Investigating the Role of the Human Microbiome in the Pathogenesis of Atopic Dermatitis in the Mechanisms of the Progression of Atopic Dermatitis to Asthma in Children (MPAACH) Cohort
A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
in the Division of Immunobiology, Department of Pediatrics of the College of Medicine by
Tammy Gonzalez
B.S. University of North Dakota May 2014
Thesis Advisor: Dr. Andrew Herr, PhD Committee Chair: Dr. George Deepe, MD
1 Abstract
Atopic dermatitis (AD) is a chronic inflammatory condition characterized by an eczematous rash, often presenting in early childhood. AD initiates the “atopic march”, a progression in which children will develop other atopic conditions such as asthma later in life. The multifactorial etiology of AD is characterized by skin barrier dysfunction, allergen sensitization, and skin microbiome dysbiosis. The healthy skin microbiome maintains immune homeostasis and prevents pathogen colonization. However, individuals with AD are often lacking in skin commensals and are colonized with Staphylococcus aureus.
Staphylococcal species can form biofilms, communities of adhesive bacteria resilient to antibiotic and immune defenses, and these biofilms have been reported on adult AD skin lesions. However, such biofilms are insufficiently studied on pediatric AD skin. S. aureus does not exist alone on the skin, but rather in a community which is difficult to study with traditional culture techniques. The advent of sequencing techniques has allowed for a less biased study of the skin microbiome in those with AD to better understand the contributions of these organisms on pathogenesis and progression through the atopic march. These studies utilize the Mechanisms of the Progression of Atopic Dermatitis to
Asthma in Children (MPAACH) cohort (PI Dr. Gurjit Khurana Hershey), the first US based
AD cohort to exclusively enroll toddlers. Our studies represent the first large-scale analysis of staphylococcal colonization in children with AD. Our two-pronged approach includes the use of contact agar plates to culture live bacteria and tape strips to collect the skin microbiome for analysis by metagenomic shotgun sequencing (1). We utilize
Salinibacter ruber as an internal control for MSS analysis to provide a less biased calculation of abundance. We observed a S. aureus colonization rate of 27% in the
2 MPAACH cohort with most staphylococcal isolates able to form moderate-strong biofilms.
Most isolates from individuals co-colonized with both S. aureus and S. epidermidis formed cooperative mixed-species biofilms. When compared to clinical measures, we show that
S. aureus strains showing higher relative biofilm propensity when compared to S. epidermidis mono-species biofilms were associated with increased AD severity and increased lesional and non-lesional transepidermal water loss. Our data suggest a pathogenic role for S. aureus biofilms in AD that is strain-dependent. Biofilms may provide a useful target for therapy in AD, as we have associated these biofilms with increases in
AD severity. To assess microbial community dynamics that could influence AD pathogenesis, we used a dissolvable tape methodology which we demonstrated was superior in nucleic acid yield to other reported methods. Tapes yielded microbial DNA, which were suitable for MSS which showed differences in species abundance across different depths of tapes. The use S. ruber as an internal control allowed for absolute quantitation of species abundance. We have also implemented an innovative methodology utilizing dissolvable tape strips for non-invasive microbiome collection that detects microbiome differences in layers of the stratum corneum. Our findings provide a method to detect microbiome fluctuations that may be useful in defining endotypes in AD.
3
4 Acknowledgements
Thank you for those who have championed on my behalf, those who have listened when
I needed it the most, and those who have opened doors along my path. Your love and unwavering support have made this experience an unforgettable one.
5 Table of Contents Investigating the Role of the Human Microbiome in the Pathogenesis of Atopic Dermatitis in the Mechanisms of the Progression of Atopic Dermatitis to Asthma in Children (MPAACH) Cohort ...... 1 Abstract ...... 2 Acknowledgements ...... 5 Abbreviations ...... 9 Chapter 1: Introduction ...... 11 Epidemiology of Atopic Dermatitis ...... 11 AD Clinical Presentation ...... 12 Skin Barrier Dysfunction ...... 14 Epidermal Immunity ...... 18 Keratinocyte Contribution ...... 20 Staphylococcal species in AD ...... 24 Basics of Biofilm Formation ...... 30 Staphylococcal biofilms in AD skin ...... 33 Mixed Biofilms ...... 36 Atopic March ...... 39 Allergic Rhinitis ...... 39 Food Allergy ...... 41 MPAACH Study Overview ...... 44 Chapter 2: Skin Staphylococcus aureus biofilm propensity increases atopic dermatitis severity and barrier dysfunction ...... 48 Abstract ...... 51 Introduction ...... 53 Methods ...... 56 Results ...... 63 Discussion ...... 80 Chapter 3: Novel skin tape strip method reveals differences in the skin microbiome by depth of sampling ...... 88 Abstract ...... 89 Methods ...... 93 Results ...... 96 Discussion ...... 114
6 Chapter 4: Standardization of Skin Microbiome Metagenomic Shotgun Sequencing Workflow Using Salinibacter ruber ...... 119 Chapter 5: Using Metagenomic Analysis to Define the Role of the Human Microbiome in the MPAACH cohort ...... 127 5.1 - Preliminary findings from the Characterization of the Skin Microbiome of MPAACH cohort ...... 128 5.2 - Optimization of Metagenomic Shotgun Sequencing of Nasal Microbiome in Healthy Adult Controls ...... 134 Introduction ...... 135 Methods ...... 136 Results ...... 137 Discussion ...... 140 Chapter 6: Future Studies ...... 142 Assessing Durability of Phenotypes in MPAACH Cohort ...... 142 Functional analysis of MPAACH bacterial isolates ...... 146 “-OMICS” of MPAACH ...... 147 Depth Study...... 147 Single Cell Metagenomics ...... 151 Mycome and Virome ...... 153 Clinical Implications ...... 159 Treatment Strategies ...... 159 Diagnostics and Prevention ...... 164 References ...... Error! Bookmark not defined.
7 Figure 1. Normal Skin and FLG Processing...... 23 Figure 2: S. aureus in AD...... 29 Figure 3: Schematic of biofilm formation by staphylococci...... 32 Figure 4: Predicted Zn-dependent interaction between S. epidermidis surface protein, Aap, amd S. aureus surface protein, SasG ...... 38 Figure 5: MPAACH Cohort Study Timeline...... 46 Figure 6: Biospecimens and Downstream Assays collected from MPAACH children...... 47 Figure 7: Contact Plate Collection...... 62 Figure 8: Staphylococcal colonization and biofilm propensity of clinical isolates from the MPAACH cohort...... 66 Figure 9: SEM of biofilms on keratinocytes collected from healthy adult...... 69 Figure 10: Non-invasive tape sampling of skin and SEM imaging reveals staphylococcal biofilms...... 71 Figure 11: Relative S. aureus biofilm propensity among co-colonized subjects is associated with increased TEWL in both lesional and non-lesional AD skin...... 74 Figure 12. S. aureus colonization is associated with increased SCORAD and lower FLG expression while relative S. aureus biofilm propensity is associated with increased SCORAD and increased TEWL...... 76 Figure 13 Proposed model relating skin barrier dysfunction, staphylococcal colonization and biofilm formation, and clinical outcomes in AD...... 84 Figure 14:Comparison of ability of tapes to sample keratinocyte RNA as assessed by filaggrin (FLG) gene expression in each tape strip as indicated...... 100 Figure 15. Epidermal marker expression in RNA isolated from Smartsolve tape strips. . 102 Figure 16. Microbial and human DNA as a function of depth of tape strip sampling...... 104 Figure 17. Tape strip collection from healthy controls yields bacterial DNA of sufficient quality and quantity for metagenomic shotgun sequencing and analysis...... 107 Figure 18. Microbial ecology differs between layers of the stratum corneum in children with AD...... 108 Figure 19. Assessment of DNA methylation in keratinocyte DNA (extracted from tape strips 4-7 from healthy control subjects) by pyrosequencing...... 110 Figure 20. Simultaneous skin microbiome and host keratinocyte genomic capture using non-invasive skin tape stripping in children with atopic dermatitis (AD)...... 113 Figure 21: Fecal samples spiked with dilutions of Salinibacter ruber allows for calculation of absolute read abundance...... 125 Figure 22. Application of Salinibacter ruber spike-in for absolute quantitation of bacterial abundance in metagenomic samples...... 126 Figure 23: Skin Microbial Diversity and Composition are not dependent on AD severity in both non-lesional and lesional skin...... 132 Figure 24: Staphylococcus and Corynebacterium species are more abundant in lesional skin in children with moderate-severe AD...... 133 Figure 25: Bubble Plots of Healthy Control Nasal Swabs and Negative Control...... 138 Figure 26. Swab collection captures intra-individual changes in nasal microbiome...... 139
8 Abbreviations Aap: Accumulation associated protein
AD: Atopic Dermatitis
AD: Atopic Dermatitis
Agr: accessory gene regulation
AR: Allergic Rhinitis
BL+TG: Bacteria lysis (buffer) with 2% Thioglycerol
BP: Biofilm Propensity
CoNS: Coagulase-negative staphylococci
CpG: Cytosine-phosphate-guanine
CRS: Chronic Rhinosinusitis
DAMP: Damage Associated Molecular Pattern
ETS: Environmental Tobacco Smoke
FLG: Filaggrin
LDHC: lactate dehydrogenase C
MPAACH: Mechanisms of Progression of AD to Asthma in Children
MSS: Metagenomic Shotgun Sequencing
PCA plot: Principal Component Analysis
PCR: Polymerase Chain Reaction
PSMs: phenol-soluble modulins
RCT: Randomized Control Trial
SCORAD: SCORing Atopic Dermatitis
SEA: Staphylococcal Enterotoxin A
SEB: Staphylococcal Enterotoxin B
9 SEC: Staphylococcal Enterotoxin C
SEM: Scanning electron microscopy
SF-6D: 6-dimensional health state short form
SNP: Single Nucleotide Polymorphism
TEWL: Transepidermal Water Loss
10 Chapter 1: Introduction
Epidemiology of Atopic Dermatitis
Atopic Dermatitis (AD) is a common inflammatory skin disease that affects up to
30% of children in developed countries, and is steadily rising in developing countries38.
Infants and children often develop symptoms with reoccurrence often continuing into adulthood. The most valuable AD prevalence and trend data were collected by the
International Study of Asthma and Allergies on Childhood (2), the only global study to use uniformly validated methodology to allow comparisons of populations worldwide (3). The prevalence of eczema differs between developing and industrialized nations (4), with rates in industrialized nations increasing to as much as 15-30% of children and 2-10% of adults (5). The ISAAC data was initially collected during 1994-1995 and re-collected 5-
10 years later in 56 countries (6). These data revealed that 58% of participating centers reported an increase in eczema prevalence among older children (13-14 years) (6, 7), and 84% reported increased prevalence of eczema among younger children (6-7 years), with the highest increases seen in Western Europe, Canada, South America, Australasia and the Far East (6). While these substantial differences argue that environmental factors are key players for eczema development worldwide (6), this also raises the possibility that that skin microbial fluctuations modulate the gene-environment interactions at the skin surface (8).
Although there is a general agreement that microorganisms are potential components of many skin disorders, there is limited literature about how they relate to the genetic and environmental variation that also contributes to the disease (8). The association of AD with factors that are linked to microbial exposure, such as daycare
11 attendance, living on a farm environment, household pets, endotoxin exposure and early antibiotic use support the microbial component of AD (3). The “revised” hygiene hypothesis theorizes that a decrease in early childhood exposures to infection, and by extension microbial exposure, increases the susceptibility to allergic disease (3), suggesting that diversity in the early microbiota might be important in allergy development and prevention (9). Other changes in lifestyle in industrialized countries, such as increased skin washing, not only lead to removal of harmful pathogens, but also remove antimicrobial peptides produced by the keratinocytes to protect the skin barrier (10). This concept is timely because it is predicted that two-thirds of the human population will be living in urban areas by 2050, resulting in declining contact with the natural environment
(11, 12).
AD Clinical Presentation
AD typically presents as an erythematous rash with complaints including intense pruritis, erythema, thickening of the skin, and excoriations from scratching. Lesions predominantly begin as dryness of the skin with a perceived roughness of the area. While lesion appearance may vary, they appear as diffuse erythematous patches, plaques, vesicles, or papules, that can have oozing or crusting. More chronic lesions often undergo keratinocyte thickening and hyperpigmentation, a process termed lichenification (13) and appear less demarcated than acute lesions. Due to the disease chronicity and excessive pruritic and excoriation, AD can have a long-lasting cosmetic effect depending on the location of lesions. The distribution of lesions is highly variable and may (14) be influenced by age group. In infants, AD lesions are most often seen on the cheeks, chin,
12 and scalp, as well as the extensor surfaces. With increased age, lesions predominantly present on flexor surfaces, neck and wrists. Diagnosis of AD is primarily based on history and physical findings; laboratory testing or histology is typically not warranted as there are no known diagnostic biomarkers of AD (14).
AD also has a significant impact on quality of life. In young children, this intense pruritis can cause extreme sleep disturbance between both child and caregiver, which is often an overlooked symptom that has significant impact on quality of life (15). In children especially, the lack of sleep and higher metabolic demands due to inflammation are hypothesized to stunt the growth and development. An early study demonstrated that history of AD was associated with duration of sleep and excessive daytime sleepiness.
Fatigue and insomnia were also associated with decreased Body Mass Index (BMI) (16).
BMI was assessed from children with moderate to severe AD and grouped as individuals with IgE-mediated food allergy (FA), those avoiding foods due to exacerbation of symptoms, and those with unrestricted diet. BMI was significantly decreased in those with
IgE-mediated FA and children avoiding milk had a lower height and weight compared to those not avoiding milk. These findings suggest that children with severe AD and milk allergies are at high risk for stunted growth; however, these studies did not address oral food challenges or document steroid exposure (which can stunt growth) (17).
Presentation and onset of AD is not restricted to childhood, and recent studies show that AD may be more common in adults as previously described (18); however, it is less clear if adult AD persists from childhood. Those with adult-onset AD are more likely to have a birthplace that was outside of the US, with onset of symptoms more often developing after immigration, while childhood onset of disease is associated with a family
13 history of atopic conditions and worsened by environmental factors and subsequent cutaneous infections. The distribution of lesions across the body differs amongst children and adults with AD, with no significant differences in severity (19). Health-related quality of life (HRQOL) was compared between healthy adults and those with AD via the 6- dimensional health state short form (SF-6D). The SF-6D is a single-index scale of health based on the likert scale which surveys itch and skin pain, symptoms of anxiety and depression, and impaired physical and social functioning. A score closer to 0 indicates worst health, whereas scores closer to 1 are indicative of best health (20). All adults with
AD, even mild AD, had significantly lower SF-6D utility scores, emphasizing the societal burden that exists (21). Health-care utilization in AD was shown to be low in hospital settings, with one of the predictors of health care service utilization being AD severity, suggesting the number of individuals who outgrow AD may be underappreciated (18).
Skin Barrier Dysfunction
Pathogenesis of AD is multifactorial and characterized by dysfunction in the stratum corneum, sensitization by allergens, and skin microbiome dysbiosis. The skin acts as a functional barrier providing protection from environmental insults or pathogens, prevents water loss, and helps maintain thermoregulation. The skin is the largest organ of the body and is made up of the epidermal and dermal layers. The epidermis, the upper layer of the skin, consists primarily of keratinocytes that are regenerated regularly (22).
As keratinocytes migrate upward from the stratum basale through the epidermis, they differentiate and proliferate, lose their organelles, undergo cornification, and slough from the skin (23, 24). Specifically, the stratum basale contains proliferating, undifferentiated
14 keratinocytes; these migrate up into the stratum spinosum, where they cease proliferating and begin to differentiate. Keratinocytes in the stratum granulosum still contain organelles and are characterized by the presence of granules containing keratohyalin. Finally, the outermost stratum corneum is composed of dead, flattened keratinocytes that are crosslinked together by corneodesmosomes to form a waxy, dense barrier through a process called cornification (22). The pathogenesis of many skin conditions is dependent on to these dynamic epidermal layers and their maturation cycle (Figure 1).
Two primary structures contribute to the epidermal barrier: the stratum corneum
(SC) and tight junctions (TJs). These structures serve many purposes, including creating a physical barrier impermeable to microbial species such as common epidermal commensals. During cornification, the protein filaggrin aggregates keratin filaments, which promotes the flattening of keratinocyte into squames. Filaggrin, keratin, and other structural proteins are subsequently cross-linked by transglutaminases to form an insoluble cornified envelope that characterizes the terminally differentiated stratum corneum and is crucial to maintenance of the physical strength of the stratum corneum
(25, 26). Mature filaggrin is the result of proteolytic processing of the profilaggrin precursor, which also results in the release of peptides that are essential for skin homeostasis (e.g., natural moisturizing factor, NMF) and for maintenance of an acidic pH
(27). Additionally, keratinocytes in the upper stratum granulosum are connected by tight junctions, a multimeric complex consisting of proteins such as claudins and occludins (28,
29) AD can be characterized by defects in the skin barrier that predominantly occur in the stratum corneum.
15 The FLG gene is the most widely studied in AD; loss-of-function mutations, truncations, and null mutations have been identified as contributors to atopy (24). Patients with filaggrin mutations exhibit perturbed barrier function as a result of the loss of structural integrity in the cornified envelope, which normally functions to minimize water loss and to protect the lower layers of skin from exposure to external antigens or environmental factors. Although FLG defects predispose individuals to atopic reactions, sensitization is also necessary as shown in mice exposed to external antigens (30-32).
Both lesional and normal-appearing skin of individuals with AD has been shown to have abnormal barrier function, as demonstrated by elevated trans-epidermal water loss
(TEWL) compared to healthy controls (33).
Mutations in the filaggrin gene (FLG), downregulation in its expression, or disruptions in the processing of the filaggrin protein significantly interferes with epidermis- microbiome homeostasis (34), leading to increased epidermal permeability to microbial species (35) and associated alterations in microbiome composition (36, 37). Notably, mutations in filaggrin or defects in filaggrin homeostasis are major risk factors for several allergic diseases (31, 32, 38). Mice deficient in three other skin barrier proteins— envoplakin, periplakin and involucrin—(referred to as EPI-/- mice) are also more susceptible to microbial invasion and exhibit increased skin microbial load, though the latter may be attributable to alterations in skin pH due to defective filaggrin degradation
(39, 40). Interestingly, EPI-/- mice also demonstrate an atopic phenotype, although this appears to be independent of the microbiome (39, 40).
The human microbiome has generated extensive interest, as it is well understood that microorganisms vastly outnumber human cells and contribute to both health and
16 disease. The skin microbiome is vastly different than the well-studied gut microbiome, as the density of skin microbiota is sparse and highly dependent on the microenvironment
(41); however, the skin microbiota are still capable of influencing host immunity (42-44).
The human skin microbiome is a highly variable, site-specific community of bacteria, viruses, and fungi that modulates host immunity and provides protection from pathogens.
The skin microbiome undergoes several changes shortly after birth and into infancy
(8);(45). Nevertheless, the skin microbiota maintains a delicate balance to prevent pathogens from colonizing and aberrant immune responses from developing. Microbes can influence human health through interactions at host epithelial surfaces, including skin, oral, respiratory, and urogenital mucosae. The interaction of microbiota with skin surfaces is extensive; including microbial colonization of skin follicles, the total surface area involved is estimated to be 30 square meters (46).
It is unclear how much influence birthing and feeding methods affect the skin microbiome in infancy. Microbial diversity and ecology in newborns were found to be similar across body sites (47, 48). Site-specific microbial communities have been found to develop around three months of age and are relatively unstable when compared to the adult skin microbiome (45). Microbial niches typically show distinct patterns in varying physiologic environments such as sebaceous, moist, or dry skin sites (44). In addition, the distribution of microbial communities changes with gender, age, and fluctuations in immune status (44) and is also sensitive to changes in humidity or seasonal weather (49).
17 Epidermal Immunity
Despite the growing body of knowledge regarding the composition of the human skin microbiome under healthy and pathogenic states, not much is known about the homeostatic interaction between normal skin commensals and epidermal immunity.
Existing studies, however, suggest that this interaction is critical for (a) the prevention of pathogen colonization, (b) the maintenance of Type 1 and Type 17 over Type 2 immune programs, and (c) the promotion of epidermal wound repair.
Typical phyla of the skin microbiome include Acinetobacter, Firmicutes,
Proteobacteria, and Bacteroides, with common genera including Corynebacteria,
Cutibacteria (formerly Propionibacteria), and Staphylococci (8, 45). Although the exact mechanisms directing epidermal tolerance to these bacteria are unclear, Scharschmidt et al. suggest that a neonatal influx of Treg cells into colonized skin is crucial to the process
(50). These findings support epidemiological evidence that disrupted early-life commensal colonization (e.g. antibiotics and reduced microbial exposure) contributes to allergic and/or inflammatory disease (50, 51).
Recent studies have demonstrated significant homeostatic crosstalk between the commensals and the immune system at the epidermal interface. The common commensal Staphyloccocus epidermidis, for example, promotes type 1 and 17 immune programs within the epidermis via multiple mechanisms. (52). S. epidermidis-derived peptides prime epidermal accumulation of IL17a+ and IFNγ+ helper (Th17 and Th1) and cytotoxic (Tc17 and Tc1) cells (53, 54). Independently, the induction of MHC-II expression on interfollicular keratinocytes by S. epidermidis is necessary for epidermal accumulation of IFNγ+ Th1 cells. Furthermore, commensals induce dendritic cells to
18 secrete IL-1a, which promote local, dermal Tc17 cells to secrete IL-17a which induces nearby keratinocytes to release AMPs (e.g. s100a8/a9) that abrogate pathogen colonization (see AMP section below) (54, 55). Commensal-specific Tc17 cells also express several tissue-repair genes and accelerate wound healing (53). These findings suggest a critical role for the interaction of skin commensals and the immune system in maintaining the physical and antimicrobial integrity of the epidermal barrier.
Interestingly, S. epidermidis-specific Tc17 and Th17 cells also exhibit a “poised”
Th2 transcriptomic profile whose translation is suppressed by regulatory T-cells (Tregs).
However, several alarmins (IL-1, 18, 25 and 33) trigger translation of the Th2 mRNA (e.g.
IL-5 and IL-13) thereby either superimposing or abolishing the previous Th17 immunophenotype. Consequently, mice without functional epidermal Treg cells demonstrate skin-specific eosinophilia and basophilia, and, in combination with deficient
S. epidermidis colonization, develop spontaneous severe skin inflammation, highlighting a role for S. epidermidis and Treg cells in modulating epidermal Th2 responses (56).
Less is known about the skin mycobiome, fungal communities that reside on the skin. Nonetheless, these communities also play a role in health and disease. Fungi typically colonize oily sites, particularly skin folds, and tend to increase during puberty.
For example, Malassezia are lipid-dependent yeasts that can be divided into many species, of which Malassezia globosa, M. sympodialis, and M. restricta are most likely to be found on healthy skin (57). The healthy skin virome is even less understood than the mycobiome, with the study of viruses limited to the study of pathogenic viruses, excluding potential commensal viruses (58).
19 Keratinocyte Contribution
Keratinocytes can produce a multitude of antimicrobial peptides (59), alarmins, and cytokines that work alone or in conjunction with skin commensals to coordinate epidermal homeostasis and defend against pathogenic bacteria (i.e. those associated with allergic disease). The functions of these proteins in an epidermal context are briefly summarized here.
Antimicrobial peptides (59) play a key role in cutaneous immunity (24, 60-62) and are secreted by keratinocytes. AMPs can be constitutively active, while others are induced by infection to combat microbes. Key inducible keratinocyte AMPs are human β- defensin 2, β-defensin 3, and cathelicidin (LL-37), which exert their antimicrobial effect by disrupting bacterial cell membranes. These three AMPs have anti-staphylococcal activity and are strongly induced in psoriasis, an inflammatory skin condition. The levels of these
AMPs are decreased in AD due to the presence of Th2 cytokines that downregulate AMP expression (61, 63, 64). AMPs are also important in modulating innate and adaptive immunity, as they can recruit and activate innate and adaptive immune cells (60). S. epidermidis and other coagulase-negative staphylococci (52) of the skin microbiota can modulate antimicrobial responses in the skin both directly and indirectly. Certain strains of commensal CoNS provide protection from S. aureus colonization through the direct production of staphylococcal AMPs (65), secretion of lipopeptides that stimulate the release of β-defensin from keratinocytes (66), and the induction of immune cell recruitment via IL-1 and IL-17 secreted from macrophages (43). The commensal staphylococcal AMPs target S. aureus to inhibit colonization and can act synergistically with keratinocyte-expressed AMPs (60, 67).
20 Human beta defensins (hBDs) and cathelicidins (e.g. LL-37) are cationic peptides secreted by keratinocytes constitutively or in response to various stimuli, such as inflammation and infection (36, 37, 68, 69). These peptides possess antimicrobial activity against a variety of bacteria, fungi, parasites and enveloped viruses (70) and primarily kill via pore-formation and membrane permeabilization, though many other effector mechanisms have been described (68, 70, 71). Skin commensals can also stimulate keratinocyte secretion of hBD and LL-37 which often synergize with the commensal- derived antimicrobial compounds (e.g. lantibiotics and phenol-soluble modulins) to limit pathogen growth and survival (72-76). In addition to direct protection from pathogens, multiple studies have described the potential of hBDs and LL-37 to maintain type 1 and/or
17 over type 2 immunity in epidermal tissues (77-81), though hBD2 and LL-37 may paradoxically promote certain allergic responses such as the secretion of pruritogenic IL-
31 and histamine by mast cells (82, 83). Finally, hBDs and LL-37 can promote epidermal barrier integrity by inducing TJ formation between keratinocytes (84, 85) and promoting keratinocyte proliferation, migration, and coordination with neutrophils during wound healing (68, 85, 86). Together, these studies indicate that commensal-induced hBD and
LL-37 secreted by keratinocytes predominantly offer protection from allergic disease by
(a) inhibiting pro-allergic microbial activity, (b) maintaining type 1 and type 17 over type 2 immunological responses at the epidermal barrier, and (c) promoting physical barrier by mediating TJ formation and wound healing responses.
Thymic stromal lymphopoietin (TSLP), IL-25, and IL-33 are three epithelial-derived cytokines whose roles in mediating type 2 allergic responses and allergic pathology are becoming increasingly clear (87). These “innate type 2 cytokines” synergistically or
21 independently promote pro-allergic type 2 immunity through a variety of mechanisms, including signaling dendritic cells (DCs) to induce Th2 differentiation (88-91), activating and expanding ILC2 and Th2 cell populations (92-95), and promoting type 2 cytokine secretion from innate and adaptive immune cells (96-99). In addition to the barrier dysfunction the resulting type 2 polarization can induce (discussed above), all three cytokines can directly decrease filaggrin expression in keratinocytes, thus directly coordinating barrier dysfunction (100-105). Notably, increased TSLP, IL-25, and IL-33 production from keratinocytes is associated with local dermatitis (106-109), and an asthma-like phenotype can result if epidermal TSLP enters the systemic circulation) (8,
110, 111).
The production of TSLP, IL-25 and IL-33 can be induced by a variety of stimuli
(e.g. type 2 cytokines, allergens, and mechanical damage) (112-116), and existing research suggests that the epidermal microbiome and skin dysbiosis also have an effect.
Mice deficient in epidermal Notch signalling, which have chronic skin inflammation and systemic atopy, produce increased TSLP in the absence of skin microbiota, though this did not affect the severity of their skin disease (117). S.aureus components can induce
IL-33 production from keratinocytes and dermal macrophages which mediates antibacterial responses (118, 119). Additionally, S.aureus-induced epidermal IL-33 has also been shown to promote neutrophil infiltration and wound healing (120), though studies in the skin suggest this is at the expense of type 1 immunity and antiviral activity
(121). Although no studies to date have addressed direct regulation of IL-25 by skin microbiota, there is precedent of such microbial influence on IL-25 production in the intestine (122).
22
Figure 1. Normal Skin and FLG Processing. FLG is a structural protein crucial to the formation of an intact normal skin barrier as it binds to and condenses keratin in the keratinocyte cytoskeleton and maintains the physical strength of the stratum corneum. Mature filaggrin is the result of proteolytic processing of the profilaggrin precursor, which also results in the release of peptides that are essential for skin homeostasis, e.g., natural moisturizing factor (NMF). NMF maintains the acidic pH (27) through its breakdown products urocanic acid and pyrrolidone carboxylic acid.
23 Staphylococcal species in AD
Interestingly, the CoNS strains that expressed AMPs were found to frequently colonize normal skin but were rarely detected on AD lesional skin (67). Furthermore, AD skin also exhibits decreased levels of keratinocyte-secreted AMPs (27, 123), which is correlated with increased S. aureus colonization (67). Recently, it was shown that the human AMP LL-37, when combined with antimicrobial peptides produced by the commensal Staphylococcus hominis, can inhibit S. aureus survival more effectively than human or bacterial AMPs individually. Furthermore, restoring strains of S. epidermidis or
S. hominis that inhibited S. aureus growth to the skin of two AD subjects led to significant decreases in S. aureus colonization compared to vehicle alone. These findings suggest that interactions between microbial communities in the skin play a central role in the pathogenesis of AD, and that restoration of antimicrobial commensal strains can be an effective way to control S. aureus colonization (67).
Recent developments in sequencing technology allow for assessment of microbial communities, including hard-to-culture organisms. 16S rRNA sequencing has been used in many studies to assess the taxa present in a microbial community of the skin. Although
16S rRNA sequencing is relatively affordable, this method typically resolves taxa down to the genus or species level and does not provide strain-level resolution of the microbiome
(124, 125). Recent studies have emphasized that specific strains of S. aureus or S. epidermidis can differ in the expression of critical virulence or protective factors (e.g., proteases or antimicrobial peptides) that may play important roles in pathogenesis of AD.
Thus, in order to fully understand strain-specific effects on atopy, shotgun metagenomic sequencing is necessary, since it can resolve species- and strain-level variation. Shotgun
24 metagenomic sequencing was recently used to verify that the relative abundance of S. aureus rises to a striking degree during AD flares and decreases after treatment (125,
126). S. epidermidis abundance was also observed to increase during AD flares, but to a lesser degree. Byrd et al. showed that S. aureus strains varied between individuals; however, individuals typically were colonized by a single strain of S. aureus. S. epidermidis populations were shown to be more heterogeneous and could vary at different skin sites from the same individual (125); such variation is likely due to differences in the skin microenvironment (41, 43). When mice were colonized with S. aureus strains isolated from healthy controls and S. epidermidis from AD patients, non- inflammatory responses were elicited. However, severe inflammation was noted when mice were colonized with S. aureus strains isolated from AD patients (125). The same S. aureus strains also induced an influx of CD4+ T cells and increased secretion of IL-13, demonstrating the ability of specific strains to elicit different inflammatory responses.
The skin microbiome can fluctuate in various states of disease. Dysbiosis is observed in AD, with loss of microbial diversity and over-abundance of certain microbial species. Ninety percent of patients with AD are colonized with S. aureus while only 5-
20% of healthy individuals are typically colonized (14, 127). To assess the evolution of dysbiosis in the skin microbiome, a study was conducted to characterize the skin microbiome within the first six months of life. Colonization at the antecubital fossa with commensal CoNS staphylococcal species at 2 months of age was associated with a decreased incidence of AD at 1 year (47). Children who had developed AD at one year of age showed a decrease in skin commensals, suggesting that these species are protective. Notably, S. aureus was not observed in any samples collected from infants
25 before the onset of AD symptoms (47). More studies are needed to assess when S. aureus colonization most commonly occurs and the implications it carries for inflammatory responses.
While both genetic and environmental factors contribute to AD pathogenesis, S. aureus colonization exacerbates AD severity by increasing inflammation and itching, ultimately worsening the already damaged skin barrier(38, 128, 129). Understanding the drivers of S. aureus colonization would allow us to target therapy to decrease severity of existing disease and prevent the development of comorbid atopic conditions. Many studies explore the effects of the skin microbiome on pathogens indirectly through the innate and adaptive immune system(43, 52-56, 130, 131); however, less is known about the direct physical interactions between commensals and pathogens. Biofilms contribute to dermatologic disease by increasing inflammation, resistance to antibiotics, and decreasing wound healing responses3. Elucidating the physical interactions between S. aureus and commensal bacteria such as S. epidermidis would provide insight into the pathophysiology of atopic dermatitis.
S. aureus is known to initiate and aggravate inflammation in AD lesions by secreting several factors that modulate host immunity or compromise barrier function in the skin (Figure 2). These secreted toxins and superantigens that are capable of inducing inflammation the production of specific IgE antibodies contributing to sensitization (132).
Staphylococcal alpha toxin, a cytolytic secreted factor, induces cell death in keratinocytes, which is further potentiated in the presence of Th2 cytokines (133). Furthermore, decreased expression of filaggrin increases the susceptibility of keratinocytes to cytolysis by alpha toxin, due to concomitant decrease in sphingomyelinase levels (134).
26 Greater than 80% of S. aureus isolated from patients with AD also secrete superantigens, such as staphylococcal enterotoxin B (SEB) and Toxic Shock Syndrome
Toxin-1 (TSST-1). These toxins crosslink MHC-II and T-cell receptors leading to the hyperactivation of T cells. These superantigens lead to significant inflammation in AD and contribute to atopy as specific IgE against these molecules is often observed (135). Toxin- producing S. aureus also induces corticosteroid resistance in peripheral blood mononuclear cells (PBMCs) in vitro, as PBMCs stimulated with superantigen were resistant to dexamethasone (136). In patients with AD, S. aureus isolates from patients that demonstrated corticosteroid resistance exhibited a greater ability to produce superantigens than isolates from corticosteroid-responsive AD or the general population
(137).
In addition to the production of toxins, S. aureus secretes many proteases that are important virulence factors. Among these, the V8 protease and exfoliative toxins A and B have each been demonstrated to cleave desmoglein-1, a critical structural protein within the corneodesmosomes that anchor differentiated keratinocytes to one another (138-
140). Such proteases therefore degrade the barrier function in the skin, increasing water loss and allowing greater exposure to external antigens. AD skin lesions also show elevated levels of the S. aureus cell wall component, lipoteichoic acid (LTA), which has been correlated to AD severity (141-143). In vitro experiments in which LTA was injected intradermally into mice show that S. aureus LTA decreases in loricrin and FLG, independent of neutrophilic invasion (143).
S. aureus secretion of LTA and other molecules triggers protease expression in keratinocytes (144, 145). The epidermis is rich in various proteases with multiple targets
27 that are under strict regulation. These proteases act to degrade superfluous proteins, catalyze downstream pathways that impact terminal differentiation, and to cleave precursors of structural proteins or other proteases into mature, processed versions
(146). Given the tight regulation of skin barrier function by the balance between critical proteases such as the kallikreins and protease inhibitors such as SPINK5, it is no surprise that changes in protease levels or activity in the skin contribute to defects in barrier function seen in AD (147-150). Recently, filaggrin knockdown keratinocytes were shown to have increased endogenous cysteine protease activity suggesting that the epidermal phenotype observed in FLG deficiency may be due in part to unleashed cysteine protease activity. Indeed, when these cysteine proteases were inhibited, keratin and tight junction proteins were significantly rescued (151). In addition to endogenous control of protease levels, exogenous factors can also modulate protease secretion in the epidermis. For example, S. aureus induces increased secretion of kallikreins by keratinocytes (145).
These serine proteases can act to degrade filaggrin as well as desmoglein-1, an important component of desmosomes (145, 147). Cleavage of desmoglein-1 is a normal aspect of desquamation, but dysregulation of this process can lead to impaired barrier function.
Different strains of S. aureus and S. epidermidis show varying effects on protease activity of keratinocytes, suggesting that a detailed understanding of staphylococcal colonization at the strain level will be important for understanding the impact on keratinocytes in AD patients.
28
Figure 2: S. aureus in AD. Microbial stimulus leads to secretion of TSLP; in addition, keratinocyte damage facilitated through apoptosis and scratching also activates TLR-3-dependent secretion of TSLP. Decreases in barrier function can allow further penetration of allergens. Allergens are taken up by the dendritic cells and presented to naïve T cells, and in the presence of TSLP, naïve T cells are polarized to a Th2 phenotype and macrophages shift toward the M2 state. Upon secretion of IL-4 and IL-13 from Th2 cells, there are many downstream effects such as a decrease in secretion of antimicrobial peptides, an increase in IgE class switching, and down regulation of tight-junction proteins. All of these facilitate sensitization, atopy and the persistence of microbial stimuli.
29 Basics of Biofilm Formation
Staphylococcal species can form bacterial networks known as biofilms; this growth mode confers protection from mechanical stressors, immune defenses, and antibiotics
(152-155). Bacterial cells contained within a biofilm are typically surrounded by a self- secreted matrix composed of extracellular polymeric substances (156) including exopolysaccharide, extracellular DNA (eDNA), and proteins(157). Staphylococcal biofilm formation begins by attachment of bacteria to a primary surface followed by adhesion of cells via intracellular mechanisms. The formation of a mature biofilm (158, 159) can lead to detachment of planktonic bacteria to form new biofilms (Figure 3).
Staphylococcal biofilms can attach to a variety of surfaces, including abiotic material and human tissues, including skin (160). Attachment of staphylococci to surfaces is facilitated by bacterial proteins that interact with host matrix proteins (157). The ability of S. epidermidis in particular to adhere to abiotic surfaces and form biofilms is the reason it is the species responsible for the largest number of device-related infections (161). Both
S. aureus and S. epidermidis express many MSCRAMM (microbial surface component recognizing adhesive matrix molecules) adhesion proteins that mediate adherence to host extracellular matrix proteins such as fibronectin, fibrinogen, or collagen(157, 162,
163).
Following attachment, the staphylococci begin to secrete biofilm matrix components to facilitate accumulation of bacterial cells in the nascent biofilm. More specifically, Staphylococcus spp. are known to mediate intercellular adhesion via two key mechanisms: through polysaccharides and proteins. Polysaccharide adhesion is mediated through the icaADBC operon which encodes biosynthetic enzymes that
30 produce the biofilm exopolysaccharide PNAG (poly-N-acetylglucosamine) (164). While it has been shown that polysaccharides can promote biofilm formation, some strains have been shown to lack the ica genes (165). Other biofilm matrix components, particularly proteins, are known to contribute to biofilm growth and development. Staphylococcal surface proteins such as S. epidermidis surface protein, Accumulation associated protein
(Aap), and S. aureus surface protein, SasG, are implicated in facilitating cellular aggregation(157, 166-170). The Herr lab was the first to characterize the adhesion mechanism of the S. epidermidis surface protein, Aap. Aap is a cell-wall anchored protein containing an N-terminal A domain followed by 5-17 tandem B repeat (171, 172), which are required for intercellular adhesion in the biofilm. In the presence of Zn2+, the B-repeat region of Aap becomes adhesive and assembles into anti-parallel dimeric structures that result in twisted rope-like fibers between staphylococcal cells (171, 172). SasG, an orthologous S. aureus surface protein, shows similar Zn2+-dependent assembly of its B- repeat region and, like Aap, SasG is required for biofilm formation in S. aureus (167, 168).
We have demonstrated using zinc chelators and biochemical dominant-negative experiments with recombinant Aap that Zn2+-induced Aap:Aap assembly is required in S. epidermidis biofilms (172), however, there is also evidence for hetero-assembly of Aap with other biofilm proteins, such as SasG, which could facilitate multispecies aggregation within a biofilm (168). We have shown that there are “consensus” and “variant” B-repeat subtypes in Aap with different assembly properties (173). Based on the similarity of their structures, we anticipate that B-repeats from Aap and SasG can form anti-parallel heterodimers similar to the Aap:Aap homodimers, although it is not yet known which B- repeats from Aap or SasG are capable of interacting.
31
Figure 3: Schematic of biofilm formation by staphylococci. Biofilm growth occurs in four stages as illustrated. Attachment is the initial stage in which organisms bind to a surface and is followed by adhesion in which bacteria begin to form cell-to-cell adhesions. Maturation of biofilms is facilitated by polysaccharides and planktonic bacteria can be released from mature biofilms to perpetuate biofilm formation in other areas.
32 Staphylococcal biofilms in AD skin
Epithelial surfaces are constitutively colonized by bacteria, which commonly exist in the form of biofilm communities. For example, S. epidermidis forms biofilms between squamous epithelial cells in normal skin that vary in thickness depending on the type of skin site (e.g., dry vs. moist), and they colonize sebaceous glands and hair follicles(174).
Furthermore, positive Congo red staining of the epidermis of patients with AD revealed that S. aureus biofilms exist in the eccrine ducts (175). Congo red typically stains amyloid proteins, which in the skin are normally found in the dermis as macular amyloid, but the matrix of staphylococcal biofilms contains amyloid and thus stain with Congo red as well.
In addition, Congo red also binds chitin staining for skin-resident fungi, making Congo- red non-specific (176). Among S. aureus and S. epidermidis isolates from AD patients,
85% were strong biofilm producers. Interestingly, while staphylococci were found across the body regardless of lesion site, biofilms were only observed in AD lesions (175). While the characterization of S. aureus biofilms in the skin is at an early stage, the implications of these findings are intriguing, given that biofilms are associated with refractory, recurrent infections that resist immune responses and antibiotic treatment.
Staphylococcal species colonize the skin, especially in AD. Adherence of staphylococcal species is dependent on host matrix proteins and (177, 178) is the priming step for biofilm formation (159). Several of these staphylococcal MSCRAMM-matrix interactions are relevant in AD. For example, the stratum corneum of AD skin has increased fibronectin relative to healthy control skin, and S. aureus fibronectin-binding protein (FnBP) A and B can interact with fibronectin in human skin (179). Likewise, the S. aureus MSCRAMM clumping factor B (ClfB) that binds to fibrinogen and several other
33 ECM proteins was shown to be important in biofilm formation under calcium-depleted conditions (180). ClfB was recently implicated in facilitating attachment of S. aureus to the stratum corneum (181). While the binding activity of ClfB varies among S. aureus strains assessed, these studies provide a molecular basis for how S. aureus may initiate colonization on AD skin.
A number of studies have begun to assess the specific roles that staphylococcal biofilms play in the pathogenesis of AD. As mentioned, by virtue of growing the biofilm, staphylococci become much more resistant to antibiotic action and immune responses such as phagocytosis. Phagocytosis effectively kills planktonic bacteria and sets the stage for adaptive immune responses (152, 182). The formation of a biofilm provides protection to the bacteria within by shielding them from innate immune cells, especially macrophages and neutrophils. Studies have shown that neutrophils are inhibited by S. aureus via neutrophilic lysins such as Hla, which is upregulated upon S. aureus biofilm formation following neutrophil exposure (153). Macrophages can either be classically activated in order to present antigen and defend against intracellular pathogens, or these cells can undergo alternative activation which is crucial in wound healing and contributes to bacterial persistence (152, 183). The alternate activation of macrophages contributes to chronicity of these infections, which could be important in disease processes such as
AD (153). Biofilms offer protection from macrophage phagocytosis through several mechanisms. The sheer size of biofilms and the density of the extracellular biofilm matrix have been suggested to render them resistant to engulfment–referred to as “frustrated phagocytosis (182, 184). In addition, macrophage phagocytosis was inhibited by specific proteins secreted from S. aureus biofilms, which were later identified to be Hla, LukA, and
34 LukB. Increased macrophage cytotoxicity was also observed in the presence of S. aureus biofilms. S. epidermidis biofilms containing increased levels of dormant bacteria led to decreased activation of murine macrophages and less secretion of inflammatory cytokines, suggesting that biofilms aid in immune evasion (185).
In addition to the immune evasion properties mediated by biofilms that lead to recurrent, hard-to-treat infections, staphylococcal biofilms exert direct effects on keratinocytes. For example, a potentially significant impact of S. aureus in AD patients is its ability to trigger apoptosis in keratinocytes. Keratinocytes exposed to S. aureus biofilms were shown to lose viability and undergo apoptosis after only 3 hours of exposure, while planktonic culture at three hours was not statistically different from the control group of keratinocytes alone. Cell morphology was also consistent with keratinocyte apoptosis (186), although the mechanism for apoptosis was not investigated.
This is of importance as damage of epithelial cells releases dsRNA, initiating TLR-3- mediated secretion of thymic stromal lymphopoietin (TSLP) (187). TSLP secretion results in a strong itch response (188) that can exacerbate excoriation of the skin. Furthermore,
TSLP induces dermal dendritic cell activation and recruitment of Th2 cells that secrete IL-
4 and IL-13, which have a suppressive effect on AMPs (27), further limiting protection from pathogens. It was also recently shown that extracts of S. aureus biofilms inhibited the terminal differentiation of keratinocytes. The biofilm extracts induced secretion of IL-
6 from the keratinocytes, leading to a decrease in expression of the important differentiation markers keratin 1 and 10, as well as FLG (189). Furthermore, this block of terminal differentiation renders the keratinocytes more susceptible to the cytotoxic effects
35 of staphylococcal alpha toxin, which was shown to be secreted by S. aureus biofilms grown on reconstructed human epidermal tissue (163, 190-198).
The severity of AD is significantly influenced by the colonization of S. aureus and
S. epidermidis, which colonize the skin via microbial communities known as biofilms.
Recent studies have reported staphylococcal biofilms colonizing eccrine ducts adjacent to lesional skin in patients with AD, and several studies have demonstrated significant impacts of staphylococcal biofilms on the differentiation, apoptosis, or cytokine secretion by keratinocytes. These studies highlight the importance of staphylococcal biofilms in the pathogenesis of AD and highlight the importance of studying host-microbial interactions and their implications for host immunity in AD and allergic disease. Further understanding of S. aureus biofilms in the context of AD will allow for development of better treatments to reduce skin colonization, reduce flares, and dampen the rampant Th2 response that likely contributes to the development of additional co-morbidities.
Mixed Biofilms
Multi-species biofilms are also prevalent; in fact, the majority of microbes in nature likely exist as members of polymicrobial communities(199). Such mixed-species biofilms represent an interwoven community of organisms with even more complex interactions
(200-202). There are many examples in which bacterial or fungal species synergize by forming cooperative multi-species biofilms, such as the interactions of Candida albicans with Streptococcus gordonii in the oral cavity, or C. albicans with S. aureus in denture stomatitis infections (199). In some cases, specific interactions between heterologous macromolecules are known to facilitate the inter-species cooperation, as in the case of
36 C. albicans protein Als3 directly binding to Streptococcus gordonii surface protein SspB
(203). Likewise, the staphylococcal biofilm adhesion proteins Aap and SasG have been shown to form heterophilic assemblies, suggesting that these two staphylococcal species might be able to form mixed biofilms (168). Indeed, a recent paper demonstrated that S. aureus and S. epidermidis can form mixed biofilms in vitro (204), and at least one example has been published of an infected prosthetic joint that was colonized by a mixed S. aureus and S. epidermidis biofilm (205). Given the prevalence of both S. aureus and S. epidermidis in AD skin, it is interesting to speculate that such mixed staphylococcal biofilms may play an important role in the pathogenesis of AD.
S. epidermidis on healthy skin has been shown to protect against pathogens such as S. aureus. This effect can be accomplished via antimicrobial peptides (59) released either by direct secretion from S. epidermidis or induced secretion from keratinocytes12,60.
S. epidermidis also secretes the protease, Esp, which has been shown to disrupt S. aureus biofilm formation8. However, studies have shown the binding of S. epidermidis surface protein, Aap, and the S. aureus homolog, SasG, suggesting that these species could potentially form mixed biofilms (168).
37
Figure 4: Predicted Zn-dependent interaction between S. epidermidis surface protein, Aap, amd S. aureus surface protein, SasG The solved structure of the Aap 1.5 construct (206), is shown modeled with the predicted structure of the C-terminal 1.5 construct of SasG, known as SasG8.9 (teal) with zinc (red) in its predicted arrangement. The known Aap structure and modeled SasG structure have high sequence identity (65.4%), which suggests that they may have similar zinc interactions. Model was created using Phyre2 and PyMol.
38 Atopic March
AD is indicated as the first step of the “atopic march”, the progression of AD to other atopic conditions such as allergic rhinitis or asthma (207). It is estimated that up to half of children with AD progress to develop asthma(208). Atopic conditions such as food allergy, allergic rhinitis, and asthma greatly affect quality of life and contribute to a substantial portion of childhood disease and financial burden(23). Children with AD in addition to allergic sensitization have a 7-fold increased risk of asthma (209). While dry, itchy skin can cause significant discomfort, this disorder is also characterized by a compromised barrier in the skin and possibly other epithelial surfaces, facilitating IgE sensitization to environmental allergens (23). There are many contributors to the pathogenesis of AD including genetic susceptibilities and dysbiosis of the skin microbiota
(65, 66, 72, 135, 210, 211). Genetic predisposition to the development of AD involves genes expressing proteins that contribute to skin barrier function. Highlighted below are atopic conditions that present as comorbid conditions or present subsequently to AD.
Allergic Rhinitis
Allergic Rhinitis (AR) is a type-I hypersensitivity characterized by seasonal allergens that trigger upper airway inflammation inducing rhinorrhea, sneezing, and nasal congestion. AR is not localized to the nasal passages, but rather manifests in the entire respiratory tract(212). AR affects up to 25% of the global population and steadily continues to rise (213). The nasal cavity harbors its own community of organisms to defend against environmental insults, similar to the skin microbiome. The nasal microbiome in allergic disease has been largely focused on which species are associated with viral respiratory infections that contribute to wheezing and asthma exacerbation
39 (214). The predominant species previously demonstrated to be associated with these exacerbations are S. pneumoniae, M. catarrhalis, or H. influenzae, with Streptococcus species being protective (215). Nasal carriage of S. aureus occurs in approximately one- third of the population, although characteristics of these carriers are not well understood
(216). In infancy, the skin and the nares are colonized by Staphylococcus and
Corynebacterium species. Exposure of S. aureus to commensals such as
Corynebacterium species was shown to induce increases in transcription of S. aureus epithelial-cell adhesion molecule genes and decreases in virulence factor secretion, potentially inducing S. aureus to behave as a commensal (217).
There is evidence to suggest that S. aureus colonization in the nares predisposes to soft tissue infections and is associated with a decrease in Corynebacterium spp colonization (218). Subjects with AD were more likely than healthy subjects to be colonized with S. aureus in the nares (219). However, nasal carriage did not seem to influence AD severity in those with AD (220) and antimicrobial resistance profiles differ between those with AD and those who are carriers of S. aureus. The presence of
Moraxella and Staphylococcus species in the nasal microbiome were most likely to be maintained over time and in vitro, M. catarrhalis and S. aureus were shown promote epithelial damage and inflammation through increased expression of IL-8, CXCL10, and occludin (221). The shift to colonization of the nares by S. aureus is also associated with higher levels of IgE. Approximately 77% of those with AD that were colonized by S. aureus in the nares were also colonized in the skin, potentially furthering the progression to AR through skin microbiome dysbiosis (222).
40 Similar to AR, chronic rhinosinusitis with nasal polyps is a Th2-mediated phenomenon and studies have shown that S. aureus drives nasal inflammation, but S. aureus-mucosal interactions have not been characterized. S. aureus results in increased barrier function of healthy nasal epithelial cells, which increase expression of tight junction molecules to protect against bacterial invasion. Dysbiosis of the nasal polyp barrier may allow S. aureus penetration and subsequently increase inflammatory cytokine production
(223).
Food Allergy
Food allergy is defined as a type-1 hypersensitivity to any food allergen, with the most severe manifestation being anaphylaxis. Studies have shown that up to 1 in 13 children in the United States potentially have a food allergy, with diagnosis being complicated by the variation in presentation and transient nature of these manifestations
(224). Common manifestations of food allergy are typical of many atopic conditions. Less severe symptoms include urticaria, pruritus, nausea, and vomiting, however these symptoms can be prodromal for anaphylaxis, a life-threatening emergency. There has been increasing interest in the interactions between various site-specific microbiomes and their contribution to allergic disease. An assessment of the skin, gut, and oral microbiomes in those with AD highlighted a decrease in diversity in skin and oral microbiomes and no change in the gut microbiome. While each site harbored niche- specific species, the oral and skin microbiome shared microbes with closer lineages than the gut. However, diversity in both the oral and skin microbiome was inversely associated
41 with SCORAD, possibly suggesting the oral microbiome playing a reflexive anti- inflammatory role in AD and other atopic conditions (225).
The microbial ecology of the gut in food allergy has been well described in both mouse models and human cohort studies (226); however, the impact of the skin microbiome on the pathogenesis of food allergy is less well studied. Mouse models have been crucial to a more mechanistic understanding of the potential skin-gut interactions in atopic conditions. In neonatal mice, skin exposure to food and environmental allergens leads to food allergy and blunting of food allergen tolerance (227). Skin sensitization induced allergic responses to food allergies in mice with skin barrier genetic mutations.
Human cohort studies have been ongoing to study the associations between dysbiosis of the skin microbiome and food allergy. S. aureus colonization has been associated with food sensitization and allergy (132, 228, 229) with S. aureus skin colonization being 95% predictive of the presence of peanut, egg, or milk-specific IgE.
Associations between S. aureus and food allergy exist but may be confounded by eczema severity. The LEAP/LEAP-ON study (n=640) observed that 32% of children were colonized with S. aureus across at any of the study time-points and S. aureus colonization is associated with concurrent eczema at any time-point.Total IgE and specific IgE, particularly to hen’s egg white and peanut, were significantly associated with skin SA colonization, while it was not associated with nasal S. aureus colonization. This study is limited by the use of culture techniques to assess colonization, and future studies should be directed towards testing these associations with sequencing-based approaches (230).
Various other cohort studies have validated the increased risk of food allergy in those with
AD (33, 231).
42 Asthma
Allergic asthma affects up to 18% of the global population and is defined by airway hyperresponsiveness (GINA, 2019). Asthma is associated with imbalances towards Th2 cells and activation of mast cells leading to the release of bronchoconstrictor mediators
(11). One of the greatest risk factors for asthma development is allergic sensitization (59,
208). Typically, skin microbiome dysbiosis and allergen sensitization are described as independent phenomena, however both have contributions to the development of atopy.
However, studies show that commensal-induced protection against pathogens through the programming of Th17 antimicrobial responses (232). in addition to TLR-mediated differentiation to Th1-Th17 responses, shift away from the Th2 responses that induce asthma (233). The loss of these antimicrobial immune defenses may shift the cytokine milliue to a Th2 phenotype.
Typical allergens consist of food and aeroallergens and studies have shown that
Staphylococcus, Haemophilus, and Corynebacterium species are associated with asthma risk, while home dust levels of cockroach, cat, and mouse allergens were inversely related to asthma development in an early life cohort (234). S. aureus is shown to persist on surfaces and in up to 81% of home dust and can be detected along with staphylococcal enterotoxins, SEA, SEB, and SEC (235).The presence of bacterial antigens in house dust is shown to have contact with the skin barrier may initiate similar responses in those with defective barriers. Serine-like proteases (SPID) secreted from S. aureus induces the symptoms of asthma and increases IL-33 expression in mice.
Blockade of IL-33 decreases the number of eosinophils but had no effect on IgE production (236). Superantigens of S. aureus also contribute to asthma, as they may
43 worsen airway inflammation, similar to the contributions of S. aureus to inflammation in the skin (237).
MPAACH Study Overview
Phenotypes of atopic disease are highly variable, leaving cohorts studying individual phenotypes underpowered. One of the aims of the U19 is to elucidate the endotypes of AD that progress to asthma and identify any predictors. A need exists for sufficiently powered pediatric cohorts to study the role of biofilms in patients that meet clinical criteria for AD. This work is unique in that it utilizes the first US-based AD cohort of infants, the Mechanisms of the Progression of Atopic Dermatitis to Asthma in Children
(MPAACH) cohort (PI Dr. Gurjit Khurana Hershey). This study spans over the course of
5 years (Figure 5) and surveys for the progression of allergic disease known as the atopic march. Inclusion criteria for enrollment into MPAACH is: 1) current age of 1-2 years old,
2) gestational age of greater than 36 weeks, and 3) diagnosis of atopic dermatitis by a specialty physician. Children were excluded from MPAACH if they had a blood diathesis, cystic fibrosis, conditions that impede sample collection, or the use of immunosuppressive drugs or oral steroids for conditions other than asthma.
Parents or guardians will complete surveys detailing symptoms of the child’s AD while providing demographic and other pertinent medical information at every visit.
Biospecimens were collected for analysis, downstream experimentation, and to create a biorepository (Figure 6). Contact agar plates are used to collect live bacterial and fungal organisms and is described extensively in Chapter 2. Tape strips were used to collect
44 keratinocytes and methodology of sampling and processing is described in Chapter 3.
Other specimens collected for the biorepository include serum, peripheral blood mononuclear cells (PBMCs), saliva, nasal swabs (described in chapter 5), stool, and home dust. Further overall description of the cohort is described in Biagini Myers et al referred to in Appendices.
45
Figure 5: MPAACH Cohort Study Timeline. Participants enrolled in MPAACH will complete 5 visits spaced 12-14 months apart. Demographic and questionnaire data will be collected from parents about each individual. In addition, various biospecimens will be collected from each individual at each visit. Visit 5 will be used to assess asthma symptoms and will include nasal epithelial collection and spirometry.
46
Figure 6: Biospecimens and Downstream Assays collected from MPAACH children.
47 Chapter 2: Skin Staphylococcus aureus biofilm propensity increases atopic dermatitis severity and barrier dysfunction
Tammy Gonzalez, BSc, Mariana L. Stevens, PhDb, Asel Baatrebek-kyzy, BSb, Rosario
Alarcon, MSb, Hua He, MSf, John W. Kroner, MSb, Daniel Spagna, BSb, Brittany Grashel,
BSb, Elaine Sidler, BAc, Lisa J. Martin, PhDa,f, Jocelyn M. Biagini Myers, PhDa,b, Gurjit K.
Khurana Hershey, MD, PhDa,b,d †, Andrew B. Herr, PhDa,c,e †
aDepartment of Pediatrics, University of Cincinnati College of Medicine, 3230 Eden
Avenue, Cincinnati, Ohio 45267, USA. bDivision of Asthma Research, cDivision of Immunobiology, dDivision of Allergy and
Immunology, eDivision of Infectious Diseases, fDivision of Human Genetics, Cincinnati
Children's Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, Ohio 45229, USA.
† Gurjit K. Khurana Hershey and Andrew B. Herr should be considered joint senior authors.
Corresponding Author Information Gurjit Khurana Hershey, MD, PhD 3333 Burnet Avenue, MLC 7037, Cincinnati, OH 45229, USA Phone 513-636-7054 Fax 513-636-1657 Email [email protected]
Andrew B. Herr, PhD 3333 Burnet Avenue, MLC 7038, Cincinnati, OH 45229, USA Phone 513-803-7490 Fax: 513-636-5355 Email [email protected]
48 Acknowledgements
We thank all the children and their families who participated in the MPAACH cohort and in this study. We thank Angela Sadler for administrative assistance. This work was supported by National Institutes of Health grant U19 AI070235 (GKH, JBM, LJM, and
ABH), the corresponding Infrastructure and Opportunity Fund U19 AI070235-140323
(JBM), T32 GM063483-17 (TG), and the Center for Pediatric Genomics at Cincinnati
Children’s Hospital Medical Center (238). The project was also supported by the National
Center for Research Resources and the National Center for Advancing Translational
Sciences, National Institutes of Health, through grant UL1 TR001425.
Conflicts of interest
Dr. Martin reports grants from National Institutes of Health, during the conduct of the study. Dr. Biagini Myers has a patent ‘Non-invasive methods for skin sample collection and analysis’ pending. Dr. Khurana Hershey reports grants from National Institutes of
Health, during the conduct of the study; equity ownership in Hoth Therapeutics, outside the submitted work; In addition, Dr. Khurana Hershey has a patent ‘Non-Invasive Methods for Skin Sample Collection and Analysis’ pending to Cincinnati Children's Hospital
Medical Center; Dr. Khurana Hershey serves on the Scientific Advisory Board for Hoth
Therapeutics, Inc. Dr. Herr reports grants from National Institutes of Health, during the conduct of the study; equity ownership in Chelexa BioSciences, equity ownership and personal fees from Hoth Therapeutics, outside the submitted work; In addition, Dr. Herr has a patent 'Use of Zinc Chelators Comprising DTPA to Inhibit Biofilm Formation' licensed to Chelexa BioSciences and sub-licensed to Hoth Therapeutics, and a patent
49 'Antimicrobial Compositions Of Aminoglycosidic Antibiotics And Zinc Ion Chelators
Specifically Formulated For Enhanced Inhibition Of Bacterial Colonization And
Antibacterial Efficacy' licensed to Chelexa BioSciences and sub-licensed to Hoth
Therapeutics; Dr. Herr serves on the Scientific Advisory Board for Hoth Therapeutics, Inc.
Author Contributions
TG and MLS performed experiments, analyzed the data, and contributed to writing the manuscript. AB and RA were responsible for the clinical part of the study. HH and JWK analyzed data. DS, BG, and ES performed experiments. LJM and JBM analyzed data and contributed to writing the manuscript. GKKH and ABH designed the study, supervised the project, contributed to writing the manuscript.
50 Abstract
Background: Atopic dermatitis (AD) patients are often colonized with Staphylococcus aureus and staphylococcal biofilms have been reported on adult AD skin lesions. The commensal Staphylococcus epidermidis can antagonize S. aureus, although its role in
AD is unclear. We sought to characterize S. aureus and S. epidermidis colonization and biofilm propensity and determine their associations with AD severity, barrier function, and epidermal gene expression in the first US early-life cohort of children with AD, the
Mechanisms of Progression of Atopic Dermatitis to Asthma in Children (MPAACH).
Methods: The biofilm propensity of MPAACH staphylococcal isolates was assessed by crystal violet assays. Gene expression of filaggrin and the anti-microbial alarmins,
S100A8 and S100A9, was measured in keratinocyte RNA extracted from skin tape strips.
Staphylococcal biofilms sampled from MPAACH skin were visualized using scanning electron microscopy.
Results: Of the 400 children analyzed in this study, 62% of staphylococcal isolates formed moderate/strong biofilms. A majority (68%) of subjects co-colonized with both staphylococcal species exhibited strains that formed cooperative mixed-species biofilms.
Scanning electron microscopy verified the presence of staphylococcal biofilms on the skin of MPAACH children. S. aureus strains showing higher relative biofilm propensity compared to S. epidermidis were associated with increased AD severity (p=0.03) and increased lesional and non-lesional transepidermal water loss (p=0.01, p=0.03).
Conclusions: Our data suggest a pathogenic role for S. aureus biofilms in AD. We found that strain-level variation in staphylococcal isolates governs the interactions between S.
51 epidermidis and S. aureus, and that the balance between these two species, and their
biofilm propensity, has important implications for AD.
1
2 Keywords: Atopic Dermatitis, Biofilm, Filaggrin, S100A8/S100A9, Staphylococcus
3 aureus
4
52 5 Introduction
6 Atopic dermatitis (AD) is a chronic, relapsing inflammatory skin disease that affects
7 15-30% of children and 2-10% of adults(5). Although up to 70% of affected children have
8 spontaneous remission of AD before adolescence, AD often precedes the development
9 of allergic complications later in life. For example, more than 50% of children with AD go
10 on to develop asthma and ~75% develop allergic rhinitis(208). A defining characteristic of
11 AD patients is a defective skin barrier, which, in some cases, is associated with mutations
12 in the structural skin protein filaggrin.(24) This dysfunction in the skin barrier, combined
13 with exposure to exogenous irritants or sensitization by allergens, underlies the
14 inflammatory responses in AD skin (31-33).
15 While the epidermis provides the first line of protection against environmental
16 insults, the skin microbiome represents a community of microorganisms that co-exist with
17 keratinocytes and can cooperate with the host immune system to protect against
18 pathogen colonization(43, 131). For example, in healthy skin the commensal gram-
19 positive bacterium Staphylococcus epidermidis can suppress colonization by S. aureus
20 or other pathogens through a number of mechanisms (54, 67, 239-241). However,
21 dysbiosis of the skin microbiome is a common feature in AD. Up to 90% of patients with
22 AD are colonized with the gram-positive bacterium Staphylococcus aureus (compared to
23 5-20% in healthy individuals) (242, 243), with a marked increase in relative abundance at
24 lesional sites, particularly during flares of severe AD (126, 223). S. aureus secretes a
25 myriad of toxins (133, 244-246), proteases (145, 146), and molecules such as phenol-
26 soluble modulins (PSMs) (247) that may influence AD severity. In contrast, S. epidermidis
27 and some other commensal coagulase-negative staphylococci (52) are not known to
53 28 produce similar virulence factors that target the host; rather, they produce a range of
29 antimicrobial agents that can inhibit S. aureus growth and/or biofilm formation. These
30 include the Esp protease (239), antimicrobial peptides (67), phenol-soluble modulins
31 (248), and autoinducer peptides that inhibit quorum sensing by S. aureus (249). In
32 addition, S. epidermidis can trigger the production of the alarmin and antimicrobial protein
33 calprotectin (S100A8/A9) by keratinocytes in the epidermis (54).
34 Bacteria that colonize surfaces under unfavorable environmental conditions (such
35 as exposure to ultraviolet light or extremes in temperature or pH) typically grow as
36 biofilms, which are highly cohesive and adhesive surface-adherent colonies surrounded
37 by an extracellular matrix (174, 250-252). The bacterial cells within biofilms are highly
38 resistant to antibiotic action or immune responses, which can lead to recurrent, hard-to-
39 treat infections (153, 250, 253, 254). Both S. epidermidis and S. aureus can form robust
40 biofilms, and both species have been reported to form biofilms on skin. In fact, S.
41 epidermidis typically exists on the skin as a biofilm growing between keratinocytes in the
42 outer layers of the epidermis in healthy individuals (174). Both S. aureus and S.
43 epidermidis biofilms have been observed on the surface and in eccrine ducts of lesional
44 skin from AD patient biopsies (175, 255-259). Given the arid, nutrient-poor environment
45 of the skin and exposure to broad fluctuations in temperature, staphylococcal colonization
46 of the skin is likely dependent on the ability to grow as biofilms, allowing for effective
47 adherence and long-term persistence (174, 260). Interactions between S. epidermidis
48 and S. aureus in the skin environment is of increasing interest. Although certain strains
49 of planktonic S. epidermidis secrete antimicrobial peptides that inhibit S. aureus growth,
54 50 little is known about potential inhibitory or cooperative interactions in multi-species
51 staphylococcal biofilms in the skin that may be relevant to AD pathogenesis.
52 In this study, we analyze staphylococcal colonization and biofilm propensity of the
53 isolated staphylococcal strains sampled from the first 400 subjects in the Mechanisms of
54 Progression of AD to Asthma in Children (MPAACH) cohort, which is the first US-based
55 longitudinal, mechanistic cohort designed to follow the progression and severity of AD in
56 a pediatric population and the potential progression from AD to other atopic diseases.
57 The goal of the current study is to determine the associations between staphylococcal
58 colonization or biofilm propensity and clinical correlates of AD severity (261) and barrier
59 dysfunction, as well as the in vivo keratinocyte gene expression of the antimicrobial
60 alarmins S100A8 and S100A9 and the skin barrier protein filaggrin.
61
62
63
55 64 Methods
65 Subjects
66 The MPAACH cohort is the first US-based patient cohort to exclusively enroll toddlers
67 with AD. Inclusion criteria encompass toddlers from the greater Cincinnati, Ohio
68 metropolitan area (t 36 weeks gestation) aged 1-2 years at enrollment with either
69 physician-diagnosed AD or a positive response to all 3 questions on the Children’s
70 Eczema Questionnaire (CEQ): 1) Does your child have or has your child had a red
71 rash/eczema which can come and go?; 2) If yes, has this caused itching or scratching?;
72 3) Has this red rash/eczema affected any of the following areas: around the eyes, ears,
73 scalp, cheeks, forehead, neck, trunk, folds of the elbows/behind the knees, wrist or ankle,
74 outer arms/legs? (262) A total of 500 children are being enrolled, with annual study visits
75 over a 5-year period. The current study is an intermediate analysis that focuses on the
76 first 400 MPAACH participants. Subjects provided demographic, environmental, asthma
77 trigger information, and personal and family allergy and asthma history data. The
78 SCORing of AD (SCORAD) scale was used to assess of AD severity for each MPAACH
79 child based on a representative lesion and subjective symptoms as reported by
80 parents(263). While the majority of participants reported the use of a medication or cream
81 for the treatment of eczema/atopic dermatitis, all were instructed to withhold the use of
82 those medications for 7 days prior to their visit. Children were asked to discontinue lotions,
83 creams, ointments, and emollients the night prior to the visit.
84 Transepidermal Water Loss (TEWL)
85 TEWL was assessed by an open-chamber TEWL machine (Tewameter,
86 Courage+Khazaka electronic, Germany) at lesional and non-lesional sites on each
56 87 MPAACH subject for sixty seconds as previously described by Gupta et al(33). Relative
88 humidity and temperature were recorded in addition to a sixty second baseline reading
89 prior to subject measurements being taken.
90
91 Contact Plate Sampling
92 Contact plates made from sheep blood agar (Hardy Diagnostics, Santa Maria, CA)
93 were placed on both non-lesional and lesional sites of MPAACH children for 30 seconds
94 and then incubated for 48 hours at 37º C. Lesional sites were determined initially and
95 subsequent non-lesional sample sites were determined based on the need of certain body
96 sites for collection of other biospecimens. Each morphologically distinct colony was
97 further isolated on individual sheep blood agar plates (Remel, San Diego, CA) and
98 incubated for another 24 hours. S. aureus and S. epidermidis colonies were identified by
99 culturing on Mannitol Salt agar (264) (BD, Sparks MD). S. aureus isolates were confirmed
100 by coagulase testing using the StaphAurex Latex Agglutination Kit (Thermo Scientific,
101 Waltham, MA). Bacterial genomic DNA isolated from colonies that appear pink on MSA
102 were further characterized by polymerase chain reaction (PCR) to screen for S.
103 epidermidis. A PCR screen to confirm the identity of S. epidermidis colonies was created
104 using established primers against a 705 bp chromosomal DNA fragment specific to S.
105 epidermidis1: SE705 (F: 5’- ATCAAAAAGTTGGCGAACCTTTTCA – 3’ R: 5’-
106 CAAAAGAGCGTGGAGAAAAGTATCA -3’); and primers targeting the gene for the S.
107 epidermidis surface protein, Aap (F: 5’ – TGCGACAAATTTAACGAGATA – 3’, R: 5’ –
108 CCACTTGCGTATGTACCACTA – 3’). PCR products were assessed on a 1% agarose
109 gel.
57 110 Biofilm Crystal Violet Assay
111 Single MPAACH-isolated colonies were obtained from glycerol stocks
112 streaked on 5% sheep blood agar and were inoculated in 5mL of tryptic soy broth
113 supplemented with 0.5% glucose (TSB-G). The colonies were cultured overnight with
114 shaking at 37° C, followed by 1:10 dilution into TSB-G; cell growth was tracked by
115 measuring optical density (OD) at 600 nm. For biofilm assays, each culture was diluted
116 to a final OD of 0.03 and added in triplicate to a plate that was incubated statically at 37°
117 C for 18 hours. Mono-species biofilms were grown from 200 μL of culture and a 100
118 μL:100μL mixture was used to grow mixed biofilms. Crystal violet assays were conducted
119 essentially as described (265) with addition of 0.1% crystal violet. Absorbance was
120 measured at 570 nm using a BioTek Synergy H1 Hybrid spectrophotometer. S. aureus
121 strain SA35556 and S. epidermidis strain RP62a (American Type Culture Collection,
122 Manassas, VA) were used as positive controls, and negative controls were wells
123 inoculated with TSB-G alone. Biofilm adherence strength was defined using published
124 cutoff values (265) based on a common classification scheme (266) that categorized
125 biofilms as non-adherent, weakly adherent, moderately adherent, and strongly adherent.
