alterations in mitochondrial distribution in a Miro2-dependent manner by activation of the Nrf2 oxidative stress sensing pathway (O’Mealey et al., 2017).
Along with the two calcium-binding EF-hand domains, Miro also contains two GTPase domains (Fransson et al., 2003). In trying to elucidating the role of these GTPase domains,
18 point mutations in both the first and second GTPase have been described based on those in the Ras-family of small GTPases. For human Miro1, these are P13V and T18N in the first
GTPase domain, leading to a predicted constitutively active and dominant negative GTPase domain, respectively; and K427V and S432N leading to a predicted constitutively active and dominant negative activity of the second GTPase domain (Fransson et al., 2003, 2006). Early descriptions of the first GTPase mutants showed that overexpression of both the P13V and
T18N mutants led to alterations in mitochondrial distributions leading to a more clustered phenotype in comparison to wild-type Miro1 (Fransson et al., 2003, 2006). In agreement with this, Babic et al. (2015) found that the functional activity of the first GTPase is required for the viability in Drosophila (A20V and T25N being constitutively active and dominant negative, respectively). Furthermore, expressing T25N in a dmiro knockout background did not rescue anterograde mitochondrial transport leading to a dramatic loss of mitochondrial from presynaptic boutons (Babic et al., 2015). The activity of the second GTPase domain does not appear to influence mitochondrial distribution or trafficking. Therefore, functional enzymatic activity of the first GTPase domain appears to be critical for mitochondrial trafficking.
Protein-protein interactions
As the role of the Miro/Trak/KIF complex for long-range mitochondrial trafficking is well characterised, efforts have been made to study the influence of protein-interactions with this core machinery. As a result, a range of proteins have been described that can modulate the mitochondrial transport through this complex: including DISC1, ARMCX1/3, CENP-F, OGT and syntaphilin; which regulate trafficking in a range of cellular contexts (Cartoni et al., 2016;
Kanfer et al., 2015; Kang et al., 2008; López-Doménech et al., 2012; Norkett et al., 2016;
Pekkurnaz et al., 2014). As the mechanism of action of OGT and syntaphilin are best known, they will be described here. Firstly, the enzyme OGT (O-GlcNAc transferase) has long been known to interact with Trak (Iyer and Hart, 2003; Iyer et al., 2003). Coupled with a low
ATP:ADP ratio decreasing mitochondrial transport, the availability of glucose has also been shown to modulate mitochondrial trafficking through Trak. In neurons, high glucose concentrations (~30 mM) reduce mitochondrial trafficking. Mechanistically, glucose provides a substrate for OGT to O-GlcNAylate Milton, leading to an arrest in mitochondrial motility
19
(Pekkurnaz et al., 2014). As a result, mitochondria can be situated in areas of high glucose availability, allowing for efficient ATP production. Currently, it is unclear whether or not this mechanism has any specificity for Trak1 or Trak2 in mammalian cells.
Another proposed way to regulate mitochondrial trafficking is by anchoring mitochondria to the cytoskeleton. The best characterised mitochondrial anchor is the axon-targeted protein syntaphilin (Sheng, 2017). Importantly, syntaphilin does not localise to all mitochondria but rather only to stationary mitochondria (Kang et al., 2008). It has been shown that it competes with Trak for kinesin-1 during neuronal activity to anchor mitochondria to the microtubules
(Chen and Sheng, 2013). Furthermore, syntaphilin has been shown to interact with the dynein light chain, LC8, also leading to docking of mitochondria on the microtubules (Chen et al.,
2009). As a result, arrest of mitochondrial transport can be achieved by recruitment of syntaphilin to the mitochondria, and often occurs at the presynapse. This docking of mitochondria at the presynapse is shown to regulate the strength of neurotransmission (Kang et al., 2008; Sun et al., 2013). Interestingly, the proportion of mitochondria that are motile at any given point, decreases throughout development, likely because mitochondria have reached an optimal position and therefore any movement can help modulate neuronal signalling. Extensive work in ‘young’ neurons in culture (typically 7-10 days in vitro obtained from embryonic rodent brains) has shown that approximately 30% of mitochondria are motile in the axon (Kang et al., 2008; López-Doménech et al., 2016; Wang and Schwarz, 2009).
Work in more mature neurons in culture and in vivo imaging in adult brains has shown that this proportion decreases to around 1-5% (Faits et al., 2016; Lewis et al., 2016; Moutaux et al., 2018; Smit-Rigter et al., 2016). Interestingly, this reduction in motile mitochondria correlates with an increase in syntaphilin expression throughout development and therefore might be key to the reduction of mitochondrial motility with age (Sun et al., 2013). Despite many aspects of how mitochondrial trafficking is regulated is yet to be ascertained, studying protein-protein interactions with the core trafficking complex has led to many important insights. This approach may therefore continue to add further detail to our current understanding of this critical cellular process.
20
Mitochondrial morphology: a balance of dynamics
Mitochondria exist as a dynamic network, constantly undergoing alterations to their size and shape. This is predominantly achieved through a balance of two processes: mitochondrial fusion and fission. These act antagonistically where the morphology of the mitochondrial network can be rapidly altered by modulating the extent of either process. The purpose of regulating mitochondrial morphology through fission and fusion appears to be multifaceted and required for a wide range of processes (Otera et al., 2013). For example, by continuously cycling through fission and fusion of individual mitochondria it is possible to dilute mitochondrial damage and mix mitochondrial contents (Chen et al., 2005). Furthermore, mitochondrial fission can segregate heavily damaged parts of the mitochondrial network for degradation by mitophagy (covered later). Mitochondrial fission has also been observed to be important for many fundamental cell biological processes, such as: mitosis and apoptosis
(Parone and Martinou, 2006; Xu et al., 2016). Given how critical these processes are to development and the maintenance of cellular health, a wide range of diseases have been found associated with mutations in both the fission/fusion machinery. Mechanistically, both fission and fusion are carried out by a family of dynamin-like GTPases localised to the outer and inner mitochondria membranes (Figure 1.2).
Mitochondrial fusion
Mitochondrial fusion is dependent on two sets of GTPases, one for the OMM and one for the
IMM. In mammals the two homologues, Mfn1 and Mfn2, mediate the fusion of the OMM. As a result, loss of either Mfn1 or Mfn2 leads to mitochondrial fragmentation, as mitochondrial fission is no longer antagonised (Chen et al., 2003). The importance of Mfn1/2 and indeed mitochondrial fusion to cell health is emphasised by constitutive knockout of Mfn1 or Mfn2 leading to embryonic lethality (Chen et al., 2003). Furthermore, mutations in Mfn2 are associated with the neurodegenerative disorder, Marie-Charcot-Tooth Type 2A (Rocha et al.,
2018). Current models propose that the Mfn1/2 cause mitochondrial fusion by dimerising in trans from opposing mitochondrial membranes, followed by the fusion of the membrane via a
SNARE-like mechanism (Koshiba et al., 2004). The fusion of the OMM is also promoted by the enzyme mitoPLD, which hydrolyses cardiolipin into phosphatidic acid, leading to a
21
Figure 1.2: The family of GTPases modulating mitochondrial morphology. Mitochondrial fission requires the recruitment of the cytosolic GTPases, Drp1 and dynamin-2. Mitochondrial fusion, on the other hand uses Mfn1/2 for the outer mitochondrial membrane fusion and Opa1 for the inner mitochondrial membrane fusion; all of which are localised to the mitochondria.
22 fusogenic lipid composition of the OMM (Choi et al., 2006; Huang et al., 2011). This process is aided by mitoguardin (Zhang et al., 2016). IMM fusion on the other hand is carried out by a single protein, Opa1. As a result of differential splicing and post-translational processing by
Yme1l and Oma1 Opa1 exists in many isoforms, though often they are simplly characterised as long and short isoforms (Anand et al., 2014; MacVicar and Langer, 2016). Alongside the role for Opa1 in IMM fusion, Opa1 also has a role in the maintenance of cristae (Patten et al.,
2014). Though there does seem to be preference for action with the different forms of Opa1 all induce IMM fusion and maintain the integrity of the cristae to some extent (Del Dotto et al.,
2017).
Mitochondrial fusion is rapidly modulated by post-translational modifications. As OMM- localised proteins critical for mitochondrial fusion, Mfn1/2 are targets of several signalling pathways. For example, the mitochondrially-localised E3-ligases, MARCH5 and Mul1 have been shown to ubiquitinate Mfn1/2, leading to degradation followed by mitochondrial fragmentation (Park and Cho, 2012; Tang et al., 2015; Yun et al., 2014). Moreover, Parkin ubiquitination following mitochondrial damage leads to rapid Mfn1/2 retrotranslocation from the OMM by VCP/p97 and subsequent degradation by the proteasome (Gegg et al., 2010;
Tanaka et al., 2010; Xu et al., 2011). As a result, mitochondrial fusion dynamics can be rapidly modulated simply by the presence of Mfn1/2 at OMM.
Mitochondrial fission
The current paradigm for mitochondrial fission is a multi-step process requiring the coordination of several proteins to elicit scission of both the OMM and IMM simultaneously.
First an ER tubule makes contact with the mitochondria at the prospective site of scission
(Friedman et al., 2011). Here, actin has also been found to polymerise dependent on INF2 and proposed to act as a force generation step to decrease the width of the mitochondria
(Korobova et al., 2013). Next Drp1 is recruited from the cytoplasm to the OMM by one of a number of OMM proteins, including: Mff, hFis1, MiD49 and MiD51 (van der Bliek et al., 2013).
The necessity of Drp1 in mitochondrial fission is clear by KO leading to a hyperfused mitochondrial network (Wakabayashi et al., 2009). The contribution of each of the Drp1 receptors in Drp1 recruitment is debated and may be dependent on the cellular context (van
23 der Bliek et al., 2013). Early models proposed that Drp1 would then oligomerise at the OMM followed by GTP hydrolysis generating the force to cause mitochondrial membrane scission, akin to the model of Dynamin. Structural studies of the Drp1, however, showed that mitochondria are too thick for the oligomerisation of Drp1 and that the diameter of the fully closed state of the Drp1 oligomer would be 120 nm, and predicted to not be closed enough for full scission (Ingerman et al., 2005). To elicit the final scission step dynamin-2 is required, providing the necessary force for mitochondrial fission (J. E. Lee et al., 2016).
Current descriptions of how mitochondrial fission is regulated centre around the extent of
Drp1 recruitment and activity at the OMM. Central to this is the phosphorylation of Drp1.
Through phosphorylation of S637 by PKA, Drp1-dependent fission is inactivated (Chang and
Blackstone, 2007). In contrast, phosphorylation at S616 by PKC-δ or CaMK-Ia promotes Drp1 recruitment by its receptors and therefore increases association with the mitochondrial membrane (Han et al., 2008; Qi et al., 2011). Another mechanism of modulating Drp1 is through the mitochondrially-localised SUMO- and ubiquitin E3 ligase, Mul1. Through
SUMOylation, Drp1 levels are stabilised, perhaps by competing against the degradative ubiquitination of certain lysine residues, thus promoting mitochondrial fission (Braschi et al.,
2009; Prudent et al., 2015). Finally, phosphorylation of Mfn by AMPK has also been shown to promote mitochondrial fission via recruiting more Drp1 to the mitochondria (Toyama et al.,
2016). Therefore like mitochondrial fusion, fission can be modulated by a host of post- translational modifications to both Drp1 and its receptors.
Link with other forms of mitochondrial dynamics
Mitochondrial trafficking and morphology appear to be intimately linked. Early work on Miro in a range of species has found that Miro promotes a more interconnected and tubular network of mitochondria (Fransson et al., 2003; Frederick et al., 2004; Saotome et al., 2008). This, like mitochondrial trafficking, also appears to be dependent on functional enzymatic activity of the first GTPase domain of Miro. Reports have also suggested that trafficking itself may promote fusion by bringing the two individual mitochondria into close proximity for fusion (Cagalinec et al., 2013). Efficient mitochondrial trafficking has been shown to be dependent on Mfn (Misko et al., 2010). Indeed, Miro and Mfn can physically interact. Alongside the mechanisms
24 described above, it should be noted that it is proposed that mitochondria can also undergo a shape transition, independent of fission and fusion, in response to rises in intracellular calcium (Nemani et al., 2018). This process is suggested as being critical on the calcium binding of the first EF-hand of Miro1. All in all, mitochondrial morphology is altered and maintained through a balance of GTPase at the OMM and IMM and can be rapidly altered in response to cellular signalling.
Mitochondrial quality control
Mitochondria are fundamental to cell health as they provide ATP and other key metabolites; however when damaged, mitochondria can produce large amounts of ROS species which, if left unchecked lead to apoptosis. As a result, a range of mitochondrial quality control pathways have evolved to deal with mitochondrial stress, ranging from local protein degradation up to degradation of entire mitochondria (Campello et al., 2014; Covill-Cooke et al., 2017; Pickles et al., 2018). Alongside establishing an optimal distribution and morphology of the mitochondrial network, trafficking and fission/fusion are also important quality control mechanisms. In the case of mild stress, mitochondrial fission and fusion can mix and dilute mitochondrial damage to preserve mitochondrial function (Otera et al., 2013). Likewise, mitochondrial trafficking can also be utilised as a quality control mechanism. During mitochondrial stress, retrograde trafficking of mitochondria increases (Lin et al., 2017; Miller and Sheetz, 2004). This increase in trafficking is proposed as being an early response in an attempt to preserve mitochondrial integrity. In fact, increasing the number of moving mitochondria by overexpressing Miro1 was shown to preserve the membrane potential across the IMM during mild mitochondrial stress (Lin et al., 2017). The importance of mitochondrial dynamics in preserving mitochondrial integrity is further emphasised by loss of members of the trafficking or fission/fusion machinery negatively impacting mitochondrial function and health (Chen et al., 2005; Trevisan et al., 2018; Wakabayashi et al., 2009; Yamada et al.,
2018).
Though mitochondrial dynamics are an effective mitochondrial quality control mechanism, if damage is too extensive or persistent, mitochondria must be degraded by the lysosome through a specialised form of autophagy called mitophagy. The most extensively
25 characterised pathway is PINK1/Parkin-mediated mitophagy (Nguyen et al., 2016). Originally identified as genes associated with familial Parkinson’s disease (PD), PINK1 (PARK6) and
Parkin (PARK2) are now known as important mediators of the clearance of mitochondria following mitochondrial damage (Kitada et al., 1998; Valente et al., 2004). Under basal conditions, PINK1 – a serine/threonine kinase - is imported into the mitochondrial matrix via the TOM and TIM complex where it is degraded by mitochondrial proteases (Greene et al.,
2012; Jin et al., 2010; Lazarou et al., 2012). However, as import through the TIM complex is dependent on the membrane potential across the IMM, upon mitochondrial damage and depolarisation, PINK1 accumulates on the OMM (Jin et al., 2010). Here, PINK1 phosphorylates ubiquitin at S65 leading the recruitment and activation of Parkin – a ubiquitin
E3-ligase – to the OMM (Kane et al., 2014; Kazlauskaite et al., 2014; Koyano et al., 2014).
PINK1 also phosphorylates Parkin in its ubiquitin-like domain at the same conserved residue as ubiquitin (Kazlauskaite et al., 2015; Wauer et al., 2015). Once activated, Parkin ubiquitinates a wide range of proteins at the OMM, resulting in large-scale ubiquitination of the damaged mitochondrion (Sarraf et al., 2013).
The effect of mitochondrial ubiquitination by Parkin is two-fold. Firstly, by ubiquitinating proteins critical for mitochondrial dynamics and function, such as Miro1/2, Mfn1/2, VDAC1 and Tom20, mitochondria can be physically and functionally segregated from the rest of the mitochondrial network. The best characterised of these targets are Miro1/2 and Mfn1/2.
Ubiquitination of these targets leads to proteasomal degradation (Birsa et al., 2014; Tanaka et al., 2010; Xu et al., 2011). By doing so, mitochondrial motility arrests alongside mitochondrial fragmentation allowing for easier degradation of the damaged mitochondrion (Ashrafi et al.,
2014; Deng et al., 2008; Wang et al., 2011). The importance of this step is further supported by loss of Miro or Mfn through RNAi or knockout in PD-associated mutations rescuing mitophagy and PD-associated phenotypes such as dopaminergic neuronal loss and motor coordination (Celardo et al., 2016; Gautier et al., 2016; Hsieh et al., 2016; Poole et al., 2008;
Yun et al., 2014). Along with being important targets for Parkin ubiquitination both Miro1 and
Mfn2 are required for efficient Parkin recruitment to the OMM of damaged mitochondria (Birsa et al., 2014; Chen and Dorn, 2013; Shlevkov et al., 2016). This is proposed as being dependent on the phosphorylation of both Miro1 and Mfn2. As both the presence at the OMM
26 and the resulting degradation of Miro and Mfn are required for efficient mitochondrial clearance it is likely that the presence of Miro1/2 and Mfn1/2 at the mitochondria must be temporally regulated depending on the degree of mitochondrial damage and stage of mitophagy.
The second effect of mitochondrial ubiquitination is that the autophagosomal machinery is engaged. By recruitment of the autophagy receptors Optineurin and NDP52 to the ubiquitinated mitochondrial proteins, LC3 can associate with the damaged mitochondrion, promoting autophagosome formation (Lazarou et al., 2015). Once inside the autophagosome, it fuses with the lysosome for degradation and recycling of the contents. To modulate the extent of mitophagy and prevent degradation of healthy organelles both deubiquitinases
(DUBs) and a phosphatase have been found to act in antagonism to the activity of PINK1 and
Parkin at the mitochondria. The DUBs USP8, USP15 and USP30 have all been shown to negatively regulate mitophagy by the removal of ubiquitin at the mitochondria (Bingol et al.,
2014; Cornelissen et al., 2014; Cunningham et al., 2015; Durcan et al., 2014; Wang et al.,
2015). Furthermore, recently a long isoform of the lipid and protein phosphatase PTEN
(PTEN-L) was shown to dephosphorylate ubiquitin (Wang et al., 2018). As phospho-ubiquitin is required for Parkin recruitment and activation, PTEN-L can prevent mitophagic clearance of mitochondria by halting Parkin activity and subsequent mitochondrial ubiquitination.
Though PINK1/Parkin-mediated mitophagy is the best characterised pathway for lysosomal degradation of damaged mitochondria, several studies have described Parkin-independent mitophagy pathways. For example, loss of Drp1 has been shown to stimulate ubiquitination and subsequent recruitment of LC3 to the mitochondria. Here, the ubiquitin E3 ligase has been shown to be Rbx1 (Yamada et al., 2018). Other proteins involved in Parkin-independent mitophagy include: AMBRA1, ARIH1, BNIP3 and NiX (Strappazzon et al., 2015; Villa et al.,
2017; Zhang and Ney, 2009). Finally, it is proposed that mitochondria can reach the lysosome by ESCRT-mediated uptake into the endosomes, in a manner independent of Parkin and indeed the autophagosome machinery (Hammerling et al., 2017). For completeness, one further quality control mechanism is the production of mitochondria-derived vesicles (MDVs)
(Covill-Cooke et al., 2017). These vesicles have been shown to be heterogeneous in content
27 and biogenesis, exhibiting both a single and a double membrane and around 150 nm in size.
Their biogenesis is independent of the Drp1-dependent fission machinery (Neuspiel et al.,
2008; Soubannier et al., 2012a). Though the biogenesis of a subset of MDVs is dependent on
Parkin, this does not appear to be dependent on the enzyme activity of Parkin and therefore independent of ubiquitin (McLelland et al., 2014). Functionally, the subset destined for the lysosome selectively accumulates oxidised proteins therefore segregating them from the mitochondria (McLelland et al., 2016; Soubannier et al., 2012a, 2012b). Therefore, MDVs may serve as an early mechanism to maintain mitochondrial homeostasis before the engagement of the autophagosomal pathway.
Association of mitochondria with actin
Alongside the extensive interactions of the mitochondrial network with the microtubule cytoskeleton, mitochondria have been shown to associate with the actin-myosin cytoskeleton to regulate many aspects of mitochondrial dynamics. Early work suggested that mitochondria were motile on the actin cytoskeleton in a manner distinct from microtubule-dependent trafficking (Morris and Hollenbeck, 1995). This motility has been found to lead to short-range trafficking events and be dependent on mitochondrially-anchored myosin, myosin-19
(Quintero et al., 2009). By mediating short-range displacement of mitochondria through its plus-end directed activity, myosin-19 has been found to be critical for the trafficking of mitochondria into stress-induced filopodia (Shneyer et al., 2017, 2016; Ušaj and Henn, 2017).
Furthermore, myosin-19 is critical for the symmetric segregation of mitochondria during mitosis (Rohn et al., 2014). Interestingly, Miro has been shown to be essential for the recruitment and stabilisation of myosin-19 at the mitochondria (López-Doménech et al.,
2018). In fact, double knockout of Miro1 and Miro2 leads to a complete loss of myosin-19 from the mitochondria. In conjunction with the interaction of Miro with CENP-F, Miro likely couples both microtubule- and actin-dependent mitochondrial transport for optimal mitochondrial distribution during mitosis (Kanfer et al., 2015; López-Doménech et al., 2018;
Rohn et al., 2014). Together with eliciting short-range motility of mitochondria, the actin cytoskeleton may also aid in the docking of mitochondria, thus reducing mitochondrial motility.
In Drosophila motor neuron axons knockdown of myosin-5 and myosin-6 increases the number and velocity of mitochondrial trafficking events (Pathak et al., 2010). Despite the
28 effect of knocking down these myosins, little is known mechanistically about their role in mitochondrial trafficking and the extent of mitochondrial docking on F-actin.
Recently, a role for actin cages around the mitochondria has been described in modulating aspects of mitochondrial homeostasis. Strikingly, F-actin polymerisation was shown to occur in cyclical waves, forming actin cages around the mitochondria as the wave passed (Moore et al., 2016). In doing so, mitochondria were shown to undergo fission and then subsequent fusion after the actin cages had depolymerised. The significance of this it thought to be the regular mixing of mitochondrial contents to promote exchange of materials and dilution of mitochondrial damage, thus maintaining mitochondrial health. Another type of actin cage is observed during mitochondrial damage and Parkin-mediated mitophagy. Here, actin and myosin-6 cages form around damaged mitochondria, promoting the segregation from the rest of the healthy mitochondrial network (Kruppa et al., 2018). This is aids in the autophagic clearance of the damaged mitochondria. Interestingly, myosin-19 is also regulated during mitophagy and therefore may also be critical for the efficient clearance of damaged mitochondria (López-Doménech et al., 2018). As Miro is an early target for Parkin-mediated ubiquitin and degradation, once Miro has been lost from the mitochondria myosin-19 has been shown to be degraded. Therefore, the presence of different myosins at the mitochondria could be a way of modulating mitochondrial health.
Multifaceted role of Miro at mitochondria
By interacting with kinesin-1 and myosin-19, Miro is critical for the coordination of mitochondrial trafficking on both the microtubule and actin cytoskeleton (Birsa et al., 2013;
López-Doménech et al., 2018). Consequently, the overwhelming majority of work has studied the role of Miro in mitochondrial trafficking. Importantly, however, a Miro orthologue has been found in essentially all eukaryotic species with very little deviation in the presence of the key domains (Vlahou et al., 2011). As long-range, microtubule-dependent mitochondrial transport is not present in many eukaryotic species, it is more likely that the microtubule-dependent trafficking apparatus evolved to use Miro, as opposed to Miro arising as part of this machinery. Interestingly, in lower eukaryotes Miro has been shown to modulate mitochondrial morphology and OXPHOS activity independent from a trafficking role (Frederick et al., 2004;
29
Sørmo et al., 2011; Vlahou et al., 2011; Yamaoka and Hara-Nishimura, 2014). As trafficking, fission/fusion and mitophagy, have significant interplay it is perhaps unsurprising that Miro has a significant role in these processes. Indeed, Vimar, a proposed GEF for dmiro, not only modulates mitochondrial trafficking in a dmiro-dependent manner but also calcium-induced mitochondrial fission (Ding et al., 2016). Furthermore, Miro is an important target for Parkin during mitophagy (Covill-Cooke et al., 2017). Alongside the roles in mitochondria distribution, morphology and turnover, Miro also seems to be critical for a wide range of other processes at the mitochondria.
The ER is known to form extensive contact sites with various organelles and the mitochondria are no exception. In yeast, these ER-mitochondria contact sites are formed by the ERMES, a complex formed of Mmm1, Mdm12, Mdm34 and Mdm10 (Kornmann et al., 2009). In contrast,
ERMES homologues have not been found in higher eukaryotes, though extensive contacts between the ER and mitochondria are still observed (Csordás et al., 2006). The exact tethering complex of the mammalian ER-mitochondria contact sites (also known as mitochondria-associated ER membranes (MAMs)) is unknown; however, it is proposed that
PTPIP51 (OMM) and VAPB (ER) can account for at least some of tethering (Gomez-Suaga et al., 2017). Functionally these contact sites are proposed to be critical for the exchange of calcium and lipids between the two organelles (English and Voeltz, 2013). Furthermore, interplay with autophagy and the unfolded protein response has also been proposed (Gomez-
Suaga et al., 2017; Phillips and Voeltz, 2016). Interestingly, through purification and mass spectrometry of the ERMES complex Gem1 – the yeast orthologue of Miro – was identified as a potential binding partner (Kornmann et al., 2011). Gem1 was shown not to be critical for the assembly of the ERMES complex but rather regulated the number and size. This was dependent on calcium binding of the first EF-hand domain and activity of the N-terminal
GTPase domain. Despite having genetic interactions with enzymes central to lipid metabolism, Gem1 was shown not to be required for the exchange of phosphatidylserine from the ER to the mitochondria (Nguyen 2012).
In higher eukaryotes the machinery for calcium import into mitochondria from the ER (IP3R and VDAC1) has also been shown to enrich at MAMs (Szabadkai et al., 2006; Wieckowski et
30 al., 2009). Interestingly, Miro localises to these sites where it modulates mitochondrial calcium uptake and has even been shown to localise to the ER membrane itself. Knockout of dmiro leads to defects in mitochondrial calcium uptake resulting in a reduction in mitochondrial
OXPHOS (S. Lee et al., 2016). Furthermore, overexpression led to excess calcium uptake into the mitochondria and subsequent apoptosis. Coupled to the role in calcium uptake at
MAMs, Miro might also have role in calcium import into the mitochondrial matrix through an interaction with the calcium uniporter, MCU (Niescier et al., 2018). Therefore, alongside its role in calcium-induced stopping of mitochondrial motility, Miro may be critical in regulating calcium homeostasis within the cell (Macaskill et al., 2009; Wang and Schwarz, 2009). The role of Miro in the many aspects of mitochondrial homeostasis described above may be important in integrating these separate but ultimately inter-related processes.
Conclusion: Part I
All in all, the regulation of mitochondrial distribution, morphology and turnover requires the complex orchestration of a range of different machineries in an attempt to maintain mitochondrial homeostasis. Interestingly, the overlap in these machineries is such that these three processes are often co-regulated leading to a balance in mitochondrial dynamics appropriate for both the cell type and subcellular environment. Through constant spatiotemporal regulation of position, size and health, the essential mitochondrial processes of ATP provision and calcium buffering can be maintained optimally throughout the cell. Given that OMM proteins, such as Miro, have a critical role in many aspects of mitochondrial homeostasis, they provide an important avenue into gaining a broader appreciation of mitochondrial dynamics in health and disease.
31
Part II: Modulating peroxisomal morphology, turnover and distribution
Peroxisomes in health and disease
Peroxisomes are single-membrane bound organelles ubiquitous to eukaryotic life, that exhibit a vesicular or more tubular appearance with an average diameter of 0.1 μm to 1 μm, depending on the cell type (Smith and Aitchison, 2013). The peroxisomal membrane encloses a lumen full of enzymes required for a wide range of peroxisomal functions central to cellular metabolism. Originally described as sites of hydrogen peroxide catabolism (hence, peroxisome), peroxisomes have since been shown to be critical for a multitude of cellular processes. Those universal to all eukaryotic species are ROS metabolism and signalling
(both production and clearance), β-oxidation of fatty acids (very-long fatty acids only in mammals) and lipid synthesis (Smith and Aitchison, 2013). Peroxisomes are also critical for the detoxification of xenobiotics and so are particularly abundant in hepatocytes. Work in a multitude of organisms has identified many genes associated with peroxisome biogenesis and maturation, resulting in the identification of the pex genes. These genes (around 30 have been described in many eukaryotic organisms) are critical in modulating the basal abundance of peroxisomes and in modulating their number in response to alterations in metabolism
(Braverman et al., 2013).
The requirement for functional peroxisomes is emphasised by diseases that affect peroxisome biogenesis, or indeed aspects of peroxisome function, being observed in humans. For example, the Zellweger spectrum disorders are a group of autosomal recessive disorders caused by defects in peroxisome biogenesis (Klouwer et al., 2015). These disorders result in the accumulation of very-long, branched chain fatty acids and plasmalogen deficiency and clinically manifest in neurological abnormalities and hepatic- and adrenocortical- dysfunction. The prognosis of patients depends on the exact mutation but in more severe cases leads to death within the first six months after birth. Importantly, many peroxisomal processes are dependent on the function of other organelles, namely the ER and mitochondria, and therefore contact sites have been observed between peroxisomes and
32 these organelles (Inês Gomes Castro et al., 2018). Much of our understanding of peroxisomal biology has come from yeast, emerging from the power of yeast genetics and the ease of growing yeast on a range of different peroxisome-dependent carbon sources, such as methanol. Despite the important contribution yeast have made in discerning peroxisome function and biogenesis, there are arguably substantial differences between yeast and mammalian systems. As a result, this thesis will deal with peroxisomal biology in mammals.
Work in yeast, however, will be mentioned throughout to inform gaps in our understanding of the mammalian system and to highlight important evolutionary differences.
Peroxisomal protein import and biogenesis
Protein import into the peroxisomal lumen
As the peroxisomal lumen is the site of many key metabolic processes, it is critical to maintain the peroxisomal luminal proteome. As peroxisomes do not contain their own DNA, all peroxisomal proteins are encoded for by the nuclear genome and imported across the peroxisomal membrane. This process is cyclical and requires multiple steps, including: 1) the recognition of the cargo in the cytoplasm by a receptor; 2) docking at the peroxisomal membrane; 3) translocation across the membrane; 4) dissociation of the cargo from the receptor; and 5) retrotranslocation of the receptor across the peroxisomal membrane back into the cytoplasm (Baker et al., 2016). Peroxisomal proteins are recognised in the cytoplasm through their intrinsic targeting signals (PTS), of which two have been characterised. The first,
PTS1 is a SKL motif (or variations on this by keeping [small]–[basic]–[hydrophobic]) at the C- terminus which binds PEX5 (Chowdhary et al., 2012; Fransen et al., 1998; Gould et al.,
1990). The second is PTS2, an N-terminal motif comprised of (R-(L/V/I/Q)-xx(L/V/I/H)-
(L/S/G/A)-x-(H/Q)-(L/A) and is present in a few peroxisome matrix proteins and bind PEX7 with the help of the coreceptor PEX5L (Kunze et al., 2015; Swinkels et al., 1991).
Upon binding either PEX5 or PEX7, the newly synthesised protein docks at the peroxisome by association with PEX13 and PEX14. The exact nature of membrane translocation at this point is not fully understood; however, work in yeast has proposed that PEX5 and PEX14 together can form a ‘transient pore’ for protein import (Erdmann and Schliebs, 2005). In fact,
PEX5 can spontaneously integrate into phospholipids in vitro (Gouveia et al., 2003, 2000).
33
Interestingly, unlike other sites of protein translocation within the cell, peroxisomal proteins can be imported in a folded and even oligomeric form (McNew and Goodman, 1994;
Meinecke et al., 2010). Once the cargo has been imported, PEX5/PEX7 dissociates from the recently imported protein and then must be recycled back into the cytoplasm. The export of
PEX5 and PEX7 has been found to be the only ATP-dependent part of the protein import process. The export of PEX5 is better described; however, it is presumed that PEX7-PEX5L export occurs via a similar mechanism (Platta et al., 2014). First PEX5 is monoubiquitinated at a conserved cysteine residue near the N-terminus by the RING- (PEX2, PEX10 and
PEX12) and Ubc- (UbcH5a/b/c) complexes (Platta et al., 2014). Once monoubiquitinated,
PEX5 can then be exported to the cytoplasm. This is carried out by the AAA ATPases PEX1 and PEX6, which are recruited to the membrane by PEX26 (Pex15 in yeast), followed by deubiquitination (Miyata and Fujiki, 2005; Pedrosa et al., 2018; Platta et al., 2005). With PEX5 deubiquitinated and exported into the cytoplasm the cycle of protein import can repeat.
Peroxisomal membrane protein (PMP) import
In comparison to peroxisomal matrix proteins, PMP import requires a different set of PEX proteins. Following translation on cytosolic ribosomes, the newly synthesised PMP is recognised by the receptor and chaperone, PEX19 (Jones et al., 2004; Matsuzono and Fujiki,
2006). PEX19 has been shown to bind PMPs dependent on their transmembrane domain and surrounding amino acids, preventing their aggregation and targeting them to the peroxisomal membrane (Halbach et al., 2006; Yagita et al., 2013). The importance of PEX19 to the targeting of PMPs to peroxisomes is emphasised by artificially targeting PEX19 to the nucleus via a nuclear-targeting signal importing PMPs into the nucleus (Jones et al., 2004; Sacksteder et al., 2000). Most PMPs exhibit a targeting signal composed of one-to-two transmembrane domains surrounded by positively charged residues (Van Ael and Fransen, 2006). Once bound to the newly synthesised PMP cargo, the N-terminus of PEX19 then associates with
PEX3 at the peroxisomal membrane leading to the docking of the PMP (Fang et al., 2004).
PEX16 also appears to be required for PMP import; however, its role is less clear and is not present in all species (Aranovich et al., 2014; Kim and Hettema, 2015; Kim et al., 2006). The integration of the protein into the peroxisomal membrane is thought to occur without ATP and
34 therefore driven by the biophysical properties of the transmembrane and surrounding amino acid residues, much like the C-terminal integration of proteins into the ER. If should be noted that there is evidence for the transit of PMP through the ER and therefore there might be a separate pathway for PMP import that is independent of some of the machinery described above (Aranovich et al., 2014; Kim and Hettema, 2015; Kim et al., 2006; Mayerhofer, 2016;
Toro et al., 2009). Current evidence for this pathway is conflicting, with no mutual consensus on the mechanism and prevalence of this pathway; though it might require the traditional
Sec61- or GET/Bag6- dependent import pathways (Mayerhofer, 2016).
De novo peroxisomal biogenesis
The formation of new peroxisomes is a step wise process, whereby peroxisomal proteins are added incrementally until a fully mature organelle is present. Interestingly, loss of function mutations in PEX3, PEX16 or PEX19 leads to the complete absence of peroxisomes within the cell (Joshi et al., 2018; Sugiura et al., 2017). The evidence of a complete lack of peroxisomes when PEX3, PEX16 or PEX19 is lost is a strong indication that these three proteins function in the earliest stages of peroxisomal biogenesis, as loss of other PEX proteins leads to peroxisome ‘ghosts’: peroxisomal membranes without the full complement of luminal enzymes (Agrawal and Subramani, 2016; Bharti et al., 2011). Indeed, PEX3, PEX16 and PEX19 are the minimal requirement to seed the peroxisome maturation process.
Intriguingly, exogenous expression of the PEX gene that has been lost leads to mature peroxisomes being present within just a few days (Sugiura et al., 2017). As a result, unlike mitochondria and chloroplasts, peroxisomes are able to form de novo. Upon rescuing loss of
PEX3 in mammalian cells, exogenous PEX3 first localises to mitochondria. PEX16, on the hand, localises to the ER. It is proposed that PEX3-containing vesicles from the mitochondria and PEX16-containing vesicles from the ER can fuse (Sugiura et al., 2017). These two proteins then function as the receptor for Pex19 allowing for the insertion of proteins into the peroxisomal membrane (Fang et al., 2004). Following the insertion of proteins critical for the peroxisomal matrix import machinery, peroxisomes can then import the full complement of proteins into a mature peroxisome. Alongside this mechanism of de novo biogenesis, evidence for heterotypic fusion of pre-peroxisomal vesicles has been observed in yeast
35
(Hoepfner et al., 2005; van der Zand et al., 2012). The biogenesis of these vesicles is proposed to occur from a specialised sub-domain of the ER.
Regulation of peroxisome proliferation by peroxisomal fission
Alongside de novo peroxisomal synthesis, peroxisome abundance can be increased by division of pre-existing peroxisomes, known as peroxisomal fission. The importance of peroxisomal fission is emphasised by human diseases associated with members of the peroxisomal fission machinery (Chao et al., 2016; Ebberink et al., 2012; Huber et al., 2013).
Peroxisomal fission occurs by three inter-related steps, which act upon existing mature peroxisomes, resulting in multiple smaller peroxisomes budding from the mature seed (Figure
1.3). These are elongation, constriction and scission. The first of these steps, elongation, is carried out by the Pex11 family of proteins. In mammalian cells these include Pex11α,
Pex11β and Pex11γ. The role of Pex11α and Pex11γ in peroxisomal fission is less clear, with neither being able to compensate for the loss of Pex11β (Ebberink et al., 2012). As a result, it is proposed that they fine tune peroxisomal proliferation, possibly through interacting with Fis1 and Mff: proteins required for the later fission event (Koch and Brocard, 2012; Koch et al.,
2010). Pex11β, on the other hand, has been found to cause peroxisomal elongation by its intrinsic ability to bend and deform lipid bilayers (Yoshida et al., 2015); which likely requires amphipathic helices in the N-terminus (Opaliński et al., 2011). To do so, Pex11β forms clusters that decorate the peroxisomal membrane. This elongation step has been found to make new intra-peroxisomal compartments where newly synthesised peroxisomal proteins can be imported; as a result Pex11β-dependent elongation is also a key maturation step in peroxisome proliferation (Delille et al., 2010). Importantly, mutations in Pex11β have been described, with patients exhibiting a similar disease state as Zellweger spectrum disorders
(Ebberink et al., 2012).
