Systematic Discovery of Nonobvious Human Disease Models Through Orthologous Phenotypes
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Multiple Activities of Arl1 Gtpase in the Trans-Golgi Network Chia-Jung Yu1,2 and Fang-Jen S
© 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 1691-1699 doi:10.1242/jcs.201319 COMMENTARY Multiple activities of Arl1 GTPase in the trans-Golgi network Chia-Jung Yu1,2 and Fang-Jen S. Lee3,4,* ABSTRACT typical features of an Arf-family GTPase, including an amphipathic ADP-ribosylation factors (Arfs) and ADP-ribosylation factor-like N-terminal helix and a consensus site for N-myristoylation (Lu et al., proteins (Arls) are highly conserved small GTPases that function 2001; Price et al., 2005). In yeast, recruitment of Arl1 to the Golgi as main regulators of vesicular trafficking and cytoskeletal complex requires a second Arf-like GTPase, Arl3 (Behnia et al., reorganization. Arl1, the first identified member of the large Arl family, 2004; Setty et al., 2003). Yeast Arl3 lacks a myristoylation site and is an important regulator of Golgi complex structure and function in is, instead, N-terminally acetylated; this modification is required for organisms ranging from yeast to mammals. Together with its effectors, its recruitment to the Golgi complex by Sys1. In mammalian cells, Arl1 has been shown to be involved in several cellular processes, ADP-ribosylation-factor-related protein 1 (Arfrp1), a mammalian including endosomal trans-Golgi network and secretory trafficking, lipid ortholog of yeast Arl3, plays a pivotal role in the recruitment of Arl1 droplet and salivary granule formation, innate immunity and neuronal to the trans-Golgi network (TGN) (Behnia et al., 2004; Panic et al., development, stress tolerance, as well as the response of the unfolded 2003b; Setty et al., 2003; Zahn et al., 2006). -
SEC23IP (NM 007190) Human Recombinant Protein – TP309056
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only. -
Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross. -
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. -
Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A. -
Gene Expression Profiles Complement the Analysis of Genomic Modifiers of the Clinical Onset of Huntington Disease
bioRxiv preprint doi: https://doi.org/10.1101/699033; this version posted July 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Gene expression profiles complement the analysis of genomic modifiers of the clinical onset of Huntington disease Galen E.B. Wright1,2,3; Nicholas S. Caron1,2,3; Bernard Ng1,2,4; Lorenzo Casal1,2,3; Xiaohong Xu5; Jolene Ooi5; Mahmoud A. Pouladi5,6,7; Sara Mostafavi1,2,4; Colin J.D. Ross3,7 and Michael R. Hayden1,2,3* 1Centre for Molecular Medicine and Therapeutics, Vancouver, British Columbia, Canada; 2Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia, Canada; 3BC Children’s Hospital Research Institute, Vancouver, British Columbia, Canada; 4Department of Statistics, University of British Columbia, Vancouver, British Columbia, Canada; 5Translational Laboratory in Genetic Medicine (TLGM), Agency for Science, Technology and Research (A*STAR), Singapore; 6Department of Medicine, Yong Loo Lin School of Medicine, National University of Singapore, Singapore; 7Department of Physiology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore; 8Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, British Columbia, Canada; *Corresponding author ABSTRACT Huntington disease (HD) is a neurodegenerative disorder that is caused by a CAG repeat expansion in the HTT gene. In an attempt to identify genomic modifiers that contribute towards the age of onset of HD, we performed a transcriptome wide association study assessing heritable differences in genetically determined expression in diverse tissues, employing genome wide data from over 4,000 patients. -
Genome Structural Variation
Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 18th, 2013, Comparative Genomics, Český Krumlov Disclosure: EEE was a member of the Pacific Biosciences Advisory Board (2009-2013) Genome Structural Variation Deletion Duplication Inversion Genetic Variation Types. Sequence • Single base-pair changes – point mutations • Small insertions/deletions– frameshift, microsatellite, minisatellite • Mobile elements—retroelement insertions (300bp -10 kb in size) • Large-scale genomic variation (>1 kb) – Large-scale Deletions, Inversion, translocations – Segmental Duplications • Chromosomal variation—translocations, inversions, fusions. Cytogenetics Introduction • Genome structural variation includes copy- number variation (CNV) and balanced events such as inversions and translocations—originally defined as > 1 kbp but now >50 bp • Objectives 1. Genomic architecture and disease impact. 2. Detection and characterization methods 3. Primate genome evolution Nature 455:237-41 2008 Nature 455:232-6 2008 Perspective: Segmental Duplications (SD) Definition: Continuous portion of genomic sequence represented more than once in the genome ( >90% and > 1kb in length)—a historical copy number variation Intrachromosomal Interchromosomal Distribution Interspersed Configuration Tandem Importance: Structural Variation A B C TEL A B C TEL Non Allelic Homologous Recombination GAMETES NAHR A B C A B C TEL TEL Human Disease Triplosensitive, Haploinsufficient and Imprinted Genes Calvin Bridges Alfred Sturtevant -
PWWP2A Binds Distinct Chromatin Moieties and Interacts with an MTA1-Specific Core Nurd Complex
ARTICLE DOI: 10.1038/s41467-018-06665-5 OPEN PWWP2A binds distinct chromatin moieties and interacts with an MTA1-specific core NuRD complex Stephanie Link1,2, Ramona M.M. Spitzer1,2, Maryam Sana3, Mario Torrado3, Moritz C. Völker-Albert1, Eva C. Keilhauer4,9, Thomas Burgold5,10, Sebastian Pünzeler1,11, Jason K.K. Low3, Ida Lindström 3, Andrea Nist6, Catherine Regnard1, Thorsten Stiewe 6,7, Brian Hendrich5, Axel Imhof 1,8, Matthias Mann 4,8, Joel P. Mackay 3, Marek Bartkuhn2 & Sandra B. Hake 2,8 1234567890():,; Chromatin structure and function is regulated by reader proteins recognizing histone mod- ifications and/or histone variants. We recently identified that PWWP2A tightly binds to H2A. Z-containing nucleosomes and is involved in mitotic progression and cranial–facial devel- opment. Here, using in vitro assays, we show that distinct domains of PWWP2A mediate binding to free linker DNA as well as H3K36me3 nucleosomes. In vivo, PWWP2A strongly recognizes H2A.Z-containing regulatory regions and weakly binds H3K36me3-containing gene bodies. Further, PWWP2A binds to an MTA1-specific subcomplex of the NuRD complex (M1HR), which consists solely of MTA1, HDAC1, and RBBP4/7, and excludes CHD, GATAD2 and MBD proteins. Depletion of PWWP2A leads to an increase of acetylation levels on H3K27 as well as H2A.Z, presumably by impaired chromatin recruitment of M1HR. Thus, this study identifies PWWP2A as a complex chromatin-binding protein that serves to direct the deacetylase complex M1HR to H2A.Z-containing chromatin, thereby promoting changes in histone acetylation levels. 1 Department of Molecular Biology, BioMedical Center (BMC), Ludwig-Maximilians-University Munich, 82152 Planegg-Martinsried, Germany. -
SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT -
Genomic and Transcriptome Analysis Revealing an Oncogenic Functional Module in Meningiomas
Neurosurg Focus 35 (6):E3, 2013 ©AANS, 2013 Genomic and transcriptome analysis revealing an oncogenic functional module in meningiomas XIAO CHANG, PH.D.,1 LINGLING SHI, PH.D.,2 FAN GAO, PH.D.,1 JONATHAN RUssIN, M.D.,3 LIYUN ZENG, PH.D.,1 SHUHAN HE, B.S.,3 THOMAS C. CHEN, M.D.,3 STEVEN L. GIANNOTTA, M.D.,3 DANIEL J. WEISENBERGER, PH.D.,4 GAbrIEL ZADA, M.D.,3 KAI WANG, PH.D.,1,5,6 AND WIllIAM J. MAck, M.D.1,3 1Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern California, Los Angeles, California; 2GHM Institute of CNS Regeneration, Jinan University, Guangzhou, China; 3Department of Neurosurgery, Keck School of Medicine, University of Southern California, Los Angeles, California; 4USC Epigenome Center, Keck School of Medicine, University of Southern California, Los Angeles, California; 5Department of Psychiatry, Keck School of Medicine, University of Southern California, Los Angeles, California; and 6Division of Bioinformatics, Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California Object. Meningiomas are among the most common primary adult brain tumors. Although typically benign, roughly 2%–5% display malignant pathological features. The key molecular pathways involved in malignant trans- formation remain to be determined. Methods. Illumina expression microarrays were used to assess gene expression levels, and Illumina single- nucleotide polymorphism arrays were used to identify copy number variants in benign, atypical, and malignant me- ningiomas (19 tumors, including 4 malignant ones). The authors also reanalyzed 2 expression data sets generated on Affymetrix microarrays (n = 68, including 6 malignant ones; n = 56, including 3 malignant ones).