Page 1 of 41 Diabetes
hZnT8 (slc30a8) Transgenic Mice Which Overexpress the R325W Polymorph Have
Reduced Islet Zn2+ and Proinsulin Levels, Increased Glucose Tolerance After a High-Fat
Diet, and Altered Levels of Pancreatic Zinc Binding Proteins 1
Li Li 2, Shi Bai 2, and Christian T. Sheline 2,3,*
2 Department of Ophthalmology and the Neuroscience Center of Excellence,
Louisiana State University Health Sciences Center, New Orleans, LA 70112
3 Department of Neurology, Stony Brook University Hospital, Stony Brook, NY 11794
1 Supplemental Figures 1 4, and Supplemental Tables 1 3 are available as Online Supporting
Material with the online posting of this paper.
RUNNING TITLE: ZnT8 and Diabetes
WORD COUNT; ABSTRACT: 200; WORD COUNT, INTRODUCTION through
DISCUSSION: 3990; NUMBER OF FIGURES: 6; NUMBER OF TABLES: 2;
SUPPLEMENTARY MATERIAL: Online Supporting Materials: 8
AUTHOR LIST FOR INDEXING: Sheline, Bai, Li
* To Whom Correspondence Should be Addressed: Department of Neurology; Stony Brook
Medicine; HSC T12 020; Stony Brook, NY 11794; Telephone (631) 444 9281, Fax (631) 444
1474; Email – [email protected]
Diabetes Publish Ahead of Print, published online November 29, 2016 Diabetes Page 2 of 41
4 Abbreviations used: GAPDH (glyceraldehyde 3 phosphate dehydrogenase), HFD (High fat diet), HFDD (High fat diet, Zn2+ deficient), IPGTT (Intraperitoneal glucose tolerance testing),
ND (Normal non purified diet), RT PCR (Reverse transcriptase polymerase chain reaction), RW
(R325W), SEM (Standard error measurement), T1DM (type 1 diabetes), T2DM (type 2
2+ 2+ 2+ diabetes), WT (Wildtype), [Zn ]i (intracellular Zn concentration), Zn (Zinc), ZnE (excess
Zn2+ diet), ZnR (reduced Zn2+ diet), ZnT5 (Zinc transporter 5), ZnT8 (Zinc transporter 8), ZP1
(ZinPyr 1) Page 3 of 41 Diabetes
Abstract
Zinc is involved in both type 1 (T1DM) and type 2 (T2DM) diabetes. The wildtype (WT)
form of the beta cell specific Zn2+ transporter, ZNT8, is linked to T2DM susceptibility. ZnT8
null mice have a mild phenotype with a slight decrease in glucose tolerance, whereas patients
with the ZnT8 R325W polymorphism (rs13266634) have decreased proinsulin staining and
susceptibility to T2DM. We measured zinc, insulin, and proinsulin stainings, and IPGTT in
transgenic mice overexpressing hZnT8 WT or hZnT8 R325W fed a normal or high fat diet (HFD).
2+ The hZnT8 R325W transgenic line had lower pancreatic [Zn ]i and proinsulin, and higher insulin
and glucose tolerance compared to control littermates after 10 weeks of a HFD in male mice.
The converse was true for the hZnT8 WT transgenic line, and dietary Zn2+ supplementation also
induced glucose intolerance. Finally, pancreatic zinc binding proteins were identified by Zn2+
affinity chromatography and proteomics. Increasing pancreatic Zn2+ (hZnT8WT) induced
nucleoside diphosphate kinase B (NDPKB), and Zn2+ reduction (hZnT8RW) induced
carboxypeptidaseA1 (CpA1). These data suggest that pancreatic Zn2+ and proinsulin levels
covary, but are inversely variant with insulin or glucose tolerance in the HFD model of T2DM
suggesting novel therapeutic targets.
Keywords: Zinc transporter 8, rs13266634, pancreas, insulin, proinsulin, type 2 diabetes Diabetes Page 4 of 41
Introduction
Zinc (Zn2+) is involved in the diabetic process, but little is known about its role, or homeostatic mechanisms within the pancreas. In animal models of type 1 diabetes (T1DM), Zn2+ chelators, compounds that prevent Zn2+ toxicity, knockout of Zn2+ transporter 5 (ZnT5), and a chronic Zn2+ reduced diet attenuated diabetic incidence and mortality (1 3). However, other studies have suggested that acute Zn2+ supplementation could be beneficial (reviewed in (4)).
The wildtype form of ZnT8 was linked to susceptibility for type 2 diabetes (T2DM), whereas the
ZnT8 R325W polymorphism (rs13266634, or RW) decreases susceptibility as demonstrated by genome wide analyses (5; 6). Patients homozygous for the ZnT8 WT at risk form have increased proinsulin levels (7) which is detrimental for type 2 diabetics (8). hZNT8 WT is also an
important autoantigen in adult onset T1DM patients who lack other autoantigens, and the
R325W polymorphism removes one auto antigenic epitope of hZNT8 (9). Finally, ZnT8 null
mice have a mild phenotype with a slight change in granule morphology and a slight decrease in
glucose tolerance (10), suggesting redundancy in the mechanisms for providing Zn2+ required for insulin packaging (11).
An animal model of type 2 diabetes is the high fat diet (HFD). Feeding mice a diet from
6 16 weeks of age in which 60% of their calories derive from fat induces hyperglycemia,
hyperinsulinemia, and glucose intolerance to intraperitoneal glucose tolerance testing (IPGTT) in
a manner similar to type 2 diabetics (12). We propose that Zn2+ is transported into the golgi and endoplasmic reticulum of β cells for secretory granule incorporation by Zn2+ transporters 5 and 8.
Knockout of ZnT5 decreases free secretory Zn2+ (3), whereas knockout of ZnT8 decreases both free and some insulin bound Zn2+ inducing a mild reduction in insulin secretion (10). During
chronic inflammation induced by obesity and T2DM, secretory Zn2+ homeostasis is disrupted, Page 5 of 41 Diabetes
leading to Zn2+ mediated potentiation of β cell death, or improper processing and packaging of
insulin. We generated hZnT8 WT and hZnT8 R325W beta cell specific transgenic mouse lines,
2+ and characterized them for expression levels, pancreatic [Zn ]i and zinc binding proteins
(ZBP’s), insulin and proinsulin levels, and IPGTT after 10 weeks of a HFD. We tested the
hypothesis that excess pancreatic Zn2+ induced by overexpression of hZnT8 WT in mice would
be detrimental in a model of T2DM, whereas overexpression of hZnT8 R325W in mice would be
beneficial. Diabetes Page 6 of 41
Materials and Methods
Generation of human ZnT8 transgenic Mice, Breeding, and Genotyping. Transgenic rather than knock in mice were undertaken because overexpression was deemed necessary because of the short duration of the experimental plan. pIns 1 plasmid (13) containing the human insulin promoter (1.9 kB) fused to the rabbit β globin intron (same construct used in (14)), was the
expression construct. Human pZnT8WT-EGFP and pZnT8RW-EGFP constructs (15) were used as templates for PCR reactions using the ZnT8 cloning primers (Supplemental Table 1) to introduce appropriate restriction enzyme sites for cloning.
Zn2+ Transporter Gene Expression. Total RNA from harvested mouse pancreas was extracted with 0.5M guanidinium isothiocyanate. For details of the method see (16) and Supplemental
Materials.
Animal Trials and High Fat Diet. All studies were conducted according to the Institutional
Animal Care and Use Committee (LSUHSC, New Orleans), the PHS Guide for the Care and Use
of Laboratory Animals, USDA Regulations, and the AVMA Panel on Euthanasia.