Constriction occurs at discrete points along the length of the newly formed peroxisome elongation, giving the appearance of ‘beads on a string’. It is currently unclear how peroxisomal constriction occurs; however, Pex11β has been found to accumulate at sites of peroxisomal constriction (Schrader et al., 1998). Given the overlap in fission machinery
36
Figure 1.3: Model of peroxisomal fission. First peroxisomes elongate by Pex11β. Next Drp1 is recruited from the cytoplasm to constrict the peroxisomal membrane. The final scission event leads to multiple peroxisomes for the mother peroxisome.
37 between peroxisomes and mitochondria (described below), parallels may be drawn from mitochondrial fission. The ER and actin (along with myosin-II) have been shown to be required for the constriction of mitochondria at the site of fission and therefore may be the mechanism by which peroxisomal constriction occurs (Friedman et al., 2011; Korobova et al.,
2013). Indeed, the peroxisomes make extensive contacts with the ER and actin cytoskeleton
(Inês Gomes Castro et al., 2018; Neuhaus et al., 2016). Furthermore, myosin-II has been shown to localise to peroxisomes (Schollenberger et al., 2010). Once the peroxisome has elongated and constricted, peroxisomal fission occurs leading to multiple peroxisomes from the original elongation. Interestingly, the machinery required for this peroxisomal fission step appears to overlap significantly with that of mitochondrial fission. Both Fis1 and Mff, Drp1- receptors involved in mitochondria fission, have been shown to localise to the peroxisomal membrane (Gandre-Babbe and van der Bliek, 2008; Koch et al., 2005). Interestingly, Pex11 family may help to attract Fis1 and Mff to sites of constriction for the localised recruitment of
Drp1 (Koch and Brocard, 2012). Disease-associated mutations in Drp1 have also been described, effecting both mitochondrial and peroxisomal morphology (Chao et al., 2016).
Once Fis1 and Mff are at constriction sites, Drp1 is then recruited from the cytosol to the peroxisomal membrane in a manner that is likely analogous to mitochondrial fission (Koch et al., 2003; Li and Gould, 2003; van der Bliek et al., 2013; Williams et al., 2015). It is then assumed that Drp1 oligomerises, like in mitochondrial fission, further constricting the peroxisomal membrane. What remains unclear is whether or not Drp1 oligomerisation is sufficient to cause the final scission event in peroxisomal fission. Mitochondrial fission has been shown to require dynamin-2 for this final step (J. E. Lee et al., 2016). As a result, the true extent of overlap between mitochondrial and peroxisomal fission is yet to be ascertained.
Indeed, it is currently unclear if other Drp1 receptors such as MiD49 and MiD51 are localised to peroxisomes. One final disease-associated protein that localises to both the mitochondria and peroxisomes to promote organelle fission is GDAP1 (Huber et al., 2013). GDAP1 mutants are associated with Charcot-Marie-Tooth disease (Cassereau et al., 2011; Niemann et al.,
2005). The exact involvement of GDAP1 in both mitochondrial and peroxisomal fission is unclear; however, it does appear to require the activity of Mff and Drp1 and therefore is likely part of the pathway described above (Huber et al., 2013). Importantly, both Fis1 and GDAP1
38 localise to peroxisomes by a Pex19-dependent mechanism and therefore are directly inserted into the peroxisomal membrane post-translationally without transiting through the mitochondria (Delille and Schrader, 2008; Huber et al., 2013; Matsuzono and Fujiki, 2006).
Therefore, peroxisome proliferation through fission is a multistep process that is discrete from, but has significant overlap with, mitochondrial fission.
De novo vs. fission
Since the discovery of peroxisomes in the 1950s, much debate has centred on their biogenesis (Agrawal and Subramani, 2016). As discussed above, substantial evidence exists for both de novo biogenesis and peroxisome proliferation through fission; however, what is the relative contribution of these two types of peroxisome proliferation to the pool of peroxisomes in the cell? The most deliberate investigation into this question in mammalian cells was carried out by Kim et al. (2006). Using a pulse-chase of peroxisome localised photoactivatable GFP, the authors suggest that 20% of peroxisomes are formed by fission, with the remainder being formed de novo. One issue with the interpretation of this data is that during elongation and constriction some proteins are excluded from the intra-peroxisome subcompartments (Delille et al., 2010). As a result, the activated GFP may not make it into these intra-peroxisomal subcompartments. Despite this limitation, this study still provides strong evidence of both peroxisomal fission and de novo biogenesis occurring to a significant extent over a 24 hour period. In yeast, many conflicting reports discuss the relative contribution of fission and de novo biogenesis; it is therefore likely that both exist in parallel with the extent of either being species-, cell- or context-dependent.
Pexophagy
As well as peroxisomal proliferation through de novo biogenesis and peroxisomal fission, the number of peroxisomes in the cell can be regulated through lysosomal clearance. This process is dependent on the macroautophagy pathway which engulfs unwanted or damaged peroxisomes targeting them to lysosomes for degradation, in a process known as pexophagy
(Cho et al., 2018). Unlike the PINK1/Parkin-dependent mitophagy pathway, the machinery required for the pexophagy is less well known. In yeast, peroxisome proliferation is easily stimulated by the addition of oleate or methanol (two carbon sources that require
39 peroxisomes for their effective use). Once the oleate of methanol is removed, superfluous organelles are rapidly degraded through pexophagy (Oku and Sakai, 2016). Using this approach has shown that in yeast Atg30, Atg32 and Atg37 directly recruit the autophagosome machinery through binding the LC3 homologue, Atg8 (Burnett et al., 2015; Farré et al., 2013;
Nazarko et al., 2014). Pexophagy in mammalian cells, on the other hand appears, to be dependent on the ubiquitination of certain peroxisomal cargoes, which then serve to recruit the autophagy receptors p62 and NBR1 (Deosaran et al., 2013; Yamashita et al., 2014).
These can then bridge between the peroxisome and autophagosomal membrane by recruiting
LC3. Indeed, simply artificially ubiquitinating PMPs leads to the recruitment of the autophagy receptor p62 and loss of peroxisomes by pexophagy (Kim et al., 2008). There are hints that the role of p62 may be in the clustering of peroxisomes during pexophagy as opposed to being strictly required for pexophagy (Yamashita et al., 2014). In fact, loss of p62 by RNAi does not affect Pex2-dependent pexophagy (Sargent et al., 2016). A similar clustering role for p62 in mitophagy has also been proposed (D. Narendra et al., 2010). NBR1 overexpression also promotes peroxisomal clustering and targeting to lysosomes for degradation (Deosaran et al., 2013).
One ubiquitin E3 ligase that has been shown to be required for pexophagy in mammalian cells is the RING-finger E3 ligase, Pex2. The activity of Pex2 leads to the ubiquitination of
Pex5 and PMP70 and the subsequent recruitment of NBR1 to peroxisomes, ultimately leading to the autophagic loss of peroxisomes (Sargent et al., 2016). This process has not only been shown to be required for the basal turnover of peroxisomes but also stimulates pexophagy during amino acid starvation; a well characterised activator of macroautophagy. Another cellular context in which the ubiquitination of Pex5 has been shown to stimulate pexophagy is following increases in ROS. The activity of the kinase, ATM, is stimulated by ROS causing it to be recruited to peroxisomes by Pex5 (Zhang et al., 2015). Once there, ATM phosphorylates Pex5 leading to the ubiquitination of Pex5 at K209. This then leads to the recruitment of p62 and the induction of pexophagy (Zhang et al., 2015). Given the role of peroxisomes in ROS metabolism, it might be that pexophagy provides a mechanism to prevent oxidative stress through the removal of damaged peroxisomes. Alongside starvation and increased ROS, hypoxia is also proposed to stimulate pexophagy. During normoxia the
40 oxygen-sensing regulatory subunits (Hif1α and Hif2α) of HIF heterodimers are readily hydroxylated and degraded (LaGory and Giaccia, 2016). However, during hypoxia they accumulate and activate leading to the transcription of many hypoxia-induced genes.
Peroxisomes consume a substantial amount of the cell’s oxygen, accounting for around a fifth of oxygen consumption in the liver (Boveris et al., 1972). As a result, peroxisomes are degraded during hypoxia via a Hif2α-dependent mechanism in an attempt to reduce cellular oxygen consumption (Walter et al., 2014).
Interestingly USP30, a mitochondrially-targeted deubiquitinase that antagonises Parkin- mediated ubiquitination, has been shown to localise to peroxisomes (Marcassa et al., 2018).
This localisation does not require transit through mitochondria so it is proposed that USP30 is directly inserted into the peroxisomal membrane via its N-terminal transmembrane domain.
As the autophagic clearance of peroxisomes has been found to be independent of PINK1 and
Parkin, it is likely that the activity of USP30 is antagonistic to another E3 ligase at peroxisomes, perhaps Pex2. Furthermore, it is not yet clear which peroxisomal targets USP30 is deubiquitinating; however, given the characterisation of Pex5 and PMP70 as targets of ubiquitination during pexophagy, it is possible that USP30 acts on these (Kim et al., 2008;
Sargent et al., 2016). All in all, the autophagic clearance of peroxisomes is a key mechanism in regulating the abundance of peroxisomes, which is regulated by the ubiquitination of PMPs and the recruitment of LC3 through either p62 or NBR1.
Maintenance of peroxisomal distribution through transport
As a key metabolic organelle, peroxisomes must be regulated spatially to optimally distribute peroxisomal processes throughout the cell. Given that many aspects of cell metabolism are required throughout the cell, peroxisomes often exhibit a homogenous distribution, relying on a balance of peroxisomal trafficking events on the actin and microtubule cytoskeleton
(Neuhaus et al., 2016). As there are important differences between species the following will concentrate of peroxisomal trafficking in mammalian cells, alongside drawing some conclusions from the filamentous fungus Ustilago maydis. The original descriptions of peroxisomal trafficking in the 1990s identified two forms of peroxisomal motility: 1) short- range peroxisomal displacements (also referred to as oscillatory motility; 2) long-range
41
Figure 1.4: Long-range vs. short-range peroxisomal transport. Peroxisomal trafficking is made up of long-range saltatory transport and shorter-range oscillatory displacements.
42 peroxisomal transport (described as saltatory on account of their characteristic starting and stopping) (Figure 1.4) (Huber et al., 1997; Rapp et al., 1996; Wiemer et al., 1997). The first of these – short-range peroxisomal displacements – makes up ~90% of all peroxisomal trafficking events; however, as disruption of either actin or microtubules has no effect on the extent of oscillatory motility this type of trafficking is often dismissed as purely Brownian
(Huber et al., 1997, 1999). Despite this, there are hints of the involvement of the actin cytoskeleton in this type of peroxisomal transport, though this has only been found in PEX14
KO patient fibroblasts and not in wild-type cells (Bharti et al., 2011). As a result, short-range peroxisomal displacements have received little attention. Coupled to a lack of regulatory mechanism, no role for the shorter-range oscillatory motility has been described; however, given that peroxisomes interact with several organelles it is possible that this type of trafficking may serve to maintain optimal crosstalk with other organelles (Inês Gomes Castro et al., 2018).
The remaining ~10% of peroxisomal trafficking events is made up of long-range peroxisomal transport. Like the long-range transport of other organelles, saltatory peroxisomal trafficking utilises the microtubule cytoskeleton by coupling to microtubule motor proteins, as observed by depolymerisation of microtubules completely abolishing this type of trafficking (Huber et al.,
1997; Rapp et al., 1996; Schrader et al., 1996; Wiemer et al., 1997). More specifically, bi- directional peroxisomal transport is achieved by binding to both kinesin-1 and dynein; however, KifC3 has also been shown to be recruited to peroxisomes by binding Pex1
(Dietrich et al., 2013; Kural et al., 2005; Schrader et al., 2000). Knockdown of KifC3 led to perinuclear clustering of peroxisomes (Dietrich et al., 2013). The importance of maintaining peroxisomes throughout the cell through long-range microtubule-dependent trafficking events is emphasised by defects in this form of trafficking resulting in improper ROS handling. In
SPAST mutant (associated with hereditary spastic paraplegias) neuron-like cells, peroxisomal trafficking into the neurite-like process of these cells is disrupted (Abrahamsen et al., 2013;
Fan et al., 2014; Wali et al., 2016). This resulted in defects in the clearance of ROS and subsequent cell death (Wali et al., 2016).
43
Though a lot less is known about microtubule-dependent trafficking of peroxisomes in comparison to mitochondria, some regulatory mechanisms for peroxisomal trafficking have been described. The close association of peroxisomes with the actin and microtubule cytoskeleton, like other organelles, has received some attention. For example PEX14, a protein critical for the import of luminal peroxisomal proteins, has been shown to bind to microtubules (Bharti et al., 2011). Consequently, loss of PEX14 disrupts long-range peroxisomal motility. The interplay of actin in regulating peroxisomal dynamics is supported by the presence of non-muscle myosin (myosin-IIa) at peroxisomes as well as RhoA and Rho kinase-II, though the functional relevance of these associations has not been explored
(Schollenberger et al., 2010). Secondly, peroxisomal trafficking has been shown to be modulated by a range of cell signalling pathways: including, phospholipase C, ATP- lysophosphatidic acid co-stimulation and PLA2 (Huber et al., 1997, 1999). Despite the large effects in arresting saltatory peroxisomal trafficking, very little is known about the mechanisms by which these cell signalling pathways influence peroxisomal transport, and indeed if they are direct. It is also noteworthy that like mitochondrial trafficking, calcium influx can also arrest peroxisomal transport; however, like the cell signalling pathways above, little is known mechanistically (Huber et al., 1997).
Unlike the budding yeast Saccharomyces cerevisiae, the fungus Ustilago maydis exhibits long-range transport of organelles on microtubules. Two important regulatory insights into peroxisomal trafficking have been made utilising this group of organisms. Firstly, peroxisomes can ‘hitch-hike’ on early endosomes for their long-range trafficking (Guimaraes et al., 2015;
Salogiannis et al., 2016). Co-trafficking of early-endosomes and peroxisomes could be observed, alongside specifically blocking early endosome transport abolishing peroxisomal trafficking. Though these organisms are evolutionarily-distant to mammals, this may be an interesting avenue in studying the regulation of peroxisomal trafficking. Secondly, this organism has been used to propose an actin-microtubule opposing force model for peroxisomal distribution (Lin et al., 2016). This is achieved by kinesin-3-dependent motility of early endosomes coupling to peroxisomes and the opposing myosin-5-dependent trafficking of cargoes. Importantly, this work was also supported by disruption of actin and microtubules
44 in Cos7 cells, and therefore might hint at a universal mechanism of controlling peroxisomal trafficking and distribution.
Interplay between peroxisomes and mitochondria
Overlap in mitochondrial and peroxisomal function
Both mitochondria and peroxisomes carry out a wide range of key metabolic process essential for cellular health. One such process is the utilisation of fatty acids as an ATP- generating carbon source. In yeast, all β-oxidation is carried out by peroxisomes. In contrast, mitochondria perform the overwhelming majority of the β-oxidation of fatty acids in mammalian cells. The exception to this is in the β-oxidation of very-long, branched fatty acids, whereby the enzyme required for the first step of oxidation is localised to peroxisomes (Smith and Aitchison, 2013). As a result, peroxisomes and mitochondria must coordinate for the efficient utilisation of these fatty acid species. Indeed, peroxisome biogenesis disorders are characterised by a build-up of this species of fatty acid (Klouwer et al., 2015). Another metabolic process shared between the two organelles is in ROS metabolism. Both organelles have machinery that generates and disposes of ROS. Though originally thought of as purely detrimental to the cell, ROS are now known to be an important part of cell signalling (Alfadda and Sallam, 2012). Therefore, the extent of turnover of ROS by peroxisomes and mitochondria is critical for both cell health and signalling.
It has emerged that mitochondria can produce a heterogeneous pool of vesicles, referred to as mitochondrial-derived vesicles (MDVs) (Sugiura et al., 2014). Though many of these are destined for degradation by the lysosome a subset are targeted to peroxisomes (Neuspiel et al., 2008). The exact function of these peroxisome-destined MDVs is unknown but their biogenesis is better understood. The E3 sumo- and ubiquitin-ligase, Mul1, has been shown to promote the formation of these MDVs in a mechanism dependent on the Vps35 and Vps26, two members of the retromer complex (Braschi et al., 2010; Neuspiel et al., 2008).
Importantly, the formation of these vesicles is Drp1-independent and is therefore distinct from mitochondrial fission. The subsequent fusion of Mul1-dependent MDVs to peroxisomes leaves Mul1 localised at the peroxisomal membrane. Despite this peroxisomal targeting, Mul1 appears to only localise to a subset of peroxisomes (Neuspiel et al., 2008). As Mul1 has also
45 been shown to modulate the innate immune response, it might be that both mitochondria and peroxisomes are required for the response to certain xenobiotics (Doiron et al., 2017; Jenkins et al., 2013). In fact, the viral RNA-detecting protein MAVS is localised to the OMM and more recently been found to localise to peroxisomes (Dixit et al., 2010). As a result, the coordination of MAVS at the mitochondrial and peroxisomal membrane may be important for the immune response.
Organelle cross-talk
Given the substantial overlap in function between the peroxisomes and mitochondria, it is perhaps unsurprising that many regulatory proteins are shared between the two organelles: these include, but are not restricted to, Fis1, Mff, Drp1, GDAP1, USP30, Mul1, Bcl-XL and
Bcl2 (Costello et al., 2017; Gandre-Babbe and van der Bliek, 2008; Huber et al., 2013;
Marcassa et al., 2018). As described in earlier sections, both the mitochondria and peroxisomes undergo Drp1-dependent fission. Unlike mitochondria, however, mature peroxisomes do not undergo fusion. Further to fission, both organelles use USP30 as an antagonistic enzyme for the selective removal of the organelle by macroautophagy (Marcassa et al., 2018). Interestingly PEX13 and PEX3, two peroxins required for peroxisomal protein import, have been shown to be critical for efficient mitophagy (Lee et al., 2017). This function was lost in Zellweger syndrome-associated mutants; however, the exact mechanism of action is currently unknown. With this significant overlap in regulatory machinery it might be that the cell needs to coordinate the dynamics of both mitochondria and peroxisomes together for optimal metabolism.
In mammalian cells a range of PMPs localise to mitochondria in the absence of peroxisomes including PMP34, PEX3, PEX12, PEX13, PEX14, PEX26 and ALDP (Aranovich et al., 2014;
Halbach et al., 2006; Kim et al., 2006; Muntau et al., 2000; Sacksteder et al., 2000; Toro et al., 2009). In the case of PEX3, this appears to have an important role in the de novo biogenesis of peroxisomes; however, the significance of the rest of the proteins being targeted to mitochondria less clear (Sugiura et al., 2017). The mislocalisation of proteins may hint at an overlapping mechanism of protein targeting by the two organelles. Indeed, it has been proposed that Pex19 and mitochondrial chaperones may bind to a nascent polypeptide
46 together, targeting proteins to either the OMM or peroxisomal membrane (Cichocki et al.,
2018). Loss of PEX19 has also been shown to cause the mistargeting of the lipid-droplet protein UBXD8 (which is synthesised in the ER) and therefore it might be that this shared organelle-targeting system extends more broadly to other compartments of the cell (Schrul and Kopito, 2016).
Both mitochondria and peroxisomes make extensive contacts with the ER, a feature which is critical for the function of both organelle (Schrader et al., 2015). Interestingly, more recent work in yeast and mammalian cells has described a contact site between mitochondria and peroxisomes (PerMit) (Mattiazzi Ušaj et al., 2015; Shai et al., 2018). Proteins proposed to regulate PerMit, include ABCD1, ACBD2 and Pex11 (Fan et al., 2016; Mattiazzi Ušaj et al.,
2015; McGuinness et al., 2003). Further to these Shai et al. (2018) found that Pex34 and
Fzo1 (the yeast orthologue of mitofusin1/2) were a critical part of the tethering of the mitochondria and peroxisomes. Interestingly, in their systematic, unbiased screen of potential regulators of the PerMit they also found that the yeast Miro orthologue Gem1 may also regulate the extent of peroxisome-mitochondria contact sites. The presence of this contact site was shown to be critical for the β-oxidation of fatty acids. Finally it is proposed that the mitochondria and peroxisomes can form a tri-partite contact site with the ER, which may also be critical for the function of these metabolic organelles (Mattiazzi Ušaj et al., 2015; Shai et al., 2018). The extensive overlap in function and proteome between the peroxisomes and mitochondria appears to be crucial for maintaining cellular health, with many targets being related to human diseases. Further work may uncover a deeper understanding of the relationship between these two organelles and their ability to modulate cell metabolism.
Conclusion: Part II
Alongside mitochondria, peroxisomes are key sites of metabolism critical for cellular health.
As metabolic organelles, peroxisomes must be rapidly altered in size, shape and turnover in response to changes environmental changes, necessitating a set of regulatory mechanisms to do so. Many aspects of these mechanisms have been elucidated, highlighting a dependence on both the cytoskeletons of the cells and machineries that overlap heavily with the mitochondrial dynamics. Given this, and the significant dependence of peroxisomes on
47 the ER for form and function, it is likely that cross-talk between mitochondria, peroxisomes and ER must occur. Indeed, these three organelles are the only site for the insertion of tail- anchored proteins. Therefore, further work into this inter-dependence of organelle dynamics might uncover critical mechanism for maintaining cellular health.
48
General conclusion and aims
One important theme that arises from the extensive work described above is that there is significant interplay between the wide array homeostatic mechanisms that regulate organelle dynamics. For example, the machinery critical for mitochondrial trafficking, fission/fusion and mitophagy have substantial overlap, whereby knockout of individuals proteins that were once thought to have very specific roles, e.g. the mitofusins in OMM fusion, results in defects in other facets of mitochondrial dynamics. Furthermore, pathways that regulate the dynamics of one organelle have been found to be critical elsewhere; as in the case of the mitochondrial and peroxisomal fission machinery. In the case of the Miro family of GTPases, originally described as critical for mitochondrial trafficking, this also holds true. It is now apparent that not only does Miro modulate many aspects of mitochondrial dynamics, but its role even extends into mitochondrial functions such as calcium dynamics.
Therefore, through Miro, the broader aim of this thesis was to further our outstanding of organelle dynamics. Starting from a Miro1 yeast-two hybrid in conjunction with published mass spectrometry data, this thesis investigates two main themes: 1) Studying the role of a novel Miro interactor, Fam54b, in mitochondrial dynamics. To do this, both the subcellular and biochemical properties of Fam54b are characterised, alongside how Miro might influence any of these properties. Additionally, the impact of Fam54b on mitochondrial dynamics is studied in an attempt to better understand how Miro modulates both trafficking and fission/fusion. 2)
Identifying a role for a peroxisomal pool of Miro in peroxisomal trafficking and morphology.
More specifically, the impact of features within Miro on this peroxisomal localisation is studied.
Furthermore, given the role of Miro in mitochondrial trafficking and morphology, a similar function at peroxisomes was investigated. In conjunction, these two parts propose a broader role for Miro in organelle dynamics and cellular health.
49
2. Materials and Methods
Constructs, primers and antibodies
Constructs pEGFP-N1 (6085-1) and pEGFP-C1 (discontinued) were obtained from Clontech; GFPFam54b was cloned from NM_019557.5 into pEGFP-N1; Fam54bGFP was cloned into pDest-eGFP-C1
(Addgene #31796) by clonase reaction from NM_019557.5. Fam54bGFP phospho-mutant and mimetic constructs (S103A, S103E, S238A, S238E, S103A/S238A and S103E/S238E) were cloned by site-directed mutagenesis; GFPMiro1, GFPMiro2, mycMiro1, mycMiro2 and myc-tagged
Miro1 point mutation constructs (V13, N18, ΔEF, V427 and N432) have been described previously (Fransson et al., 2003, 2006); GFPV13 and GFPN18 were cloned from mycV13 and mycN18 into pEGFP-N1 by Dr. Rosalind Norkett; Mtfr1myc from Origene (NM_026182); Mtfr2myc from Origene (NM_027930); Fam54bmyc from Origene (NM_029759); mtDsRed-2A-GFP made by Dr. Nathalie Higgs; mtDsRed-2A-GFP-Fam54bV5 cloned by infusion from
Fam54bGFP and mtDsRed-2A-GFP; GFPTom70(1-70), amino acids 1-70 of human Tom70 cloned into pEGFP-N1 by Dr. Guillermo López-Doménech; Miro1 truncation constructs were cloned from GFPMiro1: GFPEF1-EF2-GTP2 (184-618 only), GFPGTP1 (1-184 fused to 563-618),
GFPGTP2 (412-618 only) by Dr. Nicol Birsa; GFPC-terminus (GFP-tagged 562-618 of human
Miro1) was cloned from GFPMiro1; mycMiro1ΔTM and mycMiro2ΔTM were cloned from mycMiro1 and mycMiro2 (deletion of 593-618) as published previously (López-Doménech et al., 2018); pxDsRed from Addgene (#54503); pxGFP from Addgene (#54501); ER-DsRed from Addgene
(#55836); mtGFP from Addgene (#23214); mtDsRed, as published previously (Macaskill et al., 2009); mycPex19 is mouse Pex19 (NM_023041) cloned into pRK5-myc vector; GFP- tagged mouse Miro1 splice variants (GFPv1, GFPv2, GFPv3 and GFPv4) were cloned from
NM_021536 (v1), NM_001163354 (v2) and NM_001163354 (v3) into pEGFP-N1 by Infusion cloning. v4 was made from v2 and v3.
50
Primers
Primers Resulting vector
GFP Fwd: aattCTCGAGctatgtcaggaatggaagccac Fam54b
Rev: ggaAAGCTTctagccatttccttttctactga Fwd: CAA TGC CGC TGT TCC CAA S103AGFP Rev: CGC TGC ATG ACA ATC AGA GG Fwd: GCA ATG CCG AAG TTC CCA A S103EGFP Rev: GCT GCA TGA CAA TCA GAG GG Fwd: AAG GCC AGC GCT TTT GCA GA S238AGFP Rev: GGA CAA AGA GAC GCA GTC AT Fwd: AAG GCC AGC GAA TTT GCA GA S238EGFP Rev: AAG GCC GCT GCT TTT GCA GA Fwd: GGCCTGGACAGCACCatgtcaggaatggaagcca mtDsRed-2A-GFP- Rev: tggagGATATctcgagttagccatttccttttctactga Fam54bV5
Fwd: GAAGGATCCATGGCGGCTGCTGAGGAA mycPex19 Rev: GCAGAATTCCATGATCAGACACTGTTCGCC GFP Fwd: AAACTCGAGaaGCTGATGCCCCCAGTAAGGA C-terminus
Rev: GAAAAGCTTTCATCGCTGTTTCAATAATGCTTTG GFP GFP GFP Fwd: cagatctcgagctcaaATGGGCGGTAGGCGTGTAC v1, v2, v3
Rev: gcagaattcgaagctctaTCGCTGTTTCAGTAGTGCTCTG GFP Fwd_1: tctaaaaactgctttCCATGCCCGGTTACGCTG v4 Rev_1: tgcatggcggtaataCGGTTATCCACAGAATCAGGG Fwd_2: TATTACCGCCATGCATTAG
Rev_2: AAAGCAGTTTTTAGAAAGACC
Antibodies, dyes and drugs
Primary antibodies for immunofluorescence (IF) and western blotting (WB): rabbit anti-GFP
(Santa Cruz sc-8334, WB 1:100), mouse anti-GFP (NeuroMAb clone N86/8 WB 1:100), mouse anti-GFP (NeuroMab clone N86/38 IF 1:500), rat anti-GFP (nacalai tesque 04404-84,
IF 1:2,000), rabbit anti-Tom20 (Santa Cruz sc-11415, IF 1:500), mouse Apotrack including
ATP5a, PDH-E1α and GAPDH (Abcam ab110415 WB 1:2,000), rabbit anti-Fam54b (Atlas
HPA027124 WB 1:500), rabbit anti-Miro1 (Atlas HPA010687 WB 1:500), mouse anti-Miro2 supernatant (NeuroMAb clone N384/63 WB 1:100), rabbit anti-actin (Sigma A2066 WB
1:1,000), mouse anti-V5 (ThermoFisher R960-25 IF 1:500), mouse anti-Catalase (Abcam ab110292, IF 1:500), rabbit anti-Pex14 (Atlas HPA04386, IF 1:500), mouse anti-myc supernatant (produced in house from 9E10 hybridoma cell line, WB 1:100), rabbit anti-Pex19
(Abcam ab137072, WB 1:1000, IP 1 μg). Fluorescent secondary antibodies (from Thermo
51
Fisher Scientific, 1:1,000): Donkey anti-rat Alexa Fluor-488 (A21208), goat anti-rabbit Alexa
Fluor-555 (A21430) and donkey anti-mouse Alexa Fluor-647 (A31571). Donkey anti-rabbit
405-DyLight (BioLegend 406409). Mitotracker Orange CMTMRos (ThermoFisher M7510
1:10,000), Atto-647N conjugated phalloidin (Sigma 65906, IF 1:2,000), Vinblastine (Sigma
V1377, used at 1 μM for one hour), Cytochalasin-D (Tocris 1233, used 1 μg/ml for 30 minutes)
Molecular biology
Polymerase chain reaction
Amplification of DNA was carried out using Phusion High Fidelity DNA Polymerase (New
England Biolabs Inc. M0530) following manufacturer’s instructions. Briefly, this involved the addition of 1x Phusion buffer, 200 μM dNTPs, 0.5 μM of both forward and reverse primer, 1 ng plasmid, 1 U of Phusion and made up to 50 μl with nuclease free water. This reaction mixture was then subjected to 30 sec at 98ºC, followed by 30 cycles of 98ºC for 10 seconds,
45-72ºC for 30 seconds (temperature depending on primers), 30 seconds at 72ºC for 30 seconds per kilobase of expected product. A final extension step of 10 minutes at 72ºC was carried out. PCR product was then analysed by agarose electrophoresis.
Cloning using the Gateway system
Cloning was carried out by manufacturer’s instructions (ThermoFisher 11791-020). Briefly,
150 ng of entry vector and 150 ng of destination vector were added together with 1 μl of LR clonase and made up to 5 μl in TE buffer, pH 8.0. Sample was incubated at 25ºC for one hour followed by a 10 minute incubation step at 37º for 10 minutes. Finally, 2 μl of the mixture was transformed into DH5-α cells and screened by analytical digest and sequencing.
Site-directed mutagenesis by reverse PCR
Primers were designed so that the nucleotide changes were in the middle of the forward primer. The reverse primer started with its 5-prime most nucleotide being the next nucleotide upstream of the forward primer. Both primers were 18-25 bases long with 40-60% GC content. Following PCR, as described above, the PCR product was purified (QIAGEN, 28704)
52 followed by phosphorylated by T4 polynucleotide kinase (New England Biolabs inc. M0201) and ligated by T4 DNA ligase, as manufacturer’s instructions (New England Biolabs inc.
M0202). DNA was then transformed, colonies picked, minipreped and sequenced.
In-fusion cloning
In-fusion cloning was carried out as per manufacturer’s instructions (Takarabio, Clontech
638909). Primers were designed to contain the gene of interest with a 5’ and 3’ 15 base pair over hang complementary to the linearised vector. The vector was prepared by linearisation using the appropriate restriction enzyme. 100 ng of the linearised was then added to the 50 ng of PCR product along with 1 μl of the In-fusion enzyme mix and made up to 5 μl with nuclease free water. The reaction mixture was incubated at 50ºC for 15 minutes and then transformed into bacteria.
Transformation
Plasmid DNA was transformed into the chemically-competent cells made by Dr. Nathalie
Higgs by the Inoue method (Im, 2011). Plasmid DNA was incubated on ice with the bacteria for 30 minutes. Cells were then heat shocked at 42ºC for 30 seconds. SOC media was added and the cells recovered by shaking at 37ºC. The cells were then plates on agar plates containing the appropriate antibiotic.
Cell culture
Cell lines
Cos7 cells were incubated in high glucose-containing DMEM (ThermoFisher 41965039) containing 10% foetal bovine serum (ThermoFisher 10500064) and 100U/mL of penicillin/streptomycin (ThermoFisher 15140122). WT, Miro1 knockout (Miro1KO), Miro2 knockout (Miro2KO) and Miro1/Miro2 double knockout (DKO) MEFs were generated previously
(López-Doménech et al., 2018) and incubated in high glucose-containing DMEM
(ThermoFisher 41965039) containing 10% foetal bovine serum (ThermoFisher 10500064),
GlutaMAX (ThermoFisher 35050061) and 100U/mL of penicillin/streptomycin (ThermoFisher
15140122). All cell types were grown in humidified incubators at 37ºC with 5% CO2.
53
Preparation of rat hippocampal neurons for neuronal trafficking
Rat hippocampal neurons were obtained from rat pups at embryonic day 18 (E18). Dissection occurred from the E18 pups in 4ºC Hanks’ balanced salt solution (HBSS). Following dissection of the hippocampi they were incubated in HBSS with 0.125% trypsin EDTA solution for 15 min at 37 °C. After washing off the trypsin in HBSS three times the tissue was homogenised by passing the tissue through glass pipette 10-15 times. Cells were plates at a density of 350,000 cells in a 6 cm dish containing poly-L-lysine coated (500 μg/ml) coverslips in minimum Eagle’s medium (ThermoFisher 31095-029) plus 10% horse serum
(ThermoFisher 26050-088). After six hours the media was replaced with Neurobasal medium supplemented with B-27 (ThermoScientific 17504044), additional 6% glucose, GlutaMAX
(ThermoFisher 35050061) and 100U/mL of penicillin/streptomycin (ThermoFisher 15140122).
Cells were grown in a humidified incubator at 37ºC and 5% CO2.
Transfection by nucleofection
Cells were nucleofected using the AMAXA system. Cells were resuspended in WT-EM (15 mM NaH2PO4, 35 mM Na2HPO4, 5 mM KCl, 10 mM MgCl2, 11 mM Glucose, 100 mM NaCl,
20 mM HEPES, pH7.2 with NaOH) with the plasmid DNA of interest (for 3 cm, 6 cm and 10 cm dishes: 1 ug, 2-3 ug and 4-5 ug of DNA was used, respectively). Cells were then electroporated in the cuvettes with the appropriate program (W-001 for Cos7 and A-023 for
MEFs) and then plated and maintained as usual. Transfected cells were left to express for between 24 hours before use.
Transfection by lipofection
MEFs and neurons were lipofected with Lipofectamine 2000 (ThermoFisher 11668027). For
MEFs transfection in a 24 well plate, 0.5 μg of DNA was incubated for 5 minutes in Opti-MEM
(ThermoFisher 31985062). 1 μl of Lipofectamine 2000 was also incubated separately for 5 minutes in Opti-MEM. Next the DNA and lipofectamine 2000 mixtures were combined and incubated for 20 minutes. Finally, this mixture was added onto the MEFs and incubated in
Opti-MEM for three hours. Normal MEF media was replaced after the three hours. The same protocol was used for neurons but instead of Optim-MEM, Neurobasal (ThermoFisher
54
21103049) was used. Furthermore, 0.25 μg of DNA and 0.5 μl was used. Cells were left to express for 48 hours.
Biochemistry
Mitochondrial fractionation
A crude mitochondrial fractionation was obtained as previously published, Frezza et al.
(2007). In brief, cells were mechanically homogenised by passing a cell suspension through a
25G needle syringes 20 times. This homogenate was then cleared of nuclei and cell debris with two 600 xg spins for 10 minutes, keeping the supernatant following each spin. A small volume was taken from supernatant for the input sample (I). Next the supernatant was spun at 7000 xg for 10 minutes. The resulting supernatant was taken as the cytoplasmic fraction
(C: everything excluding nuclei and mitochondria) and spun once more at 7000 xg for 10 minutes to get rid of any residual mitochondria. The pellet from the first 7000 xg spin was taken and washed and then spun again. This process was repeated twice more, with the pellet being the crude mitochondrial fraction. Finally Lamelli’s buffer was added to the input, cytosolic and mitochondrial fractions and boiled for 5 minutes.
Coimmunoprecipitation
Cells were homogenised and lysed by rotating for 45 minutes at 4°C in a buffer containing 50 mM Tris-HCl pH 7.5, 0.5% Triton X-100, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF and protease inhibitor cocktail. Lysates were then centrifuged at 21,000 xg for 10 minutes and the supernatant collected for inputs and subsequent immunoprecipitation. GFP-tagged proteins were pulled down with GFP-trap agarose beads (Chromotek, gta-10) for 2 hours. Beads were then washed three times with the lysis buffer. For antibody pulldown 1 μg of antibody was added to the lysate following the 21,000 xg spin and incubated at 4°C with rotation for 3 hours. Protein A beads were then added for one hour. Finally, the beads were washed three times with lysis buffer. Beads were then resuspended in Lamelli’s buffer and boiled for 5 minutes.
55
Figure 2.1: Schematic of PhosTag gel electrophoresis. PhosTag acrylamide binds to phosphorylated proteins, slowing their migration through an SDS-PAGE gel. As a result, phosphorylated and unphosphorylated species can be separated.
56
Western Blotting
Following separation by SDS-PAGE, gels where transferred onto nitrocellulose membrane
(GE Heathcare) by 350 mA for two hours. The membrane was then blocked for 45 minutes in
PBS plus 0.1% Tween-20 (PBST) with 4% milk. Primary antibody was diluted in blocking solution and incubated on the membrane overnight at 4ºC with agitation. The membrane was then washed three times for five minutes in PBST and then the appropriate anti-IgG-HRP was added to the membrane (diluted in blocking solution) and incubated at room temperature for
45 minutes. Following three more five minute washes the membranes were imaged after the addition of ECL substrate (Millipore, WBLUR0500) and imaged on the ImageQuant LAS4000 mini (GE Healthcare).
Analysis of phosphorylation by PhosTag
Analysis of the extent of phosphorylation by PhosTag gel occurs by the western blot protocol described above with the following changes (Figure 2.1). 1) 25μM PhosTag acrylamide
(Wako-Chem AAL-107) and 10 mM MnCl2 are added to the gel. 2) The gel is incubated with
10 mM EDTA for 10 minutes before the transfer step. 3) Proteins are transferred onto PVDF.
