Regulation of the Anti-Inflammatory Properties of MSC Spheroids by Matrix Metalloproteinases

Regulation of the anti-inflammatory properties of MSC spheroids by matrix metalloproteinases

A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy (PhD) in the Faculty of Biology, Medicine and Health

2018

Thomas J Bosworth

School of Medical Sciences

Table of Contents 1. Introduction ...... 16 1.1. Cardiac remodelling after myocardial infarction ...... 16 1.1.1. Inflammatory response after MI ...... 16 1.1.2. MMPs in cardiac remodelling ...... 22 1.2. Anti-inflammatory properties of mesenchymal stromal cells ..... 29 1.2.1. MSCs contribute to innate immunity ...... 29 1.2.2. MSCs contribute to adaptive immunity ...... 33 1.2.3. MSCs improve outcomes after MI through secretion of specific anti-inflammatory cytokines and MMPs ...... 35 1.3. Microenvironment regulation of MSCs for cardiac repair ...... 37 1.3.1. Regulation of cytokine and MMP expression by MSCs...... 37 1.3.2. The ECM as a potent regulator of MSC function ...... 38 1.3.3. Are spheroids a new paradigm in MSC research? ...... 40 1.4. Summary ...... 44 1.5. Hypothesis ...... 46 1.6. Aims...... 46 2. Materials and Methods ...... 48 2.1. Cell culture ...... 48 2.1.1. Adherent cultures ...... 48 2.1.2. Spheroid cultures ...... 49 2.2. MSC characterisation ...... 49 2.2.1. Flow cytometry ...... 49 2.2.2. Osteogenic differentiation ...... 50 2.2.3. Adipogenic differentiation ...... 51 2.2.4. Chondrogenic differentiation ...... 51 2.3. Quantitative reverse transcription polymerase chain reaction ... 52 2.3.1. Isolation of RNA ...... 52 2.3.2. cDNA synthesis ...... 53 2.3.3. qPCR ...... 53 2.4. Western blot ...... 57 2.4.1. Protein isolation ...... 57 2.4.2. SDS-PAGE ...... 58 2.4.3. Western blotting ...... 58 2.4.4. Densitometry ...... 59 2.5. MMP Antibody Array ...... 61 2.6. Immunofluorescence ...... 62

2.6.1. Adherent MSCs ...... 62 2.6.2. Spheroids ...... 63 2.7. MMP activity assay ...... 64 2.8. siRNA knockdown ...... 65 2.9. Cytokine, conditioned medium, and MMP stimulation ...... 66 2.9.1. Cytokine stimulation ...... 66 2.9.2. Conditioned medium stimulation ...... 67 2.9.3. MMP stimulation ...... 67 2.10. Macrophage culture ...... 68 2.10.1. Macrophage polarisation ...... 68 2.11. Zymosan-induced peritonitis ...... 68 2.12. ELISA ...... 69 2.13. In vivo imaging ...... 70 2.14. Statistical analysis ...... 70 3. Spheroid culture conditions are determinants of the MSC spheroid microenvironment ...... 72 3.1. Characterisation of MSCs ...... 73 3.1.1. Surface marker expression by MSCs ...... 73 3.1.2. Differentiation potential of MSCs ...... 74 3.1.3 Summary ...... 80 3.2. MSC spheroids express increased levels of MMPs compared with adherent cultures ...... 80 3.2.1. mRNA expression levels of MMPs ...... 80 3.2.2. Protein expression levels of MMPs ...... 81 3.2.3. Secreted levels of MMPs ...... 82 3.2.3. Summary ...... 83 3.3. MMP expression and extracellular matrix deposition is altered by spheroid culture conditions ...... 85 3.3.1. Spheroid size ...... 85 3.3.2. Spheroid culture time ...... 87 3.3.3. Spheroid formation method ...... 90 3.3.4. Summary ...... 92 3.5. MSC spheroids express increased levels of specific cytokines compared with adherent cultures ...... 93 3.5.1. Gene expression levels of inflammatory cytokines ...... 93 3.5.2. Protein expression levels of cytokines ...... 94 3.6. Summary ...... 96 4. Regulation of the spheroid microenvironment by MMPs 100

4.1. The spheroid microenvironment is regulated by secreted factors ...... 100 4.2. Regulation of MSC inflammatory secretome by selected cytokines ...... 104 4.2.1. Regulation of p65 and STAT-3 signalling ...... 104 4.2.2. Regulation of TSG-6 and COX-2 expression ...... 104 4.2.3. Regulation of MMP-1 and MMP-3 expression ...... 107 4.2.4. Summary ...... 107 4.3. Spheroid derived MMP expression is regulated by IL-1RI and TSG-6 ...... 109 4.3.1. IL-1RI and TSG-6 regulate cytokine expression by MSC spheroids ...... 109 4.3.2. IL-1RI and TSG-6 regulate MMP expression by MSC spheroids ...... 111 4.3.3. IL-1RI and TSG-6 regulate p65 and STAT-3 signalling activation ...... 113 4.3.4. Summary ...... 113 4.4. The inflammatory secretome of MSC spheroids is regulated by MMPs ...... 115 4.4.1. MMP-1 and MMP-9 regulate expression of one another ...... 115 4.4.2. MMP-1 and MMP-9 drive anti-inflammatory TSG-6 and COX-2 expression whereas MMP-9 inhibits TSG-6 expression ...... 118 4.4.3. Knockdown of MMP-1 and MMP-3 alter p65 and STAT-3 signalling pathway activation ...... 120 4.4.4. Summary ...... 120 4.5. Effect of recombinant MMPs on MSC spheroids ...... 122 4.6. Summary ...... 124 5. Optimising conditions for assessing the in vivo anti- inflammatory potential of MSC spheroids ...... 130 5.1. Characterisation of macrophage response to spheroid conditioned medium ...... 130 5.2. Conditioned medium from MMP-1 knockdown spheroids is unable to abrogate the effects of LPS ...... 133 5.3. Optimisation of zymosan-induced peritonitis conditions ...... 135 5.4. Increasing spheroid number decreases the pro-inflammatory response to zymosan in zymosan-induced peritonitis ...... 137 5.5. Optimisation of spheroid imaging for in vivo applications ...... 139 5.6. Summary ...... 141 6. Discussion ...... 145 7. Appendix ...... 154

7.1. Appendix 1: Western Blots of MMP-1, MMP-3, MMP-9 MMP-13, COX-2, TSG-6, IL-6 and IL-8 ...... 154 7.2. Appendix 2: Negative control for immunofluorescence ...... 156 7.3. Appendix 3: Day 1-5 MMP expression pilot ...... 157 7.4. Appendix 4: Optimisation of siRNA concentration ...... 158 7.5. Appendix 5: All lanes of blots from Chapter 4 ...... 159 7.6. Appendix 6: MMP knockdown effects on IL-8, IL-4 and IL-10 .... 160 7.7. Appendix 7: MMP Activity after APMA activation ...... 161 References ...... 162

List of Figures Figure 1.1: Simplified overview of NF-B activation...... 18 Figure 1.2: The inflammatory response after MI ...... 21 Figure 1.3: The role of MMPs after MI ...... 27 Figure 1.4: MSCs modulate the innate immune response...... 32 Figure 1.5: MSCs modulate the adaptive immune response...... 34 Figure 1.6: ECM-integrin signalling...... 39 Figure 1.7: MSC spheroids self-stimulate to become anti- inflammatory...... 42 Figure 1.8. Microarray data of MMP expression ...... 44 Figure 2.1: Example MMP antibody array...... 62 Figure 3.1. Surface marker expression of MSCs...... 74 Figure 3.2. Osteogenic differentiation of MSCs ...... 76 Figure 3.3. Gene expression analysis of adipogenic differentiation ...... 77 Figure 3.4. Immunofluorescence analysis of adipogenic differentiation ...... 78 Figure 3.5. Chondrogenic differentiation of MSCs ...... 79 Figure 3.6. mRNA expression levels of MMPs ...... 81 Figure 3.7. Protein expression levels of MMPs ...... 82 Figure 3.8. Secreted levels of MMPs ...... 84 Figure 3.9. MMP expression changes with spheroid size ...... 86 Figure 3.10. Matrix deposition changes with spheroid size ...... 87 Figure 3.11. MMP expression changes with spheroid culture time ...... 88 Figure 3.12. Matrix deposition changes with spheroid culture time ...... 89 Figure 3.13. MMP expression changes with spheroid formation method ...... 91 Figure 3.14. Matrix deposition changes with spheroid formation method ...... 92 Figure 3.15. Cytokine expression in MSC spheroids ...... 94 Figure 3.16. Cytokine protein expression in MSC spheroids...... 95 Figure 4.1. qRT-PCR expression of MMPs in adherent MSCs stimulated with spheroid CM ...... 102

Figure 4.2. Western blot expression of MMPs in adherent MSCs stimulated with spheroid CM ...... 103 Fig. 4.3. Western blot analysis of p65 and STAT-3 activation in MSCs stimulated with selected recombinant human cytokines . 105 Fig. 4.4. Western blot analysis of p65 and STAT-3 activation in MSCs stimulated with selected recombinant human cytokines . 106 Fig. 4.5. Western blot analysis of MMP-1 and MMP-3 activation in MSCs stimulated with selected recombinant human cytokines . 108 Fig. 4.6. Regulation of cytokine expression by TSG-6 and IL-1RI in MSC spheroids ...... 110 Fig. 4.7. Regulation of MMP expression by TSG-6 and IL-1RI in MSC spheroids ...... 112 Fig. 4.8. Regulation of p65 and STAT-3 activation by TSG-6 and IL-1RI in MSC spheroids ...... 114 Fig. 4.9. Regulation of MMP expression by MMPs in MSC spheroids ...... 117 Fig. 4.10. Regulation of cytokine expression by MMPs in MSC spheroids ...... 119 4.11 Regulation of signalling pathway activation by MMPs in MSC spheroids ...... 121 4.12. Regulation of TSG-6 and COX-2 expression in MSC spheroids by recombinant MMPs ...... 123 Figure 5.1. Macrophages respond to increasing concentrations of spheroid conditioned medium ...... 132 Figure 5.2. Effects of conditioned medium from MMP knockdown spheroids on LPS-stimulated macrophages ...... 134 Figure 5.3. Effects of increasing concentrations of intra-peritoneal injection of zymosan ...... 136 Figure 5.4. Effects of increasing number of spheroids injected in mice ...... 138 Figure 5.5. Optimisation of conditions for in vivo spheroid imaging ...... 140 Figure 6.1. Schematic showing hypothesis of MMP-driven regulation of the anti-inflammatory properties of MSC spheroids ...... 148 Figure 7.1. Western Blots of MMP-1, MMP-3, MMP-9 MMP-13, COX-2, TSG-6, IL-6 and IL-8 ...... 155

Figure 7.2. Negative Control for immunofluorescence ...... 156 Figure 7.3. Day 1-5 MMP expression pilot ...... 157 Figure 7.4. Optimisation of siRNA concentrations ...... 158 Figure 7.5. All lanes of blots from Chapter 4 ...... 159 Figure 7.6. MMP knockdown effects on IL-8, IL-4 and IL-10 ..... 160 Figure 7.7. MMP Activity after APMA activation ...... 161

List of Tables

Table 1.1: Table showing the well characterised ECM substrates for human MMPs...... 23 Table 2.1: Antibodies used for flow cytometry ...... 50 Table 2.2: Primer sequences used for qRT-PCR ...... 54 Table 2.3: Antibodies used for western blotting ...... 60 Table 2.4: Antibodies used for immunofluorescence microscopy64 Table 2.5: siRNAs used for gene knockdowns ...... 66 Table 2.6: Cytokines used for MSC stimulation ...... 67

Abstract

Introduction: Mesenchymal stromal cells (MSCs) reduce inflammation and improve recovery after myocardial infarction in mice and are thus being increasingly investigated for their immunomodulatory capabilities. Importantly, MSC spheroids highly express the anti-inflammatory proteins TSG-6 and COX-2 which polarise pro-inflammatory macrophages to an anti-inflammatory phenotype. Preliminary microarray data from our laboratory have shown that MSC spheroids also upregulate the expression of matrix metalloproteinases (MMPs), enzymes that degrade matrix proteins but may also have a role in regulating inflammation. The aim of this study was to determine how MMPs regulate the expression of TSG-6 and COX-2 and thus the anti-inflammatory properties of MSC spheroids.

Methods: MSCs were cultured as spheroids in the presence or absence of siRNA targeted to specific MMPs. Expression levels of MMPs and inflammatory cytokines were assessed using qRT-PCR and western blot. Conditioned media from knockdown spheroids were tested for their ability to induce anti-inflammatory macrophage polarisation.

Results: Knockdown of MMP-1 or MMP-8 significantly decreased anti- inflammatory TSG-6 and COX-2 protein expression whereas knockdown of MMP-9 significantly increased anti-inflammatory TSG-6 expression in MSC spheroids. Conditioned media from MMP-1 knockdown spheroids, which lack TSG-6 and COX-2, were unable to induce anti-inflammatory macrophage polarisation. In vivo work also showed that intra-peritoneal injection of MSC spheroids reduced the inflammatory reaction of mice to the pro-inflammatory agent zymosan.

Conclusion: MMPs have an important and previously unknown role in regulating the anti-inflammatory properties of MSC spheroids. A deeper understanding of specific MMPs mechanism of action could lead to potential MSC-based anti-inflammatory therapeutics for myocardial infarction.

Declaration

No portion of the work referred to in the thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning.

Copyright Statement i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance Presentation of Theses Policy You are required to submit your thesis electronically Page 11 of 25 with licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=2442 0), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.library.manchester.ac.uk/about/regulations/) and in The University’s policy on Presentation of Theses

List of abbreviations

BCA – Bicinchoninic acid BSA – Bovine serum albumin CCh – Conjunctivochalasis COX – Cyclooxygenase DAMP – Danger associated molecular pattern ECM – Extracellular matrix FAK – Focal adhesion kinase GAPDH – Gylceraldehyde 3-phosphate dehydrogenase HIF – Hypoxia-inducible factor HO – Heamoxygenase IDO – Indoleamine-2,3-dioxygenase IFN – Interferon IL – Interleukin IL-1Ra – Interleukin-1 receptor antagonist ILK – Integrin-linked kinase LPS – Lipopolysaccharide LV – Left ventricular MCP – Monocyte chemoattractant protein MI – Myocardial infarction MLC – Myosin light chain MMP – Matrix metalloproteinase MSC – Mesenchymal stem/stromal cell NF-B – Nuclear factor kappa-light-chain-enhancer of activated B cells NO – Nitric oxide PAR – Protease activated receptor PBS – Phosphate buffered saline PD-L – Programmed death-ligand PDGF – Platelet-derived growth-factor PE – Phycoerythrin PGE2 – Prostaglandin E2 RAGE – Receptor for advanced glycation end products RIPA – Radioimmunoprecipation assay STC – Stanniocalcin TBP – TATA-binding protein TGF – Transforming growth factor TIMP – Tissue inhibitor of metalloproteinase TLR – Toll-like receptor TNF – Tumour necrosis factor TSG-6 – TNF-stimulated gene 6 protein WT – Wild type

Acknowledgements

I would like to thank my supervisors Professor Cay Kielty and Dr. Elizabeth Cartwright for all their support and encouragement.

I would also like to thank my advisor Professor Ann Canfield for her helpful direction and ideas.

I am particularly grateful to Dr. Steve Ball for his training and help during my mini-project and in the first year of my degree. I would also like to thank the other members of the Kielty lab for their guidance and patience.

I would also like to thank the British Heart Foundation for the funding of this project.

Finally, I would like to thank my friends and family for all their support and distractions from the lab during this degree.

Chapter 1: Introduction

1. Introduction

1.1. Cardiac remodelling after myocardial infarction

Cardiovascular injuries are characterised by inflammation and fibrosis and often lead to aberrant remodelling and imperfect recovery of the injured tissue (Frangogiannis 2014). Anti-inflammatory medications are likely to be useful in fighting inflammation after myocardial infarction (MI) as studies have shown that reduction of the inflammatory response after experimental MI decreased the infarct size (Libby et al. 1973; Romson et al. 1983; Yamazaki et al. 1993). However, there is still no treatment that effectively inhibits inflammation and promotes cardiac repair after MI. Therefore, an increased understanding of the molecular mechanisms governing the inflammatory response and cardiac remodelling process after MI is required to develop improved therapeutics.

1.1.1. Inflammatory response after MI

The inflammatory response after MI follows a similar pattern to many diseases involving sterile inflammation (i.e. inflammation in the absence of a pathogen) and thus represents a good model for understanding the inflammatory process. Firstly, tissue injury liberates factors containing danger-associated molecular patterns (DAMPs) that bind to pattern recognition receptors including toll-like receptors (TLRs) and the receptor for advanced glycation end products (RAGE; Bianchi 2007) which are widely expressed in immune and non-immune cells (Feng and Chao 2011; Bernardo and Fibbe 2013). DAMPs released after MI may include bioactive extracellular matrix fragments (termed ‘matrikines’) such as fibronectin fragments, collagen-derived peptides and fibrinogen fragments (Arslan et al. 2011; Iyer et al. 2014; Frangogiannis 2017). Studies are beginning to show that MMPs may be involved in the formation of these extracellular matrix DAMPs (Lindsey et al. 2015; Wells et al 2015). Binding of DAMPs to RAGE and/or TLRs can activate the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-B) pathway (figure 1.1)(Smiley et al. 2001; Bianchi 2007). NF-B activates expression of pro- and

16 anti-inflammatory cytokines, including tumour necrosis factor- (TNF)-α (Shakhov et al. 1990), interleukin (IL)-1β (Hiscott et al. 1993), and IL-10 (Cao et al. 2006). Equally, cell death may cause release of cytoplasmically stored cytokines allowing signalling events to occur (Rock et al. 2010). NF-B activation also upregulates several chemokines that recruit leukoctyes to the myocardium, including IL-8 (Kunsch and Rosen 1993) and monocyte chemoattractant protein (MCP)-1 (Ueda et al. 1994; Ivey et al. 1995; Dewald et al. 2005).

Concurrent with elevated chemokine expression, leukocytes are recruited to the damaged myocardium (Arslan et al. 2011). Neutrophils are the first leukocyte sub-type recruited to the infarcted myocardium. Neutrophils promote further leukocyte infiltration into the myocardium and release ECM-degrading enzymes including matrix metalloproteinases (MMPs) that aid in the clearance of cellular debris (Jordan et al. 1999).

Monocytes are then recruited to the infarcted tissue where they can differentiate into macrophages which may either exacerbate the pro- inflammatory response or initiate an anti-inflammatory response. Macrophages are characteristically classed into two categories. M1- macrophages increase the pro-inflammatory response via release of pro- inflammatory cytokines including IL-1β, IL-12, and TNFα which, amongst other functions, increase cardiomyocyte apoptosis and increase adhesion molecule synthesis to allow leukocyte infiltration to the damaged myocardium (Abbate et al. 2008; Maekawa et al. 2002; Bastos et al. 2002). Conversely, M2- macrophages may promote an anti-inflammatory response via release of IL- 10, transforming growth factor (TGF)-β, and IL-1 receptor antagonist (IL-1Ra) which increase ECM synthesis and prevent pro-inflammatory cytokine expression (Krishnamurthy et al. 2009; Martinez and Gordon 2014). Immediately after MI, pro-inflammatory M1-macrophages which phagocytose necrotic cardiomyocytes and apoptotic neutrophils are believed to predominate (Lambert et al. 2008). Furthermore, if M2 macrophages are not able to develop, chronic inflammation may persist.

DAMP/TLR IL-1/IL-1R TNFα/TNF-RI HMGB1 Heat shock proteins Fibronectin fragments

MyD88 MyD88 TRADD

IRAKs RIP1

TRAF6 TRAF2

TAK1 TAK1 NEMO IKKα

IKKβ

P IκB Degraded NFκB

Cytoplasm Nucleus Inflammatory NFκB cytokines

Figure 1.1: Simplified overview of NF-B activation. DAMPs and IL-1 share a common transduction pathway. Ligand binding recruits the adaptor protein MyD88 to the TLR or IL-1 receptor (IL-1R) complex leading to the downstream phosphorylation and degradation of the IB subunit of the NF-B complex which in turn leads to translocation of NF-B into the nucleus where it can alter target gene expression (Hayden and Ghosh 2008). TNF activates NF-B via distinct adapter proteins (Aggarwal 2000). Figure taken from Bosworth 2014.

As MI-induced inflammation is sterile, few cells of the adaptive immune response, which respond to pathogenic invasion, are found in the infarct (Hofmann et al. 2012). However, dendritic cells, which normally present antigens to lymphocytes and cells of the adaptive immune system, infiltrate the infarcted heart and are involved in the resolution of inflammation (Anzai et al. 2012). One study examined the hearts of individuals who had suffered fatal MI and found increased dendritic cell infiltration compared with individuals who were in fatal accidents (Yilmaz et al. 2010). The dendritic cells often co- localised with T-cells and possibly causing T-cell activation (Yilmaz et al. 2010). Furthermore, CD4+ T-cell deficient mice showed decreased survival in a mouse model of MI (Hofmann et al. 2012). Importantly, subsets of CD4+ T- cells may increase the pro-inflammatory response through release of interferon- (IFN)γ (termed Th1 cells) and induce further M1-macrophage polarisation whereas other CD4+ T-cell subsets may decrease the pro- inflammatory response through release of IL-4 and IL-13 (termed Th2 cells) and induce M2-macrophage polarisation (Biswas and Mantovani 2010). Significantly, the study by Hofmann et al. (2012) showed that global deficiency of all CD4+ T-cells decreased survival after MI, however it is not yet clear how individual CD4+ T-cell subsets alter the inflammatory response after MI. For example, CD4+ Th17 cells, a pro-inflammatory T-cell subtype, have been suggested to reduce fibrosis after MI (Yamashita et al. 2011) whereas CD4+

Treg deficient mice have increased markers of M1-macrophage polarisation after MI which is associated with chronic inflammation and decreased survival (Weirather et al. 2014). Overall, the pro-inflammatory response to MI lays the foundation for recovery by removing apoptotic cardiomyocytes and increasing space for ECM deposition (figure 1.2).

Animal studies have shown that if pro-inflammatory signals are not repressed after MI, chronic inflammation and ventricular dilatation, a precursor to heart failure occurs (Cochain et al. 2012;Seropian et al. 2013). Furthermore, continued expression of the inflammatory chemokine MCP-1 after MI has been associated with increased mortality in humans (de Lemos et al. 2007). Therefore, it is important that the pro-inflammatory response to MI is inhibited. Inhibition of inflammation may begin when macrophages phagocytose 19 apoptotic neutrophils. Phagocytosis of neutrophils by macrophages induces the release of the anti-inflammatory molecules TGF-β and prostaglandin E2

(PGE2) (Frangogiannis 2012; Fadok et al. 1998). In turn, PGE2 has been shown to increase macrophage expression of IL-10 (Strassmann et al. 1994) which can induce M2-macrophage polarisation whereas TGF-β may induce ECM synthesis (Martinez and Gordon 2014). Furthermore, through TGF-β secretion, some M2-macrophages may induce Treg cell responses (Cao et al. 2010) which further increase the anti-inflammatory response by secreting IL- 10. Finally, mesenchymal stem/stromal cells (MSCs) have been shown to release paracrine factors that influence infarct resolution (Iso et al. 2007; Lee et al. 2009). Ultimately, resolution of pro-inflammatory signalling is required for effective cardiac remodelling since microenvironments high in TGF-β are thought to be required for fibroblasts to transdifferentiate into myofibroblasts allowing production and secretion of ECM proteins (Wynn and Ramalingam 2012; Chen and Frangogiannis 2013).

Neutrophil 1 2

M1-macrophage M2-macrophage Pro-inflammatory Anti-inflammatory 4 IFNγ Phagocytosis IL-4 IL-4 IL-10 IFNγ IL-10 IL-13 IFNγ IL-4 GM-CSF 5 IL-10 6 IL-12 IL-13

Th1-cell Th2-cell 7

Treg-cell

Figure 1.2: The inflammatory response after MI 1) Initial tissue damage results in increased adhesion molecule synthesis and degradation of the endothelial barrier. 2) Neutrophils infiltrate the damaged myocardium. 3) IFN released by neutrophils, or DAMPs polarise macrophages towards an M1-phenotype allowing phagocytosis of apoptotic neutrophils and necrotic cardiomyocytes. 4) Phagocytosis of apoptotic neutrophils or exposure to IL-4, IL-10 or IL-13 induces M2-polarisation and resolution of inflammation. 5-7) M1-macrophages may induce Th1 responses whereas M2-macrophages may induce Th2 responses and vice versa. Th1- cells and Th2-cells may interchange if exposed to particular stimuli. 8) Treg- cells can inhibit both Th1 and Th2 responses and promote M2-macrophage polarisation (not shown).

1.1.2. MMPs in cardiac remodelling

MMPs are zinc-dependent proteases that degrade ECM proteins (table 1.1), and are widely expressed after MI due to the high levels of inflammatory cytokines such as IL-1 β, TNFα and oncostatin M present that upregulate MMP expression (Spinale 2007; Iyer et al. 2014). Most MMPs are secreted, however some ‘MT-MMPs’ remain attached to the cell membrane. It is difficult to determine the specific role of individual MMPs after MI due to the multiple ECM substrates each MMP can cleave. However, the expression levels of almost all MMPs studied in relation to MI are altered after an infarct (Herzog et al. 1998; Peterson et al. 2000; Romanic et al. 2001; Lindsey et al. 2006; Ma et al. 2013). Most MMPs increase after MI, but myocyte-derived MMP-28 decreases after MI (Ma et al. 2013). In general, and unsurprisingly, MMPs are involved in the degradation of the myocardial ECM after MI (Zamilpa and Lindsey 2010).

After the removal of specific pro-inflammatory signals cells secrete ECM proteins to provide mechanical support to the heart and initiate repair processes (Chen and Frangogiannis 2013; Dobaczewski et al. 2010). Unfortunately, excessive ECM deposition may cause heart failure due to increased mechanical stiffness being exerted on the heart (Opie et al. 2006). Therefore, the correct balance between ECM deposition and breakdown is required, thus MMP activity plays an important role in cardiac remodelling after MI.

Table 1.1: Table showing the well characterised ECM substrates for human MMPs. Table adapted from (Peng et al. 2012) MMP Subgroup ECM Substrates MMP-1 Collagenase Collagen I, II, III MMP-2 Gelatinase Gelatin, Collagen IV MMP-3 Stromelysin Fibronectin, Laminin MMP-7 Matrilysin Fibronectin, Laminin, MMP-8 Collagenase Collagen I, II, III MMP-9 Gelatinase Gelatin, Collagen IV MMP-10 Stromelysin Fibronectin, Elastin MMP-11 Matrilysin/Stromelysin Fibronectin, Gelatin MMP-12 Elastase Laminin, Elastin MMP-13 Collagenase Collagen I, II, III MMP-14 Membrane-Type Collagen I, Laminin, Fibronectin MMP-15 Membrane-Type Collagen I, Laminin, Fibronectin MMP-16 Membrane-Type Gelatin, Collagen IV MMP-17 Membrane-Type Gelatin, Collagen IV MMP-19 Unclassified Gelatin, Collagen IV, Fibronectin MMP-20 Enamelysin Amelogenins MMP-21 Unclassified Unknown MMP-22 Unclassified Unknown MMP-23 Unclassified Gelatin MMP-24 Membrane-Type Unknown MMP-25 Membrane-Type Unknown MMP-26 Matrilysin Laminin, Fibronectin MMP-27 Unclassified Unknown MMP-28 Unclassified Casein

1.1.2.2. Multifunctional role of MMPs during cardiac remodelling after MI

Upregulation of MMP gene expression and activation of latent MMPs may occur very quickly after MI in pigs (Etoh et al. 2001). As described previously, one of the roles of MMPs after MI is to cleave ECM products such as fibronectin (Yabluchanskiy et al. 2013; Zamilpa et al. 2010). Importantly, some cleaved ECM products may bind to receptors and induce cell signalling events (Iyer et al. 2014). For example, fibronectin fragments may enhance survival of injured cardiomycoytes (Trial et al. 2004); promote fibroblast to myofibroblast transition (Serini et al. 1998); act as DAMPs (Frangogiannis 2017); and upregulate expression of MMPs in T-cells (Esparza et al. 1999). These data therefore present the possibility that aside from clearing the infarct region of ECM and cellular debris, MMPs may indirectly induce signalling events that lead to resolution of the inflammatory response after MI.

MMPs, including MMP-2 and MMP-9, can also cleave and activate growth factors and cytokines including TGF-β and pro-IL-1β (Yu and Stamenkovic 2000; Schönbeck et al. 1998). Interestingly TGF-β and active IL-1β appear to have distinct roles in the inflammatory response after MI. For example, TGF- β can promote collagen and fibronectin synthesis and thus appears to be important for the resolution of inflammation (Yu and Stamenkovic 2000) whereas IL-1β is known to induce pro-inflammatory cytokine expression (Gurantz et al. 2005) and upregulate MMP expression (Iyer et al. 2014). These data provide further evidence that MMPs are not solely responsible for the clearance and/or degradation of ECM components after MI but may be partly responsible for the regulation of cytokine signalling and activation and even ECM deposition.

MMPs also have potent signalling capability themselves. For example, MMP- 1 has been shown to activate the G protein-coupled receptor protease- activated receptor (PAR)1 in breast cancer cells (Boire et al. 2005). Furthermore, activation of PAR1 by MMP-1 in endothelial cells was shown to be vital for endothelial barrier disruption and inhibition of MMP-1-induced

PAR1 activation increased survival in a mouse model of sepsis (Tressel et al. 2011). Importantly, MMP-1 activation of PAR2, a separate protease activated receptor, was shown to increase MCP-1 expression in human lung adenocarcinoma cells (Li and Tai 2014). These data suggest that MMPs, and in particular MMP-1, may be able to increase the pro-inflammatory response after MI by activating PARs and inducing MCP-1 expression thus promoting leukocyte recruitment to the infarct region. Furthermore, activation of PAR1 on endothelial cells by MMP-1 may promote infiltration of recruited leukocytes into the infarct region.

Conversely, some MMPs may act to inhibit pro-inflammatory signals. For example, one study showed that inhibition of MMP-12 after MI worsened cardiac dysfunction by delaying inflammation resolution (Iyer et al. 2015). Furthermore, MMP-2 has been shown to bind and induce TLR2 signalling on dendritic cells resulting in promotion of a Th2 response (Godefroy et al. 2014). Importantly, active MMP-2, heat-inactivated MMP-2, and MMP-2 preincubated with an inhibitor were all shown to induce dendritic cell OX40L expression, a

Th2-inducing ligand (Godefroy et al. 2014). This was shown to be dependent on MMP-2/TLR2 interactions and downstream activation of the NF-κB pathway (Godefroy et al. 2014). Additionally, intravenous injection of MMP-2 induced TNFα, IL-6, and MCP-1 expression in WT mice whereas injection of MMP-2 into TLR-2-/- mice had no effect on cytokine expression (Godefroy et al. 2014). Both MMP-2 and MMP-9 have also been shown to induce signalling events by binding to integrin receptors resulting in increased cell survival (Redondo-Muñoz et al. 2010; Bhoopathi et al. 2008; Kesanakurti et al. 2013). Importantly, these data suggest that while prolonged expression of MMP-1 may be detrimental after MI both MMP-9 and MMP-2 may be beneficial after

MI by inducing a Th2 response thus promoting M2-macrophage polarisation, and by increasing survival of apoptosing cardiomyocytes. However, MMP-9-/- mice have increased survival and improved recovery after MI (Ducharme et al. 2000). This may not be the full story as macrophage MMP-9 overexpression also increased survival and recovery after MI (Zamilpa et al. 2012).