At 6 weeks of age, the animals were randomly divided into 8 groups containing 6 mice in
each group such that researchers were blinded to genotype and diet. Groups 1 and 2 were hZnT8
WT-X40 Tg and Tg+, each fed with normal diet (2019, Harlan) (3), groups 3 and 4 were hZnT8
WT-X40 Tg and Tg+ fed with 60% high fat diet (Harlan TD.06414, Supplemental Table 2), and groups 5 and 6 and groups 7 and 8 were the same but with hZnT8 R325W-T12 transgenic mice. Additional groups of hZnT8 WT-X28, hZnT8 R325W-T8, and hZnT8 R325W-T16 lines
were similarly performed. At 16 weeks of age, IPGTT was performed, and plasma, serum and Page 7 of 41 Diabetes
pancreas were collected for further investigation. In addition, C57/Bl6 mice were fed with
normal diet (ND), High Fat Diet (HFD), and High Fat Diet Zn2+ Deficient (HFDD, 60/Fat, 1 mg
Zn2+/kg diet EWS) (Harlan TD.10872, Supplemental Table 2) plus 1, 60, or 260 mg Zn2+/kg diet
using ZnSO4 drinking water from 6 16 weeks, IPGTT performed, and tissues collected.
Glucose Tolerance Test and insulin measurements. Glucose tolerance was assessed by IPGTT at
16 weeks of age. Mice were fasted for 5 6h, weighed, and D glucose (1.5 mg glucose/g body
weight) was injected intraperitoneally. Glucose in saphenous vein blood was measured at 0, 15,
30, 45, 60, and 120 minutes using a blood glucose monitoring system (One Touch, glucose
oxidase). Insulin was measured in duplicate from plasma using enzyme linked immunosorbent
assays (EMD Millipore, Darmstadt, Germany).
Insulin/proinsulin immunohistochemistry and Zn2+ staining with Zp1. Mice were anesthetized,
plasma and serum were generated, and they were killed 24h after IPGTT. Fresh frozen pancreata
were sectioned and sequentially stained for zinc (5 M Zinpyr 1), and anti insulin, or anti
proinsulin as previously described (3). Islet images were captured at identical exposures using a
Nikon TS 100, and SIS software. The adjacent slide was fixed in 2% paraformaldehyde/2%
glutaraldehyde and developed using a monoclonal antibody to proinsulin (G3 9A8, DSHB, U
Iowa; 1:200), and goat anti mouse Cy3. Islet fluorescence intensity was measured by NIH
software Image J fromsix to eight slides per animal, and 6 animals per group. Identical threshold
intensities were calculated and integrated by area, and compared between each experimental
group.
Diabetes Page 8 of 41
Zinc-agarose chromatography. A 50 mg piece of pancreas from each of 3 animals fed a HFD of
each group (hZnT8WT X40, hZnT8RW T12, and C57/Bl6/J control) were rapidly homogenized
into 2 mls of lysis buffer (50 mM Tris (pH=7.5), 125 mM NaCl, 5% glycerol, 0.4% IGEPAL
CA 630, 10 µM MgCl2, 1mM PMSF and fresh 1x protease inhibitor without EDTA), and cleared. The supernatant was dialyzed in lysis buffer, cleared (Input), and incubated for 2 hrs with 200 µL of high affinity Zn2+ agarose beads (Lambda Biotech, Saint Louis, MO) at 4 °C.
The slurry was poured into a mini column and the unbound (FT) fraction collected. The column
was washed with lysis buffer, eluted (Eluate) with 3 x 400 µL 500 mM imidazole in lysis buffer;
the beads were boiled in SDS buffer, each fraction was collected, and aliquots saved.
PEI/SDS-PAGE. The input, FT, and eluate proteins from C57/Bl6/J controls were precipitated, and 50 ug of each fraction labeled with Cy5, Cy3, and Cy2 respectively, for Figure 5. Eluates from ZnT8 WT and ZnT8 RW were labeled with Cy2 and Cy3, and the FT from ZnT8 WT was labeled with Cy5 for Figure 6 (17). Samples were first run on isoelectric focusing gel strips (pH
3 10 non linear, 24 cm, GE Healthcare, Piscataway, NJ); equilibrated, and run in the second dimension on 10% SDS PAGE gels. These 2 D gels were scanned using a Typhoon 9400
Variable Mode Imager, and spot detection and quantification performed using DeCyder differential analysis software DIA, Version 5.0 (GE Healthcare, Piscataway, NJ, USA). Spots with at least 5 fold greater abundance in the elution than the FT, and with sufficient Sypro protein staining (~20 50ng) were excised and trypsin digested using the automated Spot
Handling Workstation from GE Healthcare.
Liquid chromatography-mass spectrometry (LC-MS). The trypsin digested peptides were resuspended in 0.1% formic acid/2% acetonitrile, loaded into a Dionex PepMap C18 trap Page 9 of 41 Diabetes
column, and separated by a New Objective reversed phase C18 Picofrit column/emitter (Woburn,
NJ). 0.1% formic acid aqueous solution and 0.1% formic acid in acetonitrile were used as Buffer
A and Buffer B, respectively. The gradient elution at 250 nL/min starts at 5%, to 25% buffer B in
20 minutes, to 60% buffer B in 10 minutes, to 80% buffer B in 15 minutes plus 10 minutes. A
blank run was inserted between sample runs to reduce cross contamination. All spectra were
acquired on a Thermo Fisher LTQ XL linear ion trap mass spectrometer (Waltham, MA)
coupling with an Eksigent nanoLC 2D (Dublin, CA).
Statistical Analysis. Values are the mean ± SEM. Differences in RT PCR, ZnT8 levels, and
blood glucose were analyzed by one way analysis of variance between transgenic positive and
negative animals followed by a Bonferroni test, with P ≤0.05 defined as statistically significant.
For determination of significance of the stained pancreatic sections, we used the
Statistical Analysis Software program to analyze the data by applying the Three Way ANOVA
test to determine the effect of three nominal predictor variables on a continuous outcome
variable. Here the three predictor variables are strain (ZnT8R325W vs ZnT8WT), treatment
(HFD vs ND), and transgene (Tg+ Vs Tg ). The continuous variable is raw integrated density of
the insulin, Zp1, or proinsulin stained pancreatic sections (n=36), with P ≤0.05 defined as
statistically significant. Diabetes Page 10 of 41
Results
RT-PCR was performed on each of the hZnT8 WT and hZnT8 RW transgenic mouse lines.
Nine hZnT8 WT and nine hZnT8 RW transgenic mouse lines were generated, and total pancreatic
RNA was isolated from each, reverse transcribed, and 25 cycles of PCR performed to determine
relative ZnT8 RNA expression between lines (top panel, Supplemental Figure. 1). GAPDH
expression was used as an internal control (bottom panel, Supplemental Fig. 1). Several high
and low expressing lines were determined.
Mice expressed the hZnT8 transgene predominantly in the pancreas. ZnT8 WT 549+ (X 40), and
ZnT8 R325W 8038+ (T 12) were chosen as the high expressing lines for further study, and were backcrossed to C57/Bl6/J for 10 generations. Pancreas, thymus, brain, and liver from these lines
were collected and RNA made. RT PCR was performed using 25 cycles, and the products run
on agarose gels as shown in Supplemental Figure 2. The expression was highest in pancreas,
with thymus and brain expressing much lower levels, and no detectable expression in liver as
expected for the insulin promoter (18).
qRT-PCR was performed on lines chosen for high or low expression. Real time quantitative
PCR was performed using GAPDH as an internal control, and the quantitation is presented in
Supplemental Table 3 for hZnT8, mZIP4, and mZnT8. Lines X 40, and T 12 were chosen for
further study of high expressing lines for ZnT8 WT and ZnT8 RW, respectively. ZnT8 RW lines
T 16, and T 8 were chosen for low expressing lines, and ZnT8 WT X 28 line was an intermediate
expressor. The expression of mZIP4 was reduced in the X40 pancreas, and increased in the T 12 pancreas, whereas mZnT8 was unaffected (Supplemental Table 3). mZIP4 was studied because it
is preferentially expressed in the pancreas, and varies inversely with zinc levels (G. Andrews, Page 11 of 41 Diabetes
personal communication), confirming the ZP1 staining results in these transgenic lines. Protein
levels of hZnT8 could not be determined because the commercially available antibody did not
recognize protein in a Western blot (data not shown). Low levels of an appropriately sized
pancreatic protein were present in a high resolution 5 20% gradient SDS PAGE gel from
transgenic positive mice, and were not present in transgenic negative mice (data not shown).