126 Scanning Electron Microscopy
127 To visualize biofilms on skin, a tape strip sampling technique was developed similar to
128 that described by Masako et al.3,4 The design of this experiment was implemented after
129 enrollment began and required an additional step of tape sampling; we received consent
130 for the additional sampling for 26 subjects, who were included in this analysis. A 1x1 in
131 square of Tegaderm Film (3M, St. Paul MN) was placed on the subject’s skin in both non-
132 lesional and lesional areas for 30 minutes. A carbon adhesive tab (Electron Microscopy
58 133 Sciences, Hatfield, PA) was placed on the tape while still on the skin, followed by a
134 scanning electron microscopy (SEM) aluminum mount (Electron Microscopy Sciences,
135 Hatfield PA) to hold the Tegaderm flat on the surface of the mount after removal from the
136 skin. The adhesive side of the Tegaderm film was coated with gold palladium and
137 visualized using a Hitachi SU8010 UltraHigh-Resolution Scanning Electron Microscope
138 (Hitachi, Tokyo) at 5.0 kV.
139 Tape Strip Sampling
140 Corneocyte and keratinocyte sampling was conducted by tape stripping, using adhesive
141 SmartSolve Strips pre-cut into eleven 1x1 inch strips. Skin cells of lesional and non-
142 lesional sites were sampled by placing the tape strip on the skin, gently massaging the
143 tape for 15-20 seconds, removing the tape, and storing it in ice-cold in BL buffer
144 supplemented with 2% thio-glycerol (Promega, Madison, WI). This process was repeated
145 to provide a total of 11 tape strips per sampled skin site. Tubes were vortexed for 10-25
146 seconds and incubated at 42° C for 30 min. Collected skin tapes were flash frozen and
147 stored at -80° C. The first 3 tapes from each lesional or non-lesional site were stored for
148 microbiome analysis, and keratinocyte DNA and RNA were extracted from tapes 4-7 and
149 8-11, respectively. Only the RNA extracted from tape 8 & 9 were used in this study, all
150 other tapes are utilized in other current and ongoing studies.
151 S100A8, S100A9, and FLG expression data
152 RNA extraction was first done with phenol:chloroform for the removal of the tape residue,
153 and the aqueous phase was used for the ReliaPrepTM RNA Cell Miniprep (PROMEGA)
154 extraction. Complementary DNA was made with SuperScript IV VILO (ThermoFisher) and
59 155 PCRs reactions were carried out with the following taqman gene expression assays: 18S
156 (Hs03003631_g1), FLG (Hs00856927_g1), S100A8 (Hs00374264_g1) and S100A9
157 (Hs00610058_m1). S100A8, S100A9, and FLG expression levels were normalized to 18S
158 levels. To maximize confidence in the gene expression data, the maximum value reported
159 from either tape strip 8 or 9 from each subject was used to measure S100A8, S100A9,
160 and FLG expression.
161 Statistical Analyses
162 Prior to analyses, distributional characteristics of the data were examined.
163 SCORAD, TEWL, and gene expression data were skewed, so non-parametric statistics
164 were used. Descriptive statistics (frequencies) were reported for categorical variables
165 while median and the interquartile range (IQR) values were reported for continuous
166 variables. We first tested for association between a 4-level bacterial colonization variable
167 (group 1: culture-positive for both S. aureus and S. epidermidis; group 2: culture-positive
168 for S. aureus but not S. epidermidis; group 3: culture-positive for S. epidermidis but not
169 S. aureus; and group 4: culture-positive for neither S. aureus nor S. epidermidis) using
170 contingency tables (black race and sex), and linear regression to test for associations
171 with age.
172 Kruskal Wallis was used to test for distributional differences between the four-level
173 bacterial colonization and clinical outcomes (SCORAD and TEWL) and gene expression
174 data. To further evaluate potential differences, Wilcoxon rank sum test was performed to
175 test the association of 2-level variables (including S. aureus colonization, S. aureus
176 biofilm propensity) with clinical outcomes (SCORAD and TEWL) and gene expression.
177 Biofilm propensity was defined by the mean of the optical densities measured from the
60 178 crystal violet assay of each strain. We defined a higher relative S. aureus biofilm
179 propensity as those cases in which the maximum biofilm propensity from all S. aureus
180 strains sampled per subject was greater than the maximum S. epidermidis biofilm
181 propensity from the same subject. The converse includes cases in which the subject had
182 biofilm-forming S. epidermidis, but no S. aureus were sampled and the same analysis for
183 the subset of subjects that were co-colonized with both S. epidermidis and S. aureus. To
184 evaluate mean absolute biofilm propensity (a quantitative measure measured by the
185 crystal violet biofilm assay) in relation to clinical outcomes and gene expression,
186 Spearman rank correlation was used. Study data were collected and managed using
187 REDCap electronic data capture tools hosted at Cincinnati Children’s Hospital Medical
188 Center (267).
189
190
191
192
61 193 194 Figure 7: Contact Plate Collection.
195 Contact plates are collected from non-lesional and lesional sites fro MPAACH children. 196 After 48hr incubation, each morphologically distinct colony is isolated on blood agar, with 197 subsequent screening using mannitol salt agar to select for Staphylococcus species. S. 198 aureus is detected using coagulase testing, while S. epidermidis is detected by detecting 199 specific 16S region sequences. Crystal violet testing is performed on S. aureus and S. 200 epidermidis strains isolated from MPAACH children in individual mono-species or in co- 201 cultured mixed biofilms and determined to either be non-adherent, weak, moderate, or 202 strong based on crystal violet intensity. 203
204
205
62 206 Results
207 Characteristics of study cohort
208
209 The study cohort was comprised of 51.3% (205/400) males and 48.7% (195/400) females
210 with the 61.5% (246/400) of participants’ race being parent-reported as black (Table I).
211 The average age of the subjects was 2.3 years (IQR 1.7 – 2.5). The median SCORAD
212 value for all children was 18.7 (IQR 11.4 – 29.8). The median TEWL value from lesional
213 skin, 11.7 g m-2 h-1, was significantly higher than TEWL value from non-lesional skin (11.7
214 vs 9.4, p<0.0001; Wilcoxon rank sum test), consistent with previous reports(33, 268-270).
215
63 216 Table 1. Characteristics of MPAACH study cohort.
MPAACH subjects No. 400 Black Race (%) 61.5 (246/400) Male Sex (%) 51.3 (205/400) Age (years), median (IQR†) 2.3 (1.7 – 2.5) SCORAD, median (IQR) 18.7 (11.4 – 29.8) Non-lesional TEWL (g m-2 h-1) 9.4 (7.1 – 13.6) Lesional TEWL (g m-2 h-1) 11.7 (8.2 – 19.8) Presence of S. aureus (%) 26.5 (106/400) Presence of S. epidermidis (%) 71.3 (285/400) Co-colonization with S. aureus and S. 18.8 (75/400) epidermidis (%) 217 † IQR, inter-quartile range
64 218 Staphylococcal colonization patterns
219 Among the MPAACH children in this study, 27% (106/400) were culture-positive
220 for S. aureus. S. aureus cultured from non-lesional sites in 17% (69/400) of subjects and
221 18% (73/400) of participants. From the participants that were culture positive for S.
222 aureus, 34% (36/106) were culture positive at both sites. Seventy-one percent of
223 participants (285/400) were culture-positive for S. epidermidis, with 46% of non-lesional
224 sites (185/400) and 50% (200/400) of lesional sites being culture positive. Of the 285
225 participants colonized with S. epidermidis, 26% (105/285) were culture positive at both
226 sites. Nineteen percent of MPAACH children (75/400) were culture-positive for both S.
227 aureus and S. epidermidis, whereas all but 4 children (99%) were culture-positive for
228 other coagulase-negative Staphylococcus spp. Those 4 children yielded no culturable
229 bacteria (1%) (Figure 8A-C). The percentage of subjects that were culture-positive for S.
230 aureus is lower than in some previous reports (14, 271), but was roughly consistent with
231 the recent study by Simpson et al. (156). No differences were observed in staphylococcal
232 colonization by race (p=0.27) or age of the children (p=0.13). Furthermore, there were no
233 significant differences among the four groups in terms of SCORAD (p=0.27), non-lesional
234 TEWL (p=0.88), or lesional TEWL (p=0.34), indicating that mere presence of S. aureus
235 or S. epidermidis on the skin of MPAACH children was not sufficient to elucidate clinical
236 outcomes (Supplementary Table I).
237
65 238 Figure 8: Staphylococcal colonization and biofilm propensity of clinical isolates 239 from the MPAACH cohort.
240 (A-C) Breakdown of children that were culture-positive for S. aureus (SA), S. epidermidis 241 (SE), and Coagulase-negative Staphylococci (52). (A) Overall distribution for combined 242 non-lesional and lesional sites. (B) Distribution at non-lesional sites. (C) Distribution at 243 lesional sites. (D) Strength of individual mono-species biofilms. (E) Breakdown of 244 cooperative vs. antagonistic mixed-species biofilms grown from isolates collected from 245 MPAACH children that were culture-positive for both S. aureus and S. epidermidis.
66 246 Eighty children (80/400, 20%) were not culture-positive for either S. epidermidis or
247 S. aureus. We performed crystal violet assays to assess their ability to form biofilms and
248 quantitate the extent of biofilm growth per strain using S. aureus and S. epidermidis
249 isolates obtained from the MPAACH cohort. A total of 509 strains of S. epidermidis and
250 S. aureus were obtained from 316 MPAACH children, with 29% (148/509) being S. aureus
251 and 72% (361/509) being S. epidermidis. The results of the crystal violet assays revealed
252 that 50% of the clinically isolated staphylococcal strains were able to form strongly
253 adherent biofilms (255/509), 12% were able to form moderately adherent biofilms
254 (61/509), and 15% could only form weakly adherent biofilms (76/509). Twenty-three
255 percent of the staphylococcal strains were not able to form biofilms (117/509) (Figure 8D).
256 Nineteen percent of children (75/400) were co-colonized with S. epidermidis and
257 S. aureus. From a subset of 72 co-colonized children, we tested whether S. epidermidis
258 and S. aureus isolates would show cooperative or antagonistic interactions in mixed
259 biofilms, given that some S. epidermidis strains can inhibit growth and/or biofilm formation
260 by S. aureus(54, 67, 239-241). Strains obtained from three children (3/75), were not able
261 to be maintained in culture. A large majority (68%, 49/72) of paired isolates from MPAACH
262 children showed cooperative mixed biofilm formation, in which the biofilm from mixed
263 culture showed greater biomass than the S. epidermidis mono-species biofilm (Figure
264 8C), whereas 32% (23/72) of the paired isolates grew mixed biofilms with lesser biomass
265 than the S. epidermidis mono-species biofilm. Thus, for those MPAACH children from
266 whom both S. epidermidis and S. aureus were sampled, most exhibited S. epidermidis
267 strains acting cooperatively with S. aureus in terms of biofilm growth rather than inhibiting
268 S. aureus growth or biofilm formation. In fact, in 13% (9/72) of paired isolates from
67 269 MPAACH children, the interaction between bacteria was synergistic, in that the mixed
270 biofilm biomass was greater than the sum of the individual mono-species biofilms (Figure
271 8E).
272
273 Non-invasive tape sampling of skin reveals staphylococcal biofilms on both healthy skin
274 and AD lesional and non-lesional sites
275 To confirm that staphylococcal biofilms grew on the skin of pediatric AD patients
276 in the MPAACH cohort, we developed a non-invasive tape strip sampling protocol to
277 remove the outer layer of corneocytes and any associated biofilm for imaging by scanning
278 electronic microscopy (SEM). Corneocytes were collected from lesional and/or non-
279 lesional skin sites of 26 MPAACH subjects (Figure 10). Fifty percent (13/26) of MPAACH
280 participants tested were positive for clusters of bacterial cocci with diameter of
281 approximately 0.6 μm adherent to the underside and edges of corneocytes; these clusters
282 of cocci exactly recapitulate the morphology of staphylococcal cells in a biofilm grown in
283 culture from MPAACH staphylococcal isolates or from lab strains SERP62a and SA35556
284 (Figure 10). Tape strips collected from healthy adult controls also showed similar clusters
285 (Figure 9).
286
68 287
288 Figure 9: SEM of biofilms on keratinocytes collected from healthy adult.
289 Tegaderm tape was used to collect keratinocytes from healthy adult skin and SEM was 290 used to identify biofilms on keratinocyte surfaces. Clusters of cocci-shaped organisms 291 can be seen at A) 1.80k, B) 7.00k (yellow box), and C) 12.0k magnification (white box). 292 An SEM image of an in-vitro staphylococcal biofilm is shown in panel D (blue box) for 293 comparison.
294
69 295 From the 13 positive MPAACH participants, 54% (7/13) of biofilm-positive samples were
296 from lesional sites, 38% (5/13) were from non-lesional sites, and 8% (1/13) had SEM-
297 visible biofilms on samples from both lesional and non-lesional sites. For 8 of the 13
298 patients from whom SEM-visible biofilm samples were observed, S. aureus and/or S.
299 epidermidis were successfully cultured from contact plates; each of these staphylococcal
300 isolates formed strong mono-species biofilms in the crystal violet assay. There were 7
301 subjects of the 26 sampled from whom no S. aureus nor S. epidermidis were cultured
302 from the contact plates, although 71% of these patients’ samples (5/7) did show visible
303 biofilms with staphylococcal morphology by SEM, suggesting that measurements of
304 culturable staphylococcal isolates may under-represent the true incidence of
305 staphylococcal colonization, at least in the case of biofilm-forming strains. Retained
306 structures of non-viable bacteria may still be captured by SEM. Studies addressing this
307 question are limited; however, one study showed that antibiotic-treated biofilms visualized
308 under SEM were sparse compared to the biofilms in the absence of antibiotics (272).
309 Another limitation to this study is the lack of staining for biofilm matrix proteins, although
310 new technologies are available and have shown promise in binding to biofilm components
311 (273) and could be implemented in future studies.
312
70 313 Figure 10: Non-invasive tape sampling of skin and SEM imaging reveals 314 staphylococcal biofilms.
315 Representative scanning electron microscopy images at increasing levels of 316 magnification of (A) biofilms formed from mixed culture of lab strains SA35556 and 317 SERP62a, (B) a biofilm grown from an S. epidermidis strain isolated from an MPAACH 318 participant, (C&D) Biofilms on corneocytes isolated using Tegaderm tape strips taken 319 from two individual MPAACH participants. All images were taken at 5.0 kV. 320
321
71 322 Relative biofilm propensity of S. aureus strains is associated with increased AD severity
323 and decreased skin barrier function in both lesional and non-lesional AD skin
324 Since our data established the presence of staphylococcal biofilms on pediatric AD
325 skin, we next sought to investigate the role of S. aureus and S. epidermidis colonization
326 and biofilm propensity in the pathogenesis of AD. We analyzed the presence of
327 staphylococcal bacteria on subjects’ skin and quantified the total bacterial load. We also
328 determined the mono-species biofilm propensity of MPAACH staphylococcal isolates and
329 grew S. aureus and S. epidermidis isolates from the same MPAACH subject in mixed
330 culture to investigate antagonistic versus cooperative interactions. We tested the
331 hypotheses that staphylococcal colonization and biofilm propensity are associated with
332 increased AD severity. The presence of culturable S. aureus on subject’s skin was
333 associated with increased AD severity as defined by SCORAD (p=0.05) but was not
334 significantly associated with TEWL (Figure 12). The presence of S. epidermidis had no
335 significant associations with either SCORAD or TEWL (Supplementary Table S1). To
336 assess the strain-specific biofilm propensity, we defined a higher relative S. aureus biofilm
337 propensity as those cases in which the maximum biofilm propensity from all S. aureus
338 strains sampled per subject was greater than the maximum S. epidermidis biofilm
339 propensity from the same subject. Higher relative biofilm propensity of S. aureus
340 compared to S. epidermidis strains sampled from the same patient was significantly
341 associated with increased SCORAD (p=0.03), non-lesional TEWL (p=0.03), and lesional
342 TEWL (p=0.01) (Figure 12). When comparing cooperative vs. antagonistic mixed biofilms
343 (defined as mixed biofilm biomass being greater or less than S. epidermidis mono-species
344 biofilm biomass, respectively), no significant associations with SCORAD nor TEWL were
72 345 observed. Likewise, in the Spearman’s rank correlation test, the mean biofilm propensity
346 (measured by the crystal violet biofilm assay) of neither S. aureus, S. epidermidis, nor
347 mixed-species biofilms were significantly associated with SCORAD or TEWL.
348 Collectively, these data suggest that while S. aureus colonization is associated with
349 increased AD severity, it is the ability of S. aureus to form strong biofilms and the balance
350 between biofilm-forming S. aureus and S. epidermidis strains that are particularly
351 important factors affecting AD severity and barrier dysfunction.
352
73 353 354 Figure 11: Relative S. aureus biofilm propensity among co-colonized subjects is 355 associated with increased TEWL in both lesional and non-lesional AD skin.
356 Biofilm propensity of S. aureus relative to the propensity of S. epidermidis from the same 357 MPAACH subject was assessed (only co-colonized subjects were used in this analysis). 358 If multiple isolates of S. aureus or S. epidermidis were sampled from the same subject, 359 the isolate with the maximal biofilm propensity was used in the analysis. Higher relative 360 S. aureus biofilm propensity was associated with: A) increased non-lesional TEWL, and 361 B) increased lesional TEWL.
362
363
364
74 365 Table 2. Associations of bacterial colonization with clinical outcomes and 366 expression of FLG or alarmin genes.
Bacterial Presence Group CoNS without S. S. epidermidis & S. aureus & S. aureus, S. p-value* epidermidis CoNS CoNS epidermidis & CoNS
No. 80 210 31 75 Black Race (%) 59.5 59.1 74.2 66.7 0.31 Male (%) 40 53 58 53 0.16 Age (y), median (IQR) 2.37 2.18 2.34 2.29 0.07 (1.84 – 2.46) (1.60 – 2.44) (1.94 – 2.46) (1.82 – 2.45) SCORAD 19.0 18.4 16.9 19.7 0.24 (13.1 – 27.6) (11.0 – 28.3) (12.0 – 40.0) (12.2 – 34.5) Non-Lesional TEWL (g m-2 h-1) 10.4 9.3 10.0 9.3 0.87 (7.2 – 13.4) (7.0 – 13.4) (8.2 – 13.8) (6.6 – 14.3) Lesional TEWL (g m-2 h-1) 10.9 11.5 12.0 13.8 0.35 (8.9 – 17.3) (8.1 – 19.4) (8.2 – 19.4) (8.5– 27.3) Maximal FLG expression, 12.0 9.8 5.2 5.9 0.007 lesional (x 10,000) (5.0 – 31.8) (2.4 – 28.6) (0.6 – 19.1) (0.9 – 17.4) Maximal FLG expression, 17.5 20.1 10.4 10.7 0.038 non-lesional (x 10,000) (6.9 – 42.9) (5.1 – 44.0) (2.6 – 20.9) (3.7 – 28.2) Maximal S100A8 expression, 1.8 1.6 1.2 1.1 0.21 lesional (x 10,000) (0.4 – 3.6) (0.5 – 4.1) (0.5 – 3.4) (0.2 – 2.4) Maximal S100A9 expression, 2.7 2.6 2.5 2.3 0.87 lesional (x 10,000) (0.7 – 6.1) (0.9 – 6.7) (1.0 – 5.7) (0.6 – 6.1) Maximal S100A8 expression, non- 1.2 1.6 0.6 0.9 0.11 lesional (x 10,000) (0.3 – 3.7) (0.5 – 5.0) (0.3 – 3.2) (0.3 – 2.0) Maximal S100A9 expression, non- 2.4 2.4 2.0 1.8 0.90 lesional (x 10,000) (0.5 – 8.5) (0.6 – 7.5) (0.5 – 7.5) (0.5 – 5.2) 367 *P values were obtained by chisq test or Kruskal-Wallis rank sum test.
368
369
75 370 Figure 12. S. aureus colonization is associated with increased SCORAD and lower 371 FLG expression while relative S. aureus biofilm propensity is associated with 372 increased SCORAD and increased TEWL.
373 (A) S. aureus colonization was associated with increased AD severity as measured by 374 SCORAD. Biofilm propensity of S. aureus relative to the propensity of S. epidermidis 375 from the same MPAACH subject was assessed. If multiple isolates of S. aureus or S. 376 epidermidis were sampled from the same subject, the isolate with the maximal biofilm 377 propensity was used in the analysis. Higher relative S. aureus biofilm propensity was 378 associated with: (B) increased SCORAD, (C) non-lesional TEWL, and (D) increased 379 lesional TEWL.
380
381
76 382 S. aureus colonization and biofilm propensity of S. aureus and mixed-species biofilms are
383 associated with decreased FLG expression
384 Both lesional and non-lesional skin of AD patients exhibit abnormal barrier
385 function, as evidenced by increased TEWL compared to normal healthy skin (33). The
386 most commonly reported gene associated with barrier dysfunction in AD is FLG, which
387 encodes filaggrin, a structural protein that plays an essential role in the formation of the
388 cornified envelope that prevents water loss from the epidermis (24, 27, 274). In the
389 MPAACH cohort, we observed that both lesional and non-lesional FLG expression levels
390 varied significantly with staphylococcal colonization pattern (Supplementary Table S1).
391 Specifically, the presence of S. aureus was associated with decreased FLG expression
392 levels in non-lesional and lesional skin (p=0.004 and p=0.001, respectively) (Figure 12).
393 Furthermore, in the Spearman’s rank correlation test, increased mean biofilm propensity
394 of S. aureus was associated with decreased non-lesional (p=0.02) and lesional (p=0.02)
395 FLG expression. Likewise, increasing mean biofilm propensity of mixed biofilms (grown
396 from co-cultured S. aureus and S. epidermidis sampled from the same subject) was also
397 associated with decreased non-lesional FLG expression (p=0.01), as was mean biofilm
398 propensity of S. epidermidis (p=0.02) (Table II).
399
400 S. epidermidis biofilm propensity is negatively associated with gene expression of
401 S100A8 and S100A9
402 We analyzed the expression of alarmins, S100A8 and S100A9, in RNA isolated
403 from AD skin tape strips and assessed potential associations with staphylococcal
404 colonization or biofilm propensity, as the role of commensal organisms plays a role in the
77 405 stimulation of alarmin expression. In this study, it was not feasible to measure the
406 heterodimer of S100A8 and S100A9, as the formation of Calprotectin occurs post-
407 transcriptionally (275). Surprisingly, colonization by S. epidermidis per se showed no
408 statistically significant difference in S100A8 or S100A9 expression levels. However, the
409 Spearman’s rank correlation test revealed that the mean S. epidermidis biofilm propensity
410 was negatively associated with expression of both S100A8 and S100A9 in lesional (A8,
411 p=0.02; A9, p=0.04) and non-lesional (A8, p=0.00006; A9, p=0.0003) skin (Table II). S.
412 aureus colonization and higher relative biofilm propensity of S. aureus were both
413 associated with decreased non-lesional S100A8 expression (p=0.02 and p=0.04,
414 respectively); however, neither was significantly associated with S100A9 expression, so
415 the relevance of S. aureus colonization to calprotectin expression is unclear.
416
417
78 418 Table 3. Spearman correlations between mean staphylococcal biofilm propensity 419 and epidermal expression of S100A8, S100A9, and FLG
Mean S. Mean S. aureus Mean mixed epidermidis biofilm propensity biofilm biofilm propensity propensity
rho p-value* rho p-value* rho p-value* Lesional S100A8 -0.15 0.02 -0.01 0.91 -0.04 0.74
Lesional S100A9 -0.14 0.04 0.00 0.99 -0.02 0.89
Non-lesional S100A8 -0.26 0.00006 -0.09 0.36 -0.17 0.16
Non-lesional S100A9 -0.24 0.0003 -0.03 0.79 -0.16 0.19
Lesional S100A8/S100A9 -0.06 0.37 -0.10 0.34 -0.12 0.33
Non-lesional -0.05 0.44 -0.25 0.02 -0.23 0.06 S100A8/S100A9 Lesional FLG -0.13 0.054 -0.23 0.02 -0.08 0.53
Non-lesional FLG -0.16 0.02 -0.23 0.02 -0.33 0.01
420
79 421 Discussion
422 In this study, we present the first large-scale analysis of staphylococcal
423 colonization and infection, as well as biofilm propensity of staphylococcal isolates
424 sampled from a cohort of pediatric AD patients, and we directly demonstrate the presence
425 of staphylococcal biofilms on pediatric AD skin. Interestingly, although we did observe a
426 significant association between colonization by S. aureus and higher SCORAD levels,
427 there was no significant association between S. aureus colonization per se and TEWL
428 measurements. Instead, we found that the relative biofilm propensity of MPAACH
429 staphylococcal isolates is associated with both increased AD severity and skin barrier
430 dysfunction (Figure 12). Specifically, MPAACH subjects whose S. aureus biofilm strains
431 had stronger biofilm propensity compared to the S. epidermidis strains from the same
432 subject exhibited significantly higher SCORAD values and higher TEWL in both lesional
433 and non-lesional skin. These data strongly suggest a pathogenic role for S. aureus
434 biofilms in AD.
435 Consistent with their important role in AD, we directly observed staphylococcal
436 biofilms around and under corneocytes sampled from the skin of young children with AD.
437 A small number of previous studies observed staphylococcal biofilms on AD skin
438 biopsies(175, 255, 259). However, these studies primarily focused on biopsies from
439 adults; our analysis is the first demonstration that staphylococcal biofilms are present on
440 AD skin from a number of young pediatric subjects. Our observations are consistent with
441 the proposed role of bacterial biofilms as a near-ubiquitous growth mode under harsh
442 environmental conditions such as the arid, nutrient-poor milieu of the skin (174, 250-252).
443 Our results agree in part with those of Simpson et al (156), who reported similar levels of
80 444 S. aureus colonization and found that S. aureus colonization was associated with
445 increased AD severity; however, they also found that S. aureus colonization was
446 associated with increased non-lesional TEWL. In contrast, we observed that higher
447 relative biofilm propensity of S. aureus rather than presence per se was associated with
448 higher TEWL. However, the Simpson et al study enrolled European-American adult AD
449 patients including a large percentage with severe to very severe AD, whereas MPAACH
450 is a pediatric cohort with 61.5% black representation that present with mild to moderate
451 AD. Our group has recently published a study that suggests that African-American
452 subjects display different phenotypes of allergic disease and the atopic march by having
453 an increased risk of developing asthma without the preceeding AD (276). Our data are
454 also consistent with the report by Di Domenico et al that increased biofilm propensity by
455 S. aureus isolates was correlated with increased AD lesion severity (277).
456 Skin barrier dysfunction, colonization of patients’ skin by the pathogen S. aureus,
457 and induction of inflammatory cytokines including IL-4, IL-13, and IL-31 (36, 278) are
458 characteristic of AD. We found that colonization by S. aureus is associated with
459 decreased FLG expression in both non-lesional and lesional skin, similar to the report by
460 Clausen et al that increased S. aureus colonization was observed in AD patients with FLG
461 mutations (37). These findings are consistent with results from a tissue culture model of
462 human epidermis, in which knockdown of FLG expression led to increased colonization
463 by S. aureus (36). Thus, in children with AD, relative deficiency in FLG expression in non-
464 lesional skin likely precedes colonization by S. aureus strains that may be more
465 pathogenic, i.e. possess higher biofilm propensity. Furthermore, breakdown products of
466 filaggrin found in healthy skin are reduced in AD patients with food allergy (279); these
81 467 products have been shown to inhibit growth of S. aureus in vitro (112) and in vivo (279)
468 Taken together, these data further support that deficiencies in the skin barrier due to
469 mutations in or lower expression of FLG predispose these individuals to colonization by
470 S. aureus. Interestingly, we also observed that decreased FLG expression in both non-
471 lesional and lesional skin was associated with S. aureus strains that formed more
472 extensive mono-species and mixed-species biofilms, raising the possibility that
473 cooperative interactions with S. epidermidis may promote S. aureus biofilm growth and
474 persistent colonization in the context of decreased FLG expression.
475 Our data suggest that perturbations in skin barrier function arising from genetic
476 (e.g., FLG mutations) or decreases in epidermal differentiation complex molecules
477 predispose infants to colonization by S. aureus, which then drives increased severity of
478 AD lesions and further degradation of barrier function (Fig 13).
479 The premise that dysregulation in the skin barrier function is upstream of microbial
480 dysbiosis is consistent with the observation that infants that developed AD by age 1 were
481 significantly more likely to show elevated TEWL as early as 2 days post-birth (280).
482 Meylan et al found that infants that went on to develop AD exhibited a significant increase
483 in the prevalence of S. aureus colonization by 3 months after birth, which then preceded
484 the development of AD symptoms by 2 months on average (281). Likewise, a mouse
485 model of AD using tissue-specific ADAM17 knockout revealed the initial development of
486 eczematous inflammatory lesions followed by dysbiosis, with sequential steps of
487 predominant colonization by Corynebacterium mastitidis, S. aureus, and
488 Corynebacterium bovis (65). Introduction of antibiotics specific for these microbial
489 species could reverse inflammatory symptoms (65). Colonization by S. aureus is favored
82 490 by lower expression levels of filaggrin(36) and the resulting reduction in normal filaggrin
491 breakdown products(112, 279). We propose that these factors favoring S. aureus
492 colonization will disrupt the balance between S. aureus and protective commensal
493 microbes including certain S. epidermidis strains. Although we requested that MPAACH
494 participants discontinue AD treatments 7 days prior and emollients 24 hours before a visit,
495 these treatments may influence our results. Thirty-five percent of MPAACH subjects are
496 treated with both over the counter and prescribed medications. Colonization of the skin
497 with commensal staphylococcal species in infants has been shown to be associated with
498 decreased rate of developing AD by 1 year of age (282). However, it is becoming clear
499 that protective effects from S. epidermidis vary in a strain-specific manner. Future studies
500 using less biased approaches such as metagenomic sequencing and isolate analysis,
501 can further assess the roles of S. aureus and S. epidermidis, as well as elucidate the
502 contributions from other potentially important organisms. Ultimately, our data suggests
503 that a dysfunctional skin barrier allows for better attachment by pathogens such as S.
504 aureus that then persist in these biofilms to induce downstream inflammation.
505
83 506 Figure 13 Proposed model relating skin barrier dysfunction, staphylococcal 507 colonization and biofilm formation, and clinical outcomes in AD.
508
84 509 Several studies have reported that S. epidermidis and other coagulase-negative
510 staphylococcal species can directly inhibit S. aureus growth or biofilm formation (67, 239,
511 248, 249). In contrast, it was recently reported that peptidoglycans from S. epidermidis
512 and other commensals can actually potentiate S. aureus virulence (283). In this study we
513 analyzed not only colonization by S. epidermidis and S. aureus, but also the biofilm
514 propensity of staphylococcal isolates. We found that when matched pairs of S.
515 epidermidis and S. aureus strains from the same subject were co-cultured, the
516 combinations produced synergistic or cooperative biofilm growth in mixed culture for 68%
517 of the co-colonized MPAACH subjects, whereas 32% showed strong antagonism by S.
518 epidermidis. In 13% of subjects, their S. epidermidis acted synergistically with S. aureus,
519 forming mixed-species biofilms that that exceeded the sum of the two mono-species
520 biofilms from the same isolates. These results demonstrate that S. epidermidis can either
521 inhibit, coexist with, or even potentiate S. aureus biofilms. This highlights the importance
522 of tracking strain-level variation in S. epidermidis, consistent with the report by Nakatsuji
523 et al that antimicrobial peptide-expressing, coagulase-negative staphylococcal strains
524 that inhibited S. aureus were common on healthy skin but rare on AD skin (67).
525 Furthermore, S. epidermidis can also have context-dependent effects on immune
526 responses and other microbes that may depend on skin barrier integrity or local
527 inflammation (56, 130). One interesting example from this study is that the growth mode
528 of S. epidermidis (biofilm versus planktonic) appears to differentially influence immune
529 responses in the skin. Naik et al (54) demonstrated using a mouse model system that S.
530 epidermidis can induce commensal-specific T cells that home to the epidermis and trigger
531 secretion of calprotectin (S100A8/S100A9) by keratinocytes in an IL-17A-dependent
85 532 manner. However, we found that S. epidermidis biofilm propensity was negatively
533 associated with S100A8 and S100A9 expression levels in both non-lesional and lesional
534 skin (Table II), suggesting that S. epidermidis growing as a biofilm is unable to be taken
535 up by skin-resident dendritic cells for presentation to commensal-specific T cells. This is
536 plausible, given that staphylococcal biofilms inhibit phagocytosis by macrophages (182,
537 184). Without antigen presentation, IL-17 secreted from these T-cells cannot induce
538 S100A8 and S100A9 expression from keratinocytes. This reduction in expression of
539 S100A8 and S100A9 could lead to a feedback loop that further promotes colonization by
540 biofilm-forming S. aureus strains and growth of mixed biofilms by S. aureus and S.
541 epidermidis, since calprotectin sequesters both Mn2+ (which is required for staphylococcal
542 growth (284-286)) and Zn2+ (which is required for intercellular adhesion in S. epidermidis
543 and S. aureus biofilms (167, 168, 171-173, 287)). Although we focused on S100A8 and
544 S100A9 due to Calprotectin’s role in sequestering divalent cations, we do understand that
545 these proteins are one piece of the complexity of epidermal innate immunity. It is known
546 that antimicrobial peptides such as LL-37 and those secrete by commensal can behave
547 synergistically (67, 288), and future studies will focus on the expression of other
548 keratinocyte-secreted antimicrobial peptides and their associations with bacterial
549 presence, biofilm propensity, and AD clinical outcomes.
550 Biofilms are highly adhesive and cohesive and will promote long-term persistence
551 of staphylococcal colonization on the epidermis. Although staphylococci growing in the
552 biofilm mode generally express lower levels of proteases or toxins compared to planktonic
553 cells, S. aureus and S. epidermidis biofilms utilize the accessory gene regulator (Agr)
554 quorum-sensing machinery to undergo periodic cycles of biofilm remodeling and release
86 555 of planktonic bacteria that can secrete increased levels of toxins and proteases(289, 290).
556 Among these are S. aureus δ-toxin that activates mast cells in allergic skin disease(244);
557 S. aureus exotoxins that act as superantigens in AD(291); and a number of S. aureus
558 proteases that can cleave desmoglein-1, an important skin structural protein (138-140,
559 211, 292). Thus, S. aureus biofilms on AD skin will provide a persistent reservoir of
560 staphylococcal cells in the epidermis. This may be especially pertinent in children with AD
561 as it provides a recurring source of proteases and toxins that will trigger inflammation and
562 further degrade skin barrier function.
563 Taken together, the results presented herein suggest that the relative balance of
564 biofilm-forming S. aureus and S. epidermidis strains is implicated in both severity of AD
565 and barrier function in pediatric patients, and that S. epidermidis plays a mixed role
566 depending on strain-level variation in antagonism or cooperation with S. aureus strains in
567 co-colonized patients. This highlights the complexity of the interactions between species
568 in the commensal skin biome and supports a recent, more nuanced view of S.
569 epidermidis, in which this nearly ubiquitous commensal plays multiple roles in skin
570 immune responses and can either inhibit or coexist with S. aureus, depending on strain-
571 level variability. Therapeutic approaches that specifically target biofilm formation by S.
572 aureus or that shift the balance from cooperative to antagonistic (i.e., protective) strains
573 of S. epidermidis could help to mitigate the inflammation and barrier dysfunction
574 characteristic of severe AD.
87 Chapter 3: Novel skin tape strip method reveals differences in the skin microbiome by depth of sampling
Mariana L. Stevens, PhDb* Tammy Gonzalez, BSd*, Eric Schauberger, DO, PhDb,e*, Asel
Baatyrbek kyzy, BSb, Heidi Andersen, MDf, Daniel Spagna, BSb, Mehak K. Kalra, BAb,
Lisa J. Martina,c, David Haslam, MDa,f, Andrew B. Herr, PhDa,d,f, Jocelyn M. Biagini Myers,
PhDa,b, and Gurjit K. Khurana Hershey, MD, PhDa,b,e aDepartment of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, 3230
Eden Avenue, Ohio, 45267, USA. bDivision of Asthma Research, cDivision of Human Genetics, dDivision of Immunobiology, eDivision of Allergy and Immunology, fDivision of Infectious Diseases, Cincinnati
Children’s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, Ohio, 45229, USA.
*These authors contributed equally to this work.
Corresponding Author Information Gurjit K. Khurana Hershey, MD, PhD 3333 Burnet Avenue, MLC 7037, Cincinnati, OH, 45229, USA Phone 513-636-8670 Fax 513-636-1657 Email [email protected]
Funding: This work was supported by National Institutes of Health grant U19 AI070235
(GKH, JBM, LJM, and ABH), the Opportunity Fund U19 AI070235-140323 (JBM),
T32 GM063483-17 (TG), and the Center for Pediatric Genomics at Cincinnati Children’s
Hospital Medical Center (238). The project was also supported by the National Center for Research Resources and the National Center for Advancing Translational Sciences,
National Institutes of Health, through grant UL1 TR001425.
88 Abstract
Background: Skin biopsies are difficult to implement in primary care settings and large cohort studies because they require trained personnel and local anesthesia. Non-invasive collection techniques are needed.
Objective: To develop a non-invasive and scalable technique to capture the surface microbiome and underlying keratinocyte DNA and RNA to enable epigenetic and genomic studies that will provide insight into skin diseases.
Methods: Different tapes were tested. Eleven sequential tape strips were used to collect skin samples from adults and children. Bacterial and human DNA from each tape was subjected to metagenomic shotgun sequencing (1) to define the biome and pyrosequencing to quantify DNA methylation and RNA was characterized for keratinocyte gene expression.
Results: The dissolvable tape methodology was superior to other reported methods when compared directly. Healthy skin yielded 30-80 ng DNA and 20-40 ng RNA. Tapes yielded microbial and human DNA, which were suitable for MSS and DNA methylation measurements, respectively. Keratinocyte filaggrin, loricrin, and keratin 1 gene expression confirmed efficient sampling of the stratum corneum. This dissolvable tape methodology was demonstrated by its application in 400 toddlers with atopic dermatitis in a clinical setting.
Conclusions: This innovative methodology utilizes dissolvable tape strips for simultaneous collection of the microbial and host genome. It outperforms other tapes in terms of cost and tolerability. It is easy to deploy and scalable. It provides molecular
89 signatures that can be used for phenotyping/endotyping, biomarker identification, and to gain insights into the mechanistic underpinnings of skin disease.
90 Introduction Atopic dermatitis (AD) is a multifactorial, inflammatory skin condition affecting up to 20% of children and 7% to 10% of adults. It usually begins in early childhood, with approximately 60% of patients experiencing disease onset within the first year of life(14).
Although the pathogenesis of the disorder is not completely understood, it appears to result from the complex interplay between defects in skin barrier function, environmental and infectious exposures, and immune dysregulation(24). Part of the difficulty in studying
AD is the lack of methods to efficiently and non-invasively sample the skin. The lack of a non-invasive, easy, and inexpensive method has hindered mechanistic studies in human cohorts, as well as the discovery of skin-specific biomarkers that could be used in clinical settings. Further, AD widely varies in terms of its presentation and natural history, yet AD phenotypes are not well defined due, in part, to this lack of non-invasive methods to characterize the skin from the surface biome to the keratinocyte.
Skin biopsy is the gold standard for reliable acquisition of skin samples. However, the increased risk of invasive procedures, administration of local anesthetic, need for trained staff, and the potential for poor cosmetic results make skin biopsies impractical, especially in pediatric populations(238). Skin tape stripping is a common dermatologic procedure used to collect keratinocytes along with other cell types that reside in the skin(293). Skin tape strips have been utilized in many downstream applications such as proteomic analysis(294-296), confocal imaging(297, 298), measurement of cytokine production(299), and even transcriptomics(300). However, in many of these studies, collection from normal undamaged skin has proven to be difficult whereby multiple rounds of tape stripping are required for priming of the skin followed by pooling of numerous tapes (20 or more) to yield keratinocyte nucleic acids(300). Although epidermal sample
91 collection has improved, there is a strong need for a non-invasive and easily scalable methodology that yields sufficient skin samples (including nucleic acids) from large numbers of healthy and disease subjects to enable simultaneous studies of the skin microbiome, keratinocyte epigenetics, and keratinocyte gene expression that will provide insight into external exposures and the ensuing host skin innate response. This study utilizes innovative dissolvable tape strips, originally designed for hydrographic applications, for simultaneous collection of the microbial and host genome. This tape outperforms other tapes and is 1) extremely cost-effective, 2) easy to deploy, and 3) scalable for the collection of a single patient in clinical practice to large cohort-based research studies. It allows simultaneous and consistent assessment of the skin microbiome, host genetics, host keratinocyte DNA methylation, and host keratinocyte mRNA expression patterns. This novel method provides molecular signatures that can be used for deep phenotyping and endotyping, identification of novel biomarkers, and to gain insights into the mechanistic underpinnings of skin disease. Because of these attributes, this methodology has significant potential both as a clinical and research tool to enhance our understanding of the natural history of skin diseases and to inform personalized treatment algorithms in the era of precision medicine.
92 Methods
Subjects
The MPAACH (Mechanisms of Progression of AD to Asthma in Children) cohort is the first US-based patient cohort to exclusively enroll toddlers with AD. It is described in detail in Biagini et al, in this issue. Inclusion criteria encompass toddlers (t 36 weeks gestation) aged 1-2 at enrollment with either physician-diagnosed AD or a positive response to all 3 questions on the Children’s Eczema Questionnaire. A total of 500 children have been enrolled thus far, with annual study visits over a 5-year period. The current study includes data from the first 400 MPAACH participants. All children were 1-
2 years of age from the greater Cincinnati, Ohio metropolitan area with AD diagnosed based on the Hanifin and Rajka Criteria for Atopic Dermatitis(301). Subjects provided demographic, environmental, asthma trigger information, and personal and family allergy and asthma history data. The SCORing of AD (SCORAD) scale was used to assess of
AD severity for each MPAACH child(263). Study data were collected and managed using
REDCap electronic data capture tools hosted at Cincinnati Children’s Hospital Medical
Center(267).
Skin Collection
Samples were collected from lesional and non-lesional skin from MPAACH children. Non-lesional skin was defined as at least 10 cm from lesional sites and non- lesional sites had no history of lesions at that site according to parental report. Tegaderm,
Transpore, Blenderm (3M), the adhesive portion of sheer bandages (Kroger), D-Squame
(Clinical and Derm), and SmartSolve water-soluble adhesive tape (SmartSolve) were
93 assessed for their ease of use, tolerability, cost, and RNA and DNA yield. The 1-in2 pre- cut strips were placed adhesive side down and massaged for 20 seconds to ensure adherence to the skin. The location of the first strip was outlined on the skin and subsequent tapes were applied to the same location. Tapes were collected in bacteria lysis (BL) + thioglycerol (TG) buffer (4M guanidine thiocyanate, 0.01M Tris (pH 7.5) and
2% 1-thioglycerol), incubated at 42qC for 30 minutes and then flash frozen in dry ice prior to being stored at -80qC.
Microbial and host DNA isolation
Genomic DNA was isolated from tape strips using the Promega Wizard DNA isolation kit (Madison, WI). Total DNA was measured with Qubit DNA HS Assay Kit
(ThermoFisher) using the Qubit 2.0 Fluorometer device. DNA concentration yield per tape ranged between 0.3 and 0.8 ng/PL.
Metagenomic sequencing
DNA concentration of tape strip extracts was determined using the Qubit analyzer.
DNA sequence library generation was performed using Nextera XT tagmentation reagents following the manufacturer’s recommendations (Illumina Corporation).
Sequence libraries were pooled and subjected to sequencing on an Illumina NextSeq500 sequencing machine at 150 paired-end reads and a depth of 2.5 G bp per sample. Raw sequence reads were demultiplexed then filtered for quality.
Bisulfite pyrosequencing
Genomic DNA isolated from tape strips was treated with sodium bisulfite overnight and purified using the EZ DNA methylation-Gold Kit according to the manufacturer’s
94 specifications (Zymo Research). Bisulfite DNA was used to amplify OTX2 and lactate dehydrogenase C (LDHC) promoter region with the ZymoTaq PreMix (Zymo Research) as previously described(302).
RNA isolation and gene expression
RNA was extracted with phenol:chloroform:isoamyl alcohol twice followed by a chloroform extraction. The aqueous layer was subjected to the ReliaPrepTM RNA Cell
Miniprep extraction following the manufacturer’s protocol (Promega). RNA yields were quantified using the Qubit RNA HS Assay Kit (ThermoFisher) and the Qubit 2.0
Fluorometer device. RNA concentration per tape ranged between 0.30 and 0.65 ng/PL.
Complementary DNA (cDNA) was generated using Superscript IV VILO Master Mix following the manufacturer's protocol (Invitrogen). PCR reactions were run with Taqman
Fast Advanced MasterMix (ThermoFisher) according to the manufacturer’s instructions.
95 Results
Comparison of different adhesive tapes to obtain skin samples
To develop a non-invasive and scalable technique to capture the surface microbiome and the underlying keratinocytes, we surveyed several adhesive tapes including Tegaderm, Transpore and Blenderm surgical tapes, Kroger brand Sheer bandage, D-Squame, and a water dissolvable tape designed for hydrographic applications, SmartSolve. The parameters we scored for each method include usability
(ability to manipulate the tape including cutting, handling, and storage in lysis buffer), tolerability (defined as absence of rash, pain, or discomfort as reported by the subject), and material cost (Table I). Tegaderm was particularly difficult to use and frequently adhered to itself. D-Squame discs (300) were rigid and difficult to manipulate during collection. The sheer bandage, the surgical tapes (Transpore and Blenderm) and the water soluble SmartSolve tape were easy to manipulate. The adhesive of the Blenderm surgical tapes was stronger than the other tapes, making removal from the skin difficult and painful, often leading to bleeding at the site, therefore this tape was not included in further analyses. The Transpore and Tegaderm tapes resulted in discomfort reported by a majority of subjects, while the bandage, D-Squame discs and SmartSolve were well tolerated, resulting in only mild erythema at the site of taping. Overall, beyond tape strip number 11, some subjects reported discomfort, therefore, all future collections were limited to 11 tapes per site. Although assays could be performed with less than 11 tapes, we collected the maximum number of SmartSolve tapes to create a repository for future studies. With the intention of scaling this technique to a clinical setting on a large scale,
96 we also compared costs of the different tapes. Tegaderm and the D-Squame discs were the most expensive, while SmartSolve and Blenderm were the least expensive (Table I).
97 Table 4. Comparison of different collection techniques for skin sampling
Cost Material Company Usability Tolerability per tape Tegaderm 3M + ++ $0.09 Transpore 3M +++ ++ $0.03 surgical tape Blenderm 3M +++ + $0.01 surgical tape Sheer bandage Kroger +++ +++ $0.02 D-Squame Clinical and Derm ++ +++ $0.16 SmartSolve SmartSolve +++ +++ $0.01 Usability: (+) difficult to handle, cut and store; (++) easy to handle and cut, but difficult to store; (+++) easy to handle, cut, and store. Safety (Tolerability): (+) pain and some bleeding, (++) discomfort, (+++) mild erythrema.
98 Comparison of ability of methods to sample epidermis
In order to directly compare the different tapes in their ability to sample skin cells, we performed RNA extraction on individual tapes and quantified the expression of the epidermal gene filaggrin (FLG) by quantitative PCR (qPCR). We compared SmartSolve,
Tegaderm, the sheer bandage, Transpore, and D-Squame discs. The adhesive in
Blenderm was not well tolerated so it was not further evaluated. Each tape was placed into an aqueous BL+TG buffer solution, incubated for 30 minutes at 420C and flash frozen in dry ice. To perform RNA extraction, two steps of phenol/chloroform extraction were needed to remove traces of the tape and adhesive, and the aqueous phase was subjected to a column-based RNA extraction kit (see methods). FLG expression was quantified from distinct RNA samples isolated from individual tape strip 8, 9, 10 or 11 using SmartSolve,
Tegaderm, the sheer bandage, Transpore, and D-Squame tapes (Figure 14). SmartSolve yielded similar relative expression of FLG in each of the four replicates. In contrast, the other four adhesives resulted in variable expression levels. FLG was detected in 1 out of
4 sheer bandage replicates, and 3 out 4 Tegaderm and Transpore replicates. FLG expression was not detected in the samples collected from D-Squame discs. Collectively, these data suggest that SmartSolve is the easiest to use and has better tolerability, lower cost, and better epidermal RNA sampling among the adhesives tested. As such, all subsequent analyses focused on this tape.
99
0.0003 18S 0.0002
relative to 0.0001 FLG 0.0000 T8 T9 T10T11 T8 T9 T10T11 T8 T9 T10T11 T8 T9 T10T11 T8 T9 T10T11 SmartSolve Tegaderm Bandage Transpore D-Squame
Figure 14:Comparison of ability of tapes to sample keratinocyte RNA as assessed by filaggrin (FLG) gene expression in each tape strip as indicated. Relative FLG expression quantified by qPCR in individual tapes 8-11 collected from healthy control skin with SmartSolve, Tegaderm, Sheer Bandage, Transpore and D- Squame adhesive tapes. Expression of FLG was normalized to 18S. Error bars represent technical replicates (N=3).
100 Keratinocyte RNA from soluble tape strips reliably detects epidermal markers
Since we collected 11 sequential tapes from each site, we next wanted to confirm sampling of the stratum corneum and assess what level(s) of the epidermis may be sampled by the tape strips. We assayed mRNA isolated from each tape for expression of the following markers by qPCR: filaggrin (FLG), loricrin (LOR), S100A9, keratin 1 (KRT1), transglutaminase 1 (TG1), and keratin 14 (KRT14) (Fig 2A). While most tapes sample the outer stratum corneum layer, tapes 8-11 may also sample deeper layers (Figure 15A).
We tested whether merging several tapes during different RNA extraction steps improved yield, but we did not observe any significant benefit compared to the yields from individual tapes (data not shown). To determine the intra-individual reliability and reproducibility, we assayed 4 consecutive tapes from the same site in the same individual for FLG, LOR,
KRT1 and S100A9 (Figure 15B). The relative expression of each of the genes remained consistent across all four tapes tested. Although the RNA yields were low (0.30 and
0.65 ng/PL), the amplification cycles for detection of most of the stratum corneum genes were between 25-35 cycles (Figure 15C). In 56 adults, we were able to consistently and reliably sample the stratum corneum with a success rate of at least 80%. Moreover, this method has also been applied to 400 children with reproducible and reliable results as discussed below.
101 A FLG LOR S100A9 Tape 1 0.003 0.0020 0.0004
18S 0.0015 0.0003 0.002 0.0010 0.0002 0.001 0.0005 0.0001 Relative to 0.000 0.0000 0.0000 12345678910 11 0 12345678910 11 0 12345678910 11 0 Tape number Tape number Tape number KRT1 TG1 KRT14 0.00015 0.0006 0.0008
18S 0.0006 0.00010 0.0004 0.0004 0.00005 0.0002 0.0002 Relative to 0.00000 0.0000 0.0000 12345678910 11 0 12345678910 11 0 12345678910 11 0 Tape 11 Tape number Tape number Tape number
B C Rn vs Cycle (Linear) 0.004 10 FLG 9 LOR 8 KRT1 0.003 7 S100A9 6 18S 5 0.002 FLG 4 Rn (Linear) 3
Relative to LOR 0.001 2 1 KRT1 0 S100A9 0.000 2 6 10 14 18 22 26 30 34 38 42 46 50 Tape 8 Tape 9 Tape 10 Tape 11 HaCAT Cycle
Figure 15. Epidermal marker expression in RNA isolated from Smartsolve tape strips. (A) Relative expression of filaggrin (FLG), loricrin (LOR), S100A9, keratin 1 (KRT1), transglutaminase 1 (TG1) and keratin 14 (KRT14) in each of the 11 sequential tape strips from healthy controls and a blank tape as negative control (). (B) Relative expression of FLG (green), LOR (purple), KRT1 (pink) and S100A9 (206) across tapes 8-11. (C) Amplification cycle numbers for FLG (green), LOR (purple), KRT1 (pink) and S100A9 (206) from Tape 11. Representative data is shown (N=56).
102 Microbial and human DNA as a function of depth of sequential tape strip collection
We next sought to determine the relative quantity of human versus microbial DNA that was present on each tape strip in order to identify which tapes would be most optimal to conduct host and microbial analyses. We extracted DNA from each tape in a series of
11 tape strips and subjected the DNA to Metagenomic Shotgun Sequencing (1). Each individual circle in the bubble plots represent an individual species while the size of each individual bubble represents that species’ relative abundance based on the fraction of reads aligned to that species (Figure 16A). The first three tapes collected yielded the highest levels of microbial DNA (10.47%, 9.08%, and 13.24%, respectively). As expected, significant amounts of human DNA were also sampled by the first three tape strips. As additional tape strips were collected from the same skin location, a decrease in the microbial DNA and a concomitant increase in the human DNA were observed. In the 11th tape strip collected, 98.47% of the reads mapped to the human host genome while only
1.53% of the reads mapped to microorganisms (Figure 16B).
103
Figure 16. Microbial and human DNA as a function of depth of tape strip sampling. (A) Schematic depicting the approach for metagenomic shotgun sequencing. DNA was extracted from each tape in the series of 11 sequential tapes strips from healthy control skin and subjected to metagenomic shotgun sequencing. (B), The result of each tape strip is displayed in a bubble plot where each individual species is displayed in a different color and the size of each individual bubble corresponds to its relative abundance. Percentages of human DNA (light blue) and microbial DNA for each tape strip are designated.
104 We next examined whether the microbial ecology was dependent on the relative depth of skin sampling, i.e., the sequential tape strip number. The predominant species in all eleven tape strips was Moraxella osloensis, a gram-negative organism known to reside on the skin (303, 304) and its relative abundance diminished with deeper sampling.
Similarly, the commensals Rhodococcus, Williamsia, and Corynebacterium were more abundant in the more superficial tape strips. In contrast, Streptococcus, Hamiltosporidium tvaerminnensis, and Mycobacterium species increased in relative abundance with deeper levels of sampling (Figure 17A). Healthy controls had similar skin microbial ecology with differences in relative abundance (Figure 17B). Thus, using tape strips we can effectively sample the skin microbial community and analyze species variation throughout the stratum corneum using MSS.
Microbial ecology was assessed in each individual tape to determine if relative abundance was dependent on the relative depth of skin sampling as determined by the sequential tape strip number in children with AD. Previous studies have shown that the distribution of microbial species is not uniform throughout the stratum corneum (293).
Further, the depth of S. aureus penetration into the dermis of AD lesional sites is associated with the presence of increased inflammatory cytokines in skin biopsies (35,
293). We subjected genomic DNA from tape strips 1 and 7 taken from non-lesional and lesional sites of randomly selected AD subjects to MSS (Figure 18). Clear differences in the skin microbial ecology were observed between tapes 1 and 7 in both non-lesional and lesional skin. Among the 200 most frequent microbial species identified, 71% (14/200) of these species had relative abundances that were markedly different between tapes 1 and
7 (median CV between paired tape samples greater than 10%). Cutibacterium acnes
105 (11.1% vs 9.5%, p=0.03), Staphylococcus.sp.HMSC077B09 (0.4% vs 0.8%, p=0.03) are examples of subspecies that have significantly different relative abundances between tape 1 vs. tape 7 even with our limited sample size. These data demonstrate substantial variability in microbial content between individual layers of tape.
106 A Top 20 Most Abundant Species Moraxella Janibacter oslonensis hoylei Microbacterium Rhodococcus spp. Malassezia Williamsia globosa Streptococcus Micrococcus spp. spp. Corynebacterium Microbispora spp. spp. Enhydrobacter Cyanothece spp. spp. Total % of Top 20 Most % of Top Total
Abundant Species Reads Species Abundant Hamiltosporidium Kocuria tvaerminnensis spp. Mycobacterium Bacillus spp. 1234567891011 spp. Tape Strip Malassezia Pseudomonas
Total % of Microbial Reads Total restricta spp. Sphingomonas Staphylococcus spp. spp.
12 3 45678 91011 Tape Strip B Subject 1 Subject 2 Subject 3 Subject 4
Cutibacterium Lactobacillus acnes lactis Kocuria Gordinia spp. bronchialis Staphylococcus Malassezia aureus restricta Escherichia Pseudomonas coli sp. NBCR 111131 Moraxella Micrococcus oslonensis spp. Proprionobacterium Staphylococcus spp. lugdunenis
Figure 17. Tape strip collection from healthy controls yields bacterial DNA of sufficient quality and quantity for metagenomic shotgun sequencing and analysis. (A) DNA isolated from each of a set of eleven sequential tape strips collected from the skin of a healthy adult control were subjected to MSS and the 20 most abundant bacterial species are shown for each tape strip. (B) Individual circles in the bubble plots represent species diversity and bubble size indicates abundance. Representative data from healthy subjects are shown (N=15).
107
Figure 18. Microbial ecology differs between layers of the stratum corneum in children with AD. Tape 1 and Tape 7 of both non-lesional and lesional skin taken from MPAACH children was subjected to metagenomic shotgun sequencing. Microbial species community composition was plotted using relative abundance (% of total reads).
108 Human DNA collected from SmartSolve tapes is suitable for DNA methylation assays
We next sought to determine whether host genomic DNA isolated from SmartSolve skin tapes was suitable for DNA methylation analyses. We bisulfite converted the DNA extracted from non-lesional tapes 4 through 7 and performed PCR to amplify the promoter region of the genes OTX2 and LDHC. Methylation of LDHC CG1, CG2 and CG3
(cg14332815) sites, as well as OTX2 CG1 (cg23365739), CG2, CG3 and CG4
(cg15607672) sites have been described previously and are associated with steroid treatment response in asthmatic children (302). Upon bisulfite treatment, unmethylated cytosines are converted into uracil, while methylated cytosines remain unchanged.
Following PCR, the uracil is detected as thymine and the product is sequenced quantifying the percentage of methylated cytosines in the sample (Figure 19A).
Amplification of OTX2 and LDHC genomic DNA isolated from tape strips confirmed that we can consistently isolate human genomic DNA from SmartSolve tapes (Figure 19B).
Next, we tested whether SmartSolve tape strip 4 from healthy subjects yield DNA, which can be used to assess methylation levels of CG1-CG3 in the LDHC promoter and CG3 and CG4 in the OTX2 gene promoter(302) (N=10). DNA methylation was reliably detected in both genes (Figure 19C) and was similar to previously reported levels at these sites
(65-85% in LDHC and 15-50% in OTX2)(302). Thus, human DNA extracted from
SmartSolve adhesive tapes can be used to perform epigenetic studies.
109
Figure 19. Assessment of DNA methylation in keratinocyte DNA (extracted from tape strips 4-7 from healthy control subjects) by pyrosequencing. (A) Schematic of an unmethylated and a methylated CpG site. (B) Keratinocyte DNA was extracted from individual tapes 4-7 and subjected to PCR for OTX2 and LDHC promoter regions and then run on an agarose gel. DNA isolated from nasal epithelial cells from subjects was included as a positive control (NEC) and lanes with no tape strip DNA or water were included as negative controls. (C) Healthy subjects were assessed for DNA methylation at CG1-CG3 in the LDHC promoter and CG3 and CG4 in the OTX2 gene promoter. Pyrogram illustrates the methylation leves at each site. Yellow band indicates a control for bisulfite conversion success. (N=10).
110 Application of Smartsolve tape strip methodology to sample skin of children with atopic dermatitis
To test the ease, generalizability, and scalability of this tool of microbiome and human genomic capture in a clinical setting, we implemented this method in 400 toddlers who are participants in the Mechanisms of Progression of Atopic Dermatitis to Asthma in
Children (MPAACH) cohort (See Appendices). Sets of eleven tape strips were collected from lesional and non-lesional sites from 400 children between the ages of 1-2 and the tapes were distributed among the assays described above (Fig 6 top panel). Genomic
DNA isolated from tape strip 1 was subjected to metagenomic shotgun sequencing, genomic DNA isolated from tape strip 4 from the same individual was subjected to pyrosequencing to quantify DNA methylation in keratinocytes, and RNA isolated from tapes 8 and 9 from the same individual were subjected to quantitative PCR for keratinocyte gene expression of filaggrin, S100A8, and S100A9. We isolated genomic
DNA from tape strip 1 taken from lesional sites and subjected the DNA to MSS. The success rate of library preparation (Agilent Technologies, Santa Clara, CA) was 96%. We have observed considerable microbiome diversity among the samples analyzed; for example, subject 1 had 12.24% S. aureus and 2.72% C. acnes, subject 2 had 3.78% S. aureus and 1.53% C. acnes, and subject 3 had 5.76% S. aureus and 47.82% C. acnes
(Figure 20 left panels). These data demonstrate variability between individuals and, as such, establish the potential for the use of S. aureus skin colonization as potential AD biomarkers.
We next analyzed the DNA methylation status of LDHC promoter CG1, CG2 and
CG3 sites as well as OTX2 CG3 and CG4 sites (Figure 19) in DNA isolated from tape
111 strip 4 taken from lesional skin. Subject 1 had high (91%) methylation on LDHC CpG1 and lower methylation levels on the CpG2 and CpG3 sites (31 and 28%, respectively). In contrast, subjects 2 and 3 had high levels of methylation on all 3 sites, ranging from 84-
88% and 91-95%, respectively. Interestingly, OTX2 methylation levels on CG3 and CG4 were low on both subjects 1 and 3 (0-1%) and intermediate in subject 2 (37 and 26%)
(Figure 20 middle panels). These data demonstrate variability between individuals and, as such, establish the potential for the use of keratinocyte DNA gene methylation as skin disease biomarkers.
We next characterized epidermal gene expression (FLG, S100A8, and S100A9) in tape strips 8 and 9 taken from both non-lesional and lesional skin of children with AD. We have performed gene expression analyses in 400 children, and gene expression was reliably detected in > 90% of the subjects. There was variability in expression observed between subjects (Figure 20 right panels) illustrating the potential utility of gene expression patterns as possible biomarkers of disease severity (See Appendices and
Chapter 2).
112
Figure 20. Simultaneous skin microbiome and host keratinocyte genomic capture using non-invasive skin tape stripping in children with atopic dermatitis (AD). Genomic DNA isolated from tape strip 1 yields microbial and host DNA suitable for metagenomic shotgun sequencing (A) host genomic DNA isolated from tape strip 4 was used for pyrosequencing to quantify DNA methylation in keratinocytes (B) and host RNA isolated from tapes 8 or 9 yielded host keratinocyte RNA suitable for quantitative PCR (C) These techniques were utilized in children with AD to gather host-microbial information from AD children (N=21 for metagenomics, N=10 for DNA methylation, and N=400 for keratinocyte RNA gene expression) and the data from three representative subjects are shown (each of the 3 assays were conducted using sequential tapes from the same child).
113 Discussion
We have developed a new non-invasive methodology to sample the skin. Our data demonstrate that this Smartsolve methodology simultaneously samples the surface skin biome as well as the underlying human DNA and RNA, which can be used to characterize host responses to environmental cutaneous exposures. This novel methodology is highly innovative in its use of a dissolvable tape. It is safe, well tolerated, efficient, low-cost, non- invasive, and we have demonstrated that it can be easily implemented at the bedside in an office setting or in large cohort studies illustrating the broad clinical and research potential of this tool. Further, our study is the first to report the use of a single set of skin tape strips for three rich data sources: metagenomics, keratinocyte epigenetic studies, and keratinocyte gene expression profiles.
This methodology was originally developed for application in the Mechanisms of
Progression of Atopic Dermatitis to Asthma in Children (MPAACH), the first US-based early life cohort of children with AD (See Appendices). We needed to develop a method that was well tolerated in young toddlers. While other tapes, particularly Tegaderm and
Blenderm, irritated the skin and often resulted in mild bleeding at the collection site in healthy controls, SmartSolve tape was much less irritating. D-Squame discs have been widely used in adult subjects (294, 300, 305). In our study of young children, FLG expression could not be detected in RNA isolated from individual D-Squame discs but was consistently detected in individual SmartSolve tapes. While D-Squame discs have been used successfully for genome-wide transcriptomics studies, the investigators had to merge 20 consecutive tapes for the analyses (300). In contrast, we were able to analyze DNA and RNA isolated from single Smartsolve tape strips. In addition,
114 SmartSolve tape is highly cost-efficient, with each tape strip costing only 1-2 cents. Thus, we selected the SmartSolve tape for the MPAACH study. MPAACH participants return annually for visits and our retention data indicated that tape strip collection was not a deterrent in returning to the second visit (data not shown).
A recent transcriptome study reported difficulties in collecting skin tape samples from non lesional compared to lesional skin (300). In the present report we were able to sample both lesional and non-lesional skin, as well as healthy adult subjects without any skin disorders. In healthy subjects, FLG and LOR were expressed across all 11 sequential tapes. These data are consistent with studies identifying FLG, which aids in keratinocyte flattening and corneocyte formation, and LOR, the most abundant component of the cornified envelope, as being predominantly late keratinocyte differentiation markers (24,
306, 307). S100A9 is a damage-associated molecular pattern (DAMP), which was expressed inconsistently in both superficial and deeper tapes. We found that its expression correlated with AD severity (See Appendices).
When determining how to effectively distribute the tapes among assays, we predicted that microbial genomic DNA would be predominantly captured by the first three tape strips, while the subsequent tape strips from the same site would capture the majority of host keratinocyte genomic DNA. While this was generally the case, MSS revealed that each tape captures both microbial and human genomic DNA. Thus, any of the eleven tape strips could be utilized for either microbial or host genome characterization. Since the first tapes provided more microbial DNA, we designated the first three tapes for microbiome collection and analyses, and the later tapes for human DNA and RNA
115 analyses, in our case, pyrosequencing and qPCR. In future studies, it will be interesting to determine if and how the biome changes as a function of depth in MPAACH children.
The important role of the commensal skin microbiome in dermal immunity and the pathogenesis of inflammatory skin conditions is increasingly evident (35, 43). SmartSolve tape strips collected from healthy adult controls identified skin commensals, with the most abundant species being Moraxella oslonensis, consistent with prior studies (303, 304).
Strikingly, while M. oslonensis remained the most abundant across all tape strips, variations in abundance occurred as a function of depth. Previous studies have shown that the distribution of microbial species is not uniform throughout the stratum corneum.
In AD skin biopsies taken from lesional sites, S. aureus penetration into the dermis was correlated with increased inflammatory cytokines in the skin biopsies(35, 293). In
MPAACH children, we found that the relative biofilm propensity of the colonizing staphylococcal strains is associated with increased AD severity and barrier dysfunction
(See Chapter 2).
Epigenetic regulations are tissue-specific. Studies of whole blood, T cells and B cells have not shown differences in genome-wide epigenetic patterns between AD cases and controls, while skin biopsies have revealed epigenetic differences between those with
AD and healthy controls (308). Skin biopsies are invasive, require trained personnel, and are not always feasible, especially in a pediatric atopic dermatitis population. Alternate non-invasive approaches are needed to sample the skin with the purpose of identifying biomarkers for epigenetic changes driven by skin diseases. Our data reveal that the
SmartSolve tape stripping approach yields keratinocyte DNA of sufficient quality to perform epigenetic studies. This will enable studies to examine how cutaneous exposures
116 affect DNA methylation in host keratinocytes that are directly exposed. This is highly relevant especially in AD where previous studies have shown that the skin is more vulnerable to cutaneous exposures. Biagini Myers et al. (See Appendices) found that serum cotinine levels were inversely correlated with SCORAD in children with AD despite equal levels of reported environmental tobacco smoke (ETS) exposure. These data strongly suggest that absorption through the skin is an important route of ETS exposure in children with AD, and that children with AD may be uniquely vulnerable to the effects of ETS.
While our approach has several advantages, this study has several limitations.
First, while we did MSS, we did not assess the ability to perform genome-wide methylation or transcriptomic analyses. We elected to focus on optimizing the utility of our novel approach in enabling specific biomarker determination in a clinical or large cohort setting since we developed this technique for use in the MPAACH study. However, genome-wide approaches would also be beneficial and provide a broader and unbiased look into the changes in the epidermis. It has strong potential for genome-wide methylation studies given our MSS success. Genome-wide transcriptomics have proved challenging due low yields from single tapes, but as methods continue to improve, we anticipate that it will be feasible. Another limitation of this methodology is also its biggest strength, namely the dissolvable tape platform. While it is clearly superior in terms of enabling biomarker determination, specifically keratinocyte RNA expression and DNA methylation, the tape residue remaining throughout and after RNA and DNA extraction may inhibit some downstream applications.
117 In conclusion, we describe an innovative new methodology that simultaneously samples the skin microbiome and the underlying keratinocytes using a water-soluble hydrographic tape and yields DNA and RNA of sufficient quality and quantity for easy assessment of potential biomarkers. It is cost-effective, easy to use, safe, and well tolerated. We successfully applied this methodology to a large cohort of young children aged 1-2. It has broad potential in clinical and research settings.
Acknowledgements
We thank all the children and their families who participated in the MPAACH cohort and in this study. G.K.K.H., J.M.B.M., and E.S. are inventors of a patent filed on the basis of this work. We thank Angela Sadler for administrative assistance.
Disclosure of potential conflict of interest
G. K. Khurana Hershey’s institution received a grant from the National Institute of Health
(NIH) for this study and grants from the NIH for other works. She serves on the Scientific
Advisory Board of Hoth Therapeutics and has equity ownership in Hoth Therapeutics. G.
K. Khurana Hershey has patents. A. B. Herr’s institution received a grant from the National
Institute of Health (NIH) for this study and grants from the NIH for other works. He is the lead inventor on three patents related to the topic of this study. He serves on the Scientific
Advisory Board of Hoth Therapeutics and has equity ownership in Hoth Therapeutics and
Chelexa BioSciences.
118 Chapter 4: Standardization of Skin Microbiome Metagenomic Shotgun Sequencing
Workflow Using Salinibacter ruber
Tammy Gonzalez, BSb, Heidi Andersen, MDc, Gurjit K. Khurana Hershey, MD, PhDa,c,
Andrew B. Herr, PhDa,b,d, David B. Haslam, MDd
a Department of Pediatrics, University of Cincinnati College of Medicine, 231 Albert Sabin
Way, Cincinnati, Ohio 45267, USA. b Division of Immunobiology, c Division of Asthma Research, d Division of Infectious
Diseases, Cincinnati Children's Hospital Medical Center, 3333 Burnet Avenue, Cincinnati,
Ohio 45229, USA.
TG – DNA Extraction, Library Preparation, QC, and Sequencing, Creation of Figures TG, HA, ABH, DH– Study design HA – Collection of Samples, Library Preparation and Sequencing DH – Sequencing, Sequence Alignment, Data Analysis, Creation of Figures
**This chapter will be submitted for publication as a short report or Letter to the Editor.**
119 DNA sequencing yields data to study microbial communities that is less biased when compared to traditional culture techniques (309). While species composition of a microbial community can be surveyed using sequencing techniques, comparison between subjects is difficult as number of species reads are relative to the total number of reads. This problem is compounded when sequencing is performed on low yield samples, that even with successful sequencing, these samples are especially susceptible to variation from other factors such as collection (309).
Several studies have used internal controls to provide standardization of the amount of read and allow for accurate and unbiased comparisons among subjects. For
16S and 18S rRNA sequencing primer binding sites (PBSs) for either prokaryotes, eukaryotes, or fungi, with a “stuffer” sequence, has been demonstrated to quantify the abundance of the soil microbiome (310). In the context of NextGen Sequencing approaches, “Sequins”, a group of synthetic DNA standards that were designed to simulate the microbial community, were demonstrated to enable sample to sample comparison in different ecological sites (311). However, human samples collected from
“low biomass” sites such as skin, mucosa, and amniotic fluid (312) have not been subjected to standardization by internal bacterial spike in. A spike-in would also be instrumental in providing information about the quality of sequencing in low-biomass samples.
