CITED2 Modulates Breast Cancer Metastatic Ability Through Effects on Ikka Swaathi Jayaraman, Michele Doucet, Wen Min Lau, and Scott L

Published OnlineFirst May 23, 2016; DOI: 10.1158/1541-7786.MCR-16-0081

Oncogenes and Tumor Suppressors Molecular Cancer Research CITED2 Modulates Breast Cancer Metastatic Ability through Effects on IKKa Swaathi Jayaraman, Michele Doucet, Wen Min Lau, and Scott L. Kominsky

Abstract

Previously, we identified the transcriptional coactivator CIT- MDA-MB-231 and MDA-MB-468 cells, expression of the NF-kB ED2 as a potential facilitator of bone metastasis using a murine regulator IKKa was significantly reduced, alongwithseveralNF- mammary cancer model. Extending these studies to human breast kB targets with known roles in metastasis (OPN, MMP9, uPA, cancer, it was observed that CITED2 mRNA expression was SPARC, IL11, and IL1b). Furthermore, ChIP assay revealed significantly elevated in patient specimens of metastatic breast recruitment of CITED2 to the promoter of IKKa, indicating a cancer relative to primary tumors, with highest levels in metastasis direct role in regulating its expression. Consistent with reduced to bone relative to non-bone sites. To further evaluate CITED2 IKKa expression, CITED2 knockdown inhibited both canonical functions in breast cancer metastasis, CITED2 expression was and noncanonical NF-kB signaling. Finally, restoration of IKKa stably reduced in the human breast cancer cell lines MDA-MB- expression following CITED2 knockdown in MDA-MB-231 and 231 and MDA-MB-468, which are metastatic in animal models. MDA-MB-468 cells rescued their invasive ability. Collectively, While CITED2 knockdown had no effect on cell proliferation, these data demonstrate that CITED2 modulates metastatic cell migration and invasion were significantly reduced, as was ability in human breast cancer cells, at least in part, through the establishment of metastasis following intracardiac admin- the regulation of IKKa. istration in athymic nude mice. To explore the mechanism behind these effects, gene expression following CITED2 knock- Implications: The current study highlights the role of CITED2 down in MDA-MB-231 cells by cDNA microarray was per- in facilitating breast cancer metastasis, partly via regulation of formed. As confirmed at the mRNA and protein levels in both IKKa. Mol Cancer Res; 14(8); 730–9. 2016 AACR.

Introduction role in development (2–5). As a transcriptional coactivator, CIT- ED2 interacts with several transcription factors, such as p300/CBP, Breast cancer is the most frequently diagnosed cancer in women Lhx2, TFAP2, Smad2/Smad3, PPARg, and estrogen receptor, worldwide and the second most commonly occurring cancer modulating their ability to activate gene transcription (6–11). overall. Although primary tumors may be effectively treated when Beyond its involvement in development, CITED2 has also been detected early, metastatic disease is largely incurable and repre- reported to play a role in cancer, including that of the skin, colon, sents the ultimate cause of mortality in breast cancer patients. It is and lung (12–14). Recently, we identified CITED2 as a potential estimated that approximately 6% of patients already have met- facilitator of breast cancer bone metastasis using a murine mam- astatic disease at the time of diagnosis while approximately 20% mary cancer model (15). Although our preliminary analysis of to 50% of patients who are initially diagnosed with early-stage primary human breast tumor tissues revealed significantly higher breast cancer will eventually develop metastasis (1). Sadly, the levels of CITED2 mRNA relative to normal mammary epithelium median survival time for patients with metastatic breast cancer is (15), its expression pattern in metastatic lesions and functional only 18 to 30 months. Despite recent research efforts, elucidation contribution to human breast cancer metastasis remain unclear. of the critical drivers of metastasis and their mechanism of action In this study, we investigated the role of CITED2 in human is lacking. Filling this knowledge gap is essential to the develop- breast cancer metastasis. Here, we show that in breast cancer ment of novel therapeutic modalities and improving the clinical patients, CITED2 expression is significantly elevated in metastatic management of this disease. lesions relative to primary tumors, with highest levels in bone The Cbp/p300–interacting transactivator with Glu/Asp–rich metastasis. Furthermore, utilizing two highly invasive breast carboxy-terminal domain-2 (CITED2) is a non-DNA–binding cancer cell lines, we show that stable knockdown of CITED2 transcriptional coactivator that was originally discovered for its significantly reduces tumor migration and invasion in vitro and the establishment of metastasis in vivo. Finally, we provide evi- Department of Orthopaedic Surgery, Johns Hopkins University School dence that CITED2 mediates metastatic ability in human breast of Medicine, Baltimore, Maryland. cancer cells, at least in part, by regulating the expression of IKKa. Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/). Materials and Methods Corresponding Author: Scott L. Kominsky, Johns Hopkins University School of Cell lines, tissues, and treatment Medicine, 720 Rutland Avenue, Ross 232, Baltimore, MD 21205. Phone: 410-502- The human breast cancer cell lines MDA-MB-231 and MDA- 6417; Fax: 410-502-6414; E-mail: [email protected] MB-468 were obtained from ATCC (2014) and were authenticat- doi: 10.1158/1541-7786.MCR-16-0081 ed using DNA profiling and cytogenetic analysis by the cell bank. 2016 American Association for Cancer Research. Cells were utilized for the experiments within 6 months from the