Finally, MMPs play important roles in the polarisation of macrophages (figure 1.3). For example, MMP-28-/- mice have increased mortality after MI compared with WT and this was due to impaired M2-macrophage polarisation in the knockout animals (Ma et al. 2013) although the mechanisms for how MMP-28 contributes to macrophage polarisation were not investigated. Interestingly, although MMP-9 expression increased in wild type (WT) animals after MI, MMP-9 expression did not increase in MMP-28-/- mice suggesting that MMP- 9 may be linked with M2-macrophage polarisation. One study found that MMP- 9 expression is increased after M2-macrophage activation but not M1- macrophage activation (Lolmede et al. 2009). Further studies into the importance of MMPs in macrophage biology may reveal novel mechanisms of M1/M2 macrophage polarisation and enable targeting of particular MMPs to promote or inhibit M1/M2 macrophage polarisation.

Extracellular matrix Ligand bioavailability degradation

Matrix metalloproteinases

Cell signalling Macrophage polarisation

M1-macrophage M2-macrophage

Figure 1.3: The role of MMPs after MI MMPs may cleave ECM proteins including fibronectin allowing immune cell infiltration and matrix-induced signalling. MMPs may also alter signalling by cleaving inactivating pro-domains from ligands. MMPs also cleave and inactivate ligands (not shown). MMPs have been shown to directly activate signalling pathways through PAR and integrin receptors. Finally, MMPs influence the ability of macrophages to polarise although the molecular mechanisms governing this are not understood.

1.1.2.3. Tissue inhibitors of metalloproteinases

Although particular MMPs may have beneficial roles after MI, MMP overactivity can lead to ventricular wall thinning and onset of heart failure (Creemers et al. 2001). To prevent MMP overactivity after MI, several cell types express tissue inhibitors of metalloproteinases (TIMPs). There are currently 4 known human TIMPs that bind to the MMP active site and inhibit their activity. Interestingly, TIMP expression lags behind MMP expression in MI (Peterson et al. 2000; Ramani et al. 2004), presumably to allow MMP-induced clearance of the ECM. TIMPs have also been shown to promote fibroblast to myofibroblast transition and have an important role in the inhibition of pro-TNFα activation (Vanhoutte and Heymans 2010). Therefore, initially after MI, MMPs are free to cleave ECM components and regulate cell signalling activation, however at later timepoints TIMPs inhibit MMP activity and promote resolution of inflammation. It is currently not known whether binding of TIMPs to MMPs alters their ability to directly induce cell signalling events.

1.1.2.4. Summary of inflammatory response after MI

Overall the inflammatory response to MI is complex. Initially, tissue injury causes DAMPs to be liberated or expressed and bind to cell receptors inducing pro-inflammatory signalling. This leads to upregulation of pro-inflammatory cytokines and immune cell recruitment to the damaged tissue. Immune cells themselves secrete pro-inflammatory cytokines and upregulate MMPs. MMPs activate latent cytokines or growth factors, may have direct signalling properties and cleave ECM proteins to produce matrikines. Matrikines in turn can upregulate MMP and cytokine expression but also induce new ECM deposition. Furthermore, MMP-9 appears to act as a propagator of pro- inflammatory signalling by cleaving and activating pro-IL-1 in some niches, but anti-inflammatory by increasing cell survival and participating in M2- macrophage polarisation in other circumstances. Therefore, determining the precise function of specific MMPs in particular niches and understanding how they contribute to the inflammatory microenvironment will allow more specific therapeutic targets for reducing MI-induced inflammation.

1.2. Anti-inflammatory properties of mesenchymal stromal cells

MSCs were initially studied for their ability to differentiate into chondrocytes, osteocytes and adipocytes, however they are now known to have enormous anti-inflammatory potential and can promote resolution of inflammation and improve recovery after MI (Bernardo and Fibbe 2013; Lee et al. 2009). Furthermore, MSCs may also be able to differentiate into a wide range of cell types including cardiomyocytes and astrocytes (Bernardo and Fibbe 2013; Salem and Thiemermann 2010). However, research into MSCs has been stifled due to the inability to distinguish them from other cell types and due to the distinct markers different groups use to define them. Considering this, the International Society for Cellular Therapy published a set of minimal criteria for defining MSCs (Dominici et al. 2006). MSCs must be plastic-adherent; >95% of cells should express CD105, CD73, and CD90 and <2% of cells should express CD45, CD34, CD14 or CD11b, CD79 or CD19, and HLA-DR; finally, cells must be able to differentiate to osteoblasts, adipocytes, and chondroblasts using standard in vitro differentiation conditions (Dominici et al. 2006). However, research is still ongoing to better characterise MSCs and to develop more extensive definitive MSC criteria (Holley et al. 2015; Rohart et al 2016).

1.2.1. MSCs contribute to innate immunity

Human MSCs (hMSCs) express a number of TLRs and are therefore able to respond to DAMPs (Raicevic et al. 2010). One study showed that individual DAMPs may be able to induce a pro- or anti-inflammatory response depending on which TLR they bind (Waterman et al. 2010). This study showed that activation of MSC TLR-4 promoted a pro-inflammatory phenotype, whereas activation of TLR-3 induced an anti-inflammatory phenotype (Waterman et al. 2010). Furthermore, cardiac-resident MSCs have been shown to proliferate in the heart after MI (Carlson et al. 2011). A hypothesis is therefore that cardiac- resident MSCs may be involved in both the initial inflammatory stage and the

29 resolution of inflammation after MI by recognising distinct DAMPs that are present at different time points, however tissue-resident MSCs may have different properties to bone marrow MSCs. Importantly, one study has shown that continued exposure of hMSCs to the TLR-4 ligand lipopolysaccharide (LPS) downregulated the expression of TLR-2 and TLR-4 (Mo et al. 2008). In an MI context, it is possible that MSCs respond to initial tissue damage by recognising pro-inflammatory TLR-4-activating DAMPs and secreting pro- inflammatory cytokines to aid in ECM clearance. Furthermore, after prolonged exposure to the TLR-4 activating DAMPs, cardiac MSCs may downregulate TLR-4 expression and become more sensitive to TLR-3 activating DAMPs that promote resolution of inflammation.

Further evidence that MSCs may be involved in initial inflammatory responses has been provided by studies investigating the effects of hMSCs on neutrophils which are one of the first cell types recruited to inflamed tissues. One study showed that hMSCs promoted neutrophil migration (Brandau et al. 2010; figure 1.4), whereas another study showed that intraperitoneal injection of hMSCs inhibited migration of neutrophils in a mouse model of sepsis (Gozalez-Rey et al. 2009). Other studies have shown that hMSCs increase survival of neutrophils in vitro (Cassatell et al. 2011) possibly by upregulating anti-apoptotic genes and downregulating pro-apoptotic genes (Raffaghello et al. 2008). Furthermore, an in vivo study showed that intravenous injection of murine MSCs (mMSCs) in a mouse model of sepsis enhanced the phagocytic ability of neutrophils (Hall et al. 2013). These studies show that MSCs potently alter neutrophil biology. However, the contradictory studies related to MSC- induced neutrophil migration show that the source of MSCs and/or the in vivo microenvironment may be an important determinant on MSC biology.

Studies have also shown that hMSCs can also influence macrophage biology (figure 1.4). For example, one study showed that co-culture of hMSCs with macrophages resulted in the upregulation of markers for M2 activation in the macrophages (Kim and Hematti 2009). This study showed that MSCs can induce M2 macrophage polarisation by secretion of soluble factor(s) as the two different cell types were separated by a transwell in some experiments 30

(Kim and Hematti 2009). Additionally, another study showed that conditioned media from mMSCs decreased LPS-induced NF-B phosphorylation and increased STAT-3 phosphorylation in macrophages, resulting in increased IL- 10 secretion and M2-polarisation (Gao et al. 2014). Several studies have attempted to define which factor(s) released by MSCs are responsible for polarising macrophages (François et al. 2011; Németh et al. 2008). One study found that indoleamine-2,-3-dioxygenase (IDO) was vital for MSCs to induce M2 macrophage polarisation (François et al. 2011) however it is now believed that this is specific to mMSCs and not relevant for hMSCs. In contrast, another study found that hMSCs mediate M2 macrophage polarisation via cyclooxygenase- (COX)-2-mediated production of prostaglandin E2 (PGE2-) which binds to EP2 and EP4 receptors on macrophages and induces IL-10 secretion (Németh et al. 2008). Other studies have found that MSCs need to be stimulated with pro-inflammatory agents including IFNγ, LPS and poly(I:C), TNFα, and/or IL-1α to become immunosuppressive and increase IDO expression and/or PGE2 secretion, indicating that pro-inflammatory environments induce MSCs to polarise macrophages towards an M2 anti- inflammatory phenotype (Croitoru-Lamoury et al. 2011; Polchert et al. 2008; François et al. 2011). Interestingly, one study found that MSCs from a donor with a gene defective for the IFNγ receptor were able to inhibit proliferation of monocytes in the absence of IDO expression (Gieseke et al. 2007). Instead, insulin-like growth factor binding proteins were found to be important for inhibition of monocyte proliferation in both WT and the MSCs with a gene defective for the IFNγ receptor (Gieseke et al. 2007). However, the study did not look at the ability of the defective MSCs to polarise macrophages.

Finally, MSCs can suppress the activity of natural killer (NK) cells (Spaggiari et al. 2008), mast cells (Brown et al. 2011), and dendritic cells Wang et al. 2018) which have all been shown to contribute to the pro-inflammatory response after MI (Brown et al. 2011; Jiang et al. 2005; Pradier et al. 2011).

Mesenchymal 1 stromal cell 2 Neutrophil IL-8

IFNγ TNFα 3 IL-1 PGE2 IDO M1-macrophage NO M2-macrophage

IL-10

Figure 1.4: MSCs modulate the innate immune response. 1) MSCs (pre-) stimulated with specific cytokines or stimulated by DAMPs can alter the innate immune response by 2) secreting IL-8 and increasing neutrophil chemotaxis, or secreting factors that inhibit neutrophil chemotaxis and 3) releasing immunomodulatory factors including PGE2, IDO, or NO resulting in IL-10 secretion from macrophages and M2-polarisation.

1.2.2. MSCs contribute to adaptive immunity

Although normally thought of as cells that respond to pathogenic growth, cells of the adaptive immune system are also important in sterile inflammation (Yan et al. 2013). Interestingly, and in striking similarity to their macrophage interactions, mMSCs may inhibit growth of CD4+ and CD8+ T-cells through IDO (Meisel et al. 2004) or nitric oxide (NO) production (Sato et al. 2007), whereas hMSCs appear to inhibit T-cell growth via PGE2 (Aggarwal and Pittenger 2005) or HLA-G5 secretion (Selmani et al. 2008; figure 1.5). Notably, MMP-2 and MMP-9 may also be involved in MSC-mediated inhibition of T-cell proliferation by cleaving IL-2 receptor α off the surface of T-cells thus preventing IL-2 dependent proliferation of T-cells (Ding et al. 2009). Many of these studies had to stimulate MSCs with a combination of IFNγ, TNFα, IL-1α, and IL-1β to observe MSC-induced effects on T-cell growth and it is now commonly accepted that MSCs must be stimulated with one of these cytokines to suppress T-cell proliferation and induce M2 macrophage polarisation. Importantly, stimulation of MSCs with these cytokines also upregulates the expression of chemokines that induce T-cell migration (Ren et al. 2008). Therefore, it is possible that T-cells migrate towards MSCs before their growth is suppressed.

Another T-cell thought to be affected by MSCs are the anti-inflammatory Tregs which have been shown to promote M2 macrophage polarisation and inhibit pro-inflammatory cytokine expression (Tang et al. 2012). Separate studies have shown that MSCs can promote CD3+ (Di Ianni et al. 2008) or CD4+

(English et al. 2009) T-cell differentiation towards Tregs. Akiyama et al. (2012) also showed that MSCs were able to induce Treg expansion in vivo in part by promoting apoptosis of other T-cell types and inducing TGF-β release from macrophages in a model of experimental colitis.

Finally, MSCs have also been shown to inhibit proliferation and antibody production in B-cells (Corcione et al. 2006). One study found that MSC- induced secretion of programmed death-ligand (PD-L)1 and/or PD-L2 may be

33 responsible for the inhibition of B-cell proliferation (Augello et al. 2005; figure 1.5).

Mesenchymal stromal cell

PGE2 MMP-2 PD-L1 IL-6 TGF-β MMP-9 PD-L2 NO

+ + Dendritic CD4 /CD8 Treg-cell B-cell cell T-cell

Figure 1.5: MSCs modulate the adaptive immune response. MSCs stimulated with cytokines including IFN, TNF and/or IL-1 may suppress the adaptive immune response by inhibiting proliferation of dendritic cells, CD4+/CD8+ T-cells and B-cells through cell-cell contact and various soluble mediators. MSCs also promote the expansion of Treg-cells that are capable of inhibiting pro-inflammatory responses.

Taken together, these data show that MSCs have potent anti-inflammatory effects and may thus be able to directly affect resolution of inflammation after MI. Several other studies have also suggested that Galectin-1 and semaphorin-3A (Lepelletier et al. 2009); TGF- β (Di Nicola et al. 2002), ephrin- B and EphB (Nguyen et al. 2013), and haemoxygenase (HO)-1 (Chabannes et al. 2007) are important effectors of the immunomodulatory functions of MSCs. As alluded to earlier, it is likely that MSCs may exert their anti- inflammatory effects via different mechanisms in distinct inflammatory microenvironments. Furthermore, source, species and specific donors are also likely to be important determinants in the anti-inflammatory properties of MSCs. Indeed, it is now widely regarded that hMSCs exert their anti- inflammatory effects via different mechanisms compared with mMSCs (Bernardo and Fibbe 2013). Therefore, future studies should attempt to unify culture conditions for MSCs from the same source and species to ensure replicability of results. Furthermore, where possible, in vitro studies should be backed up with in vivo data.

1.2.3. MSCs improve outcomes after MI through secretion of specific anti-inflammatory cytokines and MMPs

1.2.3.1. TSG-6 as an MSC anti-inflammatory effector

Some of the key studies investigating the anti-inflammatory effects of MSCs showed that intravenous injection of hMSCs improved cardiac function after MI in mice (Iso et al. 2007; Lee et al. 2009). It was initially hypothesised that the MSCs may engraft into the heart and differentiate into cardiomyocytes, however these studies showed that MSCs did not engraft in the heart but instead embolised in the lung (Iso et al. 2007; Lee et al. 2009). It was therefore hypothesised that the MSCs secreted anti-inflammatory factors that improved outcome after MI. Indeed, MSCs taken from emboli in the lung were shown to have markedly increased mRNA expression of TNF-stimulated gene 6 protein (TSG-6) (Lee et al. 2009). Thus, the follow up study showed that TSG-6

35 knockdown MSCs injected into mice after MI were no longer able to improve cardiac function (Lee et al. 2009). TSG-6 is upregulated during inflammation in many contexts however it is only constitutively expressed in a few tissues (Day and Milner 2018). The precise mechanisms by which MSC-derived TSG-6 induces anti-inflammatory effects are unknown. However, TSG-6 is known to bind to chemokines, bone morphogenetic proteins (BMPs) and several matrix molecules such as glycosaminoglycans (Day and Milner 2018). One of the most well characterised effects of TSG-6 is the catalysis of the reaction whereby non- sulphated glycosaminoglycans such as hyaluronic acid (HA) are decorated with heavy chain (HC) from the inter-α-inhibitor (IαI) proteoglycan family (Day and Milner 2018). Furthermore, some studies have shown that large HA polymers suppress the inflammatory response (Petrey and de la Motte 2014). Therefore, a potential mechanism that TSG-6 may induce an anti- inflammatory response is by inducing sulphation of HA thus creating larger HA polymers which suppress inflammation.

1.2.3.2. MMPs as MSC anti-inflammatory effectors

Other studies have attempted to define alternative factors that may be important in MSC-induced recovery after MI. For example, Iso et al. (2007) suggested that MMP-2 may be important for the anti-inflammatory effects observed as MMP-2 mRNA was upregulated in MSCs prior to their injection into mice. However, Iso et al. (2007) did not report whether MMP-2 knockdown MSCs were able to improve recovery after MI. Interestingly, a further study also implicated MMP-2 as an anti-inflammatory factor released by MSCs after MI (Mias et al. 2009). In this study rat MSCs were pretreated with melatonin to increase their cardiac retention before being injected intramyocardially into rats 2 weeks after MI (Mias et al. 2009). Cardiac function was improved and fibrosis reduced 2 months after MI compared with controls and this was linked to increased expression of MMP-2 (Mias et al. 2009).

Together these studies show that MSCs have potent anti-inflammatory affects after MI. However, one set of studies used human MSCs injected into

36 immunodeficient mice (Iso et al 2007; Lee et al. 2009) whereas the other study injected rat MSCs into rats (Mias et al. 2009) and thus results may not be directly comparable to what happens when hMSCs are injected into humans. Furthermore, immunodeficient mice lack lymphocytes and other immune cells (Christianson et al. 1997). As discussed previously, these cells alter MI progression (Hofmann et al. 2012) and MSCs can affect the function of these cells. Therefore, future studies could determine whether MSCs alter the progression of MI in immunocompetent mice.

1.3. Microenvironment regulation of MSCs for cardiac repair

1.3.1. Regulation of cytokine and MMP expression by MSCs

The signalling pathways that regulate expression of cytokines in MSCs are not well studied. It is important to delineate these mechanisms so that specific pathways can be activated for the controlled expression of cytokines. However, some studies have hinted that expression of pro- and anti- inflammatory cytokines are regulated via distinct pathways (Waterman et al. 2010). Furthermore, one study showed that stimulation of hMSCs with pro- inflammatory LPS or poly(I:C) induced phosphorylation of STAT-1 and upregulated expression of the immunosuppressive IDO but not other anti- inflammatory molecules such as IL-10 or TGF-β (Opitz et al. 2009). Together these results suggest that different microenvironments will upregulate distinct genes via different signalling mechanisms. Additionally, very little is known about how cell-matrix interactions regulate the response of MSCs to stimulation by inflammatory cytokines.

Additionally, the intracellular signalling pathways that govern MMP expression in MSCs have not been well studied. One study found that MSCs constitutively express MMPs- 2, -3, -10, -11 and -13 and that mechanical loading increased the secretion of MMPs-2, -3 and -13 (Kasper et al. 2007). Alternatively, another study found that hMSCs constitutively express MMP-2 and MMP-14 but little MMP-9 and that TGF-β1 stimulation increases MMP-2 and MMP-14

37 expression whereas TNFα or IL-1β stimulation increases MMP-9 and MMP- 14 expression (Ries et al. 2007). However as with the cytokine studies, these studies show that distinct inflammatory microenvironments upregulate the expression of different MMPs but the intracellular signalling pathways that regulate these changes were not examined. Furthermore, none of these studies investigated or correlated MMP expression with the ability of MSCs to exert an inflammatory effect on immune cells.

1.3.2. The ECM as a potent regulator of MSC function

The ECM is a major component of the cellular microenvironment in vivo and alters from tissue to tissue. Importantly, work in our lab has shown that the ECM molecule fibronectin can activate MSC intracellular signalling pathways through integrin receptors and induce MSC migration (Veevers-Lowe et al. 2011). It is possible that constitutively active MMPs on MSCs may cleave surrounding fibronectin to form fibronectin matrikines that bind to integrins and alter intracellular signalling pathways.

Integrins are heterodimeric transmembrane receptors, each comprising an α- and β-subunit. Specific α/β integrin combinations bind distinct ECM components and may thus be able to act as sensors of the local microenvironment (Humphries et al. 2006). Ligand:integrin interactions have been shown to regulate cell survival, migration and differentiation (figure 1.6). Furthermore, ECM binding to integrins can activate a variety of signalling pathways via SH2-domain adaptor proteins; Src-family kinases; and integrin- linked kinase (ILK) (Harburger and Calderwood 2009). Importantly, integrins are able to induce NF-B nuclear translocation and upregulation of inflammatory cytokines (Antonov et al. 2011) providing a direct link between the ECM microenvironment and the inflammatory phenotype of a cell. As alluded to above, it is possible that MMPs may influence the inflammatory phenotype of a cell by regulating the availability of particular ECM substrate to bind integrins.

β-integrin β-integrin β-integrin β-integrin α-integrin α-integrin α-integrin α-integrin al oc n F sio P he Ad

Talin ILK Differentiation FAK Talin

Src

Growth

MLC

Migration

Figure 1.6: ECM-integrin signalling. Activation of integrins causes a protein complex termed the focal adhesion to form (Humphries et al. 2006). Focal adhesions are closely linked with the actin cytoskeleton and signalling activation can lead to differentiation, migration, or growth (Harburger and Calderwood 2009) via distinct signalling pathways. Figure taken from Bosworth 2014.

Work from our lab has shown that binding of the ECM component fibronectin to integrins is able to induce platelet-derived growth-factor (PDGF) signalling in the absence of PDGF ligand by phosphorylating the PDGF receptor (Veevers-Lowe et al. 2011). Furthermore, other studies have shown that integrins can exhibit crosstalk with the canonical TLR-2 signalling pathway in macrophages resulting in repression of inflammation or with IL-1 induced signalling to increase MMP production in rabbit chondrocytes (Han et al. 2010; Arner and Tortorella 1995). Together these data suggest that integrins may alter the inflammatory phenotype of MSCs by regulating the availability of specific ECM components for integrin interactions and also by regulating the intracellular signalling pathways that govern cytokine expression. However, it has been hard to study these interactions due to the absence of an in vitro model closely mimics ECM:integrin interactions observed in vivo.

1.3.3. Are spheroids a new paradigm in MSC research?

MSCs cultured in monolayer are herein referred to as ‘adherent’ MSCs whereas those cultured as monolayers and then cultured as spheroids are referred to as MSCs cultured in 3D or as spheroids. Recent studies have attempted to culture MSCs in 3D to more closely replicate an in vivo microenvironment. However, different groups have used different methods of 3D culture including culturing MSCs in hydrogels (Fennema et al. 2013). One of the most promising ways to culture MSCs in 3D is to culture them as spheroids. Indeed, MSCs that formed emboli in the lungs of mice after MI were found to have formed spheroid-like structures (Lee et al. 2009) therefore culturing MSCs as spheroids in vitro may closely mimic what happens when they are injected in vivo. Furthermore, further studies showed that hMSCs from adherent cultures injected subcutaneously or intraperitoneally were also found to spontaneously form spheroids and upregulate the expression of anti- inflammatory TSG-6, COX-2 and stanniocalcin (STC)-1, an anti- inflammatory/anti-apoptic protein which may dampen the response of macrophages to DAMPs (Bartosh et al. 2013; Mohammdaipoor et al. 2016) highlighting the importance of culturing MSCs as spheroids in vitro.

Furthermore, correlating with the in vivo study described above, a study examining the in vitro anti-inflammatory properties of hMSC spheroids formed using the hanging-drop method found a significant increase in expression and secretion of TSG-6, STC-1 and COX-2 in spheroids compared to adherent cultures (Bartosh et al. 2010). Furthermore, co-culturing of spheroids with M1- activated macrophages decreased markers of M1 activation such as TNFα and increased markers of anti-inflammatory M2 macrophage activation such as IL-1Ra (Bartosh et al. 2010). A follow-up study found that MSC-derived

PGE2 was essential for murine M2 macrophage polarisation (Ylostalo et al. 2012). A later study showed that MSC spheroids formed using low-cell binding microplates exhibit COX-2 upregulation, the enzyme required for PGE2 production (Peura et al. 2009).

In contrast to adherent MSCs, MSC spheroids did not require stimulation with recombinant cytokines to exert their anti-inflammatory effects, showing that spheroid culture of MSCs is vastly different from culturing MSCs as adherent cells. Unsurprisingly, one study found that the markers of apoptosis increase with culture time in spheroids formed using the hanging drop method (Bartosh et al. 2010). This suggests that release of intracellular cytokine stores from apoptotic cells may induce the expression of anti-inflammatory factors in MSC spheroids. In agreement with this, inhibition of the pro-IL-1β activating enzyme caspase-1 abolished the ability of MSC spheroids to induce M2 macrophage polarisation (Ylostalo et al. 2012). A later study showed that inhibition of IL-1 signalling itself decreased MSC-derived PGE2 synthesis and also abolished the ability of MSC spheroids to induce M2 macrophage polarisation (Bartosh et al. 2013). Together these studies show that IL-1 is critical for the anti- inflammatory effects derived from MSC spheroids (figure 1.7). Importantly, studies have shown that fibroblast spheroids formed using low-cell binding microwells also potently upregulation COX-2 and that knockdown of fibronectin or its integrin receptors abolished fibroblast spheroid-derived COX- 2 expression (Bizik et al. 2003; Salmenperä et al. 2008).

Mesenchymal stromal cell spheroid

IL-1

TSG-6 STC-1

PGE2 MMPs

Figure 1.7: MSC spheroids self-stimulate to become anti-inflammatory. Hanging-drop generated MSC spheroids may contain apoptotic cells that induce secretion of IL-1. IL-1 induces upregulation and secretion of PGE2 from spheroids leading to the potent anti-inflammatory actions of spheroids (Bartosh et al. 2010;Ylostalo et al. 2012;Bartosh et al. 2013). In turn, factors released from MSC spheroids may have autocrine or paracrine effects on the MSC spheroids themselves. Figure adapted from Bosworth 2014. hMSC spheroids were also found to produce their own ECM (Bartosh et al. 2010). More recent studies in our lab examined the importance of the spheroid-derived ECM driving MSC differentiation towards endothelial cell types (Ball et al. 2014). Importantly, MSCs cultured as spheroids upregulated the expression of pluripotency markers Nanog and Oct4A compared with adherent MSCs (Ball et al. 2014). Furthermore, these spheroids also appeared more endothelial with increased secretion of angiogenic factors. This endothelial phenotype was increased further by inhibition of PDGFR or knockdown of fibronectin (Ball et al. 2014). Finally, PDGFR-inhibited spheroids were suspended in matrigel and implanted into mice and were shown to form vessel-like structures that were perfused with FITC-dextran indicating integration into the mouse circulation (Ball et al. 2014). Future work could

42 determine whether spheroid-based approaches are able to induce formation of new coronary vessels after MI.

MSC spheroids formed using low-cell binding microwells also exhibited changes in the expression of inflammatory genes including thrombospondin- 1, IL-8 and MCP-1 (Ball et al. 2014) compared with adherent cultures. Furthermore, fibroblasts cultured as spheroids upregulate the expression of MMPs- 1, -10 and -14 at the mRNA level compared with adherent fibroblast cultures (Sirén et al. 2006). In addition to this, unpublished microarray data from our lab has shown that the expression level of some MMPs is increased in MSC spheroids (figure 1.8) and that knockdown of different ECM components including fibronectin potently alters the mRNA expression of TSG-6 in these spheroids. Together these data are highly indicative that the ECM plays a vital role in the regulation of the inflammatory phenotype of MSC spheroids, and that MMPs in turn play an important role in the regulation of the ECM microenvironment.

Figure 1.8. Microarray data of MMP expression MSCs were cultured as 6x104 cell spheroids or as adherent cultures in 6-well plates. RNA was harvested and a microarray was performed to determine relative expression of MMPs in spheroids compared with adherent cultures. Red denotes upregulation in spheroids.

1.4. Summary

In conclusion, MI-induced injury results in a complicated inflammatory response involving crosstalk between immune cells, cytokines, MMPs, and ECM components in an attempt to remodel the infarct region. Furthermore, without the appropriate stop signals, inflammation can become chronic resulting in decreased life expectancy and the occurrence of secondary heart diseases such as heart failure. MSCs have been extensively investigated for their anti-inflammatory properties and have been shown to promote anti- inflammatory M2-macrophage polarisation and induce anti-inflammatory effects in a number of other immune cell types. Furthermore, MSCs injected intravenously (Iso et al. 2007; Lee et al. 2009) or intramyocardially (Mias et al. 2009) in mouse models of MI aided recovery by forming spheroids and

44 secreting TSG-6 or specific MMPs respectively. However, the signalling pathway mechanisms controlling inflammatory cytokine and MMP secretion by MSCs have not been fully elucidated. Furthermore, the importance of MMPs in controlling the immunomodulatory properties of MSCs has not been investigated.

Unpublished work implicates the ECM, particularly fibronectin, as a potent regulator of the MSC inflammatory phenotype. Importantly, siRNA knockdown of fibronectin from hMSC spheroids resulted in potent downregulation of TSG- 6 mRNA (SG Ball, unpublished data). As MMPs degrade ECM proteins this suggests MMPs may alter the inflammatory microenvironment of MSC spheroids via regulating the availability of particular ECM substrates. Furthermore, more groups are beginning to investigate MSC spheroids, however there have been few studies investigating how culture time, cell number or spheroid culture method affects their biology. Understanding the mechanisms that regulate the inflammatory phenotype of MSC spheroids will allow careful manipulation of spheroids to maximise their potential for anti- inflammatory therapeutics.

1.5. Hypothesis

The hypothesis of this investigation is that specific MMPs contribute to the inflammatory microenvironment of MSC spheroids and that aberrations in MMP expression will alter the ability of MSC spheroids to polarise macrophages towards an anti-inflammatory M2 phenotype.

1.6. Aims

1. To determine how MSC spheroid size and culture time alter MMP expression; 2. To determine how individual MMPs are regulated in MSC spheroids and how MMPs contribute to the inflammatory microenvironment of MSC spheroids; 3. To optimise the conditions for studying the in vivo effects of MSC spheroids formed in low-cell binding microplates.

Chapter 2: Materials and Methods

2. Materials and Methods

2.1. Cell culture

Human MSCs were purchased from Lonza and obtained from the bone marrow of a 21 year old male (lot #6F3502), a 22 year old female (lot #7F3674), and a 33 year old male (lot #6F4085). Cells were stored in liquid nitrogen in Recovery cell culture freezing medium (Gibco). MSCs were maintained on 0.1% gelatin (Sigma-Aldrich) in phosphate-buffered saline (PBS) (Sigma-Aldrich) coated 75cm2 (T75) tissue culture flasks (Corning) with vented lids in a humidified incubator at 37oC and 5% CO2. MSCs were cultured using MesenPro RS media (Gibco) supplemented with 2% L-glutamine (Invitrogen) and 1% penicillin/streptomycin (Sigma-Aldrich) (standard medium). Cells were passaged at 70-75% confluency by rinsing the cells in pre-warmed PBS and incubating the cells with 3ml trypsin-EDTA (Sigma) at 37oC for 1 minute. A further 3ml of 1x trypsin neutralisation solution (Gibco) was used to neutralise the trypsin and cells were harvested by centrifugation at 400g for 4 minutes at room temperature. Cells were then resuspended in the appropriate volume of standard medium and reseeded at a 1:5 dilution. MSCs were used at passage 5 for all experiments.

2.1.1. Adherent cultures

For experiments using adherent MSCs, cells were passaged as above and counted using an automated cell counter (CASY counter, Roche). MSCs were seeded into 0.1% gelatin in PBS-coated wells at 1x105 cells per well of a 6- well plate (100% confluency; approximately 1x104 cells/cm2) or 3x104 cells per well of a 96-well plate and isolated for analysis 5 days later unless otherwise stated.

2.1.2. Spheroid cultures

Spheroids were formed by plating 1x103, 3x104, 6x104, or 1.2x105 MSCs in 200μl of standard media into individual wells of low cell-binding microwell plates (Nunc) unless otherwise stated as previously (Ball et al. 2014). Spheroids formed within 24 hours and were isolated for analysis 1-15 days after the initial seeding stage. Some spheroids were formed using the hanging drop method. Briefly, 6x104 MSCs were suspended in 50μl of standard media which was pipetted onto the lids of 100mm Petri dishes. The lids were placed on to the Petri dish containing 10ml of PBS and incubated at 37oC and 5%

CO2 for 5 days.