Salinibacter ruber is a halophilic, motile, gram negative rod ubiquitously found in saltwater and is not abundantly found in the human microbiome (313, 314), however is sequenced and is available in databases. S. ruber had originally been used in a study done by Stammler et al. (315) in addition to non-commensal organisms such as
120 Rhizobium radiobacter and Alicyclobacillus acidiphilus. However, this study was utilized in normalizing taxa in 16S data, but it has been suggested that it could have a similar benefit in metagenomic shotgun sequencing (1). As MSS is not influenced by the 16S rRNA copy number (316), the use of multiple bacteria with varying copy numbers is not necessary. In this study, we utilize genomic DNA isolated from the halophile, Salinibacter ruber, to “spike” metagenomic samples for subsequent quantitation of absolute read abundance and demonstrate its utility in low yield samples such as the skin microbiome.
Salinibacter ruber was obtained and cultured according to protocols described by
Anton et al. (317) S. ruber genomic DNA was extracted using DNeasy UltraClean
Microbial Kit (Qiagen, Germantown, Maryland) using the manufacturer’s protocol. The concentration of S. ruber genomic DNA was determined using high sensitivity Qubit
(ThermoFischer Scientific, Waltham, Massachusetts) and then diluted with elution buffer
(Qiagen, Germantown, Maryland) to a fixed concentration of 0.01 ng/μL.
For skin metagenomic samples we DNA concentration was measured using
Qubit®. Prior to library amplification, 0.5 uL of S. ruber was added to library preparation at a final concentration of 0.01 ng/μL. Amplified library generation was performed with
Nextera XT® adapters, and sequencing was performed to obtain 150bp DNA paired-end reads to a depth of 2.5G base pairs per sample using an Illumina NextSeq500® machine in the Precision Metagenomics Laboratory at CCHMC. Raw sequence reads were extracted and demultiplexed using the Illumina program bcl2fastq. Raw reads were then filtered and trimmed for quality control using the program Sickle. Individual sequence reads were aligned to a custom database containing the genome sequences of > 40,000 bacteria, viruses, fungi, protozoa and the human genome. An exact sequence read match
121 of k-mer length 32 was used in Kraken (318) to assign reads to the lowest common ancestor then subjected to reassignment using the program Bracken (319). Normalization of count data to the lowest number of total reads mapped among the samples was performed using rrarefy with the Vegan package in R (320) to give the relative abundance at both the genus and species level (321). Absolute abundance of each microbe is calculated by comparing DNA abundance for each species to that of S. rubrum and adjusting for genome size, yielding the number of ‘genome equivalents’ per species in a patient sample (absolute abundance).
Initially we aimed to determine if S. ruber could be detected in various concentrations of stool sample, as stool metagenomic protocols have been established.
Salinibacter ruber genomic DNA at a fixed concentration of 0.01ng/μL, was added to a previously sequenced stool sample in the following concentrations: 0.5ng/μL, 0.2 ng/μL,
0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, 0.001 ng/μL, 0.0001 ng/μL (Figure 21). We observed that when the fecal sample at the lowest dilution of 0.0001ng/μL, the relative abundance of S. ruber is 100%. When the fecal sample DNA concentration was 0.2ng/μL the relative abundance of S. ruber was 0.80%. We demonstrate that in a concentration dependent manner, we can quantitate the amount of sample that is present.
Microbiome studies report organism abundance in relative rather than absolute terms, however relative abundance fails to capture the marked variability in overall organism abundance in a sample and therefore is only a surrogate marker for organism in a patient sample. We considered one sample from a highly contaminated catheter site in which Staphylococcus aureus accounts for 50% of a very high bacterial burden.
Another sample from recently cleaned skin may have very few detectable bacterial reads.
122 Yet if the clean sample contains 50% S. aureus, the two samples will be considered to have the same relative S. aureus composition when analyzed with existing approaches.
Since the absolute abundance of S. aureus is likely to contribute to risk of infection, we can adjust for ‘real’ microbial abundance using an internal control. Figure 22 demonstrates the marked differences in S. aureus abundance in two skin samples when relative versus absolute abundance is determined. Whereas typical analysis might suggest the two patients are at similar risk of infection due to S. aureus, absolute abundance determination suggests that Sample 2 would be associated with significantly higher infection risk.
In this study, we demonstrate an easy-to-use approach that provides a more accurate estimation of bacterial reads in metagenomic shotgun sequencing, which can be easily implemented in a low-biomass sequencing workflow. We also validate work done by Stammler et al. (315) in a metagenomic shotgun sequencing workflow with skin samples. There are many difficulties of sequencing the skin microbiome including that often these samples are low yield making it difficult to assess whether a microbial community is indeed from the skin. These samples are also highly prone to environmental or sampling contamination. Relative abundances would not be able to distinguish contamination from real sampling especially in low-biomass samples. We demonstrate that our spike-in method can accurately distinguish between contamination and a microbial community even in low level samples. Our method also serves as a diagnostic tool for sequencing runs of low quality. If library preparation was poor or unsuccessful, neither the S. ruber nor the samples should be detected in sequencing. However, if S. ruber is detected during sequencing but the sample was not, these findings would be
123 indicative of a collection or extraction failure. Overall, this study provides, an accessible approach to quantifying metagenomic sequencing data, that additionally serves as a diagnostic tool for avoiding contamination in low biomass samples.
124
Figure 21: Fecal samples spiked with dilutions of Salinibacter ruber allows for calculation of absolute read abundance. A previously sequenced fecal sample was diluted to 0.5ng/μL, 0.2 ng/μL, 0.1 ng/μL, 0.05 ng/μL, 0.01 ng/μL, 0.001 ng/μL, 0.0001 ng/μL Each concentration was then spiked with 0.01ng/μL of Salinibacter ruber genomic DNA. The addition of S. ruber allows for quantitation of abundance.
125
Figure 22. Application of Salinibacter ruber spike-in for absolute quantitation of bacterial abundance in metagenomic samples. Two skin swabs were subjected to metagenomic shotgun sequencing with S. ruber internal control. A) In the absence of S. ruber, both samples appear similar with an increased abundance of S. aureus. B) With S. ruber internal control, it becomes evident that Sample 1, has a lower abundance of S. aureus compared to Sample 2. C) The number of S. aureus genome copies was compared, demonstrating that Sample 2 has an increased amount S. aureus. S. ruber as an internal control can distinguish between low level contamination and low biomass samples.
126 Chapter 5: Using Metagenomic Analysis to Define the Role of the Human Microbiome in the MPAACH cohort
5.1 – Preliminary findings from the Characterization of the Skin Microbiome of MPAACH cohort 5.2 - Optimization of Metagenomic Shotgun Sequencing of Nasal Microbiome in Healthy Adult Controls
127 5.1 - Preliminary findings from the Characterization of the Skin Microbiome of MPAACH cohort
Tammy Gonzalez1,2, Asel Baatrebek-kyzy3, John W. Kroner3, Olivia Milburn4 Hua He5, Lisa J.
Martin, PhD1,5, David Haslam, MD1,4, Jocelyn M. Biagini Myers, PhD1,3, Gurjit K. Khurana Hershey,
MD, PhD1,3, Andrew B. Herr, PhD1,2,4
1 Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio
2 Division of Immunobiology, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio
3 Division of Asthma Research, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio
4 Division of Infectious Diseases, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio
5 Division of Human Genetics, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio
TG – DNA Extraction, Library Preparation, QC, and Sequencing, Creation of Figures ABK – Collection of Samples JK – Data Management, Demographic data HH, LM – Demographic Data OM – Library Preparation and Sequencing DH – Sequencing, Sequence Alignment, Data Analysis DH, JBM, ABH and GKH – Study design
128 We have established along with others (189, 322-324) the contribution of S. aureus in AD pathogenesis. In Chapter 2, we utilized contact plates to collect live organisms from the skin of MPAACH children, thereby limiting our collection to culturable organisms.
Detection of unculturable organisms is best achieved using our tape stripping technique described in Chapter 3, to perform MSS analysis to better understand the microbial communities that may define AD endotypes in an unbiased manner. The objective of this study is to explore shifts in the microbiome that are associated with clinical outcomes of
AD and identify particular organisms that distinguish between these endotypes.
Forty-four children were selected from the MPAACH cohort (See Appendices) were randomly selected using a random number generator. Of the 44 children, 59% were self-reported as black, and 52% were male. The median age of this subset of children was 2.41 years old. Fourty-three percent (19/44) of these children had a SCORAD of greater than 25 classifying them as those with severe AD. Children who were non- sensitized (20/44) to allergens defined nearly half of our population. While 45% of children
(20/44) were sensitized to food allergens, only 7 (16%) of children were sensitized to food allergens alone and the other 13 children (30%) were sensitized to both food and aeroallergens. Those who were sensitized to aeroallergens only consisted of four children
(9%). The subjects analyzed in this pilot study will be compared with the overall MPAACH cohort to ensure that the samples are representative.
There was no significant difference detected in the Shannon Diversity Index in those with Mild AD when compared to those with mod-severe AD. Unsupervised principal coordinate analysis comparing species abundance detected no statistically significant differences between severity groupings. These data demonstrate that skin microbial
129 diversity and composition are not dependent on AD severity in non-lesional and lesional skin.
Species more abundant in children with moderate-severe AD include
Staphylococcus species and Corynebacterium species with the most differentially abundant species being the Staphylococcal species HMSC062B11 and Staphylococcus xylosus. Corynebacterium species are also represented amongst species that were differentially abundant in those with moderate-severe AD (Figure 23a). The predominant shifts in differentially abundant species are seen in the lesional skin of those with moderate to severe AD as seen in Figure 23b-j.
Although these findings are preliminary, we have found no statistically significant differences between children with mild disease compared to moderate-severe disease in either microbial diversity or composition. These findings were unexpected as it has been reported (282) that there is often a decrease in overall diversity as subjects become more severe. The sample size may be a limitation to our pilot study, and with this data, sample size estimates will be generated to ensure that this study is powered. We have also selected for the species that differ between the mild and moderate-severe groupings.
Interestingly, the predominant species that differ between the groups are Staphylococcus species and Corynebacterium species. Upon analysis of the differentially abundant species, the increase in abundance among most of the species was in the lesional skin of those with high SCORAD.
130
Table 5: Subject Demographics and Clinical Characteristics n 44 Black (%) 59.09% (26/44) Age (Median) 2.41 Male (%) 52.27% (23/44) Severe AD (SCORAD >25) (%) 43.18% (19/44)
131 Figure 23: Skin Microbial Diversity and Composition are not dependent on AD severity in both non-lesional and lesional skin. A) Shannon diversity index was used to measure species diversity between non- lesional and lesional skin of those with mild and moderate-severe AD. There is no statistically significant difference in species diversity between groups. B) Microbial composition was measured by PCA plot in which distances were based on log scale of counts aligning to species.
132 Figure 24: Staphylococcus and Corynebacterium species are more abundant in lesional skin in children with moderate-severe AD. A) Tornado plot shows species that are differentially abundant in children with mild-AD and moderate-severe AD. B) The species that are most differentially abundant in moderate-severe AD are shown in box and whisker plots.
133 5.2 - Optimization of Metagenomic Shotgun Sequencing of Nasal Microbiome in Healthy Adult Controls
Contributors: Tammy Gonzalez, Asel Baatyrbek-kzky, Olivia Milburn, Andrew Herr, Liza Murrison, David Haslam, Gurjit Khurana Hershey
TG – DNA Extraction, Library Preparation, QC, and Sequencing, Creation of Figures LM, AH, and GKH – Study design ABK – Collection of Samples OM – Library Preparation and Sequencing DH – Sequencing, Sequence Alignment, Data Analysis
134 Introduction
Cutibacterium acnes and Staphylococcus epidermidis are predominant species not only in the skin but also in the anterior nares (325) with S. epidermidis being detected in over 90% of nares samples. Dysbiosis can also occur in the nasal biome as it does in the skin. Bacterial species in the nares are implicated in preventing respiratory viral infection (326), such as respiratory syncytial virus (327) and rhinovirus. These viruses are associated with wheezing disorders in young children, which could predispose to allergic rhinitis (AR) or asthma later in life (328). Up to half of the children with AD will develop
AR (329). Studies have shown that children with AR despite the presence of wheeze had decreased abundance of Corynebacteriaceae in the nose suggesting that these species may also provide protection against respiratory pathogens (328). Chronic rhinosinusitis
(CRS) also presents with shifts in the nasal microbiome with up to 80% of individuals with
CRS being colonized with S. aureus or Pseudomonas aeruginosa. In addition, bacterial biofilms have been observed on sinonasal mucosal surfaces, paralleling S. aureus biofilm formation on the skin and potential contributions to AD (330, 331).
The relationship between the nasal cavity and the skin is not well understood but may be crucial to understanding the transfer of organisms that influence homeostasis provided by the skin microbiome. This study was intended to optimize a technique in which we could survey the nasal microbiome using metagenomic shotgun sequencing in healthy adult controls and in MPAACH children to make associations with clinical outcomes.
135
Methods
Nasal Swab Collection
PurFlock Ultra swabs were used within 30 seconds of opening. The nares were swabbed with 5-6 gentle circles with one swab entering each nostril. Swabs were then placed in buffer solution and swabs were pressed against the walls of the tube for less than 10 seconds and the sample was kept on ice. Once the swabs are placed in the buffer that tube is flicked to mix. Samples were then flash-frozen for 2-5 minutes or the solution is frozen.
Library prep and Sequencing
Amplified library generation was performed with Nextera XT® adapters, and sequencing was performed to obtain 150bp DNA paired-end reads to a depth of 2.5G base pairs per sample using an Illumina NextSeq500® machine in the Precision
Metagenomics Laboratory at CCHMC. Raw sequence reads were extracted and demultiplexed using the Illumina program bcl2fastq. Raw reads were then filtered and trimmed for quality control using the program Sickle. Individual sequence reads were aligned to a custom database containing the genome sequences of > 40,000 bacteria, viruses, fungi, protozoa and the human genome. An exact sequence read match of k-mer length 32 was used in Kraken (318) to assign reads to the lowest common ancestor then subjected to reassignment using the program Bracken (319). Normalization of count data to the lowest number of total reads mapped among the samples was performed using rrarefy with the Vegan package in R (320) to give the relative abundance at both the genus and species level (321).
136 Results
Metagenomic Shotgun Sequencing (1) of nasal swabs collected from 8 individuals are represented by bubble plots. Each bubble represents an individual species with the size of the bubble representing the relative abundance of each individual species per sample. MSS reveals a significant portion of reads were mapped to human DNA in healthy individuals (Dark Blue), suggesting that most of the cells recovered were either skin or nasal epithelium. Low levels of the ‘spike-in’ S. ruber standard (described in Chapter 3), suggest library preparation and subsequent sequencing were free from contamination.
Salinibacter ruber is the predominant organism in the negative control, suggesting the sequencing run was not contaminated by collection methods or the sterility of the swab was not compromised (Figure 25).
One healthy individual was sampled at two separate occasions, followed by a negative control (sterile swab in saline). In the first panel (Top Left) the Human DNA between the two different time points is similar (97.84% and 97.35%). In the Top Right panel, the S. ruber internal standard is higher (55.88%) in second measuring suggesting that there is relatively less sample DNA. The microbial ecology at both time points demonstrate that there are few differences in individual species recovered, however the relative abundance of individual species differs amongst the two time points. The presence of Cutibacterium acnes and Staphylococcus aureus, in the sample collected from the second time point are more prevalent when compared to the first sampling. Other bacterial organisms such as Epichloe aotearoae, Penicillium biforme, and Taxomyces andreanae may also be a part of the nasal biome (Figure 26).
137
Figure 25: Bubble Plots of Healthy Control Nasal Swabs and Negative Control. Bubble plots demonstrate that the majority of reads from nasal swabs map to the human genome, suggesting nasal swab collection mostly picks up human DNA. The swab alone negative control is predominantly S. ruber demonstrating that the sterile swabs carry little contamination to the sample.
138 Figure 26. Swab collection captures intra-individual changes in nasal microbiome. Swabs were collected from one individual at two timepoints a week apart. MSS compared the microbial ecology of the two timepoints and a sterile swab negative control. Microbial ecology between the two timepoints were similar except for the presence of C. acnes and S. aureus, demonstrating the sensitivity of MSS in picking up intra-individual changes in the nasal microbiome.
139 Discussion
While this study is at its inception, nasal swab collection and sequencing was optimized to minimize contamination. The relatively low amounts of S. ruber standard in healthy adult samples but high levels in negative controls provide evidence that library preparation and sequencing were not contaminated by collection methods. When we compare nasal swabs taken from the same individual at different time points, we observed a difference in the presence of C. acnes and S. aureus. These findings may be suggestive of contamination of skin microbiome along with nasal biome, as these are typically found on the skin. However, as we know that both organisms can form biofilms, it also may be possible that differences in pressure applied during collection selected for organisms with adherent properties.
There are differences between the anterior nares and the middle meatus of the nose, possibly due to location and their lining containing different epithelia (332). Limited studies have not shown a meaningful difference in various parts of the nose; however, the secretion of sebum in the anterior nares could affect the microbial composition or diversity
(333). The microbiome of the anterior nares has been shown to include the genera
Staphyloccus, Propionibacterium (now Cutibacterium), Corynebacterium, and Moraxella
(334), which is consistent with our findings. However, it is crucial to standardize collection procedures to avoid sampling of other parts of the nasal cavity. To complicate this further, one of the difficulties in executing a survey of the nasal microbiome in MPAACH children, is the sampling of small children. Many swabs are too large to insert into a baby’s nostrils, and with younger infants, movement may lead to swabbing of skin instead of nares. This
140 may bias results, given that Staphylococcus and Corynebacterium species colonize both skin and nares (335).
The optimization of the nasal biome metagenomic sequencing protocol allows for the survey of the nasal biome in MPAACH cohort across time, and ultimately associations with respiratory outcomes such as presence of viral URI, wheezing, spirometry measurements, or use of inhaled corticosteroids. The nasal microbiome can also be compared to the skin microbiome to determine if any species or strain similarity exists between the two groups, as it may provide insight into the crosstalk between carrier states in the nose and skin colonization and infection. In combination with metagenomic analysis to study microbial communities in the nose, it may be beneficial to also assess isolates using culture-based methods to assist with functional analysis. Whole-genome sequencing of nasal isolates can also provide data for phylogenetic analysis and downstream functional assays.
141 Chapter 6: Future Studies
This chapter will focus on the potential avenues for future research specifically in
MPAACH children but the ideas here can also be broadly applied to other pediatric allergic cohort studies. Current management and treatment strategies pertinent to this work will also be discussed, in addition to insights into potential novel strategies for AD management.
Assessing Durability of Phenotypes in MPAACH Cohort
The Mechanisms of Progression of Atopic Dermatitis to Asthma in Children
(MPAACH) cohort is the first US based AD cohort designed to provide valuable insight into the various contributors delineating the endotypes observed in AD. In the first large- scale analysis of S. aureus colonization, we have shown that S. aureus colonization is related to both AD severity and a dysfunctional skin barrier in concordance with what was previously published (33, 151, 336, 337); this is the first study demonstrating that the increased biofilm propensity of S. aureus isolates is associated with increases in AD severity and decreases in skin barrier function (Chapter 2).The Report from the National
Institute of Allergy and Infectious Disease workshop on atopic dermatitis and the atopic march: Mechanisms and interventions defined objectives to “determine optimal approaches and time points for studying the infant gut, skin, and airway microbiome” and to “determine whether microbiome shifts are a cause or consequence of AD” (338).
The MPAACH cohort was uniquely designed to assess the pathogenesis of AD in various contexts over many time points. While the original proposal was intended to survey and sample these children over five years, there is tremendous potential to survey beyond five years of age. This cohort has allowed for assessment of many clinical and
142 biologic markers of disease, particularly in the skin. As these children develop extra- epiderma atopic conditions, such as food allergy, allergic rhinitis, and asthma, the amount of rich data will only expand. Microbiome studies alone tend to be data-rich and associations with clinical data add an extra layer of complexity yet provide valuable information for defining new endotypes in pediatric allergic disease and progression. The benefits and precautions to assessing durability in the skin microbiome are discussed below.
Few studies have longitudinally assessed the skin microbiome of children with AD
(47, 125, 126). These studies have demonstrated how the skin microbiome may play a role in onset of disease, as they have shown that children colonized with commensal
CoNS staphylococcal species were shown to have a decreased incidence of AD at one year (47), while the presence of S. aureus was associated with an increased risk of development of AD (281). However, it is unclear if colonization rates of S. aureus or skin commensals contribute to the differently to different endotypes of AD. Metagenomic analysis is providing insights into the variability that can occur within individuals, to the extent that even minor taxa can be used to identify individuals (339).
We have currently begun assessing the persistence of S. aureus in MPAACH children by looking at colonization rates at visit 1 and 2. Sequencing approaches complement traditional culture techniques by providing more detail into how the skin microbial community shifts over time. Preliminary analysis will include measurement of species diversity between visit 1 and visit 2 by Shannon diversity index. Based on previous studies, we predict that species diversity will decrease in lesional skin of both visit 1 and visit 2 (125). A measurement of microbial composition, or the extent of change
143 in a community, between visit 1 and visit 2 will be done using PCA plot. Due to the majority of longitudinal studies of the skin microbiome sampling at intervals no longer than 28 weeks (47, 340-343), we do predict to see differences in the microbial communities over time. Individual species that differ between visit 1 and visit 2 will be of great importance, as the abundance of these differentially increased or decreased species can be associated with clinical outcomes.
The link between S. aureus and AD severity is well established (344-347), however these findings may be confounded by allergen sensitization. IgE sensitivity is central to allergic disease and provides a metric for progression through the atopic march, yet S. aureus can induce an IgE response in those with AD (132). Sensitization in MPAACH children is assessed using total IgE, skin prick testing (SPT), and parent-reported allergy.
Self-reported allergy is not always reflective of actual sensitization, making IgE the preferred measurement of allergen sensitization (348). IgE levels are measured from
MPAACH children in addition to sensitization profiles generated using skin prick test against 13 food allergens and 11 aeroallergens. Particular organisms are implicated in inducing IgE production, contributing to progression through the atopic march. While this captures most sensitizations, use of an extended panel could provide insight into the sensitization to infectious organisms as well. However, allergen testing is limited to the most frequent inhalant allergens, leaving many allergens untested. Other cohort studies have classified subjects as non-atopic using limited allergen testing. When the same subjects were tested using an extended allergen panel, with over half were sensitized to the allergens on the extended panel which included bacterial antigens such as SEA or
SEB. These data suggest that S. aureus toxins may be inhaled and act as an
144 aeroallergen, given that 19.3% of patients sensitized to SEB were also sensitized to house dust mite, a known inhaled aeroallergen (349). It would be interesting to assess how the abundance of S. aureus is associated with levels of specific IgE to an extended panel of allergens that includes bacterial allergens.
145 Functional analysis of MPAACH bacterial isolates
Data provided from MSS analysis will inform which species we choose to further pursue in live-bacteria in vitro or in vivo experiments. Throughout the course of my thesis work, we have created a biorepository for various bacterial isolates collected from non- lesional and lesional sites on MPAACH children. As described in Chapter 1, S. aureus can behave as a commensal organism or as a pathogen. While the majority is focused on S. aureus as a pathogen, less is known about how S. aureus achieves commensalism with the host. S. aureus taken from individuals with AD who were consistently colonized, had genes encoding toxins, adhesins, clumping factor, and more interestingly variants in metabolic genes (350). In chapter 2, we demonstrate that there is significant functional strain diversity in biofilm diversity and more work needs to be done to identify how these strains functionally differ.
Whole genome sequencing (WGS) is a way to do comparable analysis amongst
MPAACH bacterial isolates and perform in-vitro functional analysis of such strains in a high throughput manner. We have performed WGS on 108 strains of S. aureus collected from the MPAACH cohort, and plan to use WGS to also characterize the CoNS species isolated from these children. Initially we would like to assess the strains of S. aureus and
S. epidermidis for the presence of genes that are associated with biofilm formation such as aap and sasg, and associate the presence of these genes with clinical outcomes such as severity, barrier dysfunction, or sensitization profiles. Based on our findings that S. aureus biofilm propensity is associated with increased severity, we predict that biofilm genes are present in strains isolated from children with more severe AD.
146 “-OMICS” of MPAACH
Organisms do not reside in niches of the human body individually or only interact with same species. Reconciling the functional analysis obtained from studying individual organisms with analysis of microbial communities is necessary to address complex interactions between the host and the microbiome. Sequencing-based approaches have limited bias from microbial community analysis; however, microbiome research requires standardization within studies to limit bias. In Chapter 3, we demonstrate our tape- stripping technique in healthy adults and MPAACH children, and in Chapter 4, we provide a method to account for and minimize contamination within our skin samples. The focus of the work in Chapter 2 was limited by the use of culture-based methods to assess the role of S. aureus and S. epidermidis, and we have validated the findings of others (8) demonstrating the presence of S. aureus being associated with severity. However, it is well understood that changes in microbial diversity and ecology cannot be measured with traditional techniques. We have begun to assess the skin microbiome in MPAACH children using sequencing techniques particularly, metagenomic shotgun sequencing. In
Chapter 5, we highlight several ongoing studies focused on characterizing the nasal and skin microbiomes in the MPAACH cohort. Below we highlight several potential future directions for the field of microbiome research in the MPAACH cohort and other AD cohort studies.
Depth Study S. aureus has been shown to cause inflammation and induce proinflammatory cytokines from keratinocytes (244). The skin microbiome has been shown to not solely reside in the upper layers of the stratum cornuem, there is evidence to show that bacteria
147 can even be found in the dermis (351). Nakatsuji et al show that there is significant dysbiosis of the skin microbiome not only in the epidermidis but also in the dermis in adult skin biopsies; these data were replicated with human skin equivalents (35). In mouse models with a functional loss of FLG, they show that with a decrease in barrier function the see enhancement of S. aureus penetration. They also demonstrate that the addition of OVA sensitization, the S. aureus was increased in the epidermis, dermis and adipose tissue compared to those sensitized with PBS. Lastly, they show that the penetration of
S. aureus into the dermis led to the induction of inflammatory cytokines in all 3 compartments of the skin, with notable cytokines being IL-4, IL-13, and TSLP. This study was predominantly done in mice; however, in MPAACH we possess the specimens to assess this phenomenon in pediatric subjects at least through the stratum corneum.
In the preliminary data provided in Chapter 3, we aimed to determine if there were differences in the skin microbiome between tapes. Tape strips collected from children from the MPAACH cohort were used to collect microbial genomic DNA which was subsequently used for metagenomic shotgun sequencing. The pilot data consisted of one healthy adult control and 3 MPAACH children and demonstrated that there are statistically significant differences between Tape 1 and Tape 7. For continuation of this study, we have tape strip 1 sequenced in several MPAACH children, and the future studies will include the sequencing of tape strip 7 in the same participants. With the raw abundances obtained from each sample, non-lesional and lesional sites will be individually analyzed to determine if there is a statistical difference between tape strip 1 and tape strip 7. It will also be important to note differences in microbial diversity using a Shannon index
148 between tape strip 1 and tape strip 7 as well as PCA analysis to see high-dimensional changes between tapes.
Based on the differences previously described in lesional skin and during active AD flaring, we predict that the lesional skin will show marked differences between tape strip
1 and tape strip 7. Based on previous work in mice (46) Gallo et al. also predict the depth of S. aureus to increase in those with higher AD severity and in lesional skin. Potential limitations are the lack of samples to assess gene expression at similar levels at which the metagenomic tapes are taken. Gene expression at these various levels would provide a metric location within the epidermal layer. More recently Bay et al (352) observed the preservation of specific species in the dermis, while the species in the epidermis are described as highly dependent on environment, site, and immune profile (8, 353). Dermal sampling was performed using skin biopsy, making this analysis difficult to perform in children of this age, however the dermal microbiome should be assessed by skin biopsy in older children and in adults and associated with clinical phenotypes.
It is well-established that strains of S. aureus differ in virulence and can vary functionally dependent on site (125) and virulence factors can contribute to deeper migration into the epidermis and dermis (354). In the MPAACH cohort, we have not performed site-specific analysis on staphylococcal presence or determined the differences between S. aureus present in non-lesional sites or lesional sites. Furthermore, the assessment of the microbial communities that reside on the skin using metagenomics and sequencing approaches are limited in that they do not provide information about metabolites or gene expression. Host genetics, environmental exposures, and body site can potentially affect the organism’s behavior on the skin especially at various levels of
149 the stratum corneum in MPAACH children. While functional analysis of organisms can determine the presence of a virulence factor, transcriptomics of the microbiome would support and bolster metagenomic approaches by measuring the level of gene expression in S. aureus in various individuals, and different strains within the same individual.
150 Single Cell Metagenomics A recently developed approach combining the most advantageous facets of metagenomics and whole genome sequencing is known as Single Cell Metagenomics, in which there is isolation of single cells from environmental samples using serial dilution, microfluidics, or flow cytometry, which are then fully sequenced. The goal of this technique is to improve efficiency and accuracy of sequencing by obtaining whole genome information from complex microbial communities. From a large population of organisms, one can study the microbial community and diversity, and with the same data, metabolic functions from specific species can be linked to investigate genome rearrangement, insertion, duplication, intra-species variation, and viral-host interaction that is not feasible with traditional culture techniques. This technique would allow for more efficient sequencing of MPAACH samples taken from various microbiomes. Based on different phenotypes, the microbial ecology could be determined and depending on those species that distinguished between phenotypes those specific species could be analyzed based on function.
The ideal sample for this type of analysis would be a skin biopsy or skin scraping to obtain capture organisms as they interact with keratinocytes. Taping may become an obstacle to this analysis as removal of the tape may be biased towards organisms that are less adherent to keratinocytes. However, as mentioned in Chapter 3, the sampling the skin of children via skin biopsy is invasive and leads to scarring. Healthy older children and adults and those with AD, who consented to skin biopsy, could be compared for not only microbial community measures such as Shannon Diversity or Principle Component
Analysis but for the presence of virulence genes and phylogenetic ancestry. For example,
151 this would be useful in assessing the composition of skin biofilms, as well as those strains that excel at initiating and propagating biofilm formation.
As this technique is a new frontier for sequencing technologies, the protocol continues to be challenging and time consuming. The addition of sorting to an already sensitive technique increases the risk for contamination. Contamination can occur at the cell-sorting step, in addition to reagents and equipment. Chimeric reads are also prominent with this technique and uneven genome coverage is caused by stochastic primer binding which leads to preferential amplification of genomic regions. However, this technique, once mastered, provides cost-efficient and valuable information about whole microbial communities in addition to functional analysis.
Applying this technology to MPAACH would provide a more direct translation between individual isolates and microbial communities. Currently, we determine the contributions of individual isolates using whole genome analysis or culture-based techniques. However, the agreement between metagnomic analysis and the techniques that survey individual isolates and their functions is unclear. The ability to perform single cell metagenomics on an MPAACH sample and gain a high-level view of the microbial community and also focus in on individual organisms within that community would eliminate some of the inferences about agreement and consistency in sampling that we are making between techniques.
152 Mycome and Virome
One particular goal from the NIAID workshop on “Atopic dermatitis and the atopic march: Mechanisms and Interventions' is to study the various microbiomes and “... such studies should include examination of the mycome and virome” (338). My work has focused on the study of the bacterial microorganisms residing on the skin using both live- culture and sequencing approaches, however bacterial organisms do not exist in isolation.
Studies on the skin mycome are limited, but the healthy skin mycome has recently been characterized (57). These fungi typically colonizing oily sites, such as skin folds during puberty and healthy individuals have Malassezia-specific T cells and antibody responses (355). The presence of antigens from yeast, Candida albicans, was one of the first associations with the presence of AD as those with AD were more likely to have
Candida specific IgE and subsequent Th2 polarization (356, 357). With the advent of sequencing approaches, assessment of the mycome has become more feasible. Several studies reveal the presence of Malassezia-specific IgE (57, 358) and the presence of
Malassezia specific IgE was correlated with increasing severity of AD in adults, but not in children. Various antigens from Malasseiza species can induce autoreactive T cells and induce further inflammation independent of these fungal antigens (359). Exposure to
Malassezia leads to colonization of the stratum corneum of mice, subsequent myelocytic infiltration, and induction of IL-17 that was crucial to controlling fungal burden. However with the presence of Malassezia on a disrupted skin barrier induced inflammation, and IL-
17 deficient mice showed a diminished inflammatory response and overgrowth of
Malassezia (360).
153 With the understanding that particular Malassezia species play a protective role as opposed to others that are more pathogenic, it became increasingly important to not only limit our scope to bacterial organisms. Through the creation of the MPAACH biorepository, we have collected potential fungal organisms have been banked but not identified. Whole genome analysis in addition to the metagenome analysis will identify these organisms and determine the phylogenetic similarities in fungus across the
Cincinnati metro area. Like S. aureus, fungal specific IgE can be measured in MPAACH children to further assess if these fungal organisms contribute to IgE production.
Viruses are obligate intracellular parasites incapable of metabolism and utilize cell machinery to replicate. Some viruses expand after replicating and lyse the cells and are classified as lytic, where others insert viral DNA into the host genome and are considered lysogenic. Viruses, like the microbiome, are niche specific and have been shown to inhabit what was once considered a sterile environment (58, 361).
Children with AD are not only prone to bacterial infection but also suceptible to viral infection, although less common. The most common viral infection in children with
AD is Herpes Simplex Virus (HSV) and is termed Eczematicum herpeticum (EH). The manifestations of EH can range from fever and malaise to more life-threatening conditions such as encephalitis or septic shock and is recurrent in up to 25% of cases (362). Viral infections are much more likely in those (355) with severe AD with atopic comorbidities, and interestingly occur concurrently with S. aureus infection and is often restricted to lesional sites (362), Ong 2017). The extensive role of S. aureus alpha-toxin in HSV infection is well established, as alpha-toxin aids in HSV replication by binding to keratinocyte receptors (Bin 2012, Wilke 2015). Th2 cytokine skewing was observed in
154 those with EH including increased IL-4 and decreased IFN-gamma positive CD-8 T cells
(363), and surprisingly prior treatment of AD with topical corticosteroids did not prevent subsequent EH and IFN-gamma therapy did not result in improvement of symptoms
(362).
In addition to HSV, several other viral infections are more common in those with
AD. Molluscum contagiosum is a DNA virus of the poxviridae family and a common childhood viral infection. While molluscum is usually self-limiting, those with AD experience prolonged infection with a more widespread distribution (364). Skin barrier defects, such as FLG mutations, predispose to molluscum infection and pruritus promotes autoinoculation (365, 366). In addition, those with AD who have received smallpox vaccination are at risk of development of eczema vaccinatum, characterized by a dissemination of the vaccinia virus that if systemic is lethal (367, 368). Although the smallpox vaccine is no longer administered to the general public, the vaccine is distributed to laboratory professionals at risk of handling vaccinia viruses (replication competent or recombinant) or other orthopoxviruses capable of infecting humans (369). The predisposition of those with AD to the vaccinia virus continues to generate interest and studies are ongoing to produce a modified vaccine for those with AD, in the case that a smallpox outbreak was to occur. Data suggests that FLG plays a role in preventing
Vaccinia infection, as FLG deficient mice suffered from disseminated Vaccinia infection
(370). In addition, Th2 cytokines such as IL-4, TSLP, and IL-33 promote replication of the vaccinia virus in mice (371, 372). Alternatives to the current smallpox vaccine are needed to avoid effects in those with AD. Imvamune, a vaccine using a modified Vaccinia Ankara
155 virus, has shown to be safe in healthy adults and in those with mild-moderate AD and elicits a specific immune response (373).
Considering the additional predisposition of viral infection in those with AD and the goals set forth by the NIAID, viral contributions to AD pathogenesis should not be ignored.
Surveys of the human skin virome are limited in healthy skin despite that viruses greatly outnumber bacterial and fungal species (374). Skin virome studies have also not been done in those with AD. However, the study of the virome is a unique challenge as viruses do not contain homologous regions that distinguish various groups as done in metagenomic analysis (374). Technical considerations need to also be made as virome library preparation is more complicated. Initially, there is an enrichment of viral particles
(375). Viruses also can house two separate types of genetic material, DNA and RNA, which require two different protocols for library preparation. An additional step of retrotranscription of the viral RNA is necessary before amplification. Viral DNA or complimentary DNA generated from viral RNA is then amplified and exogenous unencapsulated DNA and RNA is removed. The samples are then subjected to whole genome shotgun sequencing. As mentioned previously, there is no universal genetic marker to target as they have no structures that are derived from common ancestors. As viral sequencing relies on whole-genome sequencing methodologies, there may be bias toward specific viruses varying on extraction and library preparation techniques and is susceptible to lingering DNA or RNA from host cells. In addition, working with viral taxonomy is a massive computational undertaking.
Bacteria are also susceptible to infection by viruses. Bacteriophages are viruses that infect bacteria and have evolved with the infected species (376). Viruses can mediate
156 regulation of bacterial populations killing organisms and ultimately preventing overpopulation (58, 377). Microbial dysbiosis is a characteristic finding in atopic dermatitis and there is benefit in exploring the bacterial-viral interactions. For example, lysogenic bacteriophages could affect microbial dysbiosis by targeting and lysing one species or strain over another. Furthermore, phages were originally thought to be species or even strain specific, however studies are providing evidence that phages can be genus specific. A survey of the bacteriophages that are differentially abundant in those with psoriasis when compared to healthy controls, also demonstrated that there are differences in the bacterial communities that are targeted by their respective phages
(378). A recent study has shown that a combination of bacteriophages and antibiotics exhibited a synergistic effect against S. aureus and Pseudomonas aeruginosa polymicrobial biofilms (379). Studies surveying the bacteriophages in the skin are limited
(380, 381) but is necessary as therapeutics could be designed with phage to target pathogenic bacteria in AD or simulate the mechanisms of these bacteriophages in order to reduce pathogenic organisms.
The MPAACH cohort is a milder AD cohort and viral superinfection may not be as common in this group of children. However, analysis of the virome would still be useful as this has not been described in mild disease. Following the virome longitudinally in a subset of children would also provide insight into the stability of the virome especially during active flares and periods of remission. Initial analysis would be entirely descriptive focusing on viral diversity and composition as this would be the first report of the virome in AD skin. Samples should include various body sites and should be compared to healthy age-matched healthy controls. Viral infections manifested in those with AD are typically
157 restricted to those who are most severe (27, 363, 382). However, in addition to presence of pathogenic viruses, we also may see loss of commensal viruses prior to increases in severity. We and others have shown that pathogenic bacteria in planktonic and biofilms
(Chapter 2) are associated with decreases in barrier function (354, 383-385). It would also be important to understand if increased presence of pathogenic viruses is associated with decreases in barrier function. This study is ultimately going to be limited by feasibility as the extraction, library preparation, and sequencing steps are more labor-intensive than bacterial sequencing preparations.
158 Clinical Implications
Treatment Strategies
Treatment of AD focuses on preventing or reducing bacterial colonization in lesions and controlling inflammation using moisturizers and topical corticosteroids (14).
Emollients are typically first-line therapy for AD and significantly reduces the need for pharmaceutical interventions (AAD 2014 guidelines) and greatly reduces AD severity
(386-388). With administration of emollients, bacterial species diversity increases (388) and the detection of S. aureus was decreased in lesional skin (389). The self-reported use of emollients has been a limitation to the MPAACH study. Despite our instruction to discontinue emollients prior 24 hour to the visit, the concomitant use of emollients could influence every biospecimen collected from the participant. Thorough documentation of emollients used could be valuable in the MPAACH study as it may have an impact on microbiome studies.
The advantage to using emollients is that they provide an excellent vehicle for various therapies and understanding the role of the skin microbiome in allergic disease, presents unique opportunities for targeted therapies to be combined with the standard emollient therapy. As described earlier, AMPs are key to preventing S. aureus colonization(60-62,
128, 390) and commensal strains that produce protective AMPs have been shown to decrease S. aureus colonization when compared to vehicle alone (67). Human keratinocyte AMPs can also treat biofilms as LL-37 was able to eradicate pre-existing
MRSA biofilms in a wounded skin model without compromising keratinocyte function
(155, 391). Other studies (67) describe the application of emollients with Sh-lantibiotics to subjects with AD and were able to minimize the amount of detectable S. aureus from
159 the skin, however, additional in vivo studies are needed to determine if replenishing
AMPs is an effective treatment option long term.
We have discovered the association between strains of S. aureus with increased biofilm propensity and AD severity (Chapter 2) and the importance of antimicrobial peptides in skin microbiome homeostasis and in prevention of biofilm formation is established in previous literature (154, 259, 390, 391). Those with AD have decreased antimicrobial peptide secretion from both keratinocytes and commensal organisms, making AMP replacement therapy a promising approach to not only reducing pathogen colonization but also biofilm formation. Strains of S. epidermidis isolated from healthy individuals are capable of limiting S. aureus biofilm formation and partially limit pre- established biofilms (392). Individual AMPs were also shown to reduce MRSA biofilms in vitro experiments and should be explored further by treating biofilms on epidermal models with AMPs (393).
An alternative to utilizing AMPs or other secretory products from commensals is transplanting whole organisms taken from healthy human individuals to the skin of mice with induced AD to re-establish a balanced microbiome (394). Gram-negative commensals such as. Roseomonas mucosa, isolated from healthy individuals were shown to inhibit S. aureus growth in vitro. Promising studies utilizing R. mucosa strains from healthy volunteers transplanted onto the skin of mice, and showed decreased colonization of S. aureus, along with improved transepithelial water loss measurements and decreased edema in the ears (394). In future studies, it will be interesting to assess the overall contribution of transplanted individual species or even particular strains on AD
160 outcomes. These methods can also be applied to other organisms such as S. epidermidis or other commensal staphylococcal species.
As allergic disease is becoming more prevalent in industrialized countries with improving hygiene, the Hygiene hypothesis suggests that the lack of infection leads to aberrant responses that lead to atopy. OM-85 (BronchoVaxon), a mixed lyophilized bacterial lysate, was designed to mimic infection and tilt the immunologic scales away from Th2 polarization (395). OM-85 was originally designed to be taken orally and was shown to decrease the incidence of viral infection but is now being study as an additive to emollient therapy (396, 397). A placebo controlled RCT demonstrated that OM-85 therapy provided 20% protection to AD flares when compared to the emollient only group.
Future studies will be necessary to determine which therapies could benefit most from combination with adjuvant therapy, or which subpopulations respond best to adjuvant therapy (398). Isolates obtained from children in the MPAACH cohort can be utilized to create potential therapeutics that can be used in an emollient vehicle. Whole commensal organisms can be used for transplant into mice with assessment of improved severity or barrier functions. Alternatives are using secretory products from commensal organisms such as S. epidermidis or S. hominis or creating bacterial lysates to as immunomodulatory therapies.
Currently, the only recommendation for treatment of staphylococcal colonization is bleach baths and intranasal mupirocin for nasal carriage of S. aureus (399, 400). Topical or oral antibiotics are not recommended unless a lesion becomes infected (AAD recommendations). Bleach baths are used to reduce bacterial load present on the skin, and recently these have been shown to inhibit S. aureus biofilm formation and reverse
161 pre-formed S. aureus biofilms (400). However, when experiments were repeated on skin biopsies from patients with AD, a 0.16% sodium hypochlorite solution was needed to eradicate 90% of the bacteria present on the biopsy, whereas only 0.005–0.01% sodium hypochlorite solutions were tested on keratinocytes for toxicity (400). Further studies will be needed to assess the effects of higher amounts of sodium hypochlorite on keratinocytes, and to explore the possibility of recurrence of bacterial colonization.
Biologic therapies are often reserved for severe AD and established therapies target downstream cytokines strongly associated with atopy. These therapies are clinically efficacious but can also be useful in understanding the “chicken-or-egg” question if the microbiome precedes atopy or if atopy predisposes to pathogen colonization.
IL-4 and IL-13 are central to the Th2 and atopic responses and have provided a logical approach to modulating this aberrant pathology. These cytokines in turn impact the skin microbiome as they suppress keratinocyte-derived AMPs weakening overall healthy microbial defenses. In addition to decreased protection from pathogens, IL-4 and
IL-13 increase the efficacy of S. aureus alpha-toxin, ultimately perpetuating cell death
(401). Dupilumab is a human monoclonal antibody that serves a dual purpose by interacting with both IL-4 and Il-13 receptors. Dupilimab is recommended for those 12yo and older who have recalcitrant AD. The AD-LIBERTY EXPLORE study included 54 subjects with moderate-severe AD who were randomized to weekly treatments of dupilumab or control groups and were subsequently assessed for the relative abundance of S. aureus using DNA sequencing and quantitative PCR. Those treated weekly with dupilumab showed an increase in microbial diversity and a decrease in S. aureus in both
162 nonlesional and lesional skin (402). Dupilumab is shown to be effective at 16 weeks (403) and 1 year (404).
Increases in IgE production is characteristic of atopic conditions, therefore
Omalizumab, an anti-IgE monoclonal antibody, may be crucial to the management of these conditions. Currently omalizumab is FDA approved for chronic urticaria and allergic asthma, however it is used off-labeled for other atopic disorders such as AR (405), peanut allergies (406) and atopic dermatitis (407). The Atopic Dermatitis Anti-IgE Pediatric Trial
(ADAPT) is a double-blind, placebo controlled RCT comparing the use of omalizumab to placebo in those with severe atopic dermatitis. Omalizumab improved AD severity in addition to quality of life after 24 weeks. Future studies should focus on dosing and more mild forms of AD and compare Omalizumab with newer anti-IgE drugs such as ligelizumab. Concomitant therapies were permitted in these children and could have masked some of the effects of Omalizumab (408). There is no evidence to suggest that anti-IgE therapy would impact S. aureus colonization but could decrease the host response to S. aureus secretory products. Neutralizing IgE would be beneficial to reduce local and systemic IgE responses induced by S. aureus enterotoxins (409, 410). There are concerns with omalizumab especially in those who are atopic. Serum sickness develops when a subsequent antibody is generated to the injected omalizumab. However, serum sickness was reported to be very rare (411). Although omalizumab is efficacious in asthma and studies are on-going in AD, the effect of omalizumab on the skin microbiome has not been published.
IL-33 is secreted by epithelial cells in response to damage, exposure to allergens, or S. aureus colonization. Interestingly, IL-33 is pre-formed in the nucleus and can be
163 rapidly released from damaged cells and downstream, the effects of Il-33 include increased IgE and decreased FLG expression. Etokimab is a humanized monoclonal IgG antibody against IL-33 and its efficacy was assessed in 12 adult patients with mod-severe
AD (412). Etokimab inhibited IL-8 neutrophil migration to the skin along with achieving
EASI50 with only minimal adverse effects. IL-33 blockade could potentially lead to decreases in normal responses to pathogens that interact with the skin, and a decrease in IL-8-dependent recruitment of neutrophils was also reported (413). IL-33 also is established to aid in wound healing, which is also dependent on neutrophil infiltration of the wound (414-417). Subsequent blockade of IL-33 could potentially damage neutrophilic wound healing responses, allowing for access by pathogens. Future trials with placebo controls are needed to assess long-term Etokimab efficacy and safety (413).
Diagnostics and Prevention
The overarching goal of the MPAACH cohort study is to find ways to prevent AD from progressing through the atopic march and to determine who is at higher risk. The initial objective in AD management is assessment of disease severity, which depends largely on extent of skin involvement, severity of active lesions or lichenification, and severity of patient-reported symptoms with a lack of biomarkers or diagnostic testing. The skin microbiome has been shown to change prior to the presentation of symptoms of atopy, making the skin microbiome a potential avenue for target for diagnostic use. Using the skin microbiome as a marker for predicting or diagnosing allergic disease has not materialized, although the influence of certain pathogens on atopy is established (418).
Unfortunately, there are a plethora of obstacles that prevent the efficient, cost-effective, and reliable use of the microbiome for these diagnostic utilities (419). Metagenomic
164 analysis is expensive, non-quantitative, and difficult to interpret in a clinical laboratory setting making this technique a poor diagnostic tool (420). The colonization of S. aureus on the skin has been associated with increased severity in many studies (126, 277, 345,
347) however S. aureus presence or colonization does not influence current clinical practice (14). Using the S. aureus and S. epidermidis colonization data from MPAACH children along with other clinical variables, it is possible to create a prediction score for those who may be more likely to progress through the atopic march or to other comorbid atopic conditions.
165 References
1. Busch B, Bley N, Müller S, Glaß M, Misiak D, Lederer M, Vetter M, Strauß H-G, Thomssen C, Hüttelmaier S. The oncogenic triangle of HMGA2, LIN28B and IGF2BP1 antagonizes tumor-suppressive actions of the let-7 family. Nucleic Acids Research. 2016;44(8):3845-64. doi: 10.1093/nar/gkw099. 2. Seo H, Chen J, González-Avalos E, Samaniego-Castruita D, Das A, Wang YH, López-Moyado IF, Georges RO, Zhang W, Onodera A, Wu C-J, Lu L-F, Hogan PG, Bhandoola A, Rao A. TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8 + T cell exhaustion. Proceedings of the National Academy of Sciences. 2019:201905675. doi: 10.1073/pnas.1905675116. 3. Nutten S. Atopic dermatitis: global epidemiology and risk factors. Ann Nutr Metab. 2015;66 Suppl 1:8-16. Epub 2015/05/01. doi: 10.1159/000370220. PubMed PMID: 25925336. 4. Williams H, Flohr C. How epidemiology has challenged 3 prevailing concepts about atopic dermatitis. J Allergy Clin Immunol. 2006;118(1):209-13. PubMed PMID: 16815157. 5. Bieber T. Atopic dermatitis. N Engl J Med. 2008;358(14):1483-94. PubMed PMID: 18385500. 6. Williams H, Stewart A, von Mutius E, Cookson W, Anderson HR. Is eczema really on the increase worldwide? J Allergy Clin Immunol. 2008;121(4):947-54 e15. PubMed PMID: 18155278. 7. Strachan D, Sibbald B, Weiland S, Ait-Khaled N, Anabwani G, Anderson HR, Asher MI, Beasley R, Bjorksten B, Burr M, Clayton T, Crane J, Ellwood P, Keil U, Lai C, Mallol J, Martinez F, Mitchell E, Montefort S, Pearce N, Robertson C, Shah J, Stewart A, von Mutius E, Williams H. Worldwide variations in prevalence of symptoms of allergic rhinoconjunctivitis in children: the International Study of Asthma and Allergies in Childhood (ISAAC). Pediatr Allergy Immunol. 1997;8(4):161-76. PubMed PMID: 9553981. 8. Grice EA, Segre JA. The skin microbiome. Nat Rev Microbiol. 2011;9(4):244-53. Epub 2011/03/17. doi: 10.1038/nrmicro2537. PubMed PMID: 21407241; PMCID: PMC3535073. 9. Wang M, Karlsson C, Olsson C, Adlerberth I, Wold AE, Strachan DP, Martricardi PM, Aberg N, Perkin MR, Tripodi S, Coates AR, Hesselmar B, Saalman R, Molin G, Ahrne S. Reduced diversity in the early fecal microbiota of infants with atopic eczema. J Allergy Clin Immunol. 2008;121(1):129-34. PubMed PMID: 18028995. 10. Okada H, Kuhn C, Feillet H, Bach JF. The 'hygiene hypothesis' for autoimmune and allergic diseases: an update. Clin Exp Immunol. 2010;160(1):1-9. Epub 2010/04/27. doi: 10.1111/j.1365-2249.2010.04139.x. PubMed PMID: 20415844; PMCID: PMC2841828. 11. Nations U. World Urbanization Prospects; the 2007 revision. In: Affairs EaS, editor. New York2008. 12. Bendiks M, Kopp MV. The relationship between advances in understanding the microbiome and the maturing hygiene hypothesis. Curr Allergy Asthma Rep. 2013;13(5):487-94. Epub 2013/08/13. doi: 10.1007/s11882-013-0382-8. PubMed PMID: 23934550.
166 13. Hanifin JM. Progress in Understanding Atopic Dermatitis. J Invest Dermatol. 2018;138(12):e93-e5. Epub 2018/11/24. doi: 10.1016/j.jid.2018.10.004. PubMed PMID: 30466540. 14. Weidinger S, Novak N. Atopic dermatitis. Lancet. 2016;387(10023):1109-22. doi: 10.1016/S0140-6736(15)00149-X. PubMed PMID: 26377142. 15. Chamlin SL, Mattson CL, Frieden IJ, Williams ML, Mancini AJ, Cella D, Chren MM. The price of pruritus: sleep disturbance and cosleeping in atopic dermatitis. Arch Pediatr Adolesc Med. 2005;159(8):745-50. Epub 2005/08/03. doi: 10.1001/archpedi.159.8.745. PubMed PMID: 16061782. 16. Silverberg JI, Garg NK, Paller AS, Fishbein AB, Zee PC. Sleep disturbances in adults with eczema are associated with impaired overall health: a US population-based study. J Invest Dermatol. 2015;135(1):56-66. Epub 2014/08/01. doi: 10.1038/jid.2014.325. PubMed PMID: 25078665. 17. Jhamnani RD, Levin S, Rasooly M, Stone KD, Milner JD, Nelson C, DiMaggio T, Jones N, Guerrerio AL, Frischmeyer-Guerrerio PA. Impact of food allergy on the growth of children with moderate-severe atopic dermatitis. J Allergy Clin Immunol. 2018;141(4):1526-9.e4. Epub 2018/01/30. doi: 10.1016/j.jaci.2017.11.056. PubMed PMID: 29378286; PMCID: PMC5889954. 18. Silverberg JI. Adult-Onset Atopic Dermatitis. J Allergy Clin Immunol Pract. 2019;7(1):28-33. Epub 2019/01/02. doi: 10.1016/j.jaip.2018.09.029. PubMed PMID: 30598180. 19. Silverberg JI. Public Health Burden and Epidemiology of Atopic Dermatitis. Dermatol Clin. 2017;35(3):283-9. Epub 2017/06/05. doi: 10.1016/j.det.2017.02.002. PubMed PMID: 28577797. 20. Ware JE, Kosinski M, Keller SD. A 12-Item Short-Form Health Survey: Construction of Scales and Preliminary Tests of Reliability and Validity. Medical Care. 1996;34(3). 21. Silverberg JI, Gelfand JM, Margolis DJ, Boguniewicz M, Fonacier L, Grayson MH, Simpson EL, Ong PY, Chiesa Fuxench ZC. Patient burden and quality of life in atopic dermatitis in US adults: A population-based cross-sectional study. Ann Allergy Asthma Immunol. 2018;121(3):340-7. Epub 2018/07/22. doi: 10.1016/j.anai.2018.07.006. PubMed PMID: 30025911. 22. Ovaere P, Lippens S, Vandenabeele P, Declercq W. The emerging roles of serine protease cascades in the epidermis. Trends Biochem Sci. 2009;34(9):453-63. doi: 10.1016/j.tibs.2009.08.001. PubMed PMID: 19726197. 23. Zheng T, Yu J, Oh MH, Zhu Z. The atopic march: progression from atopic dermatitis to allergic rhinitis and asthma. Allergy Asthma Immunol Res. 2011;3(2):67-73. doi: 10.4168/aair.2011.3.2.67. PubMed PMID: 21461244; PMCID: PMC3062798. 24. Agrawal R, Woodfolk JA. Skin barrier defects in atopic dermatitis. Curr Allergy Asthma Rep. 2014;14(5):433. Epub 2014/03/19. doi: 10.1007/s11882-014-0433-9. PubMed PMID: 24633617; PMCID: PMC4034059. 25. Kim BE, Leung DY. Epidermal barrier in atopic dermatitis. Allergy Asthma Immunol Res. 2012;4(1):12-6. Epub 2012/01/03. doi: 10.4168/aair.2012.4.1.12. PubMed PMID: 22211165; PMCID: PMC3242054.
167 26. Candi E, Schmidt R, Melino G. The cornified envelope: a model of cell death in the skin. Nat Rev Mol Cell Biol. 2005;6(4):328-40. Epub 2005/04/02. doi: 10.1038/nrm1619. PubMed PMID: 15803139. 27. Ong PY, Leung DY. Bacterial and Viral Infections in Atopic Dermatitis: a Comprehensive Review. Clin Rev Allergy Immunol. 2016;51(3):329-37. Epub 2016/07/06. doi: 10.1007/s12016-016-8548-5. PubMed PMID: 27377298. 28. Brandner JM, Zorn-Kruppa M, Yoshida T, Moll I, Beck LA, De Benedetto A. Epidermal tight junctions in health and disease. Tissue Barriers. 2015;3(1-2):e974451. Epub 2015/04/04. doi: 10.4161/21688370.2014.974451. PubMed PMID: 25838981; PMCID: PMC4372028. 29. Yoshida K, Yokouchi M, Nagao K, Ishii K, Amagai M, Kubo A. Functional tight junction barrier localizes in the second layer of the stratum granulosum of human epidermis. J Dermatol Sci. 2013;71(2):89-99. Epub 2013/05/29. doi: 10.1016/j.jdermsci.2013.04.021. PubMed PMID: 23712060. 30. Lakatos G, Soproni K, Doka A, Miklosi A. A comparative approach to dogs' (Canis familiaris) and human infants' comprehension of various forms of pointing gestures. Anim Cogn. 2009;12(4):621-31. doi: 10.1007/s10071-009-0221-4. PubMed PMID: 19343382. 31. Kawasaki H, Nagao K, Kubo A, Hata T, Shimizu A, Mizuno H, Yamada T, Amagai M. Altered stratum corneum barrier and enhanced percutaneous immune responses in filaggrin-null mice. J Allergy Clin Immunol. 2012;129(6):1538-46 e6. doi: 10.1016/j.jaci.2012.01.068. PubMed PMID: 22409988. 32. Oyoshi MK, Murphy GF, Geha RS. Filaggrin-deficient mice exhibit TH17- dominated skin inflammation and permissiveness to epicutaneous sensitization with protein antigen. J Allergy Clin Immunol. 2009;124(3):485-93, 93 e1. Epub 2009/08/12. doi: S0091-6749(09)00877-X [pii] 10.1016/j.jaci.2009.05.042. PubMed PMID: 19665780; PMCID: 2886150. 33. Gupta J, Grube E, Ericksen MB, Stevenson MD, Lucky AW, Sheth AP, Assa'ad AH, Khurana Hershey GK. Intrinsically defective skin barrier function in children with atopic dermatitis correlates with disease severity. J Allergy Clin Immunol. 2008;121(3):725-30 e2. Epub 2008/02/06. doi: 10.1016/j.jaci.2007.12.1161. PubMed PMID: 18249438. 34. Kubica M, Hildebrand F, Brinkman BM, Goossens D, Del Favero J, Vercammen K, Cornelis P, Schroder JM, Vandenabeele P, Raes J, Declercq W. The skin microbiome of caspase-14-deficient mice shows mild dysbiosis. Exp Dermatol. 2014;23(8):561-7. Epub 2014/05/28. doi: 10.1111/exd.12458. PubMed PMID: 24863253. 35. Nakatsuji T, Chen TH, Two AM, Chun KA, Narala S, Geha RS, Hata TR, Gallo RL. Staphylococcus aureus Exploits Epidermal Barrier Defects in Atopic Dermatitis to Trigger Cytokine Expression. J Invest Dermatol. 2016;136(11):2192-200. Epub 2016/10/25. doi: 10.1016/j.jid.2016.05.127. PubMed PMID: 27381887; PMCID: PMC5103312. 36. van Drongelen V, Haisma EM, Out-Luiting JJ, Nibbering PH, El Ghalbzouri A. Reduced filaggrin expression is accompanied by increased Staphylococcus aureus colonization of epidermal skin models. Clin Exp Allergy. 2014;44(12):1515-24. Epub 2014/10/30. doi: 10.1111/cea.12443. PubMed PMID: 25352374. 37. Clausen ML, Edslev SM, Andersen PS, Clemmensen K, Krogfelt KA, Agner T. Staphylococcus aureus colonization in atopic eczema and its association with filaggrin
168 gene mutations. Br J Dermatol. 2017;177(5):1394-400. Epub 2017/03/21. doi: 10.1111/bjd.15470. PubMed PMID: 28317091. 38. Baurecht H, Ruhlemann MC, Rodriguez E, Thielking F, Harder I, Erkens AS, Stolzl D, Ellinghaus E, Hotze M, Lieb W, Wang S, Heinsen-Groth FA, Franke A, Weidinger S. Epidermal lipid composition, barrier integrity, and eczematous inflammation are associated with skin microbiome configuration. J Allergy Clin Immunol. 2018;141(5):1668-76 e16. Epub 2018/02/09. doi: 10.1016/j.jaci.2018.01.019. PubMed PMID: 29421277. 39. Sevilla LM, Nachat R, Groot KR, Klement JF, Uitto J, Djian P, Maatta A, Watt FM. Mice deficient in involucrin, envoplakin, and periplakin have a defective epidermal barrier. J Cell Biol. 2007;179(7):1599-612. Epub 2008/01/02. doi: 10.1083/jcb.200706187. PubMed PMID: 18166659; PMCID: PMC2373502. 40. Natsuga K, Cipolat S, Watt FM. Increased Bacterial Load and Expression of Antimicrobial Peptides in Skin of Barrier-Deficient Mice with Reduced Cancer Susceptibility. J Invest Dermatol. 2016;136(1):99-106. Epub 2016/01/15. doi: 10.1038/jid.2015.383. PubMed PMID: 26763429; PMCID: PMC4759621. 41. Oh J, Byrd AL, Deming C, Conlan S, Program NCS, Kong HH, Segre JA. Biogeography and individuality shape function in the human skin metagenome. Nature. 2014;514(7520):59-64. Epub 2014/10/04. doi: 10.1038/nature13786. PubMed PMID: 25279917; PMCID: PMC4185404. 42. Dybboe R, Bandier J, Skov L, Engstrand L, Johansen JD. The Role of the Skin Microbiome in Atopic Dermatitis: A Systematic Review. Br J Dermatol. 2017. doi: 10.1111/bjd.15390. PubMed PMID: 28207943. 43. Belkaid Y, Segre JA. Dialogue between skin microbiota and immunity. Science. 2014;346(6212):954-9. doi: 10.1126/science.1260144. PubMed PMID: 25414304. 44. SanMiguel A, Grice EA. Interactions between host factors and the skin microbiome. Cell Mol Life Sci. 2015;72(8):1499-515. Epub 2014/12/31. doi: 10.1007/s00018-014-1812-z. PubMed PMID: 25548803; PMCID: PMC4376244. 45. Capone KA, Dowd SE, Stamatas GN, Nikolovski J. Diversity of the human skin microbiome early in life. J Invest Dermatol. 2011;131(10):2026-32. Epub 2011/06/24. doi: 10.1038/jid.2011.168. PubMed PMID: 21697884; PMCID: PMC3182836. 46. Gallo RL. Human Skin Is the Largest Epithelial Surface for Interaction with Microbes. J Invest Dermatol. 2017;137(6):1213-4. doi: 10.1016/j.jid.2016.11.045. PubMed PMID: 28395897. 47. Kennedy EA, Connolly J, Hourihane JO, Fallon PG, McLean WH, Murray D, Jo JH, Segre JA, Kong HH, Irvine AD. Skin microbiome before development of atopic dermatitis: Early colonization with commensal staphylococci at 2 months is associated with a lower risk of atopic dermatitis at 1 year. J Allergy Clin Immunol. 2017;139(1):166- 72. doi: 10.1016/j.jaci.2016.07.029. PubMed PMID: 27609659; PMCID: PMC5207796. 48. Dominguez-Bello MG, Costello EK, Contreras M, Magris M, Hidalgo G, Fierer N, Knight R. Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc Natl Acad Sci U S A. 2010;107(26):11971-5. Epub 2010/06/23. doi: 10.1073/pnas.1002601107. PubMed PMID: 20566857; PMCID: PMC2900693.
169 49. Kong HH. Skin microbiome: genomics-based insights into the diversity and role of skin microbes. Trends Mol Med. 2011;17(6):320-8. doi: 10.1016/j.molmed.2011.01.013. PubMed PMID: 21376666; PMCID: PMC3115422. 50. Scharschmidt TC, Vasquez KS, Truong HA, Gearty SV, Pauli ML, Nosbaum A, Gratz IK, Otto M, Moon JJ, Liese J, Abbas AK, Fischbach MA, Rosenblum MD. A Wave of Regulatory T Cells into Neonatal Skin Mediates Tolerance to Commensal Microbes. Immunity. 2015;43(5):1011-21. Epub 2015/11/21. doi: 10.1016/j.immuni.2015.10.016. PubMed PMID: 26588783; PMCID: PMC4654993. 51. Gittler JK, Shemer A, Suarez-Farinas M, Fuentes-Duculan J, Gulewicz KJ, Wang CQ, Mitsui H, Cardinale I, de Guzman Strong C, Krueger JG, Guttman-Yassky E. Progressive activation of T(H)2/T(H)22 cytokines and selective epidermal proteins characterizes acute and chronic atopic dermatitis. J Allergy Clin Immunol. 2012;130(6):1344-54. Epub 2012/09/07. doi: 10.1016/j.jaci.2012.07.012. PubMed PMID: 22951056; PMCID: PMC3991245. 52. Tamoutounour S, Han SJ, Deckers J, Constantinides MG, Hurabielle C, Harrison OJ, Bouladoux N, Linehan JL, Link VM, Vujkovic-Cvijin I, Perez-Chaparro PJ, Rosshart SP, Rehermann B, Lazarevic V, Belkaid Y. Keratinocyte-intrinsic MHCII expression controls microbiota-induced Th1 cell responses. Proc Natl Acad Sci U S A. 2019;116(47):23643-52. Epub 2019/11/02. doi: 10.1073/pnas.1912432116. PubMed PMID: 31672911; PMCID: PMC6876208. 53. Linehan JL, Harrison OJ, Han SJ, Byrd AL, Vujkovic-Cvijin I, Villarino AV, Sen SK, Shaik J, Smelkinson M, Tamoutounour S, Collins N, Bouladoux N, Dzutsev A, Rosshart SP, Arbuckle JH, Wang CR, Kristie TM, Rehermann B, Trinchieri G, Brenchley JM, O'Shea JJ, Belkaid Y. Non-classical Immunity Controls Microbiota Impact on Skin Immunity and Tissue Repair. Cell. 2018;172(4):784-96 e18. Epub 2018/01/24. doi: 10.1016/j.cell.2017.12.033. PubMed PMID: 29358051; PMCID: PMC6034182. 54. Naik S, Bouladoux N, Linehan JL, Han SJ, Harrison OJ, Wilhelm C, Conlan S, Himmelfarb S, Byrd AL, Deming C, Quinones M, Brenchley JM, Kong HH, Tussiwand R, Murphy KM, Merad M, Segre JA, Belkaid Y. Commensal-dendritic-cell interaction specifies a unique protective skin immune signature. Nature. 2015;520(7545):104-8. Epub 2014/12/30. doi: 10.1038/nature14052. PubMed PMID: 25539086; PMCID: PMC4667810. 55. Naik S, Bouladoux N, Wilhelm C, Molloy MJ, Salcedo R, Kastenmuller W, Deming C, Quinones M, Koo L, Conlan S, Spencer S, Hall JA, Dzutsev A, Kong H, Campbell DJ, Trinchieri G, Segre JA, Belkaid Y. Compartmentalized control of skin immunity by resident commensals. Science. 2012;337(6098):1115-9. Epub 2012/07/28. doi: 10.1126/science.1225152. PubMed PMID: 22837383; PMCID: PMC3513834. 56. Harrison OJ, Linehan JL, Shih HY, Bouladoux N, Han SJ, Smelkinson M, Sen SK, Byrd AL, Enamorado M, Yao C, Tamoutounour S, Van Laethem F, Hurabielle C, Collins N, Paun A, Salcedo R, O'Shea JJ, Belkaid Y. Commensal-specific T cell plasticity promotes rapid tissue adaptation to injury. Science. 2019;363(6422). Epub 2018/12/14. doi: 10.1126/science.aat6280. PubMed PMID: 30523076. 57. Nowicka D, Nawrot U. Contribution of Malassezia spp. to the development of atopic dermatitis. Mycoses. 2019;62(7):588-96. Epub 2019/03/26. doi: 10.1111/myc.12913. PubMed PMID: 30908750.