Fluorescence microscopy
Immunocytochemistry
Cells were plated onto glass coverslips. When required, cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature. Following this the cells were washed three times with PBS. To block, blocking solution (10% horse serum, 5 mg/ml bovine serum albumin and 0.2% Triton X-100 in PBS) was added and incubated at room temperature for 30 minutes. Primary antibodies were then added after being dissolved in blocking solution and incubated at room temperature for one hour. Following this coverslips were washed in PBS by dunking into PBS solution 12 times. Coverslips were then added to secondary antibody for 45 minutes at room temperature. Finally the coverslips were washed in PBS 12 times and mounted onto slides with Prolong gold mounting media (ThermoFisher P36930). Images were taken using a Zeiss LSM700 confocal using a 63x oil objective (NA=1.4). For organelle imaging on micropatterns MEFs were seeded onto large-Y-shaped-fibronectin-micropatterned
57 coverslips (CYTOO 10-012-00-18) at a density of 15,000 to 20,000 cells/cm2. Cells were then left to attach for three hours and then fixed for 10 minutes with 4% paraformaldehyde (PFA).
Immunocytochemistry was then carried out, as described above.
Live cell imaging
Live imaging of mtDsRed in hippocampal neurons and pxDsRed in MEFs was carried out at
37°C whilst perfusing a solution of 10 mM glucose, 10 mM HEPES, 125 mM NaCl, 5 mM KCl,
2 mM CaCl and 1 mM MgCl at pH 7.4 by addition of NaOH, onto the coverslips. Cells were imaged with a 60x water objective on an Olympus BX60M microscope fitted with an Andor iXon camera. mtDsRed and pxDsRed was excited with an ET548/10x filter. Images were taken at one frame every 1.5 seconds for two minutes.
Dual-organelle imaging by spinning-disk microscopy
To image the mitochondria, ER and peroxisomes MEFs were transfected with mtDsRed, ER-
DsRed and pxGFP, respectively, by lipofection. Transfected MEFs were then seeded into 3 cm glass bottom dishes coated with fibronectin in normal MEF culturing conditions. Movies of either mitochondria and peroxisomes or the ER and peroxisomes were obtained on an inverted Nikon TiE stand with a Yokogawa CSU-X1 spinning disc scan head and Hamamatsu
C9100-13 EMCCD camera at two frames a second for two minutes at 37ºC with humidified
5% CO2.
PEG fusion assay
To assess mitochondria fusion a PEG fusion assay was used (Chen et al., 2003). Following separate transfection of Cos7 cells with either mtGFP or mtDsRed, cells were seeded to achieve a density of 100% the following day. Next, 50% polyethylene glycol 1500 in unsupplemented DMEM was added to the cells for 45 seconds followed by three 10 minute washed with unsupplemented DMEM. Normal Cos7 media was then added supplemented with 30 μg/ml cyclohexamide for three hours (Figure 2.2). Cells were then fixed and imaged.
58
Figure 2.2: PEG fusion assay. PEG fusion assay can be utilised to study the rate of mitochondria fusion. Fused mitochondria are both green and red (yellow). CHX is cycloheximide.
59
Analysis
Colocalisation analysis
For Fam54b mitochondrial colocalisation analysis and PEG fusion analysis the colocalisation plugin in Metamorph was used. More specifically, the proportion of integrated signal from the protein of interest was divided by the total signal of the mitochondrial network. Importantly the same threshold for all images was used. For the extent of peroxisomal localisation analysis,
ImageJ was used. Using Tom20 as a mask of mitochondrial signal, all GFP signal that overlapped with the mitochondria was removed. GFP signal that colocalised with catalase positive structures was then quantified.
Axonal mitochondrial trafficking
Mitochondrial trafficking in neurons was quantified using the Multiple kymograph plugin in
ImageJ. Movies of axonal mitochondrial trafficking were straightened and then run through the plugin. The resulting kymograph was then used to count the number of trafficking events, as observed by diagonal lines. Extent of mitochondrial transport was then given as a percentage of total mitochondria.
Analysis of organellar distribution
Organelle distribution was quantified by a Sholl-based method, as published previously
(López-Doménech et al., 2018) using a ImageJ macro written by Dr. David Sheehan. After thresholding the organelle signal and indicating the centre of the cell, the macro draws concentric circles from the centre outwards. The intra-circle signal is then measured. From this a normalised cumulative organelle signal can be plotted with distance from the centre point.
Peroxisomal trafficking analysis by Trackmate
Live trafficking of pxDsRed signal was quantified using TrackMate and MTrackJ (Tinevez et al., 2017). Only tracks that last lasted more than half the movie were used for analysis to prevent peroxisomes occurring more than once in the dataset. Size cut off was 10 pixels in diameter.
60
Mitochondrial and ER displacement analysis
Mitochondrial or ER displacement was defined as the relative change in either mitochondrial or ER pixels every 10 seconds (20 frames of the spinning disk movies). More specifically, thresholded signal from t0seconds is subtracted from t10seconds and then calculated as a proportion of the total pixel area of t0seconds. This is then iterated for every ten second interval
(e.g. t20seconds - t10seconds etc.) and then an average of all relative pixel changes taken for the cell. This approach has been published previously for mitochondrial displacement analysis
(López-Doménech et al., 2018). To automate this analysis, an ImageJ macro was written by
James Drew to carry out the steps described above.
Statistical analysis
Statistical significance was tested using the GraphPad Prism software. First normality was tested using the Kosglomorov-Smirnov test. For normal data sets of two or three and more a
Student’s t-test or ANOVA with a Tukey or Dunnett’s post-hoc test was used, respectively.
For non-parametric data sets a Mann Whitney-U test or Kruskall-Wallis test were used for two or three and more conditions, respectively. *, ** and *** denotes p<0.05, p<0.01 and p<0.001, respectively. Graphed data represents mean ± standard error of the mean.
61
3. Fam54b: a novel Miro interactor
Introduction
Mitochondria are critical for a wide range of functions within the cell, including oxidative phosphorylation, calcium buffering and lipid synthesis. To ensure mitochondrial processes are distributed optimally throughout the cell, they must be transported in response to dynamic alterations in subcellular microenvironments such as local increases in energetic demand. As a result, mechanisms have evolved to maintain mitochondrial distribution through long- and short-range trafficking alongside anchoring on the cytoskeleton (Birsa et al., 2013; Sheng,
2017). For long-range trafficking events, this is achieved by coupling the mitochondria to the microtubule cytoskeleton, whereas shorter-range displacements are proposed to occur on F- actin. Anchored in the OMM by their C-termini, the mitochondrial Rho-GTPases, Miro1 and
Miro2, are essential mediators of both long- and short-range mitochondrial transport
(Fransson et al., 2006; López-Doménech et al., 2018). Microtubule-dependent mitochondrial trafficking is regulated by Miro coupling with the microtubule adaptors Trak1/2 and ultimately kinesin or dynein for plus- and minus-end microtubule-dependent trafficking, respectively
(Fransson et al., 2006; López-Doménech et al., 2018, 2012; MacAskill et al., 2009; Russo et al., 2009; Stowers et al., 2002). In the case of short-range mitochondrial displacement, Miro has been shown to be critical for the recruitment and stabilisation of myosin-19 at the mitochondria (López-Doménech et al., 2018).
Structurally, Miro exhibits a large cytoplasm-facing N-terminus containing two calcium-binding
EF-hand domains flanked by an N-terminal and C-terminal GTPase domain (Fransson et al.,
2003; Vlahou et al., 2011). One of the earliest characterisations of how Miro dynamically modulates mitochondrial transport is following increases in cytoplasmic calcium. Interestingly, calcium has been shown to coordinate with the EF-hand domains of Miro1 (Macaskill et al.,
2009). This leads to uncoupling from the microtubules by two proposed mechanisms: 1) The interaction of Miro1 with kinesin-1 is reduced (Macaskill et al., 2009; Nemani et al., 2018); 2) the Miro1-kinesin-1 trafficking complex is released from the microtubules (Wang and
Schwarz, 2009). Despite these findings, many of the mechanistic feature by which this
62 calcium-dependent stopping occurs are not fully understood; especially as no structural changes to Miro have been observed following calcium binding (Klosowiak et al., 2013).
Alongside controlling mitochondrial position through transport, mitochondria must also be regulated morphologically to ensure that correct mitochondrial content and health is maintained (Friedman and Nunnari, 2014). This is predominantly achieved through fission and fusion of the mitochondrial network by a family of dynamin-related proteins. Mitochondrial fission is elicited by the recruitment of Drp1 to the mitochondria followed by oligomerisation of
Drp1 at the site of mitochondrial division; the final scission event is carried out by dynamin-2
(Ingerman et al., 2005; J. E. Lee et al., 2016; Smirnova et al., 2001; van der Bliek et al.,
2013). Mitochondrial fusion on the other hand is orchestrated by the mitofusins, Mfn1 and
Mfn2, at the outer mitochondrial membrane and Opa1 at the inner mitochondrial membrane
(Chen et al., 2003; Song et al., 2007; van der Bliek et al., 2013). Interestingly, the function of
Miro is interconnected with mitochondrial fusion and fission. Not only does Miro interact with much of the core machinery, but mitochondrial transport itself has been proposed as being pro-mitochondrial fusion (Cagalinec et al., 2013; Misko et al., 2010). As a result, overexpression or loss of Miro leads to long-reticulated or short-rounded mitochondria, respectively (López-Doménech et al., 2018; Saotome et al., 2008).
Despite the progress made in understanding the core machinery in mitochondrial dynamics, many aspect of how these processes are regulated have yet to be ascertained. For example, how do individual mitochondria ‘decide’ when to move or undergo morphological changes? To explore new avenues in the roles of Miro in mitochondrial dynamics, the Kittler lab carried out a yeast-two hybrid using human Miro1 as bait. One potential hit from this screen was
Fam54b, which will be the focus of this chapter. Fam54b - also known as mitochondrial fission regulator 1-like (Mtfr1l) - is one of three members of gene family 54 including Mtfr1
(Fam54a2) and Mtfr2 (Fam54a1/Dufd1) (Monticone et al., 2010; Tonachini et al., 2004).
Fam54b is predicted to be ~32 kDa (human) and shares a 28% amino acid sequence identity to Mtfr1 (Monticone et al., 2010). Both Mtfr1 and Mtfr2 have been proposed to have a role in promoting mitochondrial fission; however, to date there is no known role for Fam54b at the mitochondria, or otherwise.
63
As a potential novel Miro1 interactor, this work set out to characterise Fam54b and the importance of this protein in mitochondrial dynamics. Following confirmation of the Miro-
Fam54b interaction, it was found that Fam54b has a partial mitochondrial localisation, dependent on the presence of Miro1. This recruitment was found to be dependent on key features within Miro1. Furthermore, Fam54b is phosphorylated at S103 and S238. Finally, overexpression of Fam54b was shown to disrupt mitochondrial dynamics by altering mitochondrial morphology and disrupting mitochondrial trafficking and fusion.
Results
As Fam54b was identified as a potential Miro1 interactor, it was initially important to confirm the Fam54b-Miro1 interaction. Furthermore, as Miro1 and Miro2 share a 60% amino acid sequence identity (Fransson et al., 2003), an interaction between Miro2 and Fam54b was tested. To more easily study this interaction, a C-terminally GFP-tagged Fam54b construct was generated (Fam54bGFP) and transfected into Cos7 cells, alongside either mycMiro1 or mycMiro2. Following pulldown of Fam54bGFP with GFP trap beads it was observed that both mycMiro1 and mycMiro2 co-immunoprecipitated with Fam54bGFP (Figure 3.1). As a result,
Fam54b can interact with Miro1, as predicted by the yeast-two hybrid, and Miro2.
Fam54b is partially localised to the mitochondria in a Miro1-dependent way
At the time of writing, no published information on the localisation of Fam54b exists; however, given the amino acid similarity to Mtfr1 – a mitochondrially-localised protein (Monticone et al.,
2010; Tonachini et al., 2004) – and that Fam54b can interact with Miro1/2, the possibility of
Fam54b localising to mitochondria was explored. To do so, both N- and C-terminally GFP tagged version of Fam54b were cloned (GFPFam54b and Fam54bGFP, respectively) and expressed in wild-type mouse embryonic fibroblasts (WT MEFs). GFP signal was imaged alongside a mitochondrial stain (antibody against the OMM protein, Tom20). Both tagged versions of Fam54b exhibited a partial mitochondrial localisation, coupled to some signal residing in the cytosol (Figure 3.2A). By comparing the extent of GFP signal overlapping with
Tom20 signal, no difference between the N- and C-terminally tagged Fam54b constructs was observed (Figure 3.2B).
64
Figure 3.1: Fam54b interacts with both Miro1 and Miro2. Cos7 cells were transfected with Fam54bGFP with either mycMiro1 or mycMiro2. Fam54bGFP was immunoprecipitated with GFP- Trap agarose beads. GFP acted as a control. Samples were then analysed by western blot analysis and probed for GFP and myc for Fam54bGFP and mycMiro1/2, respectively.
65
Figure 3.2: Fam54b partially localises to the mitochondrial network. A) Representative images, and zooms, of the localisation of N-terminally- (GFPFam54b) and C-terminally- (Fam54bGFP) GFP-tagged Fam54b expressed in wild-type MEFs. Mitochondria (red) were visualised by Tom20 antibody staining. B) Quantification of the integrated density of GFP signal that overlaps with Tom20 signal. n=18 cells over three independent experiments. No statistical difference (ns) was found by Student’s t-test. Scale bar is 10 μm and 5 μm in zoomed images.
66
Given the partial mitochondrial localisation of Fam54b and the fact that it interacts with Miro, the dependency of either Miro1 or Miro2 on this mitochondrial localisation was tested. To do so, WT, Miro1 knockout (Miro1KO), Miro2 knockout (Miro2KO) and Miro1 / Miro2 double knockout (DKO) MEFs - characterised previously (López-Doménech et al., 2018) - were transfected with Fam54bGFP. The extent of Fam54b on the mitochondria was quantified by the percentage of GFP signal that colocalises with Tom20 signal. Strikingly, in comparison to WT
MEFs, the colocalisation of Fam54bGFP with mitochondria is dramatically reduced in both the
Miro1KO and DKO MEFs (Figure 3.3A&B). Knockout of Miro2 alone, on the other hand, did not affect the mitochondrial localisation of Fam54bGFP (Figure 3.3A&B). One potential explanation for the change in quantified Fam54b signal colocalising with mitochondria is that loss of Miro1 leads to perinuclear distribution of the mitochondrial network (López-Doménech et al., 2018).
To control for this, WT and DKO MEFs expressing GFP alone were quantified in the manner described above. No effect on GFP signal colocalising with Tom20 signal was observed between the two genotypes (Figure 3.3C&D). Consequently, Fam54b has a partial mitochondrial localisation, with the mitochondrial pool of Fam54b being regulated in a Miro1- dependent way.
To test whether or not endogenous Fam54b localises to mitochondria, and to further confirm the Miro1-dependence of this localisation, mitochondrial fractions were obtained from WT,
Miro1KO, Miro2KO and DKO MEFs, as published previously (Frezza et al., 2007; López-
Doménech et al., 2018). Briefly, MEFs were homogenised by passing a single cell suspension through a 25G needle. Next, cell debris and nuclei were cleared by centrifuging the homogenate at 600 g and keeping the resulting supernatant (I) and discarding the pellet.
Finally, a crude mitochondrial fraction was obtained by spinning the previous supernatant at
7000 g. The pellet is the enriched mitochondrial fraction (M) and the supernatant contains other cytoplasmic constituents (C). Comparing the fractions for the localisation of ATP5a
(inner mitochondrial membrane), PDH-E1α (mitochondrial matrix) and GAPDH (cytosol) by western blot analysis showed that the mitochondrial pellet was devoid of cytosolic contents, coupled to mitochondria being absent from the cytoplasmic fraction (Figure 3.4). Analysis of endogenous Fam54b in the fractions from the four genotypes of MEFs showed that Fam54b is partially localised to the mitochondria in WT MEFs (Figure 3.4); in agreement with the
67
Figure 3.3: Localisation of Fam54b to mitochondria is dependent on Miro1. A) Fam54bGFP (green) localisation in wild-type (WT), Miro1 knockout (Miro1KO) and Miro2 knockout (Miro2KO) and Miro1 / Miro2 double knockout (DKO) MEFs. Mitochondria (red) were stained with an anti-Tom20 antibody. B) Quantification of extent of mitochondrial colocalisation of Fam54b with mitochondria by integrated green intensity overlapping with red. n=18 over three independent experiments. ** and *** refers to p < 0.01 and p < 0.001, respectively, in comparison to WT cells by one-way ANOVA with post hoc Newman-Keuls test. ## refers to p < 0.001 in comparison to Miro1KO cells by one-way ANOVA with post hoc Newman-Keuls test. C) Representative images of GFP expression of WT and DKO MEFs. Tom20 staining (red) was used to visualise the mitochondria. D) Quantification of integrated GFP signal colocalising with Tom20 signal. n=18 over three independent experiments. No statistical difference (ns) was found by Student’s t-test. Scale bar is 10 μm.
68
Figure 3.4: Endogenous Fam54b has a partial mitochondrial localisation dependent on Miro1. Representative western blot of mitochondrial fractionation from wild-type (WT), Miro1 knockout (Miro1KO) and Miro2 knockout (Miro2KO) and Miro1 / Miro2 double knockout (DKO) MEFs. I = Input of postnuclear supernatant; M = mitochondrial fraction; C = ‘cytoplasmic’ fraction obtained from the supernatant following pelleting of mitochondria. ATP5a is an inner mitochondrial membrane protein. GAPDH is cytoplasmic.
69 imaging data of Fam54bGFP (Figure 3.2). Moreover, loss of Miro1, but not Miro2, led to a significant reduction in the extent of mitochondrial localisation of Fam54b (Figure 3.4). Very little Fam54b was observed in the mitochondrial fraction of the DKO MEFs. Interestingly, probing Fam54b by western blot analysis showed the presence of two molecular species.
Additionally, in the WT MEFs the upper band of Fam54b appears enriched in the mitochondrial fraction, whereas the lower band is absent. The specificity of this banding pattern is confirmed by a similar banding pattern being observed with the Fam54bGFP construct (Figure 3.1). Therefore, Fam54b has a Miro1 dependent localisation to the mitochondria which may be dependent on biochemical features of Fam54b – such as cleavage or post-translational modifications.
Miro is not required for mitochondrial localisation of other gene family 54 members
As Fam54b is one of three members of the gene family 54, alongside Mtfr1 and Mtfr2, the
Miro-dependence of the other gene family 54 members was investigated. Both Mtfr1 and
Mtfr2 have been described as being localised to mitochondria and to have a role in mitochondrial fission (Monticone et al., 2010; Tonachini et al., 2004). Imaging and colocalisation analysis was carried with WT and DKO MEFs expressing either Mtfr1myc or
Mtfr2myc. Mtfr1myc showed a very strong colocalisation with the mitochondria in both WT and
DKO MEFs (Figure 3.5A&B). Furthermore, overexpression of Mtfr1 led to a fragmentation of the mitochondrial network as depicted by small-rounded mitochondria in cells expressing
Mtfr1myc (Tonachini et al., 2004). Mtfr2myc, on the other hand, had a partial mitochondrial localisation, like Fam54b; however, this was not altered by the loss of Miro1/2 (Figure
3.5A&B). Therefore, though all members of gene family 54 can localise to mitochondria to some extent, the presence of Miro only affects the subcellular localisation of Fam54b.
Miro1 is required for the stability of Fam54b protein levels
Recently, Miro has been shown to be required for both the mitochondrial recruitment and stability of the mitochondrial-myosin, myosin-19 (López-Doménech et al., 2018). Given that
Miro1 is able to recruit Fam54b to the mitochondria (Figures 3.3&3.4) the effect of Miro on
Fam54b protein levels was explored. Whole cell lysates from WT, Miro1KO, Miro2KO and DKO
MEFs were probed for endogenous Fam54b by western blot analysis. Interestingly, in
70
Figure 3.5: Mitochondrial localisation of other gene family 54 gene is not Miro- dependent. A) Representative images of Mtfr1 and Mtfr2 expression in wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs. Mitochondria (red) were stained with an anti- Tom20 antibody. B) Colocalisation of Mtfr1/Mtfr2 with mitochondria quantified by integrated density of myc signal overlapping with Tom20 signal. n=18 cells over three independent experiments. No statistical difference (ns) was found one-way ANOVA with post hoc Newman-Keuls test. Scale bar is 10 μm.
71 comparison to WT MEFs, Fam54b levels were significantly reduced in the DKO MEFs (Figure
3.6A-C). Furthermore, a trend towards a decrease in the Miro1KO MEFs but not the Miro2KO
MEFs was observed.
To further test the effect of Miro1 on the stability of Fam54b, the consequence of acute loss of
Miro on Fam54b levels was tested. Following mitochondrial damage, PINK1/Parkin- dependent mitophagy is induced leading to the rapid degradation of Miro1 and Miro2 (Birsa et al., 2014; Covill-Cooke et al., 2017; Hsieh et al., 2016; Liu et al., 2012; Wang et al., 2011).
This is achieved by the E3-ligase, Parkin, being recruited to the OMM and ubiquitinating a wide range of mitochondrial proteins (Narendra et al., 2008; D. P. Narendra et al., 2010;
Sarraf et al., 2013). One way to robustly initiate PINK1/Parkin-dependent mitophagy is to treat
Parkin-overexpressing cells with the ionophore, FCCP. As a result, mitochondrial damage was stimulated by 1, 3 and 6 hours of 10 μM FCCP treatment in Parkin-overexpressing SH-
SY5Y cells (Birsa et al., 2014). To confirm that mitophagy had been successfully induced, the degradation of the mitochondrial matrix protein, PDH-E1α, was measured by normalisation of protein levels to actin. Indeed, after 6 hours there was a significant reduction in PDH-E1α, indicative of the loss of mitochondrial content from the cell (Figure 3.7A&E). To account for this autophagic clearance of mitochondria, Miro1, Miro2 and Fam54b protein levels were normalised to PDH-E1α. In agreement with previous work, both Miro1 and Miro2 levels dramatically decreased, even after just one hour of FCCP treatment (Figure 3.7A-C) (Birsa et al., 2014; Liu et al., 2012; Wang et al., 2011). Notably, at later timepoints Fam54b levels were significantly reduced (Figure 3.7A&D). Taken together with the whole cell MEF lysate data, it is clear that the presence of Miro1 is required for the stability of Fam54b.
Recruitment of Fam54b to mitochondria requires the activity of the GTPase1 domain and calcium binding ability of Miro1
Both paralogues of Miro are C-terminally anchored OMM proteins, with a large cytosol-facing
N-terminus. Structurally, the N-terminus of each has two adjacent calcium binding EF-hand domains which are flanked by a GTPase domain on either side (Fransson et al., 2003, 2006;
Macaskill et al., 2009). For Miro1, key residues for calcium binding and GTPase activity have been described. These, along with their corresponding mutants, are as follows: GTPase1
72
Figure 3.6: Loss of Miro1 reduces endogenous Fam54b protein levels. A) Western blot analysis of lysates from wild-type (WT), Miro1KO, Miro2KO and Miro1/Miro2 double knockout (DKO) MEFs. B) Quantification of the upper band of Fam54b signal. C) Quantification of the lower band of Fam54b signal. Statistical n is preparation of lysates from three independent days. * refers to p < 0.05 by one-way ANOVA with post hoc Tukey test.
73
Figure 3.7: Fam54b proteins levels decrease during mitochondrial damage. A) Representative western blots of FlagParkin overexpressing SH-SY5Y neuroblastoma cell lysates after treatment with 10 μM FCCP for 0, 1, 3 and 6 hours. B) Quantification of Miro1 signal normalised to the mitochondrial matrix marker, PDH E1α. C) Quantification of Miro2 signal normalised to the mitochondrial matrix marker, PDH E1α. D) Quantification of Fam54b signal normalised to the mitochondrial matrix marker, PDH E1α. E) PDH E1α signal over actin signal; this is indicative of the extent of mitochondrial loss. Statistical n is lysates from three independent experiments. * and *** refers to p < 0.05 and p < 0.001, respectively, in comparison to zero hours by one-way ANOVA with post hoc Tukey test.
74 constitutively active (P13V), GTPase1 dominant negative (T18N), calcium binding (E208K and E328K), GTPase2 constitutively active (K427V) and GTPase2 dominant negative
(S432N).
As Miro1 is required for the recruitment and stabilisation of Fam54b at the mitochondria, the dependence of this recruitment on the enzymatic and calcium binding ability of Miro1 was tested. DKO MEFs were transfected with myc-tagged versions of the Miro1 point mutation constructs along with Fam54bGFP. The extent of rescue of Fam54bGFP localisation to the mitochondria was then quantified for each construct. As expected, wild-type mycMiro1 significantly increased the localisation of Fam54bGFP to the mitochondria (Figure 3.8A&B).
Importantly, neither mycV13 nor mycΔEF was unable to rescue the extent of Fam54bGFP localised to the mitochondria, resulting in comparable colocalisation to DKO MEFs lacking exogenous Miro1 (Figure 3.8A&B). All other constructs tested – mycN18, mycV427 and mycN432
- led to a full rescue of the partial mitochondrial localisation of Fam54b (Figure 3.8A&B).
Consequently, it appears that both the activity of the first GTPase domain and the calcium- binding ability of Miro1 regulate the recruitment of Fam54b to the mitochondria.
Fam54b is phosphorylated on S103 and S238
The above highlights that the extent of Fam54b localised to mitochondria can be altered by biochemical features within Miro1. Alongside this, the potential for post-translational modifications of Fam54b, namely phosphorylation, altering the subcellular localisation of
Fam54b was tested. Phosphosite is an online tool to identify potential phosphorylation sites from phosphoproteomic studies. From this search, two potential candidates were identified due to their high prevalence in previous mass spectrometry work and conservation across species; S103 and S238. To confirm that these are in fact phosphorylation sites, site-directed mutagenesis of these sites to both either an alanine (phosphomutant) or glutamate
(phosphomimentic) was carried out, along with a S103/S238 double mutant and mimetic. To observe phosphorylation status of a protein, cell lysates can be run through a PhosTag gel followed by the standard western blotting protocol. In a PhosTag gel the migration of a phosphorylated protein species is slowed in comparison to the unmodified form, leading to band shift (Figure 9A).
75
Figure 3.8: Localisation of Fam54b in DKO MEFs following rescue with wild-type and mutant Miro1. A) Representative images of DKO MEFs expressing Fam54bGFP with and without myc-tagged Miro1 constructs. Miro1 constructs (cyan) are as follows: WT (wild-type), ΔEF (E208K and E328K substitution), V13 (P13V substitution), N18 (T18N substitution, V427 (K427V substitution) and N432 (S432N substitution). Mitochondria (red) are stained with anti- Tom20 antibody. B) Quantification of extent of integrated GFP signal on mitochondria. n=18 cells per condition other three independent experiments. ** and *** refers to p < 0.01 and p < 0.001, respectively, in comparison to cells lacking Miro1 constructs by one-way ANOVA with post hoc Tukey test. Scale bar is 10 μm.
76
Lysates from Cos7 cells transfected with Fam54bGFP were run on both a PhosTag and an 8%
SDS-PAGE gel. As observed in a Figure 3.1, Fam54bGFP ran as two distinct bands in an SDS-
PAGE gel (Figure 3.9B). Interestingly, in the PhosTag gel wild-type Fam54b shows several upper bands beyond the unmodified Fam54b, highlighting that Fam54b is indeed basally phosphorylated (Figure 3.9B). To ascertain whether the sites identified from the phosphoproteomic data were in fact phosphorylated residues, the phosphomutants were also transfected and run on a Phostag gel and SDS-PAGE gel. No difference in the banding pattern of Fam54b in the SDS-PAGE gel was observed (Figure 3.9B). However, in the
PhosTag gel, upon mutation of S103 loss of at least three bands was observed including the lower most and upper most bands. In the case of mutation of S238 three upper bands were lost (Figure 3.9B). All bands, except for the unmodified Fam54b, were lost in the S103/S238 double mutant, suggesting that under basal conditions these are the only two phosphorylation sites at this resolution (Figure 3.9B). Furthermore, as in both single mutants the upper most bands are lost; it is likely that Fam54b can be phosphorylated at both sites leading to a di- phosphorylated species. To confirm that the band shifts observed for Fam54b in the PhosTag gel were in fact phosphorylation lysates were treated with λ-phosphatase: an enzyme which cleaves phosphate groups from proteins. Untreated samples only showed one phosphorylated species of Fam54b, likely due to the phosphate groups being labile and lost during the lysis protocol required for λ-phosphatase treatment. Treating the cell lysates with λ- phosphatase led to a disappearance of the proposed phosphorylated species, confirming that
Fam54b is phosphorylated (Figure 3.9C).
Given the partial localisation of Fam54b to both mitochondria and the cytosol, a role for the phosphorylation of the sites identified above in the localisation of Fam54b was tested. All mutants, including the phosphomimetics of Fam54b were expressed in WT MEFs and fixed and stained for Tom20 (Figure 3.10A). Following quantification of the percentage colocalisation to the mitochondria, no difference in the localisation of any of the mutants was found in comparison to wild-type Fam54bGFP (Figure 3.10B). Therefore, under basal conditions the phosphorylation of S103 and S238 does not significantly affect the subcellular localisation of Fam54b.
77
Figure 3.9: Fam54b is basally phosphorylated at S103 and S238. A) Schematic describing how PhosTag gels can be used to study phosphorylation of proteins. B) Western blot and Phostag gel analysis of lysates from Cos7 cells transfected with wild-type (WT), S103A, S238A and S103A/S238A (AA) mutant Fam54bGFP constructs. Actin acts as a loading control. C) Phostag analysis of untreated and λ-phosphatase treated Cos7 cell lysate following transfection of Fam54bGFP.
78
Figure 3.10: Phosphomutants and phosphomimetics of S103 and S238 in Fam54b do not affect basal Fam54b localisation. A) Confocal images of mitochondria (red; Tom20) and GFP-tagged Fam54b phosphomutants (green). AAGFP and EEGFP mean S103A/S238A and S103E/S238E double mutants, respectively. B) Quantification of the percentage integrated GFP signal of the mitochondrial signal. n=26 cells per condition over three independent experiments. Statistical significance was test by one-way ANOVA with post hoc Tukey test. Scale bar is 10 μm.
79
Fam54b has a role in mitochondrial dynamics
Unlike the other two members of gene family 54, no described role for Fam54b currently exists. Miro has been shown to be critical for mitochondrial trafficking and be inter-related with fission and fusion of the mitochondrial network (Devine et al., 2016). Given the mitochondrial localisation of Fam54b, and its interaction with Miro1, a role for Fam54b in mitochondrial dynamics was tested using a range of assays. Initially, to investigate whether Fam54b functions in basal mitochondrial morphology and distribution, mitochondrial staining in
GFPFam54b overexpressing Cos7 cells was compared to GFP expressing cells as a control.
Mitochondria were visualised by antibody staining to Tom20. GFP expressing Cos7 cells exhibited a tubular and interconnected mitochondrial network as expected. Mitochondria from
GFPFam54b overexpressing cells on the other hand were rounded and clustered around the nucleus (Figure 3.11A).
To understand if Fam54b overexpression led to a more perinuclear distribution of mitochondria a Sholl assay of mitochondrial signal was carried, as described previously
(López-Doménech et al., 2018, 2016). Briefly, concentric circles are drawn from the centre of the cell, outwards, with the inter-circle Tom20 signal being measured at increasing distances from the centre of the cell. By plotting the normalised cumulative distribution of mitochondrial signal, there was a clear left shift of the curve for Fam54b overexpression, indicative of more perinuclearly distributed mitochondrial network (Figure 3.11B). To further confirm this, the distance at which 95% of mitochondria are situated was calculated from the Sholl analysis. A significant decrease in the distance at which 95% of mitochondria are localised was observed in the Fam54b overexpressing cells, in comparison to the GFP control (Figure 3.11C). Next, to quantify parameters of mitochondrial morphology the aspect ratio (the ratio between the length and width) of individual mitochondria was ascertained by particle analysis in ImageJ.
Indeed, mitochondria in GFPFam54b overexpressing cells were less tubular as shown by a lower aspect ratio (Figure 3.11A&D).
To explore whether the morphological and distribution changes observed upon Fam54b overexpression were as a result of alterations to mitochondrial dynamics, assays for mitochondrial fission/fusion and mitochondrial trafficking were employed. Firstly, to test
80
Figure 3.11: Fam54b regulates mitochondrial morphology and distribution. A) Confocal images of Cos7 cells transfected with either GFP or GFPFam54b. Green depicts GFP or GFPFam54b. Red is Tom20 stained by antibody (mitochondria). B) Normalised cumulative distribution of mitochondrial signal quantified by mitochondrial Sholl analysis. C) Quantification of the distance at which 95% of mitochondrial signal lies in GFP or GFPFam54b overexpressing Cos7 cells. D) Quantification of the aspect ratio (longest length divided by shortest width of thresholded mitochondrial signal) in GFP and GFPFam54b overexpressing Cos7 cells. B), C) & D) n=60 cells over three independent experiments. * and *** refers to p < 0.05 and p < 0.001, respectively, by Student’s t-test.
81 differences in mitochondria fission/fusion a PEG fusion assay was used (Norkett et al., 2016).
To do so, a population of cells with green mitochondria and another with red mitochondria are seeded together onto a coverslip. Polyethyleneglycol is then added for 30 seconds, leading to fusion of the plasma membrane of cells and subsequent mixing of cytoplasmic contents. Cells are then left for subsequent fission and fusion of mitochondria for three hours. Fused mitochondria are then seen as both red and green (Figure 3.12A). Comparing control cells with those over expressing Fam54bmyc, a significantly lower amount of red and green mitochondria was observed. As a result, mitochondria fusion is reduced upon Fam54b overexpression (Figure 3.12A&B).
Finally, a role for Fam54b in mitochondrial trafficking was explored. The neuronal axon has been widely used as a system to study mitochondrial trafficking (Kang et al., 2008; Lin et al.,
2017; López-Doménech et al., 2016; Norkett et al., 2016). The advantages of the neuronal axon are that not only can long-range trafficking events be easily observed due to the long axon length, but the microtubules are arranged in a unipolar orientation, whereby all the plus- ends of the microtubules grow away from the soma and towards the growth cone. As a result, kinesin- and dynein-dependent mitochondrial transport can be quantified simply by the direction of trafficking in a live movie. To more easily quantify changes in mitochondria trafficking, kymographs can be generated from live imaging of mitochondria. Kymographs are a visual representation of movement in which line scans are taken for each frame and plotted on the y-axis direction with time. Therefore, anterograde (kinesin-dependent) and retrograde
(dynein-dependent) trafficking can be observed by right and left diagonal lines, respectively.
Stationary mitochondria are depicted by straight vertical lines.
To test whether or not Fam54b overexpression modulates mitochondrial transport a polycistronic DNA construct was cloned. Using the 2A-peptide system it is possible to encode more than one gene within the same construct allowing for simpler expression of multiple proteins in the same cells, at once. By separating each gene of interest by a 2A peptide (an oligopeptide around 19-22 amino acids), all genes are transcribed into one long transcript
(Szymczak et al., 2004). The 2A site leads to a self-cleaving peptide, resulting in the expression of multiple proteins from the same transcript. A 2A vector was generated including
82
Figure 3.12: Fam54b overexpression reduces mitochondrial fusion. PEG fusion assay with either control or Fam54bmyc (Fam54b overexpression (OE)) expressing Cos7 cells. A) Representative images of control and Fam54b OE Cos7 after PEG fusion. mtGFP and mtDsRed are GFP and DsRed targeted to the mitochondrial matrix. Yellow/orange signal is indicative of mitochondria fusion. B) Quantification of the extent of mitochondrial fusion as calculated by the percentage of total mitochondrial signal that contains both red and green pixels. n=27 cells per condition over three independent experiments. ** refers to p < 0.01 by Student’s.
83
Figure 3.13: Overexpression of Fam54b reduces axonal mitochondrial trafficking. A) Representative images of the expression of mtDsRed-2A-GFP (Control) or mtDsRed-2A- GFP-2A-Fam54bV5 (Fam54b overexpression) in the axon of hippocampal neurons transfected after seven days in vitro. Images were taken two days after transfection. B) Representative kymographs of control and Fam54b overexpressing (Fam54b OE). Kymographs were generated from 2 minute movies at one frame every 1.5 seconds of mtDsRed signal. Straight lines depict stationary mitochondria. Left and right moving diagonal lines indicate retrograde and anterograde moving mitochondria, respectively. C) The percentage of moving mitochondria over a two minute period. D) Percentage of mitochondria moving in the anterograde direction. E) Percentage of mitochondria moving in the retrograde direction. C), D) & E) n=22 and 23 cells for Control and Fam54b OE axons, respectively. Cells were obtained from four independent neuronal preps. * means p < 0.05 by Student’s t-test.
84 mtDsRed and GFP (control) or mtDsRed, GFP and Fam54bV5 (Fam54b overexpression). The
GFP served as a cell fill and the mtDsRed as a mitochondrial probe. Rat hippocampal neurons were cultured at embryonic day 18, transfected with the constructs at the seventh day in culture and imaged after two more days in culture. Figure 3.13A shows the GFP and mtDsRed signal for both constructs. Furthermore, Fam54bV5, as visualised by V5 antibody, showed a mitochondrial localisation of Fam54b.
To study the effect of Fam54b overexpression of mitochondrial trafficking, two minute movie of the mtDsRed signal at 1.5 second per frame were taken for both control and Fam54b overexpressing axons. Axons were identified by their long, thin morphology as observed in the GFP channel. Kymographs were then generated from these movies using the Multiple kymograph plugin in ImageJ (Figure 3.13B). Quantification of the number of moving mitochondria over the two minute movies showed that Fam54b overexpression significantly reduced the number of mitochondrial trafficking event (Figure 3.13C). Furthermore, by splitting this movement into the anterograde and retrograde transport, there was a significant reduction in retrograde but not anterograde trafficking (Figure 3.13 D&E). Therefore, this reduction appears to be predominantly in dynein-dependent trafficking. All in all, Fam54b can regulate mitochondrial dynamics by negatively regulating mitochondrial fusion and trafficking.