2.2. MSC characterisation

MSCs were characterised according to the ISCT minimal criteria (Dominici et al. 2006). Briefly, MSCs were assessed for expression of cell-type specific cell surface antigens using flow cytometry. Additionally, MSCs were differentiated towards adipocyte, osteoblast, and chondroblast lineages using the MSC functional identification kit (R&D Systems). Differentiation was assessed using qRT-PCR (section 2.3) and immunofluorescence (section 2.6).

2.2.1. Flow cytometry

Flow cytometry was performed to determine the percentage of MSCs that expressed specific cell surface antigens. MSCs were trypsinised, resuspended in 7mls of media and allowed to recover at 37oC for 30 minutes. Cells were then washed three times in ice-cold 0.5% BSA (Sigma-Aldrich) (w/v) in PBS and 7.5x104 cells were incubated with primary antibody diluted in 0.5% BSA (w/v) in PBS for 1 hour on ice (table 2.1). After primary incubation, MSCs were washed 3 times in ice-cold 0.5% BSA (w/v) in PBS. Samples incubated with unconjugated primary antibodies were treated with secondary antibody diluted in 0.5% BSA (w/v) in PBS for 45 minutes on ice (table 2.1).

Finally, MSCs treated with secondary antibody were washed three times in ice-cold 0.5% BSA (w/v) in PBS. All samples were analysed on a Beckman Coulter Cyan ADP flow cytometer (Beckman) by the Flow Cytometry Core Facility Service, University of Manchester. Negative controls consisted of cells treated with phycoerythrin (PE)-conjugated isotype control (BD) or secondary antibody alone.

Table 2.1: Antibodies used for flow cytometry. Antibody Manufacturer Species Dilution (catalog #) CD14 BD Biosciences Mouse anti- 1:200 (347490) human CD29 BD Biosciences Mouse anti- 1:200 (555443) human PE- conjugated CD34 Chemicon Int Mouse anti- 1:200 (CBL555) human CD44 BD Biosciences Mouse anti- 1:200 (555479) human PE- conjugated CD45 BD Biosciences Mouse anti- 1:200 (347460) human CD105 R&D Systems Mouse anti- 1:200 (FAB10971P) human PE- conjugated PE-conjugated BD Biosciences - 1:200 Mouse IgG (555743) Alexa-Fluor 488 Life Technologies Donkey anti- 1:200 (A21202) mouse

2.2.2. Osteogenic differentiation

MSCs were seeded into 0.1% gelatin in PBS-coated individual wells of 6-well plates at 4x104 cells per well and 7.4x103 cells per well of 24-well plates. MSCs were cultured until they reached approximately 50% confluency after which osteogenic media comprising osteogenic supplements (R&D Systems) diluted 1:20 in StemXVivo Osteogenic/Adipogenic base media were added to the cultures. Media were replaced every 2 days and cultures were fixed in 4% paraformaldehyde or lysed for qRT-PCR analysis after 28 days of differentiation. Negative controls consisted of MSCs cultured in MesenPro or

Osteogenic/Adipogenic base media without osteogenic supplements for 28 days.

2.2.3. Adipogenic differentiation

MSCs were seeded into 0.1% gelatin in PBS-coated individual wells of 6-well plates at 1.5x105 cells per well and 3.7x104 cells per well of 24-well plates. MSCs were cultured until they reached 100% confluency after which adipogenic media comprising adipogenic supplements (R&D Systems) diluted 1:100 in StemXVivo Osteogenic/Adipogenic base media (R&D Systems) was added to the cultures. Media were replaced every 2 days and cultures were fixed in 4% paraformaldehyde or lysed for qRT-PCR analysis after 21 days of differentiation. Negative controls consisted of MSCs cultured in MesenPro or Osteogenic/Adipogenic base media without adipogenic supplements for 21 days.

2.2.4. Chondrogenic differentiation

MSCs were seeded into individual wells of low-binding culture plates at 5x105 cells per well. MSCs were cultured as pellets for up to 4 days after which chondrogenic media comprising chondrogenic supplements (R&D Systems) diluted 1:100 in DMEM/F12 (Lonza) containing 1% ITS supplements (R&D Systems). Media were replaced every 2 days and spheroids were fixed in 4% paraformaldehyde and 1% Triton X-100 in PBS or lysed for qRT-PCR analysis after 28 days of differentiation. Negative controls consisted of MSCs cultured in MesenPro or DMEM/F12 base media without chondrogenic supplements for 21 days.

2.3. Quantitative reverse transcription polymerase chain reaction qRT-PCR was performed to determine relative gene expression levels.

2.3.1. Isolation of RNA

Cells from adherent cultures were washed twice in ice-cold PBS and lysed in 200μl of BL + TG buffer (Promega). Lysates underwent RNA purification immediately or were stored at -80oC.

Spheroids, of at least 3.6x105 cells, were transferred to microcentrifuge tubes and residual medium was removed. Spheroids were washed in ice-cold PBS and lysed in 200μl TRIzol (Life Technologies). A Microson ultrasonic cell disrupter XL200 equipped with a 3mm microtip set at level 2 (Misonix) was used to dissociate spheroids with 3-4 sets of 2 second pulses. An additional 600μl of TRIzol was added to the dissociated spheroids and lysates underwent RNA purification immediately or were stored at -80oC.

After thawing, 200μl of chloroform was added to spheroid lysates which were then centrifuged at 4oC for 15 minutes at 12,000g. The clear supernatant was removed and stored in a separate microcentrifuge tube and 80μl of 100% isopropanol was added per 250μl of clear supernatant. For cells from adherent cultures, 80μl of 100% isopropanol was added to the lysates and RNA was then purified from both spheroids and adherent cultures using a ReliaPrep RNA cell miniprep kit (Promega) according to the manufacturer’s instructions with an on-column DNase digestion to remove contaminating genomic DNA. Purified RNA was quantified using a Nanodrop 1000 spectrophotometer (Thermo Scientific) and cDNA was synthesised immediately or RNA was stored at -80oC.

2.3.2. cDNA synthesis

After thawing, 100ng RNA was used to synthesise cDNA using a cDNA synthesis kit (Bioline). Briefly, 100ng RNA was prepared on ice with nuclease- free water (Promega) to a volume of 18μl to which 1μl of random hexamer (Bioline) and 1μl of oligo-dT (Bioline) were added. Samples were mixed and incubated at 65oC for 10 minutes and chilled to 4oC. A mastermix consisting of 2μl dNTP, 8μl reaction buffer, 0.5μl RNase inhibitor and 8.5μl of nuclease free water was added to each reaction. Samples were mixed well and incubated at 25oC for 10 minutes, 42oC for 60 minutes, and 70oC for 15 minutes before being chilled to 4oC. Resulting cDNA was diluted in 560μl of nuclease-free water and stored at -20oC.

2.3.3. qPCR

After thawing, 5μl of cDNA was added to 4.5μl GoTaq qPCR Master Mix (Promega), 0.05μl premixed forward and reverse primers each at a concentration of 100 pmol/μl, and 0.5μl nuclease-free water in each well of a 96- or 384-well plate (Bio-Rad). Plates were spun at 18,000g for 20 seconds and a PCR plate sealer was applied. qPCR analysis was performed using a C1000 Touch CFX96 or CFX384 Real Time PCR Detection System (Bio-Rad) using the following cycling conditions: 5 minutes at 95oC, 44 cycles of 10 seconds at 95oC and 30 seconds at 60oC. Melt curves were calculated from 65oC to 95oC reading every 0.5oC. All qRT-PCR results are relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and TATA-binding protein (TBP). These genes were chosen as housekeeper genes as microarray data of MSC spheroids subjected to different treatments suggests their expression remains stable through the different treatment regimes. Primer pairs used are shown in table 2.2. Melt curves were checked for single peaks and negative controls consisting of cDNA treated without reverse transcriptase were checked for absence of contamination.

Table 2.2: Primer sequences used for qRT-PCR. Common alternative names for some genes are shown in brackets beneath the gene symbol. Gene Accession Forward sequence (5’-3’) Reverse sequence (5’-3’) Predicted Product Size Symbol Number (bp) CD274 NM_001267706.1 AGGGCATTCCAGAAAGATGAGG TGTATGGGGCGTTCAGCAAA 77 (PD-L1) FASLG NM_000639.2 ATTGGGCCTGGGGATGTTTC CTGGCTGGTAGACTCTCGGA 73 (Fas ligand) LGALS1 NM_002305.3 CCTGACGCTAAGAGCTTCGT CGTTGAAGCGAGGGTTGAAG 79 (Galectin 1) HGF NM_001010932.1 TCCATGTCAGCGTTGGGATT CTCGTAGGTCCTTGCACTTGA 80 HLA-G NM_002127.5 CGGAATGAAGTTCTCACTCCCA ACTTTAGAACCAGGACCGC 77 HMOX1 NM_002133.2 AGTCAGGCAGAGGGTGATAGA GCAACTCCTCAAAGAGCTGGA 71 (HO-1) IDO1 NM_002164.6 AGGCAACCCCCAGCTATC CCCCCTGCAAACTCCTTT 77 IFNG NM_000619.3 TCGCCAGCAGCTAAAACA GCAGGCAGGACAACCATT 80 (IFNγ) IL1A NM_000575.4 ACCAGGCATCCTCCACAA TGGACCAAAATGCCCTGT 72 IL1B NM_000576.2 CTTCGAGGCACAAGGCACAA TGGCTGCTTCAGACACTTGAG 79 IL1R1 NM_000877.4 GGGGGTGATGATGACCAA TTCCTCCACCCACGCTTA 74 IL1RN NM_173842.2 TGCCACTGCCTCTTCCTC GTGGGAGCCACTTGGTTG 73 (IL-1Ra) IL4 NM_172348.2 CACAGAGCAGAAGAACACAACTG GCGAGTGTCCTTCTCATGGT 94 IL6 NM_000600.5 CCAGGAGCCCAGCTATGA AGGCAACACCAGGAGCAG 85 IL8 NM_000584.4 ACACTGCGCCAACACAGA TTCCTTGGGGTCCAGACA 72 IL10 NM_000572.2 GAACTCCCTGGGGGAGAA CACGGCCTTGCTCTTGTT 85 IL12A NM_000882.3 ATGCCTTCACCACTCCCAAA TAGAGTTTGTCTGGCCTTCTGG 70 IL12B NM_002187.2 GCCCAGAGCAAGATGTGTCA CGAGGGGAGATGCCAGAAAA 73 IL13 NM_002188.2 TGGAATCCCTGATCAACGTGT AAAACTGCCCAGCTGAGACC 99 IL17E NM_022789.3 ATGGACCCCTCAACAGCA GGGAGCCGGTTCAAGTCT 97 (IL-25)

Gene Accession Forward sequence (5’-3’) Reverse sequence (5’-3’) Predicted Product Size Symbol Number (bp) IL33 NM_033439.3 GACTCCTCCGAACACAGAGC AGGCTTCATTTTTCAGTATTCTT 79 GT PDCD1LG2 NM_025239.3 AAGACACAACAAAAAGACCTGTCA AGACCACAGGTTCAGATAGCAC 70 (PD-L2) PTGS1 NM_001271368.1 CCGTGTGTGTGACCTGCT GGCGGGTCGTCTGGAAAA 71 (COX1) PTGS2 NM_000963.4 TGTGGGGCAGGAGGTCTT GTGTTCCCGCAGCCAGAT 74 (COX2) SEMA3A NM_006080.2 CCGAGACCCTTACTGTGCTT CGTCTTGTGCGTCTCTTTGC 74 TGFB1 NM_00660.5 CTTTCGCCTTAGCGCCCA CCGGTAGTGAACCCGTTGAT 78 TNF NM_000594.4 AACTGGGGCCTCCAGAAC ACCAAAGGCTCCCTGGTC 79 TNFAIP6 NM_007115.4 AACCCACACGCAAAGGAG TCATTTGGGAAGCCTGGA 75 (TSG-6) MMP1 NM_001145938.1 CTGGGCTGTTCAGGGACAG AGGGAAGCCAAAGGAGCTG 73 MMP2 NM_001127891.1 GTGCTTACCTAGCACATGCAAT TCAGCACAAACAGGTTGCAG 76 MMP3 NM_002422.5 TGGCGCAAATCCCTCAGG CATATGCGGCATCCACGC 71 MMP7 NM_002423.3 TGGGAACAGGCTCAGGACTAT TGGCTTCTAAACTGTTGGCAT 80 MMP8 NM_002424.3 GGACCAACACCTCCGCAA GTGAGCGAGCCCCAAAGA 94 MMP9 NM_004994.2 CATTCAGGGAGACGCCCATT AACCGAGTTGGAACCACGAC 85 MMP10 NM_002425.3 CCCTGGGGCTCTTTCACTC GGAACTGGGCGAGCTCTG 71 MMP11 NM_005940.5 CCCGGCGTGTAGACAGTC GCGTCGATCTCAGAGGGC 83 MMP12 NM_002426.5 TGGACCTGGATCTGGCATTG AGTTTGTGCCTCCTGAATGTG 80 MMP13 NM_002427.3 TGGAATTAAGGAGCATGGCGA GCCCAGGAGGAAAAGCATGA 77 MMP14 NM_004995.3 TACCAGTGGATGGACACGGA ACCCTGACTCACCCCCATAA 85 MMP15 NM_002428.2 GCATCCCCTATGACCGCATT GCCAGTACCTGTCCTCTTGG 84 MMP16 NM_005941.4 TGCATCATTCGGGGGTGTTT AAATACTGCTCCGTTCCGCA 79 MMP17 NM_016155.4 GAACCTGTCGTGGAGGGTC AGGGCGTAGTACATGAGTGC 84 MMP19 NM_002429.5 AGGTGTTCCTCTTTAAGGGCTC TTGGGGTAGCTGCTGAAGTC 76 MMP20 NM_004771.3 AGCTCATCCTTTGACGCTGT CCGTCTCCAGAAAATCCGGT 75

Gene Accession Forward sequence (5’-3’) Reverse sequence (5’-3’) Predicted Product Size Symbol Number (bp) MMP21 NM_147191.1 CAGGAGCCTGCCTTTGAGTT TGATCCCTCACAGGAGCCATA 75 MMP23B NM_006983.1 GCATGTGGAGCGACGTGT GGTAGAAGCCTATCCGGAGGT 81 MMP24 NM_006690.3 GAAGATCTATGGACCCCCAGC GATGGTGAGTGGATCCTGCG 84 MMP25 NM_022468.4 ACCCTGACATGGAGGGTACG GGGCATAGCTCATGAGGACC 82 MMP26 NM_021801.3 GATGGGACTTTGTTGAGGGCT TCTCCTGGGTAAGGAGTGGC 77 MMP27 NM_022122.2 ATGCCTGTGACCCTGACTTG CTCCATAGGTGCCTGCCTTT 85 MMP28 NM_032950.3 ACTTCTTCAAAGTGCAATCCGTTT CCCCTCTGCTCTCCTTTAAGC 78 GAPDH NM_001256799.2 AAGGGCATCCTGGGCTAC GTGGAGGAGTGGGTGTCG 75 TBP NM_139215.3 GTGACCCAGCATCACTGTTTC GAGCATCTCCAGCACACTCT 77

2.4. Western blot

Western blots were performed to determine the relative levels of proteins in cell lysates or conditioned media as previously (Ball et al. 2014).

2.4.1. Protein isolation

Cells from adherent cultures were washed twice and lysed in 330μl of Radioimmunoprecipitation assay (RIPA) buffer containing 2% Halt Phosphatase Inhibitor (Thermo Scientific) and 1% protease inhibitor (Sigma). Full lysis was ensured using a 1cm cell scraper (Corning). Lysates were rotated at 4oC for 30 mins and spun at 12,000g for 5 minutes before being aliquoted and stored at -80oC until required.

Spheroids were transferred to microcentrifuge tubes and residual media was removed. Spheroids were washed in ice-cold PBS and lysed in 200μl RIPA buffer containing protease and phosphatase inhibitors. A Microson ultrasonic cell disrupter XL200 equipped with a 3mm microtip set at level 2 (Misonix) was used to dissociate spheroids with 3-4 sets of 2 second pulses. An additional 130μl of RIPA buffer containing protease and phosphatase inhibitors was added to the dissociated spheroids and lysates were rotated at 4oC for 30 mins and spun at 12,000g for 5 minutes before being aliquoted and stored at -80oC until required.

In some experiments, conditioned media were taken from cells in adherent and spheroid cultures. In this case, 150μl of medium was taken from individual wells of 96-well plates and spun at 12,000g for 5 minutes before being aliquoted and stored at -80oC until required.

Total protein concentration was determined using a Bicinchoninic Acid (BCA) Protein Assay Reagent kit (Pierce) according to the manufacturer’s instructions. Briefly, albumin protein standards ranging from 25ng/ml to 2μg/ml

57 were prepared in RIPA buffer and 25μl aliquots of each standard and sample to be tested were added in triplicate to individual wells of a 96-well plate. The BCA working solution (Pierce) was prepared and 200μl added to each well. The 96-well plate was incubated at 37oC for 30 minutes in the dark and the absorbance was read at 570nm using a Dynex MRX II microtitre plate reader with Revolution software (MTX Lab Systems, Inc.). Unknown protein concentrations were determined from the albumin calibration curve generated.

2.4.2. SDS-PAGE

After thawing, 5μg of total protein or 35μl of conditioned medium was mixed with 7μl of LDS sample buffer (Expedeon) and 1μl of NuPAGE reducing agent (Life Technologies) and made up with water to 20μl. Samples were boiled for 5 minutes and loaded into individual wells of pre-cast 10-well 4-12% Bis-Tris gels (Bio-Rad) alongside 10μl of Precision Plus protein marker (Bio-Rad) ranging from 10kDa to 250kDa. Electrophoresis was performed at 200V and 400mA for 50 minutes using NuPAGE MES (Life Technologies) running buffer.

2.4.3. Western blotting

After resolution, proteins were transferred to a 0.2μm nitrocellulose membrane (Whatman, GE Healthcare) using (NOVEX). Transfer was performed at 35V and 200mA for 1.5 hours using Tris-Glycine transfer buffer (60mM Tris, 50mM Glycine and 10mM SDS) containing 20% methanol (Thermo Scientific).

After transfer, membranes were blocked for 1 hour using 4% (w/v) milk solids (Marvel) in TBST (10mM Tris, 150mM NaCl, 0.5% (v/v) Tween20 (Sigma- Aldrich)) at room temperature with gentle rocking. Membranes were then incubated with primary antibody (table 2.3) diluted in 4% milk/TBST at 4oC overnight with gentle rocking. After primary antibody incubation, membranes were washed 4 times in TBST (10 minutes per wash) and incubated with secondary antibody (see table 2.3) for 2 hours at room temperature with gentle

58 rocking. After incubation, membranes were washed a further 4 times in TBST (10 minutes per wash) at room temperature with gentle rocking.

To visualise the proteins, UptiLight high sensitivity HRP substrate (Uptima) was added to the membranes for 3-5 minutes. Blots were then imaged using a ChemiDoc imaging system (Bio-Rad) and analysed using ImageLab software (Bio-Rad). Proteins from cell lysates are shown above their corresponding β-actin loading control. Full blots for some of the proteins assessed are shown in appendix 1.

Antibodies were stripped by incubating membranes for 10 minutes at 37oC in Restore western blot stripping buffer (Thermo Scientific). Following stripping, membranes were washed 4 times in TBST (10 minutes per wash) at room temperature with gentle rocking and block, primary and secondary incubation steps were performed as above.

2.4.4. Densitometry

Densitometry was performed to semi-quantitatively determine protein expression levels using ImageJ. Equal-sized boxes were drawn around each lane on a blot and ImageJ quantified the profile plot of each lane. For proteins with more than 1 band, the total area of all bands was used. Protein levels were relativized to their corresponding β-actin controls and normalised to control levels for each experiment.

Table 2.3: Antibodies used for western blotting. Phosphorylation residues are shown in brackets beneath the relevant Protein. If an antibody was unable to detect the relevant protein “Unable to detect” is shown in the Dilution column. Protein Molecular Manufacturer Species Dilution weight (kDa) (catalog #) MMP-1 52 Abcam (ab134184) Rabbit 1:1000 monoclonal MMP-3 52 Abcam (ab52915) Rabbit 1:1000 monoclonal MMP-8 53 Abcam Rabbit Unable to (ab50317) polyclonal detect MMP-8 53 Abcam Rabbit Unable to (ab81286) monoclonal detect MMP-9 100/90 Abcam Rabbit 1:10,000 (ab76003) monoclonal MMP-10 54 Abcam (ab38930) Rabbit Unable to polyclonal detect MMP-10 54 R&D Systems Monoclonal Unable to (MAB910) mouse detect MMP-13 65/54 Abcam (ab51072) Rabbit 1:500 monoclonal IL-4 15 Abcam (ab62351) Rabbit 1:1000 monoclonal IL-6 25 Abcam (ab93356) Rabbit 1:1000 polyclonal IL-8 8 Abcam (ab154390) Rabbit 1:500 polyclonal IL-10 20 Abcam (ab133575) Rabbit 1:1000 monoclonal COX-2 74 Cell Signaling Rabbit 1:1000 (12282P) monoclonal TSG-6 37 Prof. A.J. Day Rabbit 1:10,000 polyclonal p-STAT-3 85 Cell Signaling Rabbit 1:1000 (Y705) (9131) monoclonal

STAT-3 85 Cell Signaling Mouse 1:1000 (124H6) monoclonal

p-p65 65 Cell Signalling Rabbit 1:1000 (S536) (3031) polyclonal p65 65 Cell Signalling Rabbit 1:1000 (D14E12) monoclonal β-actin 42 Sigma Mouse 1:10,000 monoclonal Anti-mouse - Jackson Donkey 1:10,000 IgG Immunoresearch polyclonal peroxidase (715-035-150) conjugated Anti-rabbit IgG - Jackson Donkey 1:10,000 peroxidase Immunoresearch polyclonal conjugated (711-035-152)

2.5. MMP Antibody Array

MMP antibody arrays were used to detect the relative amount of several MMPs and TIMPs (MMPs-1, -2, -3, -8, -9, -10, -13, TIMP-1, -2, -4) in conditioned media and lysates using a Human MMP Antibody Array kit (Abcam). Conditioned media and protein lysates were extracted from cells as described previously. Antibody array membranes were blocked with 2ml 1X blocking buffer (Abcam) for 30 minutes at room temperature. After thawing, cell culture supernatant was diluted 1:1 with 1X blocking buffer (Abcam) and 1ml of the resulting sample was incubated per membrane for 2 hours at room temperature. Cell lysates were also diluted in 1X blocking buffer to a final concentration of 50μg/ml and 1ml of the resulting sample was incubated per membrane for 2 hours at room temperature. Membranes were washed three times using wash buffer I (Abcam) and then washed a further three times using wash buffer II (Abcam) for 5 minutes each at room temperature. Following the wash steps, biotin-conjugated anti-MMPs (Abcam) were diluted 1:2000 in 1X blocking buffer and incubated with the membranes overnight at 4oC. Membranes were washed using wash buffer I and wash buffer II as described previously and HRP-conjugated streptavidin (Abcam) diluted 1:1000 in 1X blocking buffer was incubated with individual membranes at room temperature for 2 hours. After a final wash step, protein spots were visualised by incubating membranes in 500μl of a 1:1 ratio of Detection Buffer C (Abcam) and Detection Buffer D (Abcam) for 2 minutes before being imaged using a ChemiDoc imaging system (Bio-Rad) and analysed using ImageLab software (Bio-Rad).

Densitometry was performed to determine the relative levels of MMPs between different samples. The spot intensities of individual MMPs and TIMPs were determined using ImageJ (http://rsb.info.nih.gov/ij) and relativized to the average spot intensity of the positive controls on the same membrane. Relative MMP levels were then normalised to spheroid controls. An example membrane is shown in figure 2.1.

1 3 8 2 - - - -

control control

MMP MMP MMP MMP Positive Negative

4 9 1 2 - - - - 10 13

- -

TIMP MMP TIMP TIMP control control MMP MMP Positive

Negative

Figure 2.1: Example MMP antibody array. Image adapted from http://www.abcam.com/human-mmp-antibody-array- membrane-10-targets-ab134004.html#description_images_5

2.6. Immunofluorescence

Immunofluorescence was performed to determine the expression pattern and expression levels of proteins.

2.6.1. Adherent MSCs

Cells for immunofluorescence microscopy were seeded onto 0.1% gelatin in PBS-coated coverslips and were fixed onto coverslips using 4% paraformaldehyde in PBS at room temperature for 20 minutes. Fixed cells were washed three times in PBS and residual paraformaldehyde was quenched using 2% (w/v) glycine in PBS before cells were washed a further three times in PBS for 5 minutes each at room temperature. Fixed cells were permeabilised for 5 minutes using 0.5% (v/v) Triton X-100 (Sigma-Aldrich) in PBS and washed three times in PBS. Non-specific binding of antibody was prevented by blocking cells in 2% (w/v) fish skin gelatin (Sigma-Aldrich) in PBS at 4oC overnight. Cells were washed three times in 0.1% Tween-20 (v/v) in PBS then incubated with primary antibody or antibody-matched isotype control

(see table 2.4) diluted in 3% bovine serum albumin (BSA) (Sigma-Aldrich) (w/v) in PBS at room temperature for 1 hour. Cells were washed three times in 0.1% Tween-20 (v/v) in PBS then incubated with secondary antibody (see table 2.4) diluted in 3% BSA in PBS at room temperature for 30 minutes in the dark. Finally, cells were washed three times in 0.1% Tween-20 (v/v) in PBS and once in H2O and blotted dry using tissue paper. Coverslips were mounted using ProLong Gold antifade reagent containing DAPI (Life Technologies). Images were collected on an Olympus BX51 upright microscope using a 10x/0.30 Plan Fln objective and captured using a Coolsnap ES camera (Photometrics) through MetaVue Software (Molecular Devices). Specific band pass filter sets for DAPI, FITC and Texas red were used to prevent bleed through from one channel to the next. Images were then processed and analysed using ImageJ.

2.6.2. Spheroids

Spheroids were transferred to microcentrifuge tubes and fixed using 4% paraformaldehyde in PBS containing 1% Triton X-100 at 4oC for 4 hours or overnight. Spheroids were washed three times in 0.1% Triton X-100 in PBS and methanol dehydrated. Dehydration consisted of exposing spheroids to increasing concentrations of methanol (10%, 20%, 50%, 75% and 95%) in PBS for 5 minutes each at 4oC followed by incubation in 100% methanol at 4oC for 4 hours. Spheroids were rehydrated by exposure to decreasing methanol concentrations (95%, 75%, 50%, 20% and 10%) in PBS for 5 minutes each and then blocked in PBS containing 3% BSA (w/v) and 0.1% Triton X-100 overnight at 4oC. Spheroids were then incubated with primary antibody (table 2.4) diluted in PBS containing 0.1% Triton X-100 at 4oC for 24 hours and washed three times in PBS containing 0.1% Triton X-100 at 4oC. Finally, spheroids were incubated with secondary antibody (table 2.4) with or without DAPI (Life Technologies D3571) diluted 1:40,000 in PBS containing 0.1% Triton X-100 at 4oC for 24 hours and washed three times in PBS containing 0.1% Triton X-100 at 4oC. Spheroids were imaged using a Leica TCS SP5 AOBS upright confocal using a 20x/0.50 Plan Fluotar objective and

1x confocal zoom. The confocal settings were as follows, pinhole 1 airy unit, scan speed 1000Hz bidirectional, format 1024 x 1024. Images were collected using the following detection mirror settings; DAPI 358-461nm; FITC 494- 530nm; Texas red 602-665nm; Cy5 640-690nm using the UV (100%), 488nm (20%), 594nm (100%) and 633nm (100%) laser lines respectively. 3D optical stacks were taken at 2μm sections. Images were processed and analysed using ImageJ. Representative negative IgG controls are shown in appendix 2.

Table 2.4: Antibodies used for immunofluorescence microscopy Protein Manufacturer Species Dilution (catalog #) FN Sigma (F 6140) Mouse 1:200 monoclonal COL1A1 Santa Cruz (sc- Goat polyclonal 1:200 8784) Aggrecan R&D Goat monoclonal 1:100 FABP-4 R&D Goat monoclonal 1:100 Osteocalcin R&D Mouse 1:100 monoclonal Mouse IgG1 Dako (X0931) - 1:5000 Goat IgG Dako (F0250) - 1:5000 Alexa Fluor 488 Life Technologies Donkey Anti- 1:200 (A21202) Mouse Alexa Fluor 594 Life Technologies Donkey Anti- 1:200 (A21203) Mouse Alexa Fluor 594 Life Technologies Donkey Anti- 1:200 (A11058) Goat

2.7. MMP activity assay

Relative MMP activity was determined from cell culture supernatants using an MMP Activity Assay Kit (Abcam) which determines the activity of MMPs-1, -2, -3, -7, -8, -9, -10, -12, -13, and -14. Briefly, 150μl of cell culture medium was removed from individual wells of 96-well plates, spun at 12,000g to remove any residual cell material and stored at -80oC until required. After thawing, 50μl of conditioned medium was added in triplicate to individual wells of 96-well fluorescent plates and 50μl Substrate Solution (Abcam) diluted 100x in Assay Buffer (Abcam) was added to every well. Fluorescence was read on an FLx800 Microplate Fluorescence Reader (BioTek) at 540/600nm every 5 minutes for

1 hour at 25oC and analysed using KC junior software (BioTek). A negative control consisting of standard media used to culture the cells was included with every experiment. Specificity of the kit was tested using a broad-spectrum MMP inhibitor, GM6001 (Abcam), which abolished MMP activity-induced fluorescence. Relative MMP activity was determined by subtracting fluorescence values of the negative control from the test values and plotting the increase in fluorescence over time. Relative MMP activity values were normalised to spheroid controls.

2.8. siRNA knockdown siRNA knockdown was used to determine the effects of inhibiting the expression of specific genes on the inflammatory characteristics of MSC spheroids. Each siRNA was added to a final concentration of 20nM (see appendix 4 for assessment of knockdown efficiency). MSCs from adherent cultures were trypsinised and reseeded into 100mm Petri dishes until 80-90% confluent and 20nM siRNA (table 2.6) was transfected into cells using Lipofectamine RNAiMAX (Life Technologies). Briefly, 10μl of Lipofectamine RNAiMAX was added to 500μl OptiMEM (Gibco) whilst 10μl 10μM stock siRNA was also added to 500μl OptiMEM. The diluted siRNA and Lipofectamine RNAiMAX were mixed together and incubated at room temperature for 20 minutes. The siRNA/Lipofectamine RNAiMAX mixture was then added to 4mls of MesenPro and used to culture MSCs for 24 hours at 37oC.

After 24 hours of culture, MSCs were trypsinised and 3.6x105 cells were resuspended per 1 ml of MesenPro and retreated with siRNA/Lipofectamine RNAiMAX. Briefly, 2μl of Lipofectamin RNAiMAX was added to 100μl OptiMEM whilst 2.4μl 10μM stock siRNA was added to 100μl OptiMEM per 3.6x105 cells. The diluted siRNA and Lipofectamine RNAiMAX were mixed together, incubated at room temperature for 20 minutes and added to the MSCs resuspended in MesenPro. Spheroids were formed by aliquoting 200μl of the MSC suspension into individual wells of low cell binding microplates.

Some genes required an additional siRNA treatment to be knocked down. Therefore after 72 hours of culture some spheroids were retreated with siRNA. Briefly, 0.3μl of Lipofectamine RNAiMAX was added to 17.2μl OptiMEM whilst 0.5μl of 10μM stock siRNA was added to 17μl of OptiMEM per spheroid to be knocked down. The diluted siRNA and Lipofectamine RNAiMAX were mixed together, incubated at room temperature for 20 minutes and 35μl of the resulting mixture was added to each spheroid to be knocked down. All spheroids were cultured for a total of 5 days before being fixed for immunofluorescence or lysed for qRT-PCR or western blot analysis.