730 Mol Cancer Res; 14(8) August 2016

CITED2 Modulates Human Breast Cancer Metastasis

time of resuscitation. MDA-MB-231 cells were maintained in a graded series of ethanol (Pharmco-AAPER). Sections were RPMI medium (Gibco) supplemented with 10% FBS (Atlanta immersed in antigen retrieval solution (Dako) and heated in a Biologicals), and MDA-MB-468 cells were maintained in DMEM steamer for 20 minutes. Cooled sections were washed with PBS medium (Gibco) supplemented with 10% FBS and 1% L-gluta- (Gibco), and endogenous peroxidase activity was quenched by mine (Gibco). To identify genes that are regulated by the NF-kB immersing sections in 3% hydrogen peroxide (Fischer Scientiﬁc) pathway, cells were treated with 10 mmol/L of PS1145 (Sigma- for 12 minutes and washed with PBS. Sections were blocked by Aldrich) for 16 hours at 37C. incubation with protein block solution (Dako) for 30 minutes at Normal mammary epithelium samples, kindly provided by room temperature and incubated at 4C for 18 hours with goat Dr. Saraswati Sukumar (Johns Hopkins University School of anti-CITED2 (1:500; Everest Biotech). Sections were then sequen- Medicine, Baltimore, MD), were prepared from reduction mam- tially incubated for 15 minutes at room temperature with strepta- moplasty specimens of women with no breast abnormalities. vidin–biotin complex, tyramide ampliﬁcation reagent, and strep- Normal and tumor tissues were obtained from the Surgical tavidin–horseradish peroxidase (HRP) from the DACO CSA Pathology Division of the Johns Hopkins Hospital (Baltimore, Kit (Vector Laboratories). To visualize proteins, the chromogen MD) following the approval of the Institutional Review Board 3, 3-diaminobenzamindine (DAB; Open Biosystems) was added (IRB) of the Johns Hopkins University School of Medicine. For all for two minutes at room temperature. Sections were subsequently specimens, required written informed patient consents were washed in water and counterstained with hematoxylin Gill No. obtained as approved by the IRB. 3 (Sigma-Aldrich).

Transfection Western blot analysis To study the effects of CITED2 in human breast cancer metas- Total protein extracts from cell lines were obtained as tasis, MDA-MB-231 and MDA-MB-468 cells were infected with described previously (15). Cytoplasmic and nuclear extracts the lentiviral shRNA expression vector pLKO.1-puro (Addgene was processed using NE-PER cytoplasmic and nuclear extrac- plasmid 8453) containing siRNA sequence specific for scrambled tion reagents (Thermo Scientific) according to the manufac- or CITED2. The CITED2 siRNA sequence has been described turer's instructions. Conditioned medium was collected by previously (9, 16). Stable cells were selected in the presence of maintaining the cells in serum-free medium. Samples were 1 mg/mL puromycin (Sigma-Aldrich) for one week and utilized for resolved using SDS-PAGE, transferred to nitrocellulose mem- subsequent experiments. brane (Bio-Rad), and probed with sheep anti-CITED2 (1:250; For experiments involving reexpression of IKKa, shCITED2- R&D Systems), rabbit anti-IKKa,anti-IkBa, anti-p65, anti-RelB, expressing cells were transiently transfected with a 3:1 ratio of anti-HDAC1 (1:1,000; Cell Signaling Technology), mouse anti- X-tremeGENE HP DNA Transfection Reagent (Roche) and GAPDH (1:10,000; kindly provided by Dr. Shanmugasun- pCR3.1-FLAG-IKKa vector [a kind gift from Hiroyasu Nakano, daram Ganapathy Kanniappan, Johns Hopkins University Juntendo University School of Medicine, Tokyo, Japan (Addgene School of Medicine, Baltimore, MD), or actin (1:1,000; Sig- plasmid 15467; ref. 17)] or empty vector in OPTI-MEM medium ma-Aldrich) antibodies. Membranes were incubated with HRP- (Gibco) for 24, 48, or 72 hours. conjugated antibody against sheep (1:2,000; R&D Systems), rabbit, or mouse (1:2,000; GE Healthcare) IgG, and binding Quantitative qRT-PCR was revealed by chemiluminescence detection (Millipore). Total RNA from tissue samples and cell lines was extracted using TRIzol (Invitrogen), and cDNA was generated using a Proliferation assay reverse transcription system (Promega). The qRT-PCR parameters The in vitro proliferation of cells was determined by MTS assay fi have been described previously (11). Ampli cation of 36B4 was using 0.2 mg/mL MTS reagent (Promega) as described previously used as an internal control. Relative expression between samples (15). Data for each time point were obtained in triplicate per C was calculated by the comparative t method. The primer experimental condition. sequences used were: CITED2 (sense) 50-ACCATCACCCTGCC- 0 CACC-3 , (antisense) CGTAGTGTATGTGCTCGCCCA; IKKa Migration and invasion assay 0 0 0 (sense) 5 -GGCTTCGGGAACGTCTGTC-3 , (antisense) 5 -TTTG- A 24-well plate containing either 8.0-mm pore cell culture insert 0 0 GTACTTAGCTCTAGGCGA-3 ; OPN (sense) 5 -GAAGTTTCGCA- (BD Falcon) or 8.0-mm pore transwell inserts precoated with 0 0 GACCTGACAT-3 , (antisense) 5 -GTATGCACCATTCAACTCCT- 100 mL Matrigel (BD Falcon) was utilized for the migration and 0 0 0 CG-3 ; MMP9 (sense) 5 -GGGACGCAGACATCGTCATC-3 , (anti- invasion assays, respectively. Tumor cells (2.5 104 cells) were 0 0 0 sense) 5 -TCGTCATCGTCGAAATGGGC-3 ; uPA (sense) 5 - seeded in the upper chamber in medium containing 0% FBS and 0 0 GGGAATGGTCACTTTTACCGAG-3 , (antisense) 5 -GGGCATG- the bottom chamber filled with medium containing either 0% or 0 0 GTACGTTTGCTG-3 ; SPARC (sense) 5 -AGCACCCCATTGACG- 20% FBS as the chemoattractant. After 16 hours (in case of 0 0 0 GGTA-3 , (antisense) 5 -GGTCACAGGTCTCGAAAAAGC-3 ; IL11 migration) or 48 hours (in case of invasion), cells in the upper 0 0 0 (sense) 5 -CGAGCGGACCTACTGTCCTA-3 , (antisense) 5 - chamber were removed with cotton swabs. Cells that migrated or 0 0 GCCCAGTCAAGTGTCAGGTG-3 ; IL1b (sense) 5 -ATGATGGCT- invaded to the lower surface of the insert were fixed in 100% cold 0 0 TATTACAGTGGCAA-3 , (antisense) 5 -GTCGGAGATTCGTAGC- methanol (Fischer Scientific), washed in PBS, and stained with 2% 0 0 0 TGGA-3 ; 36B4 (sense) 5 -GAAGGCTGTGGTGCTGATGG-3 , crystal violet (Harleco). Three representative images from each 0 0 (antisense) 5 -CCCCTGGAGATTTTAGTGGT-3 . well were captured at 100 magnification by light microscopy, and the total number of migrated or invaded cells per image was IHC counted using ImageJ imaging software (NIH, Bethesda, MD). Formalin-fixed and paraffin-embedded tissue sections were Data are representative of at least two independent experiments deparaffinized in xylene (Fisher Scientific) and rehydrated through performed in triplicates per experimental condition.

