DOCSLIB.ORG

Systematic Discovery of Nonobvious Human Disease Models Through Orthologous Phenotypes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Systematic Discovery of Nonobvious Human Disease Models Through Orthologous Phenotypes Systematic discovery of nonobvious human disease models through orthologous phenotypes Kriston L. McGarya,1, Tae Joo Parka,b,1,JohnO.Woodsa, Hye Ji Chaa, John B. Wallingforda,b, and Edward M. Marcottea,c,2 aCenter for Systems and Synthetic Biology, Institute for Cellular and Molecular Biology, bThe Howard Hughes Medical Institute and Department of Molecular Cell and Developmental Biology, and cDepartment of Chemistry and Biochemistry, University of Texas, Austin, TX 78712 Edited* by William H. Press, University of Texas, Austin, TX, and approved February 26, 2010 (received for review September 6, 2009) Biologists have long used model organisms to study human diseases, tractable models for human disease await discovery, currently hid- particularly when the model bears a close resemblance to the disease. den by differences in the emergent appearance of phenotype in We present a method that quantitatively and systematically identi- diverse model organisms. Although a framework exists for discus- fies nonobvious equivalences between mutant phenotypes in differ- sing complex gene-phenotype relationships across evolution, we ent species, based on overlapping sets of orthologous genes from lack simple—and importantly, quantifiable—methods for discov- human, mouse, yeast, worm, and plant (212,542 gene-phenotype ering new gene-phenotype relationships from existing data. associations). These orthologous phenotypes, or phenologs, predict As a foundation for a quantifiable approach to identifying equiv- unique genes associated with diseases. Our method suggests a yeast alent phenotypes, we introduce the notion of orthologous pheno- model for angiogenesis defects, a worm model for breast cancer, types (phenologs), defined as phenotypes related by the orthology of mouse models of autism, and a plant model for the neural crest de- the associated genes in two organisms. Phenologs are the phenotype- fects associated with Waardenburg syndrome, among others. Using level equivalent of gene orthologs. Two phenotypes are thus said to these models, we show that SOX13 regulates angiogenesis, and that be orthologous if they share a significantly larger set of common SEC23IP is a likely Waardenburg gene. Phenologs reveal functionally orthologous genes than would be expected at random (i.e., are coherent, evolutionarily conserved gene networks—many predating enriched for the same orthologous genes) (Fig. 1B), even if the the plant-animal divergence—capable of identifying candidate dis- phenotypes may appear dissimilar. ease genes. Phenologs, therefore, are evolutionarily conserved outputs aris- ing from disruption of any of a set of conserved genes (Fig. 1B, angiogenesis | bioinformatics | evolution | gene-phenotype associations | green and blue). These outputs manifest as different traits or de- homology fects in different organisms because of the organism-specificroles played by each set of genes. One example, noted above, is the human iochemical and molecular functions of a given protein are retinoblastoma eye cancer and the Caenorhabditis elegans ectopic generally conserved between organisms; this observation is vulvae. These phenotypes are orthologous, as failure of equivalent B — fundamental to biological research. For example, in x-ray crys- genes (the Rb pathway) performing conserved molecular func- — tallography studies, one can often choose the organism from which tions but in different contexts leads to different phenotypes in the the protein is most easily crystallized to facilitate the study of the different organisms (1, 2). protein’s biochemical function. On the other hand, even with a By quantifying the equivalence of mutational phenotypes be- conserved gene, disruption of function may give rise to radically tween different organisms, we demonstrate that orthologous different phenotypic outcomes in different species. For example, phenotypes may be found objectively, and that these phenologs suggest nonobvious models for human disease. We demonstrate mutating the human RB1 gene leads to retinoblastoma, a cancer of fi the retina, yet disrupting the nematode ortholog contributes to the power of this approach by de ning a unique yeast model that effectively predicts vertebrate angiogenesis genes and a plant ectopic vulvae (1, 2). Thus, although a gene’s “molecular” func- model that predicts genes involved in vertebrate craniofacial tions are conserved, the “organism-level” functions need not be. defects that are associated with human congenital malformations. When a conserved gene is mutated, the resulting organism-level phenotype is an emergent property of the system. This bedrock Results and Discussion principle underlying the use of model organisms not only allows us Phenologs are identified by assembling known gene-phenotype to study important aspects of human biology using mice or frogs, associations for two organisms—considering only genes that are but also permits exploration of inherently