Table 2.5: siRNAs used for gene knockdowns siRNA Manufacturer (Catalog #) Scrambled Control Qiagen (SI03650325) TSG-6 Santa Cruz (sc-39819) IL-1RI Ambion (s7273) MMP-1 Qiagen (SI03021802) MMP-3 Qiagen (SI03115140) MMP-8 Qiagen (SI00037576) MMP-9 Qiagen (SI03648883)

2.9. Cytokine, conditioned medium, and MMP stimulation

MSCs were stimulated with cytokines, MMPs or conditioned medium from spheroids to determine their effects on the inflammatory phenotype of MSC spheroids.

2.9.1. Cytokine stimulation

MSCs were plated into individual wells of gelatin-coated 6-well plates and cultured in standard medium. After 2 days, MSCs were washed in PBS 3 times and cultured in serum free conditions (without growth factors) for 3 hours. After 3 hours, the medium was replaced with serum free medium supplemented with 50ng/ml of applicable cytokine (table 2.7). After a further 3 hours, MSCs were lysed and protein was harvested for western blotting.

Table 2.6: Cytokines used for MSC stimulation Cytokine Manufacturer (Catalog #) IL-1α Peprotech (200-01A) IL-1β Peprotech (200-01B) TNFα Peprotech (300-01A) IFNγ Peprotech (300-02) IL-6 Peprotech (200-06) IL-8 Peprotech (200-08M) IL-17A Peprotech (200-17) IL-17E Peprotech (200-24)

2.9.2. Conditioned medium stimulation

To determine the effects of 1 and 5-day conditioned medium on the expression of MMPs and cytokines, MSCs were plated into individual wells of gelatin- coated 6-well plates and cultured in standard medium. After 2 days, MSCs were washed in PBS 3 times and cultured in serum free conditions for 3 hours. After 3 hours, the medium was replaced with conditioned medium taken from 1 or 5-day cultured 6x104-cell MSC spheroids. After a further 3 hours, MSCs were lysed and protein was harvested for western blotting.

2.9.3. MMP stimulation

To determine the effects of MMP stimulation on the inflammatory phenotype of MSCs, MSCs were cultured as 6x104-cell spheroids as described above. After 5 days spheroids were washed in serum-free medium 3 times and serum- free medium containing 5nM activated MMP-1, -3, -8 or -9 was added to the spheroids. After 3 hours, protein was harvested for western blot as described above.

MMPs were activated using trypsin according to Austin et al. (2013) as follows: 500ng of appropriate MMP was incubated for 10 mins with 10µg/ml of trypsin (Sigma) at 37oC. After 10 mins, trypsin was inactivated with 2mM phenyl methyl sulfonyl fluoride (Sigma) and 100µg/ml of soybean trypsin inhibitor (Sigma). Control MSCs were treated with the same MMP-activating

67 substituents in the absence of MMP. Activation of MMPs was tested using the general MMP activity assay protocol described above (see appendix 7).

2.10. Macrophage culture

The mouse macrophage cell line J774.2 was used to investigate the effects of conditioned medium from MSC spheroids on macrophage polarisation. Macrophages were cultured in 100cm2 tissue culture plates (Corning) at 1x106 cells per plate. Macrophages were cultured in DMEM supplemented with 10% fetal bovine serum (FBS). Macrophages were passaged at approximately 80% confluency every 2-3 days using cell scraping.

2.10.1. Macrophage polarisation

Macrophages were cultured for up to 5 passages before being passaged and stimulated with 1µg/ml of LPS in 10% DMEM for 10 minutes. LPS was removed by centrifugation of the macrophages. Fresh medium was added to macrophages and appropriately diluted conditioned medium was added to the cells. Macrophages were cultured in 24-well plates with 1x105 cells per well for 17 hours. Medium was collected from the macrophages for ELISA analysis.

2.11. Zymosan-induced peritonitis

Zymosan-induced peritonitis was used as an in vivo model of inflammation. BALB/c mice were housed in a 12-hour light dark cycle and fed ad libitum. Studies were performed in accordance with the UK Home Office and institutional guidelines. To induce inflammation 10µg, 50µg, or 250µg of zymosan was dissolved in 1ml of sterile PBS and kept at 37oC. Mice were injected intra-peritoneally with the 1ml of the zymosan solution or vehicle control. After 20 mins some mice were injected with 5x103 cell spheroids suspended in 500µl of sterile Hank’s Buffered Saline Solution (HBSS). After 3 hours of zymosan/spheroid treatment mice were sacrificed by cervical

68 dislocation and 5ml of PBS warmed to 37oC was injected into the peritoneal cavity of mice. The peritoneal fluid was collected, centrifuged at 500g for 10 mins to remove any residual cell material and stored at -80oC.

2.12. ELISA

ELISAs for murine IL-1Ra, TNFα, IL-6, and IL-12 were performed to assess the inflammatory status of macrophages and mice injected with zymosan using R&D DuoSet ELISA kits according to manufacturer’s instructions. Briefly, capture antibody was diluted in PBS and each well of a 96-well plate (Corning) was coated with 100µl of antibody and incubated overnight at room temperature. Capture antibody was removed and each well was washed 3 times with wash buffer containing 0.05% Tween 20 (Sigma) in PBS. Wells were blocked with 300µl blocking buffer containing 0.2µm filtered 1% BSA (Sigma) in PBS for 2 hours at room temperature. Blocking buffer was removed and wells were washed 3 times with wash buffer. Conditioned medium from stimulated macrophages, lavage fluid from mouse peritoneal cavity, or known concentrations of the analyte being measured (100µl) was added to individual wells and incubated at room temperature for 2 hours. Samples were removed and each well was washed 3 times with wash buffer. Detection antibody diluted in blocking buffer was added to each well (100µl) and plates were incubated at room temperature for 2 hours. Detection antibody was removed and wells were washed 3 times with wash buffer. Strepdavidin-HRP was diluted in blocking buffer to the specified concentration and added to each test well. Plates were incubated in the dark for 20 minutes at room temperature before being washed 3 times with wash buffer. Substrate solution was added to each well (100µl) and plates were incubated for 20 minutes at room temperature in the dark. Finally, 50µl stop solution was added to each well and the plate was tapped to ensure thorough mixing.

Plates were read at 450nm and 570nm. The readings from 570nm were subtracted from those taken at 450nm and a standard curve was generated. The concentration of samples was generated from the standard curve.

2.13. In vivo imaging

To determine the trackability of MSC spheroids in vivo, MSCs were transduced with an expression vector containing infra-red fluorescent protein and NanoLuc® luciferase obtained from Dr. Stuart Cain. Briefly, 2mls of lentivirus and 20µl of protamine sulphate (Sigma) to a final concentration of 50µg/ml was added to 8mls of standard medium and incubated with adherent MSCs cultured in T75s for 24 hours. Cells were passaged and fluorescence-activated cell sorting using a Beckman Coulter Cyan ADP flow cytometer (Beckman) by the Flow Cytometry Core Facility Service was used to separate transduced cells from non-transduced cells. Transduced cells were expanded and some were formed into spheroids as described previously. Some MSCs were also checked for retention of the virus using fluorescence-activated cell sorting.

Next, spheroids were placed into black-bottom culture plates in standard medium and treated with Luciferin and analysed for infra-red fluorescence and bioluminescence using an IVIS spectrum in vivo imaging system.

To determine whether spheroids could be tracked in vivo, some 10,000-cell 670+ spheroids were injected subcutaneously into BALB/c mice. After 2 days mice were anaesthetised and imaged using the IVIS spectrum in vivo imaging system to check for infra-red fluorescence. While anaesthetised, mice were also injected intra-peritoneally with Luciferin to analyse NanoLuc® luciferase response.

2.14. Statistical analysis

All graphs shown mean ± SEM. Statistical analysis was performed using a student’s t-test with or without Bonferroni correction for multiple comparisons or one-way ANOVA with Holm-Sidak post-hoc or two-way ANOVA with Bonferoni post-hoc to determine significance values unless otherwise stated. P-values <0.05 were considered significant.

Chapter 3: Spheroid culture conditions are determinants of the MSC spheroid microenvironment

3. Spheroid culture conditions are determinants of the MSC spheroid microenvironment

MSCs are characterised by their ability to differentiate towards osteogenic, adipogenic, and chondrogenic lineages in vitro. MSCs are cultured under specific conditions depending on which lineage is sought. For example, differentiation of MSCs towards chondrogenic lineages requires the MSCs to be cultured as cell pellets for approximately 21 days in the presence of specific chemical stimuli. Conversely, differentiation towards osteogenic or adipogenic lineages has typically required MSCs to be cultured in monolayer in the presence of different chemical stimuli.

To recreate a more in vivo-like microenvironment, some labs have begun testing the effects of culturing MSCs as spheroids. Data from our laboratory have shown that MSCs cultured as spheroids in low cell binding microplates have a high propensity to differentiate towards endothelial-like cells. Furthermore, MSCs cultured as spheroids are increasingly being investigated for their immunomodulatory properties. Microarray analysis has shown that MSC spheroids formed using the hanging drop method upregulate the expression of several MMPs compared with unstimulated adherent control cultures (Bartosh et al. 2010). Furthermore, unpublished data from our laboratory have shown that the matrix composition of MSC spheroids is an important determinant of the expression of anti-inflammatory factors such as TSG-6. As MMPs degrade ECM proteins, experiments were performed to determine how MSC spheroid conditions altered both the expression levels of different MMPs and the matrix deposition of MSC spheroids. Expression of the apoptosis marker cleaved caspase-3 was also assessed using different spheroid conditions. Finally, after optimisation of MSC spheroid culture conditions, the inflammatory microenvironment of MSC spheroids was assessed and compared to that of MSCs cultured in monolayer.

3.1. Characterisation of MSCs

The MSCs in this study have previously been characterised in our laboratory. However, it is important to ensure that MSCs remain multipotent and meet the minimal criteria set out by the International Society for Cell Therapy (Dominici et al. 2006). Therefore, MSCs were grown as adherent cultures and characterised as described below.

3.1.1. Surface marker expression by MSCs

MSCs are characterised by surface expression of CD29, CD44 and CD105 and by the absence of expression of CD14, CD34 and CD45 (although CD29 and CD44 are not part of the ISCT minimal criteria) (Dominici et al. 2006). Flow cytometry analysis was used to determine the expression of these markers in MSCs grown under basal conditions (figure 3.1). MSCs were negative for CD14, CD34 and CD45 (<5% positive) but positive for the characteristic MSC markers CD29, CD44 and CD105 (>90% positive).

Figure 3.1. Surface marker expression of MSCs. MSCs were stained with phycoethryin- or FITC-conjugated antibodies. Blue peaks represent MSCs stained with IgG controls. Green peaks represent MSCs stained with antibodies against the leukocyte markers CD14, CD45 or the haematopoietic marker, CD34. Red peaks represent MSCs stained with antibodies against CD29 (integrin β1 chain), CD44 (hyaluronan receptor), or CD105 (endoglin). Blue peaks represent IgG controls. Data are representative of 3 biological repeats.

3.1.2. Differentiation potential of MSCs

MSCs are characterised by their differentiation potential towards adipogenic, osteogenic and chondrogenic lineages (Dominici et al. 2006). Therefore, MSCs were seeded at specific cell densities and induced to differentiate towards all three lineages using specified protocols. MSCs were also cultured in base media without growth factor supplements, or MesenPro, as negative controls.

3.1.2.1. Osteogenic differentiation

Differentiation towards osteogenic lineages was induced by culturing MSCs at 50-70% confluency in the presence of osteogenic supplements. Differentiation was assessed by measuring mRNA levels of alkaline phosphatase and

74 osteopontin using qPCR and by immunofluorescence analysis of osteocalcin expression. MSCs cultured in the presence of osteogenic supplements resulted in significant increases in alkaline phosphatase (p<0.01) and osteopontin (p<0.05) mRNA levels compared with MSCs cultured in MesenPro without osteogenic supplements (figure 3.2A). Additionally, MSC cultures differentiated in the presence of osteogenic supplements, or base media without supplements, showed positive osteocalcin staining whereas MesenPro controls showed very low levels of non-specific staining (figure 3.2B).

Figure 3.2. Osteogenic differentiation of MSCs Osteogenic differentiation was induced by addition of base media with osteogenic supplements to adherent MSCs. Some MSCs were maintained in MesenPro or base media without supplements as negative controls. A qPCR analysis of alkaline phosphatase and osteopontin mRNA levels. Data were normalised to GAPDH and TBP and normalised to the MesenPro control. Statistical tests were performed using a two-way ANOVA with Bonferoni analysis. The graphs show mean ± SEM of three biological repeats. *=p<0.05; **=p<0.01 compared with MesenPro controls. B Immunofluorescence analysis of osteocalcin (green) with nuclei stained by DAPI (blue). Images are representative of three biological repeats. Scale bars show 100µm.

3.1.2.2. Adipogenic differentiation

Adipogenesis was induced by culturing MSCs at 100% confluency in the presence of adipogenic differentiation supplements. Differentiation was assessed by measuring mRNA levels of fatty acid binding protein-4 (FABP-4) and CEBPα using qPCR and immunofluorescene analysis of FABP-4 expression. MSCs cultured in the presence of adipogenic supplements significantly increased FABP-4 and CEBPα mRNA levels compared with control MSCs cultured in MesenPro (figure 3.3). MSCs differentiated towards adipocytes exhibited a clear cell-shape change from the characteristic spindle- like morphology to a rounded morphology with each cell comprising many vacuoles. Additionally, only MSCs supplemented with adipogenic factors stained positive for FABP-4 (figure 3.4).

2 15 ***

2 10

* 2 5

2 0

2 -5 FABP-4 CEBPA

Figure 3.3. Gene expression analysis of adipogenic differentiation MSCs were grown to 100% confluency and adipogenic differentiation was initiated by addition of base media containing supplements to the cells. Some MSCs were maintained in MesenPro or base media without supplements as controls. qPCR analysis of FABP-4 and CEPBA mRNA levels are shown. Data were normalised to GAPDH and TBP and made relative to MesenPro controls. Statistical analysis was performed using two-way ANOVA with Bonferoni analysis. Graphs show mean ± SEM of three biological repeats. *=p<0.05; ***=p<0.001 compared with MesenPro controls.

Figure 3.4. Immunofluorescence analysis of adipogenic differentiation MSCs were grown to 100% confluency and adipogenic differentiation was initiated by addition of base media containing supplements to the cells. Some MSCs were maintained in MesenPro or base media without supplements as controls. Immunofluorescence analysis of FABP-4 (red) with nuclei stained by DAPI (blue) is shown.

3.1.2.3. Chondrogenic differentiation

Finally, chondrogenesis was induced by culturing the MSCs as pellets in the presence of chondrogenic supplements for 21 days. Differentiation was assessed by measuring the mRNA levels of aggrecan and COL2A1 using qPCR and immunofluorescence analysis of aggrecan expression. MSCs differentiated towards chondrogenic lineages showed significantly increased mRNA levels of aggrecan and COL2A1 (p<0.05) (figure 3.5A). Additionally, although MSCs differentiated in base media in the absence of supplements and MSCs cultured in MesenPro controls exhibit small amounts of aggrecan staining, MSCs cultured in the presence of chondrogenic supplements show intense aggrecan staining (figure 3.5B).

Figure 3.5. Chondrogenic differentiation of MSCs Chondrogenic differentiation was induced by culturing MSCs as a cell pellet in the presence of chondrogenic supplements for 21 days. Some MSCs were maintained in MesenPro or base media without supplements as controls. A qPCR analysis of aggrecan and COL2A1 mRNA levels. Data were normalised to GAPDH and TBP and made relative to the MesenPro control. Statistical tests were performed using a two-way ANOVA with Bonferoni analysis. The graphs show mean ± SEM of three biological repeats. * denotes p<0.5 compared with MesenPro controls. B Immunofluorescence analysis of aggrecan (red) with nuclei stained by DAPI (blue). Images are representative of three biological repeats. Scale bars represent 100µm.

3.1.3 Summary

Taken together, these data show MSCs can be differentiated towards adipogenic, osteogenic, and chondrogenic lineages.

3.2. MSC spheroids express increased levels of MMPs compared with adherent cultures

Unpublished microarray data from our laboratory have shown that MSC spheroids cultured in low adherent cell binding wells exhibit upregulation of several MMPs compared with MSCs in adherent cultures. To validate the microarray data, MSCs were seeded at 6x104 cells per well of individual low cell binding wells or at 1x105 cells per well of individual wells of gelatin-coated 6-well plates and cultured for 5 days. MSCs formed spheroids spontaneously in low cell binding microplates within 17 hours.

3.2.1. mRNA expression levels of MMPs qRT-PCR analysis showed that expression of MMPs-1, -3 and -10 were highly significantly upregulated (p<0.00001) in MSC spheroids compared with MSCs in adherent cultures. MMP-10 was approximately 1500-fold upregulated in spheroids (figure 3.6A-B). Furthermore, levels of mRNA encoding MMPs-7, - 9, -12, -13, and -14 was also significantly upregulated in MSC spheroids (p<0.05). MMPs-7 and 23B were not detected at the mRNA level in adherent cultures. MMPs-2, -21, -22, -25, and -26 were not detected at the mRNA level in either spheroid or adherent cultures (not shown).

A mRNA Levels

* *** *** ***

* * ND ND

4 4 10 11 15 16 17 27 RelativeExpression (GAPDH/TBP) P-7 P-8 P-9 - - - - MP-1 M M M P P P P M MMP-3M M M M M M M M MMP-12MMP-13MMP-1MMP-MM M MMP-19MMP-20MP-23BMMP-2MMP- M B Gene Approximate Fold Upregulation MMP-1 800 MMP-3 800 MMP-9 25 MMP-10 1500 MMP-12 15 MMP-13 75 MMP-14 2

Figure 3.6. mRNA expression levels of MMPs MSCs were cultured as spheroids (3D) in low cell binding plates or as adherent cultures (2D) on gelatin-coated tissue culture plastic for 5 days and the expression level of several MMPs was measured. A qRT-PCR analysis of MMPs in MSC spheroids and adherent cultures. Graphs show mean ± SEM of three biological repeats and are relative to GAPDH and TBP housekeeping genes. Statistical analysis was performed using t-tests with Bonferonni correction for multiple comparisons. *=p<0.05; ***=p<0.001 compared with 2D adherent control. ND = Not detected. B Table showing the fold upregulation of mRNA levels of MMP-1, MMP-3, MMP-10, and MMP-13 in MSC spheroids compared with adherent cultures.

3.2.2. Protein expression levels of MMPs

Western blot densitometry analysis of spheroid and adherent MSC lysates showed that protein expression of MMPs-1 and -3 was significantly upregulated (p<0.01) in MSC spheroids compared with 2D cultures (figure 3.7). Protein expression of MMPs-9 and -13 was also significantly upregulated

(p<0.05) in spheroids compared with 2D cultures. Although more highly expressed at the mRNA level in MSC spheroids compared with 2D cultures, MMP-14 was not significantly upregulated at the protein level. MMPs-7, -8, and -10 were not detected using 2 different antibodies for each MMP (not shown).

Figure 3.7. Protein expression levels of MMPs MSCs were cultured as spheroids (3D) in low cell binding plates or as adherent cultures (2D) on gelatin-coated tissue culture plastic for 5 days and the expression level of several MMPs was measured. Western blot analysis of MMP-1, -3, -9, -11, -13 and -14 expression in lysates of adherent and spheroid MSCs. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean densitometry values ± SEM of blots and are normalised to 2D controls. Significance was determined using student’s t-tests. *=p<0.05; **=p<0.01 compared with 2D controls. 3.2.3. Secreted levels of MMPs

As MMPs are secreted, an MMP antibody array was also performed to detect MMPs-1, -2, -3, -7, -8, -9, -10, and -13 in conditioned medium of spheroid and adherent cultures. MSCs were seeded at 6x104 cells per well of low binding cell microplates or at 1x105 cells per well of gelatin-coated 6-well plates and cultured for 5 days. Equal volumes of conditioned media were taken from each well after 5 days of culture and analysed using an MMP antibody array. MMPs- 10 and -13 were found to be most highly secreted by spheroid cultures (p<0.05) (figure 3.8A and B). To determine MMP activity in the conditioned medium of cell cultures, a general MMP activity assay was performed which measures the activity of several MMPs. MMP activity was significantly increased (p<0.05) in conditioned medium taken from spheroids compared with conditioned medium taken from adherent cultures (figure 3.8C).

3.2.3. Summary

These data show that MSC spheroids express high levels of MMPs, particularly MMPs-1 and 3 at the mRNA and protein level. Furthermore, MMPs-10 and -13 are highly secreted into the spheroid culture medium where MMP activity is significantly higher than in adherent culture medium. These data also show that spheroids are a good model to study MMP biology.

Figure 3.8. Secreted levels of MMPs MSCs were cultured as spheroids (3D) in low cell binding plates or as adherent cultures (2D) on gelatin-coated tissue culture plastic for 5 days and the secretion of several MMPs was assessed. A MMP antibody array for several MMPs in conditioned media of MSC spheroids and adherent MSCs. B Densitometry of each MMP dot was performed to quantify the secretion of MMPs into culture medium. The densitometry graph shows mean ± SEM of two individual experiments from different MSC donors C MMP activity in conditioned media from adherent MSCs and spheroids. The MMP activity graph show mean ± SEM of three individual experiments from different MSC donors. Significance was determined using student’s t-tests with Bonferonni correction for multiple comparisons. *=p<0.05 compared with 2D adherent control. ND = not detected.

3.3. MMP expression and extracellular matrix deposition is altered by spheroid culture conditions

MMPs are known to cleave extracellular matrix proteins and are thus likely to affect the spheroid microenvironment. However, little is known about how the MSC spheroid microenvironment affects MMP expression. Since culturing MSCs as spheroids in low cell binding plates allows careful manipulation of MSC spheroid culture conditions, experiments were performed to determine how the MSC microenvironment affects MMP expression and matrix deposition.

3.3.1. Spheroid size

3.3.1.1. MMP expression

To investigate the importance of spheroid size on MMP expression and extracellular matrix deposition in MSC spheroids, MSCs were seeded at 1x104, 3x104, 6x104, and 1.2x105 cells per well of a low cell binding microwell plate and cultured for 5 days. Increasing spheroid size dose-dependently increased MMP-1, MMP-3 and MMP-13 expression (figure 3.9). Densitometry analysis showed that expression of the three MMPs tested was significantly higher (p<0.01) in 1.2x105 and 6x104 cell-spheroids compared with 1x104 cell spheroids. Furthermore, expression of MMP-13 was also significantly higher (p<0.05) in 3x104 cell spheroids compared with 1x104 cell spheroids.

Figure 3.9. MMP expression changes with spheroid size Western blot analysis of MMP-1, -3 and -13 expression in lysates of spheroid MSCs seeded into individual wells of low cell binding microwell plates ranging from 1x104 to 1.2x105 cells per well and cultured for 5 days as spheroids.. Blots shown are representative of 3 individual experiments. Graphs show densitometry analysis of Western blots and show mean ± SEM. Data are normalised to 1x104 protein levels. Significance was determined using one- way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01 compared with 1x104 cell spheroids.

3.3.1.2. Matrix deposition

Matrix deposition was also altered by MSC spheroid size (figure 3.10). All spheroids stained positively for both fibronectin and the αI(I) chain of collagen I. Additionally, all spheroids showed areas of fibronectin staining that appeared fibrillar, except spheroids formed from 1x104 MSCs (insets), whereas only spheroids formed from 6x104 MSCs exhibited fibrillar type I collagen (insets). Cross-sectional analysis of spheroids shows that collagen I was more universally expressed throughout spheroids formed from 6x104 or 1.2x105 MSCs with type I collagen expression visible in the middle of spheroids, whereas spheroids formed from 1x104 or 3x104 MSCs only showed a thin layer of collagen I on the external surface of spheroids. Together, these data show that spheroid size is a potent regulator of MMP expression and extracellular matrix composition and organisation therefore future experiments use 60,000- cell spheroids unless otherwise stated.

Figure 3.10. Matrix deposition changes with spheroid size Immunofluorescence analysis of fibronectin and type I collagen in different sized spheroids cultured for 5 days. Images shown were taken from z-stacks with 2μm sections and analysed using the “3D Project” option on ImageJ to show surface topology of individual spheroids. Cross-sections approximately 40μm from the top of spheroids are also shown. Images are representative of two experiments from separate donor MSCs.

3.3.2. Spheroid culture time

3.3.2.1. MMP expression

MSCs were seeded at 6x104 cells per well of low cell binding microwell plates and cultured for 1, 5, 10, or 15 days to determine whether MMP expression and matrix deposition were altered by spheroid culture time. Culturing of spheroids between 1-4 days showed little change in MMP-1 and MMP-3 protein expression (see appendix 3; n=1). All MMPs analysed were expressed

87 at low levels at day 1, however MMP-1 protein expression peaked at day 5 whereas MMP-3 expression peaked at day 10 and MMP-13 expression peaked at day 15 (figure 3.11). Densitometry analysis showed that MMP-1 and MMP-3 were significantly upregulated (p<0.05) at days 5, 10 and 15 compared with day 1 whereas upregulation of MMP-13 only reached significance (p<0.05) at day 15. However, the lower MMP-13 band at 54kDa (denoting the active form of MMP-13) decreased at days 10 and 15 compared to lysates from days 1 and 5 spheroids.

Figure 3.11. MMP expression changes with spheroid culture time MSCs were seeded into individual wells of low cell binding microwell plates at a density of 6x104 cells per well and cultured for 1-15 days as spheroids. Western blot analysis of MMP-1, -3 and -13 expression in lysates of spheroid MSCs. Blots shown are representative of 3 individual experiments. Graphs show densitometry analysis of Western blots and show mean ± SEM. Data are normalised to day 1 spheroids. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05 compared with day 1 spheroids.

3.3.2.2. Matrix deposition

Matrix deposition and spheroid shape were also regulated by culture time. Spheroids at day 1 appeared bigger compared with spheroids at other time points suggesting the spheroids had not fully compacted at this time point (figure 3.12). Furthermore, neither fibronectin nor collagen I showed any fibrillar-like architecture at day 1, whereas both exhibited fibrillar-like structures at day 5 (insets). Additionally, spheroids cultured for 10 and 15 days show

88 some fibrillar-like areas of fibronectin (insets) whereas no fibrillar-like collagen I areas were observed. Also, some day 10 and day 15 spheroids showed staining that appeared non-specific indicative of autofluorescent dead or dying cells whereas other spheroids showed gross morphological differences compared with day 5 spheroids. These data suggest that spheroid culture time is an important determinant of MMP expression, matrix structure, and spheroid viability.

Figure 3.12. Matrix deposition changes with spheroid culture time Immunofluorescence analysis of fibronectin and type I collagen in spheroids cultured for 1-15 days. Images shown were taken from z-stacks with 2μm sections and analysed using the “3D Project” option on ImageJ to show surface topology of individual spheroids. Cross-sections approximately 40μm from the top of spheroids are also shown. Images are representative of two experiments from separate donor MSCs.

3.3.3. Spheroid formation method

Previous studies examining the immunomodulatory properties of MSC spheroids have formed spheroids using the hanging drop method (Bartosh et al. 2010;Ylostalo et al. 2012;Bartosh et al. 2013). However, culturing of spheroids in individual wells of low cell binding microwells allows medium changes throughout the culture period and spheroids form within 24 hours whereas hanging drop spheroids take approximately 2-3 days to form (Ball et al. 2014;Bartosh et al. 2010).

3.3.3.1 MMP expression

To determine differences in MMP expression and ECM deposition between hanging drop and microwell spheroids, 6x104 cells were cultured in individual wells of low cell binding microwells or on the lids of Petri dishes filled with 10ml of PBS and cultured for 5 days. Protein expression of MMPs-1, -3, and -13 was higher in MSC spheroids formed using microwell plates (figure 3.13). Densitometry analysis showed that MMP-1 and MMP-3 protein expression was significantly (p<0.001) higher in spheroids formed in microwells compared with spheroids formed from hanging drops.

Figure 3.13. MMP expression changes with spheroid formation method 6x104 MSCs were seeded into individual wells of low cell binding microwell plates or in individual drops of medium on the lids of Petri dishes and cultured for 5 days as spheroids. Western blot analysis of MMP-1, -3 and -13 expression in lysates of spheroid MSCs. Blots shown are representative of 3 individual experiments. Graphs show densitometry analysis of Western blots and show mean ± SEM. Data are normalised to hanging drop spheroids. Significance was determined using student’s t-test. *=p<0.05 compared with hanging drop spheroids.

3.3.3.2. Matrix deposition

MSC spheroids exhibited areas of fibrillar-like fibronectin and type I collagen (insets), whereas MSC spheroids formed using the hanging drop method do not exhibit fibrillar-like type I collagen (figure 3.14). MSC spheroids formed using the hanging drop method were also observed to be have more diverse shapes than spheroids formed in microwells. Overall, these data show that the method of MSC spheroid formation alters the expression patterns of MMPs-1, -3, and -13 and the ECM proteins fibronectin and collagen I.

Figure 3.14. Matrix deposition changes with spheroid formation method 6x104 MSCs were seeded into individual wells of low cell binding microwell plates or in individual drops of medium on the lids of Petri dishes and cultured for 5 days as spheroids. Immunofluorescence analysis of fibronectin and type I collagen in MSC spheroids. Images shown are taken from z-stacks with 2μm sections and analysed using the “3D Project” option on ImageJ to show surface topology of individual spheroids. Cross-sections approximately 40μm from the top of spheroids are also shown. Images are representative of two experiments from separate donor MSCs.

3.3.4. Summary These data show that spheroid culture conditions are a potent regulator of MMP expression which in turn regulates matrix deposition. These data also show that day 5 spheroids formed from 6x104 have increased expression of MMPs-1, -3, and -13 at the protein level compared with spheroids formed from fewer cells and form a compact spheroid cell mass with an external layer of fibronectin and collagen I. Furthermore, these data show that culturing spheroids for 5 days resulted in upregulation of MMPs-1 and -3 compared to spheroids cultured for 1 day. Day 5 spheroids also retained their shape whereas spheroids cultured for longer appeared less spherical and had less intact extracellular matrix. Finally, spheroids formed using hanging drop took longer to form single spheroids, had lower expression levels of MMPs-1, -3, and -13 than spheroids formed using microwells and had a less extensive extracellular matrix network. Therefore, further studies were performed using MSC spheroids formed from 6x104 cells cultured for 5 days.

3.5. MSC spheroids express increased levels of specific cytokines compared with adherent cultures

MMPs have been shown to act as immunomodulators and MSC spheroids cultured as hanging drops secrete increased anti-inflammatory mediators compared with unstimulated adherent MSC cultures (Bartosh et al. 2010; Ylostalo et al. 2012; Bartosh et al. 2013). However, as described above, MSC spheroids cultured in low cell binding microplates differ from MSC spheroids cultured using the hanging drop method. Thus, to determine whether MSC spheroids cultured in low cell binding microplates also express increased anti- inflammatory mediators compared with unstimulated adherent cultures, MSCs were seeded at 6x104 cells in individual low cell binding wells or at 1x105 cells in individual wells of gelatin-coated 6-well plates for 5 days.