Discussion
In summary, following a yeast-two hybrid screen and subsequent biochemical confirmation by co-immunioprecipitation, Fam54b was identified as a novel Miro interactor. Fam54b has a
Miro1-dependent, partial localisation to mitochondria which requires functional GTPase activity and calcium binding ability of Miro1. Furthermore, Fam54b protein stability is reduced in both constitutive knockout and acute loss of Miro1. Here, two phosphorylation sites for
Fam54b were identified, namely S103 and S238, though no change in Fam54b localisation with phosphomutants of these sites was observed. Finally, Fam54b appears to function in the modulation of mitochondrial dynamics; affecting both mitochondrial morphology, fusion and trafficking.
The partial localisation of Fam54b to the mitochondria is of particular note. As Fam54b does not contain any predicted transmembrane domains, it is likely that it is recruited from the
85 cytoplasm to associate with the OMM, through Miro1. It is important to consider the impact of overexpression on the localisation of Fam54b, as high levels of Fam54b might saturate the capacity for Miro1 to recruit Fam54b to the mitochondria. Given that endogenous Fam54b shows a partial mitochondrial localisation – as observed by mitochondrial fractionation – it is likely that Fam54b does indeed exist as a mitochondrial and cytosolic pool; however, care should be given when interpreting the exact extent of mitochondrial localisation of Fam54b in
Figure 2, 3, 8 & 10. This Miro1-dependency of Fam54b localisation differs to the other gene family 54 members, Mtfr1 and Mtfr2, which show a mitochondrial localisation independent of either Miro1 or Miro2. Fam54b was shown to co-immunoprecipitate with both Miro1 and
Miro2; however, unlike Miro1, Miro2 does not appear to regulate the subcellular localisation or stability of Fam54b. One explanation for this is that as the co-immunoprecipitation assay was carried out in whole cell lysates, endogenous Miro1 will be present in the Fam54bGFP plus mycMiro2 experiments. Recently, the Kittler lab (unpublished data), and others (Kanfer et al.,
2015), have shown that Miro1 and Miro2 can form heterodimers; therefore, it is possible that
Fam54bGFP is interacting with endogenous Miro1 directly and then subsequently co- immunoprecipitating mycMiro2 through a Miro1-Miro2 interaction. A further explanation for this could be that the Fam54b-Miro2 interaction has a functional role, i.e. Miro2 does not affect
Fam54b localisation but rather its function.
There is already precedent for a role of Miro1 in recruiting proteins to the mitochondria, with many of the targets described in the literature so far (CENP-F, myosin-19 and DISC1) being shown to be either predominantly on or off the mitochondria under basal conditions (Kanfer et al., 2015; Norkett et al., 2016; Quintero et al., 2009). For example, during interphase CENP-F is localised to the nucleus; however, following nuclear envelope breakdown during mitosis
CENP-F is recruited to the mitochondria and proposed to be important for mitochondrial segregation (Kanfer et al., 2015). Recently, the presence of Miro at the mitochondria has also been shown to be important for the recruitment and stabilisation of myosin-19 at the OMM
(López-Doménech et al., 2018). In contrast to CENP-F and myosin-19 – which have a predominantly nuclear and mitochondrial localisation, respectively – the extent of the mitochondrial localisation of Fam54b is substantial but incomplete. In the case of the recruitment of myosin-19, Miro was been shown to be required for the stability of myosin-19
86 protein levels (López-Doménech et al., 2018). Loss of Miro led to a reduction in the mitochondrial pool of myosin-19 specifically by being degraded by the proteasome.
Interestingly, Miro1 also appears to be necessary for the stability of Fam54b. Given the significant parallels to the case of myosin-19 it is probable that Fam54b requires the presence of Miro1 for its recruitment to the mitochondria and that this interaction protects against proteasomal degradation.
Following substantial or chronic mitochondrial damage, mitochondria are degraded via the lysosome by a specialised form of autophagy known as mitophagy. The best characterised of these is the PINK1/Parkin-mediated mitophagy pathway (Covill-Cooke et al., 2017; Nguyen et al., 2016). One key step following induction of mitophagy is the rapid ubiquitination and degradation of Miro, as well as a wide range of other OMM proteins (Birsa et al., 2014; Sarraf et al., 2013). The purpose of degrading Miro1 is proposed to be in halting mitochondrial motility so that the damaged mitochondrion can be efficiently degraded by the autophagosomal machinery (Ashrafi et al., 2014; Wang et al., 2011). Figure 3.7 shows that following acute loss of Miro during damage, Fam54b levels decrease. The timescale of this decrease is similar to those seen for myosin-19 (López-Doménech et al., 2018). Though not shown here, one would predict that Fam54b would lose its mitochondrial localisation following induction of the PINK1/Parkin mitophagy pathway. Therefore, it may be important to regulate the extent of Fam54b on the mitochondria during mitochondrial damage.
The significance of the recruitment and stabilisation of Fam54b at the mitochondria by Miro1 depends on the function of Fam54b. It is important to note that Miro1, not Miro2, is essential for long-range mitochondrial trafficking (López-Doménech et al., 2018, 2016). Here, Fam54b was shown to negatively regulate mitochondrial dynamics. More specifically, overexpression of Fam54b in Cos7 and neurons led to a decrease in fusion and trafficking of mitochondria.
Furthermore, the mitochondria were more rounded and clustered closer to the nucleus. This perinuclear clustering has been observed in both Miro1KO MEFs and following mitochondrial damage. As mitochondrial fusion and mitochondrial trafficking are inter-related it is probable that the morphological and fusion defects observed with Fam54b overexpression are a consequence of reduced mitochondrial transport (Cagalinec et al., 2013). Therefore, the
87 morphology defects observed would be secondary to a reduction in trafficking as mitochondria that are unable to move would not have the opportunity to fuse.
A role for Fam54b in mitochondrial trafficking is a tantalising prospect when considering that
Fam54b might act as a dynamic pool on the mitochondria. Both the activity of the first
GTPase domain and the calcium binding ability of Miro1 were shown to regulate the subcellular localisation of Fam54b. It is noteworthy, that both of these biochemical features of
Miro1 react on very short timescales and therefore may provide an acute way to regulate the extent of Fam54b on the mitochondria. For example, Miro1 has been shown to coordinate calcium; a feature that has been shown to be particularly important in neurons whereby calcium binding to Miro1 can halt mitochondrial transport during neuronal activity (Macaskill et al., 2009; Wang and Schwarz, 2009). Perhaps the ability of Miro1 to regulate calcium-induced stopping requires the recruitment of Fam54b to the mitochondria. Indeed, structural studies have shown no significant conformational changes to Miro1 upon binding calcium, with the authors proposing that other factors may be required (Klosowiak et al., 2013). Consequently, it would be necessary to test whether increases in cytoplasmic calcium affect the subcellular localisation of Fam54b. Moreover, to test this model fully, the extent of calcium-induced mitochondrial stopping should be studied during conditions in which Fam54b is lost.
Another possibility for the regulation of Fam54b at the mitochondria is through phosphorylation. Two phosphorylation sites for Fam54b were identified, namely S103 and
S238, though neither appear to influence the subcellular localisation of Fam54b. This might be explained by the relatively small pool of phosphorylated Fam54b at basal levels. One important part of the future work of this project would be in identifying the kinase and/or phosphatase to either of the described serine residues. Through an unbiased screen of novel
AMPK substrates, S103 of Fam54b was identified as a potential target of AMPK (Schaffer,
2015). Interestingly, AMPK signalling has been shown to have a role in both mitochondrial trafficking and mitochondria fission. In the case of mitochondrial trafficking, activation of the
AMPK pathway has been shown to promote trafficking in both to axonal branch formation and to the leading edge of cells during migration (Cunniff et al., 2016; Tao et al., 2014).
Furthermore, increases in intracellular ADP – a direct activator of AMPK enzyme activity - has
88 been shown to decrease mitochondrial trafficking (Mironov, 2007). Mechanistically, how
AMPK signalling regulates mitochondrial trafficking has yet to be ascertained. In the case of mitochondrial fission, on the other hand, AMPK activation was shown to phosphorylate the
Drp1-receptor, Mff, leading to Drp1 recruitment to the mitochondrial and subsequent division
(Toyama et al., 2016). As a result, it would be important to study the role of AMPK signalling on the phosphorylation, localisation and function of Fam54b to better understand the role of
Fam54b and mitochondrial dynamics during energy deprivation.
Despite the observed links for Fam54b in mitochondrial dynamics, one should continue to keep an open mind as to the exact function of Fam54b at the mitochondria. There is increasing evidence that Miro has roles outside of mitochondrial trafficking and fission/fusion, including: mitochondria-ER contact sites, peroxisomal trafficking and mitophagy (Inês G
Castro et al., 2018; Kornmann et al., 2011; S. Lee et al., 2016; Nguyen et al., 2016; Okumoto et al., 2017). Therefore, a full understanding of the interplay of Fam54b with these processes would also be required to conclude the exact function of Fam54b. One approach that will be critical in gaining a full understanding of the function of Fam54b is to study the consequences of silencing or knocking out Fam54b. The work described above has relied on overexpression as a means to uncover the function of Fam54b. Complimenting this work with loss of function studies will also allow for rescue of Fam54b with the phosphomutants identified. To conclude, the identification of Fam54b as a novel Miro1 interactor opens up a new avenue into how mitochondrial dynamics can be regulated in response to cellular signalling.
89
4. The mitochondrial Rho-GTPases localise to peroxisomes
Introduction
Cellular health is critically dependent on the optimal supply of metabolites. Two organelles central to metabolism are mitochondria and peroxisomes, both of which having substantial overlap in their function. Peroxisomes are single-membrane bound organelles critical for several key cellular processes including, ROS metabolism, lipid biosynthesis and the β- oxidation of fatty acids; all of which are shared with mitochondria (Demarquoy and Le Borgne,
2015). The importance of functional peroxisomes is emphasised by mutations in key genes for peroxisomal biogenesis (PEX genes) leading to Zellweger spectrum disorder, a multi- organ disorder that often leads to death within the first year of life (Klouwer et al., 2015). Many of the PEX proteins are involved in the biogenesis and protein import pathways that sustain the pool of peroxisomes in the cell alongside proteins regulating peroxisome morphology
(Agrawal and Subramani, 2016; Baker et al., 2016).
Interestingly, along with the overlap in function between mitochondria and peroxisomes, they share some of their proteome. Three such proteins are those related to mitochondrial and peroxisomal fission. hFis1 and Mff has been shown to localise to both mitochondria and peroxisomes and serve as receptors for the dynamin-like GTPase, Drp1 (Gandre-Babbe and van der Bliek, 2008; Koch et al., 2005, 2003). Once at either the mitochondria or peroxisomes, Drp1 can oligomerise and form a requisite step for the fission event. The targeting of hFis1 to the peroxisomes has been characterised as being dependent on binding through its C-terminal transmembrane domain to the cytosolic chaperone, Pex19 (Delille and
Schrader, 2008). Mechanistically, Pex19 is proposed to bind to the transmembrane domains
– and surrounding amino acids – of newly synthesised proteins as they exit cytosolic ribosomes (Delille and Schrader, 2008; Halbach et al., 2006; Matsuzono and Fujiki, 2006;
Sacksteder et al., 2000; Yagita et al., 2013). Once bound, Pex19 traffics the nascent protein
90 to the peroxisomal membrane where it binds Pex3, followed by insertion of the newly translated protein into the peroxisomal membrane.
Together with chaperone binding it is proposed that the biochemical properties of the transmembrane and C-terminal amino acids dictate the subcellular localisation of C-terminally anchored proteins, like hFis1 (Borgese and Fasana, 2011; Borgese et al., 2007). Proteins targeted to mitochondria only, mitochondria and peroxisomes or peroxisomes only have increasingly more positively charged C-termini (Costello et al., 2017). Proteins targeted to the mitochondria only are also more likely to have less hydrophobic transmembrane domain
(Costello et al., 2017). For completeness, C-terminally anchored proteins destined for the ER
(the only other site for the insertion of tail-anchored proteins) through the Bag6/GET pathway have transmembrane domains with high hydrophobicity surrounded by non-charged amino acids (Borgese and Fasana, 2011; Rao et al., 2016). The C-terminal features of tail-anchored proteins are predicted to be important for the targeting to the organelle - as opposed to insertion into the membrane - as in vitro assays have shown spontaneous membrane insertion of C-terminally anchored proteins to occur in liposomes with a variety of phospholipid composition (Brambillasca et al., 2006, 2005).
Like hFis1 the mitochondrial Rho-GTPases, Miro1 and Miro2, are C-terminally anchored proteins critical for mitochondrial dynamics. Both Miro1 and Miro2 exhibit a large N-terminal domain facing the cytoplasm containing two GTPase and two EF-hand domains. The C- terminus beyond this transmembrane domain is very short, at only three amino acids in length. The biochemical properties of the transmembrane domain and the C-terminal residues are predictive of both a mitochondria and peroxisomal localisation, like hFis1 (Costello et al.,
2017). Here, both Miro1 and Miro2 are found to be resident at peroxisomes alongside their mitochondrial localisation. This peroxisomal localisation is regulated by the first GTPase and transmembrane domain of Miro and likely requires the chaperone, Pex19. Furthermore, inclusion of either exon 19 or exon 20 is found to promote peroxisomal localisation.
91
Results
Miro1 and Miro2 localise to peroxisomes
Both Miro1 and Miro2 are well characterised as proteins anchored in the OMM by their C- termini (Fransson et al., 2003). This localisation to the mitochondria is strictly dependent on the transmembrane domain, whereby deletion of this domain leads to Miro localising to the cytoplasm (Fransson et al., 2006). Whilst imaging human GFPMiro1 and GFPMiro2, by fixed confocal imaging, it was noticed that Miro also localises to vesicular structures within the cell.
Given the overlap in function between mitochondria and peroxisomes and the approximate size and distribution of this vesicular signal, cells expressing GFPMiro1 and GFPMiro2 were stained for catalase, a protein that localises to the lumen of mature peroxisomes. Staining with a catalase antibody confirmed that these structures are in fact peroxisomes (Figure
4.1A&B). Quantification of the extent of GFP signal that colocalised with peroxisomes but not mitochondria showed that both GFPMiro1 and GFPMiro2 were significantly enriched over
GFPTom70(1-70) (a fusion of the mitochondrial-targeting sequence of the OMM Tom70; known as control from hereon); controlling for mislocalisation of the OMM proteins in general (Figure
4.1A-C). Therefore, alongside their mitochondrial localisation, both Miro1 and Miro2 can localise to peroxisomes.
Miro interacts with the peroxisome-membrane protein chaperone, Pex19
Like Miro, hFis1 is a C-terminally anchored protein that can localise to both mitochondria and peroxisomes (Koch et al., 2005). Interestingly, the localisation of hFis1 to peroxisomes is mediated by the peroxisomal-membrane protein chaperone, Pex19; a cytosolic receptor which binds to newly synthesised proteins and aids in their insertion into the peroxisomal membrane (Delille and Schrader, 2008; Jones et al., 2004; Matsuzono and Fujiki, 2006;
Sacksteder et al., 2000; Yagita et al., 2013). The interaction of Pex19 with its targets is dependent on their transmembrane domains and surrounding amino acids (Delille and
Schrader, 2008; Halbach et al., 2006; Jones et al., 2004). To test whether Pex19 may also be the mediator of the peroxisomal localisation of Miro, the possibility for an interaction between
Pex19 and Miro was explored. mycPex19 and either full-length mycMiro1 or Miro1 lacking its transmembrane domain (mycΔTM1) were transfected into Cos7 cells. Pulldown of mycPex19
92
Figure 4.1: Miro1 and Miro2 localise to peroxisomes. A) (whole cell) and B) (zoom) Representative images of wild-type MEFs expressing GFPTom70(1-70) (Control), GFPMiro1 and GFPMiro2. Mitochondria (red) and peroxisomes (magenta) were stained with Tom20 and catalase antibodies, respectively. Arrow shows localisation of the peroxisome used in the zoomed images. C) Quantification of the extent of peroxisomal localisation of GFP-tagged constructs by the integrated density of GFP signal that overlapped with catalase signal. n=18 cells over three independent experiments. *** refers to p < 0.001 in comparison to control cells by one-way ANOVA with post hoc Newman-Keuls test. A) Scale bar is 10 μm. B) Scale bar is 5 μm.
93
Figure 4.2 Schematic of Miro1 and Miro2 truncation constructs. Human Miro1 truncation constructs are as follows: Miro1 (1-618), ΔTM1 (Miro1 lacking 593-618), EF1-EF2-GTP2 (184-618 only), GFPGTP1 (1-184 fused to 562-618), GTP2 (412-618 only), C-terminus (562- 618) Miro2 (1-618), ΔTM2 (Miro2 lacking 593-618).
94
Figure 4.3: Miro1 and Miro2 interact with the PMP chaperone, Pex19. A) Myc-tagged Pex19 was transfected in Cos7 cells alongside either full-length Miro1 (mycMiro1) or Miro1 lacking its transmembrane domain (mycΔTM1). Pulldown of mycPex19 was achieved by anti- Pex19 antibody. Figure shows representative western blot following the immunoprecipitation experiment. B) Same experimental paradigm as A) but with mycMiro2 and mycMiro2 lacking its transmembrane domain (mycΔTM2).
95 with an anti-Pex19 antibody was shown to robustly co-immunoprecipitate full-length mycMiro1; however, deletion of the transmembrane domain of Miro1 completely abolished this interaction (Figure 4.2 & 4.3A). An interaction with Miro2 with and without its transmembrane domain was also carried out by a similar approach. Co-immunoprecipitation was observed between full-length Miro2 and Pex19 highlighting that Pex19 can interact with both Miro1 and
Miro2 (Figure 4.3B). Unfortunately the mycΔTM2 construct precipitated with both the Rb IgG control and Pex19. Therefore it is difficult to conclude whether or not the interaction of Miro2 and Pex19 is mediated through the transmembrane domain like Miro1. Given these interactions it is possible that Miro is targeted to the peroxisomes from cytoplasmic ribosomes in accordance with Pex19’s function.
The first GTPase domain of Miro1 modulates peroxisomal localisation
Structurally Miro has a large N-terminal region with two calcium EF-hand domains flanked by a GTPase domain on either side (Yamaoka and Hara-Nishimura, 2014). To investigate whether any of these features were important for the peroxisomal localisation of Miro, Miro1 truncation mutant constructs were generated (Figure 4.2) and expressed in Miro1 / Miro2 double knockout (DKO) MEFs. The truncation constructs included: GFPEF1-EF2-GTP2 (184-
618 only), GFPGTP1 (1-184 fused to 562-618) and GFPGTP2 (412-618 only). Mitochondria and peroxisomes were stained by Tom20 and catalase, respectively, and the extent of localisation to peroxisomes quantified by the amount of GFP signal on peroxisomes that does not overlap with mitochondria. Like Figure 4.1A&B, GFPMiro1 was enriched on peroxisomes, whereas the control construct was not (Figure 4.4A&B). Furthermore, GFPGTP2 localised to peroxisomes to a similar extent as full-length Miro1. Strikingly, deletion of the first GTPase domain (GFPEF1-
EF2-GTP2) led to a dramatic increase in the extent of peroxisomal localisation in comparison to full-length GFPMiro1 and GFPGTP2 (Figure 4.4A&B). Interestingly, the GFPGTP1 construct did not show a significant enrichment over control. To test if these truncation constructs affected the interaction of Miro1 with Pex19, co-immunoprecipitation experiments were carried out.
The GFP-tagged Miro truncation constructs (Figure 4.2) and mycPex19 were expressed in
Cos7 cells. Pulldown of the GFP-tagged Miro1 constructs with GFP-Trap agarose beads
96
Figure 4.4: Deletion of the first GTPase domain of Miro1 enhances peroxisomal localisation. A) Expression of GFP-tagged Miro1 truncation constructs in DKO MEFs. Mitochondria (red) and peroxisomes (magenta) were stained with Tom20 and catalase antibodies, respectively. Arrow shows localisation of the peroxisome used in the zoomed images. B) Extent of GFP signal that colocalises with peroxisomes. n=18 cells over three independent experiments. ** and *** refers to p < 0.01 and p < 0.001, respectively, in comparison to control cells by one-way ANOVA with post hoc Newman-Keuls test. ### refers to p < 0.001 in comparison to GFPMiro1 by one-way ANOVA with post hoc Newman-Keuls test. Scale bar is 5 μm.
97
Figure 4.5: Co-immunoprecipitation of Pex19 with Miro1 truncation constructs. Western blot analysis of Cos7 cells transfected with GFP-tagged Miro1 truncation constructs and myc- tagged Pex19. Immunoprecipitation was carried out with GFP-Trap agarose beads.
98 showed co-immunoprecipitation with full-length GFPMiro1, GFPEF1-EF2-GTP2 and GFPGTP2. In contrast, GFPGTP1 interacted with Pex19 to a lesser extent (Figure 4.5).
To further probe the amino acid sequence requirements for the peroxisomal localisation of
Miro1, a construct was generated containing the amino acid residues 562-618 fused to GFP
(GFPC-terminus from hereon). This includes all residues beyond the second GTPase domain, and therefore contains the transmembrane domain and C-terminal amino acids. This truncation construct was found to localise to peroxisomes as confirmed by colocalisation with the peroxisomal marker Pex14 (Figure 4.6A). Despite this, using the quantitative approach for peroxisomal localisation used in Figures 4.1&4.4, GFPC-terminus was not found to be more peroxisomally enriched than the control construct; akin to GFPGTP1 in Figure 4.4 (Figure
4.6B). Therefore, it is probable that features between the first GTPase domain and the C- terminus of Miro are required for its peroxisomal targeting. Given this and the necessity of the transmembrane domain of Miro for the interaction with Pex19 and the widely reported cytoplasmic localisation of Miro1 lacking a transmembrane domain, it is likely the transmembrane is required for the targeting of Miro to peroxisomes but not necessarily sufficient.
As deletion of the first GTPase domain caused a peroxisomal enrichment of Miro1, the effect of GTPase1 enzyme activity on peroxisomal localisation was tested. The GTPase activity of
GTPase1 can be converted to a constitutively active and dominant negative form by mutation of P13V and T18N, respectively (Fransson et al., 2003). Expression of GFPMiro1, GFPV13
(GFP-tagged P13V) and GFPN18 (GFP-tagged T18N) in WT MEFs showed that all three constructs localised to catalase-positive structures (Figure 4.7A). Quantification of the amount of either of these forms of Miro on peroxisomes showed a significant enrichment over control but no statistical difference between one another (Figure 4.7B). Therefore, though the first
GTPase domain appears to have a regulatory role in the peroxisomal localisation of Miro1, a lack of GTPase activity is unlikely the cause of the increase in peroxisomal localisation observed in GFPEF1-EF2-GTP2 (Figure 4.4A&B).
99
Figure 4.6: Localisation of the C-terminus of Miro1. A) Representative images of DKO MEFs expressing GFPTom70(1-70) (Control), GFP-tagged Miro1 and GFPC-terminus (amino acids 562-618 of human Miro1 fused to GFP). Mitochondria (red) and peroxisomes (magenta) were stained with Mitotracker Orange and Pex14, respectively. B) Quantification of the integrated density of GFP signal on peroxisomes for the three constructs shown in A). n=18 cells per condition over three independent experiments. *** refers to p < 0.001 in comparison to control cells by one-way ANOVA with post hoc Newman-Keuls test. ## refers to p < 0.01 in comparison to GFPMiro1 by one-way ANOVA with post hoc Newman-Keuls test. Scale bar is 5 μm.
100
Figure 4.7: Enzyme activity of the first GTPase domain of Miro1 does not affect peroxisomal localisation. A) Confocal images of wild-type MEFs transfect with GFPTom70(1- 70) (Control) and GFP-tagged Miro1 constructs. GFPMiro1 is human variant 1 of Miro1. GFPV13 and GFPN18 are GFP-tagged P13V (constitutively active) and T18N (dominant negative) mutant Miro1 constructs. B) Extent of peroxisomal localisation of GFP constructs as quantified by integrated density. n=18 cells per condition over three independent experiments. *** refers to p < 0.001 in comparison to control cells by one-way ANOVA with post hoc Tukey test. Scale bar is 5 μm.
101
Miro1 splice variants differentially localise to mitochondria and peroxisomes
Recently, three new splice variants of Miro1 have been described (Okumoto et al., 2017). The splice variants described are variant 2 (including exon 19), variant 3 (including exon 20) and variant 4 (including both exon 19 and 20); the inclusion of these exons occurs between the second GTPase domain and the transmembrane (Figure 4.8). The original variant of Miro1 described in Fransson et al. (2003) and indeed most widely used in literature to date – known as variant 1 - contains neither exon 19 nor exon 20. Through scoring of subcellular localisation by fixed fluorescent imaging in HeLa cells Okumoto et al. (2018) proposed that variant 1 and variant 3 are localised to the mitochondria only and variant 2 localises to both mitochondria and peroxisomes. Variant 4, containing both exon 19 and 20, is suggested to localise solely to peroxisomes in the majority of cells, though it can localise to mitochondria and peroxisomes in a subset of cells. To confirm whether similar splicing in mouse Miro1 exhibits this localisation, the mouse variants were cloned into the pEGFP-C1 vector. As mouse variant 4 is not commercially available this construct was made from the variant 2 and variant 3.
To control for competition with endogenous Miro1 or Miro2, the four variants were expressed in the DKO MEFs (López-Doménech et al., 2018). In concordance with data from the figures above, variant 1 has a predominantly mitochondrial localisation and a partial peroxisomal localisation (Figure 4.9A). Variant 2 and variant 4, have an enriched peroxisomal localisation, most exaggerated in the case of variant 4. Despite being primarily localised to peroxisomes, a small pool of variant 4 is visible on the mitochondria of most cells. Finally, variant 3 appeared to be mostly localised to mitochondria, though a significant pool was observed on peroxisomes (Figure 4.9A). To fully characterise the subcellular localisation of the four Miro1 splice variants, quantification of peroxisomal and mitochondrial localisation was carried out. In agreement with the observations in Figure 4.1, 4.4, 4.6 & 4.7 variant 1 was enriched on peroxisomes in comparison to the control construct. Indeed all splice variants exhibited a significant peroxisomal localisation (Figure 4.9A&B). Importantly, variants 2, 3 & 4 all showed a more exaggerated peroxisomal localisation in comparison to variant 1, with both variant 2 and variant 4 having the largest peroxisomal pool (Figure 4.9B).
102
Figure 4.8: Schematic of mouse Miro1 splice variants. Mouse Miro1 variants differ as follows: v1 (1-631), v2 (v1 including exon 19: a 32 amino acid addition after 593), v3 (v1 including exon 20: a 41 amino acid addition after 593) and v4 (v1 including both exon 19 and 20 after 593).
103
Figure 4.9: Dual localisation of Miro1 splice variants to peroxisomes and mitochondria. A) Representative images of DKO MEFs transfected with GFPTom70(1-70) (Control) and GFP- tagged mouse Miro1 splice variant constructs. Mitochondria (red) and peroxisomes (magenta) visualised by Mitotracker Orange and Pex14 staining, respectively. B) Quantification of the integrated density of GFP (Control or Miro1 splice variant) signal on peroxisomes. C) Quantification of the integrated density of GFP (Control or Miro1 splice variant) signal on mitochondria. n=18 cells per condition over three independent experiments. * and *** refers to p < 0.05 and p < 0.001, respectively, in comparison to control cells by one-way ANOVA with post hoc Newman-Keuls test. ### refers to p < 0.001 in comparison to GFPv1 by one-way ANOVA with post hoc Newman-Keuls test. Scale bar is 5 μm.
104
Characterisation of the extent of mitochondrial localisation of the four variants showed that variant 1 and variant 3 localised to a similar extent to mitochondria as the control construct, through there was a trend to a decrease in variant 3 (Figure 4.9C). Importantly, variant 2 had a significant reduction in its mitochondrial localisation in comparison to control, which was further reduced in variant 4 (Figure 4.9C). As a result, the inclusion of either exon 19 or 20 can significantly increase the amount of Miro1 on peroxisomes, though this phenotype is stronger in the case of exon 19. Moreover, the inclusion of both exon 19 and exon 20 appears to be additive in leading to an almost complete localisation of Miro1 to peroxisomes.
Discussion
To summarise, alongside their mitochondrial localisation both Miro1 and Miro2 can be found localised to peroxisomes. This peroxisomal localisation is likely dependent on the ability of the transmembrane domain of Miro to bind to Pex19 and can be enhanced by deletion of the N- terminal GTPase domain. Finally, the inclusion of exon 19 and/or exon 20 promotes peroxisomal-targeting. These data have come in parallel to work from two other independent groups, confirming that Miro localises to peroxisomes (Inês G Castro et al., 2018; Costello et al., 2017; Okumoto et al., 2017).
Given that Miro1 and Miro2 are observed to have a dual localisation to mitochondria and peroxisomes, it is important to establish how this differential targeting is achieved. In the case of the C-terminally anchored protein family – to which Miro is a member – it is proposed that the interaction with chaperones is not required for the insertion of the newly synthesised tail- anchored protein, but rather important for their targeting to organelles (Borgese and Fasana,
2011). Here, Miro1 is shown to interact with the peroxisomal-membrane protein chaperone,
Pex19, in agreement with previous work (Inês G Castro et al., 2018; Okumoto et al., 2017).
This interaction is found to be dependent on the presence of the transmembrane domain of
Miro1, which fits with the current paradigm of how Pex19 interacts with its targets. Though an interaction between Miro and Pex19 was observed, this does not definitively show that Pex19 per se is the means by which Miro localises to peroxisomes. Okumoto et al. (2018) showed using a semi-intact cell assay overlaid with purified Pex19 that Pex19 can indeed promote the insertion of Miro into the peroxisomal membrane. Knockdown of Pex19 would further confirm
105 if Pex19 is strictly required for the peroxisomal localisation of Miro. If insertion of Miro into the peroxisomal membrane is akin to hFis1 then one would predict that a significant reduction in peroxisomally-localised Miro would be observed under acute loss of Pex19 (Delille and
Schrader, 2008).
One broader theme that arises from the data above is that both the inclusion and exclusion of amino acid sequences within Miro regulate the extent of Miro localised to peroxisomes. One such feature that appears to modulate the subcellular localisation of Miro is the first GTPase domain. Truncation of Miro1 through deletion of the first 388 amino acids leads to a significant increase in the peroxisomal pool of Miro1, which is unlikely to be due to alterations in GTPase activity of Miro. As Miro interacts with Pex19, one possibility for the observed role of the first
GTPase domain on the subcellular localisation of Miro is that this domain negatively regulates the interaction with this chaperone. In fact, a reduced co-immunopreciptation with GFPGTP1 was observed. Despite this, as a reduction in the extent of peroxisomal localisation of GFPC- terminus in comparison to full-length Miro was found, it is probable that there is a complex interplay of chaperones in the insertion of Miro into both the mitochondria and peroxisomes.
Moreover, no increase in Pex19 interaction with the GFPEF1-EF2-GTP2 construct was seen in comparison to full-length Miro1; as a result it is more likely that the mechanism by which truncation of the first GTPase domain occurs is not through Pex19 but rather the absence of other critical features within Miro.
Another mechanism that modulates the degree to which Miro localises to peroxisomes is differential splicing. Recently, Okumoto et al. (2018) described three new splice variants for
Miro1. All three have the same amino acid sequence as variant 1 with either the inclusion of exon 19, exon 20 or both exon 19 and 20, named variant 2, 3 and 4, respectively. The authors show that variant 2 localises to both mitochondria and peroxisomes, variant 4 predominantly localises to peroxisomes and that variant 1 and 3 localise solely to mitochondria. They therefore conclude that the inclusion of exon 19 promotes peroxisomal targeting and suggest that this exon permits the interaction of Miro1 with Pex19. However, the data above show that variant 1 of Miro1 and Miro2, both of which lack exon 19, are able to localise to peroxisomes. Though Okumoto et al. (2018) propose that sequences in exon 19
106 are the site of interaction of Miro to Pex19, this work shows that splice variant 1 of Miro can also interact with Pex19. Furthermore by expressing all mouse splice variants in DKO MEFs, all variants were found to localise to peroxisomes to some extent. In fact, variant 3 was found to localise to peroxisomes more than variant 1, contradicting the work of Okumoto et al.
(2018) where they report that both variant 1 and 3 exhibit the same subcellular localisaton.
Therefore, this provides evidence to suggest that both exon 19 and exon 20 are pro- peroxisomal and that the inclusion of both may explain why variant 4 has such a dramatic peroxisomal localisation. Furthermore, it is likely that these exons are not sites strictly necessary for the Miro1-Pex19 interaction, but regulatory sequences.
One important question in understanding the dual localisation of Miro is: how is Miro targeted to mitochondria? Recent work in yeast has described that the ssa1/2 heat shock proteins are required for efficient targeting of Fis1 and Gem1 (the yeast homologue of Miro1/2) to mitochondria (Cichocki et al., 2018). They further suggest that Pex19 may be required, further supporting the idea of chaperone binding to Miro being an essential part of the subcellular localisation of Miro. Another candidate is HSC70 (Hspa8). Indeed HSC70 has been suggested as a mitochondria-targeting chaperone and has been observed in proteomic data from Miro-interaction studies (Borgese and Fasana, 2011; Kanfer et al., 2015). Taking the results of this chapter, alongside those already published, the following model for the mitochondrial and peroxisomal localisation of Miro is proposed. Under the assumption that
Miro is translated on cytosolic ribosomes - as Miro is a C-terminally anchored protein – then much of the subcellular targeting will occur by chaperones binding post-translationally. Given that deleting the first GTPase domain leads to an enrichment of Miro on peroxisomes and that this would be the first part of the protein to be translated, it could be that a pro-mitochondrial localisation factor binds to GTPase1 e.g. HSC70. Then as the C-terminal most part of the protein is translated Pex19 can bind to the transmembrane of any Miro that is left to target it to peroxisomes. Therefore, sequences within Miro such as exon 19 and 20 would regulate chaperone binding and ultimately the extent of mitochondria and peroxisomal targeting.
Miro1 and Miro2 add to the ever growing list of mitochondrial proteins that are now known to additionally localise to peroxisomes. These include: Mff, Drp1, hFis1, Usp30, Mul1, MAVS,
107
Bcl-XL, Bcl2, OMP25 and GDAP1 (Costello et al., 2017; Gandre-Babbe and van der Bliek,
2008; Koch et al., 2005, 2003; Marcassa et al., 2018; Neuspiel et al., 2008). It is noteworthy that like Miro1 and Miro2 many of these proteins are involved in mitochondrial/peroxisomal dynamics, maintaining the size, morphology and turnover of both organelles. In light of the substantial overlap in mitochondrial and peroxisomal function it is possible that the morphology and turnover of mitochondria and peroxisomes might be coordinated in response to alterations in metabolism. Mechanistically, Miro could be modulated by the relative extent of mitochondrial and peroxisomal localisation of these dually localised proteins. In fact, during peroxisomal proliferation the peroxisomal pool of Drp1 has been shown to increase (Koch et al., 2003). Therefore, it is possible that the extent of Miro on peroxisomes and mitochondria could be fine-tuned to cellular needs. As both mitochondria and peroxisomes carry out β- oxidation of fatty acids and ROS metabolism it would be interesting to study the effect of challenging the cells with chronic, low level ROS damage or by stimulating the usage of fatty acids as an energy carbon source on the localisation Miro, and indeed all the dually-localised proteins. Furthermore, given the different metabolic requirements of cells, it would be interesting to analyse the expression levels of the individual splice variants in different cell types. The levels of peroxisomal localised Miro variants may be upregulated in cell-types particularly dependent on peroxisomal processes, such as the liver (for drug metabolism) and oligodendrocytes (for lipid constituents of myelin).
All in all, this work describes a peroxisomal localisation for the mitochondrial Rho-GTPases,
Miro1 and Miro2, with the mitochondria:peroxisome ratio of Miro localisation being altered by amino acids sequences within Miro itself. From this, several important questions arise, not least: does Miro share any of its canonical roles that is has at mitochondria with peroxisomes? And if not, what are the functional consequences of the peroxisomal localisation of Miro? These questions will be the focus of the next chapter.
108
5. The role of Miro at peroxisomes
Introduction
Peroxisomes must be maintained in morphology, number and distribution to ensure that peroxisomal processes can meet the demands of the cell (Smith and Aitchison, 2013). As a result, machineries have evolved to continually alter peroxisomal dynamics in response to environmental changes. Peroxisomal number and morphology can be modulated by two main mechanisms. Firstly, de novo formation of peroxisomes in mammalian cells occurs by the fusion of pre-peroxisomal vesicles from the ER (Pex16-containing) and mitochondria (Pex3- containing), resulting in an import competent peroxisome (Sugiura et al., 2017). Following the establishment of an import-competent, pre-peroxisomal seed, step-wise import of proteins occurs until the full complement of peroxisomal proteins are present in a mature, functional peroxisome (Agrawal and Subramani, 2016). This is dependent on many of the PEX genes; a family of proteins required for peroxisomal formation many of which are linked to Zellweger
Syndrome (Klouwer et al., 2015).
In parallel to de novo biosynthesis, peroxisome proliferation and morphological changes can occur by elongation and subsequent fission of existing peroxisomes (Schrader et al., 2016).
Key proteins in this process have been described with some overlap in machinery to mitochondrial fission. Before peroxisomal fission occurs, peroxisomes are elongated by
Pex11β (Koch et al., 2010). Once elongated, peroxisomal fission is then elicited by hFis1 or
Mff recruiting Drp1 from the cytoplasm to the peroxisomal membrane (Gandre-Babbe and van der Bliek, 2008; Koch et al., 2005; Koch and Brocard, 2012; Williams et al., 2015). It is assumed that this fission event is analogous to mitochondrial fission where Drp1 oligomerises and then the GTPase activity constricts the membrane before scission. Interestingly, mutations in both Pex11β and Drp1 have been linked to human pathologies (Chao et al.,
2016; Ebberink et al., 2012).
Alongside elongation and fission, peroxisomes can be regulated spatially through trafficking.