170 58. Garcia-Lopez R, Perez-Brocal V, Moya A. Beyond cells - The virome in the human holobiont. Microb Cell. 2019;6(9):373-96. Epub 2019/09/19. doi: 10.15698/mic2019.09.689. PubMed PMID: 31528630; PMCID: PMC6717880. 59. Sly PD, Boner AL, Bjorksten B, Bush A, Custovic A, Eigenmann PA, Gern JE, Gerritsen J, Hamelmann E, Helms PJ, Lemanske RF, Martinez F, Pedersen S, Renz H, Sampson H, von Mutius E, Wahn U, Holt PG. Early identification of atopy in the prediction of persistent asthma in children. Lancet. 2008;372(9643):1100-6. Epub 2008/09/23. doi: 10.1016/s0140-6736(08)61451-8. PubMed PMID: 18805338; PMCID: PMC4440493. 60. Zhang LJ, Gallo RL. Antimicrobial peptides. Curr Biol. 2016;26(1):R14-9. Epub 2016/01/15. doi: 10.1016/j.cub.2015.11.017. PubMed PMID: 26766224. 61. Ong PY, Ohtake T, Brandt C, Strickland I, Boguniewicz M, Ganz T, Gallo RL, Leung DY. Endogenous antimicrobial peptides and skin infections in atopic dermatitis. N Engl J Med. 2002;347(15):1151-60. doi: 10.1056/NEJMoa021481. PubMed PMID: 12374875. 62. Powers CE, McShane DB, Gilligan PH, Burkhart CN, Morrell DS. Microbiome and pediatric atopic dermatitis. J Dermatol. 2015;42(12):1137-42. Epub 2015/09/22. doi: 10.1111/1346-8138.13072. PubMed PMID: 26388516. 63. Nomura I, Goleva E, Howell MD, Hamid QA, Ong PY, Hall CF, Darst MA, Gao B, Boguniewicz M, Travers JB, Leung DY. Cytokine milieu of atopic dermatitis, as compared to psoriasis, skin prevents induction of innate immune response genes. J Immunol. 2003;171(6):3262-9. PubMed PMID: 12960356. 64. Hata TR, Gallo RL. Antimicrobial peptides, skin infections, and atopic dermatitis. Semin Cutan Med Surg. 2008;27(2):144-50. doi: 10.1016/j.sder.2008.04.002. PubMed PMID: 18620136; PMCID: PMC2546601. 65. Kobayashi T, Glatz M, Horiuchi K, Kawasaki H, Akiyama H, Kaplan DH, Kong HH, Amagai M, Nagao K. Dysbiosis and Staphylococcus aureus Colonization Drives Inflammation in Atopic Dermatitis. Immunity. 2015;42(4):756-66. Epub 2015/04/23. doi: 10.1016/j.immuni.2015.03.014. PubMed PMID: 25902485; PMCID: PMC4407815. 66. Salava A, Lauerma A. Role of the skin microbiome in atopic dermatitis. Clin Transl Allergy. 2014;4:33. doi: 10.1186/2045-7022-4-33. PubMed PMID: 25905004; PMCID: PMC4405870. 67. Nakatsuji T, Chen TH, Narala S, Chun KA, Two AM, Yun T, Shafiq F, Kotol PF, Bouslimani A, Melnik AV, Latif H, Kim JN, Lockhart A, Artis K, David G, Taylor P, Streib J, Dorrestein PC, Grier A, Gill SR, Zengler K, Hata TR, Leung DY, Gallo RL. Antimicrobials from human skin commensal bacteria protect against Staphylococcus aureus and are deficient in atopic dermatitis. Sci Transl Med. 2017;9(378). Epub 2017/02/24. doi: 10.1126/scitranslmed.aah4680. PubMed PMID: 28228596; PMCID: PMC5600545. 68. Baurecht H, Rühlemann MC, Rodríguez E, Thielking F, Harder I, Erkens A-S, Stölzl D, Ellinghaus E, Hotze M, Lieb W, Wang S, Heinsen-Groth F-A, Franke A, Weidinger S. Epidermal lipid composition, barrier integrity, and eczematous inflammation are associated with skin microbiome configuration. J Allergy Clin Immunol. 2018;141(5):1668-76.e16. doi: 10.1016/j.jaci.2018.01.019. 69. Gao P-S, Rafaels NM, Hand T, Murray T, Boguniewicz M, Hata T, Schneider L, Hanifin JM, Gallo RL, Gao L, Beaty TH, Beck LA, Barnes KC, Leung DYM. Filaggrin
171 mutations that confer risk of atopic dermatitis confer greater risk for eczema herpeticum. J Allergy Clin Immunol. 2009;124(3):507-13, 13.e1-7. doi: 10.1016/j.jaci.2009.07.034. 70. Kim BE, Bin L, Ye Y-M, Ramamoorthy P, Leung DYM. IL-25 Enhances HSV-1 Replication by Inhibiting Filaggrin Expression, and Acts Synergistically with TH2 Cytokines to Enhance HSV-1 Replication. J Invest Dermatol. 2013;133(12):2678-85. doi: 10.1038/jid.2013.223. 71. Cai SCS, Chen H, Koh WP, Common JEA, van Bever HP, McLean WHI, Lane EB, Giam YC, Tang MBY. Filaggrin mutations are associated with recurrent skin infection in Singaporean Chinese patients with atopic dermatitis. Br J Dermatol. 2012;166(1):200-3. doi: 10.1111/j.1365-2133.2011.10541.x. 72. Brandt EB, Sivaprasad U. Th2 Cytokines and Atopic Dermatitis. J Clin Cell Immunol. 2011;2(3). Epub 2011/10/14. doi: 10.4172/2155-9899.1000110. PubMed PMID: 21994899; PMCID: PMC3189506. 73. Seltmann J, Roesner LM, Hesler F-Wv, Wittmann M, Werfel T. IL-33 impacts on the skin barrier by downregulating the expression of filaggrin. Journal of Allergy and Clinical Immunology. 2015;135(6):1659-61.e4. doi: 10.1016/j.jaci.2015.01.048. 74. Kim JH, Bae HC, Ko NY, Lee SH, Jeong SH, Lee H, Ryu W-I, Kye YC, Son SW. Thymic stromal lymphopoietin downregulates filaggrin expression by signal transducer and activator of transcription 3 (STAT3) and extracellular signal-regulated kinase (ERK) phosphorylation in keratinocytes. J Allergy Clin Immunol. 2015;136(1):205-8.e9. doi: 10.1016/j.jaci.2015.04.026. 75. Palmer CNA, Irvine AD, Terron-Kwiatkowski A, Zhao Y, Liao H, Lee SP, Goudie DR, Sandilands A, Campbell LE, Smith FJD, O'Regan GM, Watson RM, Cecil JE, Bale SJ, Compton JG, DiGiovanna JJ, Fleckman P, Lewis-Jones S, Arseculeratne G, Sergeant A, Munro CS, El Houate B, McElreavey K, Halkjaer LB, Bisgaard H, Mukhopadhyay S, McLean WHI. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat Genet. 2006;38(4):441-6. doi: 10.1038/ng1767. 76. Osawa R, Akiyama M, Shimizu H. Filaggrin Gene Defects and the Risk of Developing Allergic Disorders. Allergology International. 2011;60(1):1-9. doi: 10.2332/allergolint.10-RAI-0270. 77. Fallon PG, Sasaki T, Sandilands A, Campbell LE, Saunders SP, Mangan NE, Callanan JJ, Kawasaki H, Shiohama A, Kubo A, Sundberg J, Presland RB, Fleckman P, Shimizu N, Kudoh J, Irvine AD, Amagai M, McLean WHI. A homozygous frameshift mutation in the murine filaggrin gene facilitates enhanced percutaneous allergen priming. Nat Genet. 2009;41(5):602-8. doi: 10.1038/ng.358. 78. Briot A, Deraison C, Lacroix M, Bonnart C, Robin A, Besson C, Dubus P, Hovnanian A. Kallikrein 5 induces atopic dermatitis-like lesions through PAR2-mediated thymic stromal lymphopoietin expression in Netherton syndrome. J Exp Med. 2009;206(5):1135-47. doi: 10.1084/jem.20082242. 79. Sakabe J-i, Yamamoto M, Hirakawa S, Motoyama A, Ohta I, Tatsuno K, Ito T, Kabashima K, Hibino T, Tokura Y. Kallikrein-related peptidase 5 functions in proteolytic processing of profilaggrin in cultured human keratinocytes. J Biol Chem. 2013;288(24):17179-89. doi: 10.1074/jbc.M113.476820.
172 80. Li M. Current evidence of epidermal barrier dysfunction and thymic stromal lymphopoietin in the atopic march. European Respiratory Review. 2014;23(133):292-8. doi: 10.1183/09059180.00004314. 81. Wang S, Olt S, Schoefmann N, Stuetz A, Winiski A, Wolff-Winiski B. SPINK5 knockdown in organotypic human skin culture as a model system for Netherton syndrome: effect of genetic inhibition of serine proteases kallikrein 5 and kallikrein 7. Experimental Dermatology. 2014;23(7):524-6. doi: 10.1111/exd.12451. 82. Furio L, Pampalakis G, Michael IP, Nagy A, Sotiropoulou G, Hovnanian A. KLK5 Inactivation Reverses Cutaneous Hallmarks of Netherton Syndrome. PLOS Genetics. 2015;11(9). doi: 10.1371/journal.pgen.1005389. 83. Zhu Y, Underwood J, Macmillan D, Shariff L, O'Shaughnessy R, Harper JI, Pickard C, Friedmann PS, Healy E, Di W-L. Persistent kallikrein 5 activation induces atopic dermatitis-like skin architecture independent of PAR2 activity. J Allergy Clin Immunol. 2017;140(5):1310-22.e5. doi: 10.1016/j.jaci.2017.01.025. 84. Sun JD, Linden KG. Netherton syndrome: A case report and review of the literature. International Journal of Dermatology. 2006;45(6):693-7. doi: 10.1111/j.1365- 4632.2005.02637.x. 85. Hovnanian A. Netherton syndrome: skin inflammation and allergy by loss of protease inhibition. Cell Tissue Res. 2013;351(2):289-300. doi: 10.1007/s00441-013- 1558-1. 86. Williams MR, Cau L, Wang Y, Kaul D, Sanford JA, Zaramela LS, Khalil S, Butcher AM, Zengler K, Horswill AR, Dupont CL, Hovnanian A, Gallo RL. Interplay of Staphylococcal and Host Proteases Promotes Skin Barrier Disruption in Netherton Syndrome. Cell Reports. 2020;30(9):2923-33.e7. doi: 10.1016/j.celrep.2020.02.021. 87. Jungersted JM, Scheer H, Mempel M, Baurecht H, Cifuentes L, Høgh JK, Hellgren LI, Jemec GBE, Agner T, Weidinger S. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema. Allergy. 2010;65(7):911-8. doi: 10.1111/j.1398-9995.2010.02326.x. 88. Choi MJ, Maibach HI. Role of Ceramides in Barrier Function of Healthy and Diseased Skin. American Journal of Clinical Dermatology. 2005;6(4):215-23. doi: 10.2165/00128071-200506040-00002. 89. Yamamoto A, Serizawa S, Ito M, Sato Y. Stratum corneum lipid abnormalities in atopic dermatitis. Archives Of Dermatological Research. 1991;283(4):219-23. doi: 10.1007/bf01106105. 90. Schäfer L, Kragballe K. Abnormalities in epidermal lipid metabolism in patients with atopic dermatitis. J Invest Dermatol. 1991;96(1):10-5. doi: 10.1111/1523- 1747.ep12514648. 91. Sassa T, Ohno Y, Suzuki S, Nomura T, Nishioka C, Kashiwagi T, Hirayama T, Akiyama M, Taguchi R, Shimizu H, Itohara S, Kihara A. Impaired Epidermal Permeability Barrier in Mice Lacking Elovl1, the Gene Responsible for Very-Long-Chain Fatty Acid Production. Molecular and Cellular Biology. 2013;33(14):2787-96. doi: 10.1128/MCB.00192-13. 92. Li W, Sandhoff R, Kono M, Zerfas P, Hoffmann V, Ding BC-H, Proia RL, Deng C- X. Depletion of ceramides with very long chain fatty acids causes defective skin permeability barrier function, and neonatal lethality in ELOVL4 deficient mice. Int J Biol Sci. 2007;3(2):120-8. doi: 10.7150/ijbs.3.120.
173 93. McMahon A, Butovich IA, Kedzierski W. Epidermal expression of an Elovl4 transgene rescues neonatal lethality of homozygous Stargardt disease-3 mice. J Lipid Res. 2011;52(6):1128-38. doi: 10.1194/jlr.M014415. 94. Berdyshev E, Goleva E, Bronova I, Dyjack N, Rios C, Jung J, Taylor P, Jeong M, Hall CF, Richers BN, Norquest KA, Zheng T, Seibold MA, Leung DYM. Lipid abnormalities in atopic skin are driven by type 2 cytokines. JCI Insight.3(4). doi: 10.1172/jci.insight.98006. 95. Kelly JR, Kennedy PJ, Cryan JF, Dinan TG, Clarke G, Hyland NP. Breaking down the barriers: the gut microbiome, intestinal permeability and stress-related psychiatric disorders. Front Cell Neurosci. 2015;9. doi: 10.3389/fncel.2015.00392. 96. Eichner M, Protze J, Piontek A, Krause G, Piontek J. Targeting and alteration of tight junctions by bacteria and their virulence factors such as Clostridium perfringens enterotoxin. Pflügers Archiv - European Journal of Physiology. 2017;469(1):77-90. doi: 10.1007/s00424-016-1902-x. 97. Guttman-Yassky E, Suárez-Fariñas M, Chiricozzi A, Nograles KE, Shemer A, Fuentes-Duculan J, Cardinale I, Lin P, Bergman R, Bowcock AM, Krueger JG. Broad defects in epidermal cornification in atopic dermatitis identified through genomic analysis. Journal of Allergy and Clinical Immunology. 2009;124(6):1235-44.e58. doi: 10.1016/j.jaci.2009.09.031. 98. Wan H, Winton HL, Soeller C, Tovey ER, Gruenert DC, Thompson PJ, Stewart GA, Taylor GW, Garrod DR, Cannell MB, Robinson C. Der p 1 facilitates transepithelial allergen delivery by disruption of tight junctions. J Clin Invest. 1999;104(1):123-33. doi: 10.1172/JCI5844. 99. Wan H, Winton HL, Soeller C, Taylor GW, Gruenert DC, Thompson PJ, Cannell MB, Stewart GA, Garrod DR, Robinson C. The transmembrane protein occludin of epithelial tight junctions is a functional target for serine peptidases from faecal pellets of Dermatophagoides pteronyssinus. Clinical And Experimental Allergy: Journal Of The British Society For Allergy And Clinical Immunology. 2001;31(2):279-94. doi: 10.1046/j.1365-2222.2001.00970.x. 100. Brandner JM, Zorn-Kruppa M, Yoshida T, Moll I, Beck LA, De Benedetto A. Epidermal tight junctions in health and disease. Tissue Barriers. 2014;3(1-2). doi: 10.4161/21688370.2014.974451. 101. Lai Y, Cogen AL, Radek KA, Park HJ, MacLeod DT, Leichtle A, Ryan AF, Di Nardo A, Gallo RL. Activation of TLR2 by a Small Molecule Produced by Staphylococcus epidermidis Increases Antimicrobial Defense against Bacterial Skin Infections. J Invest Dermatol. 2010;130(9):2211-21. doi: 10.1038/jid.2010.123. 102. Yuki T, Yoshida H, Akazawa Y, Komiya A, Sugiyama Y, Inoue S. Activation of TLR2 Enhances Tight Junction Barrier in Epidermal Keratinocytes. The Journal of Immunology. 2011;187(6):3230-7. doi: 10.4049/jimmunol.1100058. 103. Ohnemus U, Kohrmeyer K, Houdek P, Rohde H, Wladykowski E, Vidal S, Horstkotte MA, Aepfelbacher M, Kirschner N, Behne MJ, Moll I, Brandner JM. Regulation of epidermal tight-junctions (TJ) during infection with exfoliative toxin-negative Staphylococcus strains. J Invest Dermatol. 2008;128(4):906-16. doi: 10.1038/sj.jid.5701070. 104. Bäsler K, Galliano M-F, Bergmann S, Rohde H, Wladykowski E, Vidal-y-Sy S, Guiraud B, Houdek P, Schüring G, Volksdorf T, Caruana A, Bessou-Touya S, Schneider
174 SW, Duplan H, Brandner JM. Biphasic influence of Staphylococcus aureus on human epidermal tight junctions. Annals of the New York Academy of Sciences. 2017;1405(1):53-70. doi: 10.1111/nyas.13418. 105. Runswick S, Mitchell T, Davies P, Robinson C, Garrod DR. Pollen proteolytic enzymes degrade tight junctions. Respirology. 2007;12(6):834-42. doi: 10.1111/j.1440- 1843.2007.01175.x. 106. Lambers H, Piessens S, Bloem A, Pronk H, Finkel P. Natural skin surface pH is on average below 5, which is beneficial for its resident flora. International Journal of Cosmetic Science. 2006;28(5):359-70. doi: 10.1111/j.1467-2494.2006.00344.x. 107. Sultana R, McBain AJ, O'Neill CA. Strain-Dependent Augmentation of Tight- Junction Barrier Function in Human Primary Epidermal Keratinocytes by Lactobacillus and Bifidobacterium Lysates. Appl Environ Microbiol. 2013;79(16):4887-94. doi: 10.1128/AEM.00982-13. 108. Bergmann S, von Buenau B, Vidal-y-Sy S, Haftek M, Wladykowski E, Houdek P, Lezius S, Duplan H, Bäsler K, Dähnhardt-Pfeiffer S, Gorzelanny C, Schneider SW, Rodriguez E, Stölzl D, Weidinger S, Brandner JM. Claudin-1 decrease impacts epidermal barrier function in atopic dermatitis lesions dose-dependently. Scientific Reports. 2020;10(1):1-12. doi: 10.1038/s41598-020-58718-9. 109. Benedetto AD, Rafaels NM, Leung DYM, Ivanov AI, Hand T, Gao L, Yang M, Boguniewicz M, Hata TR, Schneider L, Hanifin JM, Gallo RL, Barnes KL, Beck LA. Variants in the Tight Junction Gene, Claudin-1 are Associated with Atopic Dermatitis in Two American Populations and May Contribute to Skin Barrier Dysfunction. Journal of Allergy and Clinical Immunology. 2009;123(2):S150. doi: 10.1016/j.jaci.2008.12.562. 110. Hoste E, Kemperman P, Devos M, Denecker G, Kezic S, Yau N, Gilbert B, Lippens S, De Groote P, Roelandt R, Van Damme P, Gevaert K, Presland RB, Takahara H, Puppels G, Caspers P, Vandenabeele P, Declercq W. Caspase-14 Is Required for Filaggrin Degradation to Natural Moisturizing Factors in the Skin. Journal of Investigative Dermatology. 2011;131(11):2233-41. doi: 10.1038/jid.2011.153. 111. Puhvel SM, Reisner RM, Sakamoto M. Analysis of lipid composition of isolated human sebaceous gland homogenates after incubation with cutaneous bacteria. Thin- layer chromatography. J Invest Dermatol. 1975;64(6):406-11. doi: 10.1111/1523- 1747.ep12512337. 112. Miajlovic H, Fallon PG, Irvine AD, Foster TJ. Effect of filaggrin breakdown products on growth of and protein expression by Staphylococcus aureus. J Allergy Clin Immunol. 2010;126(6):1184-90 e3. Epub 2010/11/03. doi: 10.1016/j.jaci.2010.09.015. PubMed PMID: 21036388; PMCID: PMC3627960. 113. Feuillie C, Vitry P, McAleer MA, Kezic S, Irvine AD, Geoghegan JA, Dufrêne YF. Adhesion of Staphylococcus aureus to Corneocytes from Atopic Dermatitis Patients Is Controlled by Natural Moisturizing Factor Levels. mBio. 2018;9(4). doi: 10.1128/mBio.01184-18. 114. Sevilla LM, Nachat R, Groot KR, Klement JF, Uitto J, Djian P, Määttä A, Watt FM. Mice deficient in involucrin, envoplakin, and periplakin have a defective epidermal barrier. Journal of Cell Biology. 2007;179(7):1599-612. doi: 10.1083/jcb.200706187. 115. Natsuga K, Watt FM. Galectin-6 is a novel skin anti-microbial peptide that is modulated by the skin barrier and microbiome. Journal of Dermatological Science. 2016;84(1):97-9. doi: 10.1016/j.jdermsci.2016.06.008.
175 116. Semple F, MacPherson H, Webb S, Cox SL, Mallin LJ, Tyrrell C, Grimes GR, Semple CA, Nix MA, Millhauser GL, Dorin JR. Human β-defensin 3 affects the activity of pro-inflammatory pathways associated with MyD88 and TRIF. European Journal of Immunology. 2011;41(11):3291-300. doi: 10.1002/eji.201141648. 117. Choi K-Y, Chow LNY, Mookherjee N. Cationic Host Defence Peptides: Multifaceted Role in Immune Modulation and Inflammation. JIN. 2012;4(4):361-70. doi: 10.1159/000336630. 118. Sørensen OE, Thapa DR, Rosenthal A, Liu L, Roberts AA, Ganz T. Differential regulation of beta-defensin expression in human skin by microbial stimuli. J Immunol. 2005;174(8):4870-9. doi: 10.4049/jimmunol.174.8.4870. 119. Dürr UHN, Sudheendra US, Ramamoorthy A. LL-37, the only human member of the cathelicidin family of antimicrobial peptides. Biochimica et Biophysica Acta (BBA) - Biomembranes. 2006;1758(9):1408-25. doi: 10.1016/j.bbamem.2006.03.030. 120. van Harten RM, van Woudenbergh E, van Dijk A, Haagsman HP. Cathelicidins: Immunomodulatory Antimicrobials. Vaccines (Basel). 2018;6(3). doi: 10.3390/vaccines6030063. 121. Meade KG, O'Farrelly C. β-Defensins: Farming the Microbiome for Homeostasis and Health. Frontiers in Immunology. 2019;9. doi: 10.3389/fimmu.2018.03072. 122. Lehrer RI, Barton A, Daher KA, Harwig SS, Ganz T, Selsted ME. Interaction of human defensins with Escherichia coli. Mechanism of bactericidal activity. Journal of Clinical Investigation. 1989;84(2):553-61. 123. de Koning HD, Kamsteeg M, Rodijk-Olthuis D, van Vlijmen-Willems IM, van Erp PE, Schalkwijk J, Zeeuwen PL. Epidermal expression of host response genes upon skin barrier disruption in normal skin and uninvolved skin of psoriasis and atopic dermatitis patients. J Invest Dermatol. 2011;131(1):263-6. Epub 2010/09/24. doi: 10.1038/jid.2010.278. PubMed PMID: 20861857. 124. Poretsky R, Rodriguez RL, Luo C, Tsementzi D, Konstantinidis KT. Strengths and limitations of 16S rRNA gene amplicon sequencing in revealing temporal microbial community dynamics. PLoS One. 2014;9(4):e93827. doi: 10.1371/journal.pone.0093827. PubMed PMID: 24714158; PMCID: PMC3979728. 125. Byrd AL, Deming C, Cassidy SKB, Harrison OJ, Ng WI, Conlan S, Program NCS, Belkaid Y, Segre JA, Kong HH. Staphylococcus aureus and Staphylococcus epidermidis strain diversity underlying pediatric atopic dermatitis. Sci Transl Med. 2017;9(397). doi: 10.1126/scitranslmed.aal4651. PubMed PMID: 28679656. 126. Kong HH, Oh J, Deming C, Conlan S, Grice EA, Beatson MA, Nomicos E, Polley EC, Komarow HD, Program NCS, Murray PR, Turner ML, Segre JA. Temporal shifts in the skin microbiome associated with disease flares and treatment in children with atopic dermatitis. Genome Res. 2012;22(5):850-9. Epub 2012/02/09. doi: 10.1101/gr.131029.111. PubMed PMID: 22310478; PMCID: PMC3337431. 127. Otto M. Staphylococcus colonization of the skin and antimicrobial peptides. Expert Rev Dermatol. 2010;5(2):183-95. doi: 10.1586/edm.10.6. PubMed PMID: 20473345; PMCID: PMC2867359. 128. Boguniewicz M, Leung DY. Atopic dermatitis: a disease of altered skin barrier and immune dysregulation. Immunol Rev. 2011;242(1):233-46. Epub 2011/06/21. doi: 10.1111/j.1600-065X.2011.01027.x. PubMed PMID: 21682749; PMCID: PMC3122139.
176 129. Basler K, Galliano MF, Bergmann S, Rohde H, Wladykowski E, Vidal YSS, Guiraud B, Houdek P, Schuring G, Volksdorf T, Caruana A, Bessou-Touya S, Schneider SW, Duplan H, Brandner JM. Biphasic influence of Staphylococcus aureus on human epidermal tight junctions. Ann N Y Acad Sci. 2017;1405(1):53-70. Epub 2017/07/29. doi: 10.1111/nyas.13418. PubMed PMID: 28753223. 130. Stacy A, Belkaid Y. Microbial guardians of skin health. Science. 2019;363(6424):227-8. Epub 2019/01/19. doi: 10.1126/science.aat4326. PubMed PMID: 30655428. 131. Belkaid Y, Tamoutounour S. The influence of skin microorganisms on cutaneous immunity. Nature reviews Immunology. 2016;16(6):353-66. Epub 2016/05/28. doi: 10.1038/nri.2016.48. PubMed PMID: 27231051. 132. Bachert C, van Steen K, Zhang N, Holtappels G, Cattaert T, Maus B, Buhl R, Taube C, Korn S, Kowalski M, Bousquet J, Howarth P. Specific IgE against Staphylococcus aureus enterotoxins: an independent risk factor for asthma. J Allergy Clin Immunol. 2012;130(2):376-81.e8. Epub 2012/06/29. doi: 10.1016/j.jaci.2012.05.012. PubMed PMID: 22738677. 133. Brauweiler AM, Goleva E, Leung DYM. Th2 cytokines increase Staphylococcus aureus alpha toxin-induced keratinocyte death through the signal transducer and activator of transcription 6 (STAT6). J Invest Dermatol. 2014;134(8):2114-21. Epub 2014/01/29. doi: 10.1038/jid.2014.43. PubMed PMID: 24468745; PMCID: PMC4102636. 134. Brauweiler AM, Bin L, Kim BE, Oyoshi MK, Geha RS, Goleva E, Leung DY. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal alpha-toxin-induced keratinocyte death. J Allergy Clin Immunol. 2013;131(2):421-7 e1-2. Epub 2012/12/19. doi: 10.1016/j.jaci.2012.10.030. PubMed PMID: 23246020; PMCID: PMC3742335. 135. Travers JB. Toxic interaction between Th2 cytokines and Staphylococcus aureus in atopic dermatitis. J Invest Dermatol. 2014;134(8):2069-71. Epub 2014/07/17. doi: 10.1038/jid.2014.122. PubMed PMID: 25029320; PMCID: PMC4101911. 136. Hauk PJ, Hamid QA, Chrousos GP, Leung DY. Induction of corticosteroid insensitivity in human PBMCs by microbial superantigens. J Allergy Clin Immunol. 2000;105(4):782-7. doi: 10.1067/mai.2000.105807. PubMed PMID: 10756230. 137. Schlievert PM, Case LC, Strandberg KL, Abrams BB, Leung DY. Superantigen profile of Staphylococcus aureus isolates from patients with steroid-resistant atopic dermatitis. Clin Infect Dis. 2008;46(10):1562-7. doi: 10.1086/586746. PubMed PMID: 18419342; PMCID: PMC2637450. 138. Amagai M, Matsuyoshi N, Wang ZH, Andl C, Stanley JR. Toxin in bullous impetigo and staphylococcal scalded-skin syndrome targets desmoglein 1. Nat Med. 2000;6(11):1275-7. doi: 10.1038/81385. PubMed PMID: 11062541. 139. Hanakawa Y, Schechter NM, Lin C, Nishifuji K, Amagai M, Stanley JR. Enzymatic and molecular characteristics of the efficiency and specificity of exfoliative toxin cleavage of desmoglein 1. J Biol Chem. 2004;279(7):5268-77. doi: 10.1074/jbc.M311087200. PubMed PMID: 14630910. 140. Amagai M, Yamaguchi T, Hanakawa Y, Nishifuji K, Sugai M, Stanley JR. Staphylococcal exfoliative toxin B specifically cleaves desmoglein 1. J Invest Dermatol. 2002;118(5):845-50. doi: 10.1046/j.1523-1747.2002.01751.x. PubMed PMID: 11982763.
177 141. Voorhees T, Chang J, Yao Y, Kaplan MH, Chang CH, Travers JB. Dendritic cells produce inflammatory cytokines in response to bacterial products from Staphylococcus aureus-infected atopic dermatitis lesions. Cell Immunol. 2011;267(1):17-22. Epub 2010/11/27. doi: 10.1016/j.cellimm.2010.10.010. PubMed PMID: 21109237; PMCID: PMC3021638. 142. Travers JB, Kozman A, Mousdicas N, Saha C, Landis M, Al-Hassani M, Yao W, Yao Y, Hyatt AM, Sheehan MP, Haggstrom AN, Kaplan MH. Infected atopic dermatitis lesions contain pharmacologic amounts of lipoteichoic acid. J Allergy Clin Immunol. 2010;125(1):146-52 e1-2. Epub 2009/12/08. doi: 10.1016/j.jaci.2009.09.052. PubMed PMID: 19962742; PMCID: PMC2813977. 143. Brauweiler AM, Goleva E, Leung DYM. Staphylococcus aureus Lipoteichoic Acid Damages the Skin Barrier through an IL-1-Mediated Pathway. J Invest Dermatol. 2019;139(8):1753-61 e4. Epub 2019/02/20. doi: 10.1016/j.jid.2019.02.006. PubMed PMID: 30779913; PMCID: PMC6650368. 144. Brauweiler AM, Bin L, Kim BE, Oyoshi MK, Geha RS, Goleva E, Leung DYM. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α- toxin–induced keratinocyte death. Journal of Allergy and Clinical Immunology. 2013;131(2):421-7.e2. doi: 10.1016/j.jaci.2012.10.030. 145. Williams MR, Nakatsuji T, Sanford JA, Vrbanac AF, Gallo RL. Staphylococcus aureus Induces Increased Serine Protease Activity in Keratinocytes. J Invest Dermatol. 2017;137(2):377-84. Epub 2016/10/22. doi: 10.1016/j.jid.2016.10.008. PubMed PMID: 27765722; PMCID: PMC5258850. 146. de Veer SJ, Furio L, Harris JM, Hovnanian A. Proteases: common culprits in human skin disorders. Trends Mol Med. 2014;20(3):166-78. Epub 2014/01/02. doi: 10.1016/j.molmed.2013.11.005. PubMed PMID: 24380647. 147. Fischer J, Meyer-Hoffert U. Regulation of kallikrein-related peptidases in the skin - from physiology to diseases to therapeutic options. Thromb Haemost. 2013;110(3):442- 9. doi: 10.1160/TH12-11-0836. PubMed PMID: 23446429. 148. Deraison C, Bonnart C, Lopez F, Besson C, Robinson R, Jayakumar A, Wagberg F, Brattsand M, Hachem JP, Leonardsson G, Hovnanian A. LEKTI fragments specifically inhibit KLK5, KLK7, and KLK14 and control desquamation through a pH-dependent interaction. Mol Biol Cell. 2007;18(9):3607-19. doi: 10.1091/mbc.E07-02-0124. PubMed PMID: 17596512; PMCID: PMC1951746. 149. Weidinger S, Baurecht H, Wagenpfeil S, Henderson J, Novak N, Sandilands A, Chen H, Rodriguez E, O'Regan GM, Watson R, Liao H, Zhao Y, Barker JN, Allen M, Reynolds N, Meggitt S, Northstone K, Smith GD, Strobl C, Stahl C, Kneib T, Klopp N, Bieber T, Behrendt H, Palmer CN, Wichmann HE, Ring J, Illig T, McLean WH, Irvine AD. Analysis of the individual and aggregate genetic contributions of previously identified serine peptidase inhibitor Kazal type 5 (SPINK5), kallikrein-related peptidase 7 (KLK7), and filaggrin (FLG) polymorphisms to eczema risk. J Allergy Clin Immunol. 2008;122(3):560-8 e4. doi: 10.1016/j.jaci.2008.05.050. PubMed PMID: 18774391. 150. Walley AJ, Chavanas S, Moffatt MF, Esnouf RM, Ubhi B, Lawrence R, Wong K, Abecasis GR, Jones EY, Harper JI, Hovnanian A, Cookson WO. Gene polymorphism in Netherton and common atopic disease. Nat Genet. 2001;29(2):175-8. doi: 10.1038/ng728. PubMed PMID: 11544479.
178 151. Wang XW, Wang JJ, Gutowska-Owsiak D, Salimi M, Selvakumar TA, Gwela A, Chen LY, Wang YJ, Giannoulatou E, Ogg G. Deficiency of filaggrin regulates endogenous cysteine protease activity, leading to impaired skin barrier function. Clin Exp Dermatol. 2017;42(6):622-31. Epub 2017/05/31. doi: 10.1111/ced.13113. PubMed PMID: 28556377. 152. Watters C, Fleming D, Bishop D, Rumbaugh KP. Host Responses to Biofilm. Prog Mol Biol Transl Sci. 2016;142:193-239. Epub 2016/08/31. doi: 10.1016/bs.pmbts.2016.05.007. PubMed PMID: 27571696. 153. Scherr TD, Heim CE, Morrison JM, Kielian T. Hiding in Plain Sight: Interplay between Staphylococcal Biofilms and Host Immunity. Front Immunol. 2014;5:37. Epub 2014/02/20. doi: 10.3389/fimmu.2014.00037. PubMed PMID: 24550921; PMCID: PMC3913997. 154. Joo HS, Otto M. Mechanisms of resistance to antimicrobial peptides in staphylococci. Biochim Biophys Acta. 2015;1848(11 Pt B):3055-61. Epub 2015/02/24. doi: 10.1016/j.bbamem.2015.02.009. PubMed PMID: 25701233; PMCID: PMC4539291. 155. Pletzer D, Hancock RE. Antibiofilm Peptides: Potential as Broad-Spectrum Agents. J Bacteriol. 2016;198(19):2572-8. doi: 10.1128/JB.00017-16. PubMed PMID: 27068589; PMCID: PMC5019066. 156. Simpson EL, Villarreal M, Jepson B, Rafaels N, David G, Hanifin J, Taylor P, Boguniewicz M, Yoshida T, De Benedetto A, Barnes KC, Leung DYM, Beck LA. Patients with Atopic Dermatitis Colonized with Staphylococcus aureus Have a Distinct Phenotype and Endotype. J Invest Dermatol. 2018;138(10):2224-33. Epub 2018/04/01. doi: 10.1016/j.jid.2018.03.1517. PubMed PMID: 29604251; PMCID: PMC6153055. 157. Speziale P, Pietrocola G, Foster TJ, Geoghegan JA. Protein-based biofilm matrices in Staphylococci. Front Cell Infect Microbiol. 2014;4:171. Epub 2014/12/30. doi: 10.3389/fcimb.2014.00171. PubMed PMID: 25540773; PMCID: PMC4261907. 158. Otto M. Staphylococcal infections: mechanisms of biofilm maturation and detachment as critical determinants of pathogenicity. Annu Rev Med. 2013;64:175-88. doi: 10.1146/annurev-med-042711-140023. PubMed PMID: 22906361. 159. Otto M. Staphylococcal biofilms. Curr Top Microbiol Immunol. 2008;322:207-28. PubMed PMID: 18453278; PMCID: PMC2777538. 160. Vlassova N, Han A, Zenilman JM, James G, Lazarus GS. New horizons for cutaneous microbiology: the role of biofilms in dermatological disease. Br J Dermatol. 2011;165(4):751-9. Epub 2011/06/15. doi: 10.1111/j.1365-2133.2011.10458.x. PubMed PMID: 21668434. 161. Otto M. Staphylococcus epidermidis--the 'accidental' pathogen. Nat Rev Microbiol. 2009;7(8):555-67. doi: 10.1038/nrmicro2182. PubMed PMID: 19609257; PMCID: PMC2807625. 162. Sugimoto S, Iwamoto T, Takada K, Okuda K, Tajima A, Iwase T, Mizunoe Y. Staphylococcus epidermidis Esp degrades specific proteins associated with Staphylococcus aureus biofilm formation and host-pathogen interaction. J Bacteriol. 2013;195(8):1645-55. Epub 2013/01/15. doi: 10.1128/JB.01672-12. PubMed PMID: 23316041; PMCID: PMC3624567. 163. Foster TJ, Hook M. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol. 1998;6(12):484-8. PubMed PMID: 10036727.
179 164. Cue D, Lei MG, Lee CY. Genetic regulation of the intercellular adhesion locus in staphylococci. Front Cell Infect Microbiol. 2012;2:38. Epub 2012/10/13. doi: 10.3389/fcimb.2012.00038. PubMed PMID: 23061050; PMCID: PMC3459252. 165. Schaeffer CR, Woods KM, Longo GM, Kiedrowski MR, Paharik AE, Buttner H, Christner M, Boissy RJ, Horswill AR, Rohde H, Fey PD. Accumulation-associated protein enhances Staphylococcus epidermidis biofilm formation under dynamic conditions and is required for infection in a rat catheter model. Infect Immun. 2015;83(1):214-26. Epub 2014/10/22. doi: 10.1128/IAI.02177-14. PubMed PMID: 25332125; PMCID: PMC4288872. 166. Gruszka DT, Wojdyla JA, Bingham RJ, Turkenburg JP, Manfield IW, Steward A, Leech AP, Geoghegan JA, Foster TJ, Clarke J, Potts JR. Staphylococcal biofilm-forming protein has a contiguous rod-like structure. Proc Natl Acad Sci U S A. 2012;109(17):E1011-8. Epub 2012/04/12. doi: 10.1073/pnas.1119456109. PubMed PMID: 22493247; PMCID: PMC3340054. 167. Geoghegan JA, Corrigan RM, Gruszka DT, Speziale P, O'Gara JP, Potts JR, Foster TJ. Role of surface protein SasG in biofilm formation by Staphylococcus aureus. J Bacteriol. 2010;192(21):5663-73. Epub 2010/09/08. doi: 10.1128/JB.00628-10. PubMed PMID: 20817770; PMCID: PMC2953683. 168. Formosa-Dague C, Speziale P, Foster TJ, Geoghegan JA, Dufrene YF. Zinc- dependent mechanical properties of Staphylococcus aureus biofilm-forming surface protein SasG. Proc Natl Acad Sci U S A. 2016;113(2):410-5. Epub 2015/12/31. doi: 10.1073/pnas.1519265113. PubMed PMID: 26715750; PMCID: PMC4720321. 169. Crosby HA, Schlievert PM, Merriman JA, King JM, Salgado-Pabon W, Horswill AR. The Staphylococcus aureus Global Regulator MgrA Modulates Clumping and Virulence by Controlling Surface Protein Expression. PLoS Pathog. 2016;12(5):e1005604. Epub 2016/05/06. doi: 10.1371/journal.ppat.1005604. PubMed PMID: 27144398; PMCID: PMC4856396. 170. Corrigan RM, Rigby D, Handley P, Foster TJ. The role of Staphylococcus aureus surface protein SasG in adherence and biofilm formation. Microbiology. 2007;153(Pt 8):2435-46. doi: 10.1099/mic.0.2007/006676-0. PubMed PMID: 17660408. 171. Conrady DG, Wilson JJ, Herr AB. Structural basis for Zn2+-dependent intercellular adhesion in staphylococcal biofilms. Proc Natl Acad Sci U S A. 2013;110(3):E202-11. Epub 2013/01/02. doi: 10.1073/pnas.1208134110. PubMed PMID: 23277549; PMCID: PMC3549106. 172. Conrady DG, Brescia CC, Horii K, Weiss AA, Hassett DJ, Herr AB. A zinc- dependent adhesion module is responsible for intercellular adhesion in staphylococcal biofilms. Proc Natl Acad Sci U S A. 2008;105(49):19456-61. doi: 10.1073/pnas.0807717105. PubMed PMID: 19047636; PMCID: PMC2592360. 173. Shelton CL, Conrady DG, Herr AB. Functional consequences of B-repeat sequence variation in the staphylococcal biofilm protein Aap: deciphering the assembly code. Biochem J. 2017;474(3):427-43. Epub 2016/11/23. doi: 10.1042/BCJ20160675. PubMed PMID: 27872164; PMCID: PMC5683732. 174. Costerton W, Veeh R, Shirtliff M, Pasmore M, Post C, Ehrlich G. The application of biofilm science to the study and control of chronic bacterial infections. Journal of Clinical Investigation. 2003;112(10):1466-77. doi: 10.1172/jci200320365.
180 175. Allen HB, Vaze ND, Choi C, Hailu T, Tulbert BH, Cusack CA, Joshi SG. The presence and impact of biofilm-producing staphylococci in atopic dermatitis. JAMA Dermatol. 2014;150(3):260-5. Epub 2014/01/24. doi: 10.1001/jamadermatol.2013.8627. PubMed PMID: 24452476. 176. Linder T. Evaluation of the chitin-binding dye Congo red as a selection agent for the isolation, classification, and enumeration of ascomycete yeasts. Arch Microbiol. 2018;200(4):671-5. Epub 2018/02/25. doi: 10.1007/s00203-018-1498-y. PubMed PMID: 29476207; PMCID: PMC5906491. 177. Wann ER, Gurusiddappa S, Hook M. The fibronectin-binding MSCRAMM FnbpA of Staphylococcus aureus is a bifunctional protein that also binds to fibrinogen. J Biol Chem. 2000;275(18):13863-71. doi: 10.1074/jbc.275.18.13863. 178. Cho S-H, Strickland I, Boguniewicz M, Leung DYM. Fibronectin and fibrinogen contribute to the enhanced binding of Staphylococcus aureus to atopic skin. Journal of Allergy and Clinical Immunology. 2001;108(2):269-74. doi: 10.1067/mai.2001.117455. 179. Cho SH, Strickland I, Boguniewicz M, Leung DY. Fibronectin and fibrinogen contribute to the enhanced binding of Staphylococcus aureus to atopic skin. J Allergy Clin Immunol. 2001;108(2):269-74. Epub 2001/08/10. doi: 10.1067/mai.2001.117455. PubMed PMID: 11496245. 180. Abraham NM, Jefferson KK. Staphylococcus aureus clumping factor B mediates biofilm formation in the absence of calcium. Microbiology. 2012;158(Pt 6):1504-12. Epub 2012/03/24. doi: 10.1099/mic.0.057018-0. PubMed PMID: 22442307; PMCID: PMC3541775. 181. Fleury OM, McAleer MA, Feuillie C, Formosa-Dague C, Sansevere E, Bennett DE, Towell AM, McLean WHI, Kezic S, Robinson DA, Fallon PG, Foster TJ, Dufrene YF, Irvine AD, Geoghegan JA. Clumping Factor B Promotes Adherence of Staphylococcus aureus to Corneocytes in Atopic Dermatitis. Infect Immun. 2017;85(6). doi: 10.1128/IAI.00994- 16. PubMed PMID: 28373353; PMCID: PMC5442637. 182. Scherr TD, Hanke ML, Huang O, James DB, Horswill AR, Bayles KW, Fey PD, Torres VJ, Kielian T. Staphylococcus aureus Biofilms Induce Macrophage Dysfunction Through Leukocidin AB and Alpha-Toxin. MBio. 2015;6(4). doi: 10.1128/mBio.01021-15. PubMed PMID: 26307164; PMCID: PMC4550693. 183. Paharik AE, Horswill AR. The Staphylococcal Biofilm: Adhesins, Regulation, and Host Response. Microbiol Spectr. 2016;4(2). Epub 2016/05/27. doi: 10.1128/microbiolspec.VMBF-0022-2015. PubMed PMID: 27227309; PMCID: PMC4887152. 184. Thurlow LR, Hanke ML, Fritz T, Angle A, Aldrich A, Williams SH, Engebretsen IL, Bayles KW, Horswill AR, Kielian T. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo. J Immunol. 2011;186(11):6585-96. doi: 10.4049/jimmunol.1002794. PubMed PMID: 21525381; PMCID: PMC3110737. 185. Cerca F, Andrade F, Franca A, Andrade EB, Ribeiro A, Almeida AA, Cerca N, Pier G, Azeredo J, Vilanova M. Staphylococcus epidermidis biofilms with higher proportions of dormant bacteria induce a lower activation of murine macrophages. J Med Microbiol. 2011;60(Pt 12):1717-24. doi: 10.1099/jmm.0.031922-0. PubMed PMID: 21799197. 186. Tankersley A, Frank MB, Bebak M, Brennan R. Early effects of Staphylococcus aureus biofilm secreted products on inflammatory responses of human epithelial
181 keratinocytes. J Inflamm (Lond). 2014;11:17. doi: 10.1186/1476-9255-11-17. PubMed PMID: 24936153; PMCID: PMC4059087. 187. Takai T. TSLP expression: cellular sources, triggers, and regulatory mechanisms. Allergol Int. 2012;61(1):3-17. Epub 2012/01/25. doi: 10.2332/allergolint.11-RAI-0395. PubMed PMID: 22270071. 188. Wilson SR, The L, Batia LM, Beattie K, Katibah GE, McClain SP, Pellegrino M, Estandian DM, Bautista DM. The epithelial cell-derived atopic dermatitis cytokine TSLP activates neurons to induce itch. Cell. 2013;155(2):285-95. Epub 2013/10/08. doi: 10.1016/j.cell.2013.08.057. PubMed PMID: 24094650; PMCID: PMC4041105. 189. Son ED, Kim HJ, Park T, Shin K, Bae IH, Lim KM, Cho EG, Lee TR. Staphylococcus aureus inhibits terminal differentiation of normal human keratinocytes by stimulating interleukin-6 secretion. J Dermatol Sci. 2014;74(1):64-71. Epub 2014/01/09. doi: 10.1016/j.jdermsci.2013.12.004. PubMed PMID: 24398033. 190. den Reijer PM, Haisma EM, Lemmens-den Toom NA, Willemse J, Koning RI, Demmers JA, Dekkers DH, Rijkers E, El Ghalbzouri A, Nibbering PH, van Wamel W. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model. PLoS One. 2016;11(1):e0145722. doi: 10.1371/journal.pone.0145722. PubMed PMID: 26741798; PMCID: PMC4704740. 191. Moormeier DE, Bose JL, Horswill AR, Bayles KW. Temporal and stochastic control of Staphylococcus aureus biofilm development. MBio. 2014;5(5):e01341-14. Epub 2014/10/16. doi: 10.1128/mBio.01341-14. PubMed PMID: 25316695; PMCID: PMC4205790. 192. Sharp JA, Echague CG, Hair PS, Ward MD, Nyalwidhe JO, Geoghegan JA, Foster TJ, Cunnion KM. Staphylococcus aureus surface protein SdrE binds complement regulator factor H as an immune evasion tactic. PLoS One. 2012;7(5):e38407. doi: 10.1371/journal.pone.0038407. PubMed PMID: 22675461; PMCID: PMC3364985. 193. Ponnuraj K, Bowden MG, Davis S, Gurusiddappa S, Moore D, Choe D, Xu Y, Hook M, Narayana SV. A "dock, lock, and latch" structural model for a staphylococcal adhesin binding to fibrinogen. Cell. 2003;115(2):217-28. PubMed PMID: 14567919. 194. Zhang X, Wu M, Zhuo W, Gu J, Zhang S, Ge J, Yang M. Crystal structures of Bbp from Staphylococcus aureus reveal the ligand binding mechanism with Fibrinogen alpha. Protein Cell. 2015;6(10):757-66. doi: 10.1007/s13238-015-0205-x. PubMed PMID: 26349459; PMCID: PMC4598324. 195. Ganesh VK, Rivera JJ, Smeds E, Ko YP, Bowden MG, Wann ER, Gurusiddappa S, Fitzgerald JR, Hook M. A structural model of the Staphylococcus aureus ClfA- fibrinogen interaction opens new avenues for the design of anti-staphylococcal therapeutics. PLoS Pathog. 2008;4(11):e1000226. doi: 10.1371/journal.ppat.1000226. PubMed PMID: 19043557; PMCID: PMC2582960. 196. Xiang H, Feng Y, Wang J, Liu B, Chen Y, Liu L, Deng X, Yang M. Crystal structures reveal the multi-ligand binding mechanism of Staphylococcus aureus ClfB. PLoS Pathog. 2012;8(6):e1002751. doi: 10.1371/journal.ppat.1002751. PubMed PMID: 22719251; PMCID: PMC3375286. 197. Askarian F, Ajayi C, Hanssen AM, van Sorge NM, Pettersen I, Diep DB, Sollid JU, Johannessen M. The interaction between Staphylococcus aureus SdrD and desmoglein 1 is important for adhesion to host cells. Sci Rep. 2016;6:22134. doi: 10.1038/srep22134. PubMed PMID: 26924733; PMCID: PMC4770587.
182 198. Barbu EM, Ganesh VK, Gurusiddappa S, Mackenzie RC, Foster TJ, Sudhof TC, Hook M. beta-Neurexin is a ligand for the Staphylococcus aureus MSCRAMM SdrC. PLoS Pathog. 2010;6(1):e1000726. doi: 10.1371/journal.ppat.1000726. PubMed PMID: 20090838; PMCID: PMC2800189. 199. Peters BM, Jabra-Rizk MA, O'May GA, Costerton JW, Shirtliff ME. Polymicrobial interactions: impact on pathogenesis and human disease. Clin Microbiol Rev. 2012;25(1):193-213. doi: 10.1128/CMR.00013-11. PubMed PMID: 22232376; PMCID: PMC3255964. 200. Stacy A, McNally L, Darch SE, Brown SP, Whiteley M. The biogeography of polymicrobial infection. Nat Rev Microbiol. 2016;14(2):93-105. doi: 10.1038/nrmicro.2015.8. PubMed PMID: 26714431; PMCID: PMC5116812. 201. Wolcott R, Costerton JW, Raoult D, Cutler SJ. The polymicrobial nature of biofilm infection. Clin Microbiol Infect. 2013;19(2):107-12. doi: 10.1111/j.1469- 0691.2012.04001.x. PubMed PMID: 22925473. 202. Gabrilska RA, Rumbaugh KP. Biofilm models of polymicrobial infection. Future Microbiol. 2015;10(12):1997-2015. doi: 10.2217/fmb.15.109. PubMed PMID: 26592098; PMCID: PMC4944397. 203. Silverman RJ, Nobbs AH, Vickerman MM, Barbour ME, Jenkinson HF. Interaction of Candida albicans cell wall Als3 protein with Streptococcus gordonii SspB adhesin promotes development of mixed-species communities. Infect Immun. 2010;78(11):4644- 52. doi: 10.1128/IAI.00685-10. PubMed PMID: 20805332; PMCID: PMC2976310. 204. Stewart EJ, Payne DE, Ma TM, VanEpps JS, Boles BR, Younger JG, Solomon MJ. Effect of Antimicrobial and Physical Treatments on Growth of Multispecies Staphylococcal Biofilms. Appl Environ Microbiol. 2017;83(12). doi: 10.1128/AEM.03483- 16. PubMed PMID: 28411222; PMCID: PMC5452825. 205. Stoodley P, Conti SF, DeMeo PJ, Nistico L, Melton-Kreft R, Johnson S, Darabi A, Ehrlich GD, Costerton JW, Kathju S. Characterization of a mixed MRSA/MRSE biofilm in an explanted total ankle arthroplasty. FEMS Immunol Med Microbiol. 2011;62(1):66-74. doi: 10.1111/j.1574-695X.2011.00793.x. PubMed PMID: 21332826. 206. Molofsky AB, Van Gool F, Liang H-E, Van Dyken SJ, Nussbaum JC, Lee J, Bluestone JA, Locksley RM. Interleukin-33 and Interferon-γ Counter-Regulate Group 2 Innate Lymphoid Cell Activation during Immune Perturbation. Immunity. 2015;43(1):161- 74. doi: 10.1016/j.immuni.2015.05.019. 207. Paller AS, Spergel JM, Mina-Osorio P, Irvine AD. The atopic march and atopic multimorbidity: Many trajectories, many pathways. J Allergy Clin Immunol. 2019;143(1):46-55. Epub 2018/11/17. doi: 10.1016/j.jaci.2018.11.006. PubMed PMID: 30458183. 208. Bantz SK, Zhu Z, Zheng T. The Atopic March: Progression from Atopic Dermatitis to Allergic Rhinitis and Asthma. J Clin Cell Immunol. 2014;5(2). Epub 2014/11/25. doi: 10.4172/2155-9899.1000202. PubMed PMID: 25419479; PMCID: PMC4240310. 209. Tran MM, Lefebvre DL, Dharma C, Dai D, Lou WYW, Subbarao P, Becker AB, Mandhane PJ, Turvey SE, Sears MR, Canadian Healthy Infant Longitudinal Development Study i. Predicting the atopic march: Results from the Canadian Healthy Infant Longitudinal Development Study. J Allergy Clin Immunol. 2018;141(2):601-7 e8. Epub 2017/11/21. doi: 10.1016/j.jaci.2017.08.024. PubMed PMID: 29153857.
183 210. Biagini Myers JM, Khurana Hershey GK. Eczema in early life: genetics, the skin barrier, and lessons learned from birth cohort studies. J Pediatr. 2010;157(5):704-14. Epub 2010/08/27. doi: 10.1016/j.jpeds.2010.07.009. PubMed PMID: 20739029; PMCID: PMC2957505. 211. Williams MR, Gallo RL. The role of the skin microbiome in atopic dermatitis. Curr Allergy Asthma Rep. 2015;15(11):65. Epub 2015/09/26. doi: 10.1007/s11882-015-0567- 4. PubMed PMID: 26404536. 212. Small P, Keith PK, Kim H. Allergic rhinitis. Allergy Asthma Clin Immunol. 2018;14(Suppl 2):51. Epub 2018/09/29. doi: 10.1186/s13223-018-0280-7. PubMed PMID: 30263033; PMCID: PMC6156899. 213. Cruz AA, Popov T, Pawankar R, Annesi-Maesano I, Fokkens W, Kemp J, Ohta K, Price D, Bousquet J. Common characteristics of upper and lower airways in rhinitis and asthma: ARIA update, in collaboration with GA(2)LEN. Allergy. 2007;62 Suppl 84:1-41. Epub 2007/10/11. doi: 10.1111/j.1398-9995.2007.01551.x. PubMed PMID: 17924930. 214. Kozik AJ, Huang YJ. The microbiome in asthma: Role in pathogenesis, phenotype, and response to treatment. Ann Allergy Asthma Immunol. 2019;122(3):270-5. Epub 2018/12/16. doi: 10.1016/j.anai.2018.12.005. PubMed PMID: 30552986; PMCID: PMC6389408. 215. Bisgaard H, Hermansen MN, Buchvald F, Loland L, Halkjaer LB, Bonnelykke K, Brasholt M, Heltberg A, Vissing NH, Thorsen SV, Stage M, Pipper CB. Childhood asthma after bacterial colonization of the airway in neonates. N Engl J Med. 2007;357(15):1487- 95. Epub 2007/10/12. doi: 10.1056/NEJMoa052632. PubMed PMID: 17928596. 216. Kluytmans JA, Wertheim HF. Nasal carriage of Staphylococcus aureus and prevention of nosocomial infections. Infection. 2005;33(1):3-8. Epub 2005/03/08. doi: 10.1007/s15010-005-4012-9. PubMed PMID: 15750752. 217. Ramsey MM, Freire MO, Gabrilska RA, Rumbaugh KP, Lemon KP. Staphylococcus aureus Shifts toward Commensalism in Response to Corynebacterium Species. Front Microbiol. 2016;7:1230. Epub 2016/09/02. doi: 10.3389/fmicb.2016.01230. PubMed PMID: 27582729; PMCID: PMC4988121. 218. Johnson RC, Ellis MW, Lanier JB, Schlett CD, Cui T, Merrell DS. Correlation between nasal microbiome composition and remote purulent skin and soft tissue infections. Infect Immun. 2015;83(2):802-11. Epub 2014/12/10. doi: 10.1128/IAI.02664- 14. PubMed PMID: 25486991; PMCID: PMC4294227. 219. Totte JE, van der Feltz WT, Hennekam M, van Belkum A, van Zuuren EJ, Pasmans SG. Prevalence and odds of Staphylococcus aureus carriage in atopic dermatitis: a systematic review and meta-analysis. Br J Dermatol. 2016;175(4):687-95. Epub 2016/03/20. doi: 10.1111/bjd.14566. PubMed PMID: 26994362. 220. Gilani SJ, Gonzalez M, Hussain I, Finlay AY, Patel GK. Staphylococcus aureus re- colonization in atopic dermatitis: beyond the skin. Clin Exp Dermatol. 2005;30(1):10-3. Epub 2005/01/25. doi: 10.1111/j.1365-2230.2004.01679.x. PubMed PMID: 15663492. 221. McCauley K, Durack J, Valladares R, Fadrosh DW, Lin DL, Calatroni A, LeBeau PK, Tran HT, Fujimura KE, LaMere B, Merana G, Lynch K, Cohen RT, Pongracic J, Khurana Hershey GK, Kercsmar CM, Gill M, Liu AH, Kim H, Kattan M, Teach SJ, Togias A, Boushey HA, Gern JE, Jackson DJ, Lynch SV. Distinct nasal airway bacterial microbiotas differentially relate to exacerbation in pediatric patients with asthma. J Allergy
184 Clin Immunol. 2019;144(5):1187-97. Epub 2019/06/16. doi: 10.1016/j.jaci.2019.05.035. PubMed PMID: 31201890; PMCID: PMC6842413. 222. Wrobel J, Tomczak H, Jenerowicz D, Czarnecka-Operacz M. Skin and nasal vestibule colonisation by Staphylococcus aureus and its susceptibility to drugs in atopic dermatitis patients. Ann Agric Environ Med. 2018;25(2):334-7. Epub 2018/06/26. doi: 10.26444/aaem/85589. PubMed PMID: 29936801. 223. Altunbulakli C, Reiger M, Neumann AU, Garzorz-Stark N, Fleming M, Huelpuesch C, Castro-Giner F, Eyerich K, Akdis CA, Traidl-Hoffmann C. Relations between epidermal barrier dysregulation and Staphylococcus species-dominated microbiome dysbiosis in patients with atopic dermatitis. J Allergy Clin Immunol. 2018;142(5):1643-7 e12. Epub 2018/07/27. doi: 10.1016/j.jaci.2018.07.005. PubMed PMID: 30048670. 224. Bird JA, Lack G, Perry TT. Clinical management of food allergy. J Allergy Clin Immunol Pract. 2015;3(1):1-11; quiz 2. Epub 2015/01/13. doi: 10.1016/j.jaip.2014.06.008. PubMed PMID: 25577612. 225. Li W, Xu X, Wen H, Wang Z, Ding C, Liu X, Gao Y, Su H, Zhang J, Han Y, Xia Y, Wang X, Gu H, Yao X. Inverse Association Between the Skin and Oral Microbiota in Atopic Dermatitis. J Invest Dermatol. 2019;139(8):1779-87 e12. Epub 2019/02/26. doi: 10.1016/j.jid.2019.02.009. PubMed PMID: 30802424. 226. Zhao W, Ho HE, Bunyavanich S. The gut microbiome in food allergy. Ann Allergy Asthma Immunol. 2019;122(3):276-82. Epub 2018/12/24. doi: 10.1016/j.anai.2018.12.012. PubMed PMID: 30578857; PMCID: PMC6389411. 227. Walker MT, Green JE, Ferrie RP, Queener AM, Kaplan MH, Cook-Mills JM. Mechanism for initiation of food allergy: Dependence on skin barrier mutations and environmental allergen costimulation. J Allergy Clin Immunol. 2018;141(5):1711-25 e9. Epub 2018/02/20. doi: 10.1016/j.jaci.2018.02.003. PubMed PMID: 29454836; PMCID: PMC5938139. 228. Jones AL, Curran-Everett D, Leung DYM. Food allergy is associated with Staphylococcus aureus colonization in children with atopic dermatitis. J Allergy Clin Immunol. 2016;137(4):1247-8.e3. Epub 2016/03/11. doi: 10.1016/j.jaci.2016.01.010. PubMed PMID: 26960580. 229. Forbes-Blom E, Camberis M, Prout M, Tang SC, Le Gros G. Staphylococcal- derived superantigen enhances peanut induced Th2 responses in the skin. Clin Exp Allergy. 2012;42(2):305-14. Epub 2011/11/19. doi: 10.1111/j.1365-2222.2011.03861.x. PubMed PMID: 22092786. 230. Tsilochristou O, du Toit G, Sayre PH, Roberts G, Lawson K, Sever ML, Bahnson HT, Radulovic S, Basting M, Plaut M, Lack G, Immune Tolerance Network Learning Early About Peanut Allergy Study T. Association of Staphylococcus aureus colonization with food allergy occurs independently of eczema severity. J Allergy Clin Immunol. 2019;144(2):494-503. Epub 2019/06/05. doi: 10.1016/j.jaci.2019.04.025. PubMed PMID: 31160034. 231. Martin PE, Eckert JK, Koplin JJ, Lowe AJ, Gurrin LC, Dharmage SC, Vuillermin P, Tang ML, Ponsonby AL, Matheson M, Hill DJ, Allen KJ. Which infants with eczema are at risk of food allergy? Results from a population-based cohort. Clin Exp Allergy. 2015;45(1):255-64. Epub 2014/09/12. doi: 10.1111/cea.12406. PubMed PMID: 25210971.
185 232. Naik S, Bouladoux N, Linehan JL, Han S-J, Harrison OJ, Wilhelm C, Conlan S, Himmelfarb S, Byrd AL, Deming C, Quinones M, Brenchley JM, Kong HH, Tussiwand R, Murphy KM, Merad M, Segre JA, Belkaid Y. Commensal–dendritic-cell interaction specifies a unique protective skin immune signature. Nature. 2015;520(7545):104-8. doi: 10.1038/nature14052. 233. Pirahmadi S, Zakeri S, A AM, N DD, Raz AA, J JS, Abbasi R, Ghorbanzadeh Z. Cell-traversal protein for ookinetes and sporozoites (CelTOS) formulated with potent TLR adjuvants induces high-affinity antibodies that inhibit Plasmodium falciparum infection in Anopheles stephensi. Malar J. 2019;18(1):146. Epub 2019/04/25. doi: 10.1186/s12936- 019-2773-3. PubMed PMID: 31014347; PMCID: PMC6480871. 234. von Mutius E. The microbial environment and its influence on asthma prevention in early life. J Allergy Clin Immunol. 2016;137(3):680-9. Epub 2016/01/26. doi: 10.1016/j.jaci.2015.12.1301. PubMed PMID: 26806048. 235. Davis NM, Proctor DM, Holmes SP, Relman DA, Callahan BJ. Simple statistical identification and removal of contaminant sequences in marker-gene and metagenomics data. Microbiome. 2018;6(1):226. Epub 2018/12/19. doi: 10.1186/s40168-018-0605-2. PubMed PMID: 30558668; PMCID: PMC6298009. 236. Teufelberger AR, Nordengrün M, Braun H, Maes T, De Grove K, Holtappels G, O'Brien C, Provoost S, Hammad H, Gonçalves A, Beyaert R, Declercq W, Vandenabeele P, Krysko DV, Bröker BM, Bachert C, Krysko O. The IL-33/ST2 axis is crucial in type 2 airway responses induced by Staphylococcus aureus-derived serine protease-like protein D. J Allergy Clin Immunol. 2018;141(2):549-59.e7. Epub 2017/05/19. doi: 10.1016/j.jaci.2017.05.004. PubMed PMID: 28532656. 237. Muluk NB, Altin F, Cingi C. Role of Superantigens in Allergic Inflammation: Their Relationship to Allergic Rhinitis, Chronic Rhinosinusitis, Asthma, and Atopic Dermatitis. Am J Rhinol Allergy. 2018;32(6):502-17. Epub 2018/09/27. doi: 10.1177/1945892418801083. PubMed PMID: 30253652. 238. Abhishek K, Khunger N. Complications of skin biopsy. J Cutan Aesthet Surg. 2015;8(4):239-41. Epub 2016/02/13. doi: 10.4103/0974-2077.172206. PubMed PMID: 26865792; PMCID: PMC4728909. 239. Iwase T, Uehara Y, Shinji H, Tajima A, Seo H, Takada K, Agata T, Mizunoe Y. Staphylococcus epidermidis Esp inhibits Staphylococcus aureus biofilm formation and nasal colonization. Nature. 2010;465(7296):346-9. Epub 2010/05/21. doi: 10.1038/nature09074. PubMed PMID: 20485435. 240. Olson ME, Todd DA, Schaeffer CR, Paharik AE, Van Dyke MJ, Buttner H, Dunman PM, Rohde H, Cech NB, Fey PD, Horswill AR. Staphylococcus epidermidis agr quorum- sensing system: signal identification, cross talk, and importance in colonization. J Bacteriol. 2014;196(19):3482-93. Epub 2014/07/30. doi: 10.1128/JB.01882-14. PubMed PMID: 25070736; PMCID: 4187671. 241. Otto M, Echner H, Voelter W, Gotz F. Pheromone cross-inhibition between Staphylococcus aureus and Staphylococcus epidermidis. Infect Immun. 2001;69(3):1957-60. Epub 2001/02/17. doi: 10.1128/IAI.69.3.1957-1960.2001. PubMed PMID: 11179383; PMCID: 98112. 242. Leung DY. Infection in atopic dermatitis. Current opinion in pediatrics. 2003;15(4):399-404. Epub 2003/08/02. PubMed PMID: 12891053.
186 243. Lin YT, Wang CT, Chiang BL. Role of bacterial pathogens in atopic dermatitis. Clin Rev Allergy Immunol. 2007;33(3):167-77. Epub 2007/12/29. doi: 10.1007/s12016-007- 0044-5. PubMed PMID: 18163223. 244. Nakamura Y, Oscherwitz J, Cease KB, Chan SM, Munoz-Planillo R, Hasegawa M, Villaruz AE, Cheung GY, McGavin MJ, Travers JB, Otto M, Inohara N, Nunez G. Staphylococcus delta-toxin induces allergic skin disease by activating mast cells. Nature. 2013;503(7476):397-401. Epub 2013/11/01. doi: 10.1038/nature12655. PubMed PMID: 24172897; PMCID: PMC4090780. 245. Park KD, Pak SC, Park KK. The Pathogenetic Effect of Natural and Bacterial Toxins on Atopic Dermatitis. Toxins (Basel). 2016;9(1). Epub 2016/12/28. doi: 10.3390/toxins9010003. PubMed PMID: 28025545; PMCID: PMC5299398. 246. Wichmann K, Uter W, Weiss J, Breuer K, Heratizadeh A, Mai U, Werfel T. Isolation of alpha-toxin-producing Staphylococcus aureus from the skin of highly sensitized adult patients with severe atopic dermatitis. Br J Dermatol. 2009;161(2):300-5. Epub 2009/05/15. doi: 10.1111/j.1365-2133.2009.09229.x. PubMed PMID: 19438853. 247. Syed AK, Reed TJ, Clark KL, Boles BR, Kahlenberg JM. Staphlyococcus aureus phenol-soluble modulins stimulate the release of proinflammatory cytokines from keratinocytes and are required for induction of skin inflammation. Infect Immun. 2015;83(9):3428-37. Epub 2015/06/17. doi: 10.1128/IAI.00401-15. PubMed PMID: 26077761; PMCID: PMC4534673. 248. Cogen AL, Yamasaki K, Sanchez KM, Dorschner RA, Lai Y, MacLeod DT, Torpey JW, Otto M, Nizet V, Kim JE, Gallo RL. Selective antimicrobial action is provided by phenol-soluble modulins derived from Staphylococcus epidermidis, a normal resident of the skin. J Invest Dermatol. 2010;130(1):192-200. Epub 2009/08/28. doi: 10.1038/jid.2009.243. PubMed PMID: 19710683; PMCID: 2796468. 249. Paharik AE, Parlet CP, Chung N, Todd DA, Rodriguez EI, Van Dyke MJ, Cech NB, Horswill AR. Coagulase-Negative Staphylococcal Strain Prevents Staphylococcus aureus Colonization and Skin Infection by Blocking Quorum Sensing. Cell Host Microbe. 2017;22(6):746-56 e5. Epub 2017/12/05. doi: 10.1016/j.chom.2017.11.001. PubMed PMID: 29199097; PMCID: PMC5897044. 250. Stewart PS, Costerton JW. Antibiotic resistance of bacteria in biofilms. Lancet. 2001;358(9276):135-8. PubMed PMID: 11463434. 251. Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol. 2004;2(2):95-108. PubMed PMID: 15040259. 252. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999;284(5418):1318-22. PubMed PMID: 10334980. 253. Patel R. Biofilms and antimicrobial resistance. Clin Orthop Relat Res. 2005;437:41-7. PubMed PMID: 16056024. 254. Vuong C, Voyich JM, Fischer ER, Braughton KR, Whitney AR, DeLeo FR, Otto M. Polysaccharide intercellular adhesin (PIA) protects Staphylococcus epidermidis against major components of the human innate immune system. Cell Microbiol. 2004;6(3):269- 75. PubMed PMID: 14764110. 255. Akiyama H, Hamada T, Huh WK, Yamasaki O, Oono T, Fujimoto W, Iwatsuki K. Confocal laser scanning microscopic observation of glycocalyx production by Staphylococcus aureus in skin lesions of bullous impetigo, atopic dermatitis and
187 pemphigus foliaceus. Br J Dermatol. 2003;148(3):526-32. Epub 2003/03/26. PubMed PMID: 12653745. 256. Allen HB, Mueller JL. A novel finding in atopic dermatitis: film-producing Staphylococcus epidermidis as an etiology. Int J Dermatol. 2011;50(8):992-3. Epub 2011/07/26. doi: 10.1111/j.1365-4632.2010.04648.x. PubMed PMID: 21781075. 257. Katsuyama M, Ichikawa H, Ogawa S, Ikezawa Z. A novel method to control the balance of skin microflora. Part 1. Attack on biofilm of Staphylococcus aureus without antibiotics. J Dermatol Sci. 2005;38(3):197-205. Epub 2005/06/02. doi: 10.1016/j.jdermsci.2005.01.006. PubMed PMID: 15927813. 258. Katsuyama M, Kobayashi Y, Ichikawa H, Mizuno A, Miyachi Y, Matsunaga K, Kawashima M. A novel method to control the balance of skin microflora Part 2. A study to assess the effect of a cream containing farnesol and xylitol on atopic dry skin. J Dermatol Sci. 2005;38(3):207-13. Epub 2005/06/02. doi: 10.1016/j.jdermsci.2005.01.003. PubMed PMID: 15927814. 259. Sonesson A, Przybyszewska K, Eriksson S, Morgelin M, Kjellstrom S, Davies J, Potempa J, Schmidtchen A. Identification of bacterial biofilm and the Staphylococcus aureus derived protease, staphopain, on the skin surface of patients with atopic dermatitis. Sci Rep. 2017;7(1):8689. Epub 2017/08/20. doi: 10.1038/s41598-017-08046- 2. PubMed PMID: 28821865; PMCID: PMC5562790. 260. Akiyama H, Tada J, Toi J, Kanzaki H, Arata J. Changes in Staphylococcus aureus density and lesion severity after topical application of povidone-iodine in cases of atopic dermatitis. J Dermatol Sci. 1997;16(1):23-30. Epub 1998/01/24. PubMed PMID: 9438904. 261. Dermatitis ETFoA. Severity scoring of atopic dermatitis: the SCORAD index. Consensus Report of the European Task Force on Atopic Dermatitis. Dermatology. 1993;186(1):23-31. Epub 1993/01/01. doi: 10.1159/000247298. PubMed PMID: 8435513. 262. von Kobyletzki LB, Berner A, Carlstedt F, Hasselgren M, Bornehag CG, Svensson A. Validation of a parental questionnaire to identify atopic dermatitis in a population-based sample of children up to 2 years of age. Dermatology. 2013;226(3):222-6. Epub 2013/06/26. doi: 10.1159/000349983. PubMed PMID: 23796755. 263. Kunz B, Oranje AP, Labreze L, Stalder JF, Ring J, Taieb A. Clinical validation and guidelines for the SCORAD index: consensus report of the European Task Force on Atopic Dermatitis. Dermatology. 1997;195(1):10-9. Epub 1997/01/01. doi: 10.1159/000245677. PubMed PMID: 9267730. 264. Ritprajak P, Hashiguchi M, Tsushima F, Chalermsarp N, Azuma M. Keratinocyte- associated B7-H1 directly regulates cutaneous effector CD8+ T cell responses. J Immunol. 2010;184(9):4918-25. doi: 10.4049/jimmunol.0902478. 265. Stepanovic S, Vukovic D, Dakic I, Savic B, Svabic-Vlahovic M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J Microbiol Methods. 2000;40(2):175-9. Epub 2000/03/04. PubMed PMID: 10699673. 266. Christensen GD, Simpson WA, Younger JJ, Baddour LM, Barrett FF, Melton DM, Beachey EH. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices. J Clin Microbiol. 1985;22(6):996-1006. Epub 1985/12/01. PubMed PMID: 3905855; PMCID: PMC271866.