3.5.1. Gene expression levels of inflammatory cytokines

MSC spheroids exhibited significantly increased mRNA expression of the immunosuppressor factors COX-2, IL-6 and TSG-6 (p<0.0001) compared with 2D adherent controls (figure 3.15A). IL-1α and IL-1β, which drive expression of COX-2, IL-6, and TSG-6 (Martin et al. 1994; Tosato and Jones 1990; Wisniewski and Vilĉek 1997), were approximately 100- and 2000-fold upregulated in spheroids compared to adherent controls respectively (figure 3.15B). Expression of PD-L1 and PD-L2, proteins previously reported to be important in MSC-derived immunosuppression (Lepelletier et al. 2009;Augello et al. 2005) were significantly downregulated (p<0.01) in spheroids compared with adherent cultures (figure 3.15A and C). However, there was no significant difference in the expression of IFNγ (p=0.27) or IL-12A (p=0.94), cytokines able to polarise macrophages towards an M1 phenotype, between spheroid or adherent MSC cultures. IL-4, IL-10, and IL-13, cytokines able to polarise macrophage towards an M2 phenotype, were not detected at the mRNA level (not shown).

A mRNA Levels

*** *** *** *** *** *** *** ** *

*** RelativeNormalised Expression

1 G A 6 a 6 - 1 - -1 1 1B 2A 3 in GF FNy - - IL- IL-8 1 DL1 H OX I IL IL L P PDL2 ma COX COX-2 ect HLA M I e TGFb1 TSG- H S Gal B Gene Approximate Fold C Change Gene Approximate Fold Change COX-1 60 COX-2 500 PDL1 0.07 HGF 7.5 PDL2 0.003 HLA-G 30 IL-1A 120 IL-1B 2000 IL-6 100 IL-8 10,000 TSG-6 85

Figure 3.15. Cytokine expression in MSC spheroids MSCs were cultured as spheroids (3D) or on gelatin as adherent cultures (2D) for 5 days and the expression of several pro- and antiinflammatory genes was measured. A qRT-PCR analysis of pro- and anti-inflammatory cytokine expression. Data are relative to GAPDH and TBP and normalised to 2D adherent cultures. B Table showing fold upregulation of cytokine gene expression in spheroids compared to adherent controls. C Table showing fold downregulation of cytokine gene expression in spheroids compared to adherent controls. Graphs show mean ± SEM of three individual experiments from separate MSC donors. Significance was determined using student’s t- tests with Bonferroni correction for multiple comparisons. *=p<0.05; **=p<0.01; ***=p<0.001 compared with 2D adherent controls.

3.5.2. Protein expression levels of cytokines

Protein levels of COX-2 was >100-fold higher in spheroids compared with adherent cultures (p<0.001). Expression of IL-1A and IL-1B, key drivers of TSG-6, COX-2 and IL-8 were also significantly upregulated in MSC spheroids (p<0.05). IL-6, a further inflammatory cytokine upregulated in response to IL-

1, was also significantly upregulated in MSC spheroids (p<0.05). Furthermore, expression of IL-8 and TSG-6 were approximately 50- and 25-fold higher in MSC spheroids than in adherent cultures (p<0.01) (figure 3.16).

Figure 3.16. Cytokine protein expression in MSC spheroids MSCs were cultured as spheroids (3D) or on gelatin as adherent cultures (2D) for 5 days and the expression of several pro- and anti-inflammatory proteins was measured. Western blot analysis of COX-2, IL-1A, IL-1B, IL-6, IL-8, and TSG-6 expression in lysates of adherent and spheroid cultures. Images shown are representative of n=3 independent experiments from separate donor MSCs. Graphs show mean densitometry values ± SEM of three individual experiments from separate MSC donors. Data are normalised to 2D controls. Significance was determined using student’s t-tests. *=p<0.05; **=p<0.01; ***=p<0.001 compared with adherent controls. 95

3.6. Summary

MMPs were initially studied for their ability to cleave ECM proteins, however recent work has shown that MMPs act as potent immunomodulators (Nissinen and Kähäri 2014). Culturing MSCs as 60,000 cell spheroids for 5 days significantly upregulated several MMPs at the mRNA and protein level, particularly the collagenase MMP-1 and the stromelysin MMP-3. Previous studies examining MSC spheroids have used defined spheroid sizes and culture times without appropriately examining how either of these factors alter spheroid biology. Altering spheroid culture conditions shows for the first time that MSC spheroid size, culture time, and formation method potently alter the expression pattern of MMPs-1, -3, and -13.

MMPs-1 and -13 are collagenases that can degrade type I collagen, and MMP- 3 is a stromelysin that degrades fibronectin. Therefore, the expression pattern of these two ECM proteins was determined by immunofluorescence analysis. Culture time, spheroid size, and spheroid formation method altered the pattern of fibronectin and type I collagen staining. Spheroids formed from 6x104 MSCs and cultured for 5 days showed areas of fibrillar-like collagen I and fibronectin whereas other spheroids only showed fibronectin staining with potentially fibrillar architecture but no type I collagen fibrillar staining. This suggests that fibronectin readily forms fibrillar-like structures in spheroids whilst collagen I may only form fibrillar-like structures in specific microenvironments. Interestingly, there is not a correlation between MMP expression and ECM organisation, however further work could investigate how specific MMPs alter the structure and organisation of ECM proteins in MSC spheroids.

It is important to note that the medium was not changed at any point during these experiments which may also alter the viability and ECM structure of MSC spheroids. The medium was not changed because the full extent of how spheroids control their own microenvironment by secretion of MSC-derived factors was investigated. A medium change would have diluted the MSC- derived factors present whilst concurrently adding 2% serum. Lack of medium

96 change may also account for the areas of autofluorescence and the gross morphological changes in spheroids cultured for over 10 days. These data therefore do not necessarily negate the use of spheroids for in vivo therapeutics as pilot data from our laboratory have shown that spheroids can be engrafted subcutaneously or intracranially in mice for up to 3 weeks with human mRNA recovery remaining possible at these late time points.

MSCs are becomingly increasingly studied for their in vivo immunomodulatory functions. Previous studies have shown that adherent MSCs must be stimulated with IFNγ, IL-1, or TNFα to be able to polarise macrophages towards the M2 phenotype (Bernardo and Fibbe 2013) whereas spheroids do not require stimulation to release anti-inflammatory factors (Bartosh et al. 2010). These experiments have shown that MSC spheroids have significantly increased mRNA levels of IL-1α and IL-1β compared with unstimulated adherent MSCs whereas IFNγ levels are not significantly increased in spheroids. Importantly, this suggests that IL-1 is the key driver of the inflammatory changes seen in MSC spheroids. Furthermore, IL-12A is equivalently expressed in MSC spheroids and adherent cultures whereas IL- 12B is not detected in either culture system. As IFNγ and IL-12 are known to induce M1 macrophage polarisation (Biswas and Mantovani 2010), these data suggest that MSC spheroids, like adherent MSCs, will be unable to polarise macrophages towards the M1-phenotype.

Furthermore, adherent MSCs have been shown to modulate immune cell function through secretion of various factors. These experiments have shown that expression of semaphorin-3A, PD-L1, and PD-L2, proteins previously linked with the immunomodulatory effects of MSCs, were significantly decreased in spheroids compared with unstimulated MSC adherent controls suggesting MSC spheroids do not alter inflammation through these molecules. Importantly, MSC spheroids exhibited increased mRNA and protein levels of TSG-6 and COX-2 compared with unstimulated adherent MSCs. COX-2 is known to catalyse PGE2-production which binds to EP2 and EP4 receptors on macrophages inducing IL-10 secretion and M2 macrophage polarisation

(Németh et al. 2008). How TSG-6 exhibits its anti-inflammatory functions is not well characterised.

Taken together these data show that the expression of anti-inflammatory factors and MMP-1 and MMP-3 are closely linked. In adherent MSC cultures, expression of MMPs-1 and -3 and anti-inflammatory cytokines are very low, however all are upregulated when MSCs are cultured as spheroids. Previous studies have shown that IL-1 is a key driver of the inflammatory secretome of MSC spheroids (Bartosh et al; 2012). Furthermore, IL-1 has been shown to drive MMP-1 and MMP-3 expression in some cell types. However, no study has shown whether IL-1 drives expression of MMPs in MSC spheroids. Additionally, there have been no studies that investigate whether the anti- inflammatory factor TSG-6 can drive expression of MMPs. Finally, whether MMPs themselves are also able to drive expression of anti-inflammatory factors such as TSG-6 has not been investigated. Therefore, the regulation of MMP expression in MSC spheroids and how MMPs regulate the anti- inflammatory phenotype of MSC spheroids was investigated further.

Chapter 4: Regulation of the spheroid microenvironment by MMPs

4. Regulation of the spheroid microenvironment by MMPs

The previous chapter showed that the culture conditions of MSC spheroids potently regulates the expression of the anti-inflammatory factors TSG-6 and COX-2 and the MMPs MMP-1 and MMP-3. Furthermore, work done in other labs have shown that the anti-inflammatory properties of MSC spheroids formed using the hanging drop method are regulated by IL-1 (Ylostalo et al. 2012; Bartosh et al. 2013). However, as shown in the previous chapter, MSC spheroids formed using the hanging drop method and MSC spheroids formed in low-cell binding microplates are different. Therefore, the aim of this chapter was to determine whether the anti-inflammatory properties of MSC spheroids formed in low-cell binding microplates are regulated in a similar manner. Further, the role of MMPs in regulating the inflammatory phenotype of MSC spheroids was also investigated.

4.1. The spheroid microenvironment is regulated by secreted factors

Previous studies have shown that expression of MMPs is regulated by several factors including secreted cytokines such as IL-1 and TNFα. To determine whether MMP expression is regulated by secreted factors in MSC spheroids conditioned medium (CM) was taken from 6.0x104 cell spheroids cultured for 1 and 5 days and used to stimulate adherent MSCs for 3 hours. Controls show 5-day adherent MSCs stimulated with fresh cell culture medium for 3 hours. Expression of MMP-1 and -10 mRNA significantly increased (p<0.001) when cultured in the presence of CM taken from day 5 spheroids compared with controls (figure 4.1). Furthermore, mRNA expression of MMP-3 and MMP-9 also significantly increased (p<0.01) compared with controls when cultured in the presence of CM taken from day 5 spheroids.

100

Lysates were taken to determine protein expression of MMPs after day 1 and day 5 spheroid CM stimulation (figure 4.2.). Protein expression of MMP-1 and MMP-3 was significantly higher in adherent MSCs stimulated with day 5 spheroid CM (p<0.05). In contrast, MMP-9 protein was not detected in any condition (not shown) whereas there was no significant change in MMP-13 protein expression in either adherent cultures stimulated with day 1 spheroid CM or day 5 spheroid CM.

101

*** ** Expression Relative Normalised Normalised Relative

Adherent Adherent + Day 1 CM Adherent + Day 5 CM Spheroid Expression Relative Normalised Normalised Relative

Figure 4.1. qRT-PCR expression of MMPs in adherent MSCs stimulated with spheroid CM MSCs were cultured as spheroids in low cell binding plates for 5 days. Conditioned medium (CM) was taken from spheroids and used to stimulate adherent cultures for 3 hours. Graphs show mean ± SEM of three individual experiments from different MSC donors. Significance was determined using student’s t-tests with Bonferonni correction for multiple comparisons. **=p<0.01; ***=p<0.001 compared with adherent controls.

102

Figure 4.2. Western blot expression of MMPs in adherent MSCs stimulated with spheroid CM MSCs were cultured as spheroids in low cell binding plates for 5 days. Conditioned medium (CM) was taken from spheroids and used to stimulate adherent cultures for 3 hours. Western blot analysis of MMP-1, -3 and -9 expression. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean densitometry values ± SEM of blots and are normalised to adherent controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05 compared with adherent controls.

103

4.2. Regulation of MSC inflammatory secretome by selected cytokines

To determine which cytokines may be important in regulating MMP expression in MSC spheroids, adherent MSCs cultured for 5 days were stimulated with 50ng/ml of recombinant human IL-1α, IL-1β, TNFα, IFNγ, IL-6, IL-8, IL-17A or IL-17E for 3 hours. Protein expression of MMP-1 and MMP-3 were tested as expression of these MMPs was induced at the protein level by conditioned medium from 5 day spheroids (figure 4.2. above). Controls show adherent MSCs cultured in serum free conditions for 3 hours.

4.2.1. Regulation of p65 and STAT-3 signalling

Stimulation of MSCs with IL-1α, IL-1β or TNFα resulted in a significant increase in phosphorylated p65 (p-p65) levels resulting in 10-15x more p65 activation compared with unstimulated MSCs (p<0.001) (figure 4.3.). Additionally, there was a slight non-significant decrease in phosphorylated STAT-3 (p-STAT-3) when MSCs were stimulated with IL-1α, IL-1β and TNFα compared with unstimulated MSCs. Stimulation of MSCs with IFNγ significantly increased p-STAT-3 levels compared with unstimulated MSCs.

4.2.2. Regulation of TSG-6 and COX-2 expression

Stimulation of MSCs with IL-1α (p<0.001), IL-1β (p<0.001) or TNFα (p<0.01) resulted in a significant increase in TSG-6 expression resulting in an approximately 6x higher protein level compared with unstimulated MSCs (figure 4.4.). Furthermore, stimulation of MSCs with IL-1α (p<0.01), IL-1β (p<0.05) and TNFα (p<0.05) resulted in a significant increase in COX-2 protein expression, approximately doubling the COX-2 protein level compared to unstimulated cultures.

104

Fig. 4.3. Western blot analysis of p65 and STAT-3 activation in MSCs stimulated with selected recombinant human cytokines MSCs were cultured as adherent cells for 3 days and stimulated with 50ng/ml of recombinant cytokine for 30 minutes. Western blot analysis of p-p65 and p- STAT-3 expression. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean densitometry values ± SEM of blots and are normalised to adherent controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05 compared with adherent controls.

105

Fig. 4.4. Western blot analysis of p65 and STAT-3 activation in MSCs stimulated with selected recombinant human cytokines MSCs were cultured as adherent cells for 3 days and stimulated with 50ng/ml of recombinant cytokine for 30 minutes. Western blot analysis of TSG-6 and COX-2 expression. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean densitometry values ± SEM of blots and are normalised to adherent controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with adherent controls.

106

4.2.3. Regulation of MMP-1 and MMP-3 expression

Stimulation of MSCs with IL-1α, IL-1β or TNFα resulted in significant increase in MMP-1 protein expression (p<0.001). While stimulation with IL-1α and IL- 1β resulted in approximately 10x MMP-1 protein level compared to unstimulated cultures, stimulation of MSCs with TNFα resulted in an approximately 15x higher level of MMP-1 compared with unstimulated MSCs. MSC-derived MMP-3 protein expression was not significantly increased by stimulation with any cytokine.

4.2.4. Summary

In summary, stimulation of MSCs with 50ng/ml of the pro-inflammatory cytokines IL-1α, IL-1β or TNFα resulted in activation of the p65 pathway which regulates expression of MMPs. There was a slight but insignificant decrease STAT-3 activation which together resulted in significant increases in TSG-6, COX-2, and MMP-1 protein expression.

107

Fig. 4.5. Western blot analysis of MMP-1 and MMP-3 activation in MSCs stimulated with selected recombinant human cytokines MSCs were cultured as adherent cells for 3 days and stimulated with 50ng/ml of recombinant cytokine for 30 minutes. Western blot analysis of MMP-1 and MMP-3 expression. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean densitometry values ± SEM of blots and are normalised to adherent controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with adherent controls.

108

4.3. Spheroid derived MMP expression is regulated by IL-1RI and TSG-6

The conditioned media and cytokine stimulation experiments have shown that MMP expression is driven by cytokines such as IL-1 and TNFα in MSCs. Furthermore, the results from chapter 1 have shown that MSC spheroids express TNFα at a similar level to MSCs in adherent cultures and at very low levels overall. Thus it was hypothesised that members of the IL-1 family are key drivers of MMP expression in MSC spheroids. TSG-6 expression is also highly upregulated in MSC spheroids however little is known about the role TSG-6 plays in MSC spheroid biology. Studies have indicated that TSG-6 plays an important role in ECM turnover, but there have been few studies that have investigated whether TSG-6 regulates MMP expression. Therefore, to confirm that IL-1 is a key driver of MMP expression in MSC spheroids, and to delineate a role for TSG-6 in spheroid biology, MSCs were cultured as spheroids for 5 days in the presence of IL-1RI or TSG-6 siRNA to specifically knockdown these genes. Control spheroids were cultured in the presence of scrambled siRNA which does not target any gene. In this section, blots show only the proteins of interest, however all blots were run on the same gel and are shown in full in the Appendices.

4.3.1. IL-1RI and TSG-6 regulate cytokine expression by MSC spheroids

Knockdown of TSG-6 and IL-1RI resulted in significant decreases in their respective mRNA expressions (p<0.001) (figure 4.6A) confirming knockdown efficacy. IL-1RI knockdown also significantly decreased TSG-6 mRNA expression (p<0.05). Surprisingly, knockdown of TSG-6 decreased IL-1RI mRNA expression; this effect was validated using an alternative TSG-6 siRNA (not shown). The effects of TSG-6 and IL-1RI knockdown on TSG-6 levels were confirmed at the protein level (figure 4.6B). To further confirm IL-1RI knockdown efficacy, expression of downstream IL-1 regulated cytokines was investigated (figure 4.6C). Knockdown of IL-1RI significantly decreased mRNA expression of IL-1α, IL-1β, IL-8, and COX-2 (p<0.001). Surprisingly,

109 knockdown of TSG-6 also significantly decreased mRNA expression of the same genes (p<0.001) indicating a vital role for TSG-6 in the inflammatory secretome of MSC spheroids. Finally, knockdown of both TSG-6 and IL-1RI resulted in a significant decrease in COX-2 protein expression (p<0.01 and p<0.001 respectively) (figure 4.6D) while IL-8 protein was not detected after TSG-6 or IL-1RI knockdown (figure 4.6E).

Fig. 4.6. Regulation of cytokine expression by TSG-6 and IL-1RI in MSC spheroids MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), TSG-6 (light blue bars) or IL-1RI (turquoise bars) siRNA. A and C mRNA expression analysis of TSG-6, IL-1RI, IL-1A, IL-1B, IL-8, and COX-2. B, D and E Western blot analysis of TSG-6, COX-2 and IL-8. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post- hoc analysis. ND = not detected; **=p<0.01; ***=p<0.001 compared with scrambled controls. See appendix 5 for full blots.

110

4.3.2. IL-1RI and TSG-6 regulate MMP expression by MSC spheroids

Knockdown of TSG-6 and IL-1RI caused significant decreases in MMP-1 and MMP-3 mRNA expression (p<0.05) whereas only TSG-6 knockdown resulted in a significant decrease in MMP-13 mRNA expression (p<0.05) (figure 4.7A). Surprisingly, knockdown of TSG-6, but not IL-1RI, resulted in a significant increase in MMP-9 mRNA expression (p<0.001). Similarly, at the protein level, knockdown of TSG-6 and IL-1RI resulted in significant decreases in MMP-1 (p<0.05) and MMP-3 (p<0.001) protein expression, with no change in MMP- 13 protein expression, whereas knockdown of TSG-6 resulted in a significant increase in MMP-9 protein (p<0.05) (figure 4.7B).

111

Fig. 4.7. Regulation of MMP expression by TSG-6 and IL-1RI in MSC spheroids MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), TSG-6 (light blue bars) or IL-1RI (turquoise bars) siRNA. A mRNA expression analysis of MMP-1, -3, -9, -10, and -13. B Western blot analysis of MMP-1, -3, -9, and -13. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with scrambled controls. See appendix 5 for full blots.

112

4.3.3. IL-1RI and TSG-6 regulate p65 and STAT-3 signalling activation

Knockdown of IL-1RI but not TSG-6 resulted in a significant decrease in p-p65 (p<0.05) (figure 4.8A). In contrast, knockdown of TSG-6 but not IL-1RI resulted in a significant increase in p-STAT-3 (p<0.05) correlating with the increase in MMP-9 protein expression seen in TSG-6 knockdown spheroids.

To determine whether IL-1α or IL-1β have differing roles in regulating the inflammatory properties of MSC spheroids, MSC were cultured as spheroids for 5 days in the presence of IL-1α or IL-1β siRNA (figure 4.8B). Neither siRNA significantly decreased IL-1α or IL-1β although both resulted in small decreases in their respective mRNA expressions. Despite this, knockdown of IL-1α resulted in a significant decrease in MMP-1 and MMP-13 mRNA expression (p<0.05) and knockdown of IL-1β resulted in a significant increase in MMP-3 mRNA expression (p<0.01) suggesting these key cytokines may have differing roles in MSC spheroid biology.

4.3.4. Summary

In summary, these experiments have shown that IL-1RI and TSG-6 potently regulate the expression of MMPs in MSC spheroids (figure 4.8C). As hypothesised, knockdown of IL-1RI decreased IL-1α and IL-1β mRNA, the IL- 1 driven cytokines IL-8 and COX-2 and decreased p-p65 levels. Furthermore, knockdown of IL-1RI also decreased MMP-1 and MMP-3 protein levels showing that IL-1 is a key driver of MMP expression, probably via the p65 pathway.

Surprisingly, TSG-6 also had an important role in regulating MMP expression. Knockdown of TSG-6 decreased MMP-1 and MMP-3 protein, apparently through a non p65-mediated pathway, but also significantly increased MMP-9 protein expression correlating with an increase in STAT-3 activation in TSG-6 knockdown spheroids.

113

Fig. 4.8. Regulation of p65 and STAT-3 activation by TSG-6 and IL-1RI in MSC spheroids MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), TSG-6 (light blue bars) or IL-1RI (turquoise bars) siRNA. A Western blot analysis of p-p65 and p-STAT-3. Blots shown are representative of 3 individual experiments using different donor MSCs. B mRNA expression analysis of IL-1, MMP-1, -3, -9, and -13. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with scrambled controls. C Mechanism of IL-1 and TSG-6-induced regulation of MMP expression in MSC spheroids. See appendix 5 for full blots. 114

4.4. The inflammatory secretome of MSC spheroids is regulated by MMPs

The experiments in section 4.3. showed that when MMP-1 or MMP-3 expression is low there are low levels of the anti-inflammatory enzyme COX- 2. Conversely, when MMP-9 expression is high there are low levels of the anti- inflammatory enzyme COX-2. Therefore, to determine whether MMPs themselves play a role in the regulation of the inflammatory secretome of MSCs, spheroids were treated with siRNA against MMP-1, MMP-3 or MMP-9. MSCs were also treated with siRNA against MMP-8 and MMP-13. MMP-8 and MMP-13 are members of the same family of MMPs as MMP-1, the collagenases, and their expressions were shown to be upregulated in spheroids compared to adherent cultures. These MMPs were thus knocked down to determine whether collagenases share a similar function in the regulation of the MSC inflammatory secretome. No concentration of siRNA was effective at knocking MMP-13 down (appendix 4) thus results for MMP- 13 knockdown are not shown in this chapter. Control MSCs were treated with scrambled siRNA that doesn’t target any gene.

4.4.1. MMP-1 and MMP-9 regulate expression of one another

Knockdown of MMP-1, -3, -8 or -9 resulted in significant decreases in mRNA expression of the respective MMP being knocked down (figure 4.9A) thus confirming knockdown efficacy. Strikingly, knockdown of MMP-1 also resulted in a significant increase in MMP-9 mRNA expression (p<0.001) while knockdown of MMP-9 resulted in a significant increase in MMP-1 mRNA expression (p<0.01).

Knockdown of MMP-1, -3, -8, or -9 resulted in a similar pattern at the protein level (figure 4.9B). Knockdown of MMP-1 or MMP-8 resulted in a significant decrease in MMP-1 protein level. Conversely, knockdown of MMP-9 significantly increased MMP-1 protein levels (p<0.05). Knockdown of MMP-3 or MMP-8 significantly decreased MMP-3 protein levels (p<0.001) whereas

115 knockdown of MMP-3 or MMP-9 significantly decreased MMP-9 protein levels (p<0.05). However, knockdown of MMP-1, but not MMP-8, resulted in a significant increase in MMP-9 protein levels (p<0.01) suggesting differing roles for these two collagenases. Unfortunately, MMP-8 protein was not detected using 2 different antibodies (not shown).

116

Fig. 4.9. Regulation of MMP expression by MMPs in MSC spheroids MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), MMP-1, -3, -8, or -9 siRNA. A mRNA expression analysis of MMP-1, -3, -8 and -9. B Western blot analysis of MMP-1, -3 and -9. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post- hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with scrambled controls.

117

4.4.2. MMP-1 and MMP-9 drive anti-inflammatory TSG-6 and COX-2 expression whereas MMP-9 inhibits TSG-6 expression

To determine whether MMPs alter the inflammatory secretome of MSC spheroids the expression of IL-1A, IL-1B, TSG-6 and COX-2 were assessed in knockdown spheroids (figure 4.10A). Knockdown of MMP-8 significantly decreased IL-1A mRNA expression (p<0.05) whereas knockdown of MMPs-1, -3 or -8 decreased IL-1B mRNA expression suggesting that MMPs differentially regulate expression of IL-1A and IL-1B. Concomitant with a decrease in IL-1B mRNA expression, knockdown of MMP-1 or MMP-8 significantly decreased TSG-6 (p<0.01) and COX-2 (p<0.001) mRNA expression. Surprisingly, knockdown of MMP-9 increased TSG-6 mRNA expression (p<0.01) but had no significant effect on any of the other cytokines tested.

Protein levels of TSG-6, COX-2 and levels of the COX-2-derived anti- inflammatory product PGE2 were assessed (figure 4.10B-4.10C). The protein changes followed a similar pattern to mRNA changes with knockdown of MMP-

1 and MMP-8 significantly decreasing both TSG-6, COX-2 and PGE2 levels whereas knockdown of MMP-9 significantly increased expression of TSG-6 levels in MSC spheroids. Knockdown of MMP-8 also significantly decreased IL-8 protein expression while no MMP altered anti-inflammatory IL-4 or IL-10 expression (annex).

118

Fig. 4.10. Regulation of cytokine expression by MMPs in MSC spheroids MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), MMP-1, -3, -8, or -9 siRNA. A mRNA expression analysis of IL-1A, IL-1B, TSG-6 and COX-2. B Western blot analysis of TSG-6 and COX- 2. Blots shown are representative of 3 individual experiments using different donor MSCs. C PGE2 Parameter Assay of conditioned medium from knockdown spheroids. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with scrambled controls. See appendix 6 for regulation of IL-8, IL-4, and IL-10.

119

4.4.3. Knockdown of MMP-1 and MMP-3 alter p65 and STAT-3 signalling pathway activation

The ability of MMPs to alter the signalling pathways p65 and STAT-3 was also assessed (figure 4.11A). Knockdown of MMP-1, -3 or -8 significantly attenuated p65 signalling activation marked by phosphorylation of p65. Conversely, knockdown of MMP-1 or MMP-8 significantly increased STAT-3 signalling activation marked by p-STAT-3. Surprisingly, knockdown of MMP-9 had a slight inhibitory effect on p65 activation and a slight activating effect on STAT-3 signalling however neither of these effects reached significance.

4.4.4. Summary

In summary, knockdown of MMP-1 or MMP-8 resulted in spheroids with a very similar phenotype. However, knockdown of MMP-1 increased mRNA and protein expression of MMP-9 and this effect was not observed in MMP-8 knockdown spheroids. This suggests that on the whole collagenases may share some similar mechanisms but there are key differences between individual collagenases. For example, it appears that both MMP-1 and MMP- 8 are critical for the expression of TSG-6 and COX-2 in MSC spheroids and this may be achieved through activation of the p65 pathway and inhibition of the STAT-3 signalling pathway (figure 4.11B). Conversely, the gelatinase MMP-9 appears to have the opposite effect to MMP-1 by exhibiting an inhibitory effect on the expression of TSG-6 whilst having a negligible effect on protein expression of COX-2.

120

4.11 Regulation of signalling pathway activation by MMPs in MSC spheroids MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), MMP-1, -3, -8, or -9 siRNA. A Western blot analysis of p-p65 and p-STAT-3. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01; ***=p<0.001 compared with scrambled controls. B Potential mechanism of MMP-1, -8 and -9 effects on the inflammatory secretome of MSC spheroids.

121

4.5. Effect of recombinant MMPs on MSC spheroids

The experiments in section 4.4. show that knockdown of specific MMPs, in particular MMP-1, MMP-8 and MMP-9 have potent effects on the anti- inflammatory phenotype of MSC spheroids. Therefore, to determine whether exogenous MMP stimulation elicited a corresponding effect, MSC spheroids were stimulated with recombinant MMPs for 3 hours in serum-free conditions (figure 4.12). Stimulation of MSCs with 5nM recombinant MMP-9 caused a significant decrease in TSG-6 and COX-2 protein expression (p<0.05 and p<0.01 correspondingly). Interestingly, stimulation of MSC spheroids with MMP-8 resulted in a small decrease in COX-2 protein expression, although this was not significant. Furthermore, preliminary data show that stimulation of MSCs with 2.5nM or 10nM had no further effect on MSC spheroids (data not shown; n=1).

122

4.12. Regulation of TSG-6 and COX-2 expression in MSC spheroids by recombinant MMPs MSCs were cultured as spheroids for 5 days. After 5 days spheroids were washed in serum-free medium 3 times and cultured in serum-free medium for a further 3 hours in the presence of 5nM recombinant MMP. Western blot analysis of TSG-6, COX-2, p-p65 and p-STAT-3. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; **=p<0.01 compared with serum free controls.

123

4.6. Summary

The regulation of the expression of the anti-inflammatory factor TSG-6 in MSC spheroids formed using the hanging drop method has previously been shown to be regulated by IL-1 (Ylostalo et al. 2012; Bartosh et al. 2013). However, little is known about what regulates the expression of MMPs in MSC spheroids. Therefore, the aim of this chapter was to determine whether MMP expression is regulated by secreted factors in MSC spheroids and whether MMPs themselves control the inflammatory secretome of MSC spheroids.

In the first set of experiments, MSCs cultured as adherent cells in the presence of conditioned medium taken from MSC spheroids cultured for 5 days upregulated the mRNA expression of MMPs-1, -3, -9, and -10 (fig 4.1) and upregulated the protein expression of MMPs-1 and -3 (fig 4.2) thus showing that secreted factors regulate MMP expression. Importantly, MMP-1 mRNA expression was the most potently upregulated MMP tested by conditioned medium taken from 5-day cultured spheroids suggesting that MMP-1 may be more sensitive to inflammatory factors than the other MMPs tested. Protein expression of all MMPs tested was low in all conditions which is likely due to the low levels of MMP protein adherent MSCs express combined with the relatively short time that the MSCs were stimulated with conditioned medium. However, stimulation of adherent MSCs with 5-day conditioned medium resulted in a clear upregulation of MMP-1 and MMP-3 protein expression.

Furthermore, as a control, adherent cultures were also stimulated with conditioned medium taken from MSC spheroids cultured for 1 day. However, 1-day conditioned medium had no effect on the mRNA expression of any MMP and although there was a slight increase in the protein level of MMP-13 corresponding to the 65kDa pro-MMP-13 after stimulation with 1-day conditioned medium, this did not reach significance. Together, these results show that MMP expression, particularly MMP-1 and MMP-3, is regulated at

124 least in part by a secreted factor that is present in conditioned medium taken from MSC spheroids cultured for 5 days but not cultured for 1 day. To determine which secreted factor(s) may be important for regulating expression of MMPs in MSCs, adherent MSCs were stimulated with 50ng/ml of individual recombinant cytokines (fig 4.3-4.5). In agreement with Bartosh et al., (2013), IL-1α, IL-1β and TNFα upregulated the expression of TSG-6 and COX-2. IL-1α, IL-1β and TNFα also all showed strong stimulatory effects on MMP-1 and MMP-3 expression, the two MMPs most sensitive to being upregulated in the conditioned medium experiments. Furthermore, IL-1α, IL- 1β and TNFα also activated the p65 pathway known to upregulate MMP expression and showed slight inhibitory effects on STAT-3 activation. This suggests a possible feedback mechanism whereby when the p65 pathway is active, the STAT-3 pathway is inactive. Additionally, activation of the p65 pathway may thus be associated with expression of TSG-6 and an anti- inflammatory MSC spheroid phenotype, while activation of STAT-3 may be associated with a pro-inflammatory MSC spheroid phenotype with low levels of TSG-6 expression.