The current paradigm in animal cells is that ~10% of peroxisomes undergo long-ranged microtubule-dependent trafficking (Huber et al., 1997; Rapp et al., 1996; Schrader et al.,
109
1996; Wiemer et al., 1997). This microtubule-dependent trafficking is likely modulated by the kinesin-1 family of motors and dynein, although there is also precedent for the involvement of
KifC3 (Dietrich et al., 2013; Kural et al., 2005; Schrader et al., 2000). The importance of the integrity of microtubule-dependent peroxisomal trafficking is highlighted in SPAST mutant
(linked to Hereditary Spastic Paraplegia), neuron-like cells. In this model peroxisomal trafficking is significantly reduced, leading to faulty ROS handling and subsequent cell death
(Abrahamsen et al., 2013; Fan et al., 2014; Wali et al., 2016). The other ~90% of peroxisomal motility is poorly defined and often described as being purely Brownian motion and has therefore received little attention in its regulation (Huber et al., 1997, 1999). However, given that peroxisomes transiently contact several organelles this oscillatory motility may maintain peroxisome-organelle contact sites (Inês Gomes Castro et al., 2018; Shai et al., 2016).
The previous chapter showed that Miro1 and Miro2 – two mitochondrial proteins required for mitochondrial dynamics – are also resident at peroxisomes. Here, the function of this localisation is explored by studying peroxisomal dynamics. Despite, the well-characterised roles of Miro in long-range mitochondrial trafficking and distribution, Miro is not found to regulate long-range peroxisomal trafficking and distribution. Instead, loss of Miro in
Miro1/Miro2 double knockout MEFs reduces short-range peroxisomal displacements.
Interestingly, these short-range displacements are dependent on the movement of the ER but not mitochondria. Further to this role in peroxisomal transport, Miro was found to modulate peroxisomal morphology, whereby loss and overexpression of Miro leads to a rounded and more tubular morphology, respectively.
Results
Effect of Miro on peroxisomal distribution
Miro has been extensively characterised as being critical for microtubule-dependent mitochondrial trafficking and distribution (Birsa et al., 2013; Fransson et al., 2006; López-
Doménech et al., 2018, 2016). As a result, a similar role in peroxisomal distribution was explored. To study the role of Miro in peroxisomal distribution a Sholl-based method was
110
Figure 5.1: Sholl analysis on organelle distribution. A) From left to right: the shape on the fibronectin pattern used to seed cells onto; F-actin staining by phalloidin to highlight the cell shape after being seeding onto Y-shaped fibronectin pattern; Schematic of how organelle Sholl analysis is carried out. B) Representative images of mitochondrial distribution – as observed by Tom20 staining – in wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs. C) Normalised cumulative distribution of mitochondrial signal quantified by organelle Sholl. D) Quantification of the distance at which 95% of mitochondria are situated within the cell. n=40 cells over three independent experiments. *** denotes p < 0.001 by Student’s t-test. Scale bar is 5 μm.
111 employed, as published previously (Figure 5.1) (López-Doménech et al., 2018, 2016). Briefly,
MEFs were seeded on Y-shaped fibronectin patterned coverslips to standardise cell shape
(Figure 5.1A). Mitochondria and peroxisomes were then stained with Tom20 and catalase, respectively. Organellar distribution was then quantified by drawing concentric circles from the centre of the cell at 1 μm distance apart and the inter-circle signal being plotted with relationship to distance from centre (Figure 5.1A). Furthermore, from these values it is possible to ascertain the distance at which 95% of the organelle of interest can be found
(Mito95 or Perox95 for mitochondria and peroxisomes, respectively). Using this approach with
WT and Miro1/Miro2 double knockout MEFs (DKO MEFs), it was possible to confirm that the loss of Miro leads to a perinuclear collapse of the mitochondrial network (López-Doménech et al., 2018), as observed by a left shift in the DKO MEFs in the cumulative distribution and a significant reduction in the mito95 (Figure 5.1B-D).
To quantify whether Miro has a role in the basal distribution of peroxisomes, the distribution of catalase signal in WT, Miro1KO, Miro2KO and DKO MEFs was compared using this Sholl- based approach. Loss of Miro had no effect of the distribution of peroxisomes, as observed by no difference in the normalised cumulative distribution of peroxisomes between any of the four genotypes (Figure 5.2A&B). Furthermore, calculating the distance at which 95% of peroxisomal signal lies (Perox95) within the cell showed no significant difference, emphasising that loss of Miro has no effect on peroxisomal distribution (Figure 5.2C). To probe the effect of
Miro on peroxisomal distribution further, WT MEFs were transfected with GFPMiro1, GFPMiro2 and GFPEF1-EF2-GTP2 (Miro1 lacking its first GTPase, shown to promote peroxisomal localisation (Figure 4.4 in Chapter 4)), to test the effect of overexpression of Miro on peroxisomal positioning. Overexpression of GFPMiro1, GFPEF1-EF2-GTP2 or GFPMiro2 were found to have no effect on peroxisomal distribution in comparison to the GFPTom70(1-70) control as observed by the normalised cumulative distribution and Perox95 (Figure 5.3A-C). As a result, Miro does not appear to have a role in establishing the basal distribution of peroxisomes.
112
Figure 5.2: Miro knockout does not affect basal distribution of peroxisomes in mouse embryonic fibroblasts. A) Representative images of peroxisome (catalase) distribution in wild-type (WT), Miro1KO, Miro2KO and Miro1/Miro2 double knockout (DKO) MEFs seeded onto Y-shaped fibronectin micropatterns. B) Normalised cumulative distribution of peroxisomal signal quantified by organelle Sholl. C) Quantification of the distance at which 95% of peroxisomes are situated within the cell. n=60 cells over three independent experiments. Statistical differences were checked by one-way ANOVA with post hoc Tukey test.
113
Figure 5.3: Miro overexpression does not affect basal distribution of peroxisomes in mouse embryonic fibroblasts. A) Representative images of peroxisome (catalase) distribution in wild-type MEFs transfected with GFPTom70(1-70), GFPMiro1, GFPMiro2 and GFP- tagged Miro1 lacking its first GTPase domain (GFPEF1-EF2-GTP2) seeded onto Y-shaped fibronectin micropatterns. B) Normalised cumulative distribution of peroxisomal signal quantified by organelle Sholl. C) Quantification of the distance at which 95% of peroxisomes are situated within the cell. n=60 cells over three independent experiments. Statistical differences were checked by one-way ANOVA with post hoc Tukey test.
114
Miro does not mediate long-range peroxisomal trafficking
Peroxisomal trafficking has been shown to occur by long-ranged (saltatory) trafficking and shorter-ranged (oscillatory) motility occurring at a prevalence of ~10% and 90%, respectively
(Huber et al., 1999; Rapp et al., 1996; Wiemer et al., 1997). Despite making up a smaller proportion of peroxisomal trafficking events, long-range transport is the best characterised out of the two types of transport. Long-range trafficking is dependent on the microtubule cytoskeleton and proposed to use the kinesin-1 and dynein motors (Kural et al., 2005; Rapp et al., 1996; Schrader et al., 2000). To study the role of Miro in microtubule-dependent peroxisomal trafficking, pxDsRed (DsRed2 localised to the peroxisome lumen via a PTS1, peroxisome-targeting sequence 1) was transfected in both WT and DKO MEFs. Cells were then imaged live, with images being taken every 1.5 seconds for two minutes. Interestingly, despite the well-established role of Miro in long-range mitochondrial trafficking, long-range peroxisomal transport events were still observed in both WT and DKO MEFs (Figure 5.4A).
Microtubule-dependent peroxisomal trafficking events are often quantified by scoring their stereotyped saltatory movement; defined as directed movement above 0.5-2 μm (Huber et al.,
1997; Okumoto et al., 2017; Schrader et al., 2000; Wiemer et al., 1997). Upon blind scoring, the number of saltatory events over the two minute period was not significantly different between the WT and DKO MEFs (Figure 5.4B). Long-range trafficking events were also manually tracked using the MTrackJ plugin in ImageJ. From this analysis, it was found that the length of individual tracks did not differ between the WT and DKO MEFs (Figure 5.4C).
On the other hand, there was a small but significant decrease in the mean velocity of individual tracks (Figure 5.4D). As a result, loss of Miro does not affect the number and length of long-range peroxisomal trafficking events, but may slightly impede the velocity of individual peroxisomes.
Loss of Miro reduces short-range peroxisomal transport
Despite being the best characterised mode of peroxisomal movement, long-range microtubule-dependent trafficking of peroxisomes only accounts for 10% of the movement at any one time. The other 90% is made up of shorter-range displacements often referred to as oscillatory motility. Oscillatory motility was originally dismissed as simply Brownian motion of
115
Figure 5.4: Loss of Miro does not affect long-range peroxisomal trafficking. A) Representative still images of peroxisome trafficking in wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs. Images were taken from two minute movies of pxDsRed signal imaging at one frame every 1.5 seconds. Arrow depicts the long-range transport of a peroxisome. B) Blind counting of the number of long-range peroxisomal trafficking events per cells during a two minute movie. C) Quantification of the length of individual long-range tracks per cells. E) Quantification of the velocity of long-range peroxisomal trafficking events. n=23 cells for WT and 21 cells for DKO over three independent experiments. ns and * denote p ≥ 0.05 and p < 0.05, respectively, by Student’s t-test. Scale bar is 5 μm.
116 peroxisomes in the cytoplasm (Huber et al., 1997; Rapp et al., 1996; Wiemer et al., 1997); although actin has been proposed to play a role in this short-range transport (Bharti et al.,
2011). With their multifaceted roles in metabolism peroxisomes are often homogenously distributed throughout the cell, making contacts with several organelles (Inês Gomes Castro et al., 2018; Valm et al., 2017). In fact, despite making up a small proportion of the cell, peroxisomes can explore up to ~30% of the cytoplasmic volume in a 15 minute period (Valm et al., 2017). Recently, Miro has been shown to regulate short-range motion of mitochondria, with the proposition of this being mediated by the mitochondrial myosin, myosin-19 (López-
Doménech et al., 2018). Taking this into consideration in conjunction with Miro appearing not to mediate long-range peroxisomal trafficking, the possibility of Miro regulating short-range peroxisomal transport was explored.
To investigate the role of Miro in oscillatory motility, pxDsRed was expressed in WT and DKO
MEFs and imaged at one frame every 1.5 seconds. Individual peroxisomes were then automatically tracked using the ImageJ plugin, TrackMate (Figure 5.5A). To quantify changes in oscillatory motility, the median net displacement of peroxisomes was calculated and compared between genotypes. The median net displacement is defined as the median distance a peroxisome has moved between the first and last frame. Interestingly, there was a significant decrease in peroxisomal displacement in the DKO MEFs in comparison to WT
MEFs (Figure 5.5A&B). As no difference in long-range trafficking was observed and the majority of peroxisomal transport events being oscillatory motility, this difference in displacement is accounted for by shorter-range peroxisomal trafficking. Therefore, Miro has a role in mediating shorter-range peroxisomal displacements. To further probe the requirement for Miro in short-range motility, peroxisomal trafficking was studied upon loss of Miro1 or
Miro2 in single knockout MEFs. The pxDsRed construct was transfected into WT, Miro1KO and Miro2KO MEFs and DKO MEFs and live imaged at one frame every 1.5 seconds. Analysis of the median net displacement of peroxisomes showed that knockout of either Miro1 or Miro2 singularly, did not lead to a significant decrease in peroxisomal movement in comparison to
WT cells; however, like Figure 5.5 a significant decrease in DKO MEFs was observed (Figure
5.6A&B). Therefore, Miro1 and Miro2 can compensate for one another to maintain short- range peroxisomal displacements.
117
Figure 5.5: Loss of Miro leads to a reduction in short-range peroxisomal displacements. A) Still images and representative tracks of pxDsRed (peroxisome) motility in wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs. Tracks represent those from a two minute movie imaged at one frame every 1.5 seconds. B) Quantification of the distance peroxisomes have moved by the change in peroxisome position in between the first and last frame. n=23 cells for WT and 21 cells for DKO over three independent experiments. *** denotes p < 0.001 by Student’s t-test.
118
Figure 5.6: Effect of Miro single knockout on short-range peroxisomal transport. A) pxDsRed transfected in wild-type (WT), Miro1KO, Miro2KO and Miro1/Miro2 double knockout (DKO) MEFs. Cells were imaged at one frame every 1.5 seconds. Representative tracks and still images of pxDsRed motility. B) Quantification of the median net displacement of peroxisomes over the two minute movie. n=24 cells over three independent experiments. *** denotes p < 0.001 in comparison to WT by one-way ANOVA with post-hoc Newman-Keuls test.
119
In view of the lack of mechanistic information of oscillatory motility and Miro’s role in shorter- range peroxisomal trafficking, two questions are raised: How is oscillatory motility elicited?
How is Miro regulating this type of transport? As organellar trafficking is linked to the various cytoskeletons of the cell, peroxisomal trafficking was quantified under conditions of microtubule or actin-microfilament disruption. Firstly, microtubules were depolymerised by addition of 1 μM vinblastine for 1 hour. By carrying out the peroxisomal trafficking assays above and quantifying median net displacement of peroxisomal movement using TrackMate, treatment with vinblastine did not lead to a change in oscillatory motility in WT or DKO MEFs
(Figure 5.7A&B). Furthermore, and more importantly, the reduction in peroxisomal motility was maintained when comparing WT and DKO MEFs treated with vinblastine. Therefore, the reduction in median net peroxisomal displacement does not appear to be mediated by the microtubule cytoskeleton. Importantly, however, long-range peroxisomal displacements as quantified by blind scoring were completely abolished, confirming that the trafficking events quantified in Figure 5.4 were in fact microtubule-dependent (Figure 5.7C).
Next, the role of actin in oscillatory motility was explored. There is some evidence that oscillatory motility is dependent on the actin cytoskeleton (Bharti et al., 2011). Cytochalasin D blocks the polymerisation of F-actin. WT and DKO MEFs were treated with 1 ug/ml for 30 minutes and then live imaged. As F-actin is critical for cell shape and mechanical strength, cell morphology was significantly perturbed following this drug paradigm (Figure 5.8A). Like the depolymerisation of microtubules there was no significant change between WT cells treated with cytochalasin D in comparison to those that had not undergone treatment (Figure
5.8A&B). Moreover, no change in oscillatory motility in treated versus untreated DKO MEFs was observed and the decrease in short-range displacements upon loss of Miro was still observed (Figure 5.8A&B). As a result, neither the microtubule or actin cytoskeleton appears to be the mechanism by which peroxisomes undergo short-range transport.
Peroxisomes must form dynamics interactions with organelles in order to function optimally in the cell (Inês Gomes Castro et al., 2018; Shai et al., 2016). It has been proposed that peroxisomes can form a three-way contact site with both the ER and mitochondria (Mattiazzi
Ušaj et al., 2015). In fact, peroxisomes are critically dependent on the ER for the supply of
120
Figure 5.7: Disruption of microtubules affects long-range but not short-range peroxisomal transport. A) Representative still images and tracks of pxDsRed (peroxisome) signal taken from two minute movies imaging at one frame every 1.5 seconds in wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs. Vinblastine treatment was at 1 μM for one hour before imaging. B) Blind counting of long-range peroxisomal trafficking events during two minute movie. C) Quantification of the distance peroxisomes have moved by the change in peroxisome position in between the first and last frame. n=18 cells per condition over three independent experiments. ns and *** denote p > 0.05 and p < 0.001, respectively, by one-way ANOVA with post hoc Tukey test.
121
Figure 5.8: Disruption of F-actin does not affect not short-range peroxisomal transport. A) Representative still images and tracks of pxDsRed (peroxisome) signal taken from two minute movies imaging at one frame every 1.5 seconds in wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs. Cytochalasin D treatment was at 1 μg/μl for 30 minutes before imaging. B) Quantification of median net displacement of peroxisomes as defined by the distance peroxisomes have moved in between the first and last frame. n=18 over three independent experiments. ns and *** denote p > 0.05 and p < 0.001, respectively, by one-way ANOVA with post hoc Tukey test.
122 phospholipids and therefore require contact sites with the ER for their biogenesis (Hua et al.,
2017; Kim et al., 2006). Furthermore, as sites of many aspects of cellular metabolism both the peroxisomes and mitochondria overlap in several functions including ROS metabolism and fatty acid β-oxidation. In line with Miro being described on both mitochondria and indeed ER
(Costello et al., 2017), the relationship between peroxisomal trafficking and the ER or mitochondria was explored. Firstly, the relationship between mitochondrial and peroxisomal trafficking was investigated by transfecting in mtDsRed (DsRed2 localised to the matrix of mitochondria by a Cox8 targeting sequence) and pxGFP (GFP targeted the peroxisomal lumen by the PTS1 SKL motif) into WT and DKO MEFs (Figure 5.9A). Live imaging for two minutes at a frame rate of two frames per second showed the well described long-range and short-range trafficking events over the entirety of the movie. Mitochondrial displacement was quantified by the relative change in mitochondrial position at 10 second intervals. To do so, mitochondrial signal from the frame at 10 seconds was subtracted from the mitochondrial signal in the first frame. The remaining pixels, as a percentage of total mitochondrial pixels were considered a relative displacement. This was iterated for the frames every 10 seconds, leading to an average 10 second displacement per cell over the two minute movie.
Quantification of mitochondrial displacement showed that knockout of Miro significantly reduced mitochondria motility (Figure 5.9C), in agreement with previous work (López-
Doménech et al., 2018). Though peroxisomes and mitochondria occasionally made ‘contact’ throughout the movie (it should be noted that true organelle contact cannot be concluded at the resolution of the images acquired), the peroxisomes appear to undergo short-range displacements in the WT and DKO MEFs in a manner not dependent on the mitochondria movement. Additionally, individual long-range peroxisomal trafficking events were also observed not to be coupled to a mitochondrion. As a result, it is unlikely that peroxisomal movement is coupled to mitochondria and therefore the reduction in peroxisomal trafficking observed in the DKO MEFs is not a direct consequence of the mitochondria.
In parallel, the relationship of ER and peroxisomal trafficking was studied by transfecting pxGFP and ER-DsRed (DsRed2 localised to the ER lumen by an ER targeting signal and
KDEL retention signal). Again, movies were taken for two minutes at 2 frames per second. In contrast to the mitochondria, the peroxisomes and ER appear to ‘contact’ throughout the cell,
123
Figure 5.9: Dual organelle imaging by live spinning disk microscopy. A) Still images every 20 seconds for live imaging of mitochondria (green; imaged by mtDsRed) and peroxisomes (magenta; imaged by pxGFP). Both wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs were imaged for two minutes at two frames a second. White arrow head highlights the path of one peroxisome through the movie. B) Still images every 20 seconds for live imaging of the endoplasmic reticulum (ER) (green; imaged by ER-DsRed) and peroxisomes (magenta; imaged by pxGFP). Both wild-type (WT) and Miro1 / Miro2 double knockout (DKO) MEFs were imaged for two minutes at two frames a second. White arrow head highlights the path of one peroxisome throughout the movie and its association with the ER. B) C) and D) Quantification of the relative displacement of mitochondria, ER and peroxisomes. n=18 cell per condition over three independent experiments. * and *** denotes p < 0.05 and p < 0.001, respectively, by Student’s t-test. Scale bar is 5 μm.
124 retaining this association with time in the WT MEFs (Figure 5.9B). Individual peroxisomes can be observed moving; following the path that the ER has taken. As peroxisomes oscillate less upon loss of Miro, and peroxisomes associate with the ER over time, two models could be proposed for the role of Miro in short-range peroxisome displacements. 1) Miro mediates the association of the ER and peroxisomes. 2) Miro influences the movement of the ER.
In the case of the Miro regulating peroxisome-ER contacts one would predict that if Miro regulates peroxisome-ER contact sites, then loss of Miro in the DKO MEFs would lead to less colocalisation of peroxisomes with the ER; however, peroxisomes showed an association with the ER in both WT and DKO MEFs (Figure 5.9B). In the case of the second proposition, it would be expected that loss of Miro would lead to a reduction in ER motility. ER displacement was quantified by ascertaining a relative movement of the ER at 10 second intervals.
Quantification of ER displacement in a similar manner to that described for mitochondria in
WT and DKO MEFs showed a significant reduction in ER displacement when Miro was knocked out (Figure 5.9D). Moreover, this reduction in ER displacement was similar in magnitude to the reduction in median net displacement of peroxisomes (Figure 5.9E). As a result, it is likely that the loss of Miro leads to a reduction in ER, mitochondrial and peroxisomal motility and that peroxisomal trafficking is highly associated with that of the ER.
To summarise the data so far, though Miro is localised to peroxisomes it does not mediate long-range microtubule-dependent peroxisomal trafficking and distribution; instead loss of
Miro leads to a reduction in short-range peroxisomal displacements. By studying how this oscillatory motility is elicited, it was found that neither the microtubule nor actin cytoskeleton mediates this type of trafficking. While peroxisomal trafficking is not obviously coupled to mitochondria, peroxisomes associate heavily with the ER throughout their movement. As loss of Miro leads to a reduction in ER motility, peroxisomal motility is also reduced under these conditions.
Miro regulates peroxisomal morphology
Alongside its role in mitochondrial trafficking, Miro has also been shown regulate other aspects of mitochondrial dynamics (Devine et al., 2016). In the case of mitochondrial morphology, expression of Miro has been shown to promote a tubular and interconnected
125 mitochondrial network (Saotome et al., 2008). Indeed, knockout of Miro leads to short and rounded mitochondria (López-Doménech et al., 2018). This has been suggested to occur not only through interactions with the fission/fusion machinery, but also through mitochondrial trafficking itself being required for functioning mitochondria morphology (Cagalinec et al.,
2013; Ding et al., 2016; Misko et al., 2010). Peroxisomes are known to vary in size in response to environmental cues and exhibit both tubular and vesicular morphologies with an average diameter ranging between 0.1 μm to 1 μm (Smith and Aitchison, 2013). The size of peroxisomes is proposed as being dependent on membrane provision by the ER and on the extent of peroxisomal fission (Schrader et al., 2016; Smith and Aitchison, 2013). Interestingly, peroxisomal fission has been shown to occur using similar machinery to mitochondrial fission whereby Drp1 is recruited to the membrane by Mff or hFis1 (Gandre-Babbe and van der
Bliek, 2008; Koch et al., 2005, 2003; Williams et al., 2015). Unlike mitochondria, however, mature peroxisomes were shown not to undergo fusion (Bonekamp et al., 2012).
To test whether Miro has a role in peroxisomal morphology, WT, Miro1KO, Miro2KO and DKO
MEFs were fixed and stained for the peroxisomal marker catalase (Figure 5.10A).
Peroxisomal size was then quantified by Particle Analysis in ImageJ. By comparing the average size of individual peroxisomes it was found that knockout of both Miro1/Miro2 in the
DKO MEFs leads to a significant decrease in peroxisomal size (Figure 5.10A&B). No change in peroxisomal size was observed in the single Miro1 and Miro2 knockout MEFs. To confirm the effect of Miro on peroxisomal size, a rescue experiment was carried out by expressing either GFPMiro1 or GFPMiro2 in DKO MEFs and comparing the peroxisomal area to WT and
DKO MEFs (Figure 5.10C). Like Figure 5.10A&B, a reduction in peroxisomal area was observed in the DKO MEFs in comparison to the WT MEFs. Importantly, both rescue of Miro1 or Miro2 in the DKO MEFs could rescue peroxisomal size, returning the average peroxisomal area to the same as WT MEFs (Figure 5.11C&D). Next, the effect of Miro overexpression of peroxisomal size was investigated. WT MEFs were transfected with either GFPMiro1 or
GFPMiro2 and compared to control (Tom70(1-70)) expressing WT MEFs. In contrast to the data in Figure 5.10, only Miro1 overexpression led to an increase in peroxisomal area (Figure
5.11A&B). As a result, Miro promotes an increase in peroxisomal size. Though Miro1 and
126
Figure 5.10: Loss of Miro reduces peroxisomal size. A) Representative images and zooms of catalase (peroxisome) staining in wild-type (WT), Miro1 knockout (Miro1KO) and Miro2 knockout (Miro2KO) and Miro1 / Miro2 double knockout (DKO) MEFs. B) Quantification of the average size of individual peroxisomes from A. C) Representative images of catalase (peroxisome) staining in WT and DKO MEFs, alongside rescue of either Miro1 (GFPMiro1) or Miro2 (GFPMiro2) in DKO MEFs. D) Quantification of the average size of individual peroxisomes shown in C. For B n=60 cells over three independent experiments. *** denotes p < 0.001 in comparison to WT by one-way ANOVA with post-hoc Newman-Keuls test. For D n=36 cells over three independent experiments. * denotes p < 0.05 in comparison to WT by one-way ANOVA with post-hoc Newman-Keuls test. # and ### denote p <0.05 and p<0.001, respectively, in comparison to DKO condition. Scale bar is 10 μm and 5 μm in zooms.
127
Figure 5.11: Overexpression of Miro1 but not Miro2 increases peroxisomal area. A) Representative images and zooms of catalase (peroxisome) staining in WT MEFs overexpressing control (GFPTom70(1-70)), Miro1 (GFPMiro1) or Miro2 (GFPMiro2). B) Quantification of the average area of individual peroxisomes per cell. n=60 cells over three independent experiments. * denotes p < 0.05 in comparison to conrtol by one-way ANOVA with post-hoc Newman-Keuls test. Scale bar is 10 μm and 5 μm in zooms.
128
Miro2 can compensate for one another in this role; it is probable that Miro1 is functionally more relevant.
Mitochondria and peroxisomes have significant functional overlap, thus is it possible that the data on the effect of Miro on peroxisomal size is an indirect consequence of the presence of
Miro at the mitochondria. To rule out secondary effects from the mitochondria on peroxisomal size, splice variant 4 of Miro1 was expressed in DKO MEFs. Variant 4 of Miro1 is known to predominantly localise to peroxisomes, with a minimal pool of Miro on mitochondria in only a few cells (Okumoto et al., 2017). As a result, GFPv4 was expressed in DKO MEFs and peroxisomal morphology quantified by Particle Analysis in ImageJ (Figure 5.12A). In comparison to control DKO cells, DKO MEFs expressing GFPv4 exhibited significantly larger peroxisomes (Figure 5.12A&B). As this splice variant of Miro1 localises almost solely to peroxisomes and it does not rescue mitochondrial phenotypes in DKO MEFs, it is likely that the presence of Miro on peroxisomes directly regulates peroxisomal morphology. Alongside peroxisomal area, peroxisomal length was quantified by the Feret’s diameter (the longest straight line) of individual peroxisomes. Using this metric peroxisomal length was shown to significantly increase in the variant 4 expressing cells (Figure 5.12C). Taken these results in conjunction with Figures 5.10 and 5.11, it is likely that Miro does not simply increase peroxisomes in all dimensions, but rather promotes a tubular morphology.
Discussion
The previous chapter showed that both Miro1 and Miro2 localise to peroxisomes and that there are regulatory features within Miro that modulate the extent of this peroxisomal localisation. Here, the role of Miro in peroxisomal dynamics was studied. Unlike its role at mitochondria, Miro was not found to be critical for long-range microtubule-dependent peroxisomal trafficking but instead loss of Miro leads to a reduction in shorter-range peroxisomal displacements. As a result, Miro does not appear to be critical for establishing basal peroxisomal distribution in MEFs. Miro is also found to control peroxisome size and morphology whereby the presence of Miro promotes larger, more tubular peroxisomes.
The canonical role of Miro is in long-range trafficking of mitochondria to regulate their distribution within the cell (Birsa et al., 2013). This has been shown to be predominantly
129
Figure 5.12: Expression of splice variant 4 of Miro1 increases peroxisomal length. A) Representative images of Pex14 staining in DKO MEFs transfected with either GFPTom70(1- 70) (Control) or GFP tagged mouse splice variant 4 of Miro1 (v4). B) Quantification of the average area of individual peroxisomes. C) Quantification of the Feret’s diameter of individual peroxisomes as a readout of peroxisomal length. n=30 cells per condition over three independent experiments. *** refers to p < 0.001 by Student’s t-test. Scale bar is 10 μm in ‘Pex14’ panels. Scale bar is 5 μm in zoom.
130 through Miro1, though there is evidence that Miro2 can alter mitochondrial distribution (López-
Doménech et al., 2018, 2016; Nguyen et al., 2014; O’Mealey et al., 2017). Peroxisomes undergo both long- and short-range transport with long-range peroxisomal trafficking accounting for approximately 10% and being elicited by the microtubule cytoskeleton (Huber et al., 1999; Rapp et al., 1996; Wiemer et al., 1997), like mitochondrial long-range trafficking.
Moreover, this type of peroxisomal transport is proposed to be dependent on kinesin-1 and dynein (Kural et al., 2005; Schrader et al., 2000), like mitochondria (Birsa et al., 2013;
Macaskill et al., 2009; Wang and Schwarz, 2009). Here, Figures 5.2&5.3 show that loss of either Miro1, Miro2 or both Miro1 and Miro2 in DKO MEFs do not affect peroxisomal distribution in MEFs. It is important to note that although Miro is fundamental to microtubule- dependent mitochondrial trafficking, this role has not been found to be ubiquitous to all species (Frederick et al., 2004; Sørmo et al., 2011; Vlahou et al., 2011; Yamaoka and Leaver,
2008). In fact, given that Miro is proposed to be present in the last eukaryotic ancestor it is more likely that the trafficking machinery evolved to ‘use’ Miro as opposed to Miro arising with it (Vlahou et al., 2011). Miro and its numerous homologues have been shown to regulate many aspects of mitochondrial homeostasis (Birsa et al., 2014; Ding et al., 2016; Kornmann et al., 2011; S. Lee et al., 2016; Sørmo et al., 2011; Yamaoka and Hara-Nishimura, 2014).
Therefore, there is precedent for Miro having a role outside of regulating long-range peroxisomal transport. In counter to this rationale, and indeed the data above, two recent papers have suggested a microtubule-dependent peroxisomal trafficking role for Miro (Inês G
Castro et al., 2018; Okumoto et al., 2017).
Using an RNAi approach Okumoto et al. (2018) showed that loss of Miro1 leads to a significant reduction in the number of peroxisomes undergoing long-range trafficking. This defect in trafficking could be rescued with the peroxisomally-localised splice variant 4 of
Miro1. Additionally, the authors concluded that overexpression of variant 4 leads to peripheral accumulations of peroxisomes. Both of these phenotypes were dependent on the first
GTPase domain being enzymatically active. Castro et al. (2018) also describe a microtubule- dependent peroxisomal trafficking role for Miro1. By constitutively targeting Miro1 to peroxisomes through addition of a transmembrane domain and C-terminus typical for peroxisome only targeting, they show, like Okumoto et al. (2018) that overexpression of Miro1
131 leads to accumulations of peroxisomes. They further conclude that this requires an active
GTPase1 domain and calcium-binding of the EF-hand domains. The findings from the two papers described above are in contradiction to those presented in Figures 5.2, 5.3 & 5.4. One important consideration is the possibility of overexpression artefacts in the two opposing papers. It is possible that in highly expressing cells Miro1 could recruit the microtubule trafficking machinery; however, the overexpressed levels of Miro1 may not be physiological relevant. Indeed, it is shown that Trak2 can be recruited to peroxisomes by variant 4 of Miro1
(Okumoto et al., 2017). It is also the case that variant 4 is expressed at very low levels in nearly all tissues examined so far. Another consideration is the fact that Trak2, as opposed to
Trak1, was shown to be recruited to peroxisomes. If Trak2 is recruited one would expect peroxisomes to be retrogradely trafficked to the microtubule-organising centre, as opposed to the cell periphery, if it fits with the mitochondrial literature (López-Doménech et al., 2018).
Short-range peroxisomal transport – often referred to as oscillatory motility – accounts for up to 90% of peroxisomal movement (Huber et al., 1997; Rapp et al., 1996; Wiemer et al., 1997).
Despite making up the majority of peroxisomal trafficking, a lot less is known about short- range transport and has even been dismissed as purely Brownian motion (Huber et al., 1997;
Rapp et al., 1996; Wiemer et al., 1997). Instead of a role for Miro in long-range peroxisomal transport, the work above illustrates that loss of Miro1 and Miro2 in DKO MEFs causes a significant reduction in shorter-range displacements. It is noteworthy, that though the authors of Castro et al. (2018) conclude a role for Miro in long-range trafficking their data from Figure
2 appear to show an increase in short-range motility upon overexpression of peroxisomally- localised Miro1. Therefore, the quantification methods of the two contradictory papers may be a result of differences in classification of trafficking. Here, the mechanism by which oscillatory motility is elicited was found to not be dependent on microtubules, in agreement with previous work, nor on F-actin (Huber et al., 1997; Rapp et al., 1996; Schrader et al., 2000; Wiemer et al., 1997). Interestingly, myosin-II has been shown to localise to peroxisomes and Miro has been shown to recruit myosin-19 to mitochondria (López-Doménech et al., 2018;
Schollenberger et al., 2010). Therefore, it would be important to further test the involvement of the actino-myosin cytoskeleton in short-range peroxisomal trafficking.
132
If neither the actin or microtubule cytoskeletons are the mechanistic explanation for the apparent role of Miro in short-range transport, then what might be? Peroxisomes have been shown to co-traffic with early endosomes in the fungi Ustilago maydis and Aspergillus nidulans to elicit microtubule-dependent peroxisomal transport (Guimaraes et al., 2015;
Salogiannis et al., 2016). Here, dual imaging of peroxisomes with either the mitochondria or
ER showed that though long-range transport of peroxisomes was not dependent on either organelle, short-range motility was highly coupled to the ER. In fact, at any one time most peroxisomes are in association with the ER, in agreement with previous work (Cohen et al.,
2018; Valm et al., 2017). For example, the de novo pathway of peroxisome biogenesis is critically dependent on the ER (Agrawal and Subramani, 2016; Aranovich et al., 2014; Kim et al., 2006). One part of this ER-dependent mode of oscillatory motility that is unclear is whether the role of Miro is direct or indirect. Though the results from Figure 5.5 show that oscillatory motility is unlikely to be strictly thermally driven as previously suggested (Huber et al., 1997; Rapp et al., 1996; Wiemer et al., 1997), the reduction in ER displacement in the
DKO MEFs casts doubt on direct role of Miro in this process. Therefore, it is possible that reduction in ER and peroxisome motility in the DKO MEFs is caused by systemic cell stress.
Regarding these observations, deeper questions that require investigation are: why would the loss of Miro1 and Miro2 lead to a reduction in ER displacement? Is there a functional consequence to this type of ER motility? How is this movement elicited? One avenue worth exploring is the potential role for Miro at the ER, especially given the recent description of an
ER-localised pool of Miro2 and a proposed role for Miro in ER-mitochondrial contact sites
(Costello et al., 2017; Kornmann et al., 2011; S. Lee et al., 2016).
In parallel to studying the role of Miro at peroxisomes, peroxisomal size and morphology was characterised in both Miro knockout and Miro overexpression conditions. In the case of mitochondria, loss of Miro has been shown to lead to a small rounded phenotype (López-
Doménech et al., 2018). Furthermore, overexpression causes a tubular and more reticular mitochondrial network (Saotome et al., 2008). When studying the effect of Miro on peroxisomal morphology it was found that peroxisomes were smaller and shorter in DKO
MEFs in comparison to WT MEFs. Furthermore, overexpression of Miro1 in WT MEFs led to large, more tubular peroxisomes (Figure 5.13). Importantly, not only could the size defect in
133
Figure 5.13: Miro regulates peroxisomal trafficking and size. Miro is inserted into peroxisomes using the chaperone, Pex19. Once there, Miro promotes short-range peroxisomal trafficking as well as peroxisomal size and tubularity.
134 the DKO MEFs be rescued by the addition of Miro1 and Miro2, it could be rescued by the variant 4 of Miro1. As this is predominantly localised to peroxisomes and does not rescue mitochondrial distribution it is likely that Miro has a direct role in peroxisomal morphology. The role of Miro in both peroxisomal and mitochondrial morphology is of significance as it hints at a shared mechanism between the two organelles.
Two candidates for the modulation of peroxisomal size by Miro are the microtubule cytoskeleton and Drp1-depenedent fission; as these machineries exist at both organelles.
Alongside their trafficking data, Castro et al. (2018) suggest that Miro1 can elongate peroxisomes on the microtubule network; as a result it would be important to investigate the role of the microtubule, and actin, cytoskeleton in Miro’s role in peroxisomal morphology. The other candidate – Drp1-dependent fission – is also a tantalising prospect. The Drp1 receptors, hFis1 and Mff, are known to localise to both mitochondria and peroxisomes (Gandre-Babbe and van der Bliek, 2008; Koch et al., 2005; Li and Gould, 2003; Smirnova et al., 2001) as well as a recent report describing them on the ER (Ji et al., 2017) though the mechanism of Drp1- dependent fission is better characterised at the mitochondria. hFis1 or Mff recruit Drp1 from the cytosol to the mitochondrial (or peroxisomal) membrane where Drp1 oligomerises around the target organelle (Ingerman et al., 2005; Yoon et al., 2001). Drp1 oligomerisation has been shown to cause sufficient constriction so that dynamin-2 can carry out the final scission event
(J. E. Lee et al., 2016). It should also be noted that the ER and actin are proposed as being critical for the early events in mitochondrial fission, though this has not been studied at peroxisomes (Friedman et al., 2011; Hatch et al., 2014). This work may therefore give more detail to how fission is elicited and provide a seed for studying how Miro might regulate both mitochondrial and peroxisomal morphology. Exactly, how Miro would negatively regulate either a microtubule or Drp1-dependent mechanism of fission remains to be seen.
In conclusion, the data provided in this chapter emphasises a multifaceted role for Miro not only at peroxisomes, but also offer insight into how Miro might modulate both mitochondrial and ER dynamics. Interestingly, these three organelles are inter-dependent for a range of functions including, lipid-synthesis. It is therefore unsurprising that these organelles make contact sites with one another (Inês Gomes Castro et al., 2018; Cohen et al., 2018; Hua et al.,
135
2017; Kornmann et al., 2009; Valm et al., 2017), with work even proposing a tri-partite contact site between the mitochondria, peroxisomes and ER (Mattiazzi Ušaj et al., 2015). This is particularly intriguing given that Gem1 – the yeast homologue of Miro – is found at the
ERMES (the ER-mitochondria contact site in yeast) (Kornmann et al., 2011) and has been proposed to regulate peroxisome-mitochondria contacts sites (Shai et al., 2018). As Miro is found on all three organelles, Miro might allow for the coordination of the dynamics of all three organelles. In view of the ever growing roles for Miro, coupled to this work, it is possible that
Miro is a master regulator of organelle dynamics allowing for the maintenance of cellular health.