188 267. Harris PA, Taylor R, Thielke R, Payne J, Gonzalez N, Conde JG. Research electronic data capture (REDCap)--a metadata-driven methodology and workflow process for providing translational research informatics support. J Biomed Inform. 2009;42(2):377-81. Epub 2008/10/22. doi: 10.1016/j.jbi.2008.08.010. PubMed PMID: 18929686; PMCID: PMC2700030. 268. Berardesca E, Fideli D, Borroni G, Rabbiosi G, Maibach H. In vivo hydration and water-retention capacity of stratum corneum in clinically uninvolved skin in atopic and psoriatic patients. Acta Derm Venereol. 1990;70(5):400-4. Epub 1990/01/01. PubMed PMID: 1980973. 269. Choi SJ, Song MG, Sung WT, Lee DY, Lee JH, Lee ES, Yang JM. Comparison of transepidermal water loss, capacitance and pH values in the skin between intrinsic and extrinsic atopic dermatitis patients. J Korean Med Sci. 2003;18(1):93-6. Epub 2003/02/18. doi: 10.3346/jkms.2003.18.1.93. PubMed PMID: 12589094; PMCID: PMC3054999. 270. Suehiro M, Hirano S, Ikenaga K, Katoh N, Yasuno H, Kishimoto S. Characteristics of skin surface morphology and transepidermal water loss in clinically normal-appearing skin of patients with atopic dermatitis: a video-microscopy study. J Dermatol. 2004;31(2):78-85. Epub 2004/05/27. PubMed PMID: 15160859. 271. Leyden JJ, Marples RR, Kligman AM. Staphylococcus aureus in the lesions of atopic dermatitis. Br J Dermatol. 1974;90(5):525-30. Epub 1974/05/01. doi: 10.1111/j.1365-2133.1974.tb06447.x. PubMed PMID: 4601016. 272. Gomes LC, Mergulhao FJ. SEM Analysis of Surface Impact on Biofilm Antibiotic Treatment. Scanning. 2017;2017:2960194. Epub 2017/11/08. doi: 10.1155/2017/2960194. PubMed PMID: 29109808; PMCID: PMC5662067. 273. Sugimoto S, Okuda K, Miyakawa R, Sato M, Arita-Morioka K, Chiba A, Yamanaka K, Ogura T, Mizunoe Y, Sato C. Imaging of bacterial multicellular behaviour in biofilms in liquid by atmospheric scanning electron microscopy. Sci Rep. 2016;6:25889. Epub 2016/05/18. doi: 10.1038/srep25889. PubMed PMID: 27180609; PMCID: PMC4867632. 274. Gonzalez T, Biagini Myers JM, Herr AB, Khurana Hershey GK. Staphylococcal Biofilms in Atopic Dermatitis. Curr Allergy Asthma Rep. 2017;17(12):81. Epub 2017/10/25. doi: 10.1007/s11882-017-0750-x. PubMed PMID: 29063212. 275. Hoskin TS, Crowther JM, Cheung J, Epton MJ, Sly PD, Elder PA, Dobson RCJ, Kettle AJ, Dickerhof N. Oxidative cross-linking of calprotectin occurs in vivo, altering its structure and susceptibility to proteolysis. Redox Biol. 2019;24:101202. Epub 2019/04/25. doi: 10.1016/j.redox.2019.101202. PubMed PMID: 31015146; PMCID: PMC6477633. 276. Johansson E, Biagini Myers JM, Martin LJ, He H, Ryan P, LeMasters GK, Bernstein DI, Lockey J, Khurana Hershey GK. Identification of two early life eczema and non-eczema phenotypes with high risk for asthma development. Clin Exp Allergy. 2019;49(6):829-37. Epub 2019/03/05. doi: 10.1111/cea.13379. PubMed PMID: 30830718; PMCID: PMC6546546. 277. Di Domenico EG, Cavallo I, Bordignon V, Prignano G, Sperduti I, Gurtner A, Trento E, Toma L, Pimpinelli F, Capitanio B, Ensoli F. Inflammatory cytokines and biofilm production sustain Staphylococcus aureus outgrowth and persistence: a pivotal interplay in the pathogenesis of Atopic Dermatitis. Sci Rep. 2018;8(1):9573. Epub 2018/06/30. doi: 10.1038/s41598-018-27421-1. PubMed PMID: 29955077; PMCID: PMC6023932. 278. Howell MD, Kim BE, Gao P, Grant AV, Boguniewicz M, Debenedetto A, Schneider L, Beck LA, Barnes KC, Leung DY. Cytokine modulation of atopic dermatitis filaggrin skin
189 expression. J Allergy Clin Immunol. 2007;120(1):150-5. Epub 2007/05/22. doi: 10.1016/j.jaci.2007.04.031. PubMed PMID: 17512043; PMCID: 2669594. 279. Leung DYM, Calatroni A, Zaramela LS, LeBeau PK, Dyjack N, Brar K, David G, Johnson K, Leung S, Ramirez-Gama M, Liang B, Rios C, Montgomery MT, Richers BN, Hall CF, Norquest KA, Jung J, Bronova I, Kreimer S, Conover Talbot C, Jr., Crumrine D, Cole RN, Elias P, Zengler K, Seibold MA, Berdyshev E, Goleva E. The nonlesional skin surface distinguishes atopic dermatitis with food allergy as a unique endotype. Sci Transl Med. 2019;11(480). Epub 2019/02/23. doi: 10.1126/scitranslmed.aav2685. PubMed PMID: 30787169. 280. Kelleher M, Dunn-Galvin A, Hourihane JO, Murray D, Campbell LE, McLean WH, Irvine AD. Skin barrier dysfunction measured by transepidermal water loss at 2 days and 2 months predates and predicts atopic dermatitis at 1 year. J Allergy Clin Immunol. 2015;135(4):930-5 e1. Epub 2015/01/27. doi: 10.1016/j.jaci.2014.12.013. PubMed PMID: 25618747; PMCID: PMC4382348. 281. Meylan P, Lang C, Mermoud S, Johannsen A, Norrenberg S, Hohl D, Vial Y, Prod'hom G, Greub G, Kypriotou M, Christen-Zaech S. Skin Colonization by Staphylococcus aureus Precedes the Clinical Diagnosis of Atopic Dermatitis in Infancy. J Invest Dermatol. 2017;137(12):2497-504. Epub 2017/08/27. doi: 10.1016/j.jid.2017.07.834. PubMed PMID: 28842320. 282. Kennedy EA, Connolly J, Hourihane JO, Fallon PG, McLean WHI, Murray D, Jo JH, Segre JA, Kong HH, Irvine AD. Skin microbiome before development of atopic dermatitis: Early colonization with commensal staphylococci at 2 months is associated with a lower risk of atopic dermatitis at 1 year. J Allergy Clin Immunol. 2017;139(1):166- 72. Epub 2016/09/10. doi: 10.1016/j.jaci.2016.07.029. PubMed PMID: 27609659; PMCID: PMC5207796. 283. Boldock E, Surewaard BGJ, Shamarina D, Na M, Fei Y, Ali A, Williams A, Pollitt EJG, Szkuta P, Morris P, Prajsnar TK, McCoy KD, Jin T, Dockrell DH, van Strijp JAG, Kubes P, Renshaw SA, Foster SJ. Human skin commensals augment Staphylococcus aureus pathogenesis. Nat Microbiol. 2018;3(8):881-90. Epub 2018/07/18. doi: 10.1038/s41564-018-0198-3. PubMed PMID: 30013237; PMCID: PMC6207346. 284. Corbin BD, Seeley EH, Raab A, Feldmann J, Miller MR, Torres VJ, Anderson KL, Dattilo BM, Dunman PM, Gerads R, Caprioli RM, Nacken W, Chazin WJ, Skaar EP. Metal chelation and inhibition of bacterial growth in tissue abscesses. Science. 2008;319(5865):962-5. PubMed PMID: 18276893. 285. Zackular JP, Chazin WJ, Skaar EP. Nutritional Immunity: S100 Proteins at the Host-Pathogen Interface. J Biol Chem. 2015;290(31):18991-8. Epub 2015/06/10. doi: 10.1074/jbc.R115.645085. PubMed PMID: 26055713; PMCID: PMC4521021. 286. Damo SM, Kehl-Fie TE, Sugitani N, Holt ME, Rathi S, Murphy WJ, Zhang Y, Betz C, Hench L, Fritz G, Skaar EP, Chazin WJ. Molecular basis for manganese sequestration by calprotectin and roles in the innate immune response to invading bacterial pathogens. Proc Natl Acad Sci U S A. 2013;110(10):3841-6. Epub 2013/02/23. doi: 10.1073/pnas.1220341110. PubMed PMID: 23431180; PMCID: PMC3593839. 287. Chaton CT, Herr AB. Defining the metal specificity of a multifunctional biofilm adhesion protein. Protein Sci. 2017. doi: 10.1002/pro.3232. PubMed PMID: 28707417. 288. Cogen AL, Yamasaki K, Muto J, Sanchez KM, Crotty Alexander L, Tanios J, Lai Y, Kim JE, Nizet V, Gallo RL. Staphylococcus epidermidis Antimicrobial δ-Toxin (Phenol-
190 Soluble Modulin-γ) Cooperates with Host Antimicrobial Peptides to Kill Group A Streptococcus. PLoS ONE. 2010;5(1). doi: 10.1371/journal.pone.0008557. 289. Boles BR, Horswill AR. Agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog. 2008;4(4):e1000052. PubMed PMID: 18437240. 290. Periasamy S, Joo HS, Duong AC, Bach TH, Tan VY, Chatterjee SS, Cheung GY, Otto M. How Staphylococcus aureus biofilms develop their characteristic structure. Proc Natl Acad Sci U S A. 2012;109(4):1281-6. Epub 2012/01/11. doi: 10.1073/pnas.1115006109. PubMed PMID: 22232686; PMCID: 3268330. 291. Leung DY, Walsh P, Giorno R, Norris DA. A potential role for superantigens in the pathogenesis of psoriasis. J Invest Dermatol. 1993;100(3):225-8. Epub 1993/03/01. PubMed PMID: 8440891. 292. Miedzobrodzki J, Kaszycki P, Bialecka A, Kasprowicz A. Proteolytic activity of Staphylococcus aureus strains isolated from the colonized skin of patients with acute- phase atopic dermatitis. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology. 2002;21(4):269-76. Epub 2002/06/20. doi: 10.1007/s10096-002-0706-4. PubMed PMID: 12072937. 293. Zeeuwen PL, Boekhorst J, van den Bogaard EH, de Koning HD, van de Kerkhof PM, Saulnier DM, van S, II, van Hijum SA, Kleerebezem M, Schalkwijk J, Timmerman HM. Microbiome dynamics of human epidermis following skin barrier disruption. Genome Biol. 2012;13(11):R101. Epub 2012/11/17. doi: 10.1186/gb-2012-13-11-r101. PubMed PMID: 23153041; PMCID: PMC3580493. 294. Clausen ML, Slotved HC, Krogfelt KA, Agner T. Tape Stripping Technique for Stratum Corneum Protein Analysis. Sci Rep. 2016;6:19918. Epub 2016/01/29. doi: 10.1038/srep19918. PubMed PMID: 26817661; PMCID: PMC4730153. 295. Reisdorph N, Armstrong M, Powell R, Quinn K, Legg K, Leung D, Reisdorph R. Quantitation of peptides from non-invasive skin tapings using isotope dilution and tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci. 2018;1084:132-40. Epub 2018/03/31. doi: 10.1016/j.jchromb.2018.03.031. PubMed PMID: 29601982; PMCID: PMC6093185. 296. Leung DYM, Calatroni A, Zaramela LS, LeBeau PK, Dyjack N, Brar K, David G, Johnson K, Leung S, Ramirez-Gama M, Liang B, Rios C, Montgomery MT, Richers BN, Hall CF, Norquest KA, Jung J, Bronova I, Kreimer S, Talbot CC, Jr., Crumrine D, Cole RN, Elias P, Zengler K, Seibold MA, Berdyshev E, Goleva E. The nonlesional skin surface distinguishes atopic dermatitis with food allergy as a unique endotype. Sci Transl Med. 2019;11(480). Epub 2019/02/23. doi: 10.1126/scitranslmed.aav2685. PubMed PMID: 30787169. 297. Goto H, Tada A, Ibe A, Kitajima Y. Basket-weave structure in the stratum corneum is an important factor for maintaining physiological properties of human skin as studied using reconstructed human epidermis and tape-stripping of human cheek skin. Br J Dermatol. 2019. Epub 2019/05/12. doi: 10.1111/bjd.18123. PubMed PMID: 31077338. 298. Peppelman M, van den Eijnde WA, Jaspers EJ, Gerritsen MJ, van Erp PE. Combining tape stripping and non-invasive reflectance confocal microscopy : an in vivo model to study skin damage. Skin Res Technol. 2015;21(4):474-84. Epub 2015/03/17. doi: 10.1111/srt.12217. PubMed PMID: 25773201. 299. Hulshof L, Hack DP, Hasnoe QCJ, Dontje B, Jakasa I, Riethmuller C, McLean WHI, van Aalderen WMC, Van't Land B, Kezic S, Sprikkelman AB, Middelkamp-Hup MA.
191 A minimally invasive tool to study immune response and skin barrier in children with atopic dermatitis. Br J Dermatol. 2018. Epub 2018/07/11. doi: 10.1111/bjd.16994. PubMed PMID: 29989151. 300. Dyjack N, Goleva E, Rios C, Kim BE, Bin L, Taylor P, Bronchick C, Hall CF, Richers BN, Seibold MA, Leung DYM. Minimally invasive skin tape strip RNA sequencing identifies novel characteristics of the type 2-high atopic dermatitis disease endotype. J Allergy Clin Immunol. 2018;141(4):1298-309. Epub 2018/01/09. doi: 10.1016/j.jaci.2017.10.046. PubMed PMID: 29309794; PMCID: PMC5892844. 301. Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. Acta Derm Venereol. 1980;92 (suppl):44-7. 302. Zhang X, Biagini Myers JM, Yadagiri VK, Ulm A, Chen X, Weirauch MT, Khurana Hershey GK, Ji H. Nasal DNA methylation differentiates corticosteroid treatment response in pediatric asthma: A pilot study. PLoS One. 2017;12(10):e0186150. Epub 2017/10/14. doi: 10.1371/journal.pone.0186150. PubMed PMID: 29028809; PMCID: PMC5640236. 303. Cosseau C, Romano-Bertrand S, Duplan H, Lucas O, Ingrassia I, Pigasse C, Roques C, Jumas-Bilak E. Proteobacteria from the human skin microbiota: Species-level diversity and hypotheses. One Health. 2016;2:33-41. Epub 2016/03/04. doi: 10.1016/j.onehlt.2016.02.002. PubMed PMID: 28616476; PMCID: PMC5441325. 304. Lim JY, Hwang I, Ganzorig M, Huang SL, Cho GS, Franz C, Lee K. Complete Genome Sequences of Three Moraxella osloensis Strains Isolated from Human Skin. Genome Announc. 2018;6(3). Epub 2018/01/20. doi: 10.1128/genomeA.01509-17. PubMed PMID: 29348360; PMCID: PMC5773745. 305. Koppes SA, Brans R, Ljubojevic Hadzavdic S, Frings-Dresen MH, Rustemeyer T, Kezic S. Stratum Corneum Tape Stripping: Monitoring of Inflammatory Mediators in Atopic Dermatitis Patients Using Topical Therapy. Int Arch Allergy Immunol. 2016;170(3):187-93. Epub 2016/09/02. doi: 10.1159/000448400. PubMed PMID: 27584583; PMCID: PMC5296885. 306. Boguniewicz M, Leung DYM. Atopic Dermatitis: A Disease of Altered Skin Barrier and Immune Dysregulation. Immunological Reviews. 2011;242(1):233-46. doi: 10.1111/j.1600-065X.2011.01027.x. 307. Kim MJ, Im MA, Lee J-S, Mun JY, Kim DH, Gu A, Kim IS. Effect of S100A8 and S100A9 on expressions of cytokine and skin barrier protein in human keratinocytes. Molecular Medicine Reports. 2019. doi: 10.3892/mmr.2019.10454. 308. Rodriguez E, Baurecht H, Wahn AF, Kretschmer A, Hotze M, Zeilinger S, Klopp N, Illig T, Schramm K, Prokisch H, Kuhnel B, Gieger C, Harder J, Cifuentes L, Novak N, Weidinger S. An integrated epigenetic and transcriptomic analysis reveals distinct tissue- specific patterns of DNA methylation associated with atopic dermatitis. J Invest Dermatol. 2014;134(7):1873-83. Epub 2014/04/18. doi: 10.1038/jid.2014.87. PubMed PMID: 24739813. 309. Ferretti P, Farina S, Cristofolini M, Girolomoni G, Tett A, Segata N. Experimental metagenomics and ribosomal profiling of the human skin microbiome. Exp Dermatol. 2017;26(3):211-9. Epub 2016/09/14. doi: 10.1111/exd.13210. PubMed PMID: 27623553. 310. Tkacz A, Hortala M, Poole PS. Absolute quantitation of microbiota abundance in environmental samples. Microbiome. 2018;6(1):110. Epub 2018/06/21. doi: 10.1186/s40168-018-0491-7. PubMed PMID: 29921326; PMCID: PMC6009823.
192 311. Hardwick SA, Chen WY, Wong T, Kanakamedala BS, Deveson IW, Ongley SE, Santini NS, Marcellin E, Smith MA, Nielsen LK, Lovelock CE, Neilan BA, Mercer TR. Synthetic microbe communities provide internal reference standards for metagenome sequencing and analysis. Nat Commun. 2018;9(1):3096. Epub 2018/08/08. doi: 10.1038/s41467-018-05555-0. PubMed PMID: 30082706; PMCID: PMC6078961. 312. Zinter MS, Mayday MY, Ryckman KK, Jelliffe-Pawlowski LL, DeRisi JL. Towards precision quantification of contamination in metagenomic sequencing experiments. Microbiome. 2019;7(1):62. Epub 2019/04/18. doi: 10.1186/s40168-019-0678-6. PubMed PMID: 30992055; PMCID: PMC6469116. 313. Mongodin EF, Emerson JB, Nelson KE. Microbial metagenomics. Genome Biol. 2005;6(10):347. Epub 2005/10/07. doi: 10.1186/gb-2005-6-10-347. PubMed PMID: 16207365; PMCID: PMC1257460. 314. Oren A. Salinibacter: an extremely halophilic bacterium with archaeal properties. FEMS Microbiol Lett. 2013;342(1):1-9. Epub 2013/02/05. doi: 10.1111/1574-6968.12094. PubMed PMID: 23373661. 315. Stammler F, Glasner J, Hiergeist A, Holler E, Weber D, Oefner PJ, Gessner A, Spang R. Adjusting microbiome profiles for differences in microbial load by spike-in bacteria. Microbiome. 2016;4(1):28. Epub 2016/06/23. doi: 10.1186/s40168-016-0175-0. PubMed PMID: 27329048; PMCID: PMC4915049. 316. Tessler M, Neumann JS, Afshinnekoo E, Pineda M, Hersch R, Velho LFM, Segovia BT, Lansac-Toha FA, Lemke M, DeSalle R, Mason CE, Brugler MR. Large-scale differences in microbial biodiversity discovery between 16S amplicon and shotgun sequencing. Scientific Reports. 2017;7(1). doi: 10.1038/s41598-017-06665-3. 317. Anton J, Lucio M, Pena A, Cifuentes A, Brito-Echeverria J, Moritz F, Tziotis D, Lopez C, Urdiain M, Schmitt-Kopplin P, Rossello-Mora R. High metabolomic microdiversity within co-occurring isolates of the extremely halophilic bacterium Salinibacter ruber. PLoS One. 2013;8(5):e64701. Epub 2013/06/07. doi: 10.1371/journal.pone.0064701. PubMed PMID: 23741374; PMCID: PMC3669384. 318. Wood DE, Salzberg SL. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 2014;15(3):R46. Epub 2014/03/04. doi: 10.1186/gb-2014-15-3-r46. PubMed PMID: 24580807; PMCID: PMC4053813. 319. Lu J BF, Thielen P, Salzberg SL. Bracken: estimating species abundance in metagenomics data. PeerJ Computer Science. 2017;3:e104. doi: 10.7717/peerj-cs.104. 320. Oksanen JB, F. G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P. R.; O'Hara, R. B.; Simpson, G. L.; Solymos, P.; Stevens, M. H. H.; Szoecs, E. and Wagner, H. vegan: Community Ecology Package. . 2.5-3 ed2018. 321. Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR, O'Hara RB, Simpson GL, Solymos P, Stevens HH, Wagner H. vegan: Community Ecology Package version 2.3-02015. Epub 2015-05-26 15:48:55. 322. Totté JEE, Feltz WTvd, Hennekam M, Belkum Av, Zuuren EJv, Pasmans SGMA. Prevalence and odds of Staphylococcus aureus carriage in atopic dermatitis: a systematic review and meta-analysis. British Journal of Dermatology. 2016;175(4):687-95. doi: 10.1111/bjd.14566. 323. Soares J, Lopes C, Tavaria F, Delgado L, Pintado M. A diversity profile from the staphylococcal community on atopic dermatitis skin: a molecular approach. J Appl
193 Microbiol. 2013;115(6):1411-9. Epub 2013/08/06. doi: 10.1111/jam.12296. PubMed PMID: 23910049. 324. Reginald K, Westritschnig K, Linhart B, Focke-Tejkl M, Jahn-Schmid B, Eckl-Dorna J, Heratizadeh A, Stocklinger A, Balic N, Spitzauer S, Niederberger V, Werfel T, Thalhamer J, Weidinger S, Novak N, Ollert M, Hirschl AM, Valenta R. Staphylococcus aureus fibronectin-binding protein specifically binds IgE from patients with atopic dermatitis and requires antigen presentation for cellular immune responses. J Allergy Clin Immunol. 2011;128(1):82-91 e8. Epub 2011/04/26. doi: 10.1016/j.jaci.2011.02.034. PubMed PMID: 21513970. 325. Wilson MT, Hamilos DL. The nasal and sinus microbiome in health and disease. Curr Allergy Asthma Rep. 2014;14(12):485. Epub 2014/10/25. doi: 10.1007/s11882-014- 0485-x. PubMed PMID: 25342392. 326. Lynch JL, Gibbs BG. Birth Weight and Early Cognitive Skills: Can Parenting Offset the Link? Maternal and Child Health Journal. 2017;21(1):156-67. doi: 10.1007/s10995- 016-2104-z. 327. Berents TL, Carlsen KCL, Mowinckel P, Skjerven HO, Kvenshagen B, Rolfsjord LB, Bradley M, Lieden A, Carlsen K-H, Gaustad P, Gjersvik P. Skin Barrier Function and Staphylococcus aureus Colonization in Vestibulum Nasi and Fauces in Healthy Infants and Infants with Eczema: A Population-Based Cohort Study. PloS One. 2015;10(6):e0130145. doi: 10.1371/journal.pone.0130145. 328. Ta LDH, Yap GC, Tay CJX, Lim ASM, Huang CH, Chu CW, De Sessions PF, Shek LP, Goh A, Van Bever HPS, Teoh OH, Soh JY, Thomas B, Ramamurthy MB, Goh DYT, Lay C, Soh SE, Chan YH, Saw SM, Kwek K, Chong YS, Godfrey KM, Hibberd ML, Lee BW. Establishment of the nasal microbiota in the first 18 months of life: Correlation with early-onset rhinitis and wheezing. J Allergy Clin Immunol. 2018;142(1):86-95. Epub 2018/02/17. doi: 10.1016/j.jaci.2018.01.032. PubMed PMID: 29452199; PMCID: PMC5989928. 329. Ballardini N, Bergstrom A, Bohme M, van Hage M, Hallner E, Johansson E, Soderhall C, Kull I, Wickman M, Wahlgren CF. Infantile eczema: Prognosis and risk of asthma and rhinitis in preadolescence. J Allergy Clin Immunol. 2014;133(2):594-6. Epub 2013/12/18. doi: 10.1016/j.jaci.2013.08.054. PubMed PMID: 24332221. 330. Hamilos DL. Host-microbial interactions in patients with chronic rhinosinusitis. Journal of Allergy and Clinical Immunology. 2014;133(3):640-53.e4. doi: https://doi.org/10.1016/j.jaci.2013.06.049. 331. Psaltis AJ, Ha KR, Beule AG, Tan LW, Wormald PJ. Confocal scanning laser microscopy evidence of biofilms in patients with chronic rhinosinusitis. Laryngoscope. 2007;117(7):1302-6. Epub 2007/07/03. doi: 10.1097/MLG.0b013e31806009b0. PubMed PMID: 17603329. 332. Yan M, Pamp SJ, Fukuyama J, Hwang PH, Cho DY, Holmes S, Relman DA. Nasal microenvironments and interspecific interactions influence nasal microbiota complexity and S. aureus carriage. Cell Host Microbe. 2013;14(6):631-40. Epub 2013/12/18. doi: 10.1016/j.chom.2013.11.005. PubMed PMID: 24331461; PMCID: PMC3902146. 333. Biswas K, Hoggard M, Jain R, Taylor MW, Douglas RG. The nasal microbiota in health and disease: variation within and between subjects. Front Microbiol. 2015;9:134. Epub 2015/03/19. doi: 10.3389/fmicb.2015.00134. PubMed PMID: 25784909; PMCID: PMC5810306.
194 334. Zhou Y, Mihindukulasuriya KA, Gao H, La Rosa PS, Wylie KM, Martin JC, Kota K, Shannon WD, Mitreva M, Sodergren E, Weinstock GM. Exploration of bacterial community classes in major human habitats. Genome Biol. 2014;15(5):R66. Epub 2014/06/03. doi: 10.1186/gb-2014-15-5-r66. PubMed PMID: 24887286; PMCID: PMC4073010. 335. Kelly MS, Surette MG, Smieja M, Rossi L, Luinstra K, Steenhoff AP, Goldfarb DM, Pernica JM, Arscott-Mills T, Boiditswe S, Mazhani T, Rawls JF, Cunningham CK, Shah SS, Feemster KA, Seed PC. Pneumococcal Colonization and the Nasopharyngeal Microbiota of Children in Botswana. Pediatr Infect Dis J. 2018;37(11):1176-83. Epub 2018/08/29. doi: 10.1097/inf.0000000000002174. PubMed PMID: 30153231; PMCID: PMC6181769. 336. Zhu TH, Zhu TR, Tran KA, Sivamani RK, Shi VY. Epithelial barrier dysfunctions in atopic dermatitis: a skin-gut-lung model linking microbiome alteration and immune dysregulation. Br J Dermatol. 2018;179(3):570-81. Epub 2018/05/16. doi: 10.1111/bjd.16734. PubMed PMID: 29761483. 337. Pellerin L, Henry J, Hsu C-Y, Balica S, Jean-Decoster C, Méchin M-C, Hansmann B, Rodriguez E, Weindinger S, Schmitt A-M, Serre G, Paul C, Simon M. Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin. Journal of Allergy and Clinical Immunology. 2013;131(4):1094-102. doi: 10.1016/j.jaci.2012.12.1566. 338. Davidson WF, Leung DYM, Beck LA, Berin CM, Boguniewicz M, Busse WW, Chatila TA, Geha RS, Gern JE, Guttman-Yassky E, Irvine AD, Kim BS, Kong HH, Lack G, Nadeau KC, Schwaninger J, Simpson A, Simpson EL, Spergel JM, Togias A, Wahn U, Wood RA, Woodfolk JA, Ziegler SF, Plaut M. Report from the National Institute of Allergy and Infectious Diseases workshop on "Atopic dermatitis and the atopic march: Mechanisms and interventions". J Allergy Clin Immunol. 2019;143(3):894-913. Epub 2019/01/15. doi: 10.1016/j.jaci.2019.01.003. PubMed PMID: 30639346. 339. Watanabe H, Nakamura I, Mizutani S, Kurokawa Y, Mori H, Kurokawa K, Yamada T. Minor taxa in human skin microbiome contribute to the personal identification. PLoS One. 2018;13(7):e0199947. Epub 2018/07/26. doi: 10.1371/journal.pone.0199947. PubMed PMID: 30044822; PMCID: PMC6059399. 340. Gardiner M, Vicaretti M, Sparks J, Bansal S, Bush S, Liu M, Darling A, Harry E, Burke CM. A longitudinal study of the diabetic skin and wound microbiome. PeerJ. 2017;5:e3543. Epub 2017/07/26. doi: 10.7717/peerj.3543. PubMed PMID: 28740749; PMCID: PMC5522608. 341. Chu DM, Ma J, Prince AL, Antony KM, Seferovic MD, Aagaard KM. Maturation of the infant microbiome community structure and function across multiple body sites and in relation to mode of delivery. Nat Med. 2017;23(3):314-26. Epub 2017/01/24. doi: 10.1038/nm.4272. PubMed PMID: 28112736; PMCID: PMC5345907. 342. Bradley CW, Morris DO, Rankin SC, Cain CL, Misic AM, Houser T, Mauldin EA, Grice EA. Longitudinal Evaluation of the Skin Microbiome and Association with Microenvironment and Treatment in Canine Atopic Dermatitis. J Invest Dermatol. 2016;136(6):1182-90. Epub 2016/02/09. doi: 10.1016/j.jid.2016.01.023. PubMed PMID: 26854488; PMCID: PMC4877200. 343. Loesche MA, Farahi K, Capone K, Fakharzadeh S, Blauvelt A, Duffin KC, DePrimo SE, Munoz-Elias EJ, Brodmerkel C, Dasgupta B, Chevrier M, Smith K, Horwinski J, Tyldsley A, Grice EA. Longitudinal Study of the Psoriasis-Associated Skin Microbiome
195 during Therapy with Ustekinumab in a Randomized Phase 3b Clinical Trial. J Invest Dermatol. 2018;138(9):1973-81. Epub 2018/03/22. doi: 10.1016/j.jid.2018.03.1501. PubMed PMID: 29559344. 344. Williams MR, Nakatsuji T, Sanford JA, Vrbanac AF, Gallo RL. Staphylococcus aureus induces increased serine protease activity in keratinocytes. J Invest Dermatol. 2017;137(2):377-84. doi: 10.1016/j.jid.2016.10.008. 345. Totte JEE, Pardo LM, Fieten KB, Vos MC, van den Broek TJ, Schuren FHJ, Pasmans S. Nasal and skin microbiomes are associated with disease severity in paediatric atopic dermatitis. Br J Dermatol. 2019;181(4):796-804. Epub 2019/02/10. doi: 10.1111/bjd.17755. PubMed PMID: 30737999. 346. Kong HH, Oh J, Deming C, Conlan S, Grice EA, Beatson MA, Nomicos E, Polley EC, Komarow HD, Murray PR, Turner ML, Segre JA. Temporal shifts in the skin microbiome associated with disease flares and treatment in children with atopic dermatitis. Genome Research. 2012;22(5):850-9. doi: 10.1101/gr.131029.111. 347. Clausen ML, Edslev SM, Andersen PS, Clemmensen K, Krogfelt KA, Agner T. Staphylococcus aureus colonization in atopic eczema and its association with filaggrin gene mutations. British Journal of Dermatology. 2017;177(5):1394-400. doi: 10.1111/bjd.15470. 348. Pham MN, Andrade J, Mishoe M, Chun Y, Bunyavanich S. Perceived Versus Actual Aeroallergen Sensitization in Urban Children. J Allergy Clin Immunol Pract. 2019;7(5):1591-8.e4. Epub 2019/01/18. doi: 10.1016/j.jaip.2018.12.026. PubMed PMID: 30654198; PMCID: PMC6511290. 349. Schreiber J, Broker BM, Ehmann R, Bachert C. Nonatopic severe asthma might still be atopic: Sensitization toward Staphylococcus aureus enterotoxins. J Allergy Clin Immunol. 2019;143(6):2279-80.e2. Epub 2019/02/02. doi: 10.1016/j.jaci.2019.01.018. PubMed PMID: 30707972. 350. Acker KP, Wong Fok Lung T, West E, Craft J, Narechania A, Smith H, O'Brien K, Moustafa AM, Lauren C, Planet PJ, Prince A. Strains of Staphylococcus aureus that Colonize and Infect Skin Harbor Mutations in Metabolic Genes. iScience. 2019;19:281- 90. Epub 2019/08/12. doi: 10.1016/j.isci.2019.07.037. PubMed PMID: 31401351; PMCID: PMC6700416. 351. Nakatsuji T, Chiang HI, Jiang SB, Nagarajan H, Zengler K, Gallo RL. The microbiome extends to subepidermal compartments of normal skin. Nat Commun. 2013;4:1431. Epub 2013/02/07. doi: 10.1038/ncomms2441. PubMed PMID: 23385576; PMCID: PMC3655727. 352. Bay L, Barnes CJ, Fritz BG, Thorsen J, Restrup MEM, Rasmussen L, Sorensen JK, Hesselvig AB, Odgaard A, Hansen AJ, Bjarnsholt T. Universal Dermal Microbiome in Human Skin. mBio. 2020;11(1). Epub 2020/02/13. doi: 10.1128/mBio.02945-19. PubMed PMID: 32047129. 353. SanMiguel A, Grice EA. Interactions between host factors and the skin microbiome. Cellular and molecular life sciences : CMLS. 2015;72(8):1499-515. doi: 10.1007/s00018-014-1812-z. 354. Nakatsuji T, Chen TH, Two AM, Chun KA, Narala S, Geha RS, Hata TR, Gallo RL. Staphylococcus aureus Exploits Epidermal Barrier Defects in Atopic Dermatitis to Trigger Cytokine Expression. J Invest Dermatol. 2016;136(11):2192-200. doi: 10.1016/j.jid.2016.05.127.
196 355. Akaza N, Akamatsu H, Sasaki Y, Takeoka S, Kishi M, Mizutani H, Sano A, Hirokawa K, Nakata S, Matsunaga K. Cutaneous Malassezia microbiota of healthy subjects differ by sex, body part and season. J Dermatol. 2010;37(9):786-92. Epub 2010/10/05. doi: 10.1111/j.1346-8138.2010.00913.x. PubMed PMID: 20883362. 356. Savolainen J, Lammintausta K, Kalimo K, Viander M. Candida albicans and atopic dermatitis. Clin Exp Allergy. 1993;23(4):332-9. Epub 1993/04/01. doi: 10.1111/j.1365- 2222.1993.tb00331.x. PubMed PMID: 8319131. 357. Morita E, Hide M, Yoneya Y, Kannbe M, Tanaka A, Yamamoto S. An assessment of the role of Candida albicans antigen in atopic dermatitis. The Journal of Dermatology. 1999;26(5):282-7. doi: 10.1111/j.1346-8138.1999.tb03473.x. 358. Wichmann K, Heratizadeh A, Werfel T. In-vitro diagnostic in atopic dermatitis: Options and limitations. Allergol Select. 2017;1(2):150-9. Epub 2017/04/07. doi: 10.5414/alx01549e. PubMed PMID: 30402613; PMCID: PMC6040009. 359. Glatz M, Buchner M, von Bartenwerffer W, Schmid-Grendelmeier P, Worm M, Hedderich J, Folster-Holst R. Malassezia spp.-specific immunoglobulin E level is a marker for severity of atopic dermatitis in adults. Acta Derm Venereol. 2015;95(2):191-6. Epub 2014/04/04. doi: 10.2340/00015555-1864. PubMed PMID: 24696225. 360. Sparber F, De Gregorio C, Steckholzer S, Ferreira FM, Dolowschiak T, Ruchti F, Kirchner FR, Mertens S, Prinz I, Joller N, Buch T, Glatz M, Sallusto F, LeibundGut- Landmann S. The Skin Commensal Yeast Malassezia Triggers a Type 17 Response that Coordinates Anti-fungal Immunity and Exacerbates Skin Inflammation. Cell Host Microbe. 2019;25(3):389-403 e6. Epub 2019/03/15. doi: 10.1016/j.chom.2019.02.002. PubMed PMID: 30870621. 361. Santiago-Rodriguez TM, Ly M, Bonilla N, Pride DT. The human urine virome in association with urinary tract infections. Front Microbiol. 2015;6:14. Epub 2015/02/11. doi: 10.3389/fmicb.2015.00014. PubMed PMID: 25667584; PMCID: PMC4304238. 362. Seegraber M, Worm M, Werfel T, Svensson A, Novak N, Simon D, Darsow U, Augustin M, Wollenberg A. Recurrent eczema herpeticum - a retrospective European multicenter study evaluating the clinical characteristics of eczema herpeticum cases in atopic dermatitis patients. J Eur Acad Dermatol Venereol. 2019. Epub 2019/11/17. doi: 10.1111/jdv.16090. PubMed PMID: 31733162. 363. Traidl S, Kienlin P, Begemann G, Jing L, Koelle DM, Werfel T, Roesner LM. Patients with atopic dermatitis and history of eczema herpeticum elicit herpes simplex virus-specific type 2 immune responses. J Allergy Clin Immunol. 2018;141(3):1144-7 e5. Epub 2017/11/21. doi: 10.1016/j.jaci.2017.09.048. PubMed PMID: 29155096; PMCID: PMC7028353. 364. Blattner RJ. Molluscum contagiosum: eruptive infection in atopic dermatitis. J Pediatr. 1967;70(6):997-9. Epub 1967/06/01. doi: 10.1016/s0022-3476(67)80277-4. PubMed PMID: 5338092. 365. Damevska K, Emurlai A. Molluscum Contagiosum in a Patient with Atopic Dermatitis. N Engl J Med. 2017;377(21):e30. Epub 2017/11/23. doi: 10.1056/NEJMicm1705273. PubMed PMID: 29166239. 366. Manti S, Amorini M, Cuppari C, Salpietro A, Porcino F, Leonardi S, Giudice MMD, Marseglia G, Caimmi DP, Salpietro C. Filaggrin mutations and Molluscum contagiosum skin infection in patients with atopic dermatitis. Ann Allergy Asthma Immunol.
197 2017;119(5):446-51. Epub 2017/09/04. doi: 10.1016/j.anai.2017.07.019. PubMed PMID: 28866311. 367. Lane JM, Ruben FL, Neff JM, Millar JD. Complications of smallpox vaccination, 1968. N Engl J Med. 1969;281(22):1201-8. Epub 1969/11/27. doi: 10.1056/nejm196911272812201. PubMed PMID: 4186802. 368. von Sonnenburg F, Perona P, Darsow U, Ring J, von Krempelhuber A, Vollmar J, Roesch S, Baedeker N, Kollaritsch H, Chaplin P. Safety and immunogenicity of modified vaccinia Ankara as a smallpox vaccine in people with atopic dermatitis. Vaccine. 2014;32(43):5696-702. Epub 2014/08/26. doi: 10.1016/j.vaccine.2014.08.022. PubMed PMID: 25149431. 369. Petersen BW, Harms TJ, Reynolds MG, Harrison LH. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupational Exposure to Orthopoxviruses - Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2015. MMWR Morb Mortal Wkly Rep. 2016;65(10):257- 62. Epub 2016/03/18. doi: 10.15585/mmwr.mm6510a2. PubMed PMID: 26985679. 370. He Y, Sultana I, Takeda K, Reed JL. Cutaneous Deficiency of Filaggrin and STAT3 Exacerbates Vaccinia Disease In Vivo. PLoS One. 2017;12(1):e0170070. Epub 2017/01/13. doi: 10.1371/journal.pone.0170070. PubMed PMID: 28081250; PMCID: PMC5231274. 371. Oyoshi MK, Venturelli N, Geha RS. Thymic stromal lymphopoietin and IL-33 promote skin inflammation and vaccinia virus replication in a mouse model of atopic dermatitis. J Allergy Clin Immunol. 2016;138(1):283-6. Epub 2016/02/03. doi: 10.1016/j.jaci.2015.12.1304. PubMed PMID: 26830114; PMCID: PMC4931957. 372. Howell MD, Gallo RL, Boguniewicz M, Jones JF, Wong C, Streib JE, Leung DY. Cytokine milieu of atopic dermatitis skin subverts the innate immune response to vaccinia virus. Immunity. 2006;24(3):341-8. Epub 2006/03/21. doi: 10.1016/j.immuni.2006.02.006. PubMed PMID: 16546102. 373. Greenberg RN, Hurley MY, Dinh DV, Mraz S, Vera JG, von Bredow D, von Krempelhuber A, Roesch S, Virgin G, Arndtz-Wiedemann N, Meyer TP, Schmidt D, Nichols R, Young P, Chaplin P. A Multicenter, Open-Label, Controlled Phase II Study to Evaluate Safety and Immunogenicity of MVA Smallpox Vaccine (IMVAMUNE) in 18-40 Year Old Subjects with Diagnosed Atopic Dermatitis. PLoS One. 2015;10(10):e0138348. Epub 2015/10/07. doi: 10.1371/journal.pone.0138348. PubMed PMID: 26439129; PMCID: PMC4595076. 374. Zárate S, Taboada B, Yocupicio-Monroy M, Arias CF. Human Virome. Arch Med Res. 2017;48(8):701-16. Epub 2018/02/02. doi: 10.1016/j.arcmed.2018.01.005. PubMed PMID: 29398104. 375. Kohl C, Brinkmann A, Dabrowski PW, Radonic A, Nitsche A, Kurth A. Protocol for metagenomic virus detection in clinical specimens. Emerg Infect Dis. 2015;21(1):48-57. Epub 2014/12/24. doi: 10.3201/eid2101.140766. PubMed PMID: 25532973; PMCID: PMC4285256. 376. Koskella B, Brockhurst MA. Bacteria-phage coevolution as a driver of ecological and evolutionary processes in microbial communities. FEMS Microbiol Rev. 2014;38(5):916-31. Epub 2014/03/27. doi: 10.1111/1574-6976.12072. PubMed PMID: 24617569.
198 377. Flint J, Racaniello VR, Rall GF, Skalka AM. Principles of Virology, Fourth Edition, Bundle: American Society of Microbiology; 2015. 378. Wang H, Chan HH, Ni MY, Lam WW, Chan WMM, Pang H. Bacteriophage of the Skin Microbiome in Patients with Psoriasis and Healthy Family Controls. J Invest Dermatol. 2020;140(1):182-90 e5. Epub 2019/06/28. doi: 10.1016/j.jid.2019.05.023. PubMed PMID: 31247199. 379. Akturk E, Oliveira H, Santos SB, Costa S, Kuyumcu S, Melo LDR, Azeredo J. Synergistic Action of Phage and Antibiotics: Parameters to Enhance the Killing Efficacy Against Mono and Dual-Species Biofilms. Antibiotics (Basel). 2019;8(3). Epub 2019/07/28. doi: 10.3390/antibiotics8030103. PubMed PMID: 31349628; PMCID: PMC6783858. 380. van Zyl LJ, Abrahams Y, Stander EA, Kirby-McCollough B, Jourdain R, Clavaud C, Breton L, Trindade M. Novel phages of healthy skin metaviromes from South Africa. Sci Rep. 2018;8(1):12265. Epub 2018/08/18. doi: 10.1038/s41598-018-30705-1. PubMed PMID: 30115980; PMCID: PMC6095929. 381. Paez-Espino D, Eloe-Fadrosh EA, Pavlopoulos GA, Thomas AD, Huntemann M, Mikhailova N, Rubin E, Ivanova NN, Kyrpides NC. Uncovering Earth's virome. Nature. 2016;536(7617):425-30. Epub 2016/08/18. doi: 10.1038/nature19094. PubMed PMID: 27533034. 382. Micali G, Lacarrubba F. Eczema Herpeticum. N Engl J Med. 2017;377(7):e9. Epub 2017/08/17. doi: 10.1056/NEJMicm1701668. PubMed PMID: 28813215. 383. van Drongelen V, Haisma EM, Out-Luiting JJ, Nibbering PH, El Ghalbzouri A. Reduced filaggrin expression is accompanied by increased Staphylococcus aureus colonization of epidermal skin models. Clinical And Experimental Allergy: Journal Of The British Society For Allergy And Clinical Immunology. 2014;44(12):1515-24. doi: 10.1111/cea.12443. 384. Son ED, Kim H-J, Park T, Shin K, Bae I-H, Lim K-M, Cho E-G, Lee TR. Staphylococcus aureus inhibits terminal differentiation of normal human keratinocytes by stimulating interleukin-6 secretion. Journal of Dermatological Science. 2014;74(1):64-71. doi: 10.1016/j.jdermsci.2013.12.004. 385. Ohnemus U, Kohrmeyer K, Houdek P, Rohde H, Wladykowski E, Vidal S, Horstkotte MA, Aepfelbacher M, Kirschner N, Behne MJ, Moll I, Brandner JM. Regulation of Epidermal Tight-Junctions (TJ) during Infection with Exfoliative Toxin-Negative Staphylococcus Strains. Journal of Investigative Dermatology. 2008;128(4):906-16. doi: 10.1038/sj.jid.5701070. 386. Evangelista MT, Abad-Casintahan F, Lopez-Villafuerte L. The effect of topical virgin coconut oil on SCORAD index, transepidermal water loss, and skin capacitance in mild to moderate pediatric atopic dermatitis: a randomized, double-blind, clinical trial. Int J Dermatol. 2014;53(1):100-8. Epub 2013/12/11. doi: 10.1111/ijd.12339. PubMed PMID: 24320105. 387. Seite S, Flores GE, Henley JB, Martin R, Zelenkova H, Aguilar L, Fierer N. Microbiome of affected and unaffected skin of patients with atopic dermatitis before and after emollient treatment. J Drugs Dermatol. 2014;13(11):1365-72. Epub 2015/01/22. PubMed PMID: 25607704. 388. Glatz M, Jo JH, Kennedy EA, Polley EC, Segre JA, Simpson EL, Kong HH. Emollient use alters skin barrier and microbes in infants at risk for developing atopic
199 dermatitis. PLoS One. 2018;13(2):e0192443. Epub 2018/03/01. doi: 10.1371/journal.pone.0192443. PubMed PMID: 29489859; PMCID: PMC5830298. 389. Tajiri T, Matsumoto H, Hiraumi H, Ikeda H, Morita K, Izuhara K, Ono J, Ohta S, Ito I, Oguma T, Nakaji H, Inoue H, Iwata T, Nagasaki T, Kanemitsu Y, Ito J, Niimi A, Mishima M. Efficacy of omalizumab in eosinophilic chronic rhinosinusitis patients with asthma. Ann Allergy Asthma Immunol. 2013;110(5):387-8. Epub 2013/04/30. doi: 10.1016/j.anai.2013.01.024. PubMed PMID: 23622013. 390. Batoni G, Maisetta G, Esin S. Antimicrobial peptides and their interaction with biofilms of medically relevant bacteria. Biochim Biophys Acta. 2016;1858(5):1044-60. Epub 2015/11/04. doi: 10.1016/j.bbamem.2015.10.013. PubMed PMID: 26525663. 391. Haisma EM, de Breij A, Chan H, van Dissel JT, Drijfhout JW, Hiemstra PS, El Ghalbzouri A, Nibbering PH. LL-37-derived peptides eradicate multidrug-resistant Staphylococcus aureus from thermally wounded human skin equivalents. Antimicrob Agents Chemother. 2014;58(8):4411-9. Epub 2014/05/21. doi: 10.1128/AAC.02554-14. PubMed PMID: 24841266; PMCID: PMC4136056. 392. Glatthardt T, Campos JCM, Chamon RC, de Sa Coimbra TF, Rocha GA, de Melo MAF, Parente TE, Lobo LA, Antunes LCM, Dos Santos KRN, Ferreira RBR. Small Molecules Produced by Commensal Staphylococcus epidermidis Disrupt Formation of Biofilms by Staphylococcus aureus. Appl Environ Microbiol. 2020;86(5). Epub 2019/12/22. doi: 10.1128/aem.02539-19. PubMed PMID: 31862721; PMCID: PMC7028967. 393. Ciandrini E, Morroni G, Cirioni O, Kamysz W, Kamysz E, Brescini L, Baffone W, Campana R. Synergic combinations of antimicrobial peptides (AMPs) against biofilms of methicillin-resistant Staphylococcus aureus (MRSA) on polystyrene and medical devices. J Glob Antimicrob Resist. 2019. Epub 2019/11/05. doi: 10.1016/j.jgar.2019.10.022. PubMed PMID: 31678322. 394. Myles IA, Williams KW, Reckhow JD, Jammeh ML, Pincus NB, Sastalla I, Saleem D, Stone KD, Datta SK. Transplantation of human skin microbiota in models of atopic dermatitis. JCI Insight. 2016;1(10). doi: 10.1172/jci.insight.86955. PubMed PMID: 27478874; PMCID: PMC4963067. 395. Parola C, Salogni L, Vaira X, Scutera S, Somma P, Salvi V, Musso T, Tabbia G, Bardessono M, Pasquali C, Mantovani A, Sozzani S, Bosisio D. Selective activation of human dendritic cells by OM-85 through a NF-kB and MAPK dependent pathway. PLoS One. 2013;8(12):e82867. Epub 2014/01/05. doi: 10.1371/journal.pone.0082867. PubMed PMID: 24386121; PMCID: PMC3875422. 396. Koatz AM, Coe NA, Ciceran A, Alter AJ. Clinical and Immunological Benefits of OM-85 Bacterial Lysate in Patients with Allergic Rhinitis, Asthma, and COPD and Recurrent Respiratory Infections. Lung. 2016;194(4):687-97. Epub 2016/04/28. doi: 10.1007/s00408-016-9880-5. PubMed PMID: 27117798. 397. Esposito S, Bianchini S, Bosis S, Tagliabue C, Coro I, Argentiero A, Principi N. A randomized, placebo-controlled, double-blinded, single-centre, phase IV trial to assess the efficacy and safety of OM-85 in children suffering from recurrent respiratory tract infections. J Transl Med. 2019;17(1):284. Epub 2019/08/25. doi: 10.1186/s12967-019- 2040-y. PubMed PMID: 31443716; PMCID: PMC6708164. 398. Bodemer C, Guillet G, Cambazard F, Boralevi F, Ballarini S, Milliet C, Bertuccio P, La Vecchia C, Bach JF, de Prost Y. Adjuvant treatment with the bacterial lysate (OM-85)
200 improves management of atopic dermatitis: A randomized study. PLoS One. 2017;12(3):e0161555. Epub 2017/03/24. doi: 10.1371/journal.pone.0161555. PubMed PMID: 28333952; PMCID: PMC5363804. 399. Kim J, Kim BE, Ahn K, Leung DYM. Interactions Between Atopic Dermatitis and Staphylococcus aureus Infection: Clinical Implications. Allergy Asthma Immunol Res. 2019;11(5):593-603. Epub 2019/07/25. doi: 10.4168/aair.2019.11.5.593. PubMed PMID: 31332972; PMCID: PMC6658404. 400. Eriksson S, van der Plas MJA, Morgelin M, Sonesson A. Antibacterial and antibiofilm effects of sodium hypochlorite against Staphylococcus aureus isolates derived from patients with atopic dermatitis. Br J Dermatol. 2017;177(2):513-21. Epub 2017/02/27. doi: 10.1111/bjd.15410. PubMed PMID: 28238217. 401. Li R, Hadi S, Guttman-Yassky E. Current and emerging biologic and small molecule therapies for atopic dermatitis. Expert Opin Biol Ther. 2019;19(4):367-80. Epub 2019/01/24. doi: 10.1080/14712598.2019.1573422. PubMed PMID: 30672355. 402. Callewaert C, Nakatsuji T, Knight R, Kosciolek T, Vrbanac A, Kotol P, Ardeleanu M, Hultsch T, Guttman-Yassky E, Bissonnette R, Silverberg JI, Krueger J, Menter A, Graham NMH, Pirozzi G, Hamilton JD, Gallo RL. IL-4Ralpha Blockade by Dupilumab Decreases Staphylococcus aureus Colonization and Increases Microbial Diversity in Atopic Dermatitis. J Invest Dermatol. 2020;140(1):191-202.e7. Epub 2019/06/30. doi: 10.1016/j.jid.2019.05.024. PubMed PMID: 31252032. 403. Simpson EL, Bieber T, Guttman-Yassky E, Beck LA, Blauvelt A, Cork MJ, Silverberg JI, Deleuran M, Kataoka Y, Lacour JP, Kingo K, Worm M, Poulin Y, Wollenberg A, Soo Y, Graham NM, Pirozzi G, Akinlade B, Staudinger H, Mastey V, Eckert L, Gadkari A, Stahl N, Yancopoulos GD, Ardeleanu M, Solo, Investigators S. Two Phase 3 Trials of Dupilumab versus Placebo in Atopic Dermatitis. N Engl J Med. 2016;375(24):2335-48. Epub 2016/10/04. doi: 10.1056/NEJMoa1610020. PubMed PMID: 27690741. 404. Blauvelt A, de Bruin-Weller M, Gooderham M, Cather JC, Weisman J, Pariser D, Simpson EL, Papp KA, Hong HC, Rubel D, Foley P, Prens E, Griffiths CEM, Etoh T, Pinto PH, Pujol RM, Szepietowski JC, Ettler K, Kemeny L, Zhu X, Akinlade B, Hultsch T, Mastey V, Gadkari A, Eckert L, Amin N, Graham NMH, Pirozzi G, Stahl N, Yancopoulos GD, Shumel B. Long-term management of moderate-to-severe atopic dermatitis with dupilumab and concomitant topical corticosteroids (LIBERTY AD CHRONOS): a 1-year, randomised, double-blinded, placebo-controlled, phase 3 trial. Lancet. 2017;389(10086):2287-303. Epub 2017/05/10. doi: 10.1016/s0140-6736(17)31191-1. PubMed PMID: 28478972. 405. Yu C, Wang K, Cui X, Lu L, Dong J, Wang M, Gao X. Clinical Efficacy and Safety of Omalizumab in the Treatment of Allergic Rhinitis: A Systematic Review and Meta- analysis of Randomized Clinical Trials. Am J Rhinol Allergy. 2020;34(2):196-208. Epub 2019/11/02. doi: 10.1177/1945892419884774. PubMed PMID: 31672020. 406. Brandstrom J, Vetander M, Lilja G, Johansson SG, Sundqvist AC, Kalm F, Nilsson C, Nopp A. Individually dosed omalizumab: an effective treatment for severe peanut allergy. Clin Exp Allergy. 2017;47(4):540-50. Epub 2016/11/25. doi: 10.1111/cea.12862. PubMed PMID: 27883239. 407. Romano C, Sellitto A, De Fanis U, Balestrieri A, Savoia A, Abbadessa S, Astarita C, Lucivero G. Omalizumab for difficult-to-treat dermatological conditions: clinical and immunological features from a retrospective real-life experience. Clin Drug Investig.
201 2015;35(3):159-68. Epub 2015/01/13. doi: 10.1007/s40261-015-0267-9. PubMed PMID: 25578818. 408. Chan S, Cornelius V, Cro S, Harper JI, Lack G. Treatment Effect of Omalizumab on Severe Pediatric Atopic Dermatitis: The ADAPT Randomized Clinical Trial. JAMA Pediatr. 2019. Epub 2019/11/26. doi: 10.1001/jamapediatrics.2019.4476. PubMed PMID: 31764962; PMCID: PMC6902112. 409. Leung DY, Harbeck R, Bina P, Reiser RF, Yang E, Norris DA, Hanifin JM, Sampson HA. Presence of IgE antibodies to staphylococcal exotoxins on the skin of patients with atopic dermatitis. Evidence for a new group of allergens. J Clin Invest. 1993;92(3):1374-80. doi: 10.1172/JCI116711. 410. Bunikowski R, Mielke M, Skarabis H, Herz U, Bergmann RL, Wahn U, Renz H. Prevalence and role of serum IgE antibodies to the Staphylococcus aureus-derived superantigens SEA and SEB in children with atopic dermatitis. J Allergy Clin Immunol. 1999;103(1 Pt 1):119-24. Epub 1999/01/20. doi: 10.1016/s0091-6749(99)70535-x. PubMed PMID: 9893195. 411. Jackson K, Bahna SL. Hypersensitivity and adverse reactions to biologics for asthma and allergic diseases. Expert Rev Clin Immunol. 2020;16(3):311-9. Epub 2020/01/30. doi: 10.1080/1744666x.2020.1724089. PubMed PMID: 31994421. 412. Wu J, Guttman-Yassky E. Efficacy of biologics in atopic dermatitis. Expert Opin Biol Ther. 2020:1-14. Epub 2020/02/01. doi: 10.1080/14712598.2020.1722998. PubMed PMID: 32003247. 413. Chen YL, Gutowska-Owsiak D, Hardman CS, Westmoreland M, MacKenzie T, Cifuentes L, Waithe D, Lloyd-Lavery A, Marquette A, Londei M, Ogg G. Proof-of-concept clinical trial of etokimab shows a key role for IL-33 in atopic dermatitis pathogenesis. Sci Transl Med. 2019;11(515). Epub 2019/10/28. doi: 10.1126/scitranslmed.aax2945. PubMed PMID: 31645451. 414. Yin H, Li X, Hu S, Liu T, Yuan B, Ni Q, Lan F, Luo X, Gu H, Zheng F. IL-33 promotes Staphylococcus aureus-infected wound healing in mice. International Immunopharmacology. 2013;17(2):432-8. doi: 10.1016/j.intimp.2013.07.008. 415. Yin H, Li X, Hu S, Liu T, Yuan B, Gu H, Ni Q, Zhang X, Zheng F. IL-33 accelerates cutaneous wound healing involved in upregulation of alternatively activated macrophages. Mol Immunol. 2013;56(4):347-53. doi: 10.1016/j.molimm.2013.05.225. 416. Wulff BC, Pappa NK, Wilgus TA. Interleukin-33 encourages scar formation in murine fetal skin wounds. Wound Repair Regen. 2019;27(1):19-28. Epub 2018/10/29. doi: 10.1111/wrr.12687. PubMed PMID: 30368969; PMCID: PMC6448156. 417. Molofsky AB, Savage AK, Locksley RM. Interleukin-33 in Tissue Homeostasis, Injury, and Inflammation. Immunity. 2015;42(6):1005-19. Epub 2015/06/18. doi: 10.1016/j.immuni.2015.06.006. PubMed PMID: 26084021; PMCID: PMC4471869. 418. Sun Z, Huang S, Zhu P, Yue F, Zhao H, Yang M, Niu Y, Jing G, Su X, Li H, Callewaert C, Knight R, Liu J, Smith E, Wei K, Xu J. A Microbiome-Based Index for Assessing Skin Health and Treatment Effects for Atopic Dermatitis in Children. mSystems. 2019;4(4). Epub 2019/08/23. doi: 10.1128/mSystems.00293-19. PubMed PMID: 31431508; PMCID: PMC6702293. 419. Reiger M, Traidl-Hoffmann C, Neumann AU. The skin microbiome as a clinical biomarker in atopic eczema: Promises, navigation, and pitfalls. J Allergy Clin Immunol.
202 2020;145(1):93-6. Epub 2020/01/09. doi: 10.1016/j.jaci.2019.11.004. PubMed PMID: 31910987. 420. Greninger AL. The challenge of diagnostic metagenomics. Expert Rev Mol Diagn. 2018;18(7):605-15. Epub 2018/06/15. doi: 10.1080/14737159.2018.1487292. PubMed PMID: 29898605.
203 ǤǤ Ȁ
An in vitro proof-of-principle study of sonobactericide
Kirby R. Lattweinͷǡǡǡ ǡ ǤǤǡGonzalezͺǡ Ǥ ͺǡǤ & Klazina ͷ Received: 23 June 2017 ȋ Ȍ Ǥ Accepted: 6 February 2018 Staphylococcus aureusȋS. aureusȌǡ Published: xx xx xxxx ȋƤȌǤ in vitroƪǡ ǡ Ǥ ƤǦ Ǧ S. aureusȋ ȌǤ Ǧ ƤƤǦ Ǥ ƪ ͶǦ Ǥ ƪơ ǣ ȋ Ȍǡ ȋǦǢ Ȍǡ Ǧ Ǧ ȋͷͶǦ ǡͶǤͺͺǦǦȌǡ ȋƤȌǤ ǡǦǡǡ Ƥ ͿͿǤ±ͷǤͽάǡ Ǥƫ Ǥ Ǥ
Infective endocarditis (IE) is a life-threatening microbial infection of the heart valves and surrounding tissue, including endocardial prosthetic material. IE is associated with high morbidity and mortality (15–40% in-hospital and 40–69% 5-year mortality)1–4. Current standard treatment for IE consists of prolonged, intensive intravenous antibiotic therapy2. IE is characterized by valvular vegetations (biofilms) composed primarily of a thrombus-like mesh con- sisting of platelets, fibrin, extracellular polymeric substance, and bacteria at different stages of replication5,6. Staphylococcal, streptococcal, and enterococcal species of bacteria have been implicated as the primary cause of IE1,2. Staphylococcus aureus (S. aureus) has been reported to have the single highest prevalence (30–31%) in IE1 and is associated with the highest mortality and worst prognosis. These bacteria initiate colonization by adhering to microthrombi present on valves, caused either by endothelial inflammation, mechanical damage, or spontane- ous formation on intact valvular surfaces1,5,7. High-risk surgical procedures may be required to treat IE, but this treatment is contraindicated in a large population of patients3. The presence of bacterial biofilm makes treatment challenging due to increased resist- ance to antibiotic action and the presence of bacteria in a dormant metabolic state. Bacteria situated within bio- films can be 100–1,000-fold less susceptible to antibiotics than the planktonic bacteria released from biofilms8,9. Furthermore, prolonged, high-dose antibiotic therapy paradoxically preserves persister cells within a biofilm that are tolerant to antibiotics9. When antibiotic therapy has concluded, persisters can switch phenotype and produce new biofilm, thereby reinitiating infection9. Adjuvant therapies for IE are desperately needed. To treat various bacteria, both planktonic and residing in biofilms, other groups have successfully used low-frequency ultrasound (US) [≤1 MHz] combined with antibiotics10–14. Acoustic cavitation and streaming have been identified as the dominant mechanisms for what appears as an increase in antibiotic efficacy and penetration into biofilms. However, these studies have employed high acoustic pressures to induce inertial cavitation, which could induce undesirable bioeffects15. Using ultrasound contrast agents (UCAs) as cavitation nuclei reduces the
ͷ ǡ ǡǡͶǡǤǤͶͺͶǡͶͶͶ ǡǡǤDepartment of Internal Medicine, Division of Cardiovascular Health and ǡ ǡ ǡǡǤDepartment of Medical Microbiology and Infectious ǡǡǡǤͺCincinnati Children’s Hospital Medical Center, Division of ǡ ǡ ǡ ǡǡǤ ǤǤǤȋǣǤ̻ Ǥ)
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 1 www.nature.com/scientificreports/
Figure 1. Cross-sectional histological staining and confocal laser scanning microscopy of the infected clot model. Both a and b are each composed of two combined microscope images acquired at 40x magnification. (a) Image of H&E staining of an infected clot cross-section. The arrowhead indicates bacteria (purple), the arrow points at fibrin (pink), and a dashed-line arrow at erythrocytes (red). (b) Crystal violet staining, where an arrowhead indicates bacteria (purple), an arrow for fibrin (yellow), and a dashed-line arrow for erythrocytes (brown). (c) ImageJ maximum intensity projection of live (green, SYTO 9 stained) and dead (red, PI stained) S. aureus comprising the outer layer of a representative infected clot.
acoustic pressure threshold for producing cavitation16, which could help translate this therapy to the clinic. UCAs are composed of encapsulated gas microbubbles (MBs; 1–10 μm in diameter) that oscillate volumetrically in response to US pressure variations, a phenomenon known as acoustic cavitation17. Cavitation of MBs has been shown to enhance US-induced bioeffects, which include drugdelivery, cell death, and dissolution of thrombi (sonothrombolysis), by mechanisms such as enhanced fluid transport, sonoporation, and stimulated endocyto- sis17–20. Other investigators have tested the use of US in combination with MBs for enhancing biofilm degrada- tion21–24. However, these studies have not evaluated the potential to enhance treatment of IE biofilms either by US, or US with UCAs. In this paper, we report the results of a translatable, proof-of-principle study for treating S. aureus IE biofilms in an in vitro flow model. This treatment strategy that we have termed sonobactericide, combines US exposure and an UCA, with or without antibiotics or other therapeutics, to treat IE infections. A therapeutic of interest could be recombinant tissue plasminogen activator (rt-PA), a thrombolytic agent, because successful treatment of paediatric patients with IE has been reported previously25–28. We hypothesized that combination treatment with an antibiotic and a thrombolytic, in the presence of US and UCAs, will enhance the efficacy ofS. aureus IE biofilm treatment. To test this hypothesisin vitro, we developed an infected clot model using S. aureus from an IE patient and human whole blood to replicate the in vivo early pathogenesis of IE. Infected clots were treated over a 30-minute period using an in vitro flow model equipped with time-lapse microscopy29,30. Infected clots were exposed to continuous human plasma flow either alone or with different combinations of the following: oxacillin (the antibiotic used clinically for the treatment of staphylococcal IE infections31,32), rt-PA, UCA Definity, and intermittent continuous-wave US. The cavitation activity nucleated by UCA was monitored using a passive detector. Treatment efficacy was assessed by measuring eth infected clot width loss by bright-field microscopy. In addition, the particle size profile of the effluent produced by treatment was characterized to assess the likelihood of emboli formation. Results Ǥ TheS. aureus IE clinical isolate used in this study was found to have the spa-type t021. Oxacillin susceptibility was determined to be less than 2 μg/mL, thereby classifying it as methicil- lin-susceptible. The S. epidermidis quality control strain was resistant to all oxacillin concentrations, which is in accordance to its already well-known methicillin-resistant status. A growth curve indicating the lag, exponential, and stationary phase was completed for the S. aureus IE isolate in Iscove’s Modified Dulbecco’s Medium (IMDM). Based on this curve, all inoculums were prepared for experiments when bacteria were in the mid-exponential growth phase, around an optical density at 600 nm (OD600nm) of 1. Ǥ Close inspection of the infected clots at high magnification showed a biofilm outer layer consisting of fibrin-embeddedStaphylococci (Fig. 1a,b). Directly below the dense matrix of large quantities of bacteria within the fibrin mesh was a layer of fibrin. The inner portions of the clots were comprised of fibrin, sporadic immune cells, and predominately erythrocytes. Additionally, locations further from the clot core contained fewer erythrocytes, and an increasing amount of fibrin, seen in both the haematoxylin-eosin (H&E) and crystal violet (CV) staining (Fig. 1a,b). CV staining confirmed the location and presence of staphylococcal bacteria, because on a cellular level only gram-positive bacteria are stained purple (Fig. 1b). Of additional note, the iodine in the CV resulted in the staining of the eryth- rocytes brown and the fibrin yellow.
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 2 www.nature.com/scientificreports/
Figure 2. H&E histology of infected and control clot cross-sections. (a1-3) Infected clot, (b1-3) sterile, retracted clot, and (c1-3) sterile, retracted clot incubated 24 hr in sterile hFFP. The boxes with a solid black line in a1, b1, c1, represent the border region of zoomed-in focus for the images to the right (a2, b2, c2). The dashed line boxes represent the zoomed-in area of the clot by the suture for the corresponding images to the far right (a3, b3, c3). Black arrows indicate a suture thread (light grey). Images (a1, b1, c1) are at 10x magnification, and the rest (a2-3, b2-3, c2-3) are at 40x magnification.
The interpretation of the living status of the infected clot bacteria could not be obtained from H&E and CV histological staining. Therefore, confocal laser scanning microscopy (CLSM) with two fluorescent markers was used to determine if bacteria were viable before flow experiments. In each case, the biofilms lining the clots were made up of predominately viable bacteria of 0.5–1 μm spheres (-cocci) (see Fig. 1c; fluorescently labelled green by Syto 9). Dead bacteria (fluorescently labelled red by propidium iodide) were present, however at substantially lower numbers than viable bacteria. Corresponding to the histology, the thickness of the biofilms was not homo- geneous. Additionally, the biofilm structure did not appear completely intact in some places (e.g. bottom left corner, Fig. 1c). Occasionally observed, most likely due to green auto-fluorescence, were rod-shaped fibre-like chains, suggesting fibrin, and round objects larger than bacteria, suggesting erythrocytes, immune cells, or pos- sibly platelets.
Ǥ When examining the H&E staining that was performed at the same time for all infected and control clots, the infected clots, though from a different batch, had similar morphology (Fig. 2a1–a3) to the previous stained specimens (Fig. 1a). Briefly, a biofilm composed of bacteria encased the fibrin mesh on the outer layer of the clots. Directly below the biofilm was a thick fibrin layer; and below the biofilm layer, the number of erythrocytes present increased towards the predominately erythrocyte core (Fig. 2). The suture (top right in Fig. 2a1–a3) supporting the infected clot was also lined in a fibrin layer and biofilm (Fig. 2a3). The biofilm was heterogeneous with varying thickness. The control clots (Fig. 2b1,c1) were structurally and morphologically different from the infected clots. The sterile retracted clots consisted of a porous perimeter surrounding a dense erythrocyte core (Fig. 2b1). The outer most layer of the perimeter appears to be less porous than the rest of the inner region (Fig. 2b2). This less porous outer layer is more prominent in the ster- ile retracted clots incubated 24 h in human fresh-frozen plasma (hFFP; Fig. 2c2). This clot was also devoid of the dense core seen in the sterile retracted clot not incubated with plasma. The sutures are eccentric in the infected clot compared to the controls (Fig. 2a3–c3). Additionally, both the infected clot core and the sterile, retracted clot have tear streaks; with multiple found in the infected clot core (Fig. 2a1) and two streaks, one from the left side of the suture to the outside and the other to the right of the suture, of the sterile clot (at 12 o’clock in Fig. 2b1).
Ǥ In this study, infected clots were subjected to different combinations of therapeutics (oxacillin, rt-PA, intermittent continuous-wave 120-kHz US, and UCA Definity), while subjected to plasma flow under controlled conditions. The infected clots had an average diameter
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 3 www.nature.com/scientificreports/
Figure 3. Fractional infected clot loss following different treatments. Boxes represent the interquartile range. The lines within the boxes represent the median and the whiskers indicate 1.5 times the interquartile range. The dot depicts an outlier as determined using the Tukey method. A single asterisk (p< 0.05) or three asterisks (p < 0.001) with a solid line above the boxes represent a statistically significant difference with the plasma alone, the plasma with ultrasound, and the plasma, ultrasound, and Definity treatment groups. The different treatment conditions are given in the table below the graph. N = 9 for all treatments, with the exception of the plasma and ultrasound treated group (n = 10).
of 442.2 μm ± 47.6 SD with no significant differences between the treatment groups. The fractional infected clot width loss (FICL) over 30 min treatment was used to quantify the extent of degradation, and was computed using custom automated computer image analysis of the time-lapse microscopy images. As seen in Fig. 3, infected clot degradation is reported as the percentage decrease in infected clot diameter at 30 min. A perfusate flow rate of 0.65 mL/min provided minimal degradation of infected clots due to mechanical shear stress and endoge- nous tissue plasminogen activator from plasma flow alone, thus providing us with a stable, reproducible control. When rt-PA and oxacillin were added to the plasma, infected clot width loss appeared highly variable, ranging from minimal (6.2%) to full clot width loss, i.e. 100% FICL. Similar amounts of degradation as the plasma alone group were seen when US alone under plasma flow was used as treatment. The addition of rt-PA and oxacillin to the perfusate of the US group demonstrated a high level of variability (−14.8–99.9%), similar to the rt-PA and oxacillin without US treatment. The addition of Definity to the plasma and US did not result in large amounts of infected clot degradation (<20%). However, Definity added to the plasma, rt-PA, oxacillin, and US perfusate treatment group resulted in an almost complete loss for all infected clots (99.3 ± 1.7%). This was statistically significantly different than the plasma, US, and Definity treated clots without the rt-PA and oxacillin addition.
Ǧ Ǥ In addition to the transverse visualization of the clots during the 30 min time-lapse imaging, a longitudinal perspective was also obtained directly after experiments using light microscopy and a colour camera. Following experiments with plasma alone, the structure of the infected clots appeared intact and adherent to the suture (Fig. 4a). At a higher magnification, the biofilm was visible and observed to be surrounding both the clot (red) and suture (horizontal black line) (Fig. 4b). The images of infected clots treated with plasma alone were consistent with histological findings. Infected clots were composed of a somewhat dense core becoming less dense towards the outer perimeter, and the biofilm as the outermost layer. When infected clots were treated with rt-PA and oxacillin in combination with the plasma, the border of the clot was no longer smooth, but irregular in shape and also appeared less dense (Fig. 4c). This border irregularity was also observed with the monochromatic camera during time-lapse imaging appearing as a rolling-adhesion type motion of fibrin degradation products down the length of the clot. However, the camera and experimental set-up did not allow for capturing the complete length of the clot. After treatment with all therapeutics combined, US exposure, Definity, rt-PA, and oxacillin, revealed a visibly bare suture (Fig. 4d).
Ǥ Two different types of cavitation energies, ultraharmonic (UH) and broadband (BB), were detected with the passive cavitation detector (PCD), demonstrating the presence of both stable and inertial cavitation. When US without Definity was used in treatment groups, very low levels of cavitation were detected for both types of energy (Fig. 5a,b). The addition of Definity resulted in significant higher levels of UH energy (Fig. 5a), indicating stable cavitation. Additionally, these three treatment groups with Definity exhibited signifi- cantly higher UH energy than BB (Fig. 5a,b), which indicates more stable than inertial cavitation. Both UH and BB cavitation was observed to be higher in the Definity, rt-PA and oxacillin treated infected clots, albeit not a significant difference from the other two treatment groups which included Definity.
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 4 www.nature.com/scientificreports/
Figure 4. Bright-field light microscopy imaging of infected clots acquired directly following treatment. Infected clot treated only with plasma at 4x (a) and at 10x magnification b( ). The black arrow in imageb points out the biofilm (beige). (c) A plasma, rt-PA, and oxacillin treated infected clot at 4x magnification. d( ) A plasma, rt-PA, oxacillin, ultrasound, and Definity treated infected clot at 4x magnification. The sutures (black line) are situated at the bottom of the clots, which can be observed to the right of the clot in images a–c.
Figure 5. The ultraharmonic a( ) and broadband (b) cavitation energy detected by the passive cavitation detector in response to 120-kHz ultrasound insonification. Boxes represent the interquartile range. The lines within the boxes represent the median and the whiskers indicate 1.5 times the interquartile range. Black circles depict outliers as determined using the Tukey method. A single asterisk (p < 0.05) above a dashed line represents a statistically significant difference between eth ultraharmonic and broadband energies of the same treatment group. Two asterisks (p < 0.01) represent a statistically significant difference of ultraharmonic energy between the group and the ultrasound without Definity groups. The different treatment conditions are given in the table below the graph.