To investigate further the role of IL-1α, IL-1β and the anti-inflammatory cytokine TSG-6 in regulating the inflammatory phenotype of MSCs, spheroids were treated with IL-1RI or TSG-6 siRNA to knockdown the expression of these proteins (fig 4.6). Knockdown efficiency was confirmed and surprisingly knockdown of IL-1RI and TSG-6 showed very similar effects at the mRNA and protein levels. IL-1 is characteristically considered a pro-inflammatory cytokine however these results suggest that IL-1 promotes an anti-inflammatory phenotype in MSCs due to its ability to stimulate TSG-6 and COX-2 and because MSC spheroids treated with either TSG-6 or IL-1RI siRNA share a similar phenotype.

These results therefore show for the first time that TSG-6 has an integral role in defining the inflammatory phenotype of MSC spheroids. Knockdown of TSG-6 results in decreased mRNA expression of IL-1, thus abrogating the ability of IL-1 to stimulate TSG-6 and other anti-inflammatory factors such as COX-2. Furthermore, knockdown of TSG-6 and IL-1RI decreased the 125 expression of MMP-1 and MMP-3 and had no effect on MMP-13. Interestingly, knockdown of TSG-6 increased expression of MMP-9 in MSC spheroids. Knockdown of IL-1RI but not TSG-6 significantly decreased activation of the p65 pathway. Conversely, knockdown of TSG-6 but not IL-1RI significantly increased activation of the STAT-3 pathway further implicating these two pathways in the regulation of the inflammatory phenotype of MSC spheroids.

Together these results also suggest a mechanism whereby knockdown of IL- 1RI or TSG-6 abrogates the anti-inflammatory phenotype of MSC spheroids, characterised by TSG-6 and COX-2 protein expression. These anti- inflammatory-abrogated spheroids are also characterised by either low activation of the p65 pathway or increased activation of the pSTAT-3 pathway and also low levels of MMP-1 and MMP-3 and high levels of MMP-9 suggesting that MMPs themselves may also define the inflammatory phenotype of MSC spheroids.

Thus MSC spheroids were cultured in the presence of siRNA against MMPs- 1, -3, -8, and -9. MSCs were cultured in the presence of siRNA against MMP- 8 as a control. Expression of MMP-8 was very low at the mRNA level in both adherent and spheroid MSCs and was thus expected to have a negligible role in the regulation of the inflammatory phenotype of MSC spheroids.

Knockdown of specific MMPs had potent effects on the expression of other MMPs. Most notably, knockdown of MMP-1 caused an increase in MMP-9 expression while knockdown of MMP-9 caused an increase in MMP-1 expression further suggesting these two MMPs have opposing roles. Surprisingly, knockdown of MMP-8 also affected expression of other MMPs by decreasing MMP-1 and MMP-3 protein expression, but not affecting MMP-9 expression suggesting MMP-1 induced upregulation of MMP-9 may occur via another factor which remains unaffected by MMP-8 knockdown.

Most importantly, the MMP knockdown experiments show a clear effect on the inflammatory phenotype of MSC spheroids. Knockdown of MMP-1 significantly decreased expression of TSG-6 and COX-2, mirroring the effects of TSG-6 126 and IL-1RI knockdown, whereas knockdown of MMP-9 had no effect on COX- 2 expression, but significantly increased TSG-6 expression. This suggests MMP-9 may act as an anti-inflammatory “brake” by inhibiting the expression of TSG-6 in MSC spheroids. Furthermore, knockdown of MMP-1, like knockdown of TSG-6 caused a significant increase in STAT-3 activation which has previously been observed in anti-inflammatory-abrogated spheroids.

Interestingly, knockdown of MMP-8 had very similar effects to knockdown of MMP-1 despite the very low MSC spheroid levels of MMP-8. This suggests that MMPs in the same family, in this case the collagenases, may act similarly in regulating the anti-inflammatory phenotype of MSC spheroids. It is tempting to speculate that these alterations in inflammatory phenotypes caused by MMP knockdown may thus be mediated by MMP-driven catalysis of ECM cleavage.

MSC spheroids were next cultured in the presence of recombinant MMP to determine whether exogenous MMP was also able to regulate the inflammatory phenotype of MSC spheroids. MMPs were enzymatically activated using APMA and cultured in the presence of MSC spheroids. Interestingly, only stimulation of spheroids with 5nM MMP-9 showed any effects. In agreement with the siRNA knockdown experiments, stimulation with exogenous MMP-9 significantly decreased MSC spheroid expression of TSG- 6. Unexpectedly, stimulation of spheroids with MMP-9 also significantly decreased anti-inflammatory COX-2 protein expression reinforcing the possibility that MMP-9 is a key driver in abrogating the anti-inflammatory effects of MSC spheroids.

Stimulation of spheroids with other recombinant MMPs showed no effect on TSG-6 or COX-2 protein expression or p65 or STAT-3 activation. This raises the possibility that MMPs-1, -3, and -8 exert their effects through cleavage of extracellular matrix proteins to release matrikines which bind to cell receptors and induce gene expression whereas MMP-9 may directly bind to cell receptors. However, a pilot study investigating earlier time points after MMP- 9 stimulation showed no significant effects on STAT-3 or p65 activation. 127

Further studies could investigate whether non-catalytically activated recombinant MMP-9 is able to reduce TSG-6 and COX-2 protein expression and investigate longer stimulation times for MMPs-1, -3 and -8 stimulation.

Together the results from this chapter show that MSC spheroids can be broadly classified into two inflammatory phenotypes; anti-inflammatory MSC spheroids characterised by high levels of MMP-1, TSG-6 and COX-2 and low levels of MMP-9 and anti-inflammatory-abrogated MSC spheroids characterised by low levels of MMP-1, TSG-6 and COX-2 and high levels of MMP-9. Furthermore, knockdown of MMP-9 increases the expression of the anti-inflammatory factor TSG-6 in MSC spheroids and thus may be a target for increasing the anti-inflammatory effects of MSC spheroids.

128

Chapter 5: Optimising conditions for assessing the in vivo anti-inflammatory potential of MSC spheroids

129

5. Optimising conditions for assessing the in vivo anti-inflammatory potential of MSC spheroids

The previous chapters have highlighted the importance of MMPs in regulating the anti-inflammatory properties of MSC spheroids in vitro. For example, knockdown of MMP-1 decreases anti-inflammatory TSG-6 and COX-2 protein expression, whereas knockdown of MMP-9 increases anti-inflammatory TSG- 6 production in spheroids. However no study has investigated whether MMP knockdown spheroids may increase the anti-inflammatory effects of MSC spheroids in vivo. Furthermore, previous studies have used catheters to inject spheroids into mice which when translated to humans may lead to low levels of patient compliance and require specialist training to administer spheroids as a treatment. Therefore, the aim of this chapter was to optimise the conditions for assessing the in vivo capacity of MMP knockdown spheroids using the zymosan-induced peritonitis model of inflammation and to optimise the method of administering spheroids for future therapy.

5.1. Characterisation of macrophage response to spheroid conditioned medium

To determine whether MSC spheroids cultured in low-cell binding microwells were able to induce an anti-inflammatory response in macrophages, J774.2 murine macrophages were treated with LPS, a pro-inflammatory agent isolated from gram-positive bacteria cells walls. Some of the stimulated macrophages were cultured in the presence of different concentrations of conditioned medium taken from 5-day spheroids at varying concentrations (figure 5.1). Pro-inflammatory macrophages are characterised by high levels of TNFα whereas anti-inflammatory macrophages are characterised by high levels of IL-1 receptor antagonist (IL-1Ra).

Macrophages stained positive for the characteristic CD68 macrophage marker. Macrophages stimulated with LPS and treated with conditioned

130 medium from spheroids at a 1:10 ratio (i.e. 1 part conditioned medium to 10 parts macrophage medium) exhibited a significantly decreased level of TNFα compared with macrophages stimulated with LPS alone (p<0.05). Furthermore, macrophages subjected to the same conditions exhibited a significantly increased level of IL-1Ra compared to macrophages stimulated with LPS only (p<0.001). Other concentrations of conditioned medium had no significant effect on the levels of TNFα or IL-1Ra. Therefore, future in vitro macrophage conditioned medium experiments were performed using MSC spheroid conditioned medium at a 1:10 ratio.

131

Figure 5.1. Macrophages respond to increasing concentrations of spheroid conditioned medium Macrophages were cultured for 2-3 days until confluent and 100,000 macrophages were seeded into individual wells of 24-well plates. Macrophages were stimulated with 1µg/ml LPS for 10 minutes before being washed and the appropriate concentration of conditioned medium was added. LPS only controls were also treated with basal medium used to grow MSC spheroids. A Immunofluorescence of macrophages cultured after 2-3 days showing characteristic CD68 staining. n = 2 technical repeats B ELISA analysis of TNF and IL-1Ra after LPS and conditioned medium treatments. n = 3 biological repeats using conditioned medium from different MSC donors. Graphs show mean ± SEM of three individual experiments using conditioned medium from different MSC donors. Significance was determined using one- way ANOVA with Holm-Sidak post-hoc analysis. Scr = Scrambled; *=p<0.05; ***=p<0.001 compared with LPS only controls.

132

5.2. Conditioned medium from MMP-1 knockdown spheroids is unable to abrogate the effects of LPS

To determine whether conditioned medium from MMP knockdown spheroids alters macrophage polarisation, macrophages were stimulated with LPS and treated with conditioned medium from MMP-1, -3, -8 or -9 knockdown spheroids cultured for 5 days (figure 5.2). Assessing the polarisation of macrophages is an effective way of determining whether MSC spheroids will exert an anti-inflammatory effect in vivo. Importantly, LPS-stimulated macrophages treated with conditioned medium from MMP-1 knockdown spheroids exhibited significantly higher levels of the characteristic pro- inflammatory cytokines TNFα (p<0.05), IL-6 (p<0.05) and IL-12 (p<0.05) and significantly lower levels of the anti-inflammatory cytokine IL-1Ra (p<0.05) compared with LPS-stimulated macrophages treated with conditioned medium from scrambled siRNA spheroids. Surprisingly, conditioned medium from MMP-8 knockdown spheroids had no effect on macrophages.

However, LPS-stimulated macrophages treated with conditioned medium from MMP-9 knockdown spheroids exhibited significantly lower levels of TNFα (p<0.05) than macrophages treated with conditioned medium from scrambled siRNA treated spheroids. Conditioned medium from MMP-9 knockdown spheroids had no effect on IL-1Ra expression.

133

IL-6 TNF concentrationTNF (pg/ml) IL-6 Concentration(pg/ml) d PS te L d S 1 3 -8 9 la e P P P- u mbled t L a MMP-1 MMP-3 MMP-8 MMP-9 M M m ula MMP- MMP- M M Scr tim crambled S Unsti ns U

150 IL-12

100

S -1 3 ted led P P- la LP b m MM MM MMP-8 MMP-9 ra Sc Unstimu

Figure 5.2. Effects of conditioned medium from MMP knockdown spheroids on LPS-stimulated macrophages Macrophages were cultured for 2-3 days until confluent and 100,000 macrophages were seeded into individual wells of 24-well plates. Macrophages were stimulated with 1µg/ml LPS for 10 minutes before being washed and the conditioned medium from MMP knockdown spheroids was added. LPS only controls were also treated with basal medium used to grow MSC spheroids. n = 3 biological repeats using conditioned medium from different MSC donors. Graphs show mean ± SEM of three individual experiments using conditioned medium from different MSC donors. Significance was determined using one-way ANOVA with Holm-Sidak post- hoc analysis. *=p<0.05; ***=p<0.001 compared with conditioned medium from scrambled siRNA controls.

134

5.3. Optimisation of zymosan-induced peritonitis conditions

To determine whether MSC spheroids were able to induce their anti- inflammatory effect in vivo, a model of zymosan-induced peritonitis was used. Mice were injected intra-peritoneally with zymosan at different concentrations to determine which concentration induced inflammation. Mice were sacrificed after 3 hours and peritoneal exudate was assessed for cytokine levels.

Mice treated with 250μg of zymosan exhibited clear signs of inflammation (figure 5.3). Levels of TNFα and IL-6 were highly significantly increased (p<0.001) in mice treated with 250μg of zymosan. Furthermore, levels of IL-12 (p<0.01) and IL-1Ra (p<0.05) were also significantly increased in 250μg- treated mice. Surprisingly, no other concentration of zymosan was able to induce inflammation in mice. However, 50μg of zymosan resulted in a slight non-significant increase in TNFα expression. In conclusion, future in vivo experiments were performed using 250μg of zymosan.

135

*** *** IL-6 concentrationIL-6 (pg/ml) TNFa Concentration(pg/ml) 0 0 0 10 50 10 50 25 250

** IL-1Ra Concentration (pg/ml) 0 0 0 0 0 0 1 5 5 10 50 2 25

Figure 5.3. Effects of increasing concentrations of intra-peritoneal injection of zymosan Mice (n=3/4 per group) were injected with different concentrations of zymosan and sacrificed after 3 hours. Peritoneal lavage fluid was collected and assayed for levels of the different cytokines shown. Mice injected with 0μg were injected with vehicle (PBS) as a control. Graphs show mean ± SEM. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; ***=p<0.001 compared with 0μg zymosan controls.

136

5.4. Increasing spheroid number decreases the pro- inflammatory response to zymosan in zymosan-induced peritonitis

Mice were treated with 250μg of zymosan and injected with increasing numbers of 5,000 cell spheroids (figure 5.4). Injection of 10 or 20 spheroids caused significant decreases in the pro-inflammatory cytokines TNFα (p<0.05), IL-6 (p<0.05), and IL-12 (p<0.05) compared with zymosan + vehicle treated controls. Surprisingly, injection of 10 or 20 spheroids also resulted in small, but non-significant decreases in IL-1Ra expression.

Together these results suggest that MSC spheroids formed using low-cell binding microplates exhibit anti-inflammatory effects in vivo however this appears to not involve the anti-inflammatory cytokine IL-1Ra.

137

IL-6 concentrationIL-6 (pg/ml) TNFaConcentration (pg/ml) d s s s n s s d d id ed d late roi roids roi ro at roids roid roi roids u e e e e mosa e e e e h h h mul y h h tim Zymosanp p i pheroidsZ p p sp s s sph st s s s + 5 0 Uns + 10 Un 2 + + 20 + 10 sph+ n ted + n an a s mosan o osan y Z Zymosan + 5 ym nstimulated Zym Zymosa nstimul ZymosaZ Zymosan + 40 sph U U

d s s te d id la osan u eroids heroids ym h m Z pheroi phero sp s + 0 s Unsti d 2 te + la san + 5 an u san + 10 sp o tim ymo s Z n Zym Zymos U

Figure 5.4. Effects of increasing number of spheroids injected in mice Mice (n=3/4 per group) were injected with 250μg zymosan and different numbers of 5,000 cell spheroids and sacrificed after 3 hours. Unstimulated represents mice injected with 0μg of zymosan. Unstimulated + spheroids represents mice injected with 0μg of zymosan and 40 5,000 cell spheroids. Peritoneal lavage fluid was collected and assayed for levels of the different cytokines shown. Graphs show mean ± SEM. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05; ***=p<0.001 compared with 0μg zymosan controls.

138

5.5. Optimisation of spheroid imaging for in vivo applications

To understand fully how MSC spheroids are acting in vivo it would be beneficial to remove spheroids from a tissue and analyse them for changes in their RNA expression profile. Therefore, spheroids need to be trackable in vivo. To test this, MSCs were transduced with a vector made in-house that expresses both NanoLuc® luciferase and infra-red fluorescent protein that fluoresces at 670nm (figure 5.5). MSCs transduced with the virus were sorted and gated based on their fluorescence at 670nm. Cells were frozen and remained 98% positive for fluorescence at 670nm when reseeded showing that the virus fully integrated into the MSCs (MSC670+).

To test the fluorescence intensity of the cells, MSCs670+ were formed into 5,000, 10,000 or 20,000 cell spheroids and cultured for 5 days (figure 5.5B). Different numbers of spheroids were placed into black-bottom plates and analysed for infra-red fluorescence and bioluminescence using an IVIS spectrum in vivo imaging system. There is little difference in the fluorescence intensity when measuring the strength of the 670nm signal across different spheroid sizes and numbers, however the bioluminescence signal which measures the NanoLuc® luciferase strength increased with increasing spheroid number and increasing spheroid size. Both infra-red and bioluminescence signals were clearly higher than the negative control.

Therefore, an in vivo experiment was performed whereby 20 10,000-cell MSC670+ spheroids were injected subcutaneously into mice (figure 5.5C). After 2 days the mice were anaesthetised and analysed for fluorescence and bioluminescence. Surprisingly, neither fluorescence nor bioluminescence was detected in these mice.

139

Figure 5.5. Optimisation of conditions for in vivo spheroid imaging A MSCs were transduced with an expression vector containing infra-red fluorescent protein and NanoLuc® luciferase. MSCs were sorted based on their fluorescence at 670nm. B MSCs670+ were formed into 5,000, 10,000, and 20,000-cell spheroids and cultured for 5 days. After 5 days, different numbers of spheroids were placed into black-bottom culture plates, treated with Luciferin and analysed using an IVIS spectrum in vivo imaging system. C Some MSCs670+ were formed into spheroids which were injected subcutaneously into mice. After 2 days, mice were analysed for fluorescence intensity and then injected intraperitoneally with Luciferin to analyse NanoLuc® luciferase response. Mice were imaged every 3 minutes up to 50 minutes after Luciferin injection.

140

5.6. Summary

MMPs were shown to regulate the expression of the anti-inflammatory factors TSG-6 and COX-2 in MSC spheroids formed in low-cell binding microwells. However, it was not known whether the change in expression of these proteins correlated with a difference in the in vivo anti-inflammatory properties of these spheroids. Therefore, the aim of this chapter was to optimise the conditions for assessing the anti-inflammatory properties of spheroids in vivo.

The J774.2 mouse macrophage cell line was used to determine whether MSC spheroids were able to influence the polarisation of macrophages in vitro. Results showed that conditioned medium from MSC spheroids at a concentration of 1 part conditioned medium to 10 parts macrophage medium was able to significantly reduce the production of pro-inflammatory TNFα and significantly increase the production of anti-inflammatory IL-1Ra expression after LPS stimulation. Previous studies have shown that conditioned medium from hanging drop spheroids at a concentration of 1:100 exhibited a similar effect on RAW264.7 macrophages (Bartosh et al. 2010; Ylostalo et al. 2012). A different concentration may have been required to show a significant effect in this study because of the different macrophage cell line used. However, conditioned medium at a concentration of 1:100 did show a trend to decreased TNFα and increased IL-1Ra but this did not reach significance.

Importantly, no previous study has shown the effect of conditioned medium taken from MMP knockdown spheroids on the polarisation of macrophages. As expected, conditioned medium from MMP-1 knockdown spheroids which express low levels of the anti-inflammatory proteins TSG-6 and COX-2 were unable to induce anti-inflammatory macrophage polarisation as efficiently as scrambled siRNA control treated spheroids. Surprisingly, conditioned medium from MMP-8 knockdown spheroids which also express low levels of the anti- inflammatory proteins TSG-6 and COX-2 showed no difference in the ability to polarise macrophages compared to conditioned medium from scrambled siRNA-treated control spheroids. This suggests that there could be alternative

141 factors secreted by MSC spheroids that are important for the regulation of macrophage polarisation that are expressed in MMP-8 knockdown spheroids but not in MMP-1 knockdown spheroids. Alternatively, full knockdown of MMP- 8 may occur later than knockdown of MMP-1 in spheroids thus allowing residual TSG-6 and COX-2 to be expressed in MMP-8 knockdown spheroids that remains in the conditioned medium and is thus able to induce anti- inflammatory macrophage polarisation. Further studies should investigate the gene expression pattern of MMP-1 and MMP-8 knockdown spheroids at different time points to identify potential unknown anti-inflammatory regulators.

Importantly, conditioned medium from MMP-9 knockdown spheroids was able to reduce TNFα expression in LPS-stimulated macrophages to a higher degree than conditioned medium from scrambled siRNA-treated control spheroids. This provides further evidence that knockdown of MMP-9 increases the anti-inflammatory potential of MSC spheroids.

Next the in vivo model of inflammation, zymosan-induced peritonitis, was used to determine whether MSC spheroids can induce an anti-inflammatory effect in vivo. Different concentrations of zymosan were injected into the peritoneal cavity of BALB/c mice to assess the ability of zymosan to induce expression of the pro-inflammatory markers TNFα, IL-6 and IL-12 and the anti- inflammatory marker IL-1Ra. Only 250µg of zymosan was able to significantly increase expression of these proteins in this study. This falls within the normal range of 10-1000µg of zymosan that has been to induce inflammation in several other studies (Cash et al. 2009).

Previously, 25,000-cell MSC spheroids formed using the hanging drop method have been injected into the peritoneal cavity of mice using a catheter (Bartosh et al. 2010). To increase patient compliance and thus the therapeutic potential of spheroids it would be beneficial to be able to inject spheroids using a standard syringe and needle. Therefore, smaller 5,000 cell spheroids were injected into the peritoneal cavity of mice using a 24g needle and tested for their ability to induce an anti-inflammatory effect in response to zymosan. Importantly, injection of either 10 or 20 5,000 cell spheroids significantly 142 decreased the levels of TNFα, IL-6 and IL-12 produced by mice in response to zymosan. This shows that smaller spheroids are able to induce a therapeutic effect in vivo and show the huge therapeutic potential these spheroids have. Further studies should investigate whether knockdown of selected MMPs (such as MMP-9) further increases the therapeutic efficacy of MSC spheroids.

Finally, it will be important to track spheroids in initial in vivo studies to determine whether spheroids remain at the injection site or localise elsewhere. In this regard, MSCs were transduced with an expression vector containing infra-red fluorescent protein and NanoLuc® luciferase. This should enable spheroids to be viewed localised subcutaneously and in tissues. Spheroids were detectable in vitro after transduction at all sizes and numbers tested. Thus 20 5,000 cell spheroids were injected subcutaneously into 4 mice and assessed for their ability to be detected in vivo. Unfortunately, spheroids were not detected 2 days after injection. This may be because the spheroids were too small, the signal was too low, or the cells from the spheroids may have died and were thus no longer expressing iRFP or NanoLuc® luciferase. Therefore, further studies should investigate the trackability of larger spheroids and/or earlier time points and/or alternative fluorescent markers to assess the in vivo localisation of spheroids after injection.

143

Chapter 6: Discussion

144

6. Discussion

MSCs have huge anti-inflammatory potential however factors that regulate the inflammatory phenotype of MSCs are not well defined. Most studies have used adherent MSC cultures to study their anti-inflammatory effects yet work by the Prockop group has shown that MSCs cultured as spheroids have a much higher anti-inflammatory potential and express higher levels of the anti- inflammatory factors TSG-6 and STC-1 (Bartosh et al. 2010; Ylostalo et al. 2012; Bartosh et al. 2013). Furthermore, results in this study show that extracellular matrix components made by MSC spheroids have specific spatial localisations which may be more representative of MSCs found in vivo. Taken together, these studies show that culturing MSCs as spheroids represents a good model for studying the inflammatory properties of MSCs and may represent an effective model for understanding inflammation more generally.

This investigation focussed on determining which factors regulate the inflammatory properties of MSC spheroids with a particular focus on MMPs. Previously our lab showed that MMP expression is upregulated at the mRNA level in MSC spheroids compared with MSCs grown in adherent cultures. Furthermore, unpublished work has shown that knockdown of some extracellular matrix components including fibronectin potently alters the inflammatory properties of MSC spheroids. Together these data suggest that altering the expression of MMPs in MSC spheroids may influence the inflammatory phenotype of spheroids.

This study used low-cell binding microplates to form MSC spheroids whereas studies by the Prockop group formed spheroids using the hanging drop method. An advantage of using low-cell binding microplates is that spheroids readily form within 2-3 hours, are uniform in size, and can be manipulated more easily due to ease of changing culture medium. In contrast, spheroids formed using the hanging drop method take approximately 24 hours to form, are heterogenous in size and shape, and cannot be manipulated as easily due to the inability to change their culture medium without rupturing the hanging

145 drop. Furthermore, this study showed that spheroids formed using low-cell binding microwells express higher levels of MMPs-1 and -3 than in spheroids formed using hanging drops and are thus more appropriate for studying the role these MMPs play in regulating the inflammatory properties of MSC spheroids.

One of the primary aims of this study was to determine the effects of culture conditions on MMP expression. Besides the increased MMP expression seen in spheroids formed using low-cell microwell plates compared with spheroids formed using the hanging drop method, this study showed that matrix formation is also subtly different between the two conditions. Furthermore, matrix deposition and MMP expression in microwell spheroids was also dependent on spheroid size and time in culture. Importantly, increasing spheroid size dose dependently increased MMP-1, -3 and -13 protein expression and compaction of spheroids. In contrast, Bartosh et al. (2010) showed that TSG-6 expression peaked in 25,000-cell MSC spheroids and was relatively low in 100,000- and 250,000-cell spheroids. Finally, no study has determined the effects of culturing spheroids in vitro for more than 5 days however this study showed that spheroids cultured for 10 days or longer exhibited severe gross morphological changes and very little difference in MMP expression compared with spheroids cultured for 5 days.

Therefore, using 60,000-cell MSC spheroids formed in low-cell binding microplates and cultured for 5 days, this study showed that MMPs-1, -3, -9, and -13 were upregulated at the protein level compared with MSCs grown in adherent cultures. Furthermore, several cytokines were also upregulated including IL-1α, IL-1β and TSG-6. Surprisingly, PD-L1 and PD-L2, cytokines previously shown to induce an anti-inflammatory effect and be expressed by adherent MSCs (Davies et al. 2017) were downregulated in MSC spheroids highlighting further differences between the two in vitro model systems.

Another key finding in this study is that gene silencing of TSG-6 potently regulates the expression of MMP-1, MMP-3 and MMP-9. Knockdown of TSG- 6 dramatically decreased MMP-1 and MMP-3 protein expression but 146 significantly increased MMP-9 expression compared with scrambled siRNA treated controls. It is now widely regarded that TSG-6 is vital for the anti- inflammatory effects of MSC spheroids (Day and Milner 2018) however it is not known why this is the case. It was previously thought that TSG-6 itself induced anti-inflammatory effects possibly by binding to macrophages and inducing M2 macrophage activation (Mittal et al. 2015). However, this study shows for the first time that TSG-6 is also essential for the expression of some MMPs and the anti-inflammatory enzyme COX-2 in MSC spheroids. Further work should investigate the mechanism of how TSG-6 regulates the expression of these proteins. For example, TSG-6 is important for the sulphation of some ECM components (Day and Milner 2018) which may allow them to act as anti-inflammatory matrikines.

The role of MMPs in regulating the inflammatory properties of MSC spheroids was also investigated. MMPs are well known for their ability to cleave ECM proteins and work is beginning to show they have important roles in regulating inflammation (Herzog et al. 1998; Peterson et al. 2000; Romanic et al. 2001; Lindsey et al. 2006; Ma et al. 2013; Redondo-Muñoz et al. 2010). However, this is the first study to show that specific MMPs have distinct roles in regulating the inflammatory properties of MSC spheroids. In particular, knockdown of MMP-1 decreased TSG-6 and COX-2 protein expression and significantly increased MMP-9 protein expression and STAT-3 activation. In contrast, and of huge therapeutic interest, knockdown of MMP-9 increased TSG-6 expression in MSC spheroids. These results are highly indicative that MMP-9 is a target for inhibition during the formation of MSC spheroids to maximise their production of anti-inflammatory TSG-6.

147

MSC Spheroid

MMP-1 MMP-9 MMP-8 p65 STAT-3

IL-1

TSG-6 COX-2 PGE2

Pro-inflammatory macrophage Anti-inflammatory macrophage

Figure 6.1. Schematic showing hypothesis of MMP-driven regulation of the anti-inflammatory properties of MSC spheroids MMP-1 and, to a lesser extent MMP-8, drive expression of the inflammatory cytokine IL-1 in MSC spheroids. This may occur through MMP-1/8-driven activation of the p65 pathway. In turn, IL-1 drives expression of the anti- inflammatory factors TSG-6 and PGE2 which drive anti-inflammatory macrophage polarisation. Thus, knockdown of MMP-1 or MMP-8 abrogated the ability of MSC spheroids to induce anti-inflammatory macrophage polarisation ultimately by decreasing TSG-6 and COX-2 expression. In contrast, knockdown of MMP-9 increased the ability of MSC spheroids to drive anti-inflammatory macrophage polarisation. This may be due to direct or indirect MMP-9-driven activation of STAT-3 pathways, which in turn appears to inhibit IL-1 and anti-inflammatory cytokine expression. It is therefore possible that MMP-9 may act to inhibit the activity of MMP-1 and/or MMP-8 and is thus a beneficial target to knockdown to produce MSC spheroids with enhanced anti-inflammatory properties.

Interestingly, knockdown of MMP-8 also increased STAT-3 activation and decreased TSG-6 and COX-2 protein expression. However, knockdown of MMP-8 did not increase MMP-9 protein expression. As both MMP-1 and MMP- 8 are collagenases these results suggest that a collagen matrikine that is normally degraded by MMP-1 and/or MMP-8 may bind to an integrin to induce STAT-3 activation. For example, both MMP-1 and MMP-8 have been shown to generate the matrikine PGP from extracellular collagen (Wells et al. 2016) however knockdown of either MMP may result in the accumulation of a PGP

148 intermediary not normally found in MSC spheroids that binds to a cell receptor and activates STAT-3.

It is unclear what the precise role of STAT-3 activation in regulating the inflammatory properties of MSC spheroids is, however results from this study have consistently shown that when STAT-3 is highly activated there is lower expression of the anti-inflammatory proteins TSG-6 and COX-2 and lower expression of MMP-1 and MMP-3. It is well known that the potent anti- inflammatory mediator IL-10 induces its effects in part by activating STAT-3 activation resulting in the suppression of cytokine production in macrophages, dendritic cells and neutrophils (Hutchins 2013). However, in this study the protein expression of IL-10 was not significantly altered by MMP knockdown. It is therefore possible that IL-10-independent activation of STAT-3 in MSC spheroids abolishes cytokine production and thus abrogates their inflammatory effects. This could represent an important feedback loop as chronic M2 macrophage polarisation is associated with many types of cancer. Further work could investigate the global gene expression changes in STAT- 3 inhibited or knocked down MSC spheroids.

Increased MMP-9 protein expression was often observed with the increased p-STAT-3 activation. Interestingly, one study found that MMP-9 was able to bind to integrin α4β1 receptors, induce STAT-3 phosphorylation and increase cell survival by preventing apoptosis in a model of chronic lymphotic leukemia (Redondo-Muñoz et al. 2010). This suggests that knockdown of MMP-1/TSG-

6 increases MMP-9 protein which could bind to α4β1 receptors on the MSC surface and induce STAT-3 phosphorylation. Unfortunately, stimulation of MSC spheroids with recombinant MMP-9 did not alter STAT-3 activation, although TSG-6 and COX-2 protein expression were decreased, suggesting an alternative mechanism for STAT-3 activation.