multicellular processes, orthologous between the two organisms—and searching for such as cancer, using unicellular organisms like yeast. interorganism phenotype pairs with significantly overlapping sets Within this paradigm, once a molecular function has been dis- of genes. Significance is derived from three observations: (i) the covered in one organism, it should be predictable in other organ- total number of orthologs in organism 1 that give rise to phenotype isms: GSK3 homologs in yeast are kinases, and such GSK3 homologs 1; (ii) the total number of orthologs in organism 2 that give rise to in every other organism will generally be kinases. In contrast, the phenotype 2; and (iii) the number of orthologs shared between emergent organism-level phenotypes are far less predictable be- these two sets. Formally, significance of a phenolog is calculated tween organisms, in part because relationships between genes and phenotypes are many-to-many. Manipulation of GSK3 perturbs nutrient and stress signaling in yeast, anteroposterior patterning and Author contributions: K.L.M., T.J.P., J.O.W., J.B.W., and E.M.M. designed research; segmentation in insects, dorsoventral patterning in frogs, and cra- K.L.M., T.J.P., J.O.W., H.J.C., and E.M.M. performed research; K.L.M., T.J.P., J.O.W., niofacial morphogenesis in mice (3–5). Recognizing functionally H.J.C., J.B.W., and E.M.M. analyzed data; and K.L.M., T.J.P., J.O.W., H.J.C., J.B.W., and equivalent organism-level phenotypes between model organisms E.M.M. wrote the paper. can therefore be nonobvious, especially across large evolutionary The authors declare no conflict of interest. distances. *This Direct Submission article had a prearranged editor. However, the ability to recognize equivalent phenotypes be- Freely available online through the PNAS open access option. tweendifferent model organisms isimportant forthe studyof human 1K.L.M. and T.J.P. contributed equally to this work. diseases. Given the success of studies in model systems (genes and 2To whom correspondence should be addressed. E-mail:[email protected]. phenotypes have been associated in model organisms at a far higher This article contains supporting information online at www.pnas.org/cgi/content/full/ rate than for humans) (Fig. 1A), it seems likely that useful and 0910200107/DCSupplemental. 6544–6549 | PNAS | April 6, 2010 | vol. 107 | no. 14 www.pnas.org/cgi/doi/10.1073/pnas.0910200107 Downloaded by guest on September 27, 2021 A 160,000 C Systematic Discovery of Phenologs. To systematically discover mouse 140,000 phenolog relationships, we collected from the literature a set of Human/Worm Ortholog Linkedcancer to breast in humansLinkedmales to more in worms 1,923 human disease-gene associations (8), 74,250 mouse gene- 120,000 ATM / atm-1 Y BRIP1 / dog-1 Y phenotype associations (9), 27,065 C. elegans gene-phenotype KRAS / let-60 Y 4649 orthologs total 100,000 PHB / phb-1 Y PIK3CA /age-1 Y Human Worm associations (10), and 86,383 yeast gene-phenotype associations RAD51 /rad-51 Y breast/ovarian high incidence 80,000 yeast RAD54L /rad-54 Y – ∼ > SLC22A18 / C53B4.3 Y cancer male progeny (11 14). The dataset spans 300 human diseases and 6,000 TSG101 / tsg-1010 Y 60,000 BARD1 /brd-1 Y Y model organism phenotypes. With these data and the sets of worm BRCA1 / brc-1 Y Y CHEK2 / chk-2 Y Y 9313 Number of unique FAM82B / F33H2.6 Y orthologous gene relationships between each pair of organisms 40,000 GCC2 / hcp-1,hcp-2 Y HMG20A,B / W02D9.3 Y HORMAD2,1 / him-3,htp-1,2 Y (15), we quantitatively examined the overlap of each interorgan- gene-phenotype associations 20,000 KIF15 / klp-10,18 Y -6 MRE11A / mre-11 Y p < 7.2x10 fi human PIGA / D2085.6 Y ism phenotype pair, measuring their signi cance (Fig. 2A). To 0 RAD1 / mrt-2 Y RAD21 / coh-1 Y correct for testing multiple hypotheses, we repeated all analyses SEH1L / npp-18 Y SVIL / viln-1 Y 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 TSPO,BZRPL1 / C41G7.3 Y 1,000 times with randomly permuted gene-phenotype associa- Year WDHD1 / F17C11.10 Y tions, then calculated a false-discovery rate (FDR) based upon the Organism 1 Organism 2 observed null distribution of scores (Fig. 2B and Fig. S1). We B observed 154 significant phenologs (5% FDR) between human Orthologous genes Candidate for diseases and yeast mutational phenotypes, 3,755 between human Gene A Gene A’ phenotype 2 and mouse, 147 between mouse and worm, 119 between mouse Gene B Gene B’ and yeast, 206 between yeast and worm, and 9 between human Gene C Gene C’ Gene D Gene D’ and worm (the low number stems from limited mutational data in Candidate for Gene E Gene E’ both species) (Fig. 2C). phenotype 1 Many specific, intuitively obvious, phenologs were revealed by Orthologous this analysis, especially for the comparison of mouse and human Mutations lead Mutations lead phenotypes to phenotype 1 to phenotype 2 phenotypes. Our analysis recapitulates many known mouse models (phenologs) of disease, providing an important positive control for our ap- Fig. 1. Number of unique gene-phenotype associations, identification of proach; Table 1 lists other specific examples of both known and phenologs, and the example of a worm model of breast cancer.