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 5 www.nature.com/scientificreports/
Figure 6. Effluent characterization using particle size measurement with the Coulter counter. Colours and line style represent different treatment groups with yellow indicating no rt-PA or oxacillin, red indicating rt-PA without oxacillin, and blue indicating oxacillin addition (n = 3 per group; line represents the average). Dashed lines indicate treatment with ultrasound; dotted lines indicate treatment with ultrasound and Definity. The number-weighted particle size distribution is shown with the background subtracted. US = ultrasound and OXA = oxacillin.
ƫ Ǥ The number-weighted size distribution of effluent particles, measured directly following treatment, is shown in Fig. 6. The largest particle size detected was 10.4μ m, and 99.6% of the particles were smaller than 5 μm. The plasma treatment alone had the lowest number of particle counts, and the infected clots treated with US, Definity, rt-PA, and oxacillin had the largest amount of counts. Note that the small- est particle-sizing bin of the Coulter counter had a diameter of 0.6 μm. This proof-of-principle study reports the potential efficacy of sonobactericide, combined with antibiotics and rt-PA, to enhance the treatment of bacterial infected clots in an in vitro flow model. In addition, this study also reports on the methods used to create a translatable in vitro infected clot model using human and bacterial prod- ucts, on the basis of the IE isolate, methodology of infected clot, histology, and flow media, to mimic the known early pathogenesis of IE. To model the in vivo situation, a methicillin-susceptible S. aureus isolate that originated from an IE patient was used. A clinical IE isolate was chosen for translatability by ensuring the bacteria had the necessary factors to induce IE in a patient, because non-IE originating isolates may lack the bacterial characteristics necessary for proper adherence (e.g. adhesins, fibronectin-, and fibrinogen-binding proteins) to host micro-thrombi to induce IE33,34. The isolate’sspa -type t021 has previously been isolated from IE35. Although we did not directly perform an in-depth virulence factor analysis of this isolate, it has been demonstrated previously that isolates (N = 105) originating from IE patients from different countries all contained the same surface-associated adhesins shown to be important for the invasiveness and development of IE (clfA, clfB, fnbA, and sdrC)36,37. Additionally, these factors important for IE development are highly conserved38. S. aureus is a known producer of coagulase, an enzyme that converts soluble fibrinogen into fibrin39. This fibrin scaffold allows the bacteria to encase themselves in a protective structure, consisting of bacterial and host components40,41. A marked presence of gram-positive bacterial colonies encapsulated in fibrin is seen in our histology (Figs 1 and 2), which is consistent with that of IE in in vivo animal models and human surgically excised valves5,41–45. The progression of the presence of microthrombi on heart valves into IE biofilms is dependent on bacterial adherence to these initial clots7,41. Two previous studies developed infected clots as an in vitro model of IE, using a mix of human, animal, and synthetic products46,47. McGarth et al.46 suspended bacteria in an eppendorf tube with a fibrin glue recipe consisting of human cryoprecipitate, bovine thrombin, monofilament line, and calcium chlo- ride to create infected clots. Another study reported by Palmer, et al.47 modified the previous method to include platelets and aprotinin (bovine) solution. Our study used infected retracted human blood clots, and the only synthetic media used was IMDM, which both may allow for bacterial adherence that better mimics the human situation in vivo. Additionally, this methodology resembles the early pathogenesis of IE, in which micro-thrombi are formed on heart valves first and then bacteria adhere and subsequently grow into an IE biofilm1,5,7. Human cell culture media for growing bacteria have previously been used48–50. IMDM was chosen because it emulates the iron-restricted environment in vivo. Iron restriction leads to the upregulation of virulence factors which would not be present if grown in a traditional iron rich bacterial growth media51. Histology and live cell imaging revealed that the morphology of infected clots reported in our study (Figs 1a,b and 2) were consistent with the pattern of biofilm growth6 and resembled the structure of IE biofilms found in animal and patient samples5. Though limited polymorphonuclear (PMN) leukocytes are seen in our histology, neutrophilic inflammation is commonly mentioned in histopathologic findings in vivo. However, this inflamma- tion is seen with regards to the valve tissue itself, resulting from endocardial injury1. Furthermore, it is well estab- lished in vivo that biofilm in IE represents a zone of localized agranulocytosis and that it would be rare that PMNs would be able to come into direct contact with the fibrin embedded bacteria43,44. This is supported by the clear separation of bacterial colonies and PMNs seen in histologic studies of animal and human IE biofilms5,41,42,45.
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 6 www.nature.com/scientificreports/
Heterogeneous accumulation of bacteria is evident in the confocal microscopy images of the biofilm (e.g. bottom left corner, Fig. 1c) which is not contiguous in some places. This irregularity could also be due to the friable nature of infected clots after thin sample preparation, which could have been damaged during transport from fluorescent staining to the CLSM system or during the image capturing process. It is widely known that the efficiency of a drug given intravenously can be affected by binding of the drug to plasma proteins52. Our flow model included the interaction of oxacillin with plasma proteins and inhibition of fibrinolysis with plasminogen activator inhibitor (e.g. PAI-1) and antiplasmin53 since we used human plasma as our flow media. Additionally, MB oscillations can be affected by the viscosity of the surrounding medium, with damping occurring with increased viscosity54. Thus, inclusion of human plasma in our flow studies provided a test of the therapeutic effect of sonobactericide in the presence of a higher viscosity fluid approximating whole blood. It has been demonstrated that IE biofilmsin vivo form and generally exist on the low-pressure chamber side of valves55. This side of the valves are exposed to normal and regurgitant jet flow, however early IE biofilms are located beside the jet flows where low velocities exist56. Additionally, a range of velocities (0 to 45 cm/s over one cardiac cycle) have been reported across the mitral valve57, which is a common site of IE. We chose 0.3 cm/s for all experiments in the in vitro set-up because 1) this is within range of flow speeds experienced by IE biofilms; and 2) this presents the worst-case scenario for the therapeutic outcome58–60. Additionally, the rate of penetration of therapeutics (both rt-PA and the antibiotic), replenishment of microbubbles as cavitation nuclei, and the removal of fibrin degradation products occurs is proportional to the flow conditions58–60, meaning the rate is slow under low flow conditions and fast under high flow conditions. In this study, US and Definity alone did not enhance infected clot size reduction (Fig. 3). There were some clots that showed negative values for infected clot width loss. The response of clots to the thrombolytic and anti- biotic may appear as growth, when the infected clot is in the early stages of degradation (Fig. 4c). It is likely that these infected clots could have been effectively lysed provided the treatment time was longer than the 30 min period employed in this study. Sustained stable cavitation was harnessed in this study, monitored using a PCD detecting UH and BB emis- sions during 30 min flow experiments. In all cases, we observed significantly more UH than BB cavitation (Fig. 5), indicating more stable than inertial cavitation29, which suggests that unwanted bioeffects may be minimized15. Paradoxically, stable cavitation, which occurs at a lower acoustic pressure amplitude, has been reported to corre- late with enhanced thrombolysis to a greater degree than inertial cavitation in the presence of rt-PA20. Although UH was observed when Definity was combined with US, the addition of oxacillin and rt-PA was necessary to achieve infected clot width loss. The inclusion of rt-PA in combination with oxacillin in our treatment regime likely benefited from this par- ticular lytic’s ability to target fibrin, which is the backbone of IE biofilm5,61,62. The absence of large fibrin deg- radation products liberated during treatment in our study (Fig. 6) suggests minimal risk of embolization from sonobactericide. Nonetheless, filters such as those deployed in vessels downstream of the heart valve during transcatheter aortic valve replacement procedures63 could be used with sonobactericide to prevent embolism. In this study, a 120-kHz frequency was chosen considering that the majority of previous studies for treating bacterial biofilms and clots in the presence of rt-PA have been performed with low frequency US10–14,21–24,64. The intermittent exposure scheme has been reported previously for sonothrombolysis29,65. However, diagnostic cardiac imaging is typically performed using a 2-MHz centre frequency66. Further studies should investigate the feasibility of using dual diagnostic and therapeutic 2-MHz cardiac imaging probes for image-guided treatment of IE. Microbubbles at 1–2 μm in diameter are closer to resonance at 2-MHz than at 120-kHz, therefore lower acoustic pressures could be used to produce sustained stable cavitation, and therefore reduce the likelihood for any negative bioeffects to surrounding tissues. The host immune system response, which includes inflammatory processes, is not adequately represented in our in vitro IE biofilm model. Another limitation is that dynamic flow was not present during the formation of the infected clot. Biofilms developed in a mostly static conditionvs . a dynamic condition can lack robustness67. Additionally, only one isolate was tested in this study. More isolates must be tested in future studies to determine the ability of sonobactericide to treat other species or other isolates of S. aureus causing IE. Finally, this study did not investigate the direct bactericidal capability of sonobactericide in combination with antibiotics and thrombo- lytics, which is important in understanding the true potential of this treatment. However, it is known that bacteria released from mature biofilms become metabolically active and are thus susceptible to antibiotic treatment in the blood stream6,8. Freed bacteria as a result of sonobactericide should be evaluated in future studies. Traditionally, IE is considered a contraindication for thrombolytic treatment in adults31,32. However, is has been shown to be effective in paediatric patients25–28. Unlike other thrombolytics, rt-PA has a high affinity to fibrin and thus provides a more local activation of fibrin-bound plasminogen, therefore decreasing the risk of negative effects due to systemic plasminogen cleavage61,62. Localized delivery of rt-PA to IE biofilms using echo- genic liposomes loaded with rt-PA in combination with an antibiotic could also be a promising strategy to reduce off-target effects65. Lastly, studies in an IE animal model will be necessary to assess the efficacy of sonobactericide in vivo. Nonetheless, the work reported in this paper represents the first time that sonobactericide has been investigated as a possible therapeutic option for infective endocarditis. Accordingly, our primary goal was to determine suit- able treatment conditions and to understand if this approach has potential in a tightly controlled setting. The rationale for using the in vitro model was to allow for precise cavitation monitoring, complete dose control, and to minimize human and microbiological variability in the infected clot. Further advantage of an in vitro model such as ours is constant visibility of the infected clot throughout treatment with time-lapse microscopy. Nevertheless, it has been previously demonstrated that the results of in vitro simulated endocarditis biofilms (infected clots) are comparable to the in vivo rabbit model of endocarditis for the study of fluoroquinolone efficacy, to include pharmacokinetics68.
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 7 www.nature.com/scientificreports/
In this proof-of-principle study, infected clots were developed as a translatable model of IE biofilm and the effi- cacy of sonobactericide, the use of US and an UCA in combination with or without an antibiotic and throm- bolytic was evaluated in vitro under flow. Histology and confocal imaging revealed that the infected clot model resembled a clinical IE biofilm, especially for early pathogenesis. Infected clots exposed to the combination of oxacillin, rt-PA, ultrasound, and Definity achieved 99.3± 1.7% fractional infected clot loss, which was greater than the other treatment arms. These results suggest that sonobactericide may have potential as an adjunctive therapy for IE. Ǥ TheS. aureus (JC01-2016) used in this study was an anonymized, de-identified strain iso- lated from an IE patient at Cincinnati Children’s Hospital Medical Center, collected in accordance with guidance from the Institutional Review Board. According to institutional review board policy, anonymized, de-identified bacterial isolates such as JC01-2016 are considered Non-Human Subject Research and do not require informed consent. All experimental protocols in this study were approved by the University of Cincinnati institutional review board, and all methods were carried out in accordance with relevant guidelines and regulations. Overnight cultures of the isolate in tryptic soy broth (MP Biomedicals, USA) were added to DMSO (15%; Fisher Chemical, USA) and stored at −80 °C. All overnight cultures from frozen stocks were streaked on tryptic soy agar (TSA; MP Biomedicals, USA) and incubated at 37 °C. Bacterial chromosomal DNA was isolated from a single colony using DNeasy Ultraclean Microbial kit (MoBio Laboratories, California, USA). Amplification and sequencing of the polymorphic X region of the Protein A gene was performed using spa1095F (5′-AGACGATCCTTCGGTGAGC-3′) and spa1517R (5′-GCTTTTGCAATGTCATTTACTG-3′) (Integrated DNA Technologies Inc., Iowa, USA)69–71. Amplification and sequencing was verified using primers spa1113F (5′-TAAAGACGATCCTTCGGTGAGC-3′) and spa1514R (5′-CAGCAGTAGTGCCGTTTGCTT-3′)69. PCR amplification (Mastercycler pro S, Eppendorf, New York, USA) was accomplished using 22 μl of sterile water, 1 μl of forward primer, 1 μl of reverse primer, 2 μl of iso- lated chromosomal DNA, and 24 μl of MidSci Taq Plus Mastermix with red tracer dye (Midsci, Missouri, USA). Thermocycler parameters were set as previously described71. Sequences were analysed for polymorphic X region repeats and matched to repeat succession sequences provided by Ridom SpaServer Database (http://spa.ridom. de) to determine the spa-type70.
Ǥ Oxacillin (28221; Sigma-Aldrich, Missouri, USA) susceptibility was determined (n = 3) using the agar dilution method on Mueller-Hinton agar (Sigma-Aldrich, Missouri, USA), supplemented with 2% NaCl72. S. epidermidis ATCC 35984 (RP62a) was used only as a quality control for antibiotic susceptibility testing. Bacterial growth curves (n = 3) with an initial 73 OD600nm of 0.05 were produced as described by Harris et al. with the exceptions of IMDM (containing no phenol red; Gibco, USA) instead of brain heart infusion medium, and samples of 3 mL were measured every 30 min for 9 h and a final sample measured at 24 h.
S. aureus Ǥ To prepare the S. aureus iso- late for inoculation of blood clots, early exponential growth phase grown bacteria were generated following the same protocol for determining growth curves. Cultures with a starting OD600nm of 0.05 were incubated at 37 °C in IMDM. After 3.5–4 h of growth theS. aureus isolate was in the mid-exponential growth phase, and a × 9 1.5 mL sample at an OD600nm of 1 (approximately 1 10 CFU/mL) was obtained. The bacteria were grown to mid-exponential phase because this is when the expression of surface-associated adhesins generally occurs to facilitate initial colonization74. This bacterial suspension was kept at 37 °C and subsequently used for inoculation within fifteen minutes of preparation.
Ǥ To produce the infected clots to resemble the in vivo early pathogenesis of IE, first human whole blood clots were created around silk sutures as previously described by Bader et al.29 with the exceptions of complete experimental sterility and suture brand and size. Specifically, 9 cm sections of 6–0 silk sutures (1639G; PERMA-HAND, Ethicon Inc., USA) were threaded into 2.5 cm long boros- ilicate glass capillaries (1.12 mm inner diameter, World Precision Instruments Inc., USA). These capillaries were subsequently placed inside borosilicate glass culture tubes (10 mm diameter x 75 mm height, VWR International, USA). With University of Cincinnati institutional review board approval and written informed consent, venous whole blood was drawn from five healthy volunteers. Five hundredμ L aliquots were transferred into each tube, and by capillary action blood was drawn into the capillaries. The glass tubes were incubated for 3 h at 37 °C to allow the blood to clot around the suture, followed by refrigeration at 4 °C for a minimum of three days to pro- mote clot retraction. These retracted clots are stable and resistant to complete rt-PA thrombolysis75. After retraction, the clots were incubated at 37 °C for 30 min. Aliquots of 30 minutes pre-warmed sterile hFFP (3.325 mL; Hoxworth Blood Centre, Cincinnati, Ohio, USA) were placed into borosilicate glass culture tubes, and inoculated with 175 μL of the prepared bacterial inoculum. The retracted clots were removed from the glass cap- illaries and carefully placed in the inoculated hFFP. To ensure the bacterial inoculate had reached all surfaces of the clot, the glass tubes were gently inverted approximately 8 times. Subsequently, the glass tubes were incubated for 24–30 h at 37 °C, and reinverted every hour for approximately the first five hours. Before placement in the in vitro flow system, infected clots were washed three times with PBS to remove any planktonic bacteria. Additionally, for histological analysis, two additional clot controls were used: sterile retracted clots alone; and sterile retracted clots following infected clot protocol, with the exception of using no bacteria and thus incubating for 24–30 h in hFFP.
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 8 www.nature.com/scientificreports/
Ǥ Clots were fixated in 10% neutral buffered formalin. Following fixation, clots were transferred to a tissue cassette containing a foam biopsy pad (first set specimens), or without a foam pad (2nd set speci- mens). These specimens were processed, embedded in paraffin, sliced μ(4 m), mounted on a microscopy slide, and stained with either H&E or CV for cross-sectional analysis. Images were either captured using a camera (Digital Sight DS-Ri1, Nikon, Japan) mounted on a microscope (BX51, Olympus Inc., USA) with imaging soft- ware (NIS-Elements Basic Research, Nikon) for the first set of clot specimens, or with a virtual microscope digital slide scanner (C9600; NanoZoomer 2.0HT, Hamamatsu Photonics, Japan) and corresponding digital pathology viewing software (U12388–01; NDP.view2, Hamamatasu, Japan) for the second set of specimens.
Ǥ Individual infected clots were placed in a sterile chambered #1.5 polymer coverslip (80286; μ-slide 2 Well, ibiTreat, ibidi GmbH, Germany). Following the manufacturer’s instructions, the LIVE/DEAD BacLight bac- terial viability fluorescence kit (L7012, Molecular Probes, Oregon, USA) was used. After incubation, the chamber was flooded with PBS, and then placed in the CLSM holder, where it was observed with an upright Nikon FN1 microscope attached to a Nikon A1R confocal system. A 25 × long working distance objective (CFI Apo LWD NA 1.10 water-immersion) was used.
ǦǤ An in vitro flow model, depicted in Supplementary Fig. S1 online was used, which has been described in detail previously29. Using a syringe pump in withdrawal mode (Model 44, Harvard Apparatus, Massachusetts, USA), the perfusate flow rate was maintained at 0.65 mL/min (0.3 cm/s), consistent with previ- ously reported sonothrombolysis studies using the same in vitro flow set-up29 and coinciding with slow blood flow eddies experienced by IE biofilms55,56. The infected clots, along with the perfusate, were insonated with a custom-designed, unfocused, 120-kHz US transducer (60 mm diameter aperture; 5 cm distance to clot; Sonic Concepts, Washinton, USA). Distances for both the passive cavitation detector and the 120-kHz transducers to the clot was 5 cm76. Using a function gener- ator (33250 A; Agilent Technologies Inc., California, USA) and power amplifier (1040 L; ENI, New York, USA), the transducer was excited at its resonant frequency (120-kHz). A custom-built impedance matching network (Sonic Concepts Inc., Washington, USA) was used to maximize power transfer to the transducer29. The acoustic field was measured and in situ acoustic pressure calibrated along the clot using a 0.5 mm hydrophone (TC 4038; Teledyne Reason Inc, California, USA) mounted on a computer-controlled three-axis positioner (NF-90; Velmex Inc., New York, USA)29. A single element acoustic passive cavitation detector (PCD; circular aperture diameter 19 mm; 5 cm distance to clot; 2.25-MHz centre frequency; −6 dB two-way bandwidth of 0.98-MHz; 595516 C; Picker Roentgen GmbH, Espelkamp, Germany) was aligned with the infected clot and used to monitor cavitation activity. As reported previously, ultraharmonic (UH) and broadband (BB) emissions were employed to detect stable and inertial cav- itation, respectively29. To remove any noise from radiofrequency interference, the received signal from the PCD was filtered by a 10-MHz low-pass filter (J73 E, TTE, California, USA), and amplified with a wideband low-noise amplifier (CLC100, Cadeka Microcircuits, Colorado, USA). The signal was digitized (10 ms duration, 31.25-MHz sampling frequency), and the power spectrum computed in MATLAB (The Mathworks, Massachusetts, USA). To compute the UH energy, UH bands of the power spectrum between 250-kHz and 1-MHz were summed over a 2-kHz bandwidth centred around each UH frequency29. The BB energy was computed by summing BB emissions between 250-kHz and 1-MHz in 4-kHz bands centred at each UH band, ± 10-kHz and ± 30-kHz respectively29.
Ǥ For each in vitro flow experiment, 30 mL of hFFP was placed in a 500 mL beaker for 2 h to reach gas equilibrium at 37 °C. An infected clot was carefully mounted inside the glass capillary, con- nected to the flow system, and placed at the bottom of the 37 °C water tank over the microscope objective. The focus of the PCD was aligned with the capillary and the 120-kHz therapeutic acoustic beam, and infected clots were treated for 30 min, which is the half-life of oxacillin in the body77. This time has also been reported for son- othrombolysis experiments29,65. A pulsed US exposure scheme, shown to promote UH emissions, was used as described by Bader et al.29. Definity and perfusate were insonated for a period of 50 s at a peak-to-peak pressure of 0.44 MPa. This was directly followed by a 30 s quiescent period to allow a fresh influx of UCA to fill the glass capillary. Acoustic emissions recorded by the PCD were acquired at a rate of 2.33-Hz (0.43 s inter-frame time)29. This scheme was repeated in intermittent fashion over the 30 min treatment time. For infected clots, 9 different experimental flow exposures were included: (1) plasma alone; (2) plasma and the US exposure scheme; (3) plasma, US exposure, and Definity; (4) plasma and rt-PA; (5) plasma, rt-PA, and US exposure; and (6) plasma, rt-PA, US exposure, and Definity; (7) plasma, oxacillin, and rt-PA; (8) plasma, oxacillin, rt-PA, and US exposure; and (9) plasma, oxacillin, rt-PA, US exposure, and Definity. Definity (Lantheus Medical Imaging, North Billerica, Massachusetts, USA)78 vials were activated according to the instructions of the manufacture and diluted to a concentration of 2 μL/mL (2 × 107 MBs/mL), the infusion dose previously used for sonothrombolysis29. For oxacillin, 172 μg/mL was chosen because this is the peak serum concentration of the antibiotic therapeutic dose in humans treated with IE79,80. For all experiments with rt-PA, 3.15 μg/mL was used, which is within the therapeutic dose range for thrombolysis interventions81,82. At least 9 experiments were per- formed for a given treatment, using blood from 5 donors (total of 82 experimental infected clots).
Ǥ To quantify instantaneous infected clot degradation from the images recorded with the CCD camera, an edge-detection and tracking analysis script in MATLAB 29,65 was used as described previously . Briefly, the initial infected clot width (ICWi) at 0 min and the final infected clot width (ICWf) at the completion of the 30 min experiment were used to determine FICL using the following equation:
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 9 www.nature.com/scientificreports/
ICW− ICW FICL = if×.100% ICWi (1) The width of the infected clot was defined as the distance between the edges for each row of the image, minus the width of the suture.
ǦǦƤ Ǥ Following in vitro flow experiments of plasma alone and the combination of plasma, thrombolytic, and antibiotic, the flow system was left intact and placed on top of an inverted microscope (IX71, Olympus Inc.). Images were obtained using a 12-bit CCD camera (Retiga-EXi, Q-imaging, British Columbia, Canada) equipped to the microscope in order to obtain additional qualitative information (e.g. colour, larger field-of-view) about clots than that inferred from time-lapse imaging.
ƫ Ǥ Effluent samples from the in vitro flow experiments were measured directly fol- lowing the 30 min protocol using a Coulter Counter (Multisizer 4, 30-μm aperture, Beckman Coulter, California, USA) to quantify the size distribution (600 nm–18 μm) of debris, cells, and cell aggregates. This measurement was completed three times for each experimental type, with five replicates per treatment.
Statistical analysis. Data were statistically analysed using GraphPad Prism 7 (GraphPad Software Inc, California, USA) with a significance level of p< 0.05. To analyse the FICL difference of means among the exper- imental exposures for infected clots, the Kruskal-Wallis test was used. Additionally, post-hoc testing was per- formed using Dunn’s non-parametric pairwise multiple comparison test. The UH and BB cavitation energy difference of means was analysed using a two-way ANOVAwith post-hoc analysis using Tukey’s multiple com- parisons test. For both the cavitation energy and FICL analyses, the Tukey method was used to calculate and report medians and interquartile ranges.
Ǥ The data generated during and/or analysed during the current study are available from the corresponding author upon reasonable request. References 1. Werdan, K. et al. Mechanisms of infective endocarditis: pathogen-host interaction and risk states. Nat Rev Cardiol 11, 35–50, https:// doi.org/10.1038/nrcardio.2013.174 (2014). 2. Cahill, T. J. & Prendergast, B. D. Infective endocarditis. Lancet 387, 882–893, https://doi.org/10.1016/S0140-6736(15)00067-7 (2016). 3. Mirabel, M. et al. Long-term outcomes and cardiac surgery in critically ill patients with infective endocarditis. Eur Heart J 35, 1195–1204, https://doi.org/10.1093/eurheartj/eht303 (2014). 4. Hoen, B. & Duval, X. Clinical practice. Infective endocarditis. N Engl J Med 368, 1425–1433, https://doi.org/10.1056/ NEJMcp1206782 (2013). 5. Thiene, G. & Basso, C. Pathology and pathogenesis of infective endocarditis in native heart valves.Cardiovasc Pathol 15, 256–263, https://doi.org/10.1016/j.carpath.2006.05.009 (2006). 6. Archer, N. K. et al. Staphylococcus aureus biofilms: properties, regulation, and roles in human disease. Virulence 2, 445–459, https:// doi.org/10.4161/viru.2.5.17724 (2011). 7. Sullam, P. M., Drake, T. A. & Sande, M. A. Pathogenesis of endocarditis. Am J Med 78, 110–115 (1985). 8. Ito, A., Taniuchi, A., May, T., Kawata, K. & Okabe, S. Increased antibiotic resistance of Escherichia coli in mature biofilms. Appl Environ Microbiol 75, 4093–4100, https://doi.org/10.1128/AEM.02949-08 (2009). 9. Lewis, K. Persister cells and the riddle of biofilm survival.Biochemistry (Mosc) 70, 267–274 (2005). 10. Carmen, J. C. et al. Treatment of biofilm infections on implants with low-frequency ultrasound and antibiotics.Am J Infect Control 33, 78–82, https://doi.org/10.1016/j.ajic.2004.08.002 (2005). 11. Yu, H., Chen, S. & Cao, P. Synergistic bactericidal effects and mechanisms of low intensity ultrasound and antibiotics against bacteria: a review. Ultrason Sonochem 19, 377–382, https://doi.org/10.1016/j.ultsonch.2011.11.010 (2012). 12. Seth, A. K. et al. Noncontact, low-frequency ultrasound as an effective therapy against Pseudomonas aeruginosa-infected biofilm wounds. Wound Repair Regen 21, 266–274, https://doi.org/10.1111/wrr.12000 (2013). 13. Liu, X., Yin, H., Weng, C. X. & Cai, Y. Low-Frequency Ultrasound Enhances Antimicrobial Activity of Colistin-Vancomycin Combination against Pan-Resistant Biofilm of Acinetobacter baumannii. Ultrasound Med Biol 42, 1968–1975, https://doi. org/10.1016/j.ultrasmedbio.2016.03.016 (2016). 14. Karosi, T., Sziklai, I. & Csomor, P. Low-frequency ultrasound for biofilm disruption in chronic rhinosinusitis with nasal olyposis:p in vitro pilot study. Laryngoscope 123, 17–23, https://doi.org/10.1002/lary.23633 (2013). 15. Miller, D. L. Overview of experimental studies of biological effects of medical ultrasound caused by gas body activation and inertial cavitation. Prog Biophys Mol Biol 93, 314–330, https://doi.org/10.1016/j.pbiomolbio.2006.07.027 (2007). 16. Unger, E. C., Hersh, E., Vannan, M., Matsunaga, T. O. & McCreery, T. Local drug and gene delivery through microbubbles. Prog Cardiovasc Dis 44, 45–54, https://doi.org/10.1053/pcad.2001.26443 (2001). 17. Kooiman, K., Vos, H. J., Versluis, M. & de Jong, N. Acoustic behavior of microbubbles and implications for drug delivery. Adv Drug Deliv Rev 72, 28–48, https://doi.org/10.1016/j.addr.2014.03.003 (2014). 18. Sutton, J. T., Haworth, K. J., Pyne-Geithman, G. & Holland, C. K. Ultrasound-mediated drug delivery for cardiovascular disease. Expert Opin Drug Deliv 10, 573–592, https://doi.org/10.1517/17425247.2013.772578 (2013). 19. van Rooij, T. et al. Viability of endothelial cells afterultrasound-mediated sonoporation: Influence of targeting, oscillation, and displacement of microbubbles. J Control Release 238, 197–211, https://doi.org/10.1016/j.jconrel.2016.07.037 (2016). 20. Datta, S. et al. Correlation of cavitation with ultrasound enhancement of thrombolysis. Ultrasound Med Biol 32, 1257–1267, https:// doi.org/10.1016/j.ultrasmedbio.2006.04.008 (2006). 21. Dong, Y., Chen, S., Wang, Z., Peng, N. & Yu, J. Synergy of ultrasound microbubbles and vancomycin against Staphylococcus epidermidis biofilm.J Antimicrob Chemother 68, 816–826, https://doi.org/10.1093/jac/dks490 (2013). 22. He, N. et al. Enhancement of vancomycin activity against biofilms by using ultrasound-targeted microbubble destruction. Antimicrob Agents Chemother 55, 5331–5337, https://doi.org/10.1128/AAC.00542-11 (2011). 23. Ronan, E., Edjiu, N., Kroukamp, O., Wolfaardt, G. & Karshafian, R. USMB-induced synergistic enhancement of aminoglycoside antibiotics in biofilms.Ultrasonics 69, 182–190, https://doi.org/10.1016/j.ultras.2016.03.017 (2016). 24. Zhu, C. et al. Ultrasound-targeted microbubble destruction enhances human beta-defensin 3 activity against antibiotic-resistant Staphylococcus biofilms.Inflammation 36, 983–996, https://doi.org/10.1007/s10753-013-9630-2 (2013).
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 10 www.nature.com/scientificreports/
25. Levitas, A. et al. Successful treatment of infective endocarditis with recombinant tissue plasminogen activator. J Pediatr 143, 649–652, https://doi.org/10.1067/S0022-3476(03)00499-2 (2003). 26. Fleming, R. E., Barenkamp, S. J. & Jureidini, S. B. Successful treatment of a staphylococcal endocarditis vegetation with tissue plasminogen activator. J Pediatr 132, 535–537 (1998). 27. Gunes, A. M., Bostan, O. M., Baytan, B. & Semizel, E. Treatment of infective endocarditis with recombinant tissue plasminogen activator. Pediatr Blood Cancer 50, 132–134, https://doi.org/10.1002/pbc.20890 (2008). 28. Levitas, A., Krymko, H., Richardson, J., Zalzstein, E. & Ioffe, V. Recombinant tissue plasminogen activator as a novel treatment option for infective endocarditis: a retrospective clinical study in 32 children. Cardiol Young 26, 110–115, https://doi.org/10.1017/ S104795111400273X (2016). 29. Bader, K. B., Gruber, M. J. & Holland, C. K. Shaken and stirred: mechanisms of ultrasound-enhanced thrombolysis. Ultrasound Med Biol 41, 187–196, https://doi.org/10.1016/j.ultrasmedbio.2014.08.018 (2015). 30. Cheng, J. Y., Shaw, G. J. & Holland, C. K. In vitro microscopic imaging of enhanced thrombolysis with 120-kHz ultrasound in a human clot model. Acoust Res Lett Online 6, 25–29, https://doi.org/10.1121/1.1815039 (2005). 31. Habib, G. et al. 2015 ESC Guidelines for the management of infective endocarditis: The Task Force for the Management of Infective Endocarditis of the European Society of Cardiology (ESC). Endorsed by: European Association for Cardio-Thoracic Surgery (EACTS), the European Association of Nuclear Medicine (EANM). Eur Heart J 36, 3075–3128, https://doi.org/10.1093/eurheartj/ ehv319 (2015). 32. Baddour, L. M. et al. Infective Endocarditis in Adults: Diagnosis, Antimicrobial Therapy, and Management of Complications: A Scientific Statement for Healthcare Professionals From the American Heart Association.Circulation 132, 1435–1486, https://doi. org/10.1161/CIR.0000000000000296 (2015). 33. Scheld, W. M., Strunk, R. W., Balian, G. & Calderone, R. A. Microbial adhesion to fibronectin in vitro correlates with production of endocarditis in rabbits. Proc Soc Exp Biol Med 180, 474–482 (1985). 34. An, Y. H. & Friedman, R. J. Concise review of mechanisms of bacterial adhesion to biomaterial surfaces. J Biomed Mater Res 43, 338–348 (1998). 35. Nethercott, C. et al. Molecular characterization of endocarditis-associated Staphylococcus aureus. J Clin Microbiol 51, 2131–2138, https://doi.org/10.1128/JCM.00651-13 (2013). 36. Rasmussen, G., Monecke, S., Ehricht, R. & Soderquist, B. Prevalence of clonal complexes and virulence genes among commensal and invasive Staphylococcus aureus isolates in Sweden. PLoS One 8, e77477, https://doi.org/10.1371/journal.pone.0077477 (2013). 37. Bouchiat, C. et al. Staphylococcus aureus infective endocarditis versus bacteremia strains: Subtle genetic differences at stake.Infect Genet Evol 36, 524–530, https://doi.org/10.1016/j.meegid.2015.08.029 (2015). 38. Sabat, A. et al. Distribution of the serine-aspartate repeat protein-encoding sdr genes among nasal-carriage and invasive Staphylococcus aureus strains. J Clin Microbiol 44, 1135–1138, https://doi.org/10.1128/JCM.44.3.1135-1138.2006 (2006). 39. Moreillon, P. et al. Role of Staphylococcus aureus coagulase and clumping factor in pathogenesis of experimental endocarditis. Infect Immun 63, 4738–4743 (1995). 40. Durack, D. T. & Beeson, P. B. Experimental bacterial endocarditis. II. Survival of a bacteria in endocardial vegetations. Br J Exp Pathol 53, 50–53 (1972). 41. Durack, D. T. & Beeson, P. B. Experimental bacterial endocarditis. I. Colonization of a sterile vegetation. Br J Exp Pathol 53, 44–49 (1972). 42. Gibson, G. W. et al. Development of a mouse model of induced Staphylococcus aureus infective endocarditis. Comp Med 57, 563–569 (2007). 43. Freedman, L. R. & Valone, J. Jr. Experimental infective endocarditis. Prog Cardiovasc Dis 22, 169–180 (1979). 44. Scheld, W. M., Whitley, R. J. & Marra, C. M. Infections of the central nervous system. Fourth edition. edn, 580 (Wolters Kluwer Health, 2014). 45. Durack, D. T. Experimental bacterial endocarditis. IV. Structure and evolution of very early lesions. J Pathol 115, 81–89, https://doi. org/10.1002/path.1711150204 (1975). 46. McGrath, B. J., Kang, S. L., Kaatz, G. W. & Rybak, M. J. Bactericidal activities of teicoplanin, vancomycin, and gentamicin alone and in combination against Staphylococcus aureus in an in vitro pharmacodynamic model of endocarditis. Antimicrob Agents Chemother 38, 2034–2040 (1994). 47. Palmer, S. M. & Rybak, M. J. Pharmacodynamics of once- or twice-daily levofloxacin versus vancomycin, with or without rifampin, against Staphylococcus aureus in an in vitro model with infected platelet-fibrin clots. Antimicrob Agents Chemother 40, 701–705 (1996). 48. Torres, V. J., Pishchany, G., Humayun, M., Schneewind, O. & Skaar, E. P. Staphylococcus aureus IsdB is a hemoglobin receptor required for heme iron utilization. J Bacteriol 188, 8421–8429, https://doi.org/10.1128/JB.01335-06 (2006). 49. den Reijer, P. M. et al. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model. PLoS One 11, e0145722, https://doi.org/10.1371/journal.pone.0145722 (2016). 50. Dias Kde, C., Barbugli, P. A. & Vergani, C. E. Influence of different buffers (HEPES/MOPS) on keratinocyte cell viability and microbial growth. J Microbiol Methods 125, 40–42, https://doi.org/10.1016/j.mimet.2016.03.018 (2016). 51. Haley, K. P. & Skaar, E. P. A battle for iron: host sequestration and Staphylococcus aureus acquisition. Microbes Infect 14, 217–227, https://doi.org/10.1016/j.micinf.2011.11.001 (2012). 52. Scheife, R. T. Protein binding: what does it mean? DICP 23, S27–31 (1989). 53. Mutch, N. J., Thomas, L., Moore, N. R., Lisiak, K. M. & Booth, N. A. TAFIa, PAI-1 and alpha-antiplasmin: complementary roles in regulating lysis of thrombi and plasma clots. J Thromb Haemost 5, 812–817, https://doi.org/10.1111/j.1538-7836.2007.02430.x (2007). 54. Khismatullin, D. B. Resonance frequency of microbubbles: effect of viscosity.J Acoust Soc Am 116, 1463–1473 (2004). 55. Rodbard, S. Blood velocity and endocarditis. Circulation 27, 18–28 (1963). 56. Hatle, L. Assessment of aortic blood flow velocities with continuous wave Doppler ultrasound in the neonate and young child. J Am Coll Cardiol 5, 113S–119S (1985). 57. Kim, W. Y. et al. Left ventricular blood flow patterns in normal subjects: a quantitative analysis by three-dimensional magnetic resonance velocity mapping. J Am Coll Cardiol 26, 224–238 (1995). 58. Bajd, F., Vidmar, J., Blinc, A. & Sersa, I. Microscopic clot fragment evidence of biochemo-mechanical degradation effects in thrombolysis. Thromb Res 126, 137–143, https://doi.org/10.1016/j.thromres.2010.04.012 (2010). 59. Bajd, F. & Sersa, I. A concept of thrombolysis as a corrosion-erosion process verified by optical microscopy. Microcirculation 19, 632–641, https://doi.org/10.1111/j.1549-8719.2012.00198.x (2012). 60. Bajd, F. & Sersa, I. Mathematical modeling of blood clot fragmentation during flow-mediated thrombolysis. Biophys J 104, 1181–1190, https://doi.org/10.1016/j.bpj.2013.01.029 (2013). 61. Gabriel, D. A., Muga, K. & Boothroyd, E. M. The effect of fibrin structure on fibrinolysis.J Biol Chem 267, 24259–24263 (1992). 62. Collen, D. On the regulation and control of fibrinolysis. Edward Kowalski Memorial Lecture. Thromb Haemost 43, 77–89 (1980). 63. Fassa, A. A., Himbert, D. & Vahanian, A. Mechanisms and management of TAVR-related complications. Nat Rev Cardiol 10, 685–695, https://doi.org/10.1038/nrcardio.2013.156 (2013). 64. Zhu, H. X., Cai, X. Z., Shi, Z. L., Hu, B. & Yan, S. G. Microbubble-mediated ultrasound enhances the lethal effect of gentamicin on planktonic Escherichia coli. Biomed Res Int 2014, 142168, https://doi.org/10.1155/2014/142168 (2014).
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 11 www.nature.com/scientificreports/
65. Shekhar, H. et al. In vitro thrombolytic efficacy of echogenic liposomes loaded with tissue plasminogen activator and octafluoropropane gas.Phys Med Biol 62, 517–538, https://doi.org/10.1088/1361-6560/62/2/517 (2017). 66. Kremkau, F. W. General principles of echocardiography. In: Lang, R. et al editor. ASE’s comprehensive echocardiography: Elsevier (2015). 67. Rodbard, S. & Yamamoto, C. Effect of stream velocity on bacterial deposition and growth. Cardiovasc Res 3, 68–74 (1969). 68. Hershberger, E., Coyle, E. A., Kaatz, G. W., Zervos, M. J. & Rybak, M. J. Comparison of a rabbit model of bacterial endocarditis and an in vitro infection model with simulated endocardial vegetations. Antimicrob Agents Chemother 44, 1921–1924 (2000). 69. Chen, J. H. K. et al. The use of high-resolution melting analysis for rapid spa typing on methicillin-resistant Staphylococcus aureus clinical isolates. J Microbiol Meth 92, 99–102, https://doi.org/10.1016/j.mimet.2012.11.006 (2013). 70. Harmsen, D. et al. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J Clin Microbiol 41, 5442–5448, https://doi.org/10.1128/Jcm.41.12.5442- 5448.2003 (2003). 71. Shopsin, B. et al. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J Clin Microbiol 37, 3556–3563 (1999). 72. National Committee for Clinical Laboratory Standards. Methods for dilution of antimicrobial susceptibility test for bacteria that grow aerobically in M07-A9. 9, 32(2) (2012). 73. Harris, L. G., Foster, S. J. & Richards, R. G. An introduction to Staphylococcus aureus, and techniques for identifying and quantifying S. aureus adhesins in relation to adhesion to biomaterials: review. Eur Cell Mater 4, 39–60 (2002). 74. Gordon, R. J. & Lowy, F. D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis 46(Suppl 5), S350–359, https://doi.org/10.1086/533591 (2008). 75. Meunier, J. M., Holland, C. K., Lindsell, C. J. & Shaw, G. J. Duty cycle dependence of ultrasound enhanced thrombolysis in a human clot model. Ultrasound Med Biol 33, 576–583, https://doi.org/10.1016/j.ultrasmedbio.2006.10.010 (2007). 76. Shaw, G. J., Meunier, J. M., Lindsell, C. J. & Holland, C. K. Tissue plasminogen activator concentration dependence of 120 kHz ultrasound-enhanced thrombolysis. Ultrasound Med Biol 34, 1783–1792, https://doi.org/10.1016/j.ultrasmedbio.2008.03.020 (2008). 77. US Food and Drug Administration. Oxacillin injection, USP in galaxy container for intravenous use only (PL2040). Silver Springs, Maryland, USA. 78. Lantheus Medical Imaging. Definity (perflutren) injection data safety label. FDA/Center for Drug Evaluation and Research. Silver Spring, Maryland, USA (2011). 79. Bennett JE, D. R., Blaser MJ. Mandell, Douglas, and Bennett’s Infectious Disease Essentials. 1 edn, 60 (Elsevier, 2016). 80. McKinnon, P. S. & Davis, S. L. Pharmacokinetic and pharmacodynamic issues in the treatment of bacterial infectious diseases. Eur J Clin Microbiol Infect Dis 23, 271–288, https://doi.org/10.1007/s10096-004-1107-7 (2004). 81. Tanswell, P., Seifried, E., Stang, E. & Krause, J. Pharmacokinetics and hepatic catabolism of tissue-type plasminogen activator. Arzneimittelforschung 41, 1310–1319 (1991). 82. Seifried, E., Tanswell, P., Ellbruck, D., Haerer, W. & Schmidt, A. Pharmacokinetics and haemostatic status during consecutive infusions of recombinant tissue-type plasminogen activator in patients with acute myocardial infarction. Thromb Haemost 61, 497–501 (1989). The authors thank members of the Image-guided Ultrasound Therapeutics Laboratories (University of Cincinnati) and the Therapeutic Ultrasound Contrast Agent Group (Erasmus MC) for useful discussions. The authors are grateful to Prof. Joel Mortensen (Cincinnati Children’s Hospital) for providing the clinical bacterial isolate, Dr. Seetharam Chadalavada (University of Cincinnati MC) for a large portion of the sterile sutures, Dr. David Witte (Cincinnati Children’s Hospital) and Dr. King Lam (Erasmus MC) for interpretation of histology, and Prof. Matthew Kofron and Mike Muntifering (both from Cincinnati Children’s Hospital) for assistance and training with the confocal microscopy. This work was financially supported by the Netherlands Heart Foundation (student grant 2016SB001 to K.R.L., E. Dekker program), the I & I Fund (Infection and Immunity Program, Molecular Medicine Postgraduate School, Erasmus MC; grant to K.R.L.), the National Institutes of Health (R01 GM094363 to A.B.H. and R01 NS047603 to C.K.H.), and the Erasmus MC Foundation (fellowship to K.K.). K.R.L., H.S., T.G. performed the experiments, analysed the data, and wrote the manuscript. K.K., C.K.H., W.J.B.v.W., and A.B.H. advised on the manuscript and experiments. All authors reviewed the manuscript. Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-018-21648-8. Competing Interests: The authors declare no competing interests. Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre- ative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per- mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© The Author(s) 2018
SCIENTIFIC REPORTS | (2018) 8:3411 ȁ ǣͷͶǤͷͶ;ȀͺͷͻͿ;ǦͶͷ;Ǧͷͼͺ;Ǧ; 12 Curr Allergy Asthma Rep (2017) 17: 81 https://doi.org/10.1007/s11882-017-0750-x
BASIC AND APPLIED SCIENCE (I LEWKOWICH, SECTION EDITOR)
Staphylococcal Biofilms in Atopic Dermatitis
Tammy Gonzalez 1 & Jocelyn M. Biagini Myers2 & Andrew B. Herr3,4 & Gurjit K. Khurana Hershey2
Published online: 23 October 2017 # Springer Science+Business Media, LLC 2017
Abstract influence secretion of keratinocyte cytokines and trigger dif- Purpose of Review Atopic dermatitis (AD) is a chronic, re- ferentiation and apoptosis of keratinocytes. These activities lapsing inflammatory skin disorder that is a major public may act to disrupt barrier function and promote disease path- health burden worldwide. AD lesions are often colonized by ogenesis as well as allergen sensitization. Staphylococcus aureus and Staphylococcus epidermidis.An Summary Formation of biofilm is a successful strategy that important aspect of Staphylococcus spp. is their propensity to protects the bacteria from environmental danger, antibiotics, form biofilms, adhesive surface-attached colonies that become and phagocytosis, enabling chronic persistence in the host. An highly resistant to antibiotics and immune responses, and re- increasing number of S. aureus skin isolates are resistant to cent studies have found that clinical isolates colonizing AD conventional antibiotics, and staphylococcal biofilm commu- skin are often biofilm-positive. Biofilm formation results in nities are prevalent on the skin of individuals with AD. complex bacterial communities that have unique effects on Staphylococcal colonization of the skin impacts skin barrier keratinocytes and host immunity. This review will summarize function and plays multiple important roles in AD recent studies exploring the role of staphyloccocal biofilms in pathogenesis. atopic dermatitis and the implications for treatment. Recent Findings Recent studies suggest an important role for Keywords Atopic dermatitis . Biofilm . Staphylococci . biofilms in the pathogenesis of numerous dermatologic dis- Microbiome . Barrier function . Epidermis eases including AD. S. aureus biofilms have been found to colonize the eccrine ducts of AD skin, and these biofilms
Introduction This article is part of the Topical Collection on Basic and Applied Science Atopic dermatitis (AD) is a chronic skin condition character- * Andrew B. Herr [email protected] ized by eczematous lesions and intense itching [1]. AD pre- sents in about 10% of children and 7% of adults in the United * Gurjit K. Khurana Hershey [email protected] States [2]. Industrialized countries have a higher prevalence of AD, although an increasing number of cases are observed in 1 Immunology Graduate Program, Cincinnati Children’s Hospital developing countries [3]. AD presents most commonly in ear- Medical Center, Cincinnati, OH, USA ly childhood, with up to 60% of patients developing symp- 2 Division of Asthma Research, Cincinnati Children’s Hospital toms within the first year of life [3]. Lesions commonly pres- Medical Center, 3333 Burnet Ave., ML 7037, Cincinnati, OH 45229, ent on the face in infancy and progress to other sites of the USA body, particularly skin surfaces that are subject to flexure [1]. 3 Division of Immunobiology, Cincinnati Children’sHospitalMedical In adulthood, these lesions often undergo lichenification [1]. Center, 3333 Burnet Ave., MLC 7038, Cincinnati, OH 45229, USA AD affects many facets of daily life for patients, families, and 4 Division of Infectious Diseases, Cincinnati Children’s Hospital caretakers as itching, scratching, and loss of sleep significantly Medical Center, Cincinnati, OH, USA impact quality of life. 81 Page 2 of 11 Curr Allergy Asthma Rep (2017) 17: 81
While dry, itchy skin can cause significant discomfort, this participating centers reported an increase in eczema preva- disorder is also characterized by a compromised barrier in the lence among older children (13–14 years) [18, 19] and 84% skin and possibly other epithelial surfaces, facilitating IgE reported increased prevalence of eczema among younger chil- sensitization to environmental allergens. Penetration of these dren (6–7 years), with the highest increases seen in Western allergens may contribute to the eventual development of aller- Europe, Canada, South America, Australasia, and the Far East gic rhinitis and asthma later in childhood in many AD patients, [18]. While these substantial differences argue that environ- a process known as the atopic march [4]. There are many mental factors and genetic predisposition are key players for contributors to the pathogenesis of AD including genetic sus- eczema development worldwide [18], this also raises the pos- ceptibilities and dysbiosis of the skin microbiota [3, 5–9]. sibility that that skin microbial fluctuations modulate the Genetic predisposition to the development of AD involves gene-environment interactions at the skin surface [20]. genes expressing proteins that contribute to skin barrier func- Although there is a general agreement that microorganisms tion. The most common example is filaggrin, a structural pro- are potential components of many skin disorders, there is lim- tein that is incorporated into the cornified envelope, a highly ited literature about how they relate to the genetic and envi- crosslinked mixture of structural proteins that surrounds a net- ronmental variation that also contributes to the disease [20]. work of keratin filaments in the outer layer of the epidermis The association of AD with factors that are linked to microbial [10]. Mature filaggrin is proteolytically processed from the exposure, such as daycare attendance, living on a farm envi- profilaggrin precursor, which also releases amino acid degra- ronment, household pets, endotoxin exposure, and early anti- dation products that play a vital role in retaining moisture in biotic use supports the microbial component of AD [15]. The the skin. However, in addition to the genetic predisposition to “revised” hygiene hypothesis theorizes that a decrease in early AD, there is accumulating evidence demonstrating the central childhood exposures to infection, and by extension microbial role that the skin microbiome plays in the pathogenesis of AD. exposure, increases the susceptibility to allergic disease [15], Ninety percent of patients with AD are colonized with suggesting that diversity in the early microbiota might be im- S. aureus while only 5–20% of healthy individuals are typi- portant in allergy development and prevention [21]. Other cally colonized [1, 11]. A major challenge with S. aureus is its changes in lifestyle in industrialized countries, such as in- propensity to form biofilm, which contributes to increasing creased skin washing, not only leads to removal of harmful severity in many diseases [12, 13]. Importantly, staphylococ- pathogens but also removes antimicrobial peptides produced cal biofilms were found to be nearly ubiquitous in AD lesional by the keratinocytes to protect the skin barrier [22]. This con- skin [14••]. Those biofilms are complex microbial communi- cept is timely because it is predicted that two-thirds of the ties that provide an advantage to the bacteria in terms of evad- human population will be living in urban areas by 2050, ing the host immune response and resisting antibiotic action. resulting in declining contact with the natural environment The objective of this review is to summarize what is currently [23, 24]. known about staphylococcal biofilms and how they impact skin keratinocytes and influence host immune responses. We will review the basics of biofilms and biofilm formation, how Barrier Function in the Skin skin-colonizing organisms interact with each other in biofilms, how biofilms may trigger and exacerbate AD, and The skin acts as a barrier to environmental insults or allergens how these recent developments influence potential directions and is also a key in preventing water loss from the tissue. The for clinical management. epidermis, the upper layer of the skin, consists primarily of keratinocytes that are regenerated regularly. The skin can be subdivided into several layers with functional specialization Epidemiology of Atopic Dermatitis and the Hygiene (Fig. 1): the outermost stratum corneum, the underlying stra- Hypothesis tum granulosum, and the lower stratum spinosum and stratum basale [10]. Throughout life, skin is continually being regen- The most valuable AD prevalence and trend data were col- erated through the migration of keratinocytes from inner lected by the International Study of Asthma and Allergies on layers outward to the stratum corneum. As keratinocytes mi- Childhood (ISAAC), the only global study to use uniformly grate upward from the stratum basale through the epidermis, validated methodology to allow comparisons of populations they differentiate and proliferate, lose their organelles, under- worldwide [15]. The prevalence of eczema differs between go cornification, and slough from the skin [4, 25]. developing and industrialized nations [16], with rates in in- Specifically, the stratum basale contains proliferating, undif- dustrialized nations increasing to as much as 15–30% of chil- ferentiated keratinocytes; these migrate up into the stratum dren and 2–10% of adults [17]. The ISAAC data was initially spinosum, where they cease proliferating and begin to differ- collected during 1994–1995 and re-collected 5–10 years later entiate. Keratinocytes in the stratum granulosum still contain in 56 countries [18]. These data revealed that 58% of organelles and are characterized by the presence of granules Curr Allergy Asthma Rep (2017) 17: 81 Page 3 of 11 81
Fig. 1 Barrier function in healthy and AD skin. Keratinocytes proliferate off. In AD, increased water loss is a result of a loss of the lipid layer in the stratum basale and migrate to the stratum granulosum where lipids surrounding corneocytes in the inner stratum corneum that acts as a are secreted into the stratum corneum. The stratum corneum houses barrier to water-soluble substances. With excoriation, pathogens such as keratinocytes that have lost organelles, flatten, and eventually slough S. aureus are able to colonize the skin more readily containing keratohyalin. Finally, the outermost stratum versions [31]. Given the tight regulation of skin barrier func- corneum is comprised of dead, flattened keratinocytes that tion by the balance between critical proteases such as the are crosslinked together by corneodesmosomes to form a kallikreins and protease inhibitors such as SPINK5, it is no waxy, dense barrier, a process called cornification [10]. surprise that changes in protease levels or activity in the skin AD can be characterized by defects in the skin barrier that contribute to defects in barrier function seen in AD [32–35]. predominate in the stratum corneum. Filaggrin (encoded by Recently, filaggrin knockdown keratinocytes were shown to the gene FLG) is a structural protein that is crucial to the have increased endogenous cysteine protease activity, sug- formation of an intact normal skin barrier; it condenses keratin gesting that the epidermal phenotype observed in FLG defi- fibers from the cytoskeleton into tight clusters [25] and is ciency may be due in part to unleashed cysteine protease ac- crucial to maintaining the physical strength of the stratum tivity. Indeed, when these cysteine proteases were inhibited, corneum. Mature filaggrin is the result of proteolytic process- keratin and tight junction proteins were significantly rescued ing of the profilaggrin precursor, which also results in the [36]. In addition to endogenous control of protease levels, release of peptides that are essential for skin homeostasis, exogenous factors can also modulate protease secretion in e.g., natural moisturizing factor (NMF), and for maintenance the epidermis. For example, S. aureus induces increased se- of an acidic pH [26]. cretion of kallikreins by keratinocytes [37]. These serine pro- The FLG gene is the most widely studied in AD; loss-of- teases can act to degrade filaggrin as well as desmoglein-1, an function mutations, truncations, and null mutations have been important component of desmosomes [32, 37]. Cleavage of identified as contributors to atopy [25]. Patients with filaggrin desmoglein-1 is a normal aspect of desquamation, but dysreg- mutations exhibit perturbed barrier function as a result of the ulation of this process can lead to impaired barrier function. loss of structural integrity in the cornified envelope, which Different strains of S. aureus and S. epidermidis show varying normally functions to minimize water loss and to protect the effects on protease activity of keratinocytes, suggesting that a lower layers of the skin from exposure to external antigens or detailed understanding of staphylococcal colonization at the environmental factors. Although FLG defects predispose in- strain level will be important for understanding the impact on dividuals to atopic conditions, sensitization is also necessary keratinocytes in AD patients. as shown in mice exposed to external antigens [27–29]. Both lesional and normal-appearing skin of individuals with AD have been shown to have abnormal barrier function, as dem- Skin Microbiome onstrated by elevated transepidermal water loss (TEWL) com- pared to healthy controls. These findings support the idea that A crucial factor impacting skin barrier function and both local AD is a disease of barrier dysfunction [30]. and systemic immune responses in AD is the skin-specific The epidermis is rich in various proteases with multiple microbiome. Microbes can influence human health through targets that are under strict regulation. These proteases act to interactions at host epithelial surfaces, including skin and oral, degrade superfluous proteins, activate downstream pathways respiratory, and urogenital mucosae. The interaction of micro- that impact terminal differentiation, and cleave precursors of biota with the skin surfaces is extensive: including microbial structural proteins or other proteases into mature, processed colonization of skin follicles, the total surface area involved is 81 Page 4 of 11 Curr Allergy Asthma Rep (2017) 17: 81 estimated to be 30 square meters [38]. The skin microbiome is differences in the skin microenvironment [40, 47••]. When less well characterized than the gut microbiome; however, there mice were colonized with S. aureus strains isolated from is increasing interest given recent studies demonstrating that healthy controls and S. epidermidis from AD patients, non- skin commensals influence host immunity [39–41]. The distri- inflammatory responses were elicited. However, severe in- bution of microbial communities changes with gender, age, and flammation was noted when mice were colonized with fluctuations in immune status [41] and is also sensitive to S. aureus strains isolated from AD patients [46••]. The same changes in humidity or seasonal weather [42]. In contrast, S. aureus strains also induced an influx of CD4+ T cells and birthing method and feeding method have little effect on the increased secretion of IL-13, demonstrating the ability of spe- skin microbiome [43]. The composition of the skin microbiome cific strains to elicit different inflammatory responses. varies widely between different skin sites, dependent in part on whether the skin site is dry, oily, or moist [40, 44••]. The skin microbiome can fluctuate in various states of dis- S. aureus in AD ease. Dysbiosis is observed in AD, with loss of microbial diversity and over-abundance of certain microbial species. S. aureus is known to initiate and aggravate inflammation in S. aureus prevalence greatly increases during AD flares and AD lesions by secreting a number of factors that modulate decreases after the lesion resolves [44••]. To assess the evolu- host immunity or compromise barrier function in the skin. tion of dysbiosis in the skin microbiome, a study was conduct- Staphylococcal alpha toxin, a cytolytic secreted factor, in- ed to characterize the skin microbiome within the first duces cell death in keratinocytes, which is further potentiated 6 months of life. Colonization at the antecubital fossa with in the presence of Th2 cytokines [48]. Furthermore, decreased commensal staphylococcal species (e.g., S. epidermidis and expression of filaggrin increases the susceptibility of S. cohnii) at 2 months of age was associated with decreased keratinocytes to cytolysis by alpha toxin, due to concomitant incidence of AD at 1 year [43]. Children who had developed decrease in sphingomyelinase levels [49]. In addition to the AD at 1 year of age showed a decrease in skin commensals, production of toxins, S. aureus secretes a large number of suggesting that these species are protective. Notably, S. aureus proteases that are important virulence factors. Among these, was not observed in any samples collected from infants before the V8 protease and exfoliative toxins A and B have each been the onset of AD symptoms [43]. More studies are needed to demonstrated to cleave desmoglein-1, a critical structural pro- assess when S. aureus colonization most commonly occurs tein within the corneodesmosomes that anchor differentiated and the implications it carries for inflammatory responses. keratinocytes to one another [50–52]. Such proteases therefore Recent developments in sequencing technology allow for degrade the barrier function in the skin, increasing water loss assessment of microbial communities, including hard-to- and allowing greater exposure to external antigens. culture organisms. 16S rRNA sequencing has been used in Greater than 80% of S. aureus isolated from patients with many studies to assess the taxa present in a microbial commu- AD also secrete superantigens, such as Staphylococcal entero- nity of the skin. Although 16S rRNA sequencing is relatively toxin B (SEB) and Toxic Shock Syndrome Toxin-1 (TSST-1). affordable, this method typically resolves taxa down to the These toxins crosslink MHC-II and T cell receptors leading to genus or species level and does not provide strain-level reso- the hyperactivation of T cells. These superantigens lead to sig- lution of the microbiome [45, 46••]. Recent studies have em- nificant inflammation in AD and contribute to atopy, as specific phasized that specific strains of S. aureus or S. epidermidis can IgE against these molecules is often observed [6]. Toxin- differ in the expression of critical virulence or protective fac- producing S. aureus also induces corticosteroid resistance in tors (e.g., proteases or antimicrobial peptides) that may play peripheral blood mononuclear cells (PBMCs) in vitro, as important roles in pathogenesis of AD. Thus, in order to fully PBMCs stimulated with superantigen were resistant to dexa- understand strain-specific effects on atopy, shotgun methasone [53]. In patients with AD, S. aureus isolates from metagenomic sequencing is necessary, since it can resolve patients that demonstrated corticosteroid resistance exhibited a species- and strain-level variation. Both 16S rRNA and shot- greater ability to produce superantigens than isolates from gun metagenomic sequencing were recently used to verify that corticosteroid-responsive AD or the general population [54]. the relative abundance of S. aureus rises to a striking degree during AD flares and decreases after treatment [44••, 46••]. S. epidermidis abundance was also observed to increase during Staphylococcal Biofilms in AD Skin AD flares, but to a lesser degree. Byrd et al. showed that S. aureus strains varied between individuals, however, each Epithelial surfaces are constitutively colonized by bacteria, individual typically was colonized by a single strain of which commonly exist in the form of biofilm communities. S. aureus. S. epidermidis populations were shown to be more For example, S. epidermidis forms biofilms between squa- heterogeneous and could vary at different skin sites from the mous epithelial cells in normal skin that vary in thickness same individual [46••]; such variation is likely due to depending on the type of skin site (e.g., dry vs. moist), and Curr Allergy Asthma Rep (2017) 17: 81 Page 5 of 11 81 they colonize sebaceous glands and hair follicles [55]. responsible for the largest number of device-related infections Furthermore, positive Congo red staining of the epidermis of [61]. Both S. aureus and S. epidermidis express a large number patients with AD revealed that S. aureus biofilms exist in the of MSCRAMM (microbial surface component recognizing ad- eccrine ducts [14••]. Congo red typically stains amyloid pro- hesive matrix molecules) adhesion proteins that mediate adher- teins, which in the skin are normally found in the dermis as ence to host extracellular matrix proteins [62–70]. Several of macular amyloid, but the matrix of staphylococcal biofilms these staphylococcal MSCRAMM-matrix interactions are rel- contains amyloid and thus stains with Congo red as well. evant in AD. For example, the stratum corneum of AD skin has Among S. aureus and S. epidermidis isolates from AD pa- increased fibronectin relative to healthy control skin, and tients, 85% were strong biofilm producers. Interestingly, while S. aureus fibronectin-binding protein (FnBP) A and B can in- staphylococci were found across the body regardless of lesion teract with fibronectin in human skin [71]. Likewise, the site,biofilmswereonlyobservedinADlesions[14••]. While S. aureus MSCRAMM clumping factor B (ClfB) that binds the characterization of S. aureus biofilms in the skin is at an to fibrinogen and several other extracellular matrix proteins early stage, the implications of these findings are intriguing, was shown to be important in biofilm formation under given that biofilms are associated with refractory, recurrent calcium-depleted conditions [72]. ClfB was recently implicated infections that resist immune responses and antibiotic in facilitating attachment of S. aureus to the stratum corneum treatment. [73]. While the binding activity of ClfB varies among S. aureus strains assessed, these studies provide a molecular basis for how S. aureus may initiate colonization on AD skin. Basics of Biofilm Formation Following attachment, the nascent biofilm forms upon ac- cumulation of bacterial cells via intercellular adhesion events, Biofilms are a growth adaptation to environmental stressors; which occur via two primary mechanisms: polysaccharide- the biofilm growth mode confers resistance to immune de- and protein-dependent. The biofilm polysaccharide, poly-N- fenses and antibiotics [56]. Biofilms are surface-attached mi- acetylglucosamine (PNAG, also called polysaccharide inter- crobial communities typically surrounded by extracellular cellular adhesin, PIA), is produced by the biosynthetic en- polymeric substances (EPS). EPS is a composite of extracellu- zymes of the icaADBC operon [74–77]. The PNAG polysac- lar DNA, exopolysaccharides, and proteins unique to bacterial charide has been shown to contribute to staphylococcal bio- biofilms [57]. Staphylococcal biofilm formation begins by ad- film strength under conditions of high shear stress [78]. The herence of bacteria to a primary surface followed by accumu- alternate mechanism involves bacterial surface proteins, lation of cells via intracellular adhesion mechanisms, and final- which directly engage one another to allow staphylococcal ly the formation of a mature biofilm [58, 59](Fig.2). cells to adhere together in the biofilm. The accumulation- Staphylococcal biofilms can attach to a variety of surfaces, associated protein (Aap) of S. epidermidis is the prototypic including abiotic material and human tissues, including the skin member of this protein family; Aap contains an N-terminal [60]. The ability of S. epidermidis in particular to adhere to A domain upstream of multiple tandem B repeats followed abiotic surfaces and form biofilms is the reason it is the species by an extended proline/glycine-rich stalk region [79]that
Fig. 2 Stages of biofilm formation. Bacterial biofilms begin with mediating cell-to-cell adhesion, cells begin to accumulate. Remodeling attachment to a biotic or abiotic surface. Attachment to host tissue of the biofilm and dispersal of planktonic bacteria is dependent on typically occurs via MSCRAMM adhesins such as clumping factors phenol-soluble modulins (PSMs) under the control of the Agr quorum (ClfA or ClfB) or fibronectin-binding proteins (FnBPs). Through either sensing system polysaccharide (PIA/PNAG) or protein (Aap/SasG) interactions 81 Page 6 of 11 Curr Allergy Asthma Rep (2017) 17: 81 terminates in an LPXTG sortase motif that is covalently at- which exert their antimicrobial effect by disrupting bacterial cell tached to the cell wall peptidoglycan [80]. The S. aureus membranes. These three AMPs have anti-staphylococcal activity ortholog SasG adopts nearly the same domain arrangement. and are strongly induced in psoriasis, an inflammatory skin con- Proteolytic processing of Aap or SasG removes the A domain, dition. The levels of these AMPs are much lower in AD due to unmasking the B-repeat region, which then allows formation the presence of Th2 cytokines that downregulate AMP expres- of a protein-dependent biofilm, even in the absence of PNAG sion [99, 101, 102]. AMPs are also important in modulating [81–83]. The B-repeat superdomain of Aap self-assembles in innate and adaptive immunity, as they can recruit and activate the presence of Zn2+ ions to form twisted, rope-like filaments innate and adaptive immune cells [98]. S. epidermidis and other between staphylococcal cells [84–88]; similar Zn2+-dependent coagulase-negative staphylococci (CoNS) of the skin microbiota assembly has been demonstrated for SasG B repeats [89, 90•]. can also modulate antimicrobial responses in the skin both di- S. epidermidis strains isolated from AD skin contained both rectly and indirectly. Certain strains of commensal CoNS pro- the ica operon and aap gene [14••]. More work will be needed vide protection from S. aureus colonization through the direct to assess the relative importance of PNAG-dependent versus production of staphylococcal AMPs [7], secretion of Aap/SasG-dependent biofilm formation among AD-isolated lipopeptides that stimulate the release of β-defensin from staphylococcal strains. keratinocytes [8], and the induction of immune cell recruitment via IL-1 and IL-17 secreted from macrophages [40]. The com- mensal staphylococcal AMPs target S. aureus to inhibit coloni- Mixed Biofilms zation and can act synergistically with keratinocyte-expressed AMPs [98, 103••]. Interestingly, the CoNS strains that expressed Multi-species biofilms are also prevalent; in fact, the majority AMPs were found to frequently colonize normal skin but were of microbes in nature likely exist as members of polymicrobial rarely detected on AD lesional skin [103••]. Furthermore, AD communities [91]. Such mixed-species biofilms represent an skin also exhibits decreased levels of keratinocyte-secreted interwoven community of organisms with even more complex AMPs [26, 104], which is correlated with increased S. aureus interactions [92–94]. There are many examples in which bac- colonization [103••]. Recently, it was shown that the human terial or fungal species synergize by forming cooperative multi- AMP LL-37 when combined with antimicrobial peptides pro- species biofilms, such as the interactions of Candida albicans duced by the commensal Staphylococcus hominis can inhibit with Streptococcus gordonii in the oral cavity, or C. albicans S. aureus survival more effectively than human or bacterial with S. aureus in denture stomatitis infections [91]. In some AMPs individually. Furthermore, restoring strains of cases, specific interactions between heterologous macromole- S. epidermidis or S. hominis that inhibited S. aureus growth to cules are known to facilitate the inter-species cooperation, as in the skin of two AD subjects led to significant decreases in thecaseofC. albicans proteinAls3directlybindingto S. aureus colonization compared to vehicle alone. These findings Streptococcus gordonii surface protein SspB [95]. Likewise, suggest that interactions between microbial communities in the the staphylococcal biofilm adhesion proteins Aap and SasG skin play a central role in the pathogenesis of AD and that res- have been shown to form heterophilic assemblies, suggesting toration of antimicrobial commensal strains can be an effective that these two staphylococcal species might be able to form way to control S. aureus colonization [103••]. mixed biofilms [90•]. Indeed, a recent paper demonstrated that S. aureus and S. epidermidis can form mixed biofilms in vitro [96], and at least one example has been published of an infected The Impact of Staphylococcal Biofilms on Immune prosthetic joint that was colonized by a mixed S. aureus and Responses and Keratinocyte Function S. epidermidis biofilm [97]. Given the prevalence of both S. aureus and S. epidermidis in AD skin, it is interesting to A number of studies have begun to assess the specific roles that speculate that such mixed staphylococcal biofilms may play staphylococcal biofilms play in the pathogenesis of AD. As an important role in the pathogenesis of AD. mentioned, by virtue of growing the biofilm, staphylococci be- come much more resistant to antibiotic action and immune re- sponses such as phagocytosis. Phagocytosis effectively kills Control of Staphylococcal Colonization of Skin planktonic bacteria and sets the stage for adaptive immune re- by Antimicrobial Peptides sponses [57, 105•]. The formation of a biofilm provides protec- tion to the bacteria within by shielding them from innate immune Antimicrobial peptides (AMPs) play a key role in cutaneous cells, especially macrophages and neutrophils. Studies have immunity [25, 98–100] and are secreted by keratinocytes. shown that neutrophils are inhibited by S. aureus via neutrophilic AMPs can be constitutively active, while others are induced by lysins such as alpha toxin, which is upregulated upon S. aureus infection to combat microbes. Key inducible keratinocyte AMPs biofilm formation following neutrophil exposure [106]. are human β-defensin 2, β-defensin 3, and cathelicidin (LL-37), Macrophages can either be classically activated in order to Curr Allergy Asthma Rep (2017) 17: 81 Page 7 of 11 81 present antigen and defend against intracellular pathogens, or further limiting protection from pathogens. It was also recently these cells can undergo “alternate” activation which is crucial shown that extracts of S. aureus biofilms inhibited the terminal in wound healing and contributes to bacterial persistence [57, differentiation of keratinocytes [113•]. The biofilm extracts in- 107]. The alternate activation of macrophages contributes to duced secretion of IL-6 from the keratinocytes, leading to a chronicity of these infections, which could be important in dis- decrease in expression of the important differentiation markers ease processes such as AD [106]. Biofilms offer protection from keratin 1 and 10, as well as filaggrin (Fig. 3). Furthermore, this macrophage phagocytosis through several mechanisms. The block of terminal differentiation renders the keratinocytes more sheer size of biofilms and the density of the extracellular biofilm susceptible to the cytotoxic effects of staphylococcal alpha tox- matrix have been suggested to render them resistant to engulf- in, which was shown to be secreted by S. aureus biofilms grown ment—referred to as “frustrated phagocytosis” [105•, 108]. In on reconstructed human epidermal tissue [114]. addition, macrophage phagocytosis is inhibited by specific pro- teins secreted from S. aureus biofilms, later identified to be alpha toxin, LukA, and LukB. Increased macrophage cytotoxicity was Clinical Implications also observed in the presence of S. aureus biofilms. S. epidermidis biofilms containing increased levels of dormant Treatment of AD focuses on preventing or reducing bacterial bacteria led to decreased activation of murine macrophages and colonization in lesions and controlling inflammation using less secretion of inflammatory cytokines, suggesting that moisturizers and topical corticosteroids [1]. Bleach baths are biofilms aid in immune evasion [109]. also used to reduce bacterial load present on the skin, and In addition to the immune evasion properties mediated by recently, these have been shown to inhibit S. aureus biofilm biofilms that lead to recurrent, hard-to-treat infections, staphy- formation and reverse pre-formed S. aureus biofilms [115]. lococcal biofilms exert direct effects on keratinocytes. For ex- However, when experiments were repeated on skin biopsies ample, a potentially significant impact of S. aureus in AD pa- from patients with AD, a 0.16% sodium hypochlorite solution tients is its ability to trigger apoptosis in keratinocytes. was needed to eradicate 90% of the bacteria present on the Keratinocytes exposed to S. aureus biofilms were shown to biopsy, whereas only 0.005–0.01% sodium hypochlorite so- lose viability and undergo apoptosis after only 3 h of exposure, lutions were tested on keratinocytes for toxicity [115]. Further while those exposed to planktonic culture at 3 h were not sta- studies will be needed to assess the effects of higher amounts tistically different from the control group of keratinocytes of sodium hypochlorite on keratinocytes and to explore the alone. Cell morphology was also consistent with keratinocyte possibility of recurrence of bacterial colonization. apoptosis [110•], although the mechanism for apoptosis was As described earlier, AMPs are key to preventing S. aureus not investigated. This is of importance as damage to epithelial colonization [98–100, 116, 117]. The isolation of commensal cells releases dsRNA, initiating TLR-3-mediated secretion of strains that produce protective AMPs has been used to assess thymic stromal lymphopoietin (TSLP) [111]. TSLP secretion the effects of AMP replacement on S. aureus colonization. In results in a strong itch response [112] that can exacerbate ex- AD patients, investigators observed a significant difference in coriation of the skin. Furthermore, TSLP induces dermal den- S. aureus colonization in skin treated with the commensal dritic cell activation and recruitment of Th2 cells that secrete bacteria versus vehicle control [103••]. Recent studies have IL-4 and IL-13, which have a suppressive effect on AMPs [26], also explored the therapeutic use of human keratinocyte