Zn2+, proinsulin, and insulin staining were determined for each of the chosen lines on a HFD or
a normal diet. Groups of male mice (n=6 for each transgenic line) were exposed to a HFD, or a
ND from 6 16 weeks of age. Zinpyr 1 (ZP1) staining was performed to determine the levels of
pancreatic, stainable Zn2+. Insulin and proinsulin immunohistochemistry were performed on
adjacent sections after post fixation. hZnT8 RW had significantly decreased Zn2+ and proinsulin
staining and increased insulin staining compared to transgenic negative littermates. hZnT8 WT
had significantly increased Zn2+ and proinsulin staining and decreased insulin staining compared
to transgenic negative littermates (Figures 1 and 2 for HFD and Supplemental Figures 3 and
4 for ND). The threshold integrated density of the staining intensity from all of the
photomicrographs was determined and is summarized in Table 1. There was a significant
difference in Zn2+, insulin, or proinsulin levels in hZnT8 RW fed a HFD compared to those fed a
ND. In hZnT8 WT, there was a significant difference in Zn2+ and insulin levels but not in
proinsulin levels dependent on dietary fat. There was a significant difference in Zn2+, insulin, and
proinsulin levels between hZnT8 RW and hZnT8 WT transgenic positive lines and negative
littermates fed a HFD. There was a significant difference in Zn2+ and insulin, but not in
proinsulin staining between the RW and WT lines fed a ND.
Diabetes Page 12 of 41
Glucose tolerance in male ZnT8 WT, ZnT8RW, and transgenic negative littermates after a HFD
or a ND. IPGTT was performed at 16 weeks of age, and the summarized data is presented in
Figure 3. There was a significant decrease in glucose tolerance for the ZnT8 WT line, X 40, in both ND and HFD conditions compared to negative littermates. Conversely, there was a
significant increase in glucose tolerance for the ZnT8 RW line, T 12, only in HFD conditions.
Low expressing ZnT8 RW lines had no effect on glucose tolerance. An alternate ZnT8 WT line
with slightly lower expression levels (X 28) had a less significant decrease in glucose tolerance
(data not shown).
Plasma insulin levels. Insulin levels were measured (in ng/ml) at 0 min and 30 min (fasting), and
24hrs (fed) after IPGTT. ND control mice had 0.19 ± 0.02*, 0.39 ± 0.05*, and 2.1 ± 0.31*
respectively. HFD control mice had 1.1 ± 0.26, 2.58 ± 0.31, and 6.2 ± 0.55 respectively. HFD
ZnT8 WT mice had 1.02 ± 0.21, 1.7 ± 0.22*, and 5.5 ± 0.5 respectively. HFD ZnT8 RW mice
had 1.15 ± 0.28, 3.25 ± 0.42*, and 6.75 ± 0.61, respectively. HFDD + 260 ppm zinc had 1.0 ±
0.19, 1.65 ± 0.20*, and 5.45 ± 0.48, respectively. * indicates a significant difference from insulin
levels in HFD control mice at the same time point at P<0.05 (n=6).
Increasing Zn2+ through diet decreases glucose tolerance. C57/Bl6/J male mice (same genetic background as ZnT8 transgenic negative mice) were exposed to a HFD, a HFD reduced Zn2+ diet (2 mg Zn2+/kg diet), a HFD normal Zn2+ diet (61 mg Zn2+/kg diet), and to a HFD excess
Zn2+ diet (261 mg Zn2+/kg diet) from 6 16 weeks and compared to normal diet for IPGTT. There was a trend towards an increase in glucose tolerance for the HFD reduced Zn2+ compared to the
HFD normal Zn2+, with a single time point achieving significance. Conversely, there was a
significant decrease in glucose tolerance for the HFD excess Zn2+ compared to the HFD normal Page 13 of 41 Diabetes
Zn2+ (Figure 4). This decreased glucose tolerance for the HFD excess Zn2+ diet was
accompanied by a significant decrease in insulin levels and staining and an increase in zinc
staining (3) and proinsulin staining (data not shown and above).
Pancreatic Zn2+ binding proteins are secretory, mitochondrial and energy metabolic proteins
and some of their levels are modulated by pancreatic zinc concentrations. Pancreatic extracts
from control mice on HFD were analyzed for ZBP’s using zinc agarose affinity chromatography
and proteomics, and proteins were identified (Figure 5 and Table 2). Only soluble proteins
between 10 150 kD with intermediate zinc affinity can be identified using this method.
Carboxypeptidase A1 (CpA1) and α amylase bind Zn2+ showing that the technique is working.
Additional proteins identified play roles in mitochondrial and cellular energy metabolism
(succinyl CoA: 3 ketoacid CoA transferase (SCOT), methyl malonate semialdehyde
dehydrogenase (MMSDH), nucleoside diphosphate kinase A & B (NDPKA&B), and alpha
aminoadipic semialdehyde dehydrogenase). ZBP’s from pancreatic extracts of ZnT8WT versus
ZnT8RW were analyzed by proteomics. Of these identified pancreatic ZBP’s, NDPKB was
significantly increased (>5 fold) in the pancreas of ZnT8 WT (high zinc) transgenic mice as was
actin. CpA1 was significantly increased in the pancreas of ZnT8 RW (low zinc) transgenic mice
(Figure 6).
Discussion
We have generated and characterized transgenic mouse lines that overexpress hZnT8 WT
and hZnT8 RW under the control of the insulin promoter for: 1) expression at the RNA level; 2)
expression at the protein level; 3) organ specific expression; 4) stainable Zn2+ levels; 5) insulin Diabetes Page 14 of 41
and proinsulin levels; 6) IPGTT after ND or HFD; 7) the effects of dietary Zn2+ on HFD induced
glucose intolerance in C57/Bl6 mice; and 8) ZBP’s and their differential expression.
Overexpression of the hZnT8 WT gene increases pancreatic Zn2+ and proinsulin levels, and decreases insulin and glucose tolerance. Conversely, overexpression of the hZnT8 RW gene decreases pancreatic Zn2+ and proinsulin levels, and increases insulin and glucose tolerance.
Altering dietary Zn2+ has similar effects on glucose tolerance after a HFD. We identified pancreatic ZBP’s and show that CpA1 is induced by low zinc, and NDPKB is induced by
increased zinc.
There are two superfamilies of mammalian Zn2+ transporters (19; 20) and members from each family function in β cells. Solute carrier 39A (Slc39A) family members, named ZIPs, import Zn2+ into cells, and solute carrier 30A (Slc30a) family members, named ZnTs, function in
Zn2+ efflux and transport into vesicular compartments (20). These transport proteins function as multimers (21). ZnT3 knockout mice don’t load Zn2+ in synaptic vesicles and therefore are resistant to neuronal injury after light damage, global ischemia or hypoglycemia (in submission, and (22; 23)). The lethal milk mouse has a mutation in the ZnT4 gene causing toxic Zn2+
deficient milk (24). Deletion of ZnT5 results in poor growth, osteopenia, low body fat, muscle
weakness, and male specific cardiac death (25). ZNT5 functions as a heterodimer putting Zn2+ into the general secretory pathway. ZNT8 is β cell specific and overexpression of ZNT8 in INS
1E cells increases cellular Zn2+ content, increases sensitivity to Zn2+ toxicity, and enhances basal
glucose stimulated insulin secretion (26). Thus, ZNT8 functions to sequester Zn2+ into the secretory granules of β cells analogous to ZNT3 in presynaptic secretory granules in the brain.