136
6. Discussion
By studying the mitochondrial Rho GTPases, Miro1/2, the work contained in this thesis investigated new aspects of mitochondrial and peroxisomal dynamics. Firstly, a yeast-two hybrid screen using Miro1 as bait identified Fam54b as a potential Miro interactor.
Importantly, to date there is no published information on Fam54b. This work found Fam54b likely exists in at least two distinct pools by localising to both the mitochondria and the cytoplasm. Interestingly, this mitochondrial localisation is dependent on the GTPase activity and calcium binding ability of Miro1, but does not appear to be dependent on the presence of
Miro2. Functionally, Fam54b was found to modulate mitochondrial dynamics by negatively regulating both mitochondrial fusion and trafficking, resulting in a rounded and clustered mitochondrial network. Two phosphorylation sites, S103 and S238, were identified in
Fam54b; however, the significance of these to the localisation and function of Fam54b is currently unknown. As well as this work adding insights to the regulation of Miro1-dependent processes at the mitochondria, a role for a peroxisomal pool of Miro was also described.
Importantly, both Miro1 and Miro2 were found to localise to peroxisomes, with the extent of this localisation being altered by amino acid sequences within Miro. The ability to localise to the peroxisomal membrane is likely dependent on the PMP chaperone, Pex19. Unlike the role of Miro in long-range mitochondrial trafficking, this thesis instead finds that Miro is required to elicit short-range peroxisomal displacements. Furthermore, this work finds that this short- range transport is extensively coupled to the movement of the ER. Finally, Miro is shown to promote a larger, more tubular peroxisomal morphology, likely in a manner akin to its role in mitochondrial morphology. Taken together, the above provides some important insights into the regulation of organelle dynamics and the broader role of Miro in the cell.
Fam54b and mitochondrial dynamics
The regulation of mitochondrial trafficking
Here, it is proposed that Fam54b is recruited to the mitochondria by Miro1 to negatively regulate mitochondrial dynamics. More specifically, overexpression of Fam54b reduces long- range mitochondrial trafficking likely leading to a clustered and less-fused mitochondrial
137 network. As Fam54b is recruited to the mitochondria by Miro1 specifically, it is worth exploring the functional relevance of this. One aspect of Miro protein functionality that shows a clear preference for Miro1 is long-range, microtubule-dependent trafficking (Birsa et al., 2013).
Through single knockout of either Miro1 or Miro2 in both neurons and MEFs it has been shown that long-range mitochondrial trafficking is elicited primarily through Miro1, whereby knockout of Miro2 had no effect on this type of transport (López-Doménech et al., 2018,
2016). In fact, the Fam54b overexpression phenotype is reminiscent of the loss of Miro1, leading to a clustered, more rounded mitochondrial network and negatively regulates long- range trafficking.
Long-range mitochondrial trafficking is elicited by a complex of Miro and Trak along with the microtubule motors kinesin-1 and the dynein/dynactin complex; however, several proteins have been identified that interact with Miro1 to modulate mitochondrial trafficking in several cellular contexts (e.g. CENP-F, myosin-19, DISC1 and ARMCX1/3) (Cartoni et al., 2016;
Kanfer et al., 2015; López-Doménech et al., 2018, 2012; Norkett et al., 2016). For example,
CENP-F is a nuclear protein that upon nuclear break-down during mitosis associates with the mitochondria through an interaction with Miro (Kanfer et al., 2015). This interaction is proposed to couple mitochondria to the plus-end tips of microtubules to maintain mitochondrial distribution during mitosis (Kanfer et al., 2017, 2015). It is possible that Fam54b also serves to regulate the long-range trafficking machinery, though the exact context in which Fam54b would do this is currently unknown. Two candidates are during increases in cytosolic calcium and activation of the first GTPase domain of Miro1.
The enzyme activity of the first GTPase domain and the ability of the EF-hand domains to coordinate calcium of Miro1 were found to be critical for the recruitment of Fam54b to the mitochondria. These two features have been shown to be necessary for the role of Miro in mitochondrial trafficking. Early work found that mutations in the first GTPase domain of Miro1 alter mitochondrial morphology and distribution (Fransson et al., 2003, 2006). Additionally, work in Drosophila showed that functional enzyme activity of the N-terminal GTPase domain is required for mitochondrial trafficking and distribution (Babic et al., 2015). It is not clear mechanistically how alterations to the GTPase activity of Miro1 elicit changes to mitochondrial
138 trafficking. Increases in cytosolic calcium are known to stop mitochondrial transport by binding to the EF-hand domains. Conflicting models as to how calcium binding to Miro halts mitochondrial motility exist, as well as structural studies showing no significant conformational changes in Miro1 upon binding calcium (Klosowiak et al., 2013; Macaskill et al., 2009; Wang and Schwarz, 2009). As Fam54b requires both functional GTPase activity and calcium binding for its recruitment to the mitochondria it could be that Fam54b serves as part of the mechanism by which these features of Miro1 modulate mitochondrial trafficking. For example, calcium-induced stopping of mitochondria should be studied upon knockdown or knockout of
Fam54b. If Fam54b is required for this process one would predict a reduction in the ability of calcium to arrest mitochondrial transport. Similarly, as a GAP and GEF for Miro has been proposed (VopE and Vimar, respectively) it would be informative to study changes to mitochondrial trafficking and distribution that these induce alongside the loss of Fam54b (Ding et al., 2016; Suzuki et al., 2014).
Gene family 54 as a potential modulator of mitochondrial dynamics
Interestingly Fam54b is part of gene family 54, a gene family made up of three members:
Mtfr1, Mtfr2 and Fam54b (Monticone et al., 2010). Our current understanding of this family is relatively poor; however, both Mtfr1 and Mtfr2 have been shown to localise to the mitochondria where they, upon overexpression, cause substantial mitochondrial fragmentation (Monticone et al., 2010; Tonachini et al., 2004). This is phenotypically similar to loss of Mfn1/2 or upregulation of Drp1 (Braschi et al., 2009; Chen et al., 2003). The pro- fragmentation role of Mtfr1 and Mtfr2 was shown to be dependent on a proline-rich domain at the C-terminus of the proteins; a domain that is absent in Fam54b (Monticone et al., 2010;
Tonachini et al., 2004). Apart from the work contained in this thesis, to date no role for
Fam54b has been described. This thesis finds that Fam54b negatively regulates mitochondrial transport, possibly through modulating the function of Miro1. As a result, gene family 54 might make up a group of proteins that can regulate different aspects of mitochondrial dynamics, perhaps through interacting with the trafficking complex (as in the case of Fam54b) and the fission/fusion machinery (as for Mtfr1 and Mtfr2). Studying the interplay of Mtfr1/2 with the core fission/fusion machinery alongside the role of Fam54b in
139 mitochondrial transport may uncover an overarching role of this gene family in mitochondrial morphology and distribution.
As gene family 54 appears to modulate mitochondrial dynamics, it would be important to investigate the signalling pathways and subcellular contexts that might feed into this family.
By Mtfr1/2 causing mitochondrial fragmentation and Fam54b impacting upon mitochondrial transport, it might be that these processes can be coordinated together. For example, during mitosis both mitochondrial fragmentation and alterations in microtubule-dependent trafficking have been observed (Chung et al., 2016; Kanfer et al., 2015; Zunino et al., 2009). Given the amino acid similarity within this family (Mtfr1 and Fam54b share 28% amino acid sequence identity), conserved residues might exist for post-translational modifications, therefore allowing for joint regulation of different aspects of mitochondrial dynamics through Mtfr1/2 and
Fam54b. Indeed, Fam54b appears to be phosphorylated at two residues, namely S103 and
S238. An unbiased screen identified Fam54b as a likely candidate for AMPK phosphorylation
(Schaffer, 2015). AMPK serves as a promising candidate as its activity has been shown to reduce mitochondrial trafficking and cause mitochondrial fragmentation (Cunniff et al., 2016;
Mironov, 2007; Toyama et al., 2016).
Another potential mechanism to regulate mitochondrial dynamics through the gene family 54 members is through ubiquitination and subsequent degradation. This mechanism is well known to affect many of the proteins required for mitochondrial dynamics (Covill-Cooke et al.,
2017). Interestingly, Fam54b protein levels are dependent on the presence of Miro1.
Moreover, acute loss of Miro1 leads to a significant loss of Fam54b proteins levels within three hours, suggesting that Fam54b protein levels are dynamically dependent on Miro, (like myosin-19 (López-Doménech et al., 2018). Candidate E3-ligases include Mul1, MARCH5 and
Parkin, all of which having multifaceted roles in mitochondrial trafficking, morphology and turnover (Covill-Cooke et al., 2017). Parkin has a critical role in the autophagic clearance of damaged mitochondria (Nguyen et al., 2016). This is particular noteworthy as rapid fragmentation and clustering of mitochondria occur during mitochondrial damage and therefore are another candidate for the joint regulation of mitochondrial dynamics by gene family 54. Indeed, Fam54b levels are altered following induction of PINK1/Parkin-mediated
140 mitophagy. All in all, gene family 54 may serve as a seed to broadening our understanding of how mitochondrial dynamics are regulated and integrated.
A novel role for Miro in peroxisomal dynamics
Regulating the localisation of tail-anchored proteins
Miro proteins have a well-characterised localisation at mitochondria, where they modulate many aspects of mitochondrial dynamics (Devine et al., 2016). Chapters 4 and 5, however, identify a non-mitochondrial role for Miro. Both Miro1 and Miro2 are observed at peroxisomes where they regulate both short-range trafficking and the morphology of peroxisomes. This work adds to the growing list of proteins that are dually-localised to mitochondria and peroxisomes, including Mff, Drp1, hFis1, Usp30, Mul1, MAVS, Bcl-XL, Bcl2, OMP25 and
GDAP1 (Costello et al., 2017; Dixit et al., 2010; Gandre-Babbe and van der Bliek, 2008;
Huber et al., 2013; Koch et al., 2005; Marcassa et al., 2018; Neuspiel et al., 2008). One important question is: how are the relative pools of these dually-localised proteins regulated?
Many of these mitochondrial/peroxisomal proteins are tail-anchored proteins and therefore likely do not require ATP for their insertion in the organelles of interest (Borgese et al., 2007;
Brambillasca et al., 2006, 2005). As tail-anchored proteins are undergo post-translational targeting, on account of their C-terminal transmembrane domains and surrounding amino acids being critical for their ultimate localisation, they must bind the necessary chaperones for this to occur (Borgese and Fasana, 2011; Costello et al., 2017; Rao et al., 2016). Tail- anchored proteins targeted to the ER use the well-characterised GET/Bag6 pathway (Hegde and Keenan, 2011). Targeting of proteins to the peroxisomal membrane uses the cytosolic chaperone, PEX19, which binds newly synthesised proteins as they exit the ribosome and traffics them to the peroxisomal membrane to associate with PEX3 (Fang et al., 2004; Jones et al., 2004). The targeting of tail-anchored proteins to the OMM, on the other hand, is poorly understood. Interestingly, a recent report studied the factors required for the mitochondrial and peroxisomal localisation of Fis1 and Gem1 (the yeast orthologue of Miro) using the budding yeast, Saccharomyces cerevisiae (Cichocki et al., 2018). The authors found that the cytosolic Hsp70 chaperones ssc1 and ssc2 are required for efficient mitochondrial targeting of these tail-anchored proteins. Furthermore, by studying the effect of knocking out pex19 or
141 ssc1/2 they propose a model where both proteins are required for efficient import into the mitochondria. Therefore, it is possible that the post-translational binding of chaperones to tail- anchored proteins acts as a pre-targeting complex, which can then be modulated to affect the targeting of that protein.
Given that it is likely that both pro-mitochondrial and pro-peroxisomal targeting chaperones bind following translation, how is the targeting of these mitochondrial and peroxisomal proteins altered? This thesis, along with Okumoto et al. (2018), shows that amino acids sequences within Miro1 affect its subcellular localisation. More specifically, inclusion of exon
19 or 20, as well as deletion of the first GTPase domain, all increase the peroxisome:mitochondria ratio of Miro1. It is possible that all of these features regulate the binding of Miro1 to PEX19 and mitochondrial chaperones. In fact, it has been suggested that exon 19 contains sequences for the binding of PEX19 to Miro1 (Okumoto et al., 2017).
Though the data in this thesis suggest this is unlikely to be the case – on account of variant 1 of Miro1 and Miro2 binding PEX19 – it is probable that this exon promotes the binding of more
PEX19; this would then lead to an increase in the peroxisome:mitochondria ratio. A similar mechanism modulating the binding of a mitochondrial chaperone would also aid in the ultimate targeting of Miro and the other dually-localised proteins. Although variable splicing is likely to be an important mechanism in regulating the relative mitochondria and peroxisomal pools of proteins, it would be interestingly to study whether or not local signals could alter the subcellular targeting. For example, Miro has both GTPase and calcium binding activity
(Fransson et al., 2003). This thesis finds that the GTPase activity does not affect the localisation of Miro1; however, it would also be important to investigate whether calcium- binding mutants of Miro effect its peroxisomal localisation. Lastly, post-translational modifications of the chaperones themselves might be a rapid way to change the peroxisomal and mitochondrial proteome.
Functional relevance of targeting Miro to both mitochondria and peroxisomes
Functionally, Miro is found to regulate both peroxisomal trafficking and morphology. As this significantly overlaps with the role of Miro at mitochondria, it is worth considering why this would be the case and what this can tell us about the coordination of mitochondrial and
142 peroxisomal dynamics. In the case of modulating mitochondrial morphology, Miro has been shown to promote a more fused mitochondrial network whereby overexpression and knockout of Miro leads to a more tubular and more rounded phenotype, respectively (López-Doménech et al., 2018; Saotome et al., 2008). As overexpression or knockout of Miro has a similar consequence at peroxisomes, could this this be through a shared mechanism between mitochondria and peroxisomes? Given that the mitofusins are currently not known to be localised to peroxisomes and the fact that mature peroxisomes are unlikely to undergo fusion, it is probable that a shared mechanism would be through the fission machinery (Bonekamp et al., 2012; Schrader et al., 2016).
Several aspects of fission are shared between mitochondria and peroxisomes. Firstly, both organelles use Drp1 recruitment and oligomerisation as a key step prior to membrane scission (Koch et al., 2003; Wakabayashi et al., 2009). At least two of the receptors for Drp1, namely Fis1 and Mff, are also shared between the organelles, therefore providing a strong candidate for how Miro might regulate organelle morphology (Gandre-Babbe and van der
Bliek, 2008; Koch et al., 2005; Koch and Brocard, 2012). Additionally, both the ER and actin have been shown to be required for the early stages of mitochondrial fission; two cellular features that are shared by the peroxisomes (Friedman et al., 2011; Hua et al., 2017;
Korobova et al., 2013; Mayerhofer, 2016; Schollenberger et al., 2010). As Miro regulates both
ER-mitochondria and peroxisome-mitochondria contact sites - and that the ER, mitochondria and peroxisomes might form a tri-partite structure - Miro might alter mitochondrial and peroxisomal morphology through these structures (Kornmann et al., 2011; S. Lee et al., 2016;
Mattiazzi Ušaj et al., 2015; Shai et al., 2018). Finally, Miro is critical for the coupling of mitochondria to the microtubule and actin cytoskeletons through kinesin-1 and myosin-19
(López-Doménech et al., 2018; Macaskill et al., 2009; Wang and Schwarz, 2009). As these cytoskeletons are important to mitochondrial and peroxisomal dynamics, the role of Miro in organelle morphology might be through regulating the extent of coupling to these cytoskeletons.
One aspect of peroxisomal biology that was not explored in this thesis is pexophagy.
Pexophagy degrades damaged or superfluous peroxisomes by targeting them to the
143 lysosome through the autophagy pathway (Cho et al., 2018). Studying the role of Miro in pexophagy may be important given that Miro is a well-characterised target in mitophagy
(Covill-Cooke et al., 2017). Following mitochondrial damage the E3-ligase, Parkin, is recruited to the mitochondria where it ubiquitinates a wide range of OMM proteins, including Miro (Birsa et al., 2014; Sarraf et al., 2013; Wang et al., 2011). Following ubiquitination, Miro1 is degraded by the proteasome causing mitochondrial motility to arrest. This is proposed as being important in allowing the autophagosomal membrane to engulf the damaged mitochondrion (Ashrafi et al., 2014). Moreover, Miro1 has also been proposed as a receptor for the recruitment of Parkin to the OMM (Birsa et al., 2014; Shlevkov et al., 2016).
Like mitophagy, pexophagy requires the ubiquitination of membrane-targeted proteins to stimulate the autophagic clearance of the organelle (Kim et al., 2008). As PEX2 has been described as a E3-ligase crucial for pexophagy, it would also be important to study whether this E3 ligase ubiquitinates Miro (Sargent et al., 2016). Interestingly USP30, a deubiquitinase that localises to both mitochondria and peroxisomes, has been found to negatively regulate the clearance of both organelles and therefore might deubiquitinate Miro to negatively regulate pexophagy and mitophagy (Marcassa et al., 2018). Miro may also serve to modulate pexophagy through its role in establishing peroxisomal size. If peroxisomes are reduced in size as a prerequisite step in pexophagy, like in mitophagy, then Miro could be a target for degradation upon peroxisomal damage. Ubiquitination and degradation of Miro may lead to peroxisomal fission, promoting the efficient engulfment by the autophagosome. All in all, studying the role of Miro in pexophagy may add further insight into the role of this protein to peroxisomal biology.
Miro as an integrator of organelle function and dynamics
An important consideration when starting to build a comprehensive view of the role of Miro in the cell is that Miro is nearly ubiquitous to eukaryotic life (Vlahou et al., 2011). This fact is made even more striking when considering that, with a few exceptions, Miro has the same domain structure: containing a large cytoplasmic N-terminus, exhibiting N- and C-terminal
GTPase domains flanking two calcium-binding EF-hand domains, anchored in a membrane by its C-terminal transmembrane domain (Fransson et al., 2003; Vlahou et al., 2011;
144
Yamaoka and Hara-Nishimura, 2014). Furthermore, Miro has been shown to be central for a wide range of processes not just at mitochondria, but also at peroxisome. Though unlikely to be a complete list, the following are part of an ever growing list of Miro’s functions: i) Through interactions with the microtubule and actin cytoskeletons Miro aids in both long-range and short-range mitochondrial trafficking (Birsa et al., 2013; López-Doménech et al., 2018); ii)
Miro is a key target of Parkin-mediated mitophagy and may even be critical for the efficient recruitment of Parkin to the OMM of damaged mitochondria (Birsa et al., 2014; Shlevkov et al., 2016; Wang et al., 2011); iii) Miro modulates mitochondrial morphology (Frederick et al.,
2004; López-Doménech et al., 2018; Yamaoka and Leaver, 2008); iv) present at ER- mitochondria sites, Miro has been proposed to modulate there size, number and functionality
(Kornmann et al., 2011; S. Lee et al., 2016); v) Miro can interact with MCU and therefore might be involved in calcium uptake into the mitochondrial matrix (Niescier et al., 2018); vi) at peroxisomes, Miro has been proposed to have a role in long-range and short-range trafficking along with regulating peroxisomal morphology (Inês G Castro et al., 2018; Okumoto et al.,
2017); and vii) an unbiased screen identified Miro as part of the peroxisome-mitochondria contact site (Shai et al., 2018). As a result, a key question is raised: why would one family of proteins have a role in so many processes?
From the functions described above it is possible to make subgroups that would require coordination. For example, microtubule-dependent mitochondrial trafficking is halted through degradation of Miro to promote the engulfment of a damaged mitochondrion during
PINK1/Parkin-mediated mitophagy (Ashrafi et al., 2014; Wang et al., 2011). Furthermore, given the role of Miro in positioning mitochondria to sites of high cytosolic calcium, Miro being part of ER-mitochondria contact sites and interacting with MCU makes mechanistic sense in modulating calcium dynamics. However, it is not immediately clear why microtubule- dependent trafficking of mitochondria would need to be coupled to peroxisomal morphology.
One reason could be to couple changes in mitochondrial and peroxisomal dynamics during increases in ROS. Indeed, both organelles are key sites of ROS production. Furthermore, increases in ROS have been shown to decrease mitochondrial trafficking in vitro and in vivo in a mechanism dependent on Miro-dependent trafficking (Debattisti et al., 2017; Liao et al.,
2017). Therefore mitochondrial and peroxisomal dynamics might be jointly altered during
145 increases in ROS through a mechanism dependent on Miro. This could have a role in ROS signalling and in segregating organelles damaged by excess ROS. Another shared function between the mitochondria and peroxisomes is the β-oxidation of fatty acids. It would therefore also be interesting to study alterations in mitochondrial and peroxisomal dynamics under conditions of fatty acid utilisation and whether loss of Miro has an effect on this.
Additionally, simply studying the ability of the DKO MEFs to utilise fatty acids as a carbon source would also be informative as to whether Miro is required on both organelles for this function.
The complexity of the wide array of roles for Miro is increased further when considering that
Miro2 localises to the ER as well (Costello et al., 2017). One role for Miro that this thesis finds to be universal to mitochondria, peroxisomes and the ER is in short-range trafficking. Loss of
Miro1 and Miro2 in the DKO MEFs causes a substantial reduction in the displacement of all three organelles. Despite there currently being no evidence that this is a direct consequence of Miro being localised to these organelles - as opposed to being caused by cellular stress - it is important to consider the implications of this overlap in function. Short-range displacements may be important for continually altering organelle-contacts sites. In fact, live imaging of these three organelles found that they are very dynamic in there interactions with one another over time, with each organelle exploring large positions of the cytoplasm over a 5 minute timescale
(Valm et al., 2017). Two potential mechanisms for the role of Miro in short-range displacements are in regulating organelle contact sites or through coupling to the cytoskeleton. Indeed, short-range mitochondrial displacements are elicited through myosin-
19, a mitochondria localised myosin whose mitochondrial targeting and stability is critically dependent on the presence of Miro (López-Doménech et al., 2018; Quintero et al., 2009).
Therefore, an overarching role for Miro in its regulation of organelle function and dynamics could be in integrating organelle contact sites and the cytoskeleton.
146
Bibliography
Abrahamsen, G., Fan, Y., Matigian, N., Wali, G., Bellette, B., Sutharsan, R., Raju, J., Wood, S.A., Veivers, D., Sue, C.M., Mackay-Sim, A., 2013. A patient-derived stem cell model of hereditary spastic paraplegia with SPAST mutations. Dis Model Mech 6, 489–502. doi:10.1242/dmm.010884
Agrawal, G., Subramani, S., 2016. De novo peroxisome biogenesis: Evolving concepts and conundrums. Biochim Biophys Acta 1863, 892–901. doi:10.1016/j.bbamcr.2015.09.014
Alfadda, A.A., Sallam, R.M., 2012. Reactive oxygen species in health and disease. J Biomed Biotechnol 2012, 936486. doi:10.1155/2012/936486
Anand, R., Wai, T., Baker, M.J., Kladt, N., Schauss, A.C., Rugarli, E., Langer, T., 2014. The i- AAA protease YME1L and OMA1 cleave OPA1 to balance mitochondrial fusion and fission. J Cell Biol 204, 919–929. doi:10.1083/jcb.201308006
Andersson, S.G., Zomorodipour, A., Andersson, J.O., Sicheritz-Pontén, T., Alsmark, U.C., Podowski, R.M., Näslund, A.K., Eriksson, A.S., Winkler, H.H., Kurland, C.G., 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396, 133–140. doi:10.1038/24094
Aranovich, A., Hua, R., Rutenberg, A.D., Kim, P.K., 2014. PEX16 contributes to peroxisome maintenance by constantly trafficking PEX3 via the ER. J Cell Sci 127, 3675–3686. doi:10.1242/jcs.146282
Ashrafi, G., Schlehe, J.S., LaVoie, M.J., Schwarz, T.L., 2014. Mitophagy of damaged mitochondria occurs locally in distal neuronal axons and requires PINK1 and Parkin. J Cell Biol 206, 655–670. doi:10.1083/jcb.201401070
Babic, M., Russo, G.J., Wellington, A.J., Sangston, R.M., Gonzalez, M., Zinsmaier, K.E., 2015. Miro’s N-terminal GTPase domain is required for transport of mitochondria into axons and dendrites. J Neurosci 35, 5754–5771. doi:10.1523/JNEUROSCI.1035- 14.2015
Baker, A., Lanyon-Hogg, T., Warriner, S.L., 2016. Peroxisome protein import: a complex journey. Biochem Soc Trans 44, 783–789. doi:10.1042/BST20160036
Becker, T., Vögtle, F.-N., Stojanovski, D., Meisinger, C., 2008. Sorting and assembly of mitochondrial outer membrane proteins. Biochim Biophys Acta 1777, 557–563. doi:10.1016/j.bbabio.2008.03.017
Bharti, P., Schliebs, W., Schievelbusch, T., Neuhaus, A., David, C., Kock, K., Herrmann, C., Meyer, H.E., Wiese, S., Warscheid, B., Theiss, C., Erdmann, R., 2011. PEX14 is required for microtubule-based peroxisome motility in human cells. J Cell Sci 124, 1759–1768. doi:10.1242/jcs.079368
Bingol, B., Tea, J.S., Phu, L., Reichelt, M., Bakalarski, C.E., Song, Q., Foreman, O., Kirkpatrick, D.S., Sheng, M., 2014. The mitochondrial deubiquitinase USP30 opposes parkin-mediated mitophagy. Nature 510, 370–375. doi:10.1038/nature13418
147
Birsa, N., Norkett, R., Higgs, N., Lopez-Domenech, G., Kittler, J.T., 2013. Mitochondrial trafficking in neurons and the role of the Miro family of GTPase proteins. Biochem Soc Trans 41, 1525–1531. doi:10.1042/BST20130234
Birsa, N., Norkett, R., Wauer, T., Mevissen, T.E.T., Wu, H.-C., Foltynie, T., Bhatia, K., Hirst, W.D., Komander, D., Plun-Favreau, H., Kittler, J.T., 2014. Lysine 27 ubiquitination of the mitochondrial transport protein Miro is dependent on serine 65 of the Parkin ubiquitin ligase. J Biol Chem 289, 14569–14582. doi:10.1074/jbc.M114.563031
Bonekamp, N.A., Sampaio, P., de Abreu, F.V., Lüers, G.H., Schrader, M., 2012. Transient complex interactions of mammalian peroxisomes without exchange of matrix or membrane marker proteins. Traffic 13, 960–978. doi:10.1111/j.1600- 0854.2012.01356.x
Borgese, N., Brambillasca, S., Colombo, S., 2007. How tails guide tail-anchored proteins to their destinations. Curr Opin Cell Biol 19, 368–375. doi:10.1016/j.ceb.2007.04.019
Borgese, N., Fasana, E., 2011. Targeting pathways of C-tail-anchored proteins. Biochim Biophys Acta 1808, 937–946. doi:10.1016/j.bbamem.2010.07.010
Boveris, A., Oshino, N., Chance, B., 1972. The cellular production of hydrogen peroxide. Biochem J 128, 617–630.
Brambillasca, S., Yabal, M., Makarow, M., Borgese, N., 2006. Unassisted translocation of large polypeptide domains across phospholipid bilayers. J Cell Biol 175, 767–777. doi:10.1083/jcb.200608101
Brambillasca, S., Yabal, M., Soffientini, P., Stefanovic, S., Makarow, M., Hegde, R.S., Borgese, N., 2005. Transmembrane topogenesis of a tail-anchored protein is modulated by membrane lipid composition. EMBO J 24, 2533–2542. doi:10.1038/sj.emboj.7600730
Braschi, E., Goyon, V., Zunino, R., Mohanty, A., Xu, L., McBride, H.M., 2010. Vps35 mediates vesicle transport between the mitochondria and peroxisomes. Curr Biol 20, 1310– 1315. doi:10.1016/j.cub.2010.05.066
Braschi, E., Zunino, R., McBride, H.M., 2009. MAPL is a new mitochondrial SUMO E3 ligase that regulates mitochondrial fission. EMBO Rep 10, 748–754. doi:10.1038/embor.2009.86
Braverman, N.E., D’Agostino, M.D., Maclean, G.E., 2013. Peroxisome biogenesis disorders: Biological, clinical and pathophysiological perspectives. Dev Disabil Res Rev 17, 187–196. doi:10.1002/ddrr.1113
Brickley, K., Stephenson, F.A., 2011. Trafficking kinesin protein (TRAK)-mediated transport of mitochondria in axons of hippocampal neurons. J Biol Chem 286, 18079–18092. doi:10.1074/jbc.M111.236018
Brix, J., Dietmeier, K., Pfanner, N., 1997. Differential recognition of preproteins by the purified cytosolic domains of the mitochondrial import receptors Tom20, Tom22, and Tom70. J Biol Chem 272, 20730–20735. doi:10.1074/jbc.272.33.20730
Burnett, S.F., Farré, J.-C., Nazarko, T.Y., Subramani, S., 2015. Peroxisomal Pex3 activates selective autophagy of peroxisomes via interaction with the pexophagy receptor Atg30. J Biol Chem 290, 8623–8631. doi:10.1074/jbc.M114.619338
148
Cagalinec, M., Safiulina, D., Liiv, M., Liiv, J., Choubey, V., Wareski, P., Veksler, V., Kaasik, A., 2013. Principles of the mitochondrial fusion and fission cycle in neurons. J Cell Sci 126, 2187–2197. doi:10.1242/jcs.118844
Calvo, S.E., Clauser, K.R., Mootha, V.K., 2016. MitoCarta2.0: an updated inventory of mammalian mitochondrial proteins. Nucleic Acids Res 44, D1251–7. doi:10.1093/nar/gkv1003
Campello, S., Strappazzon, F., Cecconi, F., 2014. Mitochondrial dismissal in mammals, from protein degradation to mitophagy. Biochim Biophys Acta 1837, 451–460. doi:10.1016/j.bbabio.2013.11.010
Carling, D., 2017. AMPK signalling in health and disease. Curr Opin Cell Biol 45, 31–37. doi:10.1016/j.ceb.2017.01.005
Cartoni, R., Norsworthy, M.W., Bei, F., Wang, C., Li, S., Zhang, Y., Gabel, C.V., Schwarz, T.L., He, Z., 2016. The Mammalian-Specific Protein Armcx1 Regulates Mitochondrial Transport during Axon Regeneration. Neuron 92, 1294–1307. doi:10.1016/j.neuron.2016.10.060
Cassereau, J., Chevrollier, A., Bonneau, D., Verny, C., Procaccio, V., Reynier, P., Ferré, M., 2011. A locus-specific database for mutations in GDAP1 allows analysis of genotype- phenotype correlations in Charcot-Marie-Tooth diseases type 4A and 2K. Orphanet J Rare Dis 6, 87. doi:10.1186/1750-1172-6-87
Castro, Inês G, Richards, D.M., Metz, J., Costello, J.L., Passmore, J.B., Schrader, T.A., Gouveia, A., Ribeiro, D., Schrader, M., 2018. A role for Mitochondrial Rho GTPase 1 (MIRO1) in motility and membrane dynamics of peroxisomes. Traffic 19, 229–242. doi:10.1111/tra.12549
Castro, Inês Gomes, Schuldiner, M., Zalckvar, E., 2018. Mind the Organelle Gap - Peroxisome Contact Sites in Disease. Trends Biochem Sci 43, 199–210. doi:10.1016/j.tibs.2018.01.001
Celardo, I., Costa, A.C., Lehmann, S., Jones, C., Wood, N., Mencacci, N.E., Mallucci, G.R., Loh, S.H.Y., Martins, L.M., 2016. Mitofusin-mediated ER stress triggers neurodegeneration in pink1/parkin models of Parkinson’s disease. Cell Death Dis 7, e2271. doi:10.1038/cddis.2016.173
Chacinska, A., van der Laan, M., Mehnert, C.S., Guiard, B., Mick, D.U., Hutu, D.P., Truscott, K.N., Wiedemann, N., Meisinger, C., Pfanner, N., Rehling, P., 2010. Distinct forms of mitochondrial TOM-TIM supercomplexes define signal-dependent states of preprotein sorting. Mol Cell Biol 30, 307–318. doi:10.1128/MCB.00749-09
Chang, C.-R., Blackstone, C., 2007. Cyclic AMP-dependent protein kinase phosphorylation of Drp1 regulates its GTPase activity and mitochondrial morphology. J Biol Chem 282, 21583–21587. doi:10.1074/jbc.C700083200
Chao, Y.-H., Robak, L.A., Xia, F., Koenig, M.K., Adesina, A., Bacino, C.A., Scaglia, F., Bellen, H.J., Wangler, M.F., 2016. Missense variants in the middle domain of DNM1L in cases of infantile encephalopathy alter peroxisomes and mitochondria when assayed in Drosophila. Hum Mol Genet 25, 1846–1856. doi:10.1093/hmg/ddw059
149
Chen, H., Chomyn, A., Chan, D.C., 2005. Disruption of fusion results in mitochondrial heterogeneity and dysfunction. J Biol Chem 280, 26185–26192. doi:10.1074/jbc.M503062200
Chen, H., Detmer, S.A., Ewald, A.J., Griffin, E.E., Fraser, S.E., Chan, D.C., 2003. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol 160, 189–200. doi:10.1083/jcb.200211046
Chen, X.J., Butow, R.A., 2005. The organization and inheritance of the mitochondrial genome. Nat Rev Genet 6, 815–825. doi:10.1038/nrg1708
Chen, Y., Dorn, G.W., 2013. PINK1-phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria. Science 340, 471–475. doi:10.1126/science.1231031
Chen, Y., Sheng, Z.-H., 2013. Kinesin-1-syntaphilin coupling mediates activity-dependent regulation of axonal mitochondrial transport. J Cell Biol 202, 351–364. doi:10.1083/jcb.201302040
Chen, Y.-M., Gerwin, C., Sheng, Z.-H., 2009. Dynein light chain LC8 regulates syntaphilin- mediated mitochondrial docking in axons. J Neurosci 29, 9429–9438. doi:10.1523/JNEUROSCI.1472-09.2009
Cho, D.-H., Kim, Y.S., Jo, D.S., Choe, S.-K., Jo, E.-K., 2018. Pexophagy: molecular mechanisms and implications for health and diseases. Mol Cells 41, 55–64. doi:10.14348/molcells.2018.2245
Choi, S.-Y., Huang, P., Jenkins, G.M., Chan, D.C., Schiller, J., Frohman, M.A., 2006. A common lipid links Mfn-mediated mitochondrial fusion and SNARE-regulated exocytosis. Nat Cell Biol 8, 1255–1262. doi:10.1038/ncb1487
Chowdhary, G., Kataya, A.R., Lingner, T., Reumann, S., 2012. Non-canonical peroxisome targeting signals: identification of novel PTS1 tripeptides and characterization of enhancer elements by computational permutation analysis. BMC Plant Biol 12, 142. doi:10.1186/1471-2229-12-142
Chung, J.Y.-M., Steen, J.A., Schwarz, T.L., 2016. Phosphorylation-Induced Motor Shedding Is Required at Mitosis for Proper Distribution and Passive Inheritance of Mitochondria. Cell Rep 16, 2142–2155. doi:10.1016/j.celrep.2016.07.055
Cichocki, B.A., Krumpe, K., Vitali, D.G., Rapaport, D., 2018. Pex19 is involved in importing dually targeted tail-anchored proteins to both mitochondria and peroxisomes. Traffic. doi:10.1111/tra.12604
Cohen, S., Valm, A.M., Lippincott-Schwartz, J., 2018. Interacting organelles. Curr Opin Cell Biol 53, 84–91. doi:10.1016/j.ceb.2018.06.003
Cornelissen, T., Haddad, D., Wauters, F., Van Humbeeck, C., Mandemakers, W., Koentjoro, B., Sue, C., Gevaert, K., De Strooper, B., Verstreken, P., Vandenberghe, W., 2014. The deubiquitinase USP15 antagonizes Parkin-mediated mitochondrial ubiquitination and mitophagy. Hum Mol Genet 23, 5227–5242. doi:10.1093/hmg/ddu244
Costello, J.L., Castro, I.G., Camões, F., Schrader, T.A., McNeall, D., Yang, J., Giannopoulou, E.-A., Gomes, S., Pogenberg, V., Bonekamp, N.A., Ribeiro, D., Wilmanns, M., Jedd, G., Islinger, M., Schrader, M., 2017. Predicting the targeting of tail-anchored proteins to subcellular compartments in mammalian cells. J Cell Sci 130, 1675–1687. doi:10.1242/jcs.200204
150
Courchet, J., Lewis, T.L., Lee, S., Courchet, V., Liou, D.-Y., Aizawa, S., Polleux, F., 2013. Terminal axon branching is regulated by the LKB1-NUAK1 kinase pathway via presynaptic mitochondrial capture. Cell 153, 1510–1525. doi:10.1016/j.cell.2013.05.021
Covill-Cooke, C., Howden, J.H., Birsa, N., Kittler, J.T., 2017. Ubiquitination at the mitochondria in neuronal health and disease. Neurochem Int. doi:10.1016/j.neuint.2017.07.003
Csordás, G., Renken, C., Várnai, P., Walter, L., Weaver, D., Buttle, K.F., Balla, T., Mannella, C.A., Hajnóczky, G., 2006. Structural and functional features and significance of the physical linkage between ER and mitochondria. J Cell Biol 174, 915–921. doi:10.1083/jcb.200604016
Cunniff, B., McKenzie, A.J., Heintz, N.H., Howe, A.K., 2016. AMPK activity regulates trafficking of mitochondria to the leading edge during cell migration and matrix invasion. Mol Biol Cell 27, 2662–2674. doi:10.1091/mbc.E16-05-0286
Cunningham, C.N., Baughman, J.M., Phu, L., Tea, J.S., Yu, C., Coons, M., Kirkpatrick, D.S., Bingol, B., Corn, J.E., 2015. USP30 and parkin homeostatically regulate atypical ubiquitin chains on mitochondria. Nat Cell Biol 17, 160–169. doi:10.1038/ncb3097
Debattisti, V., Gerencser, A.A., Saotome, M., Das, S., Hajnóczky, G., 2017. ROS Control Mitochondrial Motility through p38 and the Motor Adaptor Miro/Trak. Cell Rep 21, 1667–1680. doi:10.1016/j.celrep.2017.10.060
Del Dotto, V., Mishra, P., Vidoni, S., Fogazza, M., Maresca, A., Caporali, L., McCaffery, J.M., Cappelletti, M., Baruffini, E., Lenaers, G., Chan, D., Rugolo, M., Carelli, V., Zanna, C., 2017. OPA1 isoforms in the hierarchical organization of mitochondrial functions. Cell Rep 19, 2557–2571. doi:10.1016/j.celrep.2017.05.073
Delille, H.K., Agricola, B., Guimaraes, S.C., Borta, H., Lüers, G.H., Fransen, M., Schrader, M., 2010. Pex11pbeta-mediated growth and division of mammalian peroxisomes follows a maturation pathway. J Cell Sci 123, 2750–2762. doi:10.1242/jcs.062109
Delille, H.K., Schrader, M., 2008. Targeting of hFis1 to peroxisomes is mediated by Pex19p. J Biol Chem 283, 31107–31115. doi:10.1074/jbc.M803332200
Demarquoy, J., Le Borgne, F., 2015. Crosstalk between mitochondria and peroxisomes. World J Biol Chem 6, 301–309. doi:10.4331/wjbc.v6.i4.301
Deng, H., Dodson, M.W., Huang, H., Guo, M., 2008. The Parkinson’s disease genes pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila. Proc Natl Acad Sci U S A 105, 14503–14508. doi:10.1073/pnas.0803998105
Deosaran, E., Larsen, K.B., Hua, R., Sargent, G., Wang, Y., Kim, S., Lamark, T., Jauregui, M., Law, K., Lippincott-Schwartz, J., Brech, A., Johansen, T., Kim, P.K., 2013. NBR1 acts as an autophagy receptor for peroxisomes. J Cell Sci 126, 939–952. doi:10.1242/jcs.114819
Devine, M.J., Birsa, N., Kittler, J.T., 2016. Miro sculpts mitochondrial dynamics in neuronal health and disease. Neurobiol Dis 90, 27–34. doi:10.1016/j.nbd.2015.12.008
Dietrich, D., Seiler, F., Essmann, F., Dodt, G., 2013. Identification of the kinesin KifC3 as a new player for positioning of peroxisomes and other organelles in mammalian cells. Biochim Biophys Acta 1833, 3013–3024. doi:10.1016/j.bbamcr.2013.08.002
151
Ding, L., Lei, Y., Han, Y., Li, Y., Ji, X., Liu, L., 2016. Vimar Is a Novel Regulator of Mitochondrial Fission through Miro. PLoS Genet 12, e1006359. doi:10.1371/journal.pgen.1006359
Dixit, E., Boulant, S., Zhang, Y., Lee, A.S.Y., Odendall, C., Shum, B., Hacohen, N., Chen, Z.J., Whelan, S.P., Fransen, M., Nibert, M.L., Superti-Furga, G., Kagan, J.C., 2010. Peroxisomes are signaling platforms for antiviral innate immunity. Cell 141, 668–681. doi:10.1016/j.cell.2010.04.018
Doiron, K., Goyon, V., Coyaud, E., Rajapakse, S., Raught, B., McBride, H.M., 2017. The dynamic interacting landscape of MAPL reveals essential functions for SUMOylation in innate immunity. Sci Rep 7, 107. doi:10.1038/s41598-017-00151-6
Dolezal, P., Likic, V., Tachezy, J., Lithgow, T., 2006. Evolution of the molecular machines for protein import into mitochondria. Science 313, 314–318. doi:10.1126/science.1127895
Dudek, J., Rehling, P., van der Laan, M., 2013. Mitochondrial protein import: common principles and physiological networks. Biochim Biophys Acta 1833, 274–285. doi:10.1016/j.bbamcr.2012.05.028
Durcan, T.M., Tang, M.Y., Pérusse, J.R., Dashti, E.A., Aguileta, M.A., McLelland, G.-L., Gros, P., Shaler, T.A., Faubert, D., Coulombe, B., Fon, E.A., 2014. USP8 regulates mitophagy by removing K6-linked ubiquitin conjugates from parkin. EMBO J 33, 2473–2491. doi:10.15252/embj.201489729
Ebberink, M.S., Koster, J., Visser, G., Spronsen, F. van, Stolte-Dijkstra, I., Smit, G.P.A., Fock, J.M., Kemp, S., Wanders, R.J.A., Waterham, H.R., 2012. A novel defect of peroxisome division due to a homozygous non-sense mutation in the PEX11β gene. J Med Genet 49, 307–313. doi:10.1136/jmedgenet-2012-100778
English, A.R., Voeltz, G.K., 2013. Endoplasmic reticulum structure and interconnections with other organelles. Cold Spring Harb Perspect Biol 5, a013227. doi:10.1101/cshperspect.a013227
Erdmann, R., Schliebs, W., 2005. Peroxisomal matrix protein import: the transient pore model. Nat Rev Mol Cell Biol 6, 738–742. doi:10.1038/nrm1710
Faits, M.C., Zhang, C., Soto, F., Kerschensteiner, D., 2016. Dendritic mitochondria reach stable positions during circuit development. elife 5, e11583. doi:10.7554/eLife.11583
Fan, J., Li, X., Issop, L., Culty, M., Papadopoulos, V., 2016. ACBD2/ECI2-Mediated Peroxisome-Mitochondria Interactions in Leydig Cell Steroid Biosynthesis. Mol Endocrinol 30, 763–782. doi:10.1210/me.2016-1008
Fan, Y., Wali, G., Sutharsan, R., Bellette, B., Crane, D.I., Sue, C.M., Mackay-Sim, A., 2014. Low dose tubulin-binding drugs rescue peroxisome trafficking deficit in patient- derived stem cells in Hereditary Spastic Paraplegia. Biol. Open 3, 494–502. doi:10.1242/bio.20147641
Fang, Y., Morrell, J.C., Jones, J.M., Gould, S.J., 2004. PEX3 functions as a PEX19 docking factor in the import of class I peroxisomal membrane proteins. J Cell Biol 164, 863– 875. doi:10.1083/jcb.200311131
152
Farré, J.-C., Burkenroad, A., Burnett, S.F., Subramani, S., 2013. Phosphorylation of mitophagy and pexophagy receptors coordinates their interaction with Atg8 and Atg11. EMBO Rep 14, 441–449. doi:10.1038/embor.2013.40
Fransen, M., Terlecky, S.R., Subramani, S., 1998. Identification of a human PTS1 receptor docking protein directly required for peroxisomal protein import. Proc Natl Acad Sci U S A 95, 8087–8092.