Fig. 3 Immune dysfunction in atopic dermatitis. Genetic predispositions, via antigen presentation, activate naïve T cells. The presence of TSLP such as FLG mutations, can weaken the physical strength of the enables naïve T cells to differentiate and expand as Th2 cells, which epidermal barrier. In addition, colonization by S. aureus also causes secrete IL-4 and IL-13. These cytokines are important in class inflammation and excoriation, worsening barrier function. With loss of switching of B cells to secrete IgE as well as their ability to diminish barrier function, aeroallergens are able to interact with dendritic cells, and the secretion of antimicrobial peptides 81 Page 8 of 11 Curr Allergy Asthma Rep (2017) 17: 81
AMPs in treating biofilms; LL-37 was able to eradicate pre- Compliance with Ethical Standards existing MRSA biofilms in a wounded skin model without compromising keratinocyte function [56, 118]. However, ad- Conflict of Interest Dr. Herr reports the following disclosures: Advisory board member for Hoth Therapeutics, Inc.; Owns equity in ditional in vivo studies are needed to determine if replenishing Chelexa BioSciences, LLC; Co-inventor on patent EP23106821 licensed AMPs is an effective treatment option. to Chelexa BioSciences, LLC; and Co-inventor on patent application US As dysbiosis is a driving force in AD, restoration of balance 20140308326 A1. Ms. Gonzalez, Dr. Biagini Myers, and Dr. Khurana in microbial communities is a target of upcoming treatments. Hershey declare no conflicts of interest relevant to this manuscript. Recently, commensal skin bacteria from healthy human indi- Human and Animal Rights and Informed Consent This article does viduals have been transplanted to the skin of mice with in- not contain any studies with human or animal subjects performed by any duced AD to re-establish a balanced microbiome [119]. To of the authors. counterbalance the observed decrease in gram-negative (GN) species in patients with AD, culturable GN strains from AD patients and healthy volunteers were tested for their effects on References S. aureus. Roseomonas mucosa isolated from healthy volun- teers, but not from AD patients, was shown to inhibit S. aureus Papers of particular interest, published recently, have been growth in vitro. These findings suggest that specific GN highlighted as: strains can exert a bacteriostatic effect on S. aureus.When • Of importance R. mucosa strains from healthy volunteers were transplanted •• Of major importance onto the skin of mice, the authors observed decreased coloni- zation of S. aureus, along with improved transepithelial water 1. Weidinger S, Novak N. Atopic dermatitis. Lancet. loss measurements and decreased redness and swelling in the 2016;387(10023):1109–22. ears [119]. In future studies, it will be interesting to assess the 2. Drucker AM, Wang AR, Li WQ, Sevetson E, Block JK, Qureshi AA. The burden of atopic dermatitis: summary of a report for the overall contribution of transplanted individual species or even National Eczema Association. J Invest Dermatol. 2017;137(1): particular strains on AD outcomes. These methods can also be 26–30. applied to other organisms such as S. epidermidis or other 3. Biagini Myers JM, Khurana Hershey GK. Eczema in early life: commensal staphylococcal species. genetics, the skin barrier, and lessons learned from birth cohort studies. J Pediatr. 2010;157(5):704–14. 4. Zheng T, Yu J, Oh MH, Zhu Z. The atopic march: progression from atopic dermatitis to allergic rhinitis and asthma. Allergy Conclusion Asthma Immunol Res. 2011;3(2):67–73. 5. Brandt EB, Sivaprasad U. Th2 cytokines and atopic dermatitis. J The severity of AD is significantly influenced by the coloni- Clin Cell Immunol. 2011;2(3):110. 6. Travers JB. Toxic interaction between Th2 cytokines and zation of S. aureus and S. epidermidis, which colonize the Staphylococcus aureus in atopic dermatitis. J Invest Dermatol. skin via microbial communities known as biofilms. Recent 2014;134(8):2069–71. studies have reported staphylococcal biofilms colonizing 7. Kobayashi T, Glatz M, Horiuchi K, Kawasaki H, Akiyama H, eccrine ducts adjacent to lesional skin in patients with AD, Kaplan DH, et al. Dysbiosis and Staphylococcus aureus coloniza- tion drives inflammation in atopic dermatitis. Immunity. and a number of studies have demonstrated significant im- 2015;42(4):756–66. pacts of staphylococcal biofilms on the differentiation, apo- 8. Salava A, Lauerma A. Role of the skin microbiome in atopic ptosis, or cytokine secretion by keratinocytes. These studies dermatitis. Clin Transl Allergy. 2014;4:33. highlight the importance of staphylococcal biofilms in the 9. Williams MR, Gallo RL. The role of the skin microbiome in atopic pathogenesis of AD and highlight the importance of studying dermatitis. Curr Allergy Asthma Rep. 2015;15(11):65. 10. Ovaere P, Lippens S, Vandenabeele P, Declercq W. The emerging host-microbial interactions and their implications for host im- roles of serine protease cascades in the epidermis. Trends Biochem munity in AD and allergic disease. Further understanding of Sci. 2009;34(9):453–63. S. aureus biofilms in the context of AD will allow for devel- 11. Otto M. Staphylococcus colonization of the skin and antimicrobial opment of better treatments to reduce skin colonization, re- peptides. Expert Rev Dermatol. 2010;5(2):183–95. duce flares, and dampen the rampant Th2 response that likely 12. Archer NK, Mazaitis MJ, Costerton JW, Leid JG, Powers ME, Shirtliff ME. Staphylococcus aureus biofilms: Properties, regula- contributes to the development of additional co-morbidities. tion and roles in human disease. Virulence. 2011;2(5):445-59. 13. Dasgupta MK. Biofilms and infection in dialysis patients. Semin Acknowledgments Research by the authors on atopic dermatitis, host Dial. 2002;15(5):338–46. epithelial responses, and staphylococcal biofilms has been supported by 14.•• Allen HB, Vaze ND, Choi C, Hailu T, Tulbert BH, Cusack CA, NIH grants U19 AI070235 (to GKH, JBM, and ABH) and R01 et al. The presence and impact of biofilm-producing staphylococci GM094363 (to ABH). We gratefully acknowledge the editorial assistance in atopic dermatitis. JAMA Dermatol. 2014;150(3):260–5. The of Angela Sadler. initial study reporting near-ubiquitous S. aureus biofilms in Curr Allergy Asthma Rep (2017) 17: 81 Page 9 of 11 81
AD lesional skin and showing the activation of TLR2 adjacent inhibitor Kazal type 5 (SPINK5), kallikrein-related peptidase 7 to the sweat ducts. (KLK7), and filaggrin (FLG) polymorphisms to eczema risk. J 15. Nutten S. Atopic dermatitis: global epidemiology and risk factors. Allergy Clin Immunol. 2008;122(3):560–8. e4 Ann Nutr Metab. 2015;66(Suppl 1):8–16. 35. Walley AJ, Chavanas S, Moffatt MF, Esnouf RM, Ubhi B, 16. Williams H, Flohr C. How epidemiology has challenged 3 pre- Lawrence R, et al. Gene polymorphism in Netherton and common vailing concepts about atopic dermatitis. J Allergy Clin Immunol. atopic disease. Nat Genet. 2001;29(2):175–8. 2006;118(1):209–13. 36. Wang XW, Wang JJ, Gutowska-Owsiak D, Salimi M, Selvakumar 17. Bieber T. Atopic dermatitis. N Engl J Med. 2008;358(14):1483– TA, Gwela A, et al. Deficiency of filaggrin regulates endogenous 94. cysteine protease activity, leading to impaired skin barrier func- 18. Williams H, Stewart A, von Mutius E, Cookson W, Anderson HR. tion. Clin Exp Dermatol. 2017;42(6):622–31. Is eczema really on the increase worldwide? J Allergy Clin 37. Williams MR, Nakatsuji T, Sanford JA, Vrbanac AF, Gallo RL. Immunol. 2008;121(4):947–54. e15 Staphylococcus aureus induces increased serine protease activity 19. Strachan D, Sibbald B, Weiland S, Ait-Khaled N, Anabwani G, in keratinocytes. J Invest Dermatol. 2017;137(2):377–84. Anderson HR, et al. Worldwide variations in prevalence of symp- 38. Gallo RL. Human skin is the largest epithelial surface for interac- toms of allergic rhinoconjunctivitis in children: the International tion with microbes. J Invest Dermatol. 2017;137(6):1213–4. Study of Asthma and Allergies in Childhood (ISAAC). Pediatr 39. Dybboe R, Bandier J, Skov L, Engstrand L, Johansen JD. The role – Allergy Immunol. 1997;8(4):161 76. of the skin microbiome in atopic dermatitis: a systematic review. 20. Grice EA, Segre JA. The skin microbiome. Nat Rev Microbiol. Br J Dermatol. 2017. https://doi.org/10.1111/bjd.15390. – 2011;9(4):244 53. 40. Belkaid Y, Segre JA. Dialogue between skin microbiota and im- 21. Wang M, Karlsson C, Olsson C, Adlerberth I, Wold AE, Strachan munity. Science (New York, NY). 2014;346(6212):954–9. DP, et al. Reduced diversity in the early fecal microbiota of infants – 41. SanMiguel A, Grice EA. Interactions between host factors and the with atopic eczema. J Allergy Clin Immunol. 2008;121(1):129 skin microbiome. Cell Mol Life Sci. 2015;72(8):1499–515. 34. 42. Kong HH. Skin microbiome: genomics-based insights into the 22. Okada H, Kuhn C, Feillet H, Bach JF. The ‘hygiene hypothesis’ diversity and role of skin microbes. Trends Mol Med. for autoimmune and allergic diseases: an update. Clin Exp 2011;17(6):320–8. Immunol. 2010;160(1):1–9. 43. Kennedy EA, Connolly J, Hourihane JO, Fallon PG, McLean 23. United Nations. World Urbanization Prospects; the 2007 revision. WH, Murray D, et al. Skin microbiome before development of United Nations Department of Economic and Social Affairs, atopic dermatitis: early colonization with commensal staphylococ- Population Division.. New York; 2008. ci at 2 months is associated with a lower risk of atopic dermatitis at 24. Bendiks M, Kopp MV. The relationship between advances in un- 1 year. J Allergy Clin Immunol. 2017;139(1):166–72. derstanding the microbiome and the maturing hygiene hypothesis. •• Curr Allergy Asthma Rep. 2013;13(5):487–94. 44. Kong HH, Oh J, Deming C, Conlan S, Grice EA, Beatson MA, 25. Agrawal R, Woodfolk JA. Skin barrier defects in atopic dermatitis. et al. Temporal shifts in the skin microbiome associated with dis- ease flares and treatment in children with atopic dermatitis. Curr Allergy Asthma Rep. 2014;14(5):433. – 26. Ong PY, Leung DY. Bacterial and viral infections in atopic der- Genome Res. 2012;22(5):850 9. A study describing dysbiosis in active AD lesions using 16S rRNA sequencing, showing matitis: a comprehensive review. Clin Rev Allergy Immunol. S. aureus S. epidermidis 2016;51(3):329–37. increased prevalence of both and . 27. Lakatos G, Soproni K, Doka A, Miklosi A. A comparative ap- 45. Poretsky R, Rodriguez RL, Luo C, Tsementzi D, Konstantinidis proach to dogs’ (Canis familiaris) and human infants’ comprehen- KT. Strengths and limitations of 16S rRNA gene amplicon se- sion of various forms of pointing gestures. Anim Cogn. quencing in revealing temporal microbial community dynamics. 2009;12(4):621–31. PLoS One. 2014;9(4):e93827. •• 28. Kawasaki H, Nagao K, Kubo A, Hata T, Shimizu A, Mizuno H, 46. Byrd AL, Deming C, Cassidy SKB, Harrison OJ, Ng WI, Conlan et al. Altered stratum corneum barrier and enhanced percutaneous S, et al. Staphylococcus aureus and Staphylococcus epidermidis immune responses in filaggrin-null mice. J Allergy Clin Immunol. strain diversity underlying pediatric atopic dermatitis. Sci Transl 2012;129(6):1538–46. e6 Med. 2017;9(397):eaal4651. A study using metagenomic shot- S. aureus 29. Oyoshi MK, Murphy GF, Geha RS. Filaggrin-deficient mice ex- gun sequencing to identify strain-level differences in S. epidermidis hibit TH17-dominated skin inflammation and permissiveness to and colonization in pediatric AD patients. epicutaneous sensitization with protein antigen. J Allergy Clin 47.•• Oh J, Byrd AL, Deming C, Conlan S, Program NCS, Kong HH, Immunol. 2009;124(3):485–93. 93 e1 et al. Biogeography and individuality shape function in the human 30. Gupta J, Grube E, Ericksen MB, Stevenson MD, Lucky AW, skin metagenome. Nature. 2014;514(7520):59–64. The first Sheth AP, et al. Intrinsically defective skin barrier function in metagenomic survey of different healthy human skin sites, children with atopic dermatitis correlates with disease severity. J which lays the foundation for studies to assess changes of the Allergy Clin Immunol. 2008;121(3):725–30. e2 skin microbiome in disease. 31. de Veer SJ, Furio L, Harris JM, Hovnanian A. Proteases: common 48. Brauweiler AM, Goleva E, Leung DY. Th2 cytokines increase culprits in human skin disorders. Trends Mol Med. 2014;20(3): Staphylococcus aureus alpha toxin-induced keratinocyte death 166–78. through the signal transducer and activator of transcription 6 32. Fischer J, Meyer-Hoffert U. Regulation of kallikrein-related pep- (STAT6). J Invest Dermatol. 2014;134(8):2114–21. tidases in the skin—from physiology to diseases to therapeutic 49. Brauweiler AM, Bin L, Kim BE, Oyoshi MK, Geha RS, Goleva options. Thromb Haemost. 2013;110(3):442–9. E, et al. Filaggrin-dependent secretion of sphingomyelinase pro- 33. Deraison C, Bonnart C, Lopez F, Besson C, Robinson R, tects against staphylococcal alpha-toxin-induced keratinocyte Jayakumar A, et al. LEKTI fragments specifically inhibit KLK5, death. J Allergy Clin Immunol. 2013;131(2):421–7. e1-2 KLK7, and KLK14 and control desquamation through a pH- 50. Amagai M, Matsuyoshi N, Wang ZH, Andl C, Stanley JR. Toxin dependent interaction. Mol Biol Cell. 2007;18(9):3607–19. in bullous impetigo and staphylococcal scalded-skin syndrome 34. Weidinger S, Baurecht H, Wagenpfeil S, Henderson J, Novak N, targets desmoglein 1. Nat Med. 2000;6(11):1275–7. Sandilands A, et al. Analysis of the individual and aggregate ge- 51. Hanakawa Y, Schechter NM, Lin C, Nishifuji K, Amagai M, netic contributions of previously identified serine peptidase Stanley JR. Enzymatic and molecular characteristics of the 81 Page 10 of 11 Curr Allergy Asthma Rep (2017) 17: 81
efficiency and specificity of exfoliative toxin cleavage of 72. Abraham NM, Jefferson KK. Staphylococcus aureus clumping desmoglein 1. J Biol Chem. 2004;279(7):5268–77. factor B mediates biofilm formation in the absence of calcium. 52. Amagai M, Yamaguchi T, Hanakawa Y, Nishifuji K, Sugai M, Microbiology. 2012;158(Pt 6):1504–12. Stanley JR. Staphylococcal exfoliative toxin B specifically cleaves 73. Fleury OM, McAleer MA, Feuillie C, Formosa-Dague C, desmoglein 1. J Invest Dermat. 2002;118(5):845–50. Sansevere E, Bennett DE, et al. Clumping Factor B promotes 53. Hauk PJ, Hamid QA, Chrousos GP, Leung DY. Induction of corti- adherence of Staphylococcus aureus to corneocytes in atopic der- costeroid insensitivity in human PBMCs by microbial matitis. Infect Immun. 2017;85(6):e00994. superantigens. J Allergy Clin Immunol. 2000;105(4):782–7. 74. Vuong C, Voyich JM, Fischer ER, Braughton KR, Whitney AR, 54. Schlievert PM, Case LC, Strandberg KL, Abrams BB, Leung DY. DeLeo FR, et al. Polysaccharide intercellular adhesin (PIA) pro- Superantigen profile of Staphylococcus aureus isolates from pa- tects Staphylococcus epidermidis against major components of the tients with steroid-resistant atopic dermatitis. Clin Infect Dis. human innate immune system. Cell Microbiol. 2004;6(3):269–75. 2008;46(10):1562–7. 75. Formosa-Dague C, Feuillie C, Beaussart A, Derclaye S, 55. Costerton W, Veeh R, Shirtliff M, Pasmore M, Post C, Ehrlich G. Kucharikova S, Lasa I, et al. Sticky matrix: adhesion mechanism The application of biofilm science to the study and control of of the Staphylococcal polysaccharide intercellular adhesin. ACS chronic bacterial infections. J Clin Invest. 2003;112(10):1466–77. Nano. 2016;10(3):3443–52. 56. Pletzer D, Hancock RE. Antibiofilm peptides: potential as broad- 76. Cramton SE, Gerke C, Schnell NF, Nichols WW, Gotz F. The spectrum agents. J Bacteriol. 2016;198(19):2572–8. intercellular adhesion (ica) locus is present in Staphylococcus au- 57. Watters C, Fleming D, Bishop D, Rumbaugh KP. Host responses reus and is required for biofilm formation. Infect Immun. to biofilm. Prog Mol Biol Transl Sci. 2016;142:193–239. 1999;67(10):5427–33. 58. Otto M. Staphylococcal infections: mechanisms of biofilm matu- 77. Cue D, Lei MG, Lee CY. Genetic regulation of the intercellular ration and detachment as critical determinants of pathogenicity. adhesion locus in Staphylococci. Front Cell Infect Microbiol. Annu Rev Med. 2013;64:175–88. 2012;2:38. 59. Otto M. Staphylococcal biofilms. Curr Top Microbiol Immunol. 78. Schaeffer CR, Hoang TN, Sudbeck CM, Alawi M, Tolo IE, – 2008;322:207 28. Robinson DA, et al. Versatility of biofilm matrix molecules in 60. Vlassova N, Han A, Zenilman JM, James G, Lazarus GS. New Staphylococcus epidermidis clinical isolates and importance of horizons for cutaneous microbiology: the role of biofilms in der- polysaccharide intercellular adhesin expression during high shear matological disease. Br J Dermatol. 2011;165(4):751–9. stress. mSphere. 2016;1(5):e00165. — ‘ ’ 61. Otto M. Staphylococcus epidermidis the accidental pathogen. 79. Yarawsky AE, English LR, Whitten ST, Herr AB. The proline/ – Nat Rev Microbiol. 2009;7(8):555 67. glycine-rich region of the biofilm adhesion protein Aap forms an 62. Moormeier DE, Bose JL, Horswill AR, Bayles KW. Temporal and extended stalk that resists compaction. J Mol Biol. 2017;429(2): stochastic control of Staphylococcus aureus biofilm development. 261–79. – MBio. 2014;5(5):e01341 14. 80. Hussain M, Herrmann M, von Eiff C, Perdreau-Remington F, 63. Sharp JA, Echague CG, Hair PS, Ward MD, Nyalwidhe JO, Peters G. A 140-kilodalton extracellular protein is essential for Geoghegan JA, et al. Staphylococcus aureus surface protein the accumulation of Staphylococcus epidermidis strains on sur- SdrE binds complement regulator factor H as an immune evasion faces. Infect Immun. 1997;65(2):519–24. tactic. PLoS One. 2012;7(5):e38407. 81. Paharik AE, Kotasinska M, Both A, Hoang TN, Buttner H, Roy P, 64. Foster TJ, Hook M. Surface protein adhesins of Staphylococcus et al. The metalloprotease SepA governs processing of – aureus. Trends Microbiol. 1998;6(12):484 8. accumulation-associated protein and shapes intercellular adhesive 65. Ponnuraj K, Bowden MG, Davis S, Gurusiddappa S, Moore D, surface properties in Staphylococcus epidermidis. Mol Microbiol. “ ” Choe D, et al. A dock, lock, and latch structural model for a 2017;103(5):860–74. staphylococcal adhesin binding to fibrinogen. Cell. 2003;115(2): 82. Rohde H, Burdelski C, Bartscht K, Hussain M, Buck F, Horstkotte – 217 28. MA, et al. Induction of Staphylococcus epidermidis biofilm for- 66. Zhang X, Wu M, Zhuo W, Gu J, Zhang S, Ge J, et al. Crystal mation via proteolytic processing of the accumulation-associated structures of Bbp from Staphylococcus aureus reveal the ligand protein by staphylococcal and host proteases. Mol Microbiol. binding mechanism with Fibrinogen alpha. Protein Cell. 2005;55(6):1883–95. – 2015;6(10):757 66. 83. Corrigan RM, Rigby D, Handley P, Foster TJ. The role of 67. Ganesh VK, Rivera JJ, Smeds E, Ko YP, Bowden MG, Wann ER, Staphylococcus aureus surface protein SasG in adherence and et al. A structural model of the Staphylococcus aureus ClfA- biofilm formation. Microbiology. 2007;153(Pt 8):2435–46. fibrinogen interaction opens new avenues for the design of anti- 84. Conrady DG, Brescia CC, Horii K, Weiss AA, Hassett DJ, Herr staphylococcal therapeutics. PLoS Pathog. 2008;4(11):e1000226. AB. A zinc-dependent adhesion module is responsible for inter- 68. Xiang H, Feng Y, Wang J, Liu B, Chen Y, Liu L, et al. Crystal cellular adhesion in staphylococcal biofilms. Proc Natl Acad Sci U structures reveal the multi-ligand binding mechanism of S A. 2008;105(49):19456–61. Staphylococcus aureus ClfB. PLoS Pathog. 2012;8(6):e1002751. 69. Askarian F, Ajayi C, Hanssen AM, van Sorge NM, Pettersen I, 85. Herr AB, Conrady DG. Thermodynamic analysis of metal ion- – Diep DB, et al. The interaction between Staphylococcus aureus induced protein assembly. Methods Enzymol. 2011;488:101 21. + SdrD and desmoglein 1 is important for adhesion to host cells. Sci 86. Conrady DG, Wilson JJ, Herr AB. Structural basis for Zn2 -de- Rep. 2016;6:22134. pendent intercellular adhesion in staphylococcal biofilms. Proc – 70. Barbu EM, Ganesh VK, Gurusiddappa S, Mackenzie RC, Foster Natl Acad Sci U S A. 2013;110(3):E202 11. TJ, Sudhof TC, et al. Beta-neurexin is a ligand for the 87. Shelton CL, Conrady DG, Herr AB. Functional consequences of Staphylococcus aureus MSCRAMM SdrC. PLoS Pathog. B-repeat sequence variation in the staphylococcal biofilm protein 2010;6(1):e1000726. Aap: deciphering the assembly code. Biochem J. 2017;474(3): – 71. Cho SH, Strickland I, Boguniewicz M, Leung DY. Fibronectin 427 43. and fibrinogen contribute to the enhanced binding of 88. Chaton CT, Herr AB. Defining the metal specificity of a multi- Staphylococcus aureus to atopic skin. J Allergy Clin Immunol. functional biofilm adhesion protein. Protein Sci. 2017;26:1964– 2001;108(2):269–74. 73. Curr Allergy Asthma Rep (2017) 17: 81 Page 11 of 11 81
89. Geoghegan JA, Corrigan RM, Gruszka DT, Speziale P, O'Gara JP, 105.• Scherr TD, Hanke ML, Huang O, James DB, Horswill AR, Bayles Potts JR, et al. Role of surface protein SasG in biofilm formation KW, et al. Staphylococcus aureus biofilms induce macrophage by Staphylococcus aureus. J Bacteriol. 2010;192(21):5663–73. dysfunction through leukocidin AB and alpha-toxin. MBio. 90.• Formosa-Dague C, Speziale P, Foster TJ, Geoghegan JA, Dufrene 2015;6(4):e01021. A paper identifying protein factors secreted YF. Zinc-dependent mechanical properties of Staphylococcus au- from S. aureus biofilms that inhibit macrophage phagocytosis, reus biofilm-forming surface protein SasG. Proc Natl Acad Sci U illustrating how S. aureus biofilms can evade host defense. S A. 2016;113(2):410–5. A study demonstrating Zn2+-depen- 106. Scherr TD, Heim CE, Morrison JM, Kielian T. Hiding in plain dent intercellular adhesion between S. aureus cells mediated sight: interplay between Staphylococcal biofilms and host immu- by SasG, and heterophilic adhesion between S. aureus and S. nity. Front Immunol. 2014;5:37. epidermidis mediated by SasG/Aap, using single-cell force 107. Paharik AE, Horswill AR. The staphylococcal biofilm: adhesins, microscopy. regulation, and host response. Microbiol Spectr. 2016;4(2): 91. Peters BM, Jabra-Rizk MA, O'May GA, Costerton JW, Shirtliff VMBF-0022-2015. ME. Polymicrobial interactions: impact on pathogenesis and hu- 108. Thurlow LR, Hanke ML, Fritz T, Angle A, Aldrich A, Williams man disease. Clin Microbiol Rev. 2012;25(1):193–213. SH, et al. Staphylococcus aureus biofilms prevent macrophage 92. Stacy A, McNally L, Darch SE, Brown SP, Whiteley M. The phagocytosis and attenuate inflammation in vivo. J Immunol. biogeography of polymicrobial infection. Nat Rev Microbiol. 2011;186(11):6585–96. 2016;14(2):93–105. 109. Cerca F, Andrade F, Franca A, Andrade EB, Ribeiro A, Almeida 93. Wolcott R, Costerton JW, Raoult D, Cutler SJ. The polymicrobial AA, et al. Staphylococcus epidermidis biofilms with higher pro- nature of biofilm infection. Clin Microbiol Infect. 2013;19(2): portions of dormant bacteria induce a lower activation of murine 107–12. macrophages. J Med Microbiol. 2011;60(Pt 12):1717–24. 94. Gabrilska RA, Rumbaugh KP. Biofilm models of polymicrobial 110.• Tankersley A, Frank MB, Bebak M, Brennan R. Early effects of infection. Future Microbiol. 2015;10(12):1997–2015. Staphylococcus aureus biofilm secreted products on inflammatory 95. Silverman RJ, Nobbs AH, Vickerman MM, Barbour ME, responses of human epithelial keratinocytes. J Inflamm (Lond). Jenkinson HF. Interaction of Candida albicans cell wall Als3 pro- 2014;11:17. A paper demonstrating that S. aureus biofilm con- tein with Streptococcus gordonii SspB adhesin promotes devel- ditioned media induces significantly stronger inflammatory opment of mixed-species communities. Infect Immun. responses in human keratinocytes compared to planktonic 2010;78(11):4644–52. conditioned media. 96. Stewart EJ, Payne DE, Ma TM, VanEpps JS, Boles BR, Younger 111. Takai T. TSLP expression: cellular sources, triggers, and regulato- JG, et al. Effect of antimicrobial and physical treatments on ry mechanisms. Allergol Int. 2012;61(1):3–17. growth of multispecies Staphylococcal biofilms. Appl Environ 112. Wilson SR, The L, Batia LM, Beattie K, Katibah GE, McClain SP, Microbiol. 2017;83(12):e03483-16. et al. The epithelial cell-derived atopic dermatitis cytokine TSLP 97. Stoodley P, Conti SF, DeMeo PJ, Nistico L, Melton-Kreft R, activates neurons to induce itch. Cell. 2013;155(2):285–95. Johnson S, et al. Characterization of a mixed MRSA/MRSE bio- 113.• Son ED, Kim HJ, Park T, Shin K, Bae IH, Lim KM, et al. film in an explanted total ankle arthroplasty. FEMS Immunol Med Staphylococcus aureus inhibits terminal differentiation of normal Microbiol. 2011;62(1):66–74. human keratinocytes by stimulating interleukin-6 secretion. J 98. Zhang LJ, Gallo RL. Antimicrobial peptides. Curr Biol. Dermatol Sci. 2014;74(1):64–71. A study exploring the impact 2016;26(1):R14–9. of S. aureus on keratinocyte differentiation, describing the 99. Ong PY, Ohtake T, Brandt C, Strickland I, Boguniewicz M, Ganz increase in IL-6 and decrease in filaggrin and other differen- T, et al. Endogenous antimicrobial peptides and skin infections in tiation markers upon exposure to S. aureus. atopic dermatitis. N Engl J Med. 2002;347(15):1151–60. 114. den Reijer PM, Haisma EM, Lemmens-den Toom NA, Willemse 100. Powers CE, McShane DB, Gilligan PH, Burkhart CN, Morrell J, Koning RI, Demmers JA, et al. Detection of alpha-toxin and DS. Microbiome and pediatric atopic dermatitis. J Dermatol. other virulence factors in biofilms of Staphylococcus aureus on 2015;42(12):1137–42. polystyrene and a human epidermal model. PLoS One. 101. Nomura I, Goleva E, Howell MD, Hamid QA, Ong PY, Hall CF, 2016;11(1):e0145722. et al. Cytokine milieu of atopic dermatitis, as compared to psori- 115. Eriksson S, van der Plas MJA, Morgelin M, Sonesson A. asis, skin prevents induction of innate immune response genes. J Antibacterial and antibiofilm effects of sodium hypochlorite Immunol. 2003;171(6):3262–9. against Staphylococcus aureus isolates derived from patients with 102. Hata TR, Gallo RL. Antimicrobial peptides, skin infections, and atopic dermatitis. Br J Dermatol. 2017;177(2):513–21. atopic dermatitis. Semin Cutan Med Surg. 2008;27(2):144–50. 116. Batoni G, Maisetta G, Esin S. Antimicrobial peptides and their 103.•• Nakatsuji T, Chen TH, Narala S, Chun KA, Two AM, Yun T, et al. interaction with biofilms of medically relevant bacteria. Biochim Antimicrobials from human skin commensal bacteria protect Biophys Acta. 2016;1858(5):1044–60. against Staphylococcus aureus and are deficient in atopic derma- 117. Boguniewicz M, Leung DY.Atopic dermatitis: a disease of altered titis. Sci Transl Med. 2017;9(378):eaah4680. A study describing skin barrier and immune dysregulation. Immunol Rev. AMPs that inhibit S. aureus from strains of coagulase-negative 2011;242(1):233–46. staphylococci common on the skin of healthy individuals but 118. Haisma EM, de Breij A, Chan H, van Dissel JT, Drijfhout JW, rare in AD patients. Hiemstra PS, et al. LL-37-derived peptides eradicate multidrug- 104. de Koning HD, Kamsteeg M, Rodijk-Olthuis D, van Vlijmen- resistant Staphylococcus aureus from thermally wounded human skin Willems IM, van Erp PE, Schalkwijk J, et al. Epidermal expres- equivalents. Antimicrob Agents Chemother. 2014;58(8):4411–9. sion of host response genes upon skin barrier disruption in normal 119. Myles IA, Williams KW, Reckhow JD, Jammeh ML, Pincus NB, skin and uninvolved skin of psoriasis and atopic dermatitis pa- Sastalla I, et al. Transplantation of human skin microbiota in tients. J Invest Dermatol. 2011;131(1):263–6. models of atopic dermatitis. JCI Insight. 2016;1(10):e86955. The Laryngoscope © 2018 The American Laryngological, Rhinological and Otological Society, Inc.
Feasibility of Shotgun Metagenomics to Assess Microbial Ecology of Pediatric Tracheostomy Tubes
James C. Wang, MD, PhD ; Mathieu Bergeron, BPharm, MD, FRCSC; Heidi Andersen, MD MS; Raisa Tikhtman, BA; David Haslam, MD; Tammy Hunter, BS; Andrew B. Herr, PhD; Alessandro de Alarcon, MD, MPH
Objective: Biofilm formation on medical devices such as tracheostomy tubes (TTs) is a serious problem. The clinical impact of biofilms on the airway is still unclear. Biofilms may play a role in granulation tissue development, recurrent airway infections, and failure of laryngotracheal reconstructions. The microbial ecology on TTs has yet to be elucidated. The purpose of this study was to determine the feasibility of shotgun metagenomics to assess the biodistribution of microorganisms on TTs. Methods: Four TTs were collected from pediatric patients (1.4–10.2 years) with (n = 2) and without (n = 2) granulation tissue formation. Duration of TT placement prior to retrieval from patients ranged from 5 to 365 days. DNA extraction was performed using the MO BIO UltraClean Microbial Isolation (Mo Bio Laboratories, Carlsbad, CA). Library generation using Nextera XT adapters (Illumina Inc., San Diego, CA) and metagenomic shotgun sequencing was performed using the Illumina NextSeq500 (Illumina Inc, San Diego, CA). Salinibacter ruber, a species not found in mammalian microbiome communities, was used as a DNA standard and represented 0.7% to 5.7% of the microbiome, ensuring good quality and abundance of sample DNA. Results: Metagenomic shotgun sequencing was successful for all patients. In TTs associated with granuloma, Fusobacter- ium nucleatum, Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae were predominant, most of which are considered pathogens. From TTs without granulomas, Neisseria mucosa, Neisseria sicca, Acinetobacter baumannii, and Hae- mophilus parainfluenzae were identified, primarily consistent with respiratory microbiome. Conclusion: This study reveals that metagenomic shotgun sequencing of biofilms formed on pediatric TTs is feasible with an apparent difference in microbiome for patients with granulation tissue. Further studies are necessary to elucidate the patho- genesis of microbial ecology and its role in airway disease in patients with TTs. Key Words: Biofilms, metagenomic sequencing, tracheostomy tubes, tracheal stenosis, subglottic stenosis, laryngotracheal reconstruction, granuloma, granulation tissue, pyrosequencing. Level of Evidence: 2c Laryngoscope, 129:317–323, 2019
INTRODUCTION Complications of intubation include injury to teeth, vocal Endotracheal intubation is a critical method for cord damage, lacerations or ischemia of tracheal mucosa, securing an airway in patients with respiratory failure airway hematomas, granuloma formation, and laryngo- – secondary to airway trauma, obstruction, or aspiration.1 tracheal stenosis (LTS).1 3 Whereas effective intubation protects patients from dire Laryngotracheal stenosis poses a significant thera- consequences of prolonged hypoxia, endotracheal intuba- peutic challenge.4,5 It most commonly affects the subglot- tion poses risks of airway and esophageal trauma with tis of intubated pediatric patients due to the position of implications for short-term and long-term morbidity. the endotracheal tube in the narrowest region of the air- way.6 Ninety percent of pediatric acquired subglottic ste- 6,7 From the Department of Otolaryngology–Head and Neck Surgery noses are attributable to endotracheal intubation. (J.C.W., A.DA.); the School of Medicine (R.T., T.H.), University of Cincinnati When LTS is significant, patients may need a tracheos- Medical Center; the Division of Pediatric Otolaryngology–Head and Neck Surgery (J.C.W., M.B., D.H., A.DA.); the Division of Infectious Diseases (H.A., tomy tube (TT) or an airway reconstruction. If the former A.B.H.); Division of Immunobiology (T.H.), Cincinnati Children’s Hospital option is chosen, the ultimate goal would be decannula- Medical Center, Cincinnati, OH, U.S.A. tion after fixing the underlying stenosis. Editor’s Note: This Manuscript was accepted for publication May 21, 2018. Endoscopic evaluation of the airway is necessitated Presented as an oral presentation for the American Broncho- for assessment of airway patency and visualization of any Esophagological Association (ABEA) at the Combined Otolaryngology other abnormalities, including granulomas or granulation Spring Meeting (COSM), National Harbor, Maryland, U.S.A., April fl fl 8 16–22, 2018. tissue re ecting in ammation of the mucosa. The pres- The authors have no funding, financial relationships, or conflicts of ence of granulation tissue in the airway can delay decan- interest to disclose. nulation; endoscopic removal is required to prevent Send correspondence to Alessandro de Alarcon, MD, MPH, Professor, Divisions of Pediatric Otolaryngology–Head and Neck Surgery, Cincinnati potential obstruction from continued growth of the tissue Children’s Hospital Medical Center, 3333 Burnet Ave. MLC# 2018, Cincin- or bleeding complications.9 Granulation tissue manifests nati, OH 45242, USA. E-mail: [email protected] secondary to a localized inflammatory response and is DOI: 10.1002/lary.27356 commonly observed suprastomally in patients with
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 317 TABLE I. Demographic Data and Relevant Information Regarding Tracheostomy Tubes
Age Last at Tube Tracheostomy Tracheostomy Antibiotics at the Change Tube Change Duration Granulation Time of Tube Primary Microbiology Patient (years) Sex Comorbidities (weeks) (years) Tissue Collection Culture of the Airway
1 1.4 M Prematurity, bronchopulmonary 4 1.1 N Azithromycin No significant growth dysplasia, chronic lung disease, GERD, chronic aspiration with recurrent respiratory infections 2 5.1 M Prematurity, bronchopulmonary 52 4.8 Y n/a Haemophilus influenza dysplasia, bilateral vocal cord paralysis, obstructive sleep apnea, chronic aspiration with recurrent respiratory infections 3 10.2 F Congenital central 0.7 9.7 Y n/a Haemophilus influenza, hypoventilation syndrome oropharyngeal flora 4 5.3 M Prematurity, congenital CMV 4 5 N Sulfamethoxazole/ Pseudomonas infection, prior trimethoprim aeruginosa* laryngotracheoplasty failure Amoxicillin/ Staphyloccous clavulanate aureus
*Cultured prior to airway reconstruction and previously treated. CMV = cytomegalovirus infection; dsLTP:double-stage laryngotracheoplasty; F = female; GERD = gastroesophageal reflux disorder; M = male; N = no; NA = nonapplicable; Y = yes. tracheostomies.10 The cause of granulation tissue forma- bronchoscopy with bronchoalveolar lavage (BAL) with cultures. tion is multifactorial and is not completely understood. Microlaryngoscopy and bronchoscopy was performed to evaluate Various authors have documented associations between the airway from the supraglottis to the bronchus, including the stomal area. Granulation tissue or the presence of a granuloma granulation tissue and the use of nonabsorbable sutures, was defined by abnormal growth of a flesh-colored mass inside different stent materials, excessive TT cuff pressures, gas- the airway around tracheostomy site. troesophageal reflux, and infection with particular organisms.9,11 fi The formation of bio lms on TTs serves as a potential Tracheostomy Tube Collection and Processing factor in the delay to decannulation in patients with tra- Tracheostomy tubes were collected from four pediatric cheostomies or failure of airway reconstruction. Biofilms patients and placed into a biohazard bag and stored in −80C are complex microbial communities of multiple species freezer to prevent degradation. At the time of processing, tubes coexisting in a matrix of extracellular polysaccharide sub- were bisected longitudinally such that each aliquot included an stance (EPS). Within this matrix, bacteria are effectively anterior and posterior section. This was then placed into a protected from their environment, including host immune 15-mL conical tube with 1-mL of sterile lysis buffer and vortexed fi systems and antibiotics, and can even thrive with nutrient to disrupt bio lms on the tracheostomy tubes and lyse bacterial cells. DNA extraction was performed using the MO BIO Ultra- deprivation.12 Clinically, biofilms represent a significant Clean Microbial Isolation (Mo Bio Laboratories, Carlsbad, CA). threat to antibiotic treatment because the structure of EPS limits drug penetration into the matrix and slows the metabolism of bacteria within biofilms.13 To date, no Shotgun Metagenomic Sequencing of researchers have sought to elucidate the microflora of bio- Microflora on TTs film formation on pediatric TTs. Given the possible impact fi Shotgun metagenomic sequencing was conducted as of bio lms on granulation formation and negative conse- described. Salinibacter ruber, a species not found in mammalian quences on patients with tracheostomies, this study was microbiome communities, was added to the DNA extract from conducted to evaluate the microbial ecology of TTs in pedi- each metagenome sample at a fixed amount of 0.005 ng for use atric patients with and without stenosis and its associa- as a DNA standard. Library generation using Nextera XT tion with the presence of granulation tissue. adapters (Illumina Inc., San Diego, CA) and metagenomic shot- gun sequencing was performed using the Illumina NextSeq500 (Illumina Inc.) in the Precision Metagenomic Core Research Lab- oratory at Cincinnati Children’s Hospital Medical Center. MATERIALS AND METHODS Subjects and Study Design Our protocol was reviewed and approved by our institution RESULTS review board (IRB) prior to collecting tracheostomy tubes and data (IRB #2017-2373). Tracheostomy tubes were collected dur- Microbiological Results ing airway evaluation in the operating room under general anes- Four TTs were collected from pediatric patients (age thesia in September 2017. Routine airway evaluation included a 1.4–10.2 years old) with (n = 2) and without (n = 2) gran- microlaryngoscopy and bronchoscopy (MLB) and a flexible ulation tissue formation (Table I). Duration of TT
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 318 TABLE II. Relative Abundance of Genera Discovered by Metagenomic Sequencing of Tracheostomy Tube Samples
Genus Relative Abundance Gram Stain Aerotolerance Normal Oropharyngeal Flora
Patient 1 Acinetobacter 48.43 GN rod Aerobe Y Haemophilus 22.93 GN coccobacillus Facultative anaerobe Y Neisseria 14.42 GN coccus Aerobe Y Pseudomonas 1.25 GN rod Aerobe N Other organisms 12.97 Patient 2 Fusobacterium 43.95 GN rod Obligate anaerobe Y Leptotrichia 12.92 GN rod Facultative anaerobe Y Propionibacterium 9.67 GP rod Facultative anaerobe Y Campylobacter 5.59 GN rod Facultative anaerobe Y Other organisms 27.87 Patient 3 Haemophilus 48.81 GN coccobacillus Facultative anaerobe Y Moraxella 16.22 GN coccus Aerobe Y Streptococcus 14.66 GP coccus Facultative anaerobe Y Yersinia 1.79 GN coccobacillus Facultative anaerobe N Other organisms 18.52 Patient 4 Neisseria 47.19 GN coccus Aerobe Y Streptococcus 9.51 GP coccus Facultative anaerobe Y Rothia 4.24 GP coccus Facultative anaerobe Y Haemophilus 2.8 GN coccobacillus Facultative anaerobe Y Other organisms 36.26
GN = gram negative; GP = gram positive; N = no; Y = yes. placement prior to retrieval from patients ranged from showed mild to moderate inflammation but no evidence of 5 to 365 days. Our results showed that in TTs associated active infection. with granuloma, Fusobacterium nucleatum, Haemophilus Patient 2. Case 2 is a 5-year-old male born at influenzae, Moraxella catarrhalis, and Streptococcus 29 weeks gestational age with tracheostomy dependence pneumoniae were predominant, most of which are consid- for congenital bilateral vocal fold immobility and severe ered pathogens. From TTs without granulomas, Neisseria obstructive sleep apnea undergoing evaluation for decan- mucosa, Neisseria sicca, Acinetobacter baumanni, and nulation. The patient came to the operating room for an Haemophilus parainfluenzae were identified, primarily airway evaluation to schedule a possible reconstruction consistent with respiratory microbiome (Table II) surgery. The patient’s tracheostomy tube (Shiley 4.5 Ped, (Figs. 1 and 2). no cuff ) had been in place for more than 1 year prior to sample collection. Findings during the MLB included granulation tissue (Fig. 3) and an active larynx. Cultures from BAL grew Haemophilus influenzae. Patient Characteristics Patient 3. Patient 3 is a 10-year-old female with cen- Patient 1. Patient 1 is a 16-month-old boy born at tral hypoventilation syndrome and ventilator dependence. 25 weeks of gestational age with acquired grade 3 subglot- The patient came to the operating room for an evaluation tic stenosis due to prolonged intubation, therefore requir- of the air leak around the cannula at night. The patient ing a tracheostomy at 3 months of age. The patient came had a 5.0 mm Tracoe Pediatric with no cuff placed 5 days to the operating room for an airway evaluation to sched- prior to collection. Cultures of the patient’s BAL grew a ule a possible reconstruction surgery. The patient had a beta lactamase negative Haemophilus influenzae. MLB 3.5 Pediatric Bivona (Smiths Medical, Minneapolis, Min- was significant for granulation tissue (Fig. 3). nesota) with no cuff at his last cannula change 4 weeks prior to presentation. The patient’s MLB showed predom- Patient 4. Patient 4 is a 5-year-old male with a his- inantly a suprastomal skin tract. Other relevant findings tory of 25-week prematurity, absent cricoid cartilage, and include diffuse laryngeal edema, consistent with an active tracheostomy dependence due to acquired subglottic larynx, which was being treated with azithromycin at the stenosis. The patient failed multiple prior open airway time of the evaluation. Bronchoalveolar lavage (BAL) surgeries. The patient underwent a double-stage
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 319 Fig. 1. Relative abundance of genera discovered by metagenomic sequencing of tracheostomy tube samples. laryngotracheoplasty with anterior costal cartilage graft DISCUSSION and suprastomal stent placement. The patient came to Our research offers novel information about TT bio- the operating room to remove their suprastomal stent films and indicates that metagenomic sequence of bio- and to evaluate the airway following reconstructive sur- films is feasible. Furthermore, even with a limited sample gery. Tracheostomy cannula (Bivona 4.0 no cuff) was size, we demonstrated that patients with and without changed 4 weeks prior to presentation at the time of the granulation tissue appear to have biofilms with different reconstruction surgery. At the time of collection, the compositions. These findings have the potential to tre- patient was receiving amoxicillin-clavulanate for a mendously impact protocols in airway reconstruction group A streptococcal pharyngitis. The patient was also surgery. on sulfamethoxazole and trimethoprim, our standard Of our four pediatric patients with TTs, two had protocol, prior to stent removal. The trachea was free of granulation tissue at the time of bronchoscopic evalua- granulation tissue. Of note, this patient had a prior his- tion, whereas the other two did not. Interestingly, both tory of methicillin-resistant Staphyloccocus aureus and patients without granulation tissue were on antibiotics at Pseudomonas aeruginosa, which were previously trea- the time of presentation, with one being treated with azi- ted with vancomycin, sulfamethoxazole/trimethoprim, thromycin and the second with amoxicillin-clavulanate and topical gentamicin few weeks before the airway and trimethoprim-sulfamethoxazole. Conversely, the two surgery. patients with granulation tissue were not receiving
Fig. 2. Shotgun metagenomics revealing microbial ecology of pediatric TTs with and without granulation tissue formation. Microbes associated with granulomas include F. nucleatum, H. influenzae, M. catarrhalis, and S. pneumoniae were predominant, most of which are considered pathogens. From TTs without granulomas, N. mucosa, N. sicca, A. baumanni, and H. parainfluenzae were identified, primarily consistent with respiratory microbiome.
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 320 Fig. 3. Evaluation of the airway during a microlaryngoscopy and bronchoscopy showing the absence of suprastomal granulation tissue (A) and the presence of granulation tissue as demonstrated with the star (B). antibiotics at the time of sample of collection (Table I). together to form a mixed-species biofilm under aerobic The patients with observed granulation tissue also both in vitro conditions, confirmed through fluorescent in situ grew Haemophilus influenzae in respiratory BAL cultures hybridization and confocal laser scanning microscopy. collected the day of evaluation. Metagenomic sequencing Furthermore, by monitoring levels of dissolved oxygen in corroborated respiratory culture results in one of the two culture broths over 24 hours, they observed that patients with granulation tissue because H. influenzae P. aeruginosa facilitates anaerobic F. nucleatum growth was identified as the predominate organism in patient by reducing levels of dissolved oxygen and thereby trans- 3 (Fig. 2) (Table I). forming the media into an anaerobic environment.17 The These findings suggest that ongoing antibiotic ther- results of this study might have implications for multi- apy may play a role in suppressing granulation tissue species biofilm development in other physiologic set- formation in patients with TTs. Understanding which tings, including the airway. bacteria are primarily associated with granulation tissue To further explore these associations, a large sam- formation will allow providers to potentially target these ple size is indicated to document the association of anti- organisms with specific therapies. In addition, the two biotic exposure prior to and at time of MLBs and TT patients with granulation tissue formation reveal exchange. As both patients’ antibiotic regimens provided H. influenzae in the BAL. The metagenomics of the TTs, coverage for various opportunistic and pathogenic organ- however, suggest that other bacteria, including obligate isms associated with mucosal and airway infections, it is anaerobe, Fusobacterium nucleatum, may play a role in plausible that antibiotic status played a role in suppres- the formation of biofilms and/or inflammation resulting sion or promotion of granulation tissue proliferation. in granulation tissue formation. F. nucleatum is com- H. influenzae displays the ability to independently upre- monly isolated from the oral cavity, and it is known to gulate several genes when in a biofilm state that contrib- play a key role in the development of dental biofilms and ute to the maintenance of the biofilm’s stability.18 periodontal disease. With unique adhesin proteins that Whereas some studies have demonstrated relationships allow it to bind to both early and late colonizers of the between coexistence of tracheal biofilms and granulation oral cavity, F. nucleatum is implicated as a facilitator of tissue, none to date have identified a particular associa- polymicrobial growth in this particular microbiome.14,15 tion between H. influenzae colonization and granulation In a recent study by Marino et al., bacterial 16S rRNA tissue formation. In fact, studies have previously identi- gene sequencing was employed to compare flora from fied Staphylococcus aureus and Pseudomonas aeruginosa dental plaques, ETT biofilms, and nondirected bronchial as organisms whose colonization of airway stents corre- lavages of 12 mechanically ventilated adult patients. lated strongly with the development of granulation The findings revealed no significant differences among tissue.19,20 microbiota identified in all three sites, which included Normal tracheal flora reflects the full diversity of F. nucleatum and other known oral cavity colonizers in organisms found in the oral cavity, including a host of addition to common respiratory tract species such as anaerobes, alpha and beta-hemolytic Streptococci, Staph- S. aureus, P. aeruginosa,andS. pneumoniae.16 Wang et ylococci, Neisseria, diphtheroids, and yeast.21 Sasaki al.17 used samples of ear fluid and tympanostomy tubes et al. were the first to investigate the relationship from a pediatric patient with posttympanostomy tube between subglottic bacterial load and the presence of otorrhea and an in vitro model to characterize interac- granulation tissue in injured tracheal mucosa.22 They tions between P. aeruginosa and F. nucleatum within reported that administration of preoperative benzathine the middle ear. The investigators determined that penicillin G helped to reduce contamination of tracheal P. aeruginosa and F. nucleatum will co-aggregate tissue posttracheostomy and decrease granulation tissue
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 321 through expedited healing.22 This seems to have been the CONCLUSION case for our patients. Matt et al. examined bacterial iso- This study reveals that metagenomic shotgun lates cultured from granulation tissue of 19 pediatric sequencing of biofilms formed on pediatric TTs is feasible. patients postlaryngotracheoplasty at the time of stent Utilizing metagenomic shotgun sequencing provides unbi- removal and found that no particular organism seemed to ased resolution to the strain level within microbial com- be associated with the presence of granulation tissue and munities. This would provide invaluable information for that most species isolated comprised normal oropharyn- targeted antimicrobial therapies and possibly affect the geal flora.9 This was performed using Gram staining and management of airway reconstruction surgery. Further semiquantification of bacterial colonies via observation of studies are necessary to elucidate the pathogenesis of each quadrant of culture plates through quadrant streak microbial ecology and its role in airway disease in technique. patients with TTs. In addition, future studies will utilize Additionally, at a second endoscopic examination of scanning electron microscopy and/or fluorescence in situ performed weeks following stent removal, the investiga- hybridization with confocal laser scanning microscopy to tors observed less granulation tissue and fewer bacterial corroborate our findings. isolates through quadrant streak technique. These results underscore the interplay of bacterial load, inflammation, and granulation tissue.9 Of note, the study did not include anaerobic cultures, restricting its conclusions to Acknowledgment analyses of aerobic oropharyngeal bacteria only.9 We would like to acknowledge the Cincinnati Chil- ’ Reechaipichitkul et al. yielded similar findings in a study dren s Hospital Medical Center Precision Metagenomic of granulation tissue from 17 patients with LTS, isolating Core Research Laboratory for assistance with our Staphylococci most commonly from samples followed by sequencing data. We would also like to thank Janet Ger- diphtheroids, Streptococci, and Pseudomonas.23 mann for her assistance with obtaining the tracheostomy Medical devices function as fomites to which biofilms tubes. can attach and mature, effectively serving as niduses for chronic infection and its sequelae.24 Scanning electron microscopy (SEM) has been used to demonstrate in vitro BIBLIOGRAPHY formations of Staphylococcus aureus and Pseudomonas aer- 1. Cierniak M, Timler D, Sobczak R et al. Analysis of the incidence of postintu- uginosa biofilms on tracheostomy tubes of varying mate- bation injuries in patients intubated in the prehospital or early hospital fi conditions of the hospital emergency department and the intensive care rials, and bio lms have likewise been documented through unit. Ther Clin Risk Manag 2015;11:1489–1496. fluorescent staining with confocal microscopy on both the 2. Weissbrod P. Reducing injury during video-assisted endotracheal intuba- internal and external surfaces of pediatric tracheostomy tion: the “Smart Stylet” concept. Laryngoscope 2011;121:2391–2393. 25,26 3. Sahin M, Anglade D, Buchberger M, Jankowski A, Albaladejo P, Ferretti G. tubes. In addition, other methods of assessing biofilms Case reports: iatrogenic bronchial rupture following the use of endotra- include standard microbiological techniques such as mea- cheal tube introducers. Can J Anaesth 2012;59:963–967. 4. Gadkaree S, Pandian V, Best S, et al. Laryngotracheal stenosis: risk factors suring colony-forming units, 16s RNA sequencing, crystal for tracheostomy dependence and dilation interval. Arch Otolaryngol violet staining, and metagenomic shotgun sequencing. Maz- Head Neck Surg 2017;156: 321–328. 5. Daijo H, Takabuchi S, Ohigashi T, Yoshikawa Y, Shinomura T. Unexpect- har et al. also reported in a study of 12 patients with and edly difficult intubation caused by subglottic stenosis in Wegener’s granu- without LTS that bacterial biofilms were observed via SEM lomatosis. J Anesth 2010;24:284–286. 6. Lusk R, Woolley A, Holinger L. Laryngotracheal stenosis. In: on samples of granulation tissue from all patients with Holinger LD, Lusk RP, Green CG, eds. Pediatric Laryngology and LTS, whereas none were noted on normal tissue.27 The Bronchoesophagology. Philadelphia, PA: Lippincott-Raven Publishers; 1997: 165–186. advantages of using metagenomic shotgun sequencing for 7. Walner D, Loewen M, Kimura R. Neonatal subglottic stenosis: incidence bacterial quantification is that it can detect nonculturable and trends. Laryngoscope 2009;111:48–51. 8. Knollman P, Baroody F. Pediatric tracheotomy decannulation: a protocol for bacteria and allows for actual bacteria counts from the sub- success. Curr Opin Otolaryngol Head Neck Surg 2015;23:485–490. strate itself rather than having to incubate the bacteria in 9. Matt B, Myer C 3rd, Harrison C, Reising S, Cotton R. Tracheal granulation tissue: a study of bacteriology. Arch Otolaryngol Head Neck Surg 1991; a nutrient broth or agar. This lends itself as a technique 117:538–541. that can allow for earlier detection of bacterial load com- 10. Benjamin B, Curley J. Infant tracheotomy: endoscopy and decannulation. pared to that of standard culture techniques, resulting in Int J Pediatr Otorhinolaryngol 1990;20:113–121. 11. Epstein S. Late complications of tracheostomy. Respir Care 2005;50: earlier treatment of disease processes. 542–549. Our study is not without limitation: we have a very 12. Garrett T, Bhakoo M, Zhang Z. Bacterial adhesion and biofilms on surfaces. Prog Nat Sci 2008;18:1049–1056. limited number of patients, making it difficult to general- 13. Stewart P. Mechanisms of antibiotic resistance in bacterial biofilms. Int J ize our results. Nonetheless, we demonstrated the feasi- Med Microbiol 2002;292:107–113. 14. Lima B, Shi W, Lux R. Identification and characterization of a novel Fuso- bility of metagenomic shotgun sequencing and its bacterium nucleatum adhesin involved in physical interaction and bio- capacity to characterize biofilms on TTs. A study with a film formation with Streptococcus gordonii. Microbiologyopen 2017;6: fi e00444. larger sample size will be performed to con rm or refute 15. Guo L, He X, Shi W. Intercellular communications in multispecies oral our findings. Because this was a preliminary exploratory microbial communities. Front Microbio 2014;5:328. 16. Marino, Wise MP, Smith A, et al. Community analysis of dental plaque and study to evaluate the microbial ecology of pediatric tra- endotracheal tube biofilms from mechanically ventilated patients. J Crit cheostomy tube biofilms, focus was primarily on the feasi- Care. 2017;30:149–155. 17. Wang J, Cordero J, Sun Y, et al. Planktonic growth of Pseudomonas aer- bility of obtaining clean sequencing samples. Further uginosa around a dual-species biofilm supports the growth of Fusobac- directions would include evaluating biofilms on a larger terium nucleatum within that biofilm. Int J Otolaryngol 2017;2017: 3037191. scale and assessing the impact of different tracheostomy 18. Tikhomirova A, Kidd S. Haemophilus influenzae and Streptococcus pneu- tube material on granuloma formation. moniae: living together in a biofilm. Pathog Dis 2013;69:114–126.
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 322 19. Nouraei S, Petrou M, Randhawa P, Singh A, Howard D, Sandhu G. Bacte- 23. Reechaipichitkul W, Wongratanacheewin S, Ratanaanekchai T, Nonthapa S. rial colonization of airway stents: a promoter of granulation tissue forma- Bacteriology of granulation tissue in laryngotracheal stenosis patients. tion following laryngotracheal reconstruction. Arch Otolaryngol Head J Med Assoc Thai 2006;89:1487–1489. Neck Surg 2006;132:1086–1090. 24. Donlan R. Biofilm formation: a clinically relevant microbiological process. 20. Schmal F, Fegeler W, Terpe H, Hermann W, Stoll W, Becker K. Bacteria Clin Inf Dis 2001;33:1387–1392. and granulation tissue associated with Montgomery T-tubes. Laryngo- 25. Jarrett W, Ribes J, Manaligod J. Biofilm formation on tracheostomy tubes. scope 2003;113:624–627. Ear Nose Throat J 2002;81:659–661. 21. Davis C. Oral and upper respiratory tract flora. In: Davis C. Medical Micro- 26. Perkins J, Mouzakes J, Pereira R. Bacterial biofilm presence in pediatric biology: 4th edition. Galveston, TX: University of Texas Medical Branch tracheostomy tubes. Arch Otolaryngol Head Neck Surg 2004;130:339–343. at Galveston; 1996: Chapter 6. 27. Mazhar K, Gunawardana M, Webster P, et al. Bacterial biofilms and 22. Sasaki C, Horiuchi M, Koss N. Tracheostomy-related subglottic stenosis: increased bacterial counts are associated with airway stenosis. Otolaryn- bacterial pathogenesis. Laryngoscope 1979;89:857–865. gol Head Neck Surg 2014;150:834–840.
Laryngoscope 129: February 2019 Wang et al.: Microbiome of Pediatric Tracheostomy Tubes 323 Article
Commensal Candida albicans Positively Calibrates Systemic Th17 Immunological Responses
Graphical Abstract Authors Tzu-Yu Shao, W.X. Gladys Ang, Tony T. Jiang, ..., Gurjit K. Khurana Hershey, David B. Haslam, Sing Sing Way
Correspondence [email protected]
In Brief Mucosal tissues are frequently colonized by microbes with pathogenic invasive potential. However, invasive systemic infection rarely occurs in healthy immune component individuals. Shao et al. show commensal Candida albicans intestinal colonization uniquely activates circulating immune cells to protect against systemic infection by this and other invasive extracellular microbial pathogens.
Highlights d C. albicans intestinal colonization protects against C. albicans invasive infection d Systemic fungal-specific Th17 CD4+ T cell accumulation with intestinal colonization d Tonic neutrophil stimulation augments host defense against extracellular pathogens d Antimicrobial immunity balanced by susceptibility to allergic airway inflammation
Shao et al., 2019, Cell Host & Microbe 25, 404–417 March 13, 2019 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.chom.2019.02.004 Cell Host & Microbe Article
Commensal Candida albicans Positively Calibrates Systemic Th17 Immunological Responses
Tzu-Yu Shao,1,2,4 W.X. Gladys Ang,1,4 Tony T. Jiang,1,2 Felicia Scaggs Huang,1 Heidi Andersen,1 Jeremy M. Kinder,1 Giang Pham,1 Ashley R. Burg,1 Brandy Ruff,3 Tammy Gonzalez,2 Gurjit K. Khurana Hershey,3 David B. Haslam,1 and Sing Sing Way1,5,* 1Division of Infectious Diseases, Center for Inflammation and Tolerance, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA 2Division of Immunobiology, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA 3Division of Asthma Research, Cincinnati Children’s Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA 4These authors contributed equally 5Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.chom.2019.02.004
SUMMARY by pathobionts occur infrequently, especially considering their exceptional high rates of commensal colonization. For example, Mucosal barriers are densely colonized by pathobiont C. albicans invasive infection is estimated at only 8 cases per microbes such as Candida albicans, capable of 100,000 individuals, or 0.008% (Pfaller and Diekema, 2007), invasive disseminated infection. However, systemic despite intestinal colonization among >60% of healthy adults infections occur infrequently in healthy individuals, (Nash et al., 2017). Likewise, the annual incidence of S. aureus suggesting that pathobiont commensalism may elicit bloodstream infection of 26 per 100,000 individuals (0.026%) is host benefits. We show that intestinal colonization orders of magnitude less than the 20% and 40% rates of colo- nization in the intestine and anterior nares, respectively (Acton with C. albicans drives systemic expansion of + et al., 2009; Laupland, 2013; Williams, 1963). This discrepancy fungal-specific Th17 CD4 T cells and IL-17 respon- highlights important questions about why systemic dissemi- siveness by circulating neutrophils, which synergisti- nated infection, caused by pathobionts with near ubiquitous cally protect against C. albicans invasive infection. colonization, occurs so infrequently. Protection conferred by commensal C. albicans re- Addressing these questions requires new models of quires persistent fungal colonization and extends to commensal colonization by pathobiont microbes that also other extracellular invasive pathogens such as Staph- have the capacity for invasive infection in healthy hosts. For ylococcus aureus. However, commensal C. albicans example, while prior intranasal Streptococcus pneumoniae does not protect against intracellular influenza virus administration is protective against subsequent lung infection infection and exacerbates allergic airway inflamma- in mice, colonization is very transient with sharply reduced path- tion susceptibility, indicating that positively calibrat- obiont recovery within the first few days after inoculation that precludes analysis of how sustained commensal colonization ing systemic Th17 responses is not uniformly impacts infection susceptibility (Wilson et al., 2015). On the other beneficial. Thus, systemic Th17 inflammation driven + hand, while lethal infection and systemic seeding by commensal by CD4 T cells responsive to tonic stimulation by C. albicans can be induced using chemotherapeutic agents, the commensal C. albicans improves host defense ensuing immune suppression and intestinal epithelial damage against extracellular pathogens, but with potentially preclude analysis of pathobiont colonization conferred immunity harmful immunological consequences. in healthy hosts (Koh et al., 2008). More recently, protection against systemic C. albicans infection in mice stably colonized with attenuated isogenic mutant strains adapted for intestinal INTRODUCTION colonization has been described (Tso et al., 2018). However, the significance of these findings is uncertain since invasive in- Mucosal barrier tissues are densely colonized with a wide variety fections by prototypical pathobionts such as C. albicans and of pathobiont microbes capable of invasive disseminated infec- S. aureus are predominantly (>80%) caused by genetically iden- tion. This includes many important human pathogens such as tical virulent commensal isolates (Reagan et al., 1990; von Eiff Candida albicans and Staphylococcus aureus that in most indi- et al., 2001; Voss et al., 1994). Thus, how pathobiont commensal viduals are associated with asymptomatic colonization, but colonization impacts immunity in healthy individuals remains with invasion can cause systemic infection associated with poorly defined. high mortality (Brown et al., 2012; Casadevall and Pirofski, To fill these outstanding knowledge gaps, an instructive model 2000). Fortunately, systemic disseminated infections caused of asymptomatic long-term intestinal colonization with virulent
404 Cell Host & Microbe 25, 404–417, March 13, 2019 ª 2019 Elsevier Inc. A
B C D
E
F G
(legend on next page) Cell Host & Microbe 25, 404–417, March 13, 2019 405 C. albicans was developed. In particular, recombinant supplementation (Figures 1A and 1B). Importantly, despite C. albicans engineered to express defined model antigens was high-density intestinal C. albicans colonization, no evidence of used to establish intestinal colonization to facilitate precise iden- systemic fungal dissemination or other negative health conse- tification of adaptive immune components with surrogate quence was observed. Tissues commonly susceptible to commensal specificity. This strategy showed that C. albicans in- invasive C. albicans infection (e.g., kidney, liver, and brain) re- testinal colonization primes systemic accumulation of protective mained uniformly sterile (Figure 1C), and C. albicans-colonized Th17 activated CD4+ T cells with commensal fungi specificity compared with no antibiotic control mice gained weight with and increased IL-17 responsiveness in circulating Ly6G+ neutro- comparable tempo (Figure 1D). Thus, virulent isolates of the hu- phils. Complementary human analysis identified positive associ- man pathobiont C. albicans can achieve persistent long-term ations between C. albicans fecal colonization density, systemic asymptomatic colonization in mice. accumulation of IL-17-producing C. albicans-specific CD4+ As expected, ampicillin drinking water supplementation T cells, and IL-17 responsiveness by circulating neutrophils. caused dramatic shifts in the composition and abundance of Interestingly, commensal C. albicans conferred immunity also fecal bacterial spp. as shown by shotgun sequencing (Ubeda extends to protection against invasive infection by other extra- et al., 2010)(Figures 1E and S1A). Interestingly and regardless cellular pathobionts such as S. aureus, but these host defense of C. albicans colonization, the absolute abundance of fecal bac- benefits are offset by susceptibility to airway inflammation. teria genomic equivalents was increased by ampicillin treatment Together, exciting facets of symbiosis between commensal after comparing the bacterial DNA density to a known quantity of C. albicans and mammalian hosts that positively calibrate sys- Salinibacter ruber reference DNA added to each sample (Fig- temic neutrophil-Th17 CD4+ T cell immunological responses ure 1F). Importantly, however, the composition, diversity, or are demonstrated. differential abundance of commensal bacteria did not differ significantly between C. albicans-colonized compared with RESULTS non-colonized control mice maintained on ampicillin-supple- mented drinking water (Figures 1E–1G and S1). Thus, anti- C. albicans Intestinal Colonization Protects against biotic-induced dysbiosis is an instructive approach allowing Invasive C. albicans Systemic Infection the immune modulatory effects of C. albicans commensal colo- C. albicans is a common commensal of the human intestine nization to be evaluated in isolation. (Nash et al., 2017). However, this fungus is rarely found in the Given the lack of spontaneous disseminated infection in feces of laboratory mice (Iliev et al., 2012; Skalski et al., 2018; C. albicans-colonized mice (Figures 1C and 1D), susceptibility Wheeler et al., 2016), and completely absent in mice housed in to invasive infection was probed by intravenous inoculation our specific pathogen-free facility (Jiang et al., 2017). We with the identical or a marked isogenic virulent recombinant reasoned the lack of commensal C. albicans could be exploited strain. This analysis showed sharply reduced susceptibility to to investigate how intestinal colonization with this pathobiont systemic invasive infection conferred by intestinal colonization. shapes host immunity. Since antibiotic-induced dysbiosis is a Mice with commensal C. albicans had improved survival dominant risk factor for human C. albicans colonization (Schulte following intravenous infection with a lethal dosage of virulent et al., 2015; Spinillo et al., 1999), and in mice promotes coloniza- strain SC5314 for immune competent mice (Jiang et al., 2015) tion by virulent strains including SC5314 (Fan et al., 2015), how and >100-fold reduced fungal burden in the kidneys compared C. albicans colonization induced by bacterial dysbiosis impacts with control mice maintained on ampicillin-supplemented drink- susceptibility to invasive infection was evaluated. We found a ing water (Figure 2A). To confirm that C. albicans in the target tis- single oral C. albicans inoculation administered to mice main- sue of colonized mice directly reflects reduced susceptibility to tained on ampicillin supplemented drinking water results in intravenous infection, as opposed to dissemination from intesti- sustained (>60 days) C. albicans colonization throughout the in- nal tissue, we took advantage of GFP expression by recombi- testinal tract (Figures 1A and 1B). C. albicans recovery in the nant virulent C. albicans strains (Igya´ rto´ et al., 2011) allowing feces was consistently achieved within 24 h after oral inocula- oral inoculation and subsequent intravenous challenge by tion, and with progressively increasing levels plateauing within unique isogenic strains (Figure 2B). These experiments showed the first week in ampicillin-treated mice (Figure 1A). In contrast, recoverable fungi in the kidney were uniformly from intravenous C. albicans recovery was sporadic, and consistently at or below inoculation (GFP+), while fungi in feces were of commensal origin the limits of detection for mice without drinking water antibiotic (GFPÀ)(Figure 2B). Thus, despite retaining virulence potential,
Figure 1. Persistent C. albicans Intestinal Colonization Facilitated by Drinking Water Ampicillin Supplementation (A) Recoverable C. albicans in the feces of mice with ampicillin supplementation in the drinking water compared with no antibiotic controls after oral C. albicans inoculation. (B) Recoverable C. albicans in each intestinal segment 7 days after oral C. albicans inoculation for the mice described in (A). (C) Recoverable C. albicans in each tissue 7 days after oral C. albicans inoculation for mice with ampicillin drinking water supplementation. (D) Weight change after oral C. albicans inoculation for the mice described in (A). (E) Diversity and abundance of fecal bacterial species for each group of mice after drinking water ampicillin supplementation (12 days) with or without oral C. albicans inoculation (2 days after initiating ampicillin drinking water supplementation) determined by shotgun sequencing. Pie-chart area is directly propor- tional to the absolute abundance of fecal bacterial genomic DNA for each group of mice. (F) Bacterial genomic equivalents for each group of mice described in (E). (G) Diversity of fecal bacteria for each group of mice described in (E). *p < 0.05, ****p < 0.0001. Bar, mean ± SEM. L.o.D., limit of detection. See also Figure S1.