ZNT8 may also function in heterodimers with ZNT’s 5, 6, and 7 to put Zn2+ into the secretory granules of β cells during their formation in the golgi. Page 15 of 41 Diabetes
A common single nucleotide polymorphism in ZnT8, which changes R325 to W, is
associated with a reduced risk for type 2 diabetes (5; 6). This non conservative substitution of a
charged basic amino acid for a hydrophobic polar amino acid occurs at the predicted transporter
dimer interface in an important modulatory region (10). The R325W protein causes reduced
Zn2+ staining when overexpressed in β cells suggesting that it acts as a dominant negative,
dimerizing with itself or other ZnTs and reducing their transport function. A knockout of ZnT8
demonstrates a small reduction in glucose tolerance, and a change in secretory granule
morphology (10; 27). These results suggest a functional redundancy in secretory Zn2+
transporters, and this redundancy is supported by the recently described importance of ZNT3 for
insulin secretion (28), and ZNT5 in models of type 1 diabetes (3).
ZnT8 null mice (global or β cell) have a substantial reduction in Zn2+, but little effect on
glucose tolerance and no effect on insulin (10; 27). However in β cell ZnT8 KO’s, proinsulin
levels are increased while proinsulin transcription, and its transcription factors (pdx1, mafA) and
processing enzyme RNA’s (proconvertases 1/3 and 2, carboxypeptidase E) are decreased (27).
We suspect that as with T1DM, too little or too much Zn2+ are detrimental for T2DM, with a
partial Zn2+ reduction being optimal (3). ZnT8 global or β cell knockouts reduce Zn2+ most,
followed by ZnT8 RW overexpression (dominant negative) and ZnT8 knockdown which have
modestly reduced Zn2+ levels, versus ZnT8 WT overexpression which has high Zn2+ levels.
Varying the pancreatic ZnT8 WT/Zn2+ levels affect insulin staining and may be mediated in part
by effects of Zn2+ to inhibit processing of proinsulin to insulin as demonstrated by proinsulin and
insulin IHC.
Elevated proinsulin levels are associated with increased risk of T2DM in humans (8), and
homozygous carriers of the ZnT8 WT risk allele had elevated proinsulin/insulin ratios in humans Diabetes Page 16 of 41
(7). Overexpression of ZnT8 WT in transgenic mice results in an increase in Zn2+ and proinsulin staining and a decrease in insulin staining and glucose tolerance. hZNT8 RW significantly reduces pancreatic Zn2+ and proinsulin levels, and increases insulin and glucose tolerance
(Figures 3 and 4, and Table 2) which differentiates this mechanism from others that effect insulin
sensitivity. We hypothesize that hZNT8 RW forms hypoactive heterodimers with mZNT8, or perhaps with mZNT5, mZNT6, or mZNT7, which are all expressed in the ER and golgi.
Generally, a HFD demonstrated more substantial variations in Zn2+, insulin or proinsulin
stainings compared to a ND, suggesting an interaction between zinc levels and the effects of
high fat. Reducing Zn2+ in the diet is less effective than the RW transgenic mouse models to
increase glucose tolerance. However, increasing Zn2+ in the diet is at least as effective as the hZNT8 WT transgenic mouse model to decrease glucose tolerance after HFD (Figure 4).
Our data show that the levels of proinsulin and insulin are inversely modulated by Zn2+,
suggesting the conversion of proinsulin to insulin is inhibited by Zn2+. The processing enzymes
which convert proinsulin to insulin (proconvertases 1/2, 3, and carboxypeptidase E) have been
shown to be Ca2+ dependent (29), and therefore Zn2+ levels could affect proinsulin processing by
competition with Ca2+. Alternatively, proinsulin transcription could be Zn2+ modulated, but this
should cause covariance of proinsulin and insulin. Proinsulin processing enzyme transcription
could be Zn2+ modulated, and cytoplasmic/nuclear Zn2+ activates various kinase cascades impinging on transcription (30 32). Also the insulin degrading enzyme proteinase III requires
Zn2+ for activity (33), and membrane associated insulin degrading activity is activated by Zn2+
(34). We postulate that ZNT8 RW mediates a moderate reduction in pancreatic golgi Zn2+ levels,
reducing competition for required Ca2+ binding sites on proinsulin processing enzymes, and
inducing less Zn2+ dependent insulin degradation, thereby decreasing proinsulin levels, and
increasing insulin levels and glucose tolerance. Page 17 of 41 Diabetes
To understand this process, we identified pancreatic Zn2+ binding proteins. The role of α
amylase as a ZBP is interesting because it is a major pancreatic protein that requires Zn2+ for
activity, may be secreted in the apo form from α cells, and load with Zn2+ that is released from
β cells (35). This would provide a cross talk/signaling mechanism between α and β cells, and
suggests a mechanism for excessive Zn2+ excretion in T1 and T2DM (36). Isolating α amylase
and CpA1 provides confidence that the technique is working, and inclusion of excess zinc
prevented purification of these ZBP’s (data not shown). Several of the ZBP’s identified were
energy metabolic enzymes, and/or mitochondrial proteins, confirming a role of energy
metabolism in diabetes. Glutathione S transferase Mu is one of the ZBP’s identified in the
control pancreas. Another ZBP identified was MMSDH which is mitochondrial in origin and
displays diabetes and enalapril sensitive tyrosine nitration (37). By catalysing the CoA and
NADP+ dependent oxidative decarboxylation of malonate semialdehyde to acetyl CoA,
MMSDH provides a non glycolytic means for producing acetyl CoA. Alpha amino adipic
semialdehyde dehydrogenase is involved in the metabolism of lysine. Succinyl CoA: 3 ketoacid
CoA transferase is a mitochondrial enzyme that catalyzes the reversible transfer of coenzyme A
from acetoacetyl CoA to succinate to form acetoacetate and succinyl CoA, a reaction in the
gluconeogenesis pathway. Physiologically its enzymatic activity is involved in maintaining the
blood glucose level (38).
CpA1 is a soluble zinc dependent enzyme synthesized in the pancreas and secreted into
the gastrointestinal tract where its activity is modulated by dietary zinc (39). CpA1 is a known
Zn2+ metallopeptidase and belongs to a family of enzymes which process proinsulin. CpA1 is
differentially increased in low pancreatic Zn2+ (ZnT8 RW), supporting our hypothesis that in the
HFD model of T2DM, reduced pancreatic Zn2+ could be beneficial by inducing proinsulin
maturation by CpA1 processing of enzymes involved. Diabetes Page 18 of 41
NDPKB is critically involved in the diabetic process, by modulating its isoenzyme activities and those of AMPK. NDPKA has been shown to be phosphorylated and inactivated by
AMPK and to also modulate AMPK function (40). AMPK is the major checkpoint for energy metabolism inducing ATP synthetic proteins and reducing pathways which consume ATP, and is critically involved in the diabetic process (reviewed in (41)). NDPKB is differentially increased in high pancreatic zinc conditions (Figure 6). NDPKB also has many functions related to cellular proliferation of immune cells (42 44).
These results show that pancreatic Zn2+ and proinsulin levels covary, but are inversely variant with insulin and glucose tolerance in the HFD model of T2DM. We identified pancreatic
ZBP’s and determined those differentially affected by zinc concentrations as therapeutic targets.
We also suggest that ZNT8 RW acts in a dominant negative manner to reduce pancreatic Zn2+ levels, and that proinsulin and insulin processing are likely involved in the beneficial effects of this polymorphism, which we will test in future studies. Page 19 of 41 Diabetes
Acknowledgements
C.T.S. is the guarantor of this manuscript and had primary responsibility for research
design and conduct, writing, and final content; S.B. performed some of the Zn2+, insulin, and
proinsulin stainings, and analyzed data; L.L. performed most of the Zn2+ and insulin stainings,
and IPGTT measurements and analyzed data. Each author reviewed and approved the final
manuscript. We would like to thank Ai Li Cai, and Chunxiao Shi of Washington University for
expert technical help in generating the DNA constructs, and in animal breeding and care. We
would like to thank Nirmala Tumarada of LSUHSC for expert technical assistance with the
imaging and statistical analyses. This publication was supported by DK 073446 (CTS), and
NCRR: 5P20 RR018766/ NIGMS: 8P20 GM103514 (CTS and proteomics core), and by NIH
P60 DK20579 to the DRTC at Washington University of which CTS is a member and which
subsidized the generation of the transgenic mice. Author disclosure: C.T. Sheline, S. Bai, and L.