Fransson, A., Ruusala, A., Aspenström, P., 2003. Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J Biol Chem 278, 6495–6502. doi:10.1074/jbc.M208609200
Fransson, S., Ruusala, A., Aspenström, P., 2006. The atypical Rho GTPases Miro-1 and Miro-2 have essential roles in mitochondrial trafficking. Biochem Biophys Res Commun 344, 500–510. doi:10.1016/j.bbrc.2006.03.163
Frederick, R.L., McCaffery, J.M., Cunningham, K.W., Okamoto, K., Shaw, J.M., 2004. Yeast Miro GTPase, Gem1p, regulates mitochondrial morphology via a novel pathway. J Cell Biol 167, 87–98. doi:10.1083/jcb.200405100
Frezza, C., Cipolat, S., Scorrano, L., 2007. Organelle isolation: functional mitochondria from mouse liver, muscle and cultured fibroblasts. Nat Protoc 2, 287–295. doi:10.1038/nprot.2006.478
Friedman, J.R., Lackner, L.L., West, M., DiBenedetto, J.R., Nunnari, J., Voeltz, G.K., 2011. ER tubules mark sites of mitochondrial division. Science 334, 358–362. doi:10.1126/science.1207385
Friedman, J.R., Nunnari, J., 2014. Mitochondrial form and function. Nature 505, 335–343. doi:10.1038/nature12985
Gandre-Babbe, S., van der Bliek, A.M., 2008. The novel tail-anchored membrane protein Mff controls mitochondrial and peroxisomal fission in mammalian cells. Mol Biol Cell 19, 2402–2412. doi:10.1091/mbc.E07-12-1287
Gautheron, D.C., 1984. Mitochondrial oxidative phosphorylation and respiratory chain: review. J Inherit Metab Dis 7 Suppl 1, 57–61.
Gautier, C.A., Erpapazoglou, Z., Mouton-Liger, F., Muriel, M.P., Cormier, F., Bigou, S., Duffaure, S., Girard, M., Foret, B., Iannielli, A., Broccoli, V., Dalle, C., Bohl, D., Michel, P.P., Corvol, J.-C., Brice, A., Corti, O., 2016. The endoplasmic reticulum- mitochondria interface is perturbed in PARK2 knockout mice and patients with PARK2 mutations. Hum Mol Genet 25, 2972–2984. doi:10.1093/hmg/ddw148
Gegg, M.E., Cooper, J.M., Chau, K.-Y., Rojo, M., Schapira, A.H.V., Taanman, J.-W., 2010. Mitofusin 1 and mitofusin 2 are ubiquitinated in a PINK1/parkin-dependent manner upon induction of mitophagy. Hum Mol Genet 19, 4861–4870. doi:10.1093/hmg/ddq419
George, R., Beddoe, T., Landl, K., Lithgow, T., 1998. The yeast nascent polypeptide- associated complex initiates protein targeting to mitochondria in vivo. Proc Natl Acad Sci U S A 95, 2296–2301. doi:10.1073/pnas.95.5.2296
Glater, E.E., Megeath, L.J., Stowers, R.S., Schwarz, T.L., 2006. Axonal transport of mitochondria requires milton to recruit kinesin heavy chain and is light chain independent. J Cell Biol 173, 545–557. doi:10.1083/jcb.200601067
153
Gomez-Suaga, P., Paillusson, S., Stoica, R., Noble, W., Hanger, D.P., Miller, C.C.J., 2017. The ER-Mitochondria Tethering Complex VAPB-PTPIP51 Regulates Autophagy. Curr Biol 27, 371–385. doi:10.1016/j.cub.2016.12.038
Gorman, G.S., Chinnery, P.F., DiMauro, S., Hirano, M., Koga, Y., McFarland, R., Suomalainen, A., Thorburn, D.R., Zeviani, M., Turnbull, D.M., 2016. Mitochondrial diseases. Nat. Rev. Dis. Primers 2, 16080. doi:10.1038/nrdp.2016.80
Gould, S.J., Keller, G.A., Schneider, M., Howell, S.H., Garrard, L.J., Goodman, J.M., Distel, B., Tabak, H., Subramani, S., 1990. Peroxisomal protein import is conserved between yeast, plants, insects and mammals. EMBO J 9, 85–90.
Gouveia, A.M., Guimaraes, C.P., Oliveira, M.E., Reguenga, C., Sa-Miranda, C., Azevedo, J.E., 2003. Characterization of the peroxisomal cycling receptor, Pex5p, using a cell- free in vitro import system. J Biol Chem 278, 226–232. doi:10.1074/jbc.M209498200
Gouveia, A.M., Reguenga, C., Oliveira, M.E., Sa-Miranda, C., Azevedo, J.E., 2000. Characterization of peroxisomal Pex5p from rat liver. Pex5p in the Pex5p-Pex14p membrane complex is a transmembrane protein. J Biol Chem 275, 32444–32451. doi:10.1074/jbc.M004366200
Greene, A.W., Grenier, K., Aguileta, M.A., Muise, S., Farazifard, R., Haque, M.E., McBride, H.M., Park, D.S., Fon, E.A., 2012. Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep 13, 378–385. doi:10.1038/embor.2012.14
Guimaraes, S.C., Schuster, M., Bielska, E., Dagdas, G., Kilaru, S., Meadows, B.R.A., Schrader, M., Steinberg, G., 2015. Peroxisomes, lipid droplets, and endoplasmic reticulum “hitchhike” on motile early endosomes. J Cell Biol 211, 945–954. doi:10.1083/jcb.201505086
Guo, X., Macleod, G.T., Wellington, A., Hu, F., Panchumarthi, S., Schoenfield, M., Marin, L., Charlton, M.P., Atwood, H.L., Zinsmaier, K.E., 2005. The GTPase dMiro is required for axonal transport of mitochondria to Drosophila synapses. Neuron 47, 379–393. doi:10.1016/j.neuron.2005.06.027
Halbach, A., Landgraf, C., Lorenzen, S., Rosenkranz, K., Volkmer-Engert, R., Erdmann, R., Rottensteiner, H., 2006. Targeting of the tail-anchored peroxisomal membrane proteins PEX26 and PEX15 occurs through C-terminal PEX19-binding sites. J Cell Sci 119, 2508–2517. doi:10.1242/jcs.02979
Hammerling, B.C., Najor, R.H., Cortez, M.Q., Shires, S.E., Leon, L.J., Gonzalez, E.R., Boassa, D., Phan, S., Thor, A., Jimenez, R.E., Li, H., Kitsis, R.N., Dorn, G.W., Sadoshima, J., Ellisman, M.H., Gustafsson, Å.B., 2017. A Rab5 endosomal pathway mediates Parkin-dependent mitochondrial clearance. Nat Commun 8, 14050. doi:10.1038/ncomms14050
Han, X.-J., Lu, Y.-F., Li, S.-A., Kaitsuka, T., Sato, Y., Tomizawa, K., Nairn, A.C., Takei, K., Matsui, H., Matsushita, M., 2008. CaM kinase I alpha-induced phosphorylation of Drp1 regulates mitochondrial morphology. J Cell Biol 182, 573–585. doi:10.1083/jcb.200802164
Hatch, A.L., Gurel, P.S., Higgs, H.N., 2014. Novel roles for actin in mitochondrial fission. J Cell Sci 127, 4549–4560. doi:10.1242/jcs.153791
154
Hegde, R.S., Keenan, R.J., 2011. Tail-anchored membrane protein insertion into the endoplasmic reticulum. Nat Rev Mol Cell Biol 12, 787–798. doi:10.1038/nrm3226
Hoepfner, D., Schildknegt, D., Braakman, I., Philippsen, P., Tabak, H.F., 2005. Contribution of the endoplasmic reticulum to peroxisome formation. Cell 122, 85–95. doi:10.1016/j.cell.2005.04.025
Hroudová, J., Fišar, Z., 2013. Control mechanisms in mitochondrial oxidative phosphorylation. Neural Regen. Res. 8, 363–375. doi:10.3969/j.issn.1673-5374.2013.04.009
Hsieh, C.-H., Shaltouki, A., Gonzalez, A.E., Bettencourt da Cruz, A., Burbulla, L.F., St Lawrence, E., Schüle, B., Krainc, D., Palmer, T.D., Wang, X., 2016. Functional impairment in miro degradation and mitophagy is a shared feature in familial and sporadic parkinson’s disease. Cell Stem Cell 19, 709–724. doi:10.1016/j.stem.2016.08.002
Hua, R., Cheng, D., Coyaud, É., Freeman, S., Di Pietro, E., Wang, Y., Vissa, A., Yip, C.M., Fairn, G.D., Braverman, N., Brumell, J.H., Trimble, W.S., Raught, B., Kim, P.K., 2017. VAPs and ACBD5 tether peroxisomes to the ER for peroxisome maintenance and lipid homeostasis. J Cell Biol 216, 367–377. doi:10.1083/jcb.201608128
Huang, H., Gao, Q., Peng, X., Choi, S.-Y., Sarma, K., Ren, H., Morris, A.J., Frohman, M.A., 2011. piRNA-associated germline nuage formation and spermatogenesis require MitoPLD profusogenic mitochondrial-surface lipid signaling. Dev Cell 20, 376–387. doi:10.1016/j.devcel.2011.01.004
Huber, C., Saffrich, R., Anton, M., Passreiter, M., Ansorge, W., Gorgas, K., Just, W., 1997. A heterotrimeric G protein-phospholipase A2 signaling cascade is involved in the regulation of peroxisomal motility in CHO cells. J Cell Sci 110 ( Pt 23), 2955–2968.
Huber, C.M., Saffrich, R., Ansorge, W., Just, W.W., 1999. Receptor-mediated regulation of peroxisomal motility in CHO and endothelial cells. EMBO J 18, 5476–5485. doi:10.1093/emboj/18.20.5476
Huber, N., Guimaraes, S., Schrader, M., Suter, U., Niemann, A., 2013. Charcot-Marie-Tooth disease-associated mutants of GDAP1 dissociate its roles in peroxisomal and mitochondrial fission. EMBO Rep 14, 545–552. doi:10.1038/embor.2013.56
Hurd, D.D., Saxton, W.M., 1996. Kinesin mutations cause motor neuron disease phenotypes by disrupting fast axonal transport in Drosophila. Genetics 144, 1075–1085.
Im, H., 2011. The Inoue Method for Preparation and Transformation of Competent E. coli: “Ultra Competent” Cells. Bio Protoc 1. doi:10.21769/BioProtoc.143
Ingerman, E., Perkins, E.M., Marino, M., Mears, J.A., McCaffery, J.M., Hinshaw, J.E., Nunnari, J., 2005. Dnm1 forms spirals that are structurally tailored to fit mitochondria. J Cell Biol 170, 1021–1027. doi:10.1083/jcb.200506078
Iyer, S.P.N., Akimoto, Y., Hart, G.W., 2003. Identification and cloning of a novel family of coiled-coil domain proteins that interact with O-GlcNAc transferase. J Biol Chem 278, 5399–5409. doi:10.1074/jbc.M209384200
Iyer, S.P.N., Hart, G.W., 2003. Roles of the tetratricopeptide repeat domain in O-GlcNAc transferase targeting and protein substrate specificity. J Biol Chem 278, 24608– 24616. doi:10.1074/jbc.M300036200
155
Jenkins, K., Khoo, J.J., Sadler, A., Piganis, R., Wang, D., Borg, N.A., Hjerrild, K., Gould, J., Thomas, B.J., Nagley, P., Hertzog, P.J., Mansell, A., 2013. Mitochondrially localised MUL1 is a novel modulator of antiviral signaling. Immunol Cell Biol 91, 321–330. doi:10.1038/icb.2013.7
Ji, W.-K., Chakrabarti, R., Fan, X., Schoenfeld, L., Strack, S., Higgs, H.N., 2017. Receptor- mediated Drp1 oligomerization on endoplasmic reticulum. J Cell Biol 216, 4123– 4139. doi:10.1083/jcb.201610057
Jin, S.M., Lazarou, M., Wang, C., Kane, L.A., Narendra, D.P., Youle, R.J., 2010. Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J Cell Biol 191, 933–942. doi:10.1083/jcb.201008084
Jones, J.M., Morrell, J.C., Gould, S.J., 2004. PEX19 is a predominantly cytosolic chaperone and import receptor for class 1 peroxisomal membrane proteins. J Cell Biol 164, 57– 67. doi:10.1083/jcb.200304111
Joshi, A.S., Nebenfuehr, B., Choudhary, V., Satpute-Krishnan, P., Levine, T.P., Golden, A., Prinz, W.A., 2018. Lipid droplet and peroxisome biogenesis occur at the same ER subdomains. Nat Commun 9, 2940. doi:10.1038/s41467-018-05277-3
Kane, L.A., Lazarou, M., Fogel, A.I., Li, Y., Yamano, K., Sarraf, S.A., Banerjee, S., Youle, R.J., 2014. PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. J Cell Biol 205, 143–153. doi:10.1083/jcb.201402104
Kanfer, G., Courthéoux, T., Peterka, M., Meier, S., Soste, M., Melnik, A., Reis, K., Aspenström, P., Peter, M., Picotti, P., Kornmann, B., 2015. Mitotic redistribution of the mitochondrial network by Miro and Cenp-F. Nat Commun 6, 8015. doi:10.1038/ncomms9015
Kanfer, G., Peterka, M., Arzhanik, V.K., Drobyshev, A.L., Ataullakhanov, F.I., Volkov, V.A., Kornmann, B., 2017. CENP-F couples cargo to growing and shortening microtubule ends. Mol Biol Cell. doi:10.1091/mbc.E16-11-0756
Kang, J.-S., Tian, J.-H., Pan, P.-Y., Zald, P., Li, C., Deng, C., Sheng, Z.-H., 2008. Docking of axonal mitochondria by syntaphilin controls their mobility and affects short-term facilitation. Cell 132, 137–148. doi:10.1016/j.cell.2007.11.024
Kapitein, L.C., Schlager, M.A., Kuijpers, M., Wulf, P.S., van Spronsen, M., MacKintosh, F.C., Hoogenraad, C.C., 2010. Mixed microtubules steer dynein-driven cargo transport into dendrites. Curr Biol 20, 290–299. doi:10.1016/j.cub.2009.12.052
Kazlauskaite, A., Kondapalli, C., Gourlay, R., Campbell, D.G., Ritorto, M.S., Hofmann, K., Alessi, D.R., Knebel, A., Trost, M., Muqit, M.M.K., 2014. Parkin is activated by PINK1- dependent phosphorylation of ubiquitin at Ser65. Biochem J 460, 127–139. doi:10.1042/BJ20140334
Kazlauskaite, A., Martínez-Torres, R.J., Wilkie, S., Kumar, A., Peltier, J., Gonzalez, A., Johnson, C., Zhang, J., Hope, A.G., Peggie, M., Trost, M., van Aalten, D.M.F., Alessi, D.R., Prescott, A.R., Knebel, A., Walden, H., Muqit, M.M.K., 2015. Binding to serine 65-phosphorylated ubiquitin primes Parkin for optimal PINK1-dependent phosphorylation and activation. EMBO Rep 16, 939–954. doi:10.15252/embr.201540352
156
Kemper, C., Habib, S.J., Engl, G., Heckmeyer, P., Dimmer, K.S., Rapaport, D., 2008. Integration of tail-anchored proteins into the mitochondrial outer membrane does not require any known import components. J Cell Sci 121, 1990–1998. doi:10.1242/jcs.024034
Khalifat, N., Puff, N., Bonneau, S., Fournier, J.-B., Angelova, M.I., 2008. Membrane deformation under local pH gradient: mimicking mitochondrial cristae dynamics. Biophys J 95, 4924–4933. doi:10.1529/biophysj.108.136077
Kim, P.K., Hailey, D.W., Mullen, R.T., Lippincott-Schwartz, J., 2008. Ubiquitin signals autophagic degradation of cytosolic proteins and peroxisomes. Proc Natl Acad Sci U S A 105, 20567–20574. doi:10.1073/pnas.0810611105
Kim, P.K., Hettema, E.H., 2015. Multiple pathways for protein transport to peroxisomes. J Mol Biol 427, 1176–1190. doi:10.1016/j.jmb.2015.02.005
Kim, P.K., Mullen, R.T., Schumann, U., Lippincott-Schwartz, J., 2006. The origin and maintenance of mammalian peroxisomes involves a de novo PEX16-dependent pathway from the ER. J Cell Biol 173, 521–532. doi:10.1083/jcb.200601036
Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y., Shimizu, N., 1998. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, 605–608. doi:10.1038/33416
Klosowiak, J.L., Focia, P.J., Chakravarthy, S., Landahl, E.C., Freymann, D.M., Rice, S.E., 2013. Structural coupling of the EF hand and C-terminal GTPase domains in the mitochondrial protein Miro. EMBO Rep 14, 968–974. doi:10.1038/embor.2013.151
Klouwer, F.C.C., Berendse, K., Ferdinandusse, S., Wanders, R.J.A., Engelen, M., Poll-The, B.T., 2015. Zellweger spectrum disorders: clinical overview and management approach. Orphanet J Rare Dis 10, 151. doi:10.1186/s13023-015-0368-9
Koch, A., Thiemann, M., Grabenbauer, M., Yoon, Y., McNiven, M.A., Schrader, M., 2003. Dynamin-like protein 1 is involved in peroxisomal fission. J Biol Chem 278, 8597– 8605. doi:10.1074/jbc.M211761200
Koch, A., Yoon, Y., Bonekamp, N.A., McNiven, M.A., Schrader, M., 2005. A role for Fis1 in both mitochondrial and peroxisomal fission in mammalian cells. Mol Biol Cell 16, 5077–5086. doi:10.1091/mbc.E05-02-0159
Koch, J., Brocard, C., 2012. PEX11 proteins attract Mff and human Fis1 to coordinate peroxisomal fission. J Cell Sci 125, 3813–3826. doi:10.1242/jcs.102178
Koch, J., Pranjic, K., Huber, A., Ellinger, A., Hartig, A., Kragler, F., Brocard, C., 2010. PEX11 family members are membrane elongation factors that coordinate peroxisome proliferation and maintenance. J Cell Sci 123, 3389–3400. doi:10.1242/jcs.064907
Kornmann, B., Currie, E., Collins, S.R., Schuldiner, M., Nunnari, J., Weissman, J.S., Walter, P., 2009. An ER-mitochondria tethering complex revealed by a synthetic biology screen. Science 325, 477–481. doi:10.1126/science.1175088
Kornmann, B., Osman, C., Walter, P., 2011. The conserved GTPase Gem1 regulates endoplasmic reticulum-mitochondria connections. Proc Natl Acad Sci U S A 108, 14151–14156. doi:10.1073/pnas.1111314108
157
Korobova, F., Ramabhadran, V., Higgs, H.N., 2013. An actin-dependent step in mitochondrial fission mediated by the ER-associated formin INF2. Science 339, 464–467. doi:10.1126/science.1228360
Koshiba, T., Detmer, S.A., Kaiser, J.T., Chen, H., McCaffery, J.M., Chan, D.C., 2004. Structural basis of mitochondrial tethering by mitofusin complexes. Science 305, 858– 862. doi:10.1126/science.1099793
Koshiba, T., Holman, H.A., Kubara, K., Yasukawa, K., Kawabata, S., Okamoto, K., MacFarlane, J., Shaw, J.M., 2011. Structure-function analysis of the yeast mitochondrial Rho GTPase, Gem1p: implications for mitochondrial inheritance. J Biol Chem 286, 354–362. doi:10.1074/jbc.M110.180034
Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., Endo, T., Fon, E.A., Trempe, J.-F., Saeki, Y., Tanaka, K., Matsuda, N., 2014. Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162–166. doi:10.1038/nature13392
Kozjak-Pavlovic, V., 2017. The MICOS complex of human mitochondria. Cell Tissue Res 367, 83–93. doi:10.1007/s00441-016-2433-7
Kruppa, A.J., Kishi-Itakura, C., Masters, T.A., Rorbach, J.E., Grice, G.L., Kendrick-Jones, J., Nathan, J.A., Minczuk, M., Buss, F., 2018. Myosin VI-Dependent Actin Cages Encapsulate Parkin-Positive Damaged Mitochondria. Dev Cell 44. doi:10.1016/j.devcel.2018.01.007
Künkele, K.P., Heins, S., Dembowski, M., Nargang, F.E., Benz, R., Thieffry, M., Walz, J., Lill, R., Nussberger, S., Neupert, W., 1998. The preprotein translocation channel of the outer membrane of mitochondria. Cell 93, 1009–1019.
Kunze, M., Malkani, N., Maurer-Stroh, S., Wiesinger, C., Schmid, J.A., Berger, J., 2015. Mechanistic insights into PTS2-mediated peroxisomal protein import: the co-receptor PEX5L drastically increases the interaction strength between the cargo protein and the receptor PEX7. J Biol Chem 290, 4928–4940. doi:10.1074/jbc.M114.601575
Kural, C., Kim, H., Syed, S., Goshima, G., Gelfand, V.I., Selvin, P.R., 2005. Kinesin and dynein move a peroxisome in vivo: a tug-of-war or coordinated movement? Science 308, 1469–1472. doi:10.1126/science.1108408
LaGory, E.L., Giaccia, A.J., 2016. The ever-expanding role of HIF in tumour and stromal biology. Nat Cell Biol 18, 356–365. doi:10.1038/ncb3330
Lazarou, M., Jin, S.M., Kane, L.A., Youle, R.J., 2012. Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev Cell 22, 320–333. doi:10.1016/j.devcel.2011.12.014
Lazarou, M., Sliter, D.A., Kane, L.A., Sarraf, S.A., Wang, C., Burman, J.L., Sideris, D.P., Fogel, A.I., Youle, R.J., 2015. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524, 309–314. doi:10.1038/nature14893
Lee, C.A., Chin, L.-S., Li, L., 2018. Hypertonia-linked protein Trak1 functions with mitofusins to promote mitochondrial tethering and fusion. Protein Cell 9, 693–716. doi:10.1007/s13238-017-0469-4
158
Lee, J.E., Westrate, L.M., Wu, H., Page, C., Voeltz, G.K., 2016. Multiple dynamin family members collaborate to drive mitochondrial division. Nature 540, 139–143. doi:10.1038/nature20555
Lee, M.Y., Sumpter, R., Zou, Z., Sirasanagandla, S., Wei, Y., Mishra, P., Rosewich, H., Crane, D.I., Levine, B., 2017. Peroxisomal protein PEX13 functions in selective autophagy. EMBO Rep 18, 48–60. doi:10.15252/embr.201642443
Lee, S., Lee, K.-S., Huh, S., Liu, S., Lee, D.-Y., Hong, S.H., Yu, K., Lu, B., 2016. Polo Kinase Phosphorylates Miro to Control ER-Mitochondria Contact Sites and Mitochondrial Ca(2+) Homeostasis in Neural Stem Cell Development. Dev Cell 37, 174–189. doi:10.1016/j.devcel.2016.03.023
Lewis, T.L., Turi, G.F., Kwon, S.-K., Losonczy, A., Polleux, F., 2016. Progressive Decrease of Mitochondrial Motility during Maturation of Cortical Axons In Vitro and In Vivo. Curr Biol 26, 2602–2608. doi:10.1016/j.cub.2016.07.064
Li, X., Gould, S.J., 2003. The dynamin-like GTPase DLP1 is essential for peroxisome division and is recruited to peroxisomes in part by PEX11. J Biol Chem 278, 17012–17020. doi:10.1074/jbc.M212031200
Liao, P.-C., Tandarich, L.C., Hollenbeck, P.J., 2017. ROS regulation of axonal mitochondrial transport is mediated by Ca2+ and JNK in Drosophila. PLoS ONE 12, e0178105. doi:10.1371/journal.pone.0178105
Lin, C., Schuster, M., Guimaraes, S.C., Ashwin, P., Schrader, M., Metz, J., Hacker, C., Gurr, S.J., Steinberg, G., 2016. Active diffusion and microtubule-based transport oppose myosin forces to position organelles in cells. Nat Commun 7, 11814. doi:10.1038/ncomms11814
Lin, M.-Y., Cheng, X.-T., Tammineni, P., Xie, Y., Zhou, B., Cai, Q., Sheng, Z.-H., 2017. Releasing Syntaphilin Removes Stressed Mitochondria from Axons Independent of Mitophagy under Pathophysiological Conditions. Neuron 94, 595–610.e6. doi:10.1016/j.neuron.2017.04.004
Liu, A.P., Botelho, R.J., Antonescu, C.N., 2017. The big and intricate dreams of little organelles: Embracing complexity in the study of membrane traffic. Traffic. doi:10.1111/tra.12497
Liu, S., Sawada, T., Lee, S., Yu, W., Silverio, G., Alapatt, P., Millan, I., Shen, A., Saxton, W., Kanao, T., Takahashi, R., Hattori, N., Imai, Y., Lu, B., 2012. Parkinson’s disease- associated kinase PINK1 regulates Miro protein level and axonal transport of mitochondria. PLoS Genet 8, e1002537. doi:10.1371/journal.pgen.1002537
López-Doménech, G., Covill-Cooke, C., Ivankovic, D., Halff, E.F., Sheehan, D.F., Norkett, R., Birsa, N., Kittler, J.T., 2018. Miro proteins coordinate microtubule- and actin- dependent mitochondrial transport and distribution. EMBO J 37, 321–336. doi:10.15252/embj.201696380
López-Doménech, G., Higgs, N.F., Vaccaro, V., Roš, H., Arancibia-Cárcamo, I.L., MacAskill, A.F., Kittler, J.T., 2016. Loss of Dendritic Complexity Precedes Neurodegeneration in a Mouse Model with Disrupted Mitochondrial Distribution in Mature Dendrites. Cell Rep 17, 317–327. doi:10.1016/j.celrep.2016.09.004
159
López-Doménech, G., Serrat, R., Mirra, S., D’Aniello, S., Somorjai, I., Abad, A., Vitureira, N., García-Arumí, E., Alonso, M.T., Rodriguez-Prados, M., Burgaya, F., Andreu, A.L., García-Sancho, J., Trullas, R., Garcia-Fernàndez, J., Soriano, E., 2012. The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2. Nat Commun 3, 814. doi:10.1038/ncomms1829
MacAskill, A.F., Brickley, K., Stephenson, F.A., Kittler, J.T., 2009. GTPase dependent recruitment of Grif-1 by Miro1 regulates mitochondrial trafficking in hippocampal neurons. Mol Cell Neurosci 40, 301–312. doi:10.1016/j.mcn.2008.10.016
Macaskill, A.F., Rinholm, J.E., Twelvetrees, A.E., Arancibia-Carcamo, I.L., Muir, J., Fransson, A., Aspenstrom, P., Attwell, D., Kittler, J.T., 2009. Miro1 is a calcium sensor for glutamate receptor-dependent localization of mitochondria at synapses. Neuron 61, 541–555. doi:10.1016/j.neuron.2009.01.030
MacVicar, T., Langer, T., 2016. OPA1 processing in cell death and disease - the long and short of it. J Cell Sci 129, 2297–2306. doi:10.1242/jcs.159186
Marcassa, E., Kallinos, A., Jardine, J., Rusilowicz-Jones, E.V., Martinez, A., Kuehl, S., Islinger, M., Clague, M.J., Urbé, S., 2018. Dual role of USP30 in controlling basal pexophagy and mitophagy. EMBO Rep. doi:10.15252/embr.201745595
Matsuzono, Y., Fujiki, Y., 2006. In vitro transport of membrane proteins to peroxisomes by shuttling receptor Pex19p. J Biol Chem 281, 36–42. doi:10.1074/jbc.M509819200
Mattiazzi Ušaj, M., Brložnik, M., Kaferle, P., Žitnik, M., Wolinski, H., Leitner, F., Kohlwein, S.D., Zupan, B., Petrovič, U., 2015. Genome-Wide Localization Study of Yeast Pex11 Identifies Peroxisome-Mitochondria Interactions through the ERMES Complex. J Mol Biol 427, 2072–2087. doi:10.1016/j.jmb.2015.03.004
Mayerhofer, P.U., 2016. Targeting and insertion of peroxisomal membrane proteins: ER trafficking versus direct delivery to peroxisomes. Biochim Biophys Acta 1863, 870– 880. doi:10.1016/j.bbamcr.2015.09.021
McGuinness, M.C., Lu, J.F., Zhang, H.P., Dong, G.X., Heinzer, A.K., Watkins, P.A., Powers, J., Smith, K.D., 2003. Role of ALDP (ABCD1) and mitochondria in X-linked adrenoleukodystrophy. Mol Cell Biol 23, 744–753.
McLelland, G.-L., Lee, S.A., McBride, H.M., Fon, E.A., 2016. Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system. J Cell Biol 214, 275–291. doi:10.1083/jcb.201603105
McLelland, G.-L., Soubannier, V., Chen, C.X., McBride, H.M., Fon, E.A., 2014. Parkin and PINK1 function in a vesicular trafficking pathway regulating mitochondrial quality control. EMBO J 33, 282–295. doi:10.1002/embj.201385902
McNew, J.A., Goodman, J.M., 1994. An oligomeric protein is imported into peroxisomes in vivo. J Cell Biol 127, 1245–1257.
Meinecke, M., Cizmowski, C., Schliebs, W., Krüger, V., Beck, S., Wagner, R., Erdmann, R., 2010. The peroxisomal importomer constitutes a large and highly dynamic pore. Nat Cell Biol 12, 273–277. doi:10.1038/ncb2027
Miller, K.E., Sheetz, M.P., 2004. Axonal mitochondrial transport and potential are correlated. J Cell Sci 117, 2791–2804. doi:10.1242/jcs.01130
160
Mironov, S.L., 2007. ADP regulates movements of mitochondria in neurons. Biophys J 92, 2944–2952. doi:10.1529/biophysj.106.092981
Mishra, P., Chan, D.C., 2014. Mitochondrial dynamics and inheritance during cell division, development and disease. Nat Rev Mol Cell Biol 15, 634–646. doi:10.1038/nrm3877
Misko, A., Jiang, S., Wegorzewska, I., Milbrandt, J., Baloh, R.H., 2010. Mitofusin 2 is necessary for transport of axonal mitochondria and interacts with the Miro/Milton complex. J Neurosci 30, 4232–4240. doi:10.1523/JNEUROSCI.6248-09.2010
Miyata, N., Fujiki, Y., 2005. Shuttling mechanism of peroxisome targeting signal type 1 receptor Pex5: ATP-independent import and ATP-dependent export. Mol Cell Biol 25, 10822–10832. doi:10.1128/MCB.25.24.10822-10832.2005
Monticone, M., Panfoli, I., Ravera, S., Puglisi, R., Jiang, M.-M., Morello, R., Candiani, S., Tonachini, L., Biticchi, R., Fabiano, A., Cancedda, R., Boitani, C., Castagnola, P., 2010. The nuclear genes Mtfr1 and Dufd1 regulate mitochondrial dynamic and cellular respiration. J Cell Physiol 225, 767–776. doi:10.1002/jcp.22279
Moore, A.S., Wong, Y.C., Simpson, C.L., Holzbaur, E.L.F., 2016. Dynamic actin cycling through mitochondrial subpopulations locally regulates the fission-fusion balance within mitochondrial networks. Nat Commun 7, 12886. doi:10.1038/ncomms12886
Mordas, A., Tokatlidis, K., 2015. The MIA pathway: a key regulator of mitochondrial oxidative protein folding and biogenesis. Acc Chem Res 48, 2191–2199. doi:10.1021/acs.accounts.5b00150
Morris, R.L., Hollenbeck, P.J., 1995. Axonal transport of mitochondria along microtubules and F-actin in living vertebrate neurons. J Cell Biol 131, 1315–1326.