406 Cell Host & Microbe 25, 404–417, March 13, 2019 A
B
Figure 2. C. albicans Intestinal Colonization Protects against Systemic C. albicans Invasive Infection (A) Percent survival and recoverable C. albicans 5 days after recombinant C. albicans intravenous infection (5 3 104 CFUs) for mice with recombinant C. albicans intestinal colonization or control mice maintained on ampicillin-supplemented drinking water. (B) Fluorescence intensity of C. albicans recovered from the feces compared with kidneys 5 days after intravenous infection with GFP+ C. albicans for mice with prior GFPÀ C. albicans oral inoculation. ***p < 0.001, ****p < 0.0001. Bar, mean ± SEM. L.o.D., limit of detection. See also Figure S2. pathobiont commensal C. albicans does not breech the intestinal response to cognate antigen stimulation (Baaten et al., 2012) barrier to seed systemic tissues. Moreover, protection against (Figure 3A). Interestingly, accumulation of C. albicans-2W1S- systemic C. albicans invasive infection is not due to enhanced specific CD4+ T cells was not more pronounced in the mesenteric immunogenicity of recombinant C. albicans, since similarly lymph node compared with splenocytes and pooled peripheral reduced susceptibility was observed in mice colonized with lymph node cells, highlighting the systemic response to either recombinant or non-recombinant SC5314 strain (Fig- commensal fungal colonization (Figure S3). ure S2). Together, these results show commensal C. albicans To investigate how C. albicans intestinal colonization stimu- intestinal colonization efficiently protects against systemic inva- lates the differentiation of these systemically expanded cells, sive infection by the same pathobiont microbe. their expression of canonical T helper lineage-defining transcrip- tional regulators was evaluated. Differentiation into RORgt- Systemic Expansion of Protective IL-17-Producing CD4+ expressing Th17 cells accounted for the largest subset of T Cells with Commensal C. albicans Specificity peripheral CD4+ T cells with commensal C. albicans-2W1S spec- The immunological basis for protection against invasive infection ificity compared with <5% among CD4+ T cells of the same conferred by intestinal colonization was addressed by evaluating specificity in no colonization control mice (Figure 3B). Increased systemic accumulation of adaptive immune components with number and proportion of RORgt+ CD4+ T cells with C. albicans commensal C. albicans specificity. We focused on CD4+ T cells specificity persisted with antigen re-stimulation after intravenous since candidiasis is more prevalent among individuals with HIV C. albicans-2W1S challenge compared with cells in control mice infection or other immune compromising conditions with dimin- undergoing primary expansion (Figure S4). Likewise, production ished CD4+ T cell function (Klein et al., 1984). To facilitate identi- of Th17 lineage-defining cytokines IL-17A or IL-17F was selec- fication of CD4+ T cells with commensal C. albicans specificity, tively increased among CD4+ T cells from colonized compared constitutive expression of the 2W1S55-68 variant of I-Ea by re- with control mice after heat-killed C. albicans in vitro stimulation combinant C. albicans (Igya´ rto´ et al., 2011) and high precursor (Figure 3C). Comparatively, no differences in IFN-g production + b + + frequency of endogenous CD4 T cells with I-A :2W1S55-68 spec- were identified, and percent Tbet Th1 or FOXP3 regulatory ificity were exploited for precise identification of cells with this T cells remained similar among CD4+ T cells with commensal surrogate commensal specificity after tetramer staining and C. albicans-2W1S specificity in colonized compared with control enrichment (Moon et al., 2007). This analysis showed robust mice (Figures 3C and S5A). Importantly, Th17 immunogenicity expansion of CD4+ T cells with commensal C. albicans-2W1S primed by commensal C. albicans is not restricted to antigens specificity in systemic lymphoid tissue (spleen plus peripheral unique to this recombinant strain, given the increased number lymph nodes) that were almost all CD44hi reflecting activation in of IL-17A- and IL-17F-producing cells (100,000 cells) after
Cell Host & Microbe 25, 404–417, March 13, 2019 407 :
A b 104 100 ***
10) ***
+ 103 75 T cells T +
2 among I-A
10 hi 50 :2W1S b CD4 + T cells (log cells T + I-A 101 25 CD4 100 2W1S 0 CD44 of %
C. albicans C. albicans colonizaation colonization No colonization No colonization B
) 4 + + 60 10 t ) γ
*** 10 *** 45 103 ROR + 30 102 cells (log (% of 2W1S of (% + +
t 1 :2W1S γ 10 15 b CD4 I-A 0 ROR 0 10 n
γ C. albicans C. albicans colonizaation colonizaation No colonization No colonizatio C No colonization C. albicans 0.6 colonization **
Tcells 0.4 **
+ **
0.2 % of CD4 of % 0.0
IFN-γ IL-17A IL-17F
IL-17A or IL-17F
DEF Isotype (n=13)
αCD4 (n=10) ) ) 10
10 αI α 7 n.s. 7 L-17A + IL-17F (n=12)
**** 100 5 5 75 3 3 50 ** 1 L.o.D. 1 L.o.D. (%) Survival 25 **
CFUs/both kidneys (log CFUs/both CFUs/both kidneys (log CFUs/both C. albicans -+-+-+ 0 colonization 0 10203040 C. albicans C. albicans Isotype αCD4 αIL-17 Days after intravenous challenge No colonizationcolonization
Figure 3. Systemic Expansion of Protective Th17 CD4+ T Cells with Commensal C. albicans Specificity (A) Number and percent of CD44hi among I-Ab:2W1S tetramer-positive CD4+ T cells from spleen and peripheral lymph nodes of mice with recombinant C. albicans intestinal colonization compared with no colonization controls. (B) Percent and number of RORgt+ among I-Ab:2W1S-positive (solid line) or -negative (gray shaded) CD4+ T cells for mice described in (A).
(legend continued on next page) 408 Cell Host & Microbe 25, 404–417, March 13, 2019 in vitro stimulation with non-recombinant heat-killed C. albicans colonization control mice administered each depleting antibody (Figure S5B), compared with fewer than 1,000 I-Ab:2W1S+ cells (Figure 4F). Collectively, these results show expanded IL-17-pro- identified by tetramer staining (Figure 3A). Thus, C. albicans in- ducing CD4+ T cells primed by C. albicans intestinal colonization testinal colonization in mice preferentially primes systemic accu- tonically stimulate IL-17 responsiveness by neutrophils, which in mulation of fungal-specific Th17 CD4+ T cells, in agreement with turn protect against C. albicans invasive infection. accumulation of IL-17-producing cells in the peripheral blood of healthy human volunteers (Acosta-Rodriguez et al., 2007). Protection against Systemic Infection Requires To further investigate the necessity of these immune compo- Persistent C. albicans Intestinal Colonization nents in protection against C. albicans invasive infection, the Given shifts in the composition and density of commensal mi- effects of their depletion initiated 1 day prior to intravenous chal- crobes throughout development (Lozupone et al., 2012), we lenge were evaluated. Administration of either CD4+ T cell next investigated the durability of commensal C. albicans- depleting or IL-17A plus IL-17F neutralizing antibodies over- conferred protection, and in particular, whether persistent colo- turned the protective benefits of intestinal colonization, since nization is required. These experiments utilized fluconazole, an fungal pathogen burden and mortality each rebounded to levels anti-mycotic agent, which when added to ampicillin-supple- comparable to control mice (Figures 3D and 3E). Protection mented drinking water efficiently eliminates C. albicans intestinal against invasive infection conferred by C. albicans intestinal colonization (Figure S6A) (Iliev et al., 2012). Since fluconazole colonization was also eliminated in Rag1-deficient mice would also artificially render resistance to fungal infection, we completely devoid of all T and B cells (Figure 3F). Thus, CD4+ first determined the time after removing fluconazole from the T cells and IL-17 cytokines are each essential for C. albicans drinking water when C. albicans infection susceptibility would colonization-conferred protection against invasive infection. be restored, and found similar fungal burden in mice 5 days after removing fluconazole compared with control mice (Figure S6B). IL-17 Responsiveness in Circulating Neutrophils Using this approach, we found protection against invasive infec- Increased with C. albicans Intestinal Colonization tion and nearly all systemic immunological shifts primed by To investigate the IL-17 responsive cell subset(s) responsible for C. albicans intestinal colonization were eliminated with fungal protection, colonization-induced shifts in expression of IL-17 re- eradication. In particular, significantly increased fungal pathogen ceptor were compared among CD45+ leukocytes. Rather than burden was found after intravenous infection in fluconazole- IL-17RA, which is ubiquitously expressed in leukocyte cells treated C. albicans-colonized mice compared with mice with (Iwakura et al., 2008), we focused on IL-17RC, an essential sustained C. albicans intestinal colonization (Figure 5A). Expan- component of the IL-17 receptor complex whose expression is sion of CD4+ T cells with commensal C. albicans I-Ab:2W1S modulated by inflammation (Taylor et al., 2014). This analysis specificity and their expression of RORgt in fluconazole-treated showed significantly increased frequency of IL-17RC-express- mice were each reduced to background levels found in control ing cells in the peripheral blood of C. albicans-colonized mice without prior C. albicans intestinal colonization (Figures compared to no colonization control mice (Figure 4A). Among 5B and 5C). Likewise, IL-17A and IL-17F production by CD4+ IL-17RC+ leukocytes, the proportion of Ly6GhiLy6Cint or Gr-1+ T cells in response to heat-killed C. albicans stimulation (Fig- neutrophils was significantly increased, whereas no change ure 5D), IL-17RC expression by circulating leukocyte and neutro- (Ly6ChiLy6Glo monocytes, CD4+ or CD8+ T cells) or reciprocal re- phils (Figure 5E), expansion of circulating neutrophils (Figure 5F), ductions (B220+ B cells) were found for other leukocyte subsets and their production of reactive oxygen species (Figure 5G) were (Figure 4B). Enhanced IL-17 responsiveness by circulating leu- each overturned in fluconazole-treated mice compared with kocytes was dependent on both CD4+ T cells and IL-17, since mice with sustained C. albicans intestinal colonization. Thus, IL-17RC expression was reduced to levels comparable to no persistent C. albicans intestinal colonization is required for main- colonization control mice after administration of CD4+ T cell taining activated systemic anti-fungal Th17 immunity. depleting or IL-17A plus IL-17F neutralizing antibodies (Fig- ure 4C). Enhanced IL-17 responsiveness by neutrophils paral- Commensal C. albicans Conferred Protection Extends leled their expanded accumulation among circulating leukocytes to Other Extracellular Pathogens (Figure 4D), and increased production of reactive oxygen Given neutrophil activation induced by C. albicans colonization, species in response to C. albicans stimulation (Figure 4E). Impor- together with the shared importance of these cells in protection tantly, neutrophils are essential for commensal C. albicans- against invasive infection by other microbial pathogens (Ko- conferred protection, since resistance against invasive infection laczkowska and Kubes, 2013), we next investigated the was efficiently overturned in mice administered anti-Ly6G or breadth of protection conferred by commensal C. albicans. anti-Gr-1 depleting antibodies, with mortality comparable to no Since ampicillin drinking water supplementation is required
(C) Percent IL-17A, IL-17F, or IFN-g production after heat-killed wild-type C. albicans stimulation by CD4+ splenocyte and lymph nodes cells for mice described in (A). (D) Recoverable C. albicans 5 days after recombinant C. albicans intravenous infection (5 3 104 CFUs) among recombinant C. albicans colonized compared with control mice administered rat IgG (isotype), anti-CD4, or anti-IL-17A plus anti-IL-17F antibodies beginning 1 day prior to infection. (E) Percent survival for mice described in (D). (F) Recoverable C. albicans 5 days after recombinant C. albicans intravenous infection (5 3 104 CFUs) for Rag1-deficient mice colonized with recombinant C. albicans or no colonization controls. **p < 0.01, ***p < 0.001, ****p < 0.0001. Bar, mean ± SEM. L.o.D., limit of detection. See also Figures S3–S5.
Cell Host & Microbe 25, 404–417, March 13, 2019 409 A B ) + 80 100 ** ** No colonization C. albicans colonization 60 **** 75 ** 40 50 (% of CD45 of (% +
20 % of IL-17RC 25
IL-17RC 0 0 + int + lo + + 8 Gr-1 Ly6G CD4 CD B220 hi Ly6C hi C. albicans colonizaation Ly6G Ly6C No colonization
CDE ) 40
** + ** ) + 20 **** 1.4 30 * 15 20 1.2
10 CD45 of (% + (% of CD45 + 10 1.0 5 Ly6G 0 Fold of change % oxidative DHR123 oxidative % 0.8 IL-17RC 0 ion C. albicans -+++ colonization C. albicans α α colonizat Isotype CD4 IL-17 No colonization C. albicans o colonizationcolonization N
F C. albicans colonization + anti-Ly6G (n=13) C. albicans colonization + anti-Gr-1 (n=8) No colonization + anti-Ly6G (n=13) No colonization + anti-Gr-1 (n=7) C. albicans colonization + rat IgG2a (n=11) C. albicans colonization + rat IgG2b (n=5) No colonization + rat IgG2a (n=9) No colonization + rat IgG2b (n=6)
100 100
75 75
50 50 Survival (%) Survival 25 (%) Survival 25
0 0 0 10203040 0 10203040 Days after C. albicans Days after C. albicans intravenous challenge intravenous challenge
Figure 4. C. albicans Intestinal Colonization Stimulates Accumulation, Activation, and IL-17 Responsiveness by Circulating Neutrophils (A) Percent of IL-17RC+ among CD45+ leukocytes in the peripheral blood of mice with recombinant C. albicans intestinal colonization compared with no colo- nization controls. (B) Percent of IL-17RC+ among each leukocyte subset for mice described in (A). (C) Percent of IL-17RC+ among CD45+ leukocytes in the peripheral blood of recombinant C. albicans-colonized mice 7 days after the administration of rat IgG (isotype), anti-CD4, or anti-IL-17A plus anti-IL-17F antibodies. (D) Percent of Ly6G+Ly6Cint neutrophils among CD45+ leukocytes in the peripheral blood for each group of mice described in (A). (E) Representative plots (solid line histogram, C. albicans extract stimulation; shaded histogram, no stimulation controls) and composite data showing the relative proportion of dihydrorhodamine (DHR)123 fluorescence among Ly6G+Ly6Cint neutrophils in the peripheral blood for each group of mice described in (A). (F) Percent survival after recombinant C. albicans intravenous infection (5 3 104 CFUs) among recombinant C. albicans-colonized compared with no colonization control mice administered anti-Ly6G or anti-Gr-1 antibodies, along with each respective rat IgG isotype control antibody, beginning 1 day prior to infection. *p < 0.05, **p < 0.01, ****p < 0.0001. Bar, mean ± SEM. L.o.D., limit of detection. for maintaining C. albicans colonization, microbial pathogens methicillin-resistant S. aureus that is lethal for ampicillin- with natural or induced ampicillin resistance were utilized for treated control mice was completely eliminated for mice with infection. Interestingly, sharply reduced susceptibility to sys- commensal C. albicans (Figure 6A). Survival paralleled reduced temic infection by the unrelated extracellular bacterial pathogen bacterial burden after infection with a lower S. aureus inoculum S. aureus was associated with C. albicans intestinal coloniza- (Figure 6A). Reciprocally, S. aureus susceptibility rebounded in tion. Mortality after intravenous infection with an inoculum of fluconazole-treated mice in agreement with the aforementioned
410 Cell Host & Microbe 25, 404–417, March 13, 2019 A
BC
D
E FG
Figure 5. Protection against Systemic C. albicans Invasive Infection Requires Persistent C. albicans Intestinal Colonization (A) Recoverable C. albicans 5 days after recombinant C. albicans intravenous infection (5 3 104 CFUs) for recombinant C. albicans-colonized mice treated with fluconazole, no antifungal treatment, or no C. albicans colonization control mice. (B) Number of I-Ab:2W1S tetramer-positive CD4+ T cells from spleen and peripheral lymph nodes for recombinant C. albicans-colonized mice treated with fluconazole for 20 days, no antifungal treatment, or no colonization control mice. (C) Percent and number of RORgt+ among I-Ab:2W1S-positive CD4+ T cells for mice described in (B). (D) Percent IL-17A or IL-17F production by CD4+ splenocyte and lymph nodes cells after heat-killed wild-type C. albicans stimulation for mice described in (B). (E) Percent IL-17RC+ among CD45+ leukocytes or Ly6G+Ly6Cint neutrophils in the peripheral blood for mice described in (B). (F) Percent of Ly6G+Ly6Cint neutrophils among CD45+ leukocytes in the peripheral blood for mice described in (B). (G) Relative intensity of dihydrorhodamine (DHR)123 fluorescence among Ly6G+Ly6Cint neutrophils in the peripheral blood after C. albicans extract stimulation for mice described in (B). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Bar, mean ± SEM. L.o.D., limit of detection. See also Figure S6.
Cell Host & Microbe 25, 404–417, March 13, 2019 411 A
B
C
Figure 6. Commensal C. albicans Protects against S. aureus Infection and Promotes Susceptibility to Th17 Airway Inflammation (A) Percent survival after S. aureus intravenous infection (strain USA300; 108 [left panel]) and recoverable S. aureus 5 days after infection with a reduced dosage (strain USA300; 3 3 107 CFUs [right panel]) for mice with recombinant C. albicans intestinal colonization, C. albicans colonized mice treated with fluconazole, or no colonization control mice. (B) Percent survival and clinical score progression after influenza A virus intranasal infection (strain PR8; 2 3 105 PFU) for mice with recombinant C. albicans intestinal colonization or no colonization control mice. (C) Airway resistance, percent RORgt+, or IL-17A production by CD4+ T cells recovered from the lungs of recombinant C. albicans-colonized mice treated with fluconazole, no antifungal treatment, or no C. albicans colonization control mice. Mice were intratracheally sensitized and challenged with house dust mite extract, and airway resistance represents change over baseline after inhaled methacholine challenge. **p < 0.01, ***p < 0.001, ****p < 0.0001. Bar, mean ± 1 SEM. L.o.D., limit of detection. experiments, highlighting a necessity for persistent C. albicans C. albicans-colonized compared with control mice (Figure 6B). colonization in maintaining activated Th17 systemic immunity Thus, commensal C. albicans-conferred protection is not (Figure 6A). In contrast to definitive protection against restricted only to C. albicans invasive infection, but also ex- S. aureus, no significant differences in survival, time to death, tends to other extracellular pathogens, such as S. aureus, or progression of clinical symptoms were found after infection where neutrophils play a dominant role in protection (Rigby with the intracellular viral pathogen, influenza A virus, among and DeLeo, 2012).
412 Cell Host & Microbe 25, 404–417, March 13, 2019 A Figure 7. C. albicans Fecal Colonization Den- sity Positively Correlates with Systemic Levels of Fungal-Specific Th17 Inflammation (A) Regression analysis comparing IL-17A or IL-17F production by CD4+ peripheral blood cells after heat-killed C. albicans stimulation compared with the fecal relative abundance of C. albicans or non- albicans Candida spp. determined by shotgun sequencing for each individual. (B) Regression analysis comparing intensity of IL-17RC staining by CD15+CD16+ neutrophils in peripheral blood cells compared with the fecal rela- tive abundance of C. albicans or non-albicans B Candida spp. for each individual. (C) Regression analysis comparing intensity of IL-17RC staining by CD15+CD16+ neutrophils in peripheral blood cells compared with the fecal rela- tive abundance of S. aureus, E. coli,orE. faecalis for each individual. Levels below the limits of detection are shown as open circles on the y axis. See also Figure S7.
hand protecting against systemic invasive C infection by extracellular pathogens, but also promoting susceptibility to aberrant tissue inflammation.
C. albicans Fecal Colonization Density Positively Correlates with Systemic Fungal-Specific Th17 Inflammation To investigate whether Th17 inflammation driven by CD4+ T cell recognition of commensal C. albicans occurs similarly in humans, the relationship between fecal Commensal C. albicans Activation of Systemic Th17 C. albicans colonization density and levels of IL-17-producing Inflammation Promotes Susceptibility to Airway CD4+ T cells with fungal specificity and IL-17 responsiveness Inflammation by circulating neutrophils was evaluated in intensive-care unit Given these remarkable protective benefits against invasive patients naturally predisposed to have fungal colonization from infection, complementary studies addressed the potential for antibiotic exposure. We reasoned comparing activation of im- harmful consequences associated with systemic accumulation mune cells with C. albicans fecal colonization density at a single of activated neutrophils and Th17 immunity primed by time point for each individual would reveal a snapshot for how C. albicans colonization. Allergic airway inflammation is increas- tonic C. albicans colonization impacts systemic immunity. Fecal ingly recognized to be mediated by activated neutrophils and abundance of C. albicans was evaluated by shotgun aberrant IL-17 production (Alcorn et al., 2010). Since intestinal sequencing, followed by Kraken alignment of sequence reads fungi have been shown to exacerbate asthma-like symptoms against a custom comprehensive microbial genome database in antibiotic-treated mice (Li et al., 2018; Noverr et al., 2005; (Wood and Salzberg, 2014). C. albicans-specific Th17 cells Skalski et al., 2018; Wheeler et al., 2016), the potential for were enumerated as the percentage of IL-17A- and/or IL- commensal C. albicans-induced shifts in airway inflammation 17F-producing CD4+ peripheral blood cells after heat-killed was evaluated. We found the lungs of mice with C. albicans in- C. albicans in vitro stimulation. Both stimulation and no stimula- testinal colonization compared with no colonization control tion control specimens were supplemented with anti-CD28 anti- mice contained significantly expanded levels of Th17 (RORgt+ body to improve re-stimulation efficiency and cytokine produc- and IL-17 producing) CD4+ T cells that parallel increased airway tion (Koehler et al., 2018). These experiments showed direct hyperresponsiveness after house dust mite intratracheal chal- correlations between IL-17 production by circulating CD4+ lenge (Figure 6C). Reciprocally, RORgt+- and IL-17-producing T cells (p = 0.001) and IL-17RC expression by CD15+CD16+ neu- CD4+ T cell accumulation and airway responsiveness were trophils (p < 0.001), each compared with the relative or absolute each efficiently reversed with commensal C. albicans eradication abundance of C. albicans fecal colonization (Figures 7A, 7B, and by fluconazole (Figure 6C). Together, these results show S7). These differences in CD4+ T cell IL-17 production and shifts commensal C. albicans tonically stimulates systemic Th17 in neutrophil IL-17 responsiveness are restricted to C. albicans inflammation with broad immunological host impacts, on one since positive associations were eliminated when compared
Cell Host & Microbe 25, 404–417, March 13, 2019 413 with the fecal density of non-albicans Candida spp. (Figures 7A, be influenced by the unique host mycobiome. For example, while 7B, and S7). Likewise, no correlations were identified between antibiotic-induced intestinal overgrowth of the commensal fun- neutrophil IL-17RC expression and the density of fecal coloniza- gus Wallemia mellicola enhances the severity of allergic airway tion by other common pathobionts including S. aureus, E. coli,or disease in mice (Skalski et al., 2018), this fungal species is not Enterococcus faecalis (Figure 7C). Thus, selective activation of present for animals in our facility (Jiang et al., 2017). Instead, the Th17-neutrophil axis by commensal C. albicans is recapitu- we and others find similarly increased susceptibility of mice to lated in humans. allergic airway inflammation with C. albicans intestinal coloniza- tion (Noverr et al., 2005)(Figure 6C). Functional overlap between DISCUSSION unique species of commensal fungi is further supported by recent independent studies showing C. tropicalis and other The intestine and other mucosal tissues harbor many virulent endogenous fungi protect against colon cancer through pathobionts capable of invasive disseminated infection (Brown CARD9 signaling in intestinal myeloid cells (Malik et al., 2018; et al., 2012; Casadevall and Pirofski, 2000). Despite their excep- Wang et al., 2018). Together, these results suggest positive cali- tionally high colonization prevalence, systemic infection by path- bration of Th17 inflammation we demonstrate may not be unique obiont microbes occurs relatively infrequently. One explanation to C. albicans, but shared by other fungal species that activate may be that mucosal-dwelling pathobionts have limited tropism unique intestinal immune cell subsets, such as CX3CR1+ mono- for extra-intestinal tissues, and thus rarely cause systemic infec- nuclear phagocytes, in a similar fashion (Li et al., 2018). In this re- tion. However, this is likely an over-simplification, since invasion gard, functional overlap for fungi would represent a sharp and dissemination to extra-intestinal tissues are nonetheless contrast to commensal bacteria in which a majority of intestinal consistent features of human clinical infection. Thus, we sought Th17 cells respond to the single bacterial species, segmented an immunological explanation by investigating systemic immu- filamentous bacteria (Yang et al., 2014). On the other hand, the nological changes primed by commensal pathobiont coloniza- remarkable specificity whereby IL-17 responsiveness in human tion first in healthy immune competent hosts, and later with circulating neutrophil cells is associated with C. albicans fecal depletion of defined immune components to probe their neces- colonization density, but not non-albicans Candida spp. or other sity against invasive infection. We show that despite high-den- bacterial pathobionts (Figure 7), highlights potentially unique im- sity C. albicans intestinal colonization, spontaneous dissemi- mune modulatory properties of C. albicans, distinct from other nated infection occurs very infrequently in mice, similar to commensal fungal species. This notion is in agreement with immune competent humans (Pfaller and Diekema, 2007). Inter- recent human T cell analysis implicating C. albicans as the major estingly, resistance to systemic infection is not passive, but inducer of systemic Th17 differentiation that propagates expan- actively acquired and maintained by Th17 CD4+ T cells respon- sion of IL-17-producing CD4+ T cells cross-reactive to other sive to commensal-pathobiont microbes. In turn, IL-17 stimu- fungal species (Bacher et al., 2019). Thus, unique microbial fea- lates accumulation, activation, and enhanced IL-17 responsive- tures of C. albicans dominantly promote Th17 immunity shifts in ness in circulating neutrophils. This necessity for IL-17, CD4+ humans. Whether C. albicans-induced immune modulation is T cells, and circulating neutrophils reveals mechanistic details restricted only to humans or present in other mammalian species for why immune suppression and, in particular, neutropenia are is an important area for future investigation. dominant risk factors for candidemia (Patolia et al., 2013), and Antibiotic-induced bacterial dysbiosis is a pervasive risk factor extends the functional implications of Th17-dominated differen- for human fungal colonization (Schulte et al., 2015; Spinillo et al., tiation of C. albicans-specific memory CD4+ T cells in healthy hu- 1999), and susceptibility to invasive fungal infections (Berdal man volunteers (Acosta-Rodriguez et al., 2007) by establishing et al., 2014; Yu et al., 2013). These clinical aspects of fungal colo- their importance in host defense against invasive infection. nization and invasive infection susceptibility were investigated Commensal C. albicans primed expansion of protective IL-17- by supplementing the drinking water of mice with ampicillin. producing CD4+ T cells with fungal specificity also provides Despite the relatively narrow spectrum of this single b-lactam important clues for explaining discordance in the necessity of antibiotic, dramatic shifts in the composition of fecal commensal IL-17 in protection against C. albicans invasive infection. In bacteria were identified (Fan et al., 2015; Ubeda et al., 2010)(Fig- particular, while IL-17A and IL-17 receptor have each been re- ures 1E–1G and S1) that grossly recapitulate loss of diversity and ported to be indispensable for resistance against intravenous bacterial composition shifts by antibiotics in humans (Zaura C. albicans infection using IL-17A- or IL-17 receptor-deficient et al., 2015). Thus, while the impacts of ampicillin cannot be mice (Huang et al., 2004; Saijo et al., 2010; van de Veerdonk definitively excluded, bacterial dysbiosis was experimentally et al., 2010), others have shown completely non-essential roles controlled given the similar composition, abundance, and diver- for these molecules (De Luca et al., 2010). Our results suggest sity of intestinal bacteria in C. albicans-colonized compared with this discordance is explained by whether mice in each facility ampicillin-treated control mice (Figures 1E–1G and S1). have commensal C. albicans colonization, since IL-17 neutraliza- Protection against C. albicans invasive infection has been tion and CD4+ T cell depletion each cause susceptibility to intra- used to show innate immune cells without antigen specificity venous C. albicans infection only among mice with C. albicans (e.g., monocyte, macrophage) can be trained to remember prior intestinal colonization (Figure 3D). Thus, the presence of infectious encounters. Classical experiments show recent prior commensal fungi dictates the relative importance of these im- intravenous infection with a sublethal C. albicans inoculum im- mune components in host defense against invasive infection. proves survival of both wild-type and Rag1-deficient mice after Many other phenotypes attributed to fungal immunity and the C. albicans intravenous challenge (Quintin et al., 2012). More immune modulatory properties of commensal fungi are likely to recently, Rag1-deficient mice were used to show non-essential
414 Cell Host & Microbe 25, 404–417, March 13, 2019 roles for adaptive immune components in protection against d METHOD DETAILS C. albicans invasive infection conferred by colonization with B Antibiotic and Antimycotic Agents attenuated mutant strains adapted for intestinal commensalism B Microbial Propagation and Infection (Tso et al., 2018). By contrast, we show a necessity for adaptive B Cell Staining, Stimulation and Flow Cytometry immune cells, and in particular CD4+ T cells, in systemic host de- B Isolation of Kidney Leukocytes fense primed by virulent C. albicans intestinal colonization, since B In Vivo Cell Depletion or Cytokine Neutralization susceptibility to invasive infection rebounds to levels found in B Imaging non-colonized control mice with CD4+ T cell depletion or in B Reactive Oxygen Production Rag1-deficient mice (Figures 3D–3F). The reason for this discor- B Airway Reactivity and Inflammation dance remains uncertain, but likely reflects intrinsic differences B Human peripheral blood cells in immunogenicity of virulent pathobionts compared with atten- B Fecal DNA Extraction and Shotgun Metagenome uated commensal microbes, the spectrum of antibiotics used to Sequencing facilitate C. albicans intestinal colonization, or intrinsic differ- B Taxonomic Assignment of DNA Reads ences between commensal microbiota for mice housed in d QUANTIFICATION AND STATISTICAL ANALYSIS each respective facility. d DATA AND SOFTWARE AVAILABILITY Systemic expansion of IL-17-producing CD4+ T cells with commensal C. albicans specificity (Figures 3C and S5), together SUPPLEMENTAL INFORMATION with enhanced IL-17 responsiveness by circulating neutrophils, which require exposure to IL-17 and CD4+ T cells in mice with Supplemental Information can be found with this article online at https://doi. C. albicans intestinal colonization (Figure 4C), suggests that org/10.1016/j.chom.2019.02.004. even innately trained immune cells can be further educated by adaptive immune components with commensal specificity. ACKNOWLEDGMENTS Durability is one important distinction between non-antigen-spe- We are indebted to Dr. Paul E. Steele for help obtaining human blood samples cific immune cells trained by transient exposure to defined mi- and Dr. Matthew Kofron for imaging assistance. We thank members of the Drs. crobial compounds or acute infection conditions, which have Alenghat, Deshmukh, Haslam, Qualls, and Way laboratories for helpful sug- relatively short functional longevity (Quintin et al., 2012; Tso gestions. This work was supported by the NIH through grants F30- et al., 2018), and the more sustained activation of neutrophils DK107199 and T32-GM63483 (T.T.J.); R21-AI123089, R21-AI128932, and in mice with C. albicans intestinal colonization that we show re- DP1-AI131080 (S.S.W.); and P30-DK078392 (Pathology Core of the Cincinnati lies on CD4+ T cell recognition of commensal C. albicans. How- Digestive Diseases Research Center). S.S.W. is supported by the HHMI Fac- ulty Scholar’s program, and Burroughs Wellcome Fund Investigator in the ever, durability in this context is also not absolute, since tonic Pathogenesis of Infectious Disease Award. stimulation by commensal C. albicans is needed for sustained activation and expansion of protective neutrophils and Th17 AUTHOR CONTRIBUTIONS CD4+ T cells (Figure 5). Further supporting the need for tonic commensal stimulation is the positive correlation in humans be- Conceptualization, T.-Y.S., W.X.G.A., T.T.J., J.M.K., G.K.K.H., D.B.H., and tween C. albicans fecal density and levels of systemic S.S.W.; Methodology, T.-Y.S., W.X.G.A., F.S.H., H.A., G.P., B.R., and T.G.; Investigation, T.-Y.S., W.X.G.A., A.R.B., D.B.H., and S.S.W.; Writing – Review C. albicans-specific Th17 CD4+ T cells plus IL-17 responsive- & Editing, T.-Y.S., W.X.G.A., D.B.H., and S.S.W. ness by circulating neutrophils (Figures 7A, 7B, and S7). Thus, despite inherent differences in the composition of commensal DECLARATION OF INTERESTS microbes across species, this complementary analysis of immu- nity in humans and mice highlights conserved shifts in systemic The authors declare no competing interests. immunity primed by C. albicans. Existence of this dynamic inter- play between commensal C. albicans and systemic immune Received: November 13, 2018 Revised: January 7, 2019 cells, which sense not only the presence of C. albicans coloniza- Accepted: February 15, 2019 tion, but also transient shifts in colonization levels, opens up Published: March 13, 2019 exciting new opportunities to target fungi with mycotic probiotics and/or antifungal agents for therapeutically fine-tuning systemic REFERENCES immunity. Acosta-Rodriguez, E.V., Rivino, L., Geginat, J., Jarrossay, D., Gattorno, M., Lanzavecchia, A., Sallusto, F., and Napolitani, G. (2007). Surface phenotype STAR+METHODS and antigenic specificity of human interleukin 17-producing T helper memory cells. Nat. Immunol. 8, 639–646. Detailed methods are provided in the online version of this paper Acton, D.S., Plat-Sinnige, M.J., van Wamel, W., de Groot, N., and van Belkum, and include the following: A. (2009). Intestinal carriage of Staphylococcus aureus: how does its fre- quency compare with that of nasal carriage and what is its clinical impact? d KEY RESOURCES TABLE Eur. J. Clin. Microbiol. Infect. Dis. 28, 115–127. d CONTACT FOR REAGENT AND RESOURCE SHARING Alcorn, J.F., Crowe, C.R., and Kolls, J.K. (2010). TH17 cells in asthma and d EXPERIMENTAL MODEL AND SUBJECT DETAILS COPD. Annu. Rev. Physiol. 72, 495–516. B Mice Baaten, B.J.G., Tinoco, R., Chen, A.T., and Bradley, L.M. (2012). Regulation of B Microbes antigen-experienced T cells: lessons from the quintessential memory marker B Human Subjects CD44. Front. Immunol. 3,23.
Cell Host & Microbe 25, 404–417, March 13, 2019 415 Bacher, P., Hohnstein, T., Beerbaum, E., Ro¨ cker, M., Blango, M.G., Kaufmann, Malik, A., Sharma, D., Malireddi, R.K.S., Guy, C.S., Chang, T.-C., Olsen, S.R., S., Ro¨ hmel, J., Eschenhagen, P., Grehn, C., Seidel, K., et al. (2019). Human Neale, G., Vogel, P., and Kanneganti, T.-D. (2018). SYK-CARD9 signaling axis anti-fungal Th17 immunity and pathology rely on cross-reactivity against promotes gut fungi-mediated inflammasome activation to restrict colitis and Candida albicans. Cell 176, 1340–1355. colon cancer. Immunity 49, 515–530.e5. Berdal, J.-E., Haagensen, R., Ranheim, T., and Bjørnholt, J.V. (2014). Moon, J.J., Chu, H.H., Pepper, M., McSorley, S.J., Jameson, S.C., Kedl, R.M., Nosocomial candidemia; risk factors and prognosis revisited; 11 years expe- and Jenkins, M.K. (2007). Naive CD4(+) T cell frequency varies for different epi- rience from a Norwegian secondary hospital. PLoS One 9, e103916. topes and predicts repertoire diversity and response magnitude. Immunity 27, Brown, G.D., Denning, D.W., Gow, N.A., Levitz, S.M., Netea, M.G., and White, 203–213. T.C. (2012). Hidden killers: human fungal infections. Sci. Transl. Med. 4, Nash, A.K., Auchtung, T.A., Wong, M.C., Smith, D.P., Gesell, J.R., Ross, M.C., 165rv13. Stewart, C.J., Metcalf, G.A., Muzny, D.M., Gibbs, R.A., et al. (2017). The gut Casadevall, A., and Pirofski, L.A. (2000). Host-pathogen interactions: basic mycobiome of the Human Microbiome Project healthy cohort. Microbiome concepts of microbial commensalism, colonization, infection, and disease. 5, 153. Infect. Immun. 68, 6511–6518. Noverr, M.C., Falkowski, N.R., McDonald, R.A., McKenzie, A.N., and De Luca, A., Zelante, T., D’Angelo, C., Zagarella, S., Fallarino, F., Spreca, A., Huffnagle, G.B. (2005). Development of allergic airway disease in mice Iannitti, R.G., Bonifazi, P., Renauld, J.-C., Bistoni, F., et al. (2010). IL-22 defines following antibiotic therapy and fungal microbiota increase: role of host ge- a novel immune pathway of antifungal resistance. Mucosal Immunol. 3, netics, antigen, and interleukin-13. Infect. Immun. 73, 30–38. 361–373. Patolia, S., Kennedy, E., Zahir, M., Patolia, S., Gulati, N., Narendra, D., Vadde, Fan, D., Coughlin, L.A., Neubauer, M.M., Kim, J., Kim, M.S., Zhan, X., Simms- R., Pokharel, S., Schmidt, F.M., Enriquez, D., et al. (2013). Risk factors for Waldrip, T.R., Xie, Y., Hooper, L.V., and Koh, A.Y. (2015). Activation of HIF-1a candida blood stream infection in medical ICU and role of colonization-A retro- and LL-37 by commensal bacteria inhibits Candida albicans colonization. Nat. spective study. Br. J. Med. Pract. 6, a618. Med. 21, 808–814. Pfaller, M.A., and Diekema, D.J. (2007). Epidemiology of invasive candidiasis: Huang, W., Na, L., Fidel, P.L., and Schwarzenberger, P. (2004). Requirement of a persistent public health problem. Clin. Microbiol. Rev. 20, 133–163. interleukin-17A for systemic anti-Candida albicans host defense in mice. Quintin, J., Saeed, S., Martens, J.H.A., Giamarellos-Bourboulis, E.J., Ifrim, J. Infect. Dis. 190, 624–631. D.C., Logie, C., Jacobs, L., Jansen, T., Kullberg, B.-J., Wijmenga, C., et al. Igya´ rto´ , B.Z., Haley, K., Ortner, D., Bobr, A., Gerami-Nejad, M., Edelson, B.T., (2012). Candida albicans infection affords protection against reinfection via Zurawski, S.M., Malissen, B., Zurawski, G., Berman, J., and Kaplan, D.H. functional reprogramming of monocytes. Cell Host Microbe 12, 223–232. (2011). Skin-resident murine dendritic cell subsets promote distinct and opposing antigen-specific T helper cell responses. Immunity 35, 260–272. Reagan, D.R., Pfaller, M.A., Hollis, R.J., and Wenzel, R.P. (1990). Characterization of the sequence of colonization and nosocomial candidemia Iliev, I.D., Funari, V.A., Taylor, K.D., Nguyen, Q., Reyes, C.N., Strom, S.P., using DNA fingerprinting and a DNA probe. J. Clin. Microbiol. 28, 2733–2738. Brown, J., Becker, C.A., Fleshner, P.R., Dubinsky, M., et al. (2012). Interactions between commensal fungi and the C-type lectin receptor Rigby, K.M., and DeLeo, F.R. (2012). Neutrophils in innate host defense Dectin-1 influence colitis. Science 336, 1314–1317. against Staphylococcus aureus infections. Semin. Immunopathol. 34, 237–259. Iwakura, Y., Nakae, S., Saijo, S., and Ishigame, H. (2008). The roles of IL-17A in inflammatory immune responses and host defense against pathogens. Saijo, S., Ikeda, S., Yamabe, K., Kakuta, S., Ishigame, H., Akitsu, A., Fujikado, Immunol. Rev. 226, 57–79. N., Kusaka, T., Kubo, S., Chung, S.H., et al. (2010). Dectin-2 recognition of a-mannans and induction of Th17 cell differentiation is essential for host de- Jiang, T.T., Chaturvedi, V., Ertelt, J.M., Xin, L., Clark, D.R., Kinder, J.M., and fense against Candida albicans. Immunity 32, 681–691. Way, S.S. (2015). Commensal enteric bacteria lipopolysaccharide impairs host defense against disseminated Candida albicans fungal infection. Schulte, D.M., Sethi, A., Gangnon, R., Duster, M., Maki, D.G., and Safdar, N. Mucosal Immunol. 8, 886–895. (2015). Risk factors for Candida colonization and co-colonization with Jiang, T.T., Shao, T.-Y., Ang, W.X.G., Kinder, J.M., Turner, L.H., Pham, G., multi-drug resistant organisms at admission. Antimicrob. Resist. Infect. Whitt, J., Alenghat, T., and Way, S.S. (2017). Commensal fungi recapitulate Control 4,46. the protective benefits of intestinal bacteria. Cell Host Microbe 22, Skalski, J.H., Limon, J.J., Sharma, P., Gargus, M.D., Nguyen, C., Tang, J., 809–816.e4. Coelho, A.L., Hogaboam, C.M., Crother, T.R., and Underhill, D.M. (2018). Klein, R.S., Harris, C.A., Small, C.B., Moll, B., Lesser, M., and Friedland, G.H. Expansion of commensal fungus Wallemia mellicola in the gastrointestinal my- (1984). Oral candidiasis in high-risk patients as the initial manifestation of the cobiota enhances the severity of allergic airway disease in mice. PLoS Pathog. acquired immunodeficiency syndrome. N. Engl. J. Med. 311, 354–358. 14, e1007260. Koehler, F.C., Cornely, O.A., Wisplinghoff, H., Schauss, A.C., Salmanton- Spinillo, A., Capuzzo, E., Acciano, S., De Santolo, A., and Zara, F. (1999). Effect Garcia, J., Ostermann, H., Ziegler, M., Bacher, P., Scheffold, A., Alex, R., of antibiotic use on the prevalence of symptomatic vulvovaginal candidiasis. et al. (2018). Candida-reactive T cells for the diagnosis of invasive Candida Am. J. Obstet. Gynecol. 180, 14–17. infection–a prospective pilot study. Front. Microbiol. 9, 1381. Taylor, P.R., Roy, S., Leal, S.M., Jr., Sun, Y., Howell, S.J., Cobb, B.A., Li, X., Koh, A.Y., Ko¨ hler, J.R., Coggshall, K.T., Van Rooijen, N., and Pier, G.B. (2008). and Pearlman, E. (2014). Activation of neutrophils by autocrine IL-17A-IL- Mucosal damage and neutropenia are required for Candida albicans dissem- 17RC interactions during fungal infection is regulated by IL-6, IL-23, RORgt ination. PLoS Pathog. 4, e35. and dectin-2. Nat. Immunol. 15, 143–151. Kolaczkowska, E., and Kubes, P. (2013). Neutrophil recruitment and function in Tso, G.H.W., Reales-Calderon, J.A., Tan, A.S.M., Sem, X., Le, G.T.T., Tan, health and inflammation. Nat. Rev. Immunol. 13, 159–175. T.G., Lai, G.C., Srinivasan, K.G., Yurieva, M., Liao, W., et al. (2018). Laupland, K.B. (2013). Incidence of bloodstream infection: a review of popula- Experimental evolution of a fungal pathogen into a gut symbiont. Science tion-based studies. Clin. Microbiol. Infect. 19, 492–500. 362, 589–595. Li, X., Leonardi, I., Semon, A., Doron, I., Gao, I.H., Putzel, G.G., Kim, Y., Turner, L.H., Kinder, J.M., Wilburn, A., D’Mello, R.J., Braunlin, M.R., Jiang, Kabata, H., Artis, D., Fiers, W.D., et al. (2018). Response to fungal dysbiosis T.T., Pham, G., and Way, S.S. (2017). Preconceptual Zika virus asymptomatic by gut-resident CX3CR1+ mononuclear phagocytes aggravates allergic airway infection protects against secondary prenatal infection. PLoS Pathog. 13, disease. Cell Host Microbe 24, 847–856.e4. e1006684. Lozupone, C.A., Stombaugh, J.I., Gordon, J.I., Jansson, J.K., and Knight, R. Ubeda, C., Taur, Y., Jenq, R.R., Equinda, M.J., Son, T., Samstein, M., Viale, A., (2012). Diversity, stability and resilience of the human gut microbiota. Nature Socci, N.D., van den Brink, M.R., Kamboj, M., and Pamer, E.G. (2010). 489, 220–230. Vancomycin-resistant Enterococcus domination of intestinal microbiota is
416 Cell Host & Microbe 25, 404–417, March 13, 2019 enabled by antibiotic treatment in mice and precedes bloodstream invasion in Williams, R.E. (1963). Healthy carriage of Staphylococcus aureus: its preva- humans. J. Clin. Invest. 120, 4332–4341. lence and importance. Bacteriol. Rev. 27, 56–71. van de Veerdonk, F.L., Kullberg, B.J., Verschueren, I.C., Hendriks, T., van der Wilson, R., Cohen, J.M., Jose, R.J., de Vogel, C., Baxendale, H., and Brown, Meer, J.W., Joosten, L.A., and Netea, M.G. (2010). Differential effects of IL-17 J.S. (2015). Protection against Streptococcus pneumoniae lung infection after pathway in disseminated candidiasis and zymosan-induced multiple organ nasopharyngeal colonization requires both humoral and cellular immune re- failure. Shock 34, 407–411. sponses. Mucosal Immunol. 8, 627–639. von Eiff, C., Becker, K., Machka, K., Stammer, H., and Peters, G.; Study Group Wood, D.E., and Salzberg, S.L. (2014). Kraken: ultrafast metagenomic (2001). Nasal carriage as a source of Staphylococcus aureus bacteremia. sequence classification using exact alignments. Genome Biol. 15, R46. N. Engl. J. Med. 344, 11–16. Yang, Y., Torchinsky, M.B., Gobert, M., Xiong, H., Xu, M., Linehan, J.L., Voss, A., Hollis, R.J., Pfaller, M.A., Wenzel, R.P., and Doebbeling, B.N. (1994). Alonzo, F., Ng, C., Chen, A., Lin, X., et al. (2014). Focused specificity of intes- Investigation of the sequence of colonization and candidemia in nonneutro- tinal TH17 cells towards commensal bacterial antigens. Nature 510, 152–156. penic patients. J. Clin. Microbiol. 32, 975–980. Yu, Y., Du, L., Yuan, T., Zheng, J., Chen, A., Chen, L., and Shi, L. (2013). Risk Wang, T., Fan, C., Yao, A., Xu, X., Zheng, G., You, Y., Jiang, C., Zhao, X., Hou, factors and clinical analysis for invasive fungal infection in neonatal intensive Y., Hung, M.-C., and Lin, X. (2018). The adaptor protein CARD9 protects care unit patients. Am. J. Perinatol. 30, 589–594. against colon cancer by restricting mycobiota-mediated expansion of Zaura, E., Brandt, B.W., Teixeira de Mattos, M.J., Buijs, M.J., Caspers, M.P., myeloid-derived suppressor cells. Immunity 49, 504–514.e4. Rashid, M.-U., Weintraub, A., Nord, C.E., Savell, A., Hu, Y., et al. (2015). Wheeler, M.L., Limon, J.J., Bar, A.S., Leal, C.A., Gargus, M., Tang, J., Brown, Same exposure but two radically different responses to antibiotics: resilience J., Funari, V.A., Wang, H.L., Crother, T.R., et al. (2016). Immunological conse- of the salivary microbiome versus long-term microbial shifts in feces. MBio 6, quences of intestinal fungal dysbiosis. Cell Host Microbe 19, 865–873. e01693-15.
Cell Host & Microbe 25, 404–417, March 13, 2019 417 STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PE-Cy7 anti-mouse CD4 (clone: GK1.5) eBioscience Cat# 25-0041-82; RRID: AB_469576 FITC anti-mouse CD4 (clone: GK1.5) eBioscience Cat# 11-0041-82; RRID: AB_464892 PE-Cy5 anti-mouse CD8 (clone: 53-6.7) eBioscience Cat# 35-0081-82; RRID: AB_11217674 APC anti-mouse CD8 (clone: 53-6.7) eBioscience Cat# 17-0081-82; RRID: AB_469335 PE-Cy5 anti-mouse CD11b (clone: M1/70) Biolegend Cat# 101210; RRID: AB_312793 eFluor 605NC anti-mouse CD11b (clone: M1/70) eBioscience Cat# 93-0112-42; RRID: AB_1944342 PE-Cy5 anti-mouse CD11c (clone: N418) Biolegend Cat# 15-0114-82; RRID: AB_468717 PE-Cy5 anti-mouse F4/80 (clone: BM8) eBioscience Cat# 15-4801-82; RRID: AB_468798 PE-Cy5 anti-mouse B220 (clone: RA3-6B2) Biolegend Cat# 15-0452-83; RRID: AB_468756 Alexa Fluor 700 anti-mouse CD44 (clone: IM7) Biolegend Cat# 56-0441-82; RRID: AB_494011 APC-eFluor780 anti-mouse CD45 (clone: 30F11) Invitrogen Cat# 47-0451-82; RRID: AB_1548781 PE-Cy7 anti-mouse Ly6G (clone: 1A8) BD bioscience Cat# 560601; RRID: AB_1727562 eFluor 450-mouse Ly6C (clone: HK1.4) eBioscience Cat# 48-5932-82; RRID: AB_10805519 Alexa Fluor 700 anti-mouse Gr-1 (clone: RB6-8C5) eBioscience Cat# 56-5931-80; RRID: AB_494008 Biotin anti-mouse IL-17RC (polyclonal IgG) R&D Systems Cat# BAF2270; RRID: AB_2125673 FITC anti-mouse FOXP3 (clone: FJK-16S) eBioscience Cat# 11-5773-82; RRID: AB_465243 BV650 anti-mouse RORgt (clone: Q31-378) BD bioscience Cat# 564722; RRID: AB_2738915 anti-mouse T-bet (clone: 4B10) Biolegend Cat# 644816; RRID: AB_10959653 Brilliant Violet421 anti-mouse IFN-g eBioscience Cat# 48-7311-82; RRID: AB_1834366 (clone: XMG1.2) PE-Cy7 anti-mouse IL17A (clone: TC 11-18H10.1) Biolegend Cat# 506922; RRID: AB_2125010 PE anti-mouse IL17F (clone: 9D3.1C8) Biolegend Cat# 517008; RRID: AB_10690818 Alexa Fluor 700 anti-human CD4 (clone: OKT4) eBioscience Cat# 56-0048-82; RRID: AB_657741 eFluor 450 anti-human CD15 (clone: H198) Invitrogen Cat# 48-0159-42; RRID: AB_2016661 PE-Cy5 anti-human CD16 (clone: 3G8) Biolegend Cat# 302010; RRID: AB_314210 PE-Cy7 anti-human CD45 (clone: HI30) BD bioscience Cat# 557748; RRID: AB_396854 APC anti-human IL-17A (clone: eBio64DEC17) eBioscience Ca# 17-7179-42; RRID: AB_1582221 PE anti-human IL17F (clone: O33-782) BD Bioscience Cat# 564263; RRID: AB_2738715 PE anti-human IL17RC (clone: 309822) R&D Systems Cat# FAB22691P; RRID: AB_10889842 PE Streptavidin eBioscience Cat# 12-4317-87 anti-human CD28 BD Bioscience Cat# 555725; RRID: AB_396068 anti-mouse CD4 (clone: GK1.5) BioXcell Cat# BE0003-1; RRID: AB_1107636 anti-mouse IL-17A (clone:17F3) BioXcell Cat# BE0173; RRID: AB_10950102 anti-mouse IL-17F (clone: MM17F8F5.1A9) BioXcell Cat# BE0303; RRID: AB_2715461 anti-mouse Ly6G (clone: 1A8) BioXcell Cat# BE0075-1; RRID: AB_1107721 anti-mouse Gr-1 (clone: RB6-8C5) BioXcell Cat# BE0075; RRID: AB_10312146 rat IgG2a isotype control BioXcell Cat# BE0089; RRID: AB_1107769 rat IgG2b isotype control BioXcell Cat# BE0090; RRID: AB_1107780 mouse IgG1 isotype control BioXcell Cat# BE0083; RRID: AB_1107784 Bacterial and Virus Strains Candida albicans SC5314 Daniel Kaplan, University of Pittsburg N/A Recombinant Candida albicans SC5314 Daniel Kaplan, University of Pittsburg N/A Influenza A H1N1 strain PR8 Monica McNeal, Cincinnati Children’s Hospital N/A Staphylococcus aureus USA300 Matthew Flick, Cincinnati Children’s Hospital N/A (Continued on next page) e1 Cell Host & Microbe 25, 404–417.e1–e6, March 13, 2019 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Salinibacter ruber ATCC BAA-605 Biological Samples Candida albicans Greer Laboratories Catalog# My15 Mite, House Dust (freeze-dried extract) Greer Laboratories Catalog# B82 Chemicals, Peptides, and Recombinant Proteins Ampicillin Sigma-Aldrich Catalog# A0166-100G Gentamicin Sigma-Aldrich Catalog# G3632-25G Metronidazole Sigma-Aldrich Catalog# M3761-100G Neomycin Sigma-Aldrich Catalog# N6386-100G Vancomycin MP Biomedical Catalog# 0219554005-5g Fluconazole Sigma-Aldrich Catalog# PHR1160-1G Dehydrated Culture Media: Brain Heart Infusion Thermo Fisher Scientific Catalog# B11060 Yeast extract Boston Bio Product Catalog# P-950 Bactopeptone BD Bioscience Catalog# DF0118170 Uridine Alfa-Aesar Catalog# A15227 D-(+)-Glucose Sigma-Aldrich Catalog# G5767-500G Agar Bio Express Catalog# J637-2500G DMEM GIBCO Catalog# 10313-21 Fetal bovine serum GeneMate Catalog# S-1200-500 Glutamine (100X) GIBCO Catalog# 25030-081 HEPES 1M GIBCO Catalog# 15630-080 penicillin-streptomycin solution (100X) GIBCO Catalog# 15140-122 Collagenase Sigma-Aldrich Catalog# C5138 DNase I Sigma-Aldrich Catalog# DN25 Percoll Sigma-Aldrich Catalog# P4937 Potassium hydrogen bicarbonate Fisher Chemical Catalog# P184-500 Ammonium chloride ACROS Catalog# 3931825 Methacholine Sigma-Aldrich Catalog# A2251 Dihydrohodamine123 Sigma-Aldrich Catalog# D1054-10MG Cell stimulation Cocktail (PMA and ionomycin) eBioscience Catalog# 00-4970-03 BD Golgi Plug (Brefeldin A solution) BD Bioscience Catalog# 555029 Human Fc block BD Bioscience Catalog# 564219 Foxp3/Transcription factor staining buffer set eBioscience Catalog# 00-5523-00 Fixation /Permeabilization solution kit BD Bioscience Catalog# 554722 Critical Commercial Assays Epicenter Masterpure Yeast DNA Purification Kit Lucigen Catalog# MPY80200 Ready-Lyse Lysozyme solution Lucigen Catalogue# R1810M PureLink Genomic DNA Mini Kit Invitrogen Catalogue# K182001 Deposited Data No antibiotic control mouse 1 https://www.ncbi.nlm.nih.gov/sra/SRX5382123 Accession: SAMN10948878 No antibiotic control mouse 2 https://www.ncbi.nlm.nih.gov/sra/SRX5382124 Accession: SAMN10948879 No antibiotic control mouse 3 https://www.ncbi.nlm.nih.gov/sra/SRX538212 Accession: SAMN10948880 No antibiotic control mouse 4 https://www.ncbi.nlm.nih.gov/sra/SRX5382122 Accession: SAMN10948881 Ampicillin drinking water mouse 1 https://www.ncbi.nlm.nih.gov/sra/SRX5382115 Accession: SAMN10948886 Ampicillin drinking water mouse 2 https://www.ncbi.nlm.nih.gov/sra/SRX5382116 Accession: SAMN10948887 Ampicillin drinking water mouse 3 https://www.ncbi.nlm.nih.gov/sra/SRX5382111 Accession: SAMN10948888 Ampicillin drinking water mouse 4 https://www.ncbi.nlm.nih.gov/sra/SRX5382112 Accession: SAMN10948889 C. albicans colonization mouse 1 https://www.ncbi.nlm.nih.gov/sra/SRX5382119 Accession: SAMN10948882 C. albicans colonization mouse 2 https://www.ncbi.nlm.nih.gov/sra/SRX5382120 Accession: SAMN10948883 (Continued on next page)
Cell Host & Microbe 25, 404–417.e1–e6, March 13, 2019 e2 Continued REAGENT or RESOURCE SOURCE IDENTIFIER C. albicans colonization mouse 3 https://www.ncbi.nlm.nih.gov/sra/SRX5382117 Accession: SAMN10948884 C. albicans colonization mouse 4 https://www.ncbi.nlm.nih.gov/sra/SRX5382118 Accession: SAMN10948885 Clinical sample 1 https://www.ncbi.nlm.nih.gov/sra/SRX5382113 Accession: SAMN10948890 Clinical sample 2 https://www.ncbi.nlm.nih.gov/sra/SRX5382114 Accession: SAMN10948891 Clinical sample 3 https://www.ncbi.nlm.nih.gov/sra/SRX5382107 Accession: SAMN10948892 Clinical sample 4 https://www.ncbi.nlm.nih.gov/sra/SRX5382108 Accession: SAMN10948893 Clinical sample 5 https://www.ncbi.nlm.nih.gov/sra/SRX5382109 Accession: SAMN10948894 Clinical sample 6 https://www.ncbi.nlm.nih.gov/sra/SRX5382110 Accession: SAMN10948895 Experimental Models: Cell Lines Madin-Darby Canine Kidney Cell (line MDCK.2) ATCC CRL-2936 Experimental Models: Organisms/Strains C57BL/6 mice Charles River Stain Code: 027 B6.129S7-Rag1tm1Mom/J mice Jackson Laboratory Stock No: 002216 Software and Algorithms Prism 6.0h GraphPad N/A Flow Jo 9.9.6 Treestar N/A Tableau 2018.2.2 Tableau Software N/A Other b I-A :2W1S52-68 tetramer Marc Jenkins, University of Minnesota N/A
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources or reagents should be directed to and will be fulfilled the Lead Contact, Dr. Sing Sing Way ([email protected]).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Mice C57BL/6 and Rag1-deficient mice were purchased from Charles River laboratories and Jackson laboratories respectively, housed under specific pathogen-free conditions, and used between 6-8 weeks of age. All experiments were performed using sex- and age- matched controls under Cincinnati Children’s Hospital Research Foundation IACUC approved protocols.
Microbes
Wild-type C. albicans (strain SC5314) and the isogenic recombinant virulent strain expressing GFP plus 2W1S55-68 peptide was pro- vided by Dr. Daniel Kaplan (University of Pittsburgh) (Igya´ rto´ et al., 2011). Methicillin resistant S. aureus (strain USA300) was provided by Dr. Matthew Flick (Cincinnati Children’s Hospital). Mouse adapted H1N1 influenza A virus (strain PR8) was provided by Monica Malone McNeal (Cincinnati Children’s Hospital). Each C. albicans strain (wild-type or recombinant) was cultured in YPAD media at 30C with shaking (200 rpm). S. aureus was cultured in BHI media at 37C with shaking (200 rpm). For infection, C. albicans and S. aureus were each back-diluted to early log phase growth (OD600 0.1), then washed and diluted in sterile saline. PR8 virus was grown and tittered in Madin-Darby Canine kidney epithelial cells, stored as individual aliquots –70C, and thawed immediately prior to infection.
Human Subjects Informed consent to use discard anticoagulated blood collected for routine clinical care was obtained under Cincinnati Children’s Hospital Institutional Review Board (IRB) approved protocols. Inclusion criteria were patients scheduled for routine early morning blood collection so that analysis could be performed on excess sample after clinical processing, and those willing and able to provide a stool specimen. Exclusion criteria were patients with lymphopenia or neutropenia (absolute lymphocyte and neutrophil count each > 500 3 103/ml), recent (past 30 days) exposure to antifungal compounds, or being critically ill that precluded being able to obtain oral and written consent. The final analysis included patients fitting these criteria (age range, 15 months to 5 years) and of both genders.
e3 Cell Host & Microbe 25, 404–417.e1–e6, March 13, 2019 METHOD DETAILS
Antibiotic and Antimycotic Agents To establish C. albicans intestinal colonization, the drinking water of mice was supplemented with ampicillin (1 mg/mL) two days prior to oral C. albicans inoculation. Thereafter mice were maintained on ampicillin supplemented drinking water throughout the experi- ment. To eradicate commensal fungi, ampicillin treated drinking water was further supplemented with fluconazole (0.5 mg/mL).
Microbial Propagation and Infection For oral inoculation, 30 ml of the overnight culture C. albicans was administered dropwise into the mouths of mice. For intravenous infection, each C. albicans strain (wild-type or recombinant) (5 3 104 CFUs in 200ml) or S. aureus (108 CFUs or 3 3 107 CFUs each in 200ml) was injected into mice via the lateral tail vein. For influenza A virus infection, frozen aliquots of PR8 virus were individually thawed, diluted in saline to 2 3 105 PFU/30 ml, and intranasally administered to anesthetized (ketamine/xylazine) mice (Jiang et al., 2017). Mice were checked daily and assigned the following clinical disease score (1 healthy; 2 limited ruffled fur; 3 ruffled fur throughout; 4 mild lethargy; 5 limited movement; 6 moribund or uncontrolled spastic movements; 7 deceased) as described (Turner et al., 2017). For enumerating the number of recoverable C. albicans and S. aureus colony forming units, individual fetal pellets or each tissue from mice was sterilely dissected, weighed, and homogenized in sterile saline. Serial dilutions on the organ homog- enate were spread onto BHI media plates (S. aureus) or BHI media plates supplemented with antibiotics (C. albicans) (ampicillin [2.5 mg/mL), gentamicin (2.5 mg/mL), metronidazole (2.5 mg/mL), neomycin (2.5 mg/mL), and vancomycin (1.25 mg/mL), and the num- ber of individual colonies enumerated after incubation at 37C for 24 hours.
Cell Staining, Stimulation and Flow Cytometry Fluorophore- or biotin-conjugated antibodies used mouse cell analysis are as follows: anti-CD4 (clone GK1.5), anti-CD8a (clone 53-6.7), anti-CD11b (clone M1/70), anti-CD11c (clone N418), anti-F4/80 (clone BM8), anti-B220 (clone RA3-6B2), anti-CD44 (clone IM7), anti-CD45 (clone 30F11), anti-Ly6G (clone 1A8), anti-Ly6C (clone HK1.4), anti-Gr-1 (clone RB6-8C5), anti-IL-17RC (poly- clonal IgG), anti-FOXP3 (clone FJK-16S), anti-RORgt (clone Q31-378), anti-T-bet (clone 4B10), anti-IFN-g (clone XMG1.2), anti-IL17A (clone TC 11-18H10.1), anti-IL17F (clone 9D3.1C8). Fluorophore-conjugated antibodies were used for human cell analysis are as fol- lows: anti-CD4 (clone OKT4), anti-CD15 (clone H198), anti-CD16 (clone 3G8), anti-CD45(clone HI30), anti-IL-17A (clone eBio64- DEC17), anti-IL17F (clone O33-782), anti-IL17RC (clone 309822) with staining in the presence of Human Fc block (BD Bioscience). For detecting cytokine production by individual cells, 106 cells from the spleen and peripheral lymph nodes were stimulated with heat-killed (65C for 90 min) WT C. albicans (106 CFU equivalents) in 200 ml complete DMEM medium (supplemented with 10% fetal bovine serum, 1% L-glutamine, 10 mM HEPES, 1% penicillin-streptomycin) at 37 C and 5% CO2 for 24 hours, and with GolgiPlug supplementation to the media for the last 6 hours, and intracellular staining was performed after cell permeabilization (BD PharMingen) according to the manufacturers’ instructions. Single cell suspensions from spleen and peripheral lymph nodes were b stained with APC or PE conjugated I-A :2W1S55-68 tetramer at room temperature for 60 min, and enriched using anti-APC or anti- PE antibody conjugated magnetic beads (Militenyi Biotec) as described (Moon et al., 2007). Samples were acquired using an FACS- Canto (BD) cytometer and analyzed using FlowJo software (Tree Star).
Isolation of Kidney Leukocytes Kidneys were minced and digested with collagenase D (1 mg/mL) and DNase (0.1 mg/mL) in complete DMEM medium at 37C 200 rpm for 30 min. The digest was then passed through a 70 mm filter to obtain single cell suspensions. Leukocytes were isolated by centrifugation at 2000 rpm for 20 min on a 40% and 80% Percoll gradient. Residual red blood cells were lysed by hypertonic so- lution (10 mM HKCO3,16mMNH4Cl, pH 7.3) before further manipulation. Single cell suspensions were stained with APC conjugated b I-A :2W1S55-68 tetramer at room temperature for 60 min before surface and intranuclear staining.
In Vivo Cell Depletion or Cytokine Neutralization The following antibodies were administered to mice for in vivo cell depletion or cytokine neutralization: anti-CD4 (clone GK1.5); anti- IL-17A (clone 17F3), anti-IL17F (clone MM17F8F5), anti-Gr-1 (clone RB6-8C5), anti-Ly6G (clone 1A8), or each respective isotype anti- body control (mouse IgG1, rat IgG2b, and rat IgG2a) by intraperitoneal injection (0.6 mg each antibody per mouse) beginning 1 day prior to C. albicans intravenous infection or 7 days prior to blood collection. Thereafter, 0.3 mg of the same antibody was administered every two days until the end of the experiment.
Imaging BHI agar plates containing fungal colonies were imaged by the In Vivo Imaging System (Perkin Elmer) using the GFP and Cy5.5 filter sets. Fluorescence intensity was quantified by region-of-interest calibration using the Cy5.5-filter set image as background and showing the ratio properties as pseudo-color images (rainbow pseudo-color shows ratio high to low as red to blue), and analyzed using Nikon Elements software.
Cell Host & Microbe 25, 404–417.e1–e6, March 13, 2019 e4 Reactive Oxygen Production Peripheral blood was collected via retro-orbital bleeding from mice. To detect production of reactive oxygen species, RBC lysed pe- ripheral blood cells were seeded into 96-well round-bottom plates (2 3 105/well) in the presence of 0.45 mM dihydrorhodamine 123 for 15 min, then stimulated with 100 mg/mL C. albicans extract (Greer Laboratories) for 60 min.
Airway Reactivity and Inflammation Mice were anesthetized with ketamine/xylazine and hung by their front incisors on an angled stand. 100 mg house dust mite extract (Greer Laboratories) in 40 mL sterile saline was administered intratracheally. 10 days later, mice were challenged with the same amount of house dust mite extract. 48 hours after the second intratracheal challenge, airway resistance in response to inhaled meth- acholine (100 mg/mL) was measured using FlexiVent (SCIREQ). Saline perfused lungs were minced and digested with collagenase D (1 mg/mL) and DNase (0.1mg/mL) in complete DMEM media for 30 min at 37C with gentle shaking (200 rpm). The tissue digest was then passed through a 70 mm filter to obtain single cell suspensions. For intracellular cytokine staining, single cell preparations from the lung were stimulated with phorbol 12-myristate 13-acetate (PMA) and ionomycin (eBioscience Cell Stimulation Cocktail) for 4.5 hours at 37 C and 5% CO2 in the presence of BD GolgiPlug.
Human peripheral blood cells Anticoagulated peripheral blood was RBC lysed, and cells seeded into 96-well round-bottom plates (2 3 105/well). Thereafter, trip- licate wells were stimulated with heat-killed C. albicans (106 CFU equivalents) and anti-human CD28 (5 mg/mL, BD Bioscience) or anti- human CD28 for 24 hours at 37C, and with supplementation of the media with GolgiPlug (BD Biosciences) for the last 6 hours.
Fecal DNA Extraction and Shotgun Metagenome Sequencing DNA extraction was performed by mixing 0.1 g stool with 0.35 mL Epicenter Masterpure Yeast DNA Purification lysis buffer to which was added 3500U of Epicenter Ready Lyse solution. Two 5-mm stainless steel beads were added and the samples were vortexed for 1 hour at room temperature. The samples were frozen at –80C briefly then thawed and the supernatant was transferred to a new tube, to which 0.15 mL MPC Protein Precipitation Reagent was as added. After centrifugation (13,000 x g) for 10 min the supernatant was added to new tube to which 0.2 mL 100% ethanol was added. The samples were incubated at –20C for 30 min. DNA was then purified on Invitrogen PureLink DNA columns following the manufacturer’s instructions. DNA concentration was determined using Qubit analyzer, and diluted to 200 ng/mL. Salinibacter ruber genomic DNA (which is not a component of the human microbiota) was then added to each sample at a fixed concentration (1.4 pg/mL) as a reference standard. Nextera XT adapters following manufacturer’s instructions, and sequencing was performed on an Illumina NextSeq500 machine using 150-bp DNA paired end reads to a depth of approximately 2 million base pairs per sample. Raw sequence data was demultiplexed and converted to fasta format and subjected to downstream analysis.
Taxonomic Assignment of DNA Reads Paired-end sequencing reads from each sample were aligned with Kraken (Wood and Salzberg, 2014) against a custom genome database consisting of the human genome and approximately 40,054 bacterial, fungal, viral and parasitic genomes. The database was derived initially from all bacteria, fungi, and viruses in the RefSeq genome database (ftp://ftp.ncbi.nlm.nih.gov/genomes/refseq/, accessed 11/27/2017) as well as the human genome database (GR38Ch; ftp://ftp.ncbi.nlm.nih.gov/genomes/refseq/ vertebrate_mammalian/Homo_sapiens/latest_assembly_versions/). Manual curation was used to add additional Bacteroides, Para- bacteroides, and Clostridia genomes including draft genomes from NCBI Assemblies (https://www.ncbi.nlm.nih.gov/assembly) and PATRIC (https://www.patricbrc.org/view/Taxonomy/2#view_tab=genomes). Additional fungal and viral genome sequences were recovered from the above two resources and dedicated viral (https://www.viprbrc.org/brc/home.spg?decorator=vipr, http://www. virusite.org/) and fungal (http://fungidb.org/fungidb/) databases. Reads were assigned initially using Kraken and then using Bracken, which uses a Baysean approach to rebalance reads that might have had several possible assignments. Taxonomic count data was normalized by rarefaction. Species that contributed less than 0.01% of overall mapped reads or were present in less than 10% of the samples were removed. To calculate genome equivalents of total bacterial species in each fecal sample, total read counts were first normalized across samples. Read counts per sample were then multiplied by 150 (the length of sequence read) then divided by the genomic size of each bacterial species, which yielded normalized genome equivalents per sample. Genomic equivalents were then then normalized to the known quantity of added Salinibacter ruber genome equivalents. Finally, genome abundance of all bacterial species were summed to yield the total bacterial abundance (genome equivalents) per sample.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical tests were performed using Prism (Graphpad) software. The unpaired two-tailed Student’s t test was used to compared differences between two groups. One-way ANOVA with Tukey’s test for multiple comparisons was used to evaluate experiments containing more than two groups. Repeated-measures two-way ANOVA was used to evaluate time course experiments. To identify species that significantly differed between patient groups, Wilcoxon pairwise rank sum test was used to identify taxa that were signif- icantly different between patient groups and the resulting p values were subjected to Bonferroni correction. Shrinkage Linear Discriminant Analysis (SLDA; a form of Linear Discriminant Analysis) was utilized to calculate effect size. Corrected p values with e5 Cell Host & Microbe 25, 404–417.e1–e6, March 13, 2019 FDR < 0.1 and SLDA effect size > 0.2 are considered significantly different between groups. As the number of species differing among groups was very large, the much more stringent cutoffs of effect size R10, and FDR < 0.05 (Wilcoxon rank sum test with Bonferroni correction) were applied to the data for the purposes of graphical representation. Survival curves were analyzed by Log-rank (Mantel- Cox) test. Non-linear regression was used to evaluate the association between human CD4+ T cell IL-17 production or neutrophil IL-17RC expression each compared with fecal colonization density.
DATA AND SOFTWARE AVAILABILITY
The accession number for the shotgun sequencing data reported in this paper is under NCBI accession numbers SAMN10948878- 10948895 (see Key Resources Table for additional details).
Cell Host & Microbe 25, 404–417.e1–e6, March 13, 2019 e6