Li have no conflicts of interest.
Diabetes Page 20 of 41
Table 1. Quantitation of thresholded integrated density of proinsulin, insulin, and Zn2+
staining in RW and WT transgenic positive and negative mice fed HFD or ND 1
ZP1 Insulin Proinsulin
RW HFD Tg+ 458±83 a1,c1,d1 479±52.6 a2,c2,d2 199±20 a3,c3
RW HFD Tg 782±87 343±30.6 284±78
RW ND Tg+ 804±120 b1 121.4±18 b2 116±8.9 b3
RW ND Tg 620±116 50.9±9.6 240±35
WT HFD Tg+ 828±138 e1, f1 48.1±9.6 e2, f2 204±21.3 e3
WT HFD Tg 466±57 80.5±9.2 137±16.4
WT ND Tg+ 301±56 31.2±6.4 205±8.5
WT ND Tg 646±78 31.2±11 206±33
1 Values are the average x 104 ± SEM in relative fluorescence units of thresholded integrated density from 3 4 independent experiments (n=15 25). a1,a2,a3 indicate a significant difference between ZnT8RW Tg+ and Tg mice fed a HFD in pancreatic ZP1, insulin, and proinsulin staining, respectively. b1,b2,b3 indicate a significant difference between ZnT8RW and ZnT8WT Tg+ mice fed a ND in pancreatic ZP1, insulin, and proinsulin staining, respectively. c1,c2,c3 indicate a significant difference between ZnT8RW Tg+ mice fed a HFD versus a ND in pancreatic ZP1, insulin, and proinsulin staining, respectively. d1,d2,d3 indicate a significant difference between ZnT8RW and ZnT8WT Tg+ mice fed a HFD in pancreatic ZP1, insulin, and proinsulin staining, respectively. e1,e2,e3 indicate a significant difference between ZnT8WT Tg+ and Tg mice fed a HFD in pancreatic ZP1, insulin, and proinsulin staining, respectively. f1,f2 indicate a significant difference between ZnT8WT Tg+ and Tg mice fed a ND in pancreatic ZP1, and insulin staining, respectively.
Page 21 of 41 Diabetes
Table 2. Identification of the control pancreatic ZBP’s.
Protein Name Score 1 # of peptide MW 2 matches 1. Alpha amylase 656 29 58.1 kD
2. Nucleoside diphosphate kinase A 431 21 17.3 kD
3. Nucleoside diphosphate kinase B 419 25 17.5 kD
4. Methylmalonate semialdehyde 328 8 58.3 kD dehydrogenase 5. Carboxypeptidase A1 182 6 47.5 kD
6. Glutathione S transferase Mu 1 175 7 26.1 kD
7. Eukaryotic translation initiation factor 5A 1 126 7 17.0 kD
8. Alpha aminoadipic semialdehyde dehydrogenase 96 1 59.3 kD 9. Succinyl CoA:3 ketoacid coenzyme A transferase 1 87 3 56.4 kD
1 A score > 70 gives > 95% confidence that protein was present in the picked protein spot
from the 2D gel. The score was based upon the number of peptides identified for the
given protein, and the intensity of that peptide.
2 Calculated size in kD from the protein sequence was given as molecular weight (MW). Diabetes Page 22 of 41
FIGURE LEGENDS
FIGURE 1. Zn2+, proinsulin, and insulin staining of hZnT8 RW male mice (line T 12) after a
high fat diet (HFD) from 6 16 weeks of age. Pancreatic sections (10 microns) from three
different 16 week old HFD fed hZnT8 T 12 transgenic (+) mice (Top Panel), and three different
HFD fed transgenic ( ) mice (Bottom Panel) were stained with anti insulin (exposure time
500ms), anti proinsulin (exposure time 100 ms), and Zp1 (exposure time 200ms) at
magnification x 100. Scale bar represents 400 microns.
FIGURE 2. Zn2+, proinsulin, and insulin staining of hZnT8 WT male mice (line X 40) after a
HFD from 6 16 weeks of age. Pancreatic sections from three different 16 week old HFD fed hZnT8 X 40 transgenic (+) mice (Top Panel), and three different HFD fed transgenic ( ) mice
(Bottom Panel) were stained with anti insulin (exposure time 500ms), anti proinsulin (exposure time 100 ms), and Zp1 (exposure time 200ms) at magnification x 100. Scale bar represents 400 microns.
FIGURE 3. Intraperitoneal glucose tolerance in ZnT8 RW T 12 (A) and ZnT8 WT X 40 (B) transgenic positive and negative mice fed either a HFD or a ND from 6 16 weeks of age. Six to ten mice per group were tested for glucose tolerance at 16 weeks (1.5 mg glucose/g body weight) and blood glucose was measured at the indicated times after injection. * indicates a significant difference from transgenic negative animals on the same diet at P < 0.05
Page 23 of 41 Diabetes
FIGURE 4. Intraperitoneal glucose tolerance in C57/Bl6 mice fed a HFD, ND, or HFDD/2,
HFDD/61, or HFDD/261 mg Zn2+/kg diet from 6 16 weeks of age. Six to ten mice per group
were tested for glucose tolerance at 16 weeks (1.5 mg glucose/g body weight) and blood glucose
was measured at the indicated times after injection. * indicates a significant difference from
HFDD/61 mg Zn2+/kg diet at P < 0.05
FIGURE 5. 2D gels of ZBP’s from control pancreas. Fifty g of the input, flow through, and
eluate from Zn2+ agarose columns of pancreatic extracts from control animals was precipitated,
labeled with Cy5, Cy3, and Cy2 respectively, and loaded onto PEI tube gels before running on
SDS PAGE gels in the second dimension. The left panel shows the Cy2 labeled eluate proteins.
The right panel shows the Cy3 labeled proteins from the flow through fraction. Protein spots 5
fold enriched in eluate and containing sufficient mass were picked (faint colored circles) and
identified using LC MS (Table 1).
FIGURE 6. 2D PEI/SDS PAGE gels of the zinc agarose eluates of high zinc (hZnT8WT)
pancreas, versus low zinc (hZnT8RW) pancreas. Fifty µg of the high zinc E1, high zinc FT, and
low zinc E1 fractions were processed. Protein spots 5 fold enriched in an eluate and containing
sufficient mass were picked and identified using LC MS. Blue circles were increased in low
zinc, and the red circle was increased in high zinc conditions. The right panel shows the three
circled spots at high magnification, and with histograms.