In contrast to STAT-3, p65 was shown to be activated by recombinant IL-1α, IL-1β, and TNFα and correlated with high levels of the anti-inflammatory proteins TSG-6 and COX-2 and high levels of MMPs-1 and -3. Phosphorylation of p65 is required for activation of NFκB signalling (Hayden 149 and Ghosh 2012) suggesting that NFκB activation is required for TSG-6, COX- 2, MMP-1 and MMP-3 expression. These results agree with other studies that show NFκB is required for MSC spheroids to exert their anti-inflammatory effects (Bartosh et al. 2010; Ylostalo et al. 2012; Bartosh et al. 2013; Lee et al. 2014). Furthermore, in this study activation of p65 and STAT-3 were never found together, suggesting that these signalling pathways regulate distinct inflammatory phenotypes in MSC spheroids. This provides further evidence for the hypothesis that STAT-3 activation regulates the suppression of anti- inflammatory cytokine expression in MSC spheroids.

These results therefore show the changes in the MSC spheroid inflammatory phenotype when TSG-6 and specific MMPs are knocked down using siRNA. Some studies have used overexpression of TSG-6 or specific MMPs to determine the role they play in particular environments (Selbi et al. 2006; Zamilpa et al. 2012;). However, overexpression of genes may result in proteins localising to non-natural microenvironments thus making it hard to determine whether any effects observed are representative of an in vivo effect. In contrast, knockdown of genes using siRNA removes the protein from its natural microenvironment and thus results may be more likely to reflect the effects of inhibiting an MMP in vivo. On the other hand, overexpression of MMPs such as MMP-1 may further increase the expression of anti- inflammatory proteins TSG-6 and COX-2 in MSC spheroids resulting in a potentially highly beneficial therapeutic cell type. Alternatively, recent studies have begun to exploit the use of CRISPR-Cas9 to knockdown specific metalloproteinases such as ADAMTS-10 (Mularczyk et al. 2018) and MMP-13 (Seidl et al. 2018). Further work into CRISPR targeting of metalloproteinases may enable specific mutations to be introduced into MMPs to further investigate MMP- and/or MMP-domain-specific roles in inflammation.

In this study, the mouse macrophage J774.2 cell line was used to show the therapeutic relevance of conditioned medium from MMP-knockdown MSC spheroids. Importantly, conditioned medium from MMP-1 knockdown spheroids showed a lower propensity to induce M2 macrophage polarisation, whereas medium from MMP-9 knockdown spheroids showed a slightly higher 150 propensity to induce M2 macrophage polarisation. However, studies have shown that primary macrophages and J774 macrophages may respond differently to infection (Andreu et al. 2017). Therefore, although the response of J774.2 macrophages to conditioned medium may be a good indicator of in vivo effects, the same studies should be performed on primary macrophages. Additionally, as the ultimate aim is to use MSC spheroids in human therapy, the ability of conditioned medium from MSC spheroids to alter human macrophage polarisation should be assessed.

Furthermore, in this study LPS was used to induce M1 macrophage polarisation. LPS is derived from bacterial cell walls and is therefore unlikely to be an exact replica of the pro-inflammatory response observed in sterile inflammation. However, use of LPS to induce M1 macrophage polarisation allows a relatively simple way to determine whether a test compound, in this case conditioned medium from MSC spheroids, can dampen M1 macrophage polarisation or induce M2 macrophage polarisation. Further studies could investigate the effects of MSC spheroid conditioned medium on macrophages stimulated with a DAMP or cytokines that are upregulated in the initial stages of sterile inflammatory diseases such as myocardial infarction.

A mouse model of zymosan-induced peritonitis was used to investigate the in vivo potential of MSC spheroids formed using low-cell binding microplates. The results showed that intra-peritoneal injection of MSC spheroids was able to reduce markers of inflammation after zymosan injection. Importantly, a previous study showed that MSC spheroids formed using hanging drops were also able to ameliorate inflammation in zymosan-induced peritonitis (Bartosh et al. 2010). However, as described previously, that study used much larger spheroids which may not be therapeutically relevant. Therefore, this is the first study that shows that smaller 5000-cell spheroids can reduce inflammation in a mouse model of zymosan-induced peritonitis.

Zymosan-induced peritonitis is a model of innate immunity and acute inflammation with similar initial pro-inflammatory mechanisms to other inflammatory conditions such as myocardial infarction (Cash et al. 2009). 151

However, as zymosan is a polysaccharide derived from the cell wall of Saccharomyces cerevisiae the specific mechanisms of inflammation resolution will differ from MI as described above for LPS. Additionally, zymosan-induced peritonitis is a mild inflammatory insult and inflammation normally self-resolves within 48 to 72 hours (Cash et al. 2009). This contrasts with many sterile inflammatory diseases which often become chronic. Therefore, further studies should investigate the ability of MSC spheroids to alter inflammation in a chronic and/or sterile model of inflammation such as MI or heart failure.

Overall this investigation has highlighted the importance of MMPs in regulating the inflammatory properties of MSC spheroids. MMPs-1 and -9 were shown to have opposing roles in the regulation of the anti-inflammatory protein TSG-6. Furthermore TSG-6 itself was also shown to regulate MMP-1 and -9 protein expression. This study has therefore advanced our understanding of the conditions required for MSC spheroids to exert their anti-inflammatory effect and highlighted ways in which MSC spheroids may be manipulated to increase expression of TSG-6. Understanding why MSC spheroids express anti- inflammatory proteins is vital for their use in anti-inflammatory therapies.

152

Chapter 7: Appendix

153

7. Appendix

7.1. Appendix 1: Western Blots of MMP-1, MMP-3, MMP-9 MMP-13, COX-2, TSG-6, IL-6 and IL-8

154

Figure 7.1. Western Blots of MMP-1, MMP-3, MMP-9 MMP-13, COX-2, TSG-6, IL-6 and IL-8 Representative Western blots for MMPs-1, -3, -9, and -13 and TSG-6, IL-6, IL- 8 and COX-2. Left lane shows spheroid positive control; right lane shows adherent MSC negative control.

155

7.2. Appendix 2: Negative control for immunofluorescence

Figure 7.2. Negative Control for immunofluorescence MSCs cultured as spheroids for 5 days were analysed using immunofluorescence and IgGs added in place of primary antibodies.

156

7.3. Appendix 3: Day 1-5 MMP expression pilot

Figure 7.3. Day 1-5 MMP expression pilot MSCs were cultured as spheroids for 1-5 days and expression of MMP-1 and MMP-3 was analysed using western blot.

157

7.4. Appendix 4: Optimisation of siRNA concentration

TSG-6 IL-1RI 1.5 1.5

1.0 1.0

0.5 0.5

0.0 0.0 Scrambled 10nM 20nM 50nM Scrambled 10nM 20nM 50nM Relative Normalised Expression Relative Normalised Expression

Figure 7.4. Optimisation of siRNA concentrations Knockdown of specific MMPs and cytokines was optimised using increasing concentrations of siRNA. Scrambled siRNA was used as a control. Data are normalised to GAPDH and TBP and made relative to scrambled siRNA spheroids.

158

7.5. Appendix 5: All lanes of blots from Chapter 4

Figure 7.5. All lanes of blots from Chapter 4 MSCs cultured as spheroids for 5 days in the presence of scrambled siRNA, TSG-6 siRNA or IL-1RI siRNA.

159

7.6. Appendix 6: MMP knockdown effects on IL-8, IL-4 and IL- 10

Figure 7.6. MMP knockdown effects on IL-8, IL-4 and IL-10 MSCs were cultured as spheroids for 5 days in the presence of scrambled (dark blue bars), MMP-1, -3, -8, or -9 siRNA. Western blot analysis of IL-8, IL- 4 and IL-10. Blots shown are representative of 3 individual experiments using different donor MSCs. Graphs show mean ± SEM and are normalised to scrambled controls. Significance was determined using one-way ANOVA with Holm-Sidak post-hoc analysis. *=p<0.05 compared with scrambled controls.

160

7.7. Appendix 7: MMP Activity after APMA activation

Figure 7.7. MMP Activity after APMA activation MMPs were activated using APMA as described previously. Activation was assessed using the MMP activity assay as described. MMP activity was confirmed for each replicate. The graph shown is MMP activity taken from 1 replicate.

161

References

Abbate, A., Salloum, F. N., Vecile, E., Das, A., Hoke, N. N., Straino, S., Biondi-Zoccai, G. G., Houser, J.-E., Qureshi, I. Z. & Ownby, E. D. (2008). Anakinra, a recombinant human interleukin-1 receptor antagonist, inhibits apoptosis in experimental acute myocardial infarction. Circulation, 117(20), 2670-2683. Aggarwal, B. B. (2000). Tumour necrosis factors receptor associated signalling molecules and their role in activation of apoptosis, JNK and NF-κB. Annals of the Rheumatic Diseases, 59(suppl 1), i6-i16. Aggarwal, S. & Pittenger, M. F. (2005). Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood, 105(4), 1815-1822. Akiyama, K., Chen, C., Wang, D., Xu, X., Qu, C., Yamaza, T., Cai, T., Chen, W., Sun, L. & Shi, S. (2012). Mesenchymal-stem-cell-induced immunoregulation involves FAS- ligand-/FAS-mediated T cell apoptosis. Cell Stem Cell, 10(5), 544-555. Andreu, N., Phelan, J., de Session, P. F., Cliff, J. M, Clark, T. G., Hibberd, M. L. (2006) Primary macrophages and J774 cells respond differently to infection with Mycobacterium tuberculosis. J Am Soc Nephrol 17(6) 1553-1567 Antonov, A. S., Antonova, G. N., Munn, D. H., Mivechi, N., Lucas, R., Catravas, J. D. & Verin, A. D. (2011). αVβ3 integrin regulates macrophage inflammatory responses via PI3 kinase/Akt-dependent NF-κB activation. Journal of Cellular Physiology, 226(2), 469-476. Anzai, A., Anzai, T., Nagai, S., Maekawa, Y., Naito, K., Kaneko, H., Sugano, Y., Takahashi, T., Abe, H. & Mochizuki, S. (2012). Regulatory role of dendritic cells in postinfarction healing and left ventricular remodeling. Circulation, 125(10), 1234-1245. Arner, E. & Tortorella, M. (1995). Signal transduction through chondrocyte integrin receptors induces matrix metalloproteinase synthesis and synergizes with interleukin-1. Arthritis & Rheumatism, 38(9), 1304-1314. Arslan, F., de Kleijn, D. P. & Pasterkamp, G. (2011). Innate immune signaling in cardiac ischemia. Nature Reviews Cardiology, 8(5), 292-300. Asokananthan, N., Graham, P. T., Fink, J., Knight, D. A., Bakker, A. J., McWilliam, A. S., Thompson, P. J. & Stewart, G. A. (2002). Activation of protease-activated receptor (PAR)-1, PAR-2, and PAR-4 stimulates IL-6, IL-8, and prostaglandin E2 release from human respiratory epithelial cells. The Journal of Immunology, 168(7), 3577- 3585. Augello, A., Tasso, R., Negrini, S. M., Amateis, A., Indiveri, F., Cancedda, R. & Pennesi, G. (2005). Bone marrow mesenchymal progenitor cells inhibit lymphocyte proliferation by activation of the programmed death 1 pathway. European journal of immunology, 35(5), 1482-1490. Bahri, R., Hirsch, F., Josse, A., Rouas-Freiss, N., Bidere, N., Vasquez, A., Carosella, E. D., Charpentier, B. & Durrbach, A. (2006). Soluble HLA-G inhibits cell cycle progression in human alloreactive T lymphocytes. The Journal of Immunology, 176(3), 1331- 1339. Ball, S., Worthington, J., Canfield, A., Merry, C. & Kielty, C. (2014). Mesenchymal stromal cells: Inhibiting PDGF receptors or depleting fibronectin induces mesodermal progenitors with endothelial potential. Stem Cells, 32(3), 694-705. Baraniak, P. R. & McDevitt, T. C. (2012). Scaffold-free culture of mesenchymal stem cell spheroids in suspension preserves multilineage potential. Cell and Tissue Research, 347(3), 701-711. Bartosh, T. J., Ylöstalo, J. H., Bazhanov, N., Kuhlman, J. & Prockop, D. J. (2013). Dynamic compaction of human mesenchymal stem/precursor cells into spheres self-activates caspase-dependent IL1 signaling to enhance secretion of modulators of inflammation and immunity (PGE2, TSG6, and STC1). Stem Cells, 31(11), 2443- 2456. Bartosh, T. J., Ylöstalo, J. H., Mohammadipoor, A., Bazhanov, N., Coble, K., Claypool, K., Lee, R. H., Choi, H. & Prockop, D. J. (2010). Aggregation of human mesenchymal stromal cells (MSCs) into 3D spheroids enhances their antiinflammatory properties. Proceedings of the National Academy of Sciences, 107(31), 13724-13729.

162

Bastos, K. R., Alvarez, J. M., Marinho, C. R., Rizzo, L. V. & Lima, M. R. D. I. (2002). Macrophages from IL-12p40-deficient mice have a bias toward the M2 activation profile. Journal of leukocyte biology, 71(2), 271-278. Bernardo, M. E. & Fibbe, W. E. (2013). Mesenchymal stromal cells: sensors and switchers of inflammation. Cell Stem Cell, 13(4), 392-402. Bernardo, M. E., Zaffaroni, N., Novara, F., Cometa, A. M., Avanzini, M. A., Moretta, A., Montagna, D., Maccario, R., Villa, R. & Daidone, M. G. (2007). Human bone marrow–derived mesenchymal stem cells do not undergo transformation after long- term in vitro culture and do not exhibit telomere maintenance mechanisms. Cancer Research, 67(19), 9142-9149. Bhoopathi, P., Chetty, C., Kunigal, S., Vanamala, S. K., Rao, J. S. & Lakka, S. S. (2008). Blockade of tumor growth due to matrix metalloproteinase-9 inhibition is mediated by sequential activation of β1-integrin, ERK, and NF-κB. Journal of Biological Chemistry, 283(3), 1545-1552. Bianchi, M. E. (2007). DAMPs, PAMPs and alarmins: all we need to know about danger. Journal of Leukocyte Biology, 81(1), 1-5. Bingisser, R. M., Tilbrook, P. A., Holt, P. G. & Kees, U. R. (1998). Macrophage-derived nitric oxide regulates T cell activation via reversible disruption of the Jak3/STAT5 signaling pathway. The Journal of Immunology, 160(12), 5729-5734. Biswas, S. K. & Mantovani, A. (2010). Macrophage plasticity and interaction with lymphocyte subsets: cancer as a paradigm. Nature immunology, 11(10), 889-896. Bizik, J., Kankuri, E., Ristimäki, A., Taieb, A., Vapaatalo, H., Lubitz, W. & Vaheri, A. (2003). Cell–cell contacts trigger programmed necrosis and induce cyclooxygenase-2 expression. Cell Death & Differentiation, 11(2), 183-195. Boire, A., Covic, L., Agarwal, A., Jacques, S., Sherifi, S. & Kuliopulos, A. (2005). PAR1 is a matrix metalloprotease-1 receptor that promotes invasion and tumorigenesis of breast cancer cells. Cell, 120(3), 303-313. Bosworth, T. (2014) How the microenvironment regulates the anti-inflammatory properties of mesenchymal stromal cells for cardiovascular therapy. MRes Cardiovascular Sciences. University of Manchester, Manchester. Brandau, S., Jakob, M., Hemeda, H., Bruderek, K., Janeschik, S., Bootz, F. & Lang, S. (2010). Tissue-resident mesenchymal stem cells attract peripheral blood neutrophils and enhance their inflammatory activity in response to microbial challenge. Journal of Leukocyte Biology, 88(5), 1005-1015. Brown, J. M., Nemeth, K., Kushnir‐Sukhov, N. M., Metcalfe, D. D. & Mezey, E. (2011). Bone marrow stromal cells inhibit mast cell function via a COX2-dependent mechanism. Clinical & Experimental Allergy, 41(4), 526-534. Bujak, M. & Frangogiannis, N. G. (2007). The role of TGF-β signaling in myocardial infarction and cardiac remodeling. Cardiovascular Research, 74(2), 184-195. Calderwood, D. (2004). Talin controls integrin activation. Biochemical Society Transactions, 32(3), 434-437. Cao, Q., Wang, Y., Zheng, D., Sun, Y., Wang, Y., Lee, V. W., Zheng, G., Tan, T. K., Ince, J. & Alexander, S. I. (2010). Il-10/TGF-β–modified macrophages induce regulatory T cells and protect against adriamycin nephrosis. Journal of the American Society of Nephrology, 21(6), 933-942. Cao, S., Zhang, X., Edwards, J. P. & Mosser, D. M. (2006). NF-κB1 (p50) homodimers differentially regulate pro-and anti-inflammatory cytokines in macrophages. Journal of Biological Chemistry, 281(36), 26041-26050. Carlson, S., Trial, J., Soeller, C. & Entman, M. L. (2011). Cardiac mesenchymal stem cells contribute to scar formation after myocardial infarction. Cardiovascular Research, 91(1), 99-107. Cassatella, M. A., Mosna, F., Micheletti, A., Lisi, V., Tamassia, N., Cont, C., Calzetti, F., Pelletier, M., Pizzolo, G. & Krampera, M. (2011). Toll-Like Receptor-3-Activated Human Mesenchymal Stromal Cells Significantly Prolong the Survival and Function of Neutrophils. Stem Cells, 29(6), 1001-1011. Chabannes, D., Hill, M., Merieau, E., Rossignol, J., Brion, R., Soulillou, J. P., Anegon, I. & Cuturi, M. C. (2007). A role for heme oxygenase-1 in the immunosuppressive effect of adult rat and human mesenchymal stem cells. Blood, 110(10), 3691-3694.

163

Chen, W. & Frangogiannis, N. G. (2013). Fibroblasts in post-infarction inflammation and cardiac repair. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1833(4), 945-953. Choi, H., Lee, R. H., Bazhanov, N., Oh, J. Y. & Prockop, D. J. (2011). Anti-inflammatory protein TSG-6 secreted by activated MSCs attenuates zymosan-induced mouse peritonitis by decreasing TLR2/NF-κB signaling in resident macrophages. Blood, 118(2), 330-338. Christianson, S. W., Greiner, D. L., Hesselton, R. A., Leif, J. H., Wagar, E. J., Schweitzer, I. B., Rajan, T. V., Gott, B., Roopenian, D. C. & Shultz, L. D. (1997). Enhanced human CD4+ T cell engraftment in beta2-microglobulin-deficient NOD-scid mice. The Journal of Immunology, 158(8), 3578-3586. Cochain, C., Auvynet, C., Poupel, L., Vilar, J., Dumeau, E., Richart, A., Récalde, A., Zouggari, Y., Yin, K. Y. H. W. & Bruneval, P. (2012). The chemokine decoy receptor D6 prevents excessive inflammation and adverse ventricular remodeling after myocardial infarction. Arteriosclerosis, Thrombosis, and Vascular Biology, 32(9), 2206-2213. Corcione, A., Benvenuto, F., Ferretti, E., Giunti, D., Cappiello, V., Cazzanti, F., Risso, M., Gualandi, F., Mancardi, G. L. & Pistoia, V. (2006). Human mesenchymal stem cells modulate B-cell functions. Blood, 107(1), 367-372. Creemers, E. E., Cleutjens, J. P., Smits, J. F. & Daemen, M. J. (2001). Matrix metalloproteinase inhibition after myocardial infarction: A new approach to prevent heart failure? Circulation Research, 89(3), 201-210. Croitoru-Lamoury, J., Lamoury, F. M., Caristo, M., Suzuki, K., Walker, D., Takikawa, O., Taylor, R. & Brew, B. J. (2011). Interferon-γ regulates the proliferation and differentiation of mesenchymal stem cells via activation of indoleamine 2, 3 dioxygenase (IDO). PloS One, 6(2), e14698. Day, A. J., Milner, C. M. (2018) TSG-6: A multifunctional protein with anti-inflammatory and tissue-protective properties. Matrix Biology de Lemos, J. A., Morrow, D. A., Blazing, M. A., Jarolim, P., Wiviott, S. D., Sabatine, M. S., Califf, R. M. & Braunwald, E. (2007). Serial measurement of monocyte chemoattractant protein-1 after acute coronary syndromes: Results from the A to Z trial. Journal of the American College of Cardiology, 50(22), 2117-2124. Dewald, O., Zymek, P., Winkelmann, K., Koerting, A., Ren, G., Abou-Khamis, T., Michael, L. H., Rollins, B. J., Entman, M. L. & Frangogiannis, N. G. (2005). CCL2/monocyte chemoattractant protein-1 regulates inflammatory responses critical to healing myocardial infarcts. Circulation Research, 96(8), 881-889. Di Ianni, M., Del Papa, B., De Ioanni, M., Moretti, L., Bonifacio, E., Cecchini, D., Sportoletti, P., Falzetti, F. & Tabilio, A. (2008). Mesenchymal cells recruit and regulate T regulatory cells. Experimental Hematology, 36(3), 309-318. Di Nicola, M., Carlo-Stella, C., Magni, M., Milanesi, M., Longoni, P. D., Matteucci, P., Grisanti, S. & Gianni, A. M. (2002). Human bone marrow stromal cells suppress T- lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood, 99(10), 3838-3843. Ding, Y., Xu, D., Feng, G., Bushell, A., Muschel, R. J. & Wood, K. J. (2009). Mesenchymal stem cells prevent the rejection of fully allogenic islet grafts by the immunosuppressive activity of matrix metalloproteinase-2 and-9. Diabetes, 58(8), 1797-1806. Djouad, F., Charbonnier, L. M., Bouffi, C., Louis‐Plence, P., Bony, C., Apparailly, F., Cantos, C., Jorgensen, C. & Noel, D. (2007). Mesenchymal Stem Cells Inhibit the Differentiation of Dendritic Cells Through an Interleukin‐6‐Dependent Mechanism. Stem Cells, 25(8), 2025-2032. Dobaczewski, M., Gonzalez-Quesada, C. & Frangogiannis, N. G. (2010). The extracellular matrix as a modulator of the inflammatory and reparative response following myocardial infarction. Journal of Molecular and Cellular Cardiology, 48(3), 504-511. Dominici, M., Le Blanc, K., Mueller, I., Slaper-Cortenbach, I., Marini, F., Krause, D., Deans, R., Keating, A., Prockop, D. & Horwitz, E. (2006). Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy, 8(4), 315-317. Ducharme, A., Frantz, S., Aikawa, M., Rabkin, E., Lindsey, M., Rohde, L. E., Schoen, F. J., Kelly, R. A., Werb, Z. & Libby, P. (2000). Targeted deletion of matrix

164

metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction. The Journal of Clinical Investigation, 106(1), 55-62. English, K., Barry, F. P., Field-Corbett, C. P. & Mahon, B. P. (2007). IFN-γ and TNF-α differentially regulate immunomodulation by murine mesenchymal stem cells. Immunology letters, 110(2), 91-100. English, K., Ryan, J., Tobin, L., Murphy, M., Barry, F. & Mahon, B. (2009). Cell contact, prostaglandin E2 and transforming growth factor beta 1 play non-redundant roles in human mesenchymal stem cell induction of CD4+ CD25Highforkhead box P3+ regulatory T cells. Clinical & Experimental Immunology, 156(1), 149-160. Esparza, J., Vilardell, C., Calvo, J., Juan, M., Vives, J., Urbano-Márquez, A., Yagüe, J. & Cid, M. C. (1999). Fibronectin upregulates gelatinase B (MMP-9) and induces coordinated expression of gelatinase A (MMP-2) and its activator MT1-MMP (MMP- 14) by human T lymphocyte cell lines. A process repressed through RAS/MAP kinase signaling pathways. Blood, 94(8), 2754-2766. Etoh, T., Joffs, C., Deschamps, A. M., Davis, J., Dowdy, K., Hendrick, J., Baicu, S., Mukherjee, R., Manhaini, M. & Spinale, F. G. (2001). Myocardial and interstitial matrix metalloproteinase activity after acute myocardial infarction in pigs. American Journal of Physiology-Heart and Circulatory Physiology, 281(3), H987-H994. Fadok, V. A., Bratton, D. L., Konowal, A., Freed, P. W., Westcott, J. Y. & Henson, P. M. (1998). Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF. Journal of Clinical Investigation, 101(4), 890. Feng, Y. & Chao, W. (2011). Toll-like receptors and myocardial inflammation. International Journal of Inflammation, 2011. Fennema, E., Rivron, N., Rouwkema, J., van Blitterswijk, C. & de Boer, J. (2013). Spheroid culture as a tool for creating 3D complex tissues. Trends in Biotechnology, 31(2), 108-115. François, M., Romieu-Mourez, R., Li, M. & Galipeau, J. (2011). Human MSC suppression correlates with cytokine induction of indoleamine 2, 3-dioxygenase and bystander M2 macrophage differentiation. Molecular Therapy, 20(1), 187-195. Frangogiannis, N. G. (2012). Regulation of the inflammatory response in cardiac repair. Circulation Research, 110(1), 159-173. Frangogiannis, N. G. (2014). The inflammatory response in myocardial injury, repair, and remodelling. Nature Reviews Cardiology, 11(5), 255-265. Frangogiannis, N. G. (2017). The extracellular matrix in moycardial injury, repair and remodelin. Journal of Clinical Investigation, 127(5), 1600-1612 Gao, S., Mao, F., Zhang, B., Zhang, L., Zhang, X., Wang, M., Yan, Y., Yang, T., Zhang, J. & Zhu, W. (2014). Mouse bone marrow-derived mesenchymal stem cells induce macrophage M2 polarization through the nuclear factor-κB and signal transducer and activator of transcription 3 pathways. Experimental Biology and Medicine, 239(3), 366-375. Garcia-Faroldi, G., Melo, F. R., Rönnberg, E., Grujic, M. & Pejler, G. (2013). Active caspase- 3 is stored within secretory compartments of viable mast cells. The Journal of Immunology, 191(3), 1445-1452. Gieseke, F., Schütt, B., Viebahn, S., Koscielniak, E., Friedrich, W., Handgretinger, R. & Müller, I. (2007). Human multipotent mesenchymal stromal cells inhibit proliferation of PBMCs independently of IFNγR1 signaling and IDO expression. Blood, 110(6), 2197-2200. Godefroy, E., Gallois, A., Idoyaga, J., Merad, M., Tung, N., Monu, N., Saenger, Y., Fu, Y., Ravindran, R. & Pulendran, B. (2014). Activation of Toll-like Receptor-2 by Endogenous Matrix Metalloproteinase-2 Modulates Dendritic-Cell-Mediated Inflammatory Responses. Cell reports, 9(5), 1856-1870. Gonzalez-Rey, E., Gonzalez, M. A., Rico, L., Buscher, D. & Delgado, M. (2009). Human adult stem cells derived from adipose tissue protect against experimental colitis and sepsis. Gut. Guo, P., Zhang, S.-Z., He, H., Zhu, Y.-T. & Tseng, S. C. (2012). TSG-6 controls transcription and activation of matrix metalloproteinase 1 in conjunctivochalasis. Investigative ophthalmology & visual science, 53(3), 1372.

165

Gurantz, D., Cowling, R. T., Varki, N., Frikovsky, E., Moore, C. D. & Greenberg, B. H. (2005). IL-1β and TNF-α upregulate angiotensin II type 1 (AT1) receptors on cardiac fibroblasts and are associated with increased AT1 density in the post-MI heart. Journal of Molecular and Cellular Cardiology, 38(3), 505-515. Hall, S. R., Tsoyi, K., Ith, B., Padera, R. F., Lederer, J. A., Wang, Z., Liu, X. & Perrella, M. A. (2013). Mesenchymal stromal cells improve survival during sepsis in the absence of heme oxygenase-1: The importance of neutrophils. Stem Cells, 31(2), 397-407. Han, C., Jin, J., Xu, S., Liu, H., Li, N. & Cao, X. (2010). Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting degradation of MyD88 and TRIF via Cbl-b. Nature Immunology, 11(8), 734-742. Harburger, D. S. & Calderwood, D. A. (2009). Integrin signalling at a glance. Journal of Cell Science, 122(2), 159-163. Hayden, M. S. & Ghosh, S. (2008). Shared principles in NF-κB signaling. Cell, 132(3), 344- 362. Herzog, E., Gu, A., Kohmoto, T., Burkhoff, D. & Hochman, J. S. (1998). Early activation of metalloproteinases after experimental myocardial infarction occurs in infarct and non-infarct zones. Cardiovascular Pathology, 7(6), 307-312. Heymans, S., Luttun, A., Nuyens, D., Theilmeier, G., Creemers, E., Moons, L., Dyspersin, G., Cleutjens, J., Shipley, M. & Angellilo, A. (1999). Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nature Medicine, 5(10), 1135- 1142. Hiscott, J., Marois, J., Garoufalis, J., D'addario, M., Roulston, A., Kwan, I., Pepin, N., Lacoste, J., Nguyen, H. & Bensi, G. (1993). Characterization of a functional NF- kappa B site in the human interleukin 1 beta promoter: evidence for a positive autoregulatory loop. Molecular and Cellular Biology, 13(10), 6231-6240. Hoesel, B. & Schmid, J. A. (2013). The complexity of NF-κB signaling in inflammation and cancer. Molecular Cancer, 12, 86. Hofmann, U., Beyersdorf, N., Weirather, J., Podolskaya, A., Bauersachs, J., Ertl, G., Kerkau, T. & Frantz, S. (2012). Activation of CD4+ T lymphocytes improves wound healing and survival after experimental myocardial infarction in mice. Circulation, 125(13), 1652-1663. Holley, R. J., Tai, G., Williamson, A. J. K., Taylor, S., Cain, S. A., Richardson, S. M., Merry, C. L. R., Whetton, A. D., Kielty, C. M., Canfield, A. E. (2018) Comparative quantification of the surfaceome of human multipotent mesenchymal progenitor cells. Stem cells Int Humphries, J. D., Byron, A. & Humphries, M. J. (2006). Integrin ligands at a glance. Journal of Cell Science, 119(19), 3901-3903. Hutchins, A. P., Diez, D., Saavedra, D. M. (2017) The IL-10/STAT-3-mediated anti- inflammatory response: recent developments and future challenges. Sci rep 7 42225 Iso, Y., Spees, J. L., Serrano, C., Bakondi, B., Pochampally, R., Song, Y.-H., Sobel, B. E., Delafontaine, P. & Prockop, D. J. (2007). Multipotent human stromal cells improve cardiac function after myocardial infarction in mice without long-term engraftment. Biochemical and Biophysical Research Communications, 354(3), 700-706. Ivey, C. L., Williams, F. M., Collins, P. D., Jose, P. J. & Williams, T. J. (1995). Neutrophil chemoattractants generated in two phases during reperfusion of ischemic myocardium in the rabbit. Evidence for a role for C5a and interleukin-8. Journal of Clinical Investigation, 95(6), 2720. Iyer, R. P., de Castro Brás, L. E., Jin, Y.-F. & Lindsey, M. L. (2014). Translating Koch’s postulates to identify matrix metalloproteinase roles in postmyocardial infarction remodeling cardiac metalloproteinase actions (CarMA) postulates. Circulation Research, 114(5), 860-871. Iyer, R. P., Patterson, N. L., Zouein, F. A., Ma, Y., Dive, V., de Castro Bras, L. E., Lindsey, M. L. (2015) Early matrix metalloproteinase-12 inhibition worsens post-myocardial infarction cardiac dysfunction by delaying inflammation resolution Int J Cardiol 185 198-208 Jiang, X.-X., Zhang, Y., Liu, B., Zhang, S.-X., Wu, Y., Yu, X.-D. & Mao, N. (2005). Human mesenchymal stem cells inhibit differentiation and function of monocyte-derived dendritic cells. Blood, 105(10), 4120-4126.