www.aacrjournals.org Mol Cancer Res; 14(8) August 2016 731

Jayaraman et al.

In vivo assessment of breast cancer metastasis (sense) 50-GTGGTTCCGTTCAGCCCT-30, (antisense) 50-TGCTC- Tumor cells (1 105 cells) from each group were injected into GCGCGTCTTTG-30. the left cardiac ventricle of five-week-old athymic nude mice [Taconic; for MDA-MB-231 cells, n ¼ 9 (scramble) and 10 Statistical analysis (shCITED2); for MDA-MB-468 cells, n ¼ 10 (scramble) and Differences in the migratory and invasive ability, average tumor n ¼ 7 (shCITED2)]. Two weeks later, the establishment of area and osteolytic area, and protein expression between exper- tumor-induced osteolysis in the bone was analyzed by obtaining imental conditions were compared by unpaired Student t test. digital radiographic images of the femur and tibia twice a week Differences in the mRNA expression of prometastatic genes in the using a Faxitron MX-20 X-ray unit (Faxitron X-ray Corp.) until shCITED2-expressing cells relative to scramble cells normalized to termination of the experiment. The experiment was terminated 1.0 were compared by one sample t test. CITED2 mRNA expres- when animals became moribund. The osteolytic area in the sion in tissues and the results of the invasion assay upon IKKa radiographic images was measured using MetaMorph image reexpression were analyzed by ANOVA and Tukey multiple com- analysis software (Meta Imaging Series version 6.1, Universal parison test. P < 0.05 was considered statistically significant. For Imaging Corp.). Tumor lesions within the bone were analyzed all figures, denotes P < 0.05, denotes P < 0.01, and denotes by H&E staining of bone sections decalcified in 10% EDTA P < 0.001. (Sigma-Aldrich). Brain, liver, and lungs were harvested and maintained in Bouin's fixative (RICCA Chemical) for 24 hours and Results counted for the total number of macrometastatic lesions. CITED2 expression is elevated in breast cancer metastasis All animal experiments were carried out in accordance with the Previously, we presented evidence that CITED2 expression is National Research Council's "Guide to the Care and Use of significantly elevated in primary human breast tumors relative to Laboratory Animals." Animal use was approved by the Johns normal mammary epithelium and is negatively correlated with Hopkins Animal Care and Use Committee, animal welfare assur- survival (11, 15). Extending our analysis to metastatic lesions, ance #A3272-01, protocol #MO10M450. CITED2 mRNA expression was significantly higher in human breast cancer metastases relative to primary breast tumors by Microarray analysis qRT-PCR analysis (Fig. 1A). This difference appeared to be due cDNA expression between scramble and shCITED2 MDA-MB- to the fact that CITED2 levels in metastases were more frequently 231 cells was compared using Agilent Human GE 4 44 K v2 elevated beyond those observed in normal mammary epithelium microarray (G4845A). Log2-transformed signal intensities, with- as compared with primary tumors, many of which displayed out background subtraction were imported into GeneSpring GX CITED2 levels equivalent to that in normal. Consistent with 10 software (Agilent Technologies) and (quantile) normalized mRNA results, this expression pattern was also appreciated at the within the sample type. Differentially expressed genes in protein level in a limited subset of samples by immunohisto- shCITED2-expressing cells relative to scramble cells were identi- chemical analysis (Fig. 1B). Finally, among metastases, higher fied based on 2-fold change in gene expression. Quality assess- expression of CITED2 mRNA was observed in metastasis to bone ment of samples and microarray analysis were conducted at the relative to non-bone sites. Taken together, these data demonstrate Sidney Kimmel Cancer Center Microarray Core Facility at Johns that CITED2 expression is frequently elevated in metastatic Hopkins University School of Medicine (Baltimore, MD; sup- lesions of breast cancer patients, with highest levels in bone ported by NIH grant P30 CA006973 entitled Regional Oncology metastasis. Research Center). Microarray data are deposited in the Array Express database (www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-4267. Downregulation of CITED2 inhibits breast cancer metastasis To explore the role of CITED2 in breast cancer metastasis, we ELISA analysis utilized the human breast cancer cell lines MDA-MB-231 and OPN and IL11 ELISA immunoassay (R&D Systems) were MDA-MB-468. These cell lines are highly invasive in vitro, readily performed on serum-free tumor-conditioned media obtained establish metastases following systemic administration in animal from cell lines according to the manufacturer's instructions. models (18–22), and as we have shown previously, express elevated levels of CITED2 relative to human mammary epithelial Electrophoretic mobility shift assay cells and breast cancer cell lines that are nonmetastatic in animal Electrophoretic mobility shift assay (EMSA) was performed on models (15). MDA-MB-231 and MDA-MB-468 cells were stably nuclear cell lysates using the LightShift EMSA and Chemilumines- infected with a lentiviral expression vector containing either cent Detection Kit (Thermo Scientific) based on the manufacturer's shRNA specific for CITED2 (shCITED2) or scrambled shRNA instructions using NF-kB(50-Biotin-AAGTTGAGGGGACTTTCC- (scramble), and levels of CITED2 were assessed at both the mRNA CAGGCT-30 and 50-Biotin-AGCCTGGGAAAGTCCCCTCAACTT- and protein levels (Fig. 2A). Stable expression of shCITED2 30) oligonucleotides. Oct1 (50-Biotin-TGTCGAATGCAAATCACTA- resulted in a greater than 75% reduction in CITED2 expression GAA-30 and 50-Biotin-TTCTAGTGATTTGCATTCGACA-30)was in both MDA-MB-231 and MDA-MB-468 cells by qRT-PCR and used as the loading control. Western blot analysis. Prior to examining the effect of CITED2 on metastatic progression, we first examined whether reducing Chromatin immunoprecipitation CITED2 expression altered the rate of cell proliferation in vitro.As Chromatin immunoprecipitation (ChIP) was performed on determined by MTS assay, shCITED2 cells exhibited a similar nuclear cell lysates using the SimpleChIP Enyzmatic Chromatin IP growth rate to that of scramble cells, indicating that knockdown of Kit (Cell Signaling Technology) based on the manufacturer's CITED2 did not affect cell growth in either cell line (Fig. 2B). To instructions. The promoter primer sequence used for IKKa was begin exploring CITED2 involvement in metastatic progression,