Diabetes Page 24 of 41
Literature Cited
1. Kim BJ, Kim YH, Kim S, Kim JW, Koh JY, Oh SH, Lee MK, Kim KW, Lee MS: Zinc as a paracrine effector in pancreatic islet cell death. Diabetes 49:367 372., 2000 2. Priel T, Aricha Tamir B, Sekler I: Clioquinol attenuates zinc dependent beta cell death and the onset of insulitis and hyperglycemia associated with experimental type I diabetes in mice. Eur J Pharmacol 565:232 239, 2007 3. Sheline CT, Shi C, Takata T, Zhu J, Zhang W, Sheline PJ, Cai AL, Li L: Dietary Zinc Reduction, Pyruvate Supplementation, or Zinc Transporter 5 Knockout Attenuates beta Cell Death in Nonobese Diabetic Mice, Islets, and Insulinoma Cells. J Nutr 142:2119 2127, 2012 4. Taylor CG: Zinc, the pancreas, and diabetes: insights from rodent studies and future directions. Biometals 18:305 312, 2005 5. Sladek R, Rocheleau G, Rung J, Dina C, Shen L, Serre D, Boutin P, Vincent D, Belisle A, Hadjadj S, Balkau B, Heude B, Charpentier G, Hudson TJ, Montpetit A, Pshezhetsky AV, Prentki M, Posner BI, Balding DJ, Meyre D, Polychronakos C, Froguel P: A genome wide association study identifies novel risk loci for type 2 diabetes. Nature 445:881 885, 2007 6. Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, Erdos MR, Stringham HM, Chines PS, Jackson AU, Prokunina Olsson L, Ding CJ, Swift AJ, Narisu N, Hu T, Pruim R, Xiao R, Li XY, Conneely KN, Riebow NL, Sprau AG, Tong M, White PP, Hetrick KN, Barnhart MW, Bark CW, Goldstein JL, Watkins L, Xiang F, Saramies J, Buchanan TA, Watanabe RM, Valle TT, Kinnunen L, Abecasis GR, Pugh EW, Doheny KF, Bergman RN, Tuomilehto J, Collins FS, Boehnke M: A genome wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316:1341 1345, 2007 7. Majithia AR, Jablonski KA, McAteer JB, Mather KJ, Goldberg RB, Kahn SE, Florez JC, Group DPPR: Association of the SLC30A8 missense polymorphism R325W with proinsulin levels at baseline and after lifestyle, metformin or troglitazone intervention in the Diabetes Prevention Program. Diabetologia 54:2570 2574, 2011 8. Wareham NJ, Byrne CD, Williams R, Day NE, Hales CN: Fasting proinsulin concentrations predict the development of type 2 diabetes. Diabetes Care 22:262 270, 1999 9. Wenzlau JM, Moua O, Liu Y, Eisenbarth GS, Hutton JC, Davidson HW: Identification of a major humoral epitope in Slc30A8 (ZnT8). Ann N Y Acad Sci 1150:252 255, 2008 10. Nicolson TJ, Bellomo EA, Wijesekara N, Loder MK, Baldwin JM, Gyulkhandanyan AV, Koshkin V, Tarasov AI, Carzaniga R, Kronenberger K, Taneja TK, da Silva Xavier G, Libert S, Froguel P, Scharfmann R, Stetsyuk V, Ravassard P, Parker H, Gribble FM, Reimann F, Sladek R, Hughes SJ, Johnson PR, Masseboeuf M, Burcelin R, Baldwin SA, Liu M, Lara Lemus R, Arvan P, Schuit FC, Wheeler MB, Chimienti F, Rutter GA: Insulin storage and glucose homeostasis in mice null for the granule zinc transporter ZnT8 and studies of the type 2 diabetes associated variants. Diabetes 58:2070 2083, 2009 11. Huang XF, Arvan P: Intracellular transport of proinsulin in pancreatic beta cells. Structural maturation probed by disulfide accessibility. J Biol Chem 270:20417 20423., 1995 12. Chung J, Nguyen AK, Henstridge DC, Holmes AG, Chan MH, Mesa JL, Lancaster GI, Southgate RJ, Bruce CR, Duffy SJ, Horvath I, Mestril R, Watt MJ, Hooper PL, Kingwell BA, Vigh L, Hevener A, Febbraio MA: HSP72 protects against obesity induced insulin resistance. Proc Natl Acad Sci U S A 105:1739 1744, 2008 13. Miyazaki J, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Oka Y, Yamamura K: Establishment of a pancreatic beta cell line that retains glucose inducible insulin secretion: Page 25 of 41 Diabetes
special reference to expression of glucose transporter isoforms. Endocrinology 127:126 132, 1990 14. Moynihan KA, Grimm AA, Plueger MM, Bernal Mizrachi E, Ford E, Cras Meneur C, Permutt MA, Imai S: Increased dosage of mammalian Sir2 in pancreatic beta cells enhances glucose stimulated insulin secretion in mice. Cell Metab 2:105 117, 2005 15. Chimienti F, Devergnas S, Favier A, Seve M: Identification and cloning of a beta cell specific zinc transporter, ZnT 8, localized into insulin secretory granules. Diabetes 53:2330 2337, 2004 16. Han JH, Stratowa C, Rutter WJ: Isolation of full length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning. Biochemistry 26:1617 1625, 1987 17. Alban A, David SO, Bjorkesten L, Andersson C, Sloge E, Lewis S, Currie I: A novel experimental design for comparative two dimensional gel analysis: two dimensional difference gel electrophoresis incorporating a pooled internal standard. Proteomics 3:36 44, 2003 18. Kojima H, Fujimiya M, Terashima T, Kimura H, Chan L: Extrapancreatic proinsulin/insulin expressing cells in diabetes mellitus: is history repeating itself? Endocr J 53:715 722, 2006 19. Taylor KM, Nicholson RI: The LZT proteins; the LIV 1 subfamily of zinc transporters. Biochim Biophys Acta 1611:16 30, 2003 20. Palmiter RD, Huang L: Efflux and compartmentalization of zinc by members of the SLC30 family of solute carriers. Pflugers Arch 447:744 751, 2004 21. Suzuki T, Ishihara K, Migaki H, Nagao M, Yamaguchi Iwai Y, Kambe T: Two different zinc transport complexes of cation diffusion facilitator proteins localized in the secretory pathway operate to activate alkaline phosphatases in vertebrate cells. J Biol Chem 280:30956 30962, 2005 22. Bai S, Sheline CR, Zhou Y, Sheline CT: A reduced zinc diet or zinc transporter 3 knockout attenuate light induced zinc accumulation and retinal degeneration. Exp Eye Res 108:59 67, 2013 23. Suh SW, Hamby AM, Gum ET, Shin BS, Won SJ, Sheline CT, Chan PH, Swanson RA: Sequential release of nitric oxide, zinc, and superoxide in hypoglycemic neuronal death. J Cereb Blood Flow Metab 28:1697 1706, 2008 24. Huang L, Gitschier J: A novel gene involved in zinc transport is deficient in the lethal milk mouse. Nat Genet 17:292 297, 1997 25. Inoue K, Matsuda K, Itoh M, Kawaguchi H, Tomoike H, Aoyagi T, Nagai R, Hori M, Nakamura Y, Tanaka T: Osteopenia and male specific sudden cardiac death in mice lacking a zinc transporter gene, Znt5. Hum Mol Genet 11:1775 1784., 2002 26. Chimienti F, Devergnas S, Pattou F, Schuit F, Garcia Cuenca R, Vandewalle B, Kerr Conte J, Van Lommel L, Grunwald D, Favier A, Seve M: In vivo expression and functional characterization of the zinc transporter ZnT8 in glucose induced insulin secretion. J Cell Sci 119:4199 4206, 2006 27. Wijesekara N, Dai FF, Hardy AB, Giglou PR, Bhattacharjee A, Koshkin V, Chimienti F, Gaisano HY, Rutter GA, Wheeler MB: Beta cell specific Znt8 deletion in mice causes marked defects in insulin processing, crystallisation and secretion. Diabetologia 53:1656 1668, 2010 28. Smidt K, Jessen N, Petersen AB, Larsen A, Magnusson N, Jeppesen JB, Stoltenberg M, Culvenor JG, Tsatsanis A, Brock B, Schmitz O, Wogensen L, Bush AI, Rungby J: SLC30A3 Diabetes Page 26 of 41