166

Jing, Y. & Jian-xiong, Y. (2011). 3D spheroid culture of bone marrow mesenchymal stem cell of rhesus monkey with improved multi-differentiation potential to epithelial progenitors and neuron in vitro. Clinical & Experimental Ophthalmology, 39(8), 808- 819. Jokinen, J., Dadu, E., Nykvist, P., Käpylä, J., White, D. J., Ivaska, J., Vehviläinen, P., Reunanen, H., Larjava, H. & Häkkinen, L. (2004). Integrin-mediated cell adhesion to type I collagen fibrils. Journal of Biological Chemistry, 279(30), 31956-31963. Jordan, J. E., Zhao, Z.-Q. & Vinten-Johansen, J. (1999). The role of neutrophils in myocardial ischemia–reperfusion injury. Cardiovascular Research, 43(4), 860-878. Kasper, G., Glaeser, J. D., Geissler, S., Ode, A., Tuischer, J., Matziolis, G., Perka, C. & Duda, G. N. (2007). Matrix metalloprotease activity is an essential link between mechanical stimulus and mesenchymal stem cell behavior. Stem Cells, 25(8), 1985- 1994. Kawai, T. & Akira, S. (2007). Signaling to NF-κB by Toll-like receptors. Trends in Molecular Medicine, 13(11), 460-469. Kesanakurti, D., Chetty, C., Dinh, D. H., Gujrati, M. & Rao, J. S. (2013). Role of MMP-2 in the regulation of IL-6/Stat3 survival signaling via interaction with α5β1 integrin in glioma. Oncogene, 32(3), 327-340. Kim, J. & Hematti, P. (2009). Mesenchymal stem cell–educated macrophages: A novel type of alternatively activated macrophages. Experimental Hematology, 37(12), 1445- 1453. Kobara, M., Noda, K., Kitamura, M., Okamoto, A., Shiraishi, T., Toba, H., Matsubara, H. & Nakata, T. (2010). Antibody against interleukin-6 receptor attenuates left ventricular remodelling after myocardial infarction in mice. Cardiovascular Research, cvq078. Krishnamurthy, P., Rajasingh, J., Lambers, E., Qin, G., Losordo, D. W. & Kishore, R. (2009). IL-10 inhibits inflammation and attenuates left ventricular remodeling after myocardial infarction via activation of STAT3 and suppression of HuR. Circulation Research, 104(2), e9-e18. Kunsch, C. & Rosen, C. A. (1993). NF-kappa B subunit-specific regulation of the interleukin- 8 promoter. Molecular and Cellular Biology, 13(10), 6137-6146. Lambert, J. M., Lopez, E. F. & Lindsey, M. L. (2008). Macrophage roles following myocardial infarction. International Journal of Cardiology, 130(2), 147-158. Lee, R. H., Pulin, A. A., Seo, M. J., Kota, D. J., Ylostalo, J., Larson, B. L., Semprun-Prieto, L., Delafontaine, P. & Prockop, D. J. (2009). Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell, 5(1), 54-63. Lepelletier, Y., Lecourt, S., Renand, A., Arnulf, B., Vanneaux, V., Fermand, J.-P., Menasché, P., Domet, T., Marolleau, J.-P. & Hermine, O. (2009). Galectin-1 and semaphorin-3A are two soluble factors conferring T-cell immunosuppression to bone marrow mesenchymal stem cell. Stem cells and development, 19(7), 1075-1079. Li, X. & Tai, H. H. (2014). Thromboxane A2 receptor‐mediated release of matrix metalloproteinase‐1 (MMP‐1) induces expression of monocyte chemoattractant protein‐1 (MCP‐1) by activation of protease‐activated receptor 2 (PAR2) in A549 human lung adenocarcinoma cells. Molecular carcinogenesis, 53(8), 659-666. Liacini, A., Sylvester, J., Li, W. Q. & Zafarullah, M. (2002). Inhibition of interleukin-1- stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF- κB) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biology, 21(3), 251-262. Libby, P., Maroko, P. R., Bloor, C. M., Sobel, B. E. & Braunwald, E. (1973). Reduction of experimental myocardial infarct size by corticosteroid administration. Journal of Clinical Investigation, 52(3), 599. Lin, J.-L., Wang, M. J., Lee, D., Liang, C.-C. & Lin, S. (2008). Hypoxia-inducible factor-1α regulates matrix metalloproteinase-1 activity in human bone marrow-derived mesenchymal stem cells. FEBS Letters, 582(17), 2615-2619. Lindsey, M. L., Escobar, G. P., Mukherjee, R., Goshorn, D. K., Sheats, N. J., Bruce, J. A., Mains, I. M., Hendrick, J. K., Hewett, K. W. & Gourdie, R. G. (2006). Matrix metalloproteinase-7 affects connexin-43 levels, electrical conduction, and survival after myocardial infarction. Circulation, 113(25), 2919-2928. Lolmede, K., Campana, L., Vezzoli, M., Bosurgi, L., Tonlorenzi, R., Clementi, E., Bianchi, M. E., Cossu, G., Manfredi, A. A. & Brunelli, S. (2009). Inflammatory and alternatively

167

activated human macrophages attract vessel-associated stem cells, relying on separate HMGB1-and MMP-9-dependent pathways. Journal of leukocyte biology, 85(5), 779-787. Ma, Y., Halade, G. V., Zhang, J., Ramirez, T. A., Levin, D., Voorhees, A., Jin, Y.-F., Han, H.- C., Manicone, A. M. & Lindsey, M. L. (2013). Matrix metalloproteinase-28 deletion exacerbates cardiac dysfunction and rupture after myocardial infarction in mice by inhibiting M2 macrophage activation. Circulation Research, 112(4), 675-688. Maekawa, N., Wada, H., Kanda, T., Niwa, T., Yamada, Y., Saito, K., Fujiwara, H., Sekikawa, K. & Seishima, M. (2002). Improved myocardial ischemia/reperfusion injury in mice lacking tumor necrosis factor-α. Journal of the American College of Cardiology, 39(7), 1229-1235. Martin, M., Neumann, D., Hoff, T., Resch, K., DeWitt, D. L. & Goppelt-Struebe, M. (1994). Interleukin-1-induced cyclooxygenase 2 expression is suppressed by cyclosporin A in rat mesangial cells. Kidney international, 45(1), 150-158. Martinez, F. O. & Gordon, S. (2014). The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000prime reports, 6. McIlwain, D. R., Berger, T. & Mak, T. W. (2013). Caspase functions in cell death and disease. Cold Spring Harbor perspectives in biology, 5(4), a008656. Meisel, R., Zibert, A., Laryea, M., Göbel, U., Däubener, W. & Dilloo, D. (2004). Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2, 3- dioxygenase–mediated tryptophan degradation. Blood, 103(12), 4619-4621. Mengshol, J. A., Vincenti, M. P., Coon, C. I., Barchowsky, A. & Brinckerhoff, C. E. (2000). Interleukin‐1 induction of collagenase 3 (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c‐jun N‐terminal kinase, and nuclear factor κB: Differential regulation of collagenase 1 and collagenase 3. Arthritis & Rheumatism, 43(4), 801-811. Mias, C., Lairez, O., Trouche, E., Roncalli, J., Calise, D., Seguelas, M. H., Ordener, C., Piercecchi‐Marti, M. D., Auge, N. & Salvayre, A. N. (2009). Mesenchymal stem cells promote matrix metalloproteinase secretion by cardiac fibroblasts and reduce cardiac ventricular fibrosis after myocardial infarction. Stem Cells, 27(11), 2734- 2743. Mitchell, M. D., Laird, R. E., Brown, R. D. & Long, C. S. (2007). IL-1β stimulates rat cardiac fibroblast migration via MAP kinase pathways. American Journal of Physiology- Heart and Circulatory Physiology, 292(2), H1139-H1147. Mittal, M., Toya, S., Malik, A. (2015) TSG6 as a central mediator of macrophage M2 polarisation. J Immunol May 194 Miura, M., Miura, Y., Padilla‐Nash, H. M., Molinolo, A. A., Fu, B., Patel, V., Seo, B. M., Sonoyama, W., Zheng, J. J. & Baker, C. C. (2006). Accumulated chromosomal instability in murine bone marrow mesenchymal stem cells leads to malignant transformation. Stem Cells, 24(4), 1095-1103. Mo, I. F., Yip, K. H., Chan, W. K., Law, H. K., Lau, Y. L. & Chan, G. C. (2008). Prolonged exposure to bacterial toxins downregulated expression of toll-like receptors in mesenchymal stromal cell-derived osteoprogenitors. BMC Cell Biology, 9(1), 52. Mohammadipoor, A., Lee, R. H., Prockop, D. J., Bartosh, T. J. (2014) Stanniocalcin-1 attenuates ischemic cardiac injury and response of differentiating monocytes/macrophages to inflammatory stimuli. Front Immunol 5 101 Mularczyk, E. J., Singh, M., Godwin, A. R. F., Galli, F., Humphreys, N., Adamson, A. D., Mironov, A., Cain, S. A., Boot-Handford, R. P., Cossu, G., Kielty, C. M., Baldock, C. (2018) ADAMTS10-mediated tissue disruption in Weill-Marchesani Syndrome. Hum Mol Genet Németh, K., Leelahavanichkul, A., Yuen, P. S., Mayer, B., Parmelee, A., Doi, K., Robey, P. G., Leelahavanichkul, K., Koller, B. H. & Brown, J. M. (2008). Bone marrow stromal cells attenuate sepsis via prostaglandin E2–dependent reprogramming of host macrophages to increase their interleukin-10 production. Nature Medicine, 15(1), 42-49. Nguyen, T. M., Arthur, A., Hayball, J. D. & Gronthos, S. (2013). EphB and Ephrin-B interactions mediate human mesenchymal stem cell suppression of activated T- cells. Stem cells and development, 22(20), 2751-2764. Nissinen, L. & Kähäri, V.-M. (2014). Matrix metalloproteinases in inflammation. Biochimica et Biophysica Acta (BBA)-General Subjects, 1840(8), 2571-2580.

168

O’Cearbhaill, E. D., Murphy, M., Barry, F., McHugh, P. E. & Barron, V. (2010). Behavior of human mesenchymal stem cells in fibrin-based vascular tissue engineering constructs. Annals of Biomedical Engineering, 38(3), 649-657. Opie, L. H., Commerford, P. J., Gersh, B. J. & Pfeffer, M. A. (2006). Controversies in ventricular remodelling. The Lancet, 367(9507), 356-367. Opitz, C. A., Litzenburger, U. M., Lutz, C., Lanz, T. V., Tritschler, I., Köppel, A., Tolosa, E., Hoberg, M., Anderl, J. & Aicher, W. K. (2009). Toll-like receptor engagement enhances the immunosuppressive properties of human bone marrow-derived mesenchymal stem cells by inducing indoleamine-2, 3-dioxygenase-1 via interferon- β and protein kinase R. Stem Cells, 27(4), 909-919. Owyang, A. M., Zaph, C., Wilson, E. H., Guild, K. J., McClanahan, T., Miller, H. R., Cua, D. J., Goldschmidt, M., Hunter, C. A. & Kastelein, R. A. (2006). Interleukin 25 regulates type 2 cytokine-dependent immunity and limits chronic inflammation in the gastrointestinal tract. The Journal of experimental medicine, 203(4), 843-849. Parks, W. C., Wilson, C. L. & López-Boado, Y. S. (2004). Matrix metalloproteinases as modulators of inflammation and innate immunity. Nature Reviews Immunology, 4(8), 617-629. Peng, W.-j., Yan, J.-w., Wan, Y.-n., Wang, B.-x., Tao, J.-h., Yang, G.-j., Pan, H.-f. & Wang, J. (2012). Matrix metalloproteinases: a review of their structure and role in systemic sclerosis. Journal of clinical immunology, 32(6), 1409-1414. Peterson, J. T., Li, H., Dillon, L. & Bryant, J. W. (2000). Evolution of matrix metalloprotease and tissue inhibitor expression during heart failure progression in the infarcted rat. Cardiovascular Research, 46(2), 307-315. Petrey, A. C., de la Motte, C. A. (2018) Hyaluronan, a crucial regulator of inflammation. Matrix Biology Peura, M., Bizik, J., Salmenperä, P., Noro, A., Korhonen, M., Pätilä, T., Vento, A., Vaheri, A., Alitalo, R. & Vuola, J. (2009). Bone marrow mesenchymal stem cells undergo nemosis and induce keratinocyte wound healing utilizing the HGF/c-Met/PI3K pathway. Wound Repair and Regeneration, 17(4), 569-577. Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S. & Marshak, D. R. (1999). Multilineage potential of adult human mesenchymal stem cells. Science, 284(5411), 143-147. Polchert, D., Sobinsky, J., Douglas, G., Kidd, M., Moadsiri, A., Reina, E., Genrich, K., Mehrotra, S., Setty, S. & Smith, B. (2008). IFN‐γ activation of mesenchymal stem cells for treatment and prevention of graft versus host disease. European journal of immunology, 38(6), 1745-1755. Potapova, I. A., Doronin, S. V., Kelly, D. J., Rosen, A. B., Schuldt, A. J., Lu, Z., Kochupura, P. V., Robinson, R. B., Rosen, M. R. & Brink, P. R. (2008). Enhanced recovery of mechanical function in the canine heart by seeding an extracellular matrix patch with mesenchymal stem cells committed to a cardiac lineage. American Journal of Physiology-Heart and Circulatory Physiology, 295(6), H2257-H2263. Potapova, I. A., Gaudette, G. R., Brink, P. R., Robinson, R. B., Rosen, M. R., Cohen, I. S. & Doronin, S. V. (2007). Mesenchymal stem cells support migration, extracellular matrix invasion, proliferation, and survival of endothelial cells in vitro. Stem Cells, 25(7), 1761-1768. Pradier, A., Passweg, J., Villard, J. & Kindler, V. (2011). Human bone marrow stromal cells and skin fibroblasts inhibit natural killer cell proliferation and cytotoxic activity. Cell Transplantation, 20(5), 681-691. Raffaghello, L., Bianchi, G., Bertolotto, M., Montecucco, F., Busca, A., Dallegri, F., Ottonello, L. & Pistoia, V. (2008). Human mesenchymal stem cells inhibit neutrophil apoptosis: A model for neutrophil preservation in the bone marrow niche. Stem Cells, 26(1), 151-162. Raicevic, G., Rouas, R., Najar, M., Stordeur, P., Id Boufker, H., Bron, D., Martiat, P., Goldman, M., Nevessignsky, M. T. & Lagneaux, L. (2010). Inflammation modifies the pattern and the function of Toll-like receptors expressed by human mesenchymal stromal cells. Human Immunology, 71(3), 235-244. Ramani, R., Mathier, M., Wang, P., Gibson, G., Tögel, S., Dawson, J., Bauer, A., Alber, S., Watkins, S. C. & McTiernan, C. F. (2004). Inhibition of tumor necrosis factor receptor-1-mediated pathways has beneficial effects in a murine model of

169

postischemic remodeling. American Journal of Physiology-Heart and Circulatory Physiology, 287(3), H1369-H1377. Redondo-Muñoz, J., Ugarte-Berzal, E., Terol, M. J., Van den Steen, P. E., del Cerro, M. H., Roderfeld, M., Roeb, E., Opdenakker, G., García-Marco, J. A. & García-Pardo, A. (2010). Matrix metalloproteinase-9 promotes chronic lymphocytic leukemia b cell survival through its hemopexin domain. Cancer cell, 17(2), 160-172. Ren, G., Zhang, L., Zhao, X., Xu, G., Zhang, Y., Roberts, A. I., Zhao, R. C. & Shi, Y. (2008). Mesenchymal stem cell-mediated immunosuppression occurs via concerted action of chemokines and nitric oxide. Cell Stem Cell, 2(2), 141-150. Renner, P., Eggenhofer, E., Rosenauer, A., Popp, F., Steinmann, J., Slowik, P., Geissler, E., Piso, P., Schlitt, H. & Dahlke, M. (Year). Mesenchymal stem cells require a sufficient, ongoing immune response to exert their immunosuppressive function. In: Transplantation Proceedings, 2009. Elsevier, 2607-2611. Ricard‐Blum, S. & Salza, R. (2014). Matricryptins and matrikines: biologically active fragments of the extracellular matrix. Experimental Dermatology. Ries, C., Egea, V., Karow, M., Kolb, H., Jochum, M. & Neth, P. (2007). MMP-2, MT1-MMP, and TIMP-2 are essential for the invasive capacity of human mesenchymal stem cells: Differential regulation by inflammatory cytokines. Blood, 109(9), 4055-4063. Roberts, R., DeMello, V. & Sobel, B. (1976). Deleterious effects of methylprednisolone in patients with myocardial infarction. Circulation, 53(3 Suppl), I204-6. Rock, K. L., Latz, E., Ontiveros, F. & Kono, H. (2010). The sterile inflammatory response. Annual review of immunology, 28, 321. Rohart, F., Mason, E. A., Matigian, N. (2016). A molecular classification of human mesenchymal stromal cells. Peer J 4: e1845 Rohde, L. E., Ducharme, A., Arroyo, L. H., Aikawa, M., Sukhova, G. H., Lopez-Anaya, A., McClure, K. F., Mitchell, P. G., Libby, P. & Lee, R. T. (1999). Matrix metalloproteinase inhibition attenuates early left ventricular enlargement after experimental myocardial infarction in mice. Circulation, 99(23), 3063-3070. Romanic, A. M., Burns-Kurtis, C. L., Gout, B., Berrebi-Bertrand, I. & Ohlstein, E. H. (2001). Matrix metalloproteinase expression in cardiac myocytes following myocardial infarction in the rabbit. Life Sciences, 68(7), 799-814. Romson, J. L., Hook, B. G., Kunkel, S. L., Abrams, G., Schork, M. & Lucchesi, B. (1983). Reduction of the extent of ischemic myocardial injury by neutrophil depletion in the dog. Circulation, 67(5), 1016-1023. Saleh, F., Whyte, M. & Genever, P. (2011). Effects of endothelial cells on human mesenchymal stem cell activity in a three-dimensional in vitro model. European Cells & Materials, 22, 242-257. Salem, H. K. & Thiemermann, C. (2010). Mesenchymal stromal cells: current understanding and clinical status. Stem Cells, 28(3), 585-596. Salmenperä, P., Kankuri, E., Bizik, J., Sirén, V., Virtanen, I., Takahashi, S., Leiss, M., Fässler, R. & Vaheri, A. (2008). Formation and activation of fibroblast spheroids depend on fibronectin–integrin interaction. Experimental Cell Research, 314(19), 3444-3452. Sato, K., Ozaki, K., Oh, I., Meguro, A., Hatanaka, K., Nagai, T., Muroi, K. & Ozawa, K. (2007). Nitric oxide plays a critical role in suppression of T-cell proliferation by mesenchymal stem cells. Blood, 109(1), 228-234. Schönbeck, U., Mach, F. & Libby, P. (1998). Generation of biologically active IL-1β by matrix metalloproteinases: A novel caspase-1-independent pathway of IL-1β processing. The Journal of Immunology, 161(7), 3340-3346. See, F., Kompa, A., Martin, J., Lewis, D. A. & Krum, H. (2005). Fibrosis as a therapeutic target post-myocardial infarction. Current Pharmaceutical Design, 11(4), 477-487. Seidl, C. L., Fulga, T. A., Murphy, C. L. (2018) CRISPR-Cas9 targeting of MMP13 in human chondrocytes leads to significantly reduced levels of the metalloproteinase and enhanced type II collagen accumulation. Osteoarthritis Cartialge Selbi, W., Day, A. J., Rugg, M. S., Fulop, C., de la Motte, C. A., Bowen, T. Hascall, V. C., Phillips, A. O. (2006) Overexpression of hyaluronan synthase 2 alters hyaluronan distribution and function in proximal tubular epithelial cells. Journal of the American Society of Nephrology. 17(6) 1553-1567 Selmani, Z., Naji, A., Zidi, I., Favier, B., Gaiffe, E., Obert, L., Borg, C., Saas, P., Tiberghien, P. & Rouas‐Freiss, N. (2008). Human leukocyte antigen‐G5 secretion by human

170

mesenchymal stem cells is required to suppress T lymphocyte and natural killer function and to induce CD4+ CD25highFOXP3+ regulatory T cells. Stem Cells, 26(1), 212-222. Serini, G., Bochaton-Piallat, M.-L., Ropraz, P., Geinoz, A., Borsi, L., Zardi, L. & Gabbiani, G. (1998). The fibronectin domain ED-A is crucial for myofibroblastic phenotype induction by transforming growth factor-β1. The Journal of Cell Biology, 142(3), 873- 881. Seropian, I. M., Cerliani, J. P., Toldo, S., Van Tassell, B. W., Ilarregui, J. M., González, G. E., Matoso, M., Salloum, F. N., Melchior, R. & Gelpi, R. J. (2013). Galectin-1 controls cardiac inflammation and ventricular remodeling during acute myocardial infarction. The American Journal of Pathology, 182(1), 29-40. Shakhov, A. N., Collart, M., Vassalli, P., Nedospasov, S. & Jongeneel, C. V. (1990). Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. The Journal of Experimental Medicine, 171(1), 35-47. Shioiri, T., Muroi, M., Hatao, F., Nishida, M., Ogawa, T., Mimura, Y., Seto, Y., Kaminishi, M. & Tanamoto, K.-i. (2009). Caspase-3 is activated and rapidly released from human umbilical vein endothelial cells in response to lipopolysaccharide. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 1792(10), 1011-1018. Sirén, V., Salmenperä, P., Kankuri, E., Bizik, J., Sorsa, T., Tervahartiala, T. & Vaheri, A. (2006). Cell-cell contact activation of fibroblasts increases the expression of matrix metalloproteinases. Annals of Medicine, 38(3), 212-220. Sivanathan, K. N., Rojas‐Canales, D. M., Hope, C. M., Krishnan, R., Carroll, R. P., Gronthos, S., Grey, S. T. & Coates, P. T. (2015). Interleukin‐17A‐Induced Human Mesenchymal Stem Cells Are Superior Modulators of Immunological Function. Stem Cells. Smiley, S. T., King, J. A., Hancock, W. W. (2001) Fibrinogen stimulates macrophage chemokine secretion through toll-like receptor 4. Journal of Immunology 167(5), 2887-2894 Spaggiari, G. M., Capobianco, A., Abdelrazik, H., Becchetti, F., Mingari, M. C. & Moretta, L. (2008). Mesenchymal stem cells inhibit natural killer–cell proliferation, cytotoxicity, and cytokine production: Role of indoleamine 2, 3-dioxygenase and prostaglandin E2. Blood, 111(3), 1327-1333. Spinale, F. G. (2007). Myocardial matrix remodeling and the matrix metalloproteinases: Influence on cardiac form and function. Physiological Reviews, 87(4), 1285-1342. Stawowy, P., Margeta, C., Kallisch, H., Seidah, N. G., Chrétien, M., Fleck, E. & Graf, K. (2004). Regulation of matrix metalloproteinase MT1-MMP/MMP-2 in cardiac fibroblasts by TGF-β1 involves furin-convertase. Cardiovascular Research, 63(1), 87-97. Strassmann, G., Patil-Koota, V., Finkelman, F., Fong, M. & Kambayashi, T. (1994). Evidence for the involvement of interleukin 10 in the differential deactivation of murine peritoneal macrophages by prostaglandin E2. The Journal of experimental medicine, 180(6), 2365-2370. Tang, T.-T., Yuan, J., Zhu, Z.-F., Zhang, W.-C., Xiao, H., Xia, N., Yan, X.-X., Nie, S.-F., Liu, J. & Zhou, S.-F. (2012). Regulatory T cells ameliorate cardiac remodeling after myocardial infarction. Basic Research in Cardiology, 107(1), 1-17. Tosato, G. & Jones, K. (1990). Interleukin-1 induces interleukin-6 production in peripheral blood monocytes. Blood, 75(6), 1305-1310. Tressel, S. L., Kaneider, N. C., Kasuda, S., Foley, C., Koukos, G., Austin, K., Agarwal, A., Covic, L., Opal, S. M. & Kuliopulos, A. (2011). A matrix metalloprotease‐PAR1 system regulates vascular integrity, systemic inflammation and death in sepsis. EMBO molecular medicine, 3(7), 370-384. Trial, J., Rossen, R. D., Rubio, J. & Knowlton, A. A. (2004). Inflammation and ischemia: Macrophages activated by fibronectin fragments enhance the survival of injured cardiac myocytes. Experimental Biology and Medicine, 229(6), 538-545. Ueda, A., Okuda, K., Ohno, S., Shirai, A., Igarashi, T., Matsunaga, K., Fukushima, J., Kawamoto, S., Ishigatsubo, Y. & Okubo, T. (1994). NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. The Journal of Immunology, 153(5), 2052-2063.

171

Van Tassell, B. W., Varma, A., Salloum, F. N., Das, A., Seropian, I. M., Toldo, S., Smithson, L., Hoke, N. N., Chau, V. Q. & Robati, R. (2010). Interleukin-1 trap attenuates cardiac remodeling after experimental acute myocardial infarction in mice. Journal of Cardiovascular Pharmacology, 55(2), 117-122. Vanhoutte, D. & Heymans, S. (2010). TIMPs and cardiac remodeling: ‘Embracing the MMP- independent-side of the family’. Journal of Molecular and Cellular Cardiology, 48(3), 445-453. Varda-Bloom, N., Leor, J., Ohad, D. G., Hasin, Y., Amar, M., Fixler, R., Battler, A., Eldar, M. & Hasin, D. (2000). Cytotoxic T lymphocytes are activated following myocardial infarction and can recognize and kill healthy myocytes in vitro. Journal of Molecular and Cellular Cardiology, 32(12), 2141-2149. Veevers-Lowe, J., Ball, S. G., Shuttleworth, A. & Kielty, C. M. (2011). Mesenchymal stem cell migration is regulated by fibronectin through α5β1-integrin-mediated activation of PDGFR-β and potentiation of growth factor signals. Journal of Cell Science, 124(8), 1288-1300. Vincenti, M. P. & Brinckerhoff, C. E. (2007). Signal transduction and cell-type specific regulation of matrix metalloproteinase gene expression: Can MMPs be good for you? Journal of Cellular Physiology, 213(2), 355-364. Waterman, R. S., Tomchuck, S. L., Henkle, S. L. & Betancourt, A. M. (2010). A new mesenchymal stem cell (MSC) paradigm: Polarization into a pro-inflammatory MSC1 or an immunosuppressive MSC2 phenotype. PloS One, 5(4), e10088. Wang, M., Yuan, Q., Xie, L. (2016) Mesenchymal stem cell-based immunomodulation: properties and clinical application. Transl Res 177 127-142 Weirather, J., Hofmann, U. D., Beyersdorf, N., Ramos, G. C., Vogel, B., Frey, A., Ertl, G., Kerkau, T. & Frantz, S. (2014). Foxp3+ CD4+ T cells improve healing after myocardial infarction by modulating monocyte/macrophage differentiation. Circulation research, 115(1), 55-67. Wells, J. M., Gaggar, A., Blalock, J. E. (2015) A novel collagen matricryptin reduces left ventricular dilation post-myocardial infarction by promoting scar formation and angiogenesis Matrix Biology 122-129 Wisniewski, H.-G. & Vilĉek, J. (1997). TSG-6: an IL-1/TNF-inducible protein with anti- inflammatory activity. Cytokine & growth factor reviews, 8(2), 143-156. Wynn, T. A. & Ramalingam, T. R. (2012). Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nature medicine, 18(7), 1028-1040. Yabluchanskiy, A., Li, Y., de Castro Brás, L. E., Hakala, K., Weintraub, S. T. & Lindsey, M. L. (2013). Proteomic analysis of the left ventricle post-myocardial infarction to identify in vivo candidate matrix metalloproteinase substrates. Cell-Cell Interactions. Springer. Yamashita, T., Obana, M., Hayama, A., Iwakura, T., Komuro, I., Nakayama, H. & Fujio, Y. (2011). Th17 cells exhibit protective effects against cardiac fibrosis after myocardial infarction. Circulation, 124(21 Supplement), A14566. Yamazaki, T., Seko, Y., Tamatani, T., Miyasaka, M., Yagita, H., Okumura, K., Nagai, R. & Yazaki, Y. (1993). Expression of intercellular adhesion molecule-1 in rat heart with ischemia/reperfusion and limitation of infarct size by treatment with antibodies against cell adhesion molecules. The American Journal of Pathology, 143(2), 410. Yan, X., Anzai, A., Katsumata, Y., Matsuhashi, T., Ito, K., Endo, J., Yamamoto, T., Takeshima, A., Shinmura, K. & Shen, W. (2013). Temporal dynamics of cardiac immune cell accumulation following acute myocardial infarction. Journal of Molecular and Cellular Cardiology, 62, 24-35. Yilmaz, A., Dietel, B., Cicha, I., Schubert, K., Hausmann, R., Daniel, W. G., Garlichs, C. D. & Stumpf, C. (2010). Emergence of dendritic cells in the myocardium after acute myocardial infarction–implications for inflammatory myocardial damage. International Journal of Biomedical Science, 6(1), 27. Ylostalo, J. H., Bartosh, T. J., Coble, K. & Prockop, D. J. (2012). Human mesenchymal stem/stromal cells cultured as spheroids are self-activated to produce prostaglandin E2 that directs stimulated macrophages into an anti-inflammatory phenotype. Stem Cells, 30(10), 2283-2296. Yu, Q. & Stamenkovic, I. (2000). Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-β and promotes tumor invasion and angiogenesis. Genes & Development, 14(2), 163-176.

172

Zamilpa, R., Ibarra, J., de Castro Brás, L. E., Ramirez, T. A., Nguyen, N., Halade, G. V., Zhang, J., Dai, Q., Dayah, T. & Chiao, Y. A. (2012). Transgenic overexpression of matrix metalloproteinase-9 in macrophages attenuates the inflammatory response and improves left ventricular function post-myocardial infarction. Journal of molecular and cellular cardiology, 53(5), 599-608. Zamilpa, R. & Lindsey, M. L. (2010). Extracellular matrix turnover and signaling during cardiac remodeling following MI: Causes and consequences. Journal of Molecular and Cellular Cardiology, 48(3), 558-563. Zamilpa, R., Lopez, E. F., Chiao, Y. A., Dai, Q., Escobar, G. P., Hakala, K., Weintraub, S. T. & Lindsey, M. L. (2010). Proteomic analysis identifies in vivo candidate matrix metalloproteinase-9 substrates in the left ventricle post-myocardial infarction. Proteomics, 10(11), 2214-2223. Zavadzkas, J. A., Stroud, R. E., Bouges, S., Mukherjee, R., Jones, J. R., Patel, R. K., McDermott, P. J. & Spinale, F. G. (2014). Targeted overexpression of tissue inhibitor of matrix metalloproteinase-4 modifies post–myocardial infarction remodeling in mice. Circulation Research, 114(9), 1435-1445. Zelante, T., Fallarino, F., Bistoni, F., Puccetti, P. & Romani, L. (2009). Indoleamine 2, 3- dioxygenase in infection: the paradox of an evasive strategy that benefits the host. Microbes and Infection, 11(1), 133-141. Zimmermann, J. A. & Mcdevitt, T. C. (2014). Pre-conditioning mesenchymal stromal cell spheroids for immunomodulatory paracrine factor secretion. Cytotherapy, 16(3), 331-345. Zorn, C. N., Pardo, J., Martin, P., Kuhny, M., Simon, M. M. & Huber, M. (2013). Secretory lysosomes of mouse mast cells store and exocytose active caspase‐3 in a strictly granzyme B dependent manner. European journal of immunology, 43(12), 3209- 3218. Zouggari, Y., Ait-Oufella, H., Bonnin, P., Simon, T., Sage, A. P., Guérin, C., Vilar, J., Caligiuri, G., Tsiantoulas, D. & Laurans, L. (2013). B lymphocytes trigger monocyte mobilization and impair heart function after acute myocardial infarction. Nature Medicine, 19(10), 1273-1280.

173