732 Mol Cancer Res; 14(8) August 2016 Molecular Cancer Research

CITED2 Modulates Human Breast Cancer Metastasis

* A * 5,000 ** 3,000

1,000 1,000 750 500 250

Relative mRNA expression mRNA Relative 0 Normal mammary >5 yr <5 yr Non-bone Bone epithelium Survival Survival Primary tumors Metastases

B Mammary epithelium IDC (low CITED2) IDC (high CITED2) BBM

T N N T T T T N N T B T T

Figure 1. CITED2 expression is elevated in human breast cancer metastasis. A, CITED2 mRNA expression was determined by qRT-PCR in human normal mammary epithelium (n ¼ 12), primary breast tumor tissues (invasive ductal carcinoma) from patients surviving greater than (n ¼ 11) and less than (n ¼ 8) 5 years from the time of diagnosis, and metastatic lesions obtained from non-bone (n ¼ 19) and bone (n ¼ 6) sites (, P < 0.05; , P < 0.01). B, immunohistochemical analysis was performed on parafﬁn-embedded tissue sections of normal mammary epithelium (n ¼ 5), invasive ductal carcinoma (IDC; n ¼ 5), and breast cancer bone metastasis (BBM; n ¼ 8) using goat anti-CITED2 antibody. Protein was visualized using DAB (brown). Sections were counterstained with hematoxylin and visualized by light microscopy. N, normal; T, tumor; and B, bone. Magniﬁcation, 400.

we evaluated the effects of CITED2 knockdown on the migratory to those injected with scramble cells, although no differences were and invasive ability of MDA-MB-231 and MDA-MB-468 cells observed using MDA-MB-468 cells (Supplementary Fig. S1A). using in vitro transwell migration and invasion assays, respective- Furthermore, metastasis to the lung and liver did not appear to ly. CITED2 knockdown significantly reduced the migratory and be affected by shCITED2 expression in either MDA-MB-231 or invasive ability of both MDA-MB-231 and MDA-MB-468 cells MDA-MB-468 cells (Supplementary Fig. S1B and S1C). Taken (Fig. 2C and D). Next, we assessed the effects of CITED2 down- together, these observations indicate that CITED2 may play a role regulation on the establishment of metastasis following intracar- in the establishment of breast cancer metastasis, particularly to the diac administration of MDA-MB-231 and MDA-MB-468 cells bone. stably expressing shCITED2 or scramble in athymic nude mice. Although this model does not replicate the entire metastatic Inhibition of CITED2 reduces expression of IKKa and cascade, it effectively assesses the ability of tumor cells to extrav- prometastatic NF-kB target genes asate from the vasculature, invade, and colonize secondary organ To explore the mechanism through which CITED2 influences sites and establish vascularized metastatic lesions. Mice admin- metastatic ability, we examined the effect of CITED2 knockdown istered with shCITED2-expressing cells displayed significantly on gene expression in MDA-MB-231 cells by cDNA microarray reduced metastasis to bone relative to the scramble group. As analysis (Supplementary Table S1). Notably, IKKa, a critical evidenced by digital radiography, osteolytic area was significantly mediator of the NF-kB signaling cascade (23) was found to be lower in the shCITED2 group relative to the scramble group (Fig. downregulated along with several downstream targets having 2E and F, top). Consistent with reduced osteolysis, the shCITED2 reported roles in promoting metastasis, including osteopontin group also displayed a significant reduction in tumor area relative (OPN), matrix metalloproteinase 9 (MMP9), urokinase-type to the scramble group, as measured on histologic sections (Fig. 2E plasminogen activator (uPA), secreted protein, acidic, cysteine- and F, bottom). In addition, mice injected with shCITED2-expres- rich (SPARC), IL11, and IL1b. Although the extracellular matrix sing MDA-MB-231 cells developed fewer brain metastases relative protein SPARC and proteases MMP9 and uPA have been shown to