responds to glucose and zinc variations in beta cells and is critical for insulin production and in vivo glucose metabolism during beta cell stress. PLoS One 4:e5684, 2009 29. Davidson HW, Rhodes CJ, Hutton JC: Intraorganellar calcium and pH control proinsulin cleavage in the pancreatic beta cell via two distinct site specific endopeptidases. Nature 333:93 96, 1988 30. Park JA, Koh JY: Induction of an immediate early gene egr 1 by zinc through extracellular signal regulated kinase activation in cortical culture: its role in zinc induced neuronal death. J Neurochem 73:450 456, 1999 31. Kim S, Jung Y, Kim D, Koh H, Chung J: Extracellular zinc activates p70 S6 kinase through the phosphatidylinositol 3 kinase signaling pathway. J Biol Chem 275:25979 25984, 2000 32. Manzerra P, Behrens MM, Canzoniero LM, Wang XQ, Heidinger V, Ichinose T, Yu SP, Choi DW: Zinc induces a Src family kinase mediated up regulation of NMDA receptor activity and excitotoxicity. Proc Natl Acad Sci U S A 98:11055 11061., 2001 33. Becker AB, Roth RA: Identification of glutamate 169 as the third zinc binding residue in proteinase III, a member of the family of insulin degrading enzymes. Biochem J 292 ( Pt 1):137 142, 1993 34. Bellomo G, Nicotera PL, Travaglino F, Palma Martino A, Mirabelli F, Fratino P: Insulin degradation in human erythrocyte: effects of cations. Acta Diabetol Lat 22:63 69, 1985 35. Lu J, Combs GF, Jr.: Effect of excess dietary zinc on pancreatic exocrine function in the chick. J Nutr 118:681 689, 1988 36. Chausmer AB: Zinc, insulin and diabetes. J Am Coll Nutr 17:109 115, 1998 37. Ishii N, Carmines PK, Yokoba M, Imaizumi H, Ichikawa T, Ikenagasa H, Kodera Y, Oh Ishi M, Aoki Y, Maeda T, Takenaka T, Katagiri M: Angiotensin converting enzyme inhibition curbs tyrosine nitration of mitochondrial proteins in the renal cortex during the early stage of diabetes mellitus in rats. Clin Sci (Lond) 124:543 552, 2013 38. Berry GT, Fukao T, Mitchell GA, Mazur A, Ciafre M, Gibson J, Kondo N, Palmieri MJ: Neonatal hypoglycaemia in severe succinyl CoA: 3 oxoacid CoA transferase deficiency. J Inherit Metab Dis 24:587 595, 2001 39. Fernandez D, Boix E, Pallares I, Aviles FX, Vendrell J: Structural and Functional Analysis of the Complex between Citrate and the Zinc Peptidase Carboxypeptidase A. Enzyme Res 2011:128676 40. Crawford RM, Treharne KJ, Arnaud Dabernat S, Daniel JY, Foretz M, Viollet B, Mehta A: Understanding the molecular basis of the interaction between NDPK A and AMPK alpha 1. In Mol Cell Biol United States, 2006, p. 5921 5931 41. Rutter GA, Leclerc I: The AMP regulated kinase family: enigmatic targets for diabetes therapy. In Mol Cell Endocrinol Ireland, 2009, p. 41 49 42. Di L, Srivastava S, Zhdanova O, Sun Y, Li Z, Skolnik EY: Nucleoside diphosphate kinase B knock out mice have impaired activation of the K+ channel KCa3.1, resulting in defective T cell activation. J Biol Chem 285:38765 38771, 2010 43. Srivastava S, Zhdanova O, Di L, Li Z, Albaqumi M, Wulff H, Skolnik EY: Protein histidine phosphatase 1 negatively regulates CD4 T cells by inhibiting the K+ channel KCa3.1. Proc Natl Acad Sci U S A 105:14442 14446, 2008 44. Postel EH, Wohlman I, Zou X, Juan T, Sun N, D'Agostin D, Cuellar M, Choi T, Notterman DA, La Perle KM: Targeted deletion of Nm23/nucleoside diphosphate kinase A and B reveals their requirement for definitive erythropoiesis in the mouse embryo. Dev Dyn 238:775 787, 2009 Page 27 of 41 Diabetes
Proinsulin Insulin Zp1 Diabetes Page 28 of 41
Proinsulin Insulin Zp1 Page 29 of 41 Diabetes
A 8 7
6 * * * 5
4 * 3 Tg(-)-ND Glucose Level (g/L) 2 Tg(+)-ND Tg(-)-HFD 1 Tg(+)-HFD 0 0 15 30 45 60 120 Time (min) B 8
7 * * * 6 * 5 * 4
3 Tg(-)-ND
Glucose Level (g/L) Tg(+)-ND 2 Tg(-)-HFD 1 Tg(+)-HFD
0 0 15 30 45 60 120 Time (min) Diabetes Page 30 of 41
8
7 ** * * 6
5 * 4 ND 3 HFD HFDD/2 mg/kg diet Blood Glucose (g/L) Glucose Blood 2 HFDD/61 mg Zn/kg diet 1 HFDD/261 mg Zn/kg diet
0 0 15 30 45 60 120 Time (min) Page 31 of 41 Diabetes
Eluate Flowthrough Diabetes Page 32 of 41
A B
High Low Zinc Zinc
NDPKB
High Pancreatic Zinc
Actin CpA1
Low Pancreatic Zinc Page 33 of 41 Diabetes
Generation of human ZnT8 transgenic Mice, Breeding, and Genotyping. pIns 1 plasmid (26) containing the
human insulin promoter (1.9 kB) fused to the rabbit β globin intron (same construct used in 27), was used as
the expression construct. Human pZnT8WT-EGFP and pZnT8RW-EGFP constructs (28) were used as
templates for PCR reactions using the ZnT8 cloning primers whose sequence is given in Supplemental Table
1. These primers generated new EcoRI sites to allow cloning, and removed the EGFP fusion protein. The
PCR products were inserted into the EcoRI site in the pIns 1 plasmid and verified by sequencing, and
expression was tested in MIN6 cells. Constructs were linearized, gel purified, and injected into CBA X B6
blastocysts by the Washington University Transgenic Core Facility. These mice were bred with C57BL/6J to
syngeneity (Jackson Lab, Bar Harbor, ME). hZnT8 genotype of mouse lines was performed on tail DNA by
PCR amplification using the T8hum RTF and RTR human specific primers (Supplemental Table 1). The hZnT8
and mZnT8 primers were chosen to cover regions of sequence divergence to differentiate the human and
mouse genes.
Zn2+ Transporter Gene Expression. Total RNA from harvested mouse pancreas was extracted with 0.5M
guanidinium isothiocyanate. For details of the method see (29). The RNA concentration was measured, and
RNA integrity was verified by electrophoresis in a 1% agarose gel. Reverse transcription (RT) was performed
using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA) and 1 g total pancreatic RNA in 20 L.
Real time RT PCR specific primers for human ZnT8 R325W (RW) and ZnT8 wildtype (WT) were the same as
above (T8hum RTF and RTR). Mouse GAPDH, ZIP4, and ZnT8 forward and reverse primers were also used
(Supplemental Table 1)
The reactions used iQSYBR green Supermix (BioRad) and 1 L of the RT reaction with a final
concentration of 100 nmol/L of the primer. The PCR cycle for ZnT8 was as follows: 95°C 5 min, 40 cycles of
95°C/30 s, 62°C/30 s, and 72°C/ 30 s. The PCR cycle for mZIP4 was as described (30). The melt curve was
65°C to 95°C in increments of 0.5°C every 5 s to demonstrate a single PCR product, and the correct size
product was verified by agarose gel electrophoresis. The melt curve analyses were performed using an iCycler
iQ Multicolor Real Time PCR Detection System (BioRad). Samples were compared using the relative CT (The
cycle number at the threshold level of log based fluorescence) method. The fold increase or decrease
(=Power) was determined relative to a transgenic negative control after normalizing to the GAPDH Diabetes Page 34 of 41
housekeeping gene using the 2 ∆∆CT(Livak) method, where ∆CT is (gene of interest CT) (GAPDH CT) and
∆∆CT is (∆CT ZnT8RW+ or ZnT8WT+) (∆CT ZnT8RW or ZnT8WT ).