Muntau, A.C., Mayerhofer, P.U., Paton, B.C., Kammerer, S., Roscher, A.A., 2000. Defective peroxisome membrane synthesis due to mutations in human PEX3 causes Zellweger syndrome, complementation group G. Am J Hum Genet 67, 967–975. doi:10.1086/303071
Nangaku, M., Sato-Yoshitake, R., Okada, Y., Noda, Y., Takemura, R., Yamazaki, H., Hirokawa, N., 1994. KIF1B, a novel microtubule plus end-directed monomeric motor protein for transport of mitochondria. Cell 79, 1209–1220. doi:10.1016/0092- 8674(94)90012-4
Narendra, D., Kane, L.A., Hauser, D.N., Fearnley, I.M., Youle, R.J., 2010. p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both. Autophagy 6, 1090–1106.
Narendra, D., Tanaka, A., Suen, D.-F., Youle, R.J., 2008. Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J Cell Biol 183, 795–803. doi:10.1083/jcb.200809125
Narendra, D.P., Jin, S.M., Tanaka, A., Suen, D.-F., Gautier, C.A., Shen, J., Cookson, M.R., Youle, R.J., 2010. PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol 8, e1000298. doi:10.1371/journal.pbio.1000298
Nazarko, T.Y., Ozeki, K., Till, A., Ramakrishnan, G., Lotfi, P., Yan, M., Subramani, S., 2014. Peroxisomal Atg37 binds Atg30 or palmitoyl-CoA to regulate phagophore formation during pexophagy. J Cell Biol 204, 541–557. doi:10.1083/jcb.201307050
161
Nemani, N., Carvalho, E., Tomar, D., Dong, Z., Ketschek, A., Breves, S.L., Jaña, F., Worth, A.M., Heffler, J., Palaniappan, P., Tripathi, A., Subbiah, R., Riitano, M.F., Seelam, A., Manfred, T., Itoh, K., Meng, S., Sesaki, H., Craigen, W.J., Rajan, S., Shanmughapriya, S., Caplan, J., Prosser, B.L., Gill, D.L., Stathopulos, P.B., Gallo, G., Chan, D.C., Mishra, P., Madesh, M., 2018. MIRO-1 Determines Mitochondrial Shape Transition upon GPCR Activation and Ca2+ Stress. Cell Rep 23, 1005–1019. doi:10.1016/j.celrep.2018.03.098
Neuhaus, A., Eggeling, C., Erdmann, R., Schliebs, W., 2016. Why do peroxisomes associate with the cytoskeleton? Biochim Biophys Acta 1863, 1019–1026. doi:10.1016/j.bbamcr.2015.11.022
Neuspiel, M., Schauss, A.C., Braschi, E., Zunino, R., Rippstein, P., Rachubinski, R.A., Andrade-Navarro, M.A., McBride, H.M., 2008. Cargo-selected transport from the mitochondria to peroxisomes is mediated by vesicular carriers. Curr Biol 18, 102–108. doi:10.1016/j.cub.2007.12.038
Nguyen, T.N., Padman, B.S., Lazarou, M., 2016. Deciphering the molecular signals of pink1/parkin mitophagy. Trends Cell Biol 26, 733–744. doi:10.1016/j.tcb.2016.05.008
Nguyen, T.T., Oh, S.S., Weaver, D., Lewandowska, A., Maxfield, D., Schuler, M.-H., Smith, N.K., Macfarlane, J., Saunders, G., Palmer, C.A., Debattisti, V., Koshiba, T., Pulst, S., Feldman, E.L., Hajnóczky, G., Shaw, J.M., 2014. Loss of Miro1-directed mitochondrial movement results in a novel murine model for neuron disease. Proc Natl Acad Sci U S A 111, E3631–40. doi:10.1073/pnas.1402449111
Niemann, A., Ruegg, M., La Padula, V., Schenone, A., Suter, U., 2005. Ganglioside-induced differentiation associated protein 1 is a regulator of the mitochondrial network: new implications for Charcot-Marie-Tooth disease. J Cell Biol 170, 1067–1078. doi:10.1083/jcb.200507087
Niescier, R.F., Hong, K., Park, D., Min, K.-T., 2018. MCU Interacts with Miro1 to Modulate Mitochondrial Functions in Neurons. J Neurosci 38, 4666–4677. doi:10.1523/JNEUROSCI.0504-18.2018
Norkett, R., Modi, S., Birsa, N., Atkin, T.A., Ivankovic, D., Pathania, M., Trossbach, S.V., Korth, C., Hirst, W.D., Kittler, J.T., 2016. DISC1-dependent Regulation of Mitochondrial Dynamics Controls the Morphogenesis of Complex Neuronal Dendrites. J Biol Chem 291, 613–629. doi:10.1074/jbc.M115.699447
O’Mealey, G.B., Plafker, K.S., Berry, W.L., Janknecht, R., Chan, J.Y., Plafker, S.M., 2017. A PGAM5-KEAP1-Nrf2 complex is required for stress-induced mitochondrial retrograde trafficking. J Cell Sci 130, 3467–3480. doi:10.1242/jcs.203216
Oku, M., Sakai, Y., 2016. Pexophagy in yeasts. Biochim Biophys Acta 1863, 992–998. doi:10.1016/j.bbamcr.2015.09.023
Okumoto, K., Ono, T., Toyama, R., Shimomura, A., Nagata, A., Fujiki, Y., 2017. New splicing variants of mitochondrial Rho GTPase-1 (Miro1) transport peroxisomes. J Cell Biol 217, 619–633. doi:10.1083/jcb.201708122
Opaliński, Ł., Kiel, J.A.K.W., Williams, C., Veenhuis, M., van der Klei, I.J., 2011. Membrane curvature during peroxisome fission requires Pex11. EMBO J 30, 5–16. doi:10.1038/emboj.2010.299
162
Otera, H., Ishihara, N., Mihara, K., 2013. New insights into the function and regulation of mitochondrial fission. Biochim Biophys Acta 1833, 1256–1268. doi:10.1016/j.bbamcr.2013.02.002
Park, Y.-Y., Cho, H., 2012. Mitofusin 1 is degraded at G2/M phase through ubiquitylation by MARCH5. Cell Div 7, 25. doi:10.1186/1747-1028-7-25
Parone, P.A., Martinou, J.-C., 2006. Mitochondrial fission and apoptosis: an ongoing trial. Biochim Biophys Acta 1763, 522–530. doi:10.1016/j.bbamcr.2006.04.005
Pathak, D., Sepp, K.J., Hollenbeck, P.J., 2010. Evidence that myosin activity opposes microtubule-based axonal transport of mitochondria. J Neurosci 30, 8984–8992. doi:10.1523/JNEUROSCI.1621-10.2010
Patten, D.A., Wong, J., Khacho, M., Soubannier, V., Mailloux, R.J., Pilon-Larose, K., MacLaurin, J.G., Park, D.S., McBride, H.M., Trinkle-Mulcahy, L., Harper, M.-E., Germain, M., Slack, R.S., 2014. OPA1-dependent cristae modulation is essential for cellular adaptation to metabolic demand. EMBO J 33, 2676–2691. doi:10.15252/embj.201488349
Paumard, P., Vaillier, J., Coulary, B., Schaeffer, J., Soubannier, V., Mueller, D.M., Brèthes, D., di Rago, J.-P., Velours, J., 2002. The ATP synthase is involved in generating mitochondrial cristae morphology. EMBO J 21, 221–230. doi:10.1093/emboj/21.3.221
Pedrosa, A.G., Francisco, T., Bicho, D., Dias, A.F., Barros-Barbosa, A., Hagmann, V., Dodt, G., Rodrigues, T.A., Azevedo, J.E., 2018. Peroxisomal monoubiquitinated PEX5 interacts with the AAA ATPases PEX1 and PEX6 and is unfolded during its dislocation into the cytosol. J Biol Chem 293, 11553–11563. doi:10.1074/jbc.RA118.003669
Pekkurnaz, G., Trinidad, J.C., Wang, X., Kong, D., Schwarz, T.L., 2014. Glucose regulates mitochondrial motility via Milton modification by O-GlcNAc transferase. Cell 158, 54– 68. doi:10.1016/j.cell.2014.06.007
Phillips, M.J., Voeltz, G.K., 2016. Structure and function of ER membrane contact sites with other organelles. Nat Rev Mol Cell Biol 17, 69–82. doi:10.1038/nrm.2015.8
Pickles, S., Vigié, P., Youle, R.J., 2018. Mitophagy and Quality Control Mechanisms in Mitochondrial Maintenance. Curr Biol 28, R170–R185. doi:10.1016/j.cub.2018.01.004
Platta, H.W., Grunau, S., Rosenkranz, K., Girzalsky, W., Erdmann, R., 2005. Functional role of the AAA peroxins in dislocation of the cycling PTS1 receptor back to the cytosol. Nat Cell Biol 7, 817–822. doi:10.1038/ncb1281
Platta, H.W., Hagen, S., Reidick, C., Erdmann, R., 2014. The peroxisomal receptor dislocation pathway: to the exportomer and beyond. Biochimie 98, 16–28. doi:10.1016/j.biochi.2013.12.009
Poole, A.C., Thomas, R.E., Andrews, L.A., McBride, H.M., Whitworth, A.J., Pallanck, L.J., 2008. The PINK1/Parkin pathway regulates mitochondrial morphology. Proc Natl Acad Sci U S A 105, 1638–1643. doi:10.1073/pnas.0709336105
Prudent, J., Zunino, R., Sugiura, A., Mattie, S., Shore, G.C., McBride, H.M., 2015. MAPL sumoylation of drp1 stabilizes an er/mitochondrial platform required for cell death. Mol Cell 59, 941–955. doi:10.1016/j.molcel.2015.08.001
163
Qi, X., Disatnik, M.-H., Shen, N., Sobel, R.A., Mochly-Rosen, D., 2011. Aberrant mitochondrial fission in neurons induced by protein kinase C{delta} under oxidative stress conditions in vivo. Mol Biol Cell 22, 256–265. doi:10.1091/mbc.E10-06-0551
Quintero, O.A., DiVito, M.M., Adikes, R.C., Kortan, M.B., Case, L.B., Lier, A.J., Panaretos, N.S., Slater, S.Q., Rengarajan, M., Feliu, M., Cheney, R.E., 2009. Human Myo19 is a novel myosin that associates with mitochondria. Curr Biol 19, 2008–2013. doi:10.1016/j.cub.2009.10.026
Rao, M., Okreglak, V., Chio, U.S., Cho, H., Walter, P., Shan, S.-O., 2016. Multiple selection filters ensure accurate tail-anchored membrane protein targeting. elife 5. doi:10.7554/eLife.21301
Rapp, S., Saffrich, R., Anton, M., Jäkle, U., Ansorge, W., Gorgas, K., Just, W.W., 1996. Microtubule-based peroxisome movement. J Cell Sci 109 ( Pt 4), 837–849.
Renken, C., Siragusa, G., Perkins, G., Washington, L., Nulton, J., Salamon, P., Frey, T.G., 2002. A thermodynamic model describing the nature of the crista junction: a structural motif in the mitochondrion. J Struct Biol 138, 137–144. doi:10.1016/S1047- 8477(02)00012-6
Rizzuto, R., De Stefani, D., Raffaello, A., Mammucari, C., 2012. Mitochondria as sensors and regulators of calcium signalling. Nat Rev Mol Cell Biol 13, 566–578. doi:10.1038/nrm3412
Rocha, A.G., Franco, A., Krezel, A.M., Rumsey, J.M., Alberti, J.M., Knight, W.C., Biris, N., Zacharioudakis, E., Janetka, J.W., Baloh, R.H., Kitsis, R.N., Mochly-Rosen, D., Townsend, R.R., Gavathiotis, E., Dorn, G.W., 2018. MFN2 agonists reverse mitochondrial defects in preclinical models of Charcot-Marie-Tooth disease type 2A. Science 360, 336–341. doi:10.1126/science.aao1785
Rohn, J.L., Patel, J.V., Neumann, B., Bulkescher, J., Mchedlishvili, N., McMullan, R.C., Quintero, O.A., Ellenberg, J., Baum, B., 2014. Myo19 ensures symmetric partitioning of mitochondria and coupling of mitochondrial segregation to cell division. Curr Biol 24, 2598–2605. doi:10.1016/j.cub.2014.09.045
Russo, G.J., Louie, K., Wellington, A., Macleod, G.T., Hu, F., Panchumarthi, S., Zinsmaier, K.E., 2009. Drosophila Miro is required for both anterograde and retrograde axonal mitochondrial transport. J Neurosci 29, 5443–5455. doi:10.1523/JNEUROSCI.5417- 08.2009
Sacksteder, K.A., Jones, J.M., South, S.T., Li, X., Liu, Y., Gould, S.J., 2000. PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis. J Cell Biol 148, 931–944.
Salogiannis, J., Egan, M.J., Reck-Peterson, S.L., 2016. Peroxisomes move by hitchhiking on early endosomes using the novel linker protein PxdA. J Cell Biol 212, 289–296. doi:10.1083/jcb.201512020
Saotome, M., Safiulina, D., Szabadkai, G., Das, S., Fransson, A., Aspenstrom, P., Rizzuto, R., Hajnóczky, G., 2008. Bidirectional Ca2+-dependent control of mitochondrial dynamics by the Miro GTPase. Proc Natl Acad Sci U S A 105, 20728–20733. doi:10.1073/pnas.0808953105
164
Sargent, G., van Zutphen, T., Shatseva, T., Zhang, L., Di Giovanni, V., Bandsma, R., Kim, P.K., 2016. PEX2 is the E3 ubiquitin ligase required for pexophagy during starvation. J Cell Biol 214, 677–690. doi:10.1083/jcb.201511034
Sarraf, S.A., Raman, M., Guarani-Pereira, V., Sowa, M.E., Huttlin, E.L., Gygi, S.P., Harper, J.W., 2013. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372–376. doi:10.1038/nature12043
Schollenberger, L., Gronemeyer, T., Huber, C.M., Lay, D., Wiese, S., Meyer, H.E., Warscheid, B., Saffrich, R., Peränen, J., Gorgas, K., Just, W.W., 2010. RhoA regulates peroxisome association to microtubules and the actin cytoskeleton. PLoS ONE 5, e13886. doi:10.1371/journal.pone.0013886
Schrader, M., Burkhardt, J.K., Baumgart, E., Lüers, G., Spring, H., Völkl, A., Fahimi, H.D., 1996. Interaction of microtubules with peroxisomes. Tubular and spherical peroxisomes in HepG2 cells and their alterations induced by microtubule-active drugs. Eur J Cell Biol 69, 24–35.
Schrader, M., Costello, J.L., Godinho, L.F., Azadi, A.S., Islinger, M., 2016. Proliferation and fission of peroxisomes - An update. Biochim Biophys Acta 1863, 971–983. doi:10.1016/j.bbamcr.2015.09.024
Schrader, M., Godinho, L.F., Costello, J.L., Islinger, M., 2015. The different facets of organelle interplay-an overview of organelle interactions. Front. Cell Dev. Biol. 3, 56. doi:10.3389/fcell.2015.00056
Schrader, M., King, S.J., Stroh, T.A., Schroer, T.A., 2000. Real time imaging reveals a peroxisomal reticulum in living cells. J Cell Sci 113 ( Pt 20), 3663–3671.
Schrader, M., Reuber, B.E., Morrell, J.C., Jimenez-Sanchez, G., Obie, C., Stroh, T.A., Valle, D., Schroer, T.A., Gould, S.J., 1998. Expression of PEX11beta mediates peroxisome proliferation in the absence of extracellular stimuli. J Biol Chem 273, 29607–29614.
Schrul, B., Kopito, R.R., 2016. Peroxin-dependent targeting of a lipid-droplet-destined membrane protein to ER subdomains. Nat Cell Biol 18, 740–751. doi:10.1038/ncb3373
Schuler, M.-H., Lewandowska, A., Caprio, G.D., Skillern, W., Upadhyayula, S., Kirchhausen, T., Shaw, J.M., Cunniff, B., 2017. Miro1-mediated mitochondrial positioning shapes intracellular energy gradients required for cell migration. Mol Biol Cell 28, 2159–2169. doi:10.1091/mbc.E16-10-0741
Schwarz, T.L., 2013. Mitochondrial trafficking in neurons. Cold Spring Harb Perspect Biol 5. doi:10.1101/cshperspect.a011304
Shai, N., Schuldiner, M., Zalckvar, E., 2016. No peroxisome is an island - Peroxisome contact sites. Biochim Biophys Acta 1863, 1061–1069. doi:10.1016/j.bbamcr.2015.09.016
Shai, N., Yifrach, E., van Roermund, C.W.T., Cohen, N., Bibi, C., IJlst, L., Cavellini, L., Meurisse, J., Schuster, R., Zada, L., Mari, M.C., Reggiori, F.M., Hughes, A.L., Escobar-Henriques, M., Cohen, M.M., Waterham, H.R., Wanders, R.J.A., Schuldiner, M., Zalckvar, E., 2018. Systematic mapping of contact sites reveals tethers and a function for the peroxisome-mitochondria contact. Nat Commun 9, 1761. doi:10.1038/s41467-018-03957-8
165
Sheng, Z.-H., 2017. The interplay of axonal energy homeostasis and mitochondrial trafficking and anchoring. Trends Cell Biol 27, 403–416. doi:10.1016/j.tcb.2017.01.005
Shlevkov, E., Kramer, T., Schapansky, J., LaVoie, M.J., Schwarz, T.L., 2016. Miro phosphorylation sites regulate Parkin recruitment and mitochondrial motility. Proc Natl Acad Sci U S A 113, E6097–E6106. doi:10.1073/pnas.1612283113
Shneyer, B.I., Ušaj, M., Henn, A., 2016. Myo19 is an outer mitochondrial membrane motor and effector of starvation-induced filopodia. J Cell Sci 129, 543–556. doi:10.1242/jcs.175349
Shneyer, B.I., Ušaj, M., Wiesel-Motiuk, N., Regev, R., Henn, A., 2017. ROS induced distribution of mitochondria to filopodia by Myo19 depends on a class specific tryptophan in the motor domain. Sci Rep 7, 11577. doi:10.1038/s41598-017-11002-9
Smirnova, E., Griparic, L., Shurland, D.L., van der Bliek, A.M., 2001. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 12, 2245–2256. doi:10.1091/mbc.12.8.2245
Smit-Rigter, L., Rajendran, R., Silva, C.A.P., Spierenburg, L., Groeneweg, F., Ruimschotel, E.M., van Versendaal, D., van der Togt, C., Eysel, U.T., Heimel, J.A., Lohmann, C., Levelt, C.N., 2016. Mitochondrial dynamics in visual cortex are limited in vivo and not affected by axonal structural plasticity. Curr Biol 26, 2609–2616. doi:10.1016/j.cub.2016.07.033
Smith, J.J., Aitchison, J.D., 2013. Peroxisomes take shape. Nat Rev Mol Cell Biol 14, 803– 817. doi:10.1038/nrm3700
Song, Z., Chen, H., Fiket, M., Alexander, C., Chan, D.C., 2007. OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. J Cell Biol 178, 749–755. doi:10.1083/jcb.200704110
Sørmo, C.G., Brembu, T., Winge, P., Bones, A.M., 2011. Arabidopsis thaliana MIRO1 and MIRO2 GTPases are unequally redundant in pollen tube growth and fusion of polar nuclei during female gametogenesis. PLoS ONE 6, e18530. doi:10.1371/journal.pone.0018530
Soubannier, V., McLelland, G.-L., Zunino, R., Braschi, E., Rippstein, P., Fon, E.A., McBride, H.M., 2012a. A vesicular transport pathway shuttles cargo from mitochondria to lysosomes. Curr Biol 22, 135–141. doi:10.1016/j.cub.2011.11.057
Soubannier, V., Rippstein, P., Kaufman, B.A., Shoubridge, E.A., McBride, H.M., 2012b. Reconstitution of mitochondria derived vesicle formation demonstrates selective enrichment of oxidized cargo. PLoS ONE 7, e52830. doi:10.1371/journal.pone.0052830
Stefan, C.J., Trimble, W.S., Grinstein, S., Drin, G., Reinisch, K., De Camilli, P., Cohen, S., Valm, A.M., Lippincott-Schwartz, J., Levine, T.P., Iaea, D.B., Maxfield, F.R., Futter, C.E., Eden, E.R., Judith, D., van Vliet, A.R., Agostinis, P., Tooze, S.A., Sugiura, A., McBride, H.M., 2017. Membrane dynamics and organelle biogenesis-lipid pipelines and vesicular carriers. BMC Biol 15, 102. doi:10.1186/s12915-017-0432-0
Stowers, R.S., Megeath, L.J., Górska-Andrzejak, J., Meinertzhagen, I.A., Schwarz, T.L., 2002. Axonal transport of mitochondria to synapses depends on milton, a novel Drosophila protein. Neuron 36, 1063–1077. doi:10.1016/S0896-6273(02)01094-2
166
Strappazzon, F., Nazio, F., Corrado, M., Cianfanelli, V., Romagnoli, A., Fimia, G.M., Campello, S., Nardacci, R., Piacentini, M., Campanella, M., Cecconi, F., 2015. AMBRA1 is able to induce mitophagy via LC3 binding, regardless of PARKIN and p62/SQSTM1. Cell Death Differ 22, 419–432. doi:10.1038/cdd.2014.139
Sugiura, A., Mattie, S., Prudent, J., McBride, H.M., 2017. Newly born peroxisomes are a hybrid of mitochondrial and ER-derived pre-peroxisomes. Nature 542, 251–254. doi:10.1038/nature21375
Sugiura, A., McLelland, G.-L., Fon, E.A., McBride, H.M., 2014. A new pathway for mitochondrial quality control: mitochondrial-derived vesicles. EMBO J 33, 2142–2156. doi:10.15252/embj.201488104
Sun, T., Qiao, H., Pan, P.-Y., Chen, Y., Sheng, Z.-H., 2013. Motile axonal mitochondria contribute to the variability of presynaptic strength. Cell Rep 4, 413–419. doi:10.1016/j.celrep.2013.06.040
Suzuki, M., Danilchanka, O., Mekalanos, J.J., 2014. Vibrio cholerae T3SS effector VopE modulates mitochondrial dynamics and innate immune signaling by targeting Miro GTPases. Cell Host Microbe 16, 581–591. doi:10.1016/j.chom.2014.09.015
Swinkels, B.W., Gould, S.J., Bodnar, A.G., Rachubinski, R.A., Subramani, S., 1991. A novel, cleavable peroxisomal targeting signal at the amino-terminus of the rat 3-ketoacyl- CoA thiolase. EMBO J 10, 3255–3262.
Szabadkai, G., Bianchi, K., Várnai, P., De Stefani, D., Wieckowski, M.R., Cavagna, D., Nagy, A.I., Balla, T., Rizzuto, R., 2006. Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J Cell Biol 175, 901–911. doi:10.1083/jcb.200608073
Szymczak, A.L., Workman, C.J., Wang, Y., Vignali, K.M., Dilioglou, S., Vanin, E.F., Vignali, D.A.A., 2004. Correction of multi-gene deficiency in vivo using a single “self-cleaving” 2A peptide-based retroviral vector. Nat Biotechnol 22, 589–594. doi:10.1038/nbt957
Tanaka, A., Cleland, M.M., Xu, S., Narendra, D.P., Suen, D.-F., Karbowski, M., Youle, R.J., 2010. Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J Cell Biol 191, 1367–1380. doi:10.1083/jcb.201007013
Tanaka, Y., Kanai, Y., Okada, Y., Nonaka, S., Takeda, S., Harada, A., Hirokawa, N., 1998. Targeted disruption of mouse conventional kinesin heavy chain, kif5B, results in abnormal perinuclear clustering of mitochondria. Cell 93, 1147–1158. doi:10.1016/S0092-8674(00)81459-2
Tang, F.-L., Liu, W., Hu, J.-X., Erion, J.R., Ye, J., Mei, L., Xiong, W.-C., 2015. VPS35 deficiency or mutation causes dopaminergic neuronal loss by impairing mitochondrial fusion and function. Cell Rep 12, 1631–1643. doi:10.1016/j.celrep.2015.08.001
Tao, K., Matsuki, N., Koyama, R., 2014. AMP-activated protein kinase mediates activity- dependent axon branching by recruiting mitochondria to axon. Dev Neurobiol 74, 557–573. doi:10.1002/dneu.22149
Tas, R.P., Chazeau, A., Cloin, B.M.C., Lambers, M.L.A., Hoogenraad, C.C., Kapitein, L.C., 2017. Differentiation between Oppositely Oriented Microtubules Controls Polarized Neuronal Transport. Neuron 96, 1264–1271.e5. doi:10.1016/j.neuron.2017.11.018
167
Tinevez, J.-Y., Perry, N., Schindelin, J., Hoopes, G.M., Reynolds, G.D., Laplantine, E., Bednarek, S.Y., Shorte, S.L., Eliceiri, K.W., 2017. TrackMate: An open and extensible platform for single-particle tracking. Methods 115, 80–90. doi:10.1016/j.ymeth.2016.09.016
Tonachini, L., Monticone, M., Puri, C., Tacchetti, C., Pinton, P., Rizzuto, R., Cancedda, R., Tavella, S., Castagnola, P., 2004. Chondrocyte protein with a poly-proline region (CHPPR) is a novel mitochondrial protein and promotes mitochondrial fission. J Cell Physiol 201, 470–482. doi:10.1002/jcp.20126
Toro, A.A., Araya, C.A., Córdova, G.J., Arredondo, C.A., Cárdenas, H.G., Moreno, R.E., Venegas, A., Koenig, C.S., Cancino, J., Gonzalez, A., Santos, M.J., 2009. Pex3p- dependent peroxisomal biogenesis initiates in the endoplasmic reticulum of human fibroblasts. J Cell Biochem 107, 1083–1096. doi:10.1002/jcb.22210
Toyama, E.Q., Herzig, S., Courchet, J., Lewis, T.L., Losón, O.C., Hellberg, K., Young, N.P., Chen, H., Polleux, F., Chan, D.C., Shaw, R.J., 2016. Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science 351, 275–281. doi:10.1126/science.aab4138
Trevisan, T., Pendin, D., Montagna, A., Bova, S., Ghelli, A.M., Daga, A., 2018. Manipulation of mitochondria dynamics reveals separate roles for form and function in mitochondria distribution. Cell Rep 23, 1742–1753. doi:10.1016/j.celrep.2018.04.017
Ušaj, M., Henn, A., 2017. Kinetic adaptation of human Myo19 for active mitochondrial transport to growing filopodia tips. Sci Rep 7, 11596. doi:10.1038/s41598-017-11984- 6
Vaccaro, V., Devine, M.J., Higgs, N.F., Kittler, J.T., 2017. Miro1-dependent mitochondrial positioning drives the rescaling of presynaptic Ca2+ signals during homeostatic plasticity. EMBO Rep 18, 231–240. doi:10.15252/embr.201642710
Valente, E.M., Salvi, S., Ialongo, T., Marongiu, R., Elia, A.E., Caputo, V., Romito, L., Albanese, A., Dallapiccola, B., Bentivoglio, A.R., 2004. PINK1 mutations are associated with sporadic early-onset parkinsonism. Ann Neurol 56, 336–341. doi:10.1002/ana.20256
Valm, A.M., Cohen, S., Legant, W.R., Melunis, J., Hershberg, U., Wait, E., Cohen, A.R., Davidson, M.W., Betzig, E., Lippincott-Schwartz, J., 2017. Applying systems-level spectral imaging and analysis to reveal the organelle interactome. Nature 546, 162– 167. doi:10.1038/nature22369
Van Ael, E., Fransen, M., 2006. Targeting signals in peroxisomal membrane proteins. Biochim Biophys Acta 1763, 1629–1638. doi:10.1016/j.bbamcr.2006.08.020
Van Bergeijk, P., Hoogenraad, C.C., Kapitein, L.C., 2016. Right time, right place: probing the functions of organelle positioning. Trends Cell Biol 26, 121–134. doi:10.1016/j.tcb.2015.10.001
Van der Bliek, A.M., Shen, Q., Kawajiri, S., 2013. Mechanisms of mitochondrial fission and fusion. Cold Spring Harb Perspect Biol 5. doi:10.1101/cshperspect.a011072
Van der Laan, M., Meinecke, M., Dudek, J., Hutu, D.P., Lind, M., Perschil, I., Guiard, B., Wagner, R., Pfanner, N., Rehling, P., 2007. Motor-free mitochondrial presequence
168
translocase drives membrane integration of preproteins. Nat Cell Biol 9, 1152–1159. doi:10.1038/ncb1635
Van der Zand, A., Gent, J., Braakman, I., Tabak, H.F., 2012. Biochemically distinct vesicles from the endoplasmic reticulum fuse to form peroxisomes. Cell 149, 397–409. doi:10.1016/j.cell.2012.01.054
Van Spronsen, M., Mikhaylova, M., Lipka, J., Schlager, M.A., van den Heuvel, D.J., Kuijpers, M., Wulf, P.S., Keijzer, N., Demmers, J., Kapitein, L.C., Jaarsma, D., Gerritsen, H.C., Akhmanova, A., Hoogenraad, C.C., 2013. TRAK/Milton motor-adaptor proteins steer mitochondrial trafficking to axons and dendrites. Neuron 77, 485–502. doi:10.1016/j.neuron.2012.11.027
Villa, E., Proïcs, E., Rubio-Patiño, C., Obba, S., Zunino, B., Bossowski, J.P., Rozier, R.M., Chiche, J., Mondragón, L., Riley, J.S., Marchetti, S., Verhoeyen, E., Tait, S.W.G., Ricci, J.-E., 2017. Parkin-Independent Mitophagy Controls Chemotherapeutic Response in Cancer Cells. Cell Rep 20, 2846–2859. doi:10.1016/j.celrep.2017.08.087
Vlahou, G., Eliáš, M., von Kleist-Retzow, J.-C., Wiesner, R.J., Rivero, F., 2011. The Ras related GTPase Miro is not required for mitochondrial transport in Dictyostelium discoideum. Eur J Cell Biol 90, 342–355. doi:10.1016/j.ejcb.2010.10.012
Wakabayashi, J., Zhang, Z., Wakabayashi, N., Tamura, Y., Fukaya, M., Kensler, T.W., Iijima, M., Sesaki, H., 2009. The dynamin-related GTPase Drp1 is required for embryonic and brain development in mice. J Cell Biol 186, 805–816. doi:10.1083/jcb.200903065
Wali, G., Sutharsan, R., Fan, Y., Stewart, R., Tello Velasquez, J., Sue, C.M., Crane, D.I., Mackay-Sim, A., 2016. Mechanism of impaired microtubule-dependent peroxisome trafficking and oxidative stress in SPAST-mutated cells from patients with Hereditary Spastic Paraplegia. Sci Rep 6, 27004. doi:10.1038/srep27004
Walter, K.M., Schönenberger, M.J., Trötzmüller, M., Horn, M., Elsässer, H.-P., Moser, A.B., Lucas, M.S., Schwarz, T., Gerber, P.A., Faust, P.L., Moch, H., Köfeler, H.C., Krek, W., Kovacs, W.J., 2014. Hif-2α promotes degradation of mammalian peroxisomes by selective autophagy. Cell Metab 20, 882–897. doi:10.1016/j.cmet.2014.09.017
Wang, L., Cho, Y.-L., Tang, Y., Wang, J., Park, J.-E., Wu, Yajun, Wang, C., Tong, Y., Chawla, R., Zhang, Jianbin, Shi, Y., Deng, S., Lu, G., Wu, Yihua, Tan, H.W.-S., Pawijit, P., Lim, G.G.-Y., Chan, H.-Y., Zhang, Jingzi, Fang, L., Yu, H., Liou, Y.-C., Karthik, M., Bay, B.-H., Lim, K.-L., Sze, S.-K., Yap, C.T., Shen, H.-M., 2018. PTEN-L is a novel protein phosphatase for ubiquitin dephosphorylation to inhibit PINK1-Parkin-mediated mitophagy. Cell Res 28, 787–802. doi:10.1038/s41422-018-0056-0
Wang, X., Schwarz, T.L., 2009. The mechanism of Ca2+ -dependent regulation of kinesin- mediated mitochondrial motility. Cell 136, 163–174. doi:10.1016/j.cell.2008.11.046
Wang, X., Winter, D., Ashrafi, G., Schlehe, J., Wong, Y.L., Selkoe, D., Rice, S., Steen, J., LaVoie, M.J., Schwarz, T.L., 2011. PINK1 and Parkin target Miro for phosphorylation and degradation to arrest mitochondrial motility. Cell 147, 893–906. doi:10.1016/j.cell.2011.10.018
Wang, Y., Serricchio, M., Jauregui, M., Shanbhag, R., Stoltz, T., Di Paolo, C.T., Kim, P.K., McQuibban, G.A., 2015. Deubiquitinating enzymes regulate PARK2-mediated mitophagy. Autophagy 11, 595–606. doi:10.1080/15548627.2015.1034408
169
Wauer, T., Simicek, M., Schubert, A., Komander, D., 2015. Mechanism of phospho-ubiquitin- induced PARKIN activation. Nature 524, 370–374. doi:10.1038/nature14879
Wieckowski, M.R., Giorgi, C., Lebiedzinska, M., Duszynski, J., Pinton, P., 2009. Isolation of mitochondria-associated membranes and mitochondria from animal tissues and cells. Nat Protoc 4, 1582–1590. doi:10.1038/nprot.2009.151
Wiemer, E.A., Wenzel, T., Deerinck, T.J., Ellisman, M.H., Subramani, S., 1997. Visualization of the peroxisomal compartment in living mammalian cells: dynamic behavior and association with microtubules. J Cell Biol 136, 71–80. doi:10.1083/jcb.136.1.71
Williams, C., Opalinski, L., Landgraf, C., Costello, J., Schrader, M., Krikken, A.M., Knoops, K., Kram, A.M., Volkmer, R., van der Klei, I.J., 2015. The membrane remodeling protein Pex11p activates the GTPase Dnm1p during peroxisomal fission. Proc Natl Acad Sci U S A 112, 6377–6382. doi:10.1073/pnas.1418736112
Xu, S., Cherok, E., Das, S., Li, S., Roelofs, B.A., Ge, S.X., Polster, B.M., Boyman, L., Lederer, W.J., Wang, C., Karbowski, M., 2016. Mitochondrial E3 ubiquitin ligase MARCH5 controls mitochondrial fission and cell sensitivity to stress-induced apoptosis through regulation of MiD49 protein. Mol Biol Cell 27, 349–359. doi:10.1091/mbc.E15-09-0678
Xu, S., Peng, G., Wang, Y., Fang, S., Karbowski, M., 2011. The AAA-ATPase p97 is essential for outer mitochondrial membrane protein turnover. Mol Biol Cell 22, 291–300. doi:10.1091/mbc.E10-09-0748
Yagita, Y., Hiromasa, T., Fujiki, Y., 2013. Tail-anchored PEX26 targets peroxisomes via a PEX19-dependent and TRC40-independent class I pathway. J Cell Biol 200, 651– 666. doi:10.1083/jcb.201211077
Yamada, T., Murata, D., Adachi, Y., Itoh, K., Kameoka, S., Igarashi, A., Kato, T., Araki, Y., Huganir, R.L., Dawson, T.M., Yanagawa, T., Okamoto, K., Iijima, M., Sesaki, H., 2018. Mitochondrial Stasis Reveals p62-Mediated Ubiquitination in Parkin- Independent Mitophagy and Mitigates Nonalcoholic Fatty Liver Disease. Cell Metab. doi:10.1016/j.cmet.2018.06.014
Yamaoka, S., Hara-Nishimura, I., 2014. The mitochondrial Ras-related GTPase Miro: views from inside and outside the metazoan kingdom. Front Plant Sci 5, 350. doi:10.3389/fpls.2014.00350
Yamaoka, S., Leaver, C.J., 2008. EMB2473/MIRO1, an Arabidopsis Miro GTPase, is required for embryogenesis and influences mitochondrial morphology in pollen. Plant Cell 20, 589–601. doi:10.1105/tpc.107.055756
Yamashita, S., Abe, K., Tatemichi, Y., Fujiki, Y., 2014. The membrane peroxin PEX3 induces peroxisome-ubiquitination-linked pexophagy. Autophagy 10, 1549–1564. doi:10.4161/auto.29329
Yoon, Y., Pitts, K.R., McNiven, M.A., 2001. Mammalian dynamin-like protein DLP1 tubulates membranes. Mol Biol Cell 12, 2894–2905. doi:10.1091/mbc.12.9.2894
Yoshida, Y., Niwa, H., Honsho, M., Itoyama, A., Fujiki, Y., 2015. Pex11mediates peroxisomal proliferation by promoting deformation of the lipid membrane. Biol. Open 4, 710–721. doi:10.1242/bio.201410801
170
Yun, J., Puri, R., Yang, H., Lizzio, M.A., Wu, C., Sheng, Z.-H., Guo, M., 2014. MUL1 acts in parallel to the PINK1/parkin pathway in regulating mitofusin and compensates for loss of PINK1/parkin. elife 3, e01958. doi:10.7554/eLife.01958
Zhang, J., Ney, P.A., 2009. Role of BNIP3 and NIX in cell death, autophagy, and mitophagy. Cell Death Differ 16, 939–946. doi:10.1038/cdd.2009.16
Zhang, J., Tripathi, D.N., Jing, J., Alexander, A., Kim, J., Powell, R.T., Dere, R., Tait-Mulder, J., Lee, J.-H., Paull, T.T., Pandita, R.K., Charaka, V.K., Pandita, T.K., Kastan, M.B., Walker, C.L., 2015. ATM functions at the peroxisome to induce pexophagy in response to ROS. Nat Cell Biol 17, 1259–1269. doi:10.1038/ncb3230
Zhang, Y., Liu, X., Bai, J., Tian, X., Zhao, X., Liu, W., Duan, X., Shang, W., Fan, H.-Y., Tong, C., 2016. Mitoguardin Regulates Mitochondrial Fusion through MitoPLD and Is Required for Neuronal Homeostasis. Mol Cell 61, 111–124. doi:10.1016/j.molcel.2015.11.017
Zunino, R., Braschi, E., Xu, L., McBride, H.M., 2009. Translocation of SenP5 from the nucleoli to the mitochondria modulates DRP1-dependent fission during mitosis. J Biol Chem 284, 17783–17795. doi:10.1074/jbc.M901902200
171