www.aacrjournals.org Mol Cancer Res; 14(8) August 2016 733

Jayaraman et al.

A 231 468 B 231 468 100 100 2.0 Scramble 1.00 Scramble ScrambleshCITED2 shCITED2 shCITED2

75 75 468 231 CITED2 1.5 0.75

50 50 GAPDH 1.0 0.50

25 25 ** ** CITED2 0.5 0.25 MTS Assay (OD)

Relative mRNA expressionRelative mRNA 0 0 GAPDH 0.0 0.00 le b 024487296 024487296 Hours Hours ScrambleshCITED2 ScramshCITED2

C 231 468 D 231 468 3,000 1,750 500 1,600 1,500 400 1,200 1,250 2,000 * 1,000 300 800 * 750 200 1,000 500 400 100 250 *

Number of invading cells *** Number of migrating cells 0 0 0 0

Scramble Scramble ScrambleshCITED2 ScrambleshCITED2 shCITED2 shCITE

EFScramble shCITED2 Scramble shCITED2

) 1.5 0.5 ) 2 2

0.4 1.0 0.3 * * 0.2 0.5

0.1 Average osteolytic area (mm area osteolytic Average

0.0 (mm area osteolytic Average 0.0

ScrambleshCITED2 ScrambleshCITED2 2.5 231 468 2.5 ) ) 2 2 2.0 2.0

1.5 1.5

1.0 1.0 * 0.5 * 0.5 Average tumor area (mm tumor Average Average tumor area (mm tumor Average 0.0 0.0

ScrambleshCITED2 ScrambleshCITED2

Figure 2. CITED2 knockdown in breast cancer cells inhibits tumor migration and invasion invitro and bone metastasisinvivo. A, CITED2 mRNA expression (left) was determined by qRT-PCR. Data are representative of triplicate experiments. CITED2 protein expression (right) was determined by Western blot analysis performed onequal amounts of protein from total cell lysates. GAPDH serves as the loading control. B, cell proliferation was determined by MTS assay. OD, optical density. C and D, the migratory and invasive capability of the tumors was determined by migration (C) and invasion (D) assays, respectively. E and F, scramble or shCITED2-expressing MDA-MB-231 (E) and MDA-MB-468 (F) cells were injected into the left cardiac ventricle of athymic nude mice. Top, digital radiographic imaging of the femur and tibia showing areas of osteolysis marked by white circles. The adjacent histograms represent the average osteolytic area measured on the radiographic images between the experimental groups; bottom, H&E staining of decalciﬁed bone sections indicating presence of tumor lesions as shown by black rectangles and circles. The adjacent histograms represent the average tumor area measured on histologic images between the experimental groups (, P < 0.05; , P < 0.01; , P < 0.001).

734 Mol Cancer Res; 14(8) August 2016 Molecular Cancer Research

CITED2 Modulates Human Breast Cancer Metastasis

A BC 0.0 50,000 0.5 ScrambleshCITED2 –2.5 * 40,000 0.4 *** IKKα 30,000 0.3 –5.0 CE

231 –5 GAPDH 20,000 0.2 ** * * 0.1 –15 10,000 MMP9 *** IL11 Expression (pg/mL) OPN Expression (ng/mL) 0.0 Relative mRNA expression ** 0 CM uPA –25 Scramble α β Scramble shCITED2 shCITED2 IKK OPN uPA IL11 IL1 MMP9 SPARC

D 0.0 EF

25,000 –2.5 Scramble shCITED2 22,500 ** *** IKKα 20,000 17,500 –5.0 * 15,000 * CE

468 GAPDH –7.5 10,000 MMP9 **

–50 * IL11 Expression (pg/mL) Relative mRNA expression

CM 0 uPA –100 α β Scramble IKK uPA IL11 IL1 shCITED2 MMP9 SPARC

G 0.25

0.20 * 0.15 231 0.10 % Input

0.05

0.00

IgG

CITED2

Figure 3. CITED2 knockdown in breast cancer cells reduces expression of IKKa and prometastatic NF-kB target genes. A and D, mRNA expression was determined by qRT-PCR. Data are representative of triplicate experiments. B and E, protein expression of IKKa was determined by Western blot analysis of total cell lysates (CE). GAPDH serves as the loading control. Protein expression of MMP9 and uPA was determined by Western blot analysis of serum-free condition medium (CM). C and F, protein expression of IL11 and OPN (MDA-MB-231 only) was analyzed by ELISA. G, localization of CITED2 or IgG to the IKKa promoter was assessed by ChIP assay using anti-sheep CITED2 or sheep IgG antibodies in wild-type MDA-MB-231 cells (, P < 0.05; , P < 0.01; , P < 0.001). promote tumor invasion (24–28), evidence suggests that the reportedly affects numerous steps in the metastatic cascade (30). cytokines IL11 and IL1b facilitate the establishment of osteolytic Regulation of these genes by NF-kB signaling was conﬁrmed in metastasis (18, 29). In addition, the multifunctional protein OPN MDA-MB-231 cells, wherein treatment with the IKK inhibitor

www.aacrjournals.org Mol Cancer Res; 14(8) August 2016 735

Jayaraman et al.