Load more

Recommended publications
  • Multiple Activities of Arl1 Gtpase in the Trans-Golgi Network Chia-Jung Yu1,2 and Fang-Jen S
    © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 1691-1699 doi:10.1242/jcs.201319 COMMENTARY Multiple activities of Arl1 GTPase in the trans-Golgi network Chia-Jung Yu1,2 and Fang-Jen S. Lee3,4,* ABSTRACT typical features of an Arf-family GTPase, including an amphipathic ADP-ribosylation factors (Arfs) and ADP-ribosylation factor-like N-terminal helix and a consensus site for N-myristoylation (Lu et al., proteins (Arls) are highly conserved small GTPases that function 2001; Price et al., 2005). In yeast, recruitment of Arl1 to the Golgi as main regulators of vesicular trafficking and cytoskeletal complex requires a second Arf-like GTPase, Arl3 (Behnia et al., reorganization. Arl1, the first identified member of the large Arl family, 2004; Setty et al., 2003). Yeast Arl3 lacks a myristoylation site and is an important regulator of Golgi complex structure and function in is, instead, N-terminally acetylated; this modification is required for organisms ranging from yeast to mammals. Together with its effectors, its recruitment to the Golgi complex by Sys1. In mammalian cells, Arl1 has been shown to be involved in several cellular processes, ADP-ribosylation-factor-related protein 1 (Arfrp1), a mammalian including endosomal trans-Golgi network and secretory trafficking, lipid ortholog of yeast Arl3, plays a pivotal role in the recruitment of Arl1 droplet and salivary granule formation, innate immunity and neuronal to the trans-Golgi network (TGN) (Behnia et al., 2004; Panic et al., development, stress tolerance, as well as the response of the unfolded 2003b; Setty et al., 2003; Zahn et al., 2006).
    [Show full text]
  • SEC23IP (NM 007190) Human Recombinant Protein – TP309056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only.
    [Show full text]
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Gene Expression Profiles Complement the Analysis of Genomic Modifiers of the Clinical Onset of Huntington Disease
    bioRxiv preprint doi: https://doi.org/10.1101/699033; this version posted July 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Gene expression profiles complement the analysis of genomic modifiers of the clinical onset of Huntington disease Galen E.B. Wright1,2,3; Nicholas S. Caron1,2,3; Bernard Ng1,2,4; Lorenzo Casal1,2,3; Xiaohong Xu5; Jolene Ooi5; Mahmoud A. Pouladi5,6,7; Sara Mostafavi1,2,4; Colin J.D. Ross3,7 and Michael R. Hayden1,2,3* 1Centre for Molecular Medicine and Therapeutics, Vancouver, British Columbia, Canada; 2Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia, Canada; 3BC Children’s Hospital Research Institute, Vancouver, British Columbia, Canada; 4Department of Statistics, University of British Columbia, Vancouver, British Columbia, Canada; 5Translational Laboratory in Genetic Medicine (TLGM), Agency for Science, Technology and Research (A*STAR), Singapore; 6Department of Medicine, Yong Loo Lin School of Medicine, National University of Singapore, Singapore; 7Department of Physiology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore; 8Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, British Columbia, Canada; *Corresponding author ABSTRACT Huntington disease (HD) is a neurodegenerative disorder that is caused by a CAG repeat expansion in the HTT gene. In an attempt to identify genomic modifiers that contribute towards the age of onset of HD, we performed a transcriptome wide association study assessing heritable differences in genetically determined expression in diverse tissues, employing genome wide data from over 4,000 patients.