SUPPLEMENTAL FIGURE 1. Expression levels of hZnT8 WT and RW transgenic mouse lines. Human ZnT8
mRNA expression for WT and R325W animal lines (upper panel) was assessed by RT PCR performed on
mouse pancreas RNA. Mouse GAPDH was used as an internal control (lower panel). The negative control (
CT) was performed without RNA, and the positive control (+CT) was performed using 1 ng of ZnT8-GFP
plasmid DNA. The names of the different animal lines are given below.
SUPPLEMENTAL FIGURE 2. RT PCR of tissues from ZnT8 WT and RW transgenic mouse lines. To
demonstrate the relative levels of expression of the transgene in different tissues, the pancreas (P), thymus
(T), brain (B), and liver (L) were isolated, RNA extracted, and RT PCR performed. The upper panel shows the
ZnT8 expression in each sample, whereas the lower panel shows the GAPDH loading control expression in each sample. The first lane is DNA size markers, and the last lane in the upper panel is the positive control for
ZnT8 (1 ng of ZnT8-GFP plasmid DNA).
SUPPLEMENTAL FIGURE 3. Zn2+, proinsulin, and insulin staining of hZnT8 RW male mice (line T 12) after a normal diet (ND). Pancreatic sections from three different 16 week old hZnT8 T 12 transgenic (+) mice fed ND
(Top Panel), and three different transgenic ( ) mice fed ND (Bottom Panel) were stained with anti insulin
(exposure time 500ms), anti proinsulin (exposure time 100 ms), and Zp1 (exposure time 200ms) at
magnification x 100. Scale bar represents 400 microns.
SUPPLEMENTAL FIGURE 4. Zn2+, proinsulin, and insulin staining of hZnT8 WT male mice (line X 40) after a
ND. Pancreatic sections from three different 16 week old hZnT8 X 40 transgenic (+) mice fed ND (Top Panel) , and three different transgenic ( ) mice fed ND (Bottom Panel) were stained with anti insulin (exposure time
500ms), anti proinsulin (exposure time 100 ms), and Zp1 (exposure time 200ms) at magnification x 100. Scale bar represents 400 microns.
Page 35 of 41 Diabetes
Online Supplemental Material
SUPPLEMENTAL TABLE 1. Primer sequences used in this manuscript.
1 hZnT8CloningF: 5’ CCCCGGATCCCGAATTCATGGAGTTTCTTGAA 3’
1 hZnT8CloningR: 5’ CCCCGAATTCCGGATCCGTCACAGGGGTCTTC 3’
2 hZnT8 RTF: 5’ CTCCTGGGCAACGTGCTGGTTGTTGTGCTG 3’
2 hZnT8 RTR: 5’ TGGTCTCTCTCTGGGACACTGATCTTTATT 3’ (190bp).
3 mZnT8 RTF: 5’ CAAGCCACCAAGATGTACGCCTTCCCTCTA 3’
3 mZnT8 RTR: 5’ TCGGTGCCCTGCTGTCTGTCCTTTGCATCT 3’ (415bp)
3 mGAPDH RTF: 5’ GGTGAAGGTCGGTGTGAACG 3’
3 mGAPDH RTR: 5’ CTCGCTCCTGGAAGATGGTG 3’ (230 bp).
3 mZIP4 long RTF: 5′ AGAAGTCAGCACCTCTACAAGGAACGC 3’
3 mZIP4 long RTR: 5′ AGTAGCTGGCTCAGACCCAGGGTC 3′ (475bp).
1 Cloning primers were used to generate restriction enzyme sites, and to remove the GFP
portion of the fusion protein construct used as the template for the cDNA PCR reaction.
2 hZnT8 primers were used both for DNA genotyping of the mouse transgenic lines, and for
qRT PCR of pancreatic RNA levels.
3 The other three pairs of primers were used for qRT PCR of the specified pancreatic RNA. The
number given in parentheses is the size of the PCR product in base pairs. Diabetes Page 36 of 41
Online Supporting Material
SUPPLEMENTAL TABLE 2 Content of Harlan Teklad High Fat Diets
Ingredient High Fat Diet (60% of calories) 1 High Fat Diet (60% of calories) 2 (Harlan Teklad TD.06414, g/kg) (Harlan Teklad TD.10872, g/kg) Casein 265.0 NA Egg White Solids, spray-dried NA 266.0 L-Cystine 4.0 NA Dextrose, monohydrate NA 151.5 Maltodextrin 160.0 160.0 Sucrose 90.0 NA Lard 310.0 325.0 Soybean Oil 30.0 NA Corn Oil NA 20.0 Cellulose 65.5 30.0 Mineral Mix, AIN-93G-MX (3) 48.0 NA Mineral Mix, Zn Deficient NA 34.2 (81264) (31) Calcium Phosphate, dibasic 3.4 NA Biotin NA 0.005 Vitamin Mix, AIN-93G-VX (3) 21.0 NA Vitamin Mix, Teklad (40060) (31) NA 13.3 Choline Bitartrate 3.0 NA Chromium Potassium Sulfate, NA 0.027 dodecahydrate Blue Food Color 0.1 NA Ethoxyquin, antioxidant NA 0.004
1 This diet contained 50-60 mg Zn2+/kg of diet.
2 This diet contained 0.8-1.2 mg Zn2+/kg of diet.
NA specifies not added. Page 37 of 41 Diabetes
Supplemental Table 3. Quantitation of RT-PCR of the ZnT8 WT and ZnT8 RW transgenic mouse lines 1
Animal Sample hZnT8 mZIP4 mZnT8
Line ID Power Power Power
X-28-WT 8078+ 1076 ± 137 a NP NP
X-40-WT 549+ 1258 ± 94 a 0.5 ± 0.1 b 0.9 ± 0.2
T-12-RW 8038+ 1643 ± 160 a 1.8 ± 0.2 b 1.1 ± 0.2
T-16-RW 852+ 46 ± 15 NP NP
T-8-RW 8024+ 53 ± 12 NP NP
Negative 615- 1 ± 3 1.0 ± 0.15 1.0 ± 0.17
1 Values are the average ± SEM, from 4 independent experiments, normalized to GAPDH, and compared to
hZnT8 transgenic negative littermates (fold increase above negative control).
a Indicates a significant difference of hZnT8 RNA expression from negative littermates at P < 0.05
b Indicates a significant difference of mZIP4 RNA expression from negative littermates at P < 0.05 Page 38 of 41 of 38 Page ZnT8 190bp 230bp GAPDH –CT +CT Wtins-523wt Wtins-615wt Wtins-619wt Rwins-866+ Rwins-7111+
Wtins-8065+ Wtins-8053+
Diabetes Wtins-331+
Wtins-8078+ Wtins-549+ Rwins-1077/1078-2+ Rwins-8019+ Rwins-852+
Rwins-8024+ Rwins-8038+ Page 39 of 41 Diabetes
Negative ZnT8 ZnT8 WT Control R325W PTBLPTBL PTBL+
ZnT8
GAPDH Diabetes Page 40 of 41
Online Supplemental Material
Proinsulin Insulin Zp1
Supplemental Figure 3. Zn2+, proinsulin, and insulin staining of hZnT8 RW male mice (line 5 after a normal diet /% Pancreatic sections from three different week old hZnT8 5 transgenic mice fed ND (Top 1BOFM and three different transgenic mice fed ND (Bottom 1BOFM were stained with BOUJJOTVMJO(exposure time NT BOUJQSPJOTVMJO (exposure time NT and ;Q (exposure time NT at magnification Y Scale bar represents 400 microns. Page 41 of 41 Diabetes
Online Supplemental Material
Proinsulin Insulin Zp1
Supplemental Figure 4. Zn2+, proinsulin, and insulin staining of hZnT8 WT male mice (line 9 after a ND. Pancreatic sections from three different week old hZnT8 9 transgenic mice fed ND (Top 1BOFM and three different transgenic mice fed ND (Bottom 1BOFM were stained with BOUJJOTVMJO(exposure time NT BOUJQSPJOTVMJO (exposure time NT and ;Q (exposure time NT at magnification Y Scale bar represents 400 microns.