A 231 468 cells, CITED2 was found to localize to the promoter of IKKa, indicating a potentially direct role for CITED2 in the regulation of its expression. (Fig. 3G). Collectively, these data indicate that CITED2 knockdown reduces the expression of IKKa and several ScrambleshCITED2ScrambleshCITED2 downstream prometastatic genes in breast cancer cells. IκBα Downregulation of CITED2 attenuates NF-kB signaling NF-kB signaling is constitutively active in breast cancer (32) CE GAPDH and occurs via both canonical and noncanonical pathways, each of which involves IKKa. In the canonical pathway, the trimeric IKKa/b/g complex phosphorylates the NF-kB inhibitor IkBa, inducing its degradation and concomitantly releasing p65 p65/p50 transcription factors to translocate into the nucleus for regulation of gene expression (33). In the noncanonical pathway, phosphorylation of p100 by IKKa triggers nuclear RelB

NE translocation of the RelB/p52 transcription factors for regulating gene expression (33). As CITED2 knockdown resulted in the HDAC1 downregulation of IKKa expression along with several downstream targets of NF-kB, we next investigated the effect of CITED2 on basal NF-kB signaling in breast cancer cells. Exam- ining the effects of CITED2 knockdown on the expression levels and localization of NF-kB signaling factors by Western blot B analysis revealed increased levels of IkBa and reduced nuclear levels of p65 and RelB in shCITED2-expressing MDA-MB-231 ScrambleshCITED2 and MDA-MB-468 cells relative to scramble cells (Fig. 4A), p65.p50 indicating that both the canonical and noncanonical pathways were affected. Consistent with reduced nuclear p65 and RelB p50.p50 levels, NF-kB DNA-binding activity of the p65/p50 heterodimer

NF- κ B was also markedly reduced in shCITED2-expressing MDA-MB- 231 and MDA-MB-468 cells relative to scramble cells as deter- Oct-1 mined by EMSA (Fig. 4B). Together, these data demonstrate the ability of CITED2 to inﬂuence NF-kB signaling.

Restoration of IKKa expression reverses effects of CITED2 p65.p50 knockdown on breast cancer cell invasion As CITED2 knockdown reduced levels of IKKa along with p50.p50 NF- κ B numerous downstream factors with reported roles in promot- 468 231 ing metastatic dissemination (Fig. 3), we next investigated the possibility that the reduced metastatic ability of shCITED2- Oct-1 expressing breast cancer cells was related to the downregulation of IKKa expression. To address this question, we transiently restored IKKa expression in shCITED2-expressing MDA-MB- Figure 4. 231 and MDA-MB-468 cells (Fig. 5A) and examined invasive CITED2 regulates NF-kB signaling. A, Western blot analysis of cytoplasmic IkBa ability by in vitro transwell invasion assay. Notably, restoring and nuclear p65 and RelB proteins was performed on equal amounts IKKa expression in shCITED2-expressing cells signiﬁcantly of protein obtained from cytoplasmic (CE) and nuclear (NE) cell lysates. increased invasive ability relative to empty vector–transfected GAPDH and HDAC1 serve as the cytoplasmic and nuclear loading controls, shCITED2 cells, returning invasiveness to levels commensurate respectively. B, nonradioactive EMSA analysis was performed on equal with those observed in scramble cells (Fig. 5B and C). These amounts of nuclear cell lysate using NF-kB and Oct-1 oligonucleotides. Oct-1 serves as the loading control (, P < 0.05; , P < 0.01). data support a role for IKKa in mediating the effects of CITED2 on the metastatic ability of breast cancer cells.

PS1145, which prevents IkBa degradation (31), reduced both Discussion basal NF-kB signaling by Western blot analysis and expression of Despite current treatment efforts, the vast majority of patients OPN, MMP9, uPA, SPARC, IL11, and IL1b by qRT-PCR (Supple- diagnosed with metastatic breast cancer ultimately succumb to mentary Fig. S2A and S2B). Moreover, using qRT-PCR and this disease, highlighting the need for clearer understanding of the Western blot/ELISA analyses, we conﬁrmed downregulation of drivers of metastasis and their mechanism of action. In this study, IKKa along with the aforementioned NF-kB target genes in we have shown that expression of the non-DNA–binding tran- shCITED2-expressing MDA-MB-231 and MDA-MB-468 cells scriptional coactivator CITED2 is signiﬁcantly elevated in meta- compared with scramble cellsatboththemRNAandprotein static lesions of breast cancer patients relative to primary tumors. levels (Fig. 3A–F).Furthermore,byChIPassayinMDA-MB-231 Furthermore, we have demonstrated that downregulation of

736 Mol Cancer Res; 14(8) August 2016 Molecular Cancer Research

CITED2 Modulates Human Breast Cancer Metastasis

A 231 468

ScrambleshCITED2shCITED2 (EV) (IKKα) ScrambleshCITED2shCITED2 (EV) (IKKα)

IKKα IKKα

GAPDH GAPDH

Figure 5. Restoration of IKKa expression B following CITED2 knockdown in breast Scramble Scramble cancer cells rescues cell invasiveness. A, IKKa expression was determined by Western blot analysis of equal amounts shCITED2 shCITED2 of total protein lysates obtained from (EV) scramble cells or shCITED2-expressing (EV) cells transfected with either empty shCITED2 vector (EV) or IKKa. GAPDH serves as shCITED2 the loading control. B and C, invasive (IKKα) (IKKα) ability of scramble cells and shCITED2 cells transfected with either empty vector (EV) or IKKa was determined *** by in vitro transwell invasion assay. C 800 *** 400 *** B, representative images of transwell *** inserts following staining of invading 600 cells. C, quantiﬁcation of invading cells 300 showing the average number per experimental condition (, P < 0.001). 400 200

200 100 Number of invading cells Number of invading cells 0 0

Scramble Scramble

shCITED2 (EV) α shCITED2 (EV) shCITED2 (IKK ) shCITED2 (IKKα)

CITED2 significantly attenuates invasive and metastatic ability in expression of IL11 and IL1b, both of which are reported two human breast cancer cell lines (MDA-MB-231 and MDA-MB- mediators of bone metastasis and osteolysis (18, 29), thus 468). Finally, we provide evidence that the effects of CITED2 on warranting further investigation into their potential contribu- metastatic ability are mediated, at least in part, by controlling tion toward the metastatic effects of CITED2. expression of the NF-kB regulator IKKa, the levels of which have In addition to the impairment of bone metastasis, CITED2 been shown to negatively correlate with relapse-free survival in knockdown in MDA-MB-231 cells also inhibited the establish- breast cancer patients (Supplementary Fig. S3). ment of brain metastasis. This effect was not observed in MDA- Although elevated levels of CITED2 were found in patient MB-468 cells, possibly due to the fact that this cell line samples of metastatic disease relative to primary tumors, high- colonized the brain less frequently than MDA-MB-231 in the est levels were noted in metastases to bone (Fig. 1A). Further- control condition. Although the lesser ability of MDA-MB-468 more, the inhibition of metastatic colonization observed fol- cells to colonize the brain could be due to various differences lowing knockdown of CITED2 in breast cancer cell lines (Fig. between these two cell lines, it is interesting to note that 2E and F and Supplementary Fig. S1) was largely limited to canonical TGFb signaling is absent in MDA-MB-468 cells due skeletal disease. These findings are in agreement with our to the lack of Smad4 in this cell line (34). Combined with the previous data demonstrating that reducing CITED2 expression reported role of CITED2 in regulating TGFb signaling through in the murine mammary tumor cell line NT2.5 significantly Smad interactions (9), it is tempting to speculate that the reduces bone metastasis in vivo (15), highlighting the potential divergent ability of MDA-MB-231 and MDA-MB-468 cells to importance of CITED2 as a critical mediator of bone metastasis establish brain metastasis may be related to TGFb responsive- in breast cancer. Although the mechanism by which CITED2 ness. Moreover, it should be noted that the lack of canonical mediates this effect remains unclear, CITED2 knockdown in TGFb signaling in MDA-MB-468 cells did not impact the effect MDA-MB-231 and MDA-MB-468 cells resulted in reduced of CITED2 knockdown on invasion or the establishment of

www.aacrjournals.org Mol Cancer Res; 14(8) August 2016 737

Jayaraman et al.

bone metastasis. This indicates that these effects were medi- but may also provide new avenues for the prevention and ated in a TGFb-independent manner, further supporting a role treatment of metastatic spread. for NF-kB signaling, which was attenuated in both the MDA- fl MB-231 and MDA-MB-468 cell lines. Disclosure of Potential Con icts of Interest fl Despite the ability of CITED2 to directly regulate expression No potential con icts of interest were disclosed. of the NF-kB pathway regulator IKKa,itisnotyetclearhow Disclaimer CITED2 modulates NF-kB signaling and transcriptional activ- The content is solely the responsibility of the authors and does not neces- ity in breast cancer cells. Although we did not observe changes sarily represent the official views of the NIH. in the mRNA expression of NF-kB signaling intermediates downstream of IKKa, upstream mediators also exist whose Authors' Contributions expression could be impacted by CITED2. In addition, CITED2 Conception and design: S. Jayaraman, S.L. Kominsky is known to interact with CREB-binding protein (CBP) and Acquisition of data (provided animals, acquired and managed patients, p300, reported coactivators of p65-mediated gene transcrip- provided facilities, etc.): S. Jayaraman, M. Doucet, W.M. Lau, S.L. Kominsky tion (35), suggesting that CITED2 could also regulate the Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): S. Jayaraman, S.L. Kominsky activity of NF-kB as part of the transcriptional complex. Writing, review, and/or revision of the manuscript: S. Jayaraman, Although the ability of IKKa to restore NF-kB signaling (data S.L. Kominsky not shown) and rescue tumor invasion in MDA-MB-231 and Study supervision: S.L. Kominsky MDA-MB-468 cells following CITED2 knockdown (Fig. 5B and C) implicates involvement of the NF-kB pathway, it should be Grant Support noted that IKKa can also exert NF-kB–independent effects The research reported in this article was supported by the NCI of the NIH (36). Thus, further investigation is required not only to assess under Award number R01CA157687. the mechanism whereby CITED2 modulates NF-kBactivity, The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in but also to determine the extent of its contribution to the accordance with 18 U.S.C. Section 1734 solely to indicate this fact. prometastatic effects of CITED2, as well as the ultimate effec- tors of its action. Addressing these questions will not only Received March 9, 2016; revised April 26, 2016; accepted May 14, 2016; further our understanding of CITED2 action in breast cancer published OnlineFirst May 23, 2016.

References 1. Lu J, Steeg PS, Price JE, Krishnamurthy S, Mani SA, Reuben J, et al. Breast 13. Bai L, Merchant JL. A role for CITED2, a CBP/p300 interacting protein, in cancer metastasis: challenges and opportunities. Cancer Res 2009;69: colon cancer cell invasion. FEBS Lett 2007;581:5904–10. 4951–3. 14. Chou YT, Hsieh CH, Chiou SH, Hsu CF, Kao YR, Lee CC, et al. CITED2 2. Chen Y, Doughman YQ, Gu S, Jarrell A, Aota S, Cvekl A, et al. Cited2 is functions as a molecular switch of cytokine-induced proliferation and required for the proper formation of the hyaloid vasculature and for lens quiescence. Cell Death Differ 2012;19:2015–28. morphogenesis. Development 2008;135:2939–48. 15. Lau WM, Weber KL, Doucet M, Chou YT, Brady K, Kowalski J, et al. 3. Qu X, Lam E, Doughman YQ, Chen Y, Chou YT, Lam M, et al. Cited2, a Identification of prospective factors promoting osteotropism in breast coactivator of HNF4alpha, is essential for liver development. EMBO J cancer: a potential role for CITED2. Int J Cancer 2010;126:876–84. 2007;26:4445–56. 16. Chou YT, Yang YC. Post-transcriptional control of CITED2 by transforming 4. Xu B, Qu X, Gu S, Doughman YQ, Watanabe M, Dunwoodie SL, et al. growth factor beta. Regulation via Smads and CITED2 coding region. J Biol Cited2 is required for fetal lung maturation. Dev Biol 2008;317:95–105. Chem 2006;281:18451–62. 5. Yin Z, Haynie J, Yang X, Han S, Kiatchoosakun S, Restivo J, et al. The 17. Nakano H, Shindo M, Sakon S, Nishinaka S, Mihara M, Yagita H, et al. essential role of Cited2, a negative regulator for HIF-1alpha, in heart Differential regulation of IkappaB kinase alpha and beta by two development and neurulation. Proc Natl Acad Sci U S A 2002;99: upstream kinases, NF-kappaB-inducing kinase and mitogen-activated 10488–93. protein kinase/ERK kinase kinase-1. Proc Natl Acad Sci U S A 1998; 6. Bhattacharya S, Michels CL, Leung MK, Arany ZP, Kung AL, Livingston DM. 95:3537–42. Functional role of p35srj, a novel p300/CBP binding protein, during 18. Kang Y, Siegel PM, Shu W, Drobnjak M, Kakonen SM, Cordon-Cardo C, transactivation by HIF-1. Genes Dev 1999;13:64–75. et al. A multigenic program mediating breast cancer metastasis to bone. 7. Glenn DJ, Maurer RA. MRG1 binds to the LIM domain of Lhx2 and may Cancer Cell 2003;3:537–49. function as a coactivator to stimulate glycoprotein hormone alpha-subunit 19. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, et al. Genes that gene expression. J Biol Chem 1999;274:36159–67. mediate breast cancer metastasis to lung. Nature 2005;436:518–24. 8. Braganca¸ J, Eloranta JJ, Bamforth SD, Ibbitt JC, Hurst HC, Bhattacharya 20. Bos PD, Zhang XH, Nadal C, Shu W, Gomis RR, Nguyen DX, et al. Genes S. Physical and functional interactions among AP-2 transcription fac- that mediate breast cancer metastasis to the brain. Nature 2009;459: tors, p300/CREB-binding protein, and CITED2. J Biol Chem 2003;278: 1005–9. 16021–9. 21. Lau WM, Doucet M, Stadel R, Huang D, Weber KL, Kominsky SL. Enpp1: a 9. Chou YT, Want H, Chen Y, Danielpour D, Yang YC. Cited2 modulates potential facilitator of breast cancer bone metastasis. PLoS One 2013;8: TGFbeta-mediated upregulation of MMP9. Oncogene 2006;25:5547–60. e66752. 10. Tien ES, Davis JW, Vanden Heuvel JP. Identification of the CREB-binding 22. Vantyghem SA, Allan AL, Postenka CO, Al-Katib W, Keeney M, Tuck AB, protein/p300-interacting protein CITED2 as a peroxisome proliferator et al. A new model for lymphatic metastasis: development of a variant of activated receptor alpha coregulator. J Biol Chem 2004;279:24053–63. the MDA-MB-468 human breast cancer cell line that aggressively metas- 11. Lau WM, Doucet M, Huang D, Weber KL, Kominsky SL. CITED2 modulates tasize to lymph nodes. Clin Exp Metastasis 2005;22:351–61. estrogen receptor transcriptional activity in breast cancer cells. Biochem 23. Adli M, Merkhofer E, Cogswell P, Baldwin AS. IKKalpha and IKKbeta each Biophys Res Commun 2013;437:261–6. function to regulate NF-kappaB activation in the TNF-induced/canonical 12. Sun HB, Zhu YX, Yin T, Sledge G, Yang YC. MRG1, the product of a pathway. PLoS One 2010;5:e9428. melanocyte-specific gene related gene, is a cytokine-inducible transcription 24. Seno T, Harada H, Kohno S, Teraoka M, Inoue A, Ohnishi T. Down- factor with transformation activity. Proc Natl Acad Sci U S A 1998;95: regulation of SPARC expression inhibits cell migration and invasion in 13555–60. malignant gliomas. Int J Dev Neurosci 1999;17