    [Show full text]
  • Genome Structural Variation
    Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 18th, 2013, Comparative Genomics, Český Krumlov Disclosure: EEE was a member of the Pacific Biosciences Advisory Board (2009-2013) Genome Structural Variation Deletion Duplication Inversion Genetic Variation Types. Sequence • Single base-pair changes – point mutations • Small insertions/deletions– frameshift, microsatellite, minisatellite • Mobile elements—retroelement insertions (300bp -10 kb in size) • Large-scale genomic variation (>1 kb) – Large-scale Deletions, Inversion, translocations – Segmental Duplications • Chromosomal variation—translocations, inversions, fusions. Cytogenetics Introduction • Genome structural variation includes copy- number variation (CNV) and balanced events such as inversions and translocations—originally defined as > 1 kbp but now >50 bp • Objectives 1. Genomic architecture and disease impact. 2. Detection and characterization methods 3. Primate genome evolution Nature 455:237-41 2008 Nature 455:232-6 2008 Perspective: Segmental Duplications (SD) Definition: Continuous portion of genomic sequence represented more than once in the genome ( >90% and > 1kb in length)—a historical copy number variation Intrachromosomal Interchromosomal Distribution Interspersed Configuration Tandem Importance: Structural Variation A B C TEL A B C TEL Non Allelic Homologous Recombination GAMETES NAHR A B C A B C TEL TEL Human Disease Triplosensitive, Haploinsufficient and Imprinted Genes Calvin Bridges Alfred Sturtevant
    [Show full text]
  • PWWP2A Binds Distinct Chromatin Moieties and Interacts with an MTA1-Specific Core Nurd Complex
    ARTICLE DOI: 10.1038/s41467-018-06665-5 OPEN PWWP2A binds distinct chromatin moieties and interacts with an MTA1-specific core NuRD complex Stephanie Link1,2, Ramona M.M. Spitzer1,2, Maryam Sana3, Mario Torrado3, Moritz C. Völker-Albert1, Eva C. Keilhauer4,9, Thomas Burgold5,10, Sebastian Pünzeler1,11, Jason K.K. Low3, Ida Lindström 3, Andrea Nist6, Catherine Regnard1, Thorsten Stiewe 6,7, Brian Hendrich5, Axel Imhof 1,8, Matthias Mann 4,8, Joel P. Mackay 3, Marek Bartkuhn2 & Sandra B. Hake 2,8 1234567890():,; Chromatin structure and function is regulated by reader proteins recognizing histone mod- ifications and/or histone variants. We recently identified that PWWP2A tightly binds to H2A. Z-containing nucleosomes and is involved in mitotic progression and cranial–facial devel- opment. Here, using in vitro assays, we show that distinct domains of PWWP2A mediate binding to free linker DNA as well as H3K36me3 nucleosomes. In vivo, PWWP2A strongly recognizes H2A.Z-containing regulatory regions and weakly binds H3K36me3-containing gene bodies. Further, PWWP2A binds to an MTA1-specific subcomplex of the NuRD complex (M1HR), which consists solely of MTA1, HDAC1, and RBBP4/7, and excludes CHD, GATAD2 and MBD proteins. Depletion of PWWP2A leads to an increase of acetylation levels on H3K27 as well as H2A.Z, presumably by impaired chromatin recruitment of M1HR. Thus, this study identifies PWWP2A as a complex chromatin-binding protein that serves to direct the deacetylase complex M1HR to H2A.Z-containing chromatin, thereby promoting changes in histone acetylation levels. 1 Department of Molecular Biology, BioMedical Center (BMC), Ludwig-Maximilians-University Munich, 82152 Planegg-Martinsried, Germany.
    [Show full text]
  • SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT
    [Show full text]
  • Genomic and Transcriptome Analysis Revealing an Oncogenic Functional Module in Meningiomas
    Neurosurg Focus 35 (6):E3, 2013 ©AANS, 2013 Genomic and transcriptome analysis revealing an oncogenic functional module in meningiomas XIAO CHANG, PH.D.,1 LINGLING SHI, PH.D.,2 FAN GAO, PH.D.,1 JONATHAN RUssIN, M.D.,3 LIYUN ZENG, PH.D.,1 SHUHAN HE, B.S.,3 THOMAS C. CHEN, M.D.,3 STEVEN L. GIANNOTTA, M.D.,3 DANIEL J. WEISENBERGER, PH.D.,4 GAbrIEL ZADA, M.D.,3 KAI WANG, PH.D.,1,5,6 AND WIllIAM J. MAck, M.D.1,3 1Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern California, Los Angeles, California; 2GHM Institute of CNS Regeneration, Jinan University, Guangzhou, China; 3Department of Neurosurgery, Keck School of Medicine, University of Southern California, Los Angeles, California; 4USC Epigenome Center, Keck School of Medicine, University of Southern California, Los Angeles, California; 5Department of Psychiatry, Keck School of Medicine, University of Southern California, Los Angeles, California; and 6Division of Bioinformatics, Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California Object. Meningiomas are among the most common primary adult brain tumors. Although typically benign, roughly 2%–5% display malignant pathological features. The key molecular pathways involved in malignant trans- formation remain to be determined. Methods. Illumina expression microarrays were used to assess gene expression levels, and Illumina single- nucleotide polymorphism arrays were used to identify copy number variants in benign, atypical, and malignant me- ningiomas (19 tumors, including 4 malignant ones). The authors also reanalyzed 2 expression data sets generated on Affymetrix microarrays (n = 68, including 6 malignant ones; n = 56, including 3 malignant ones).
    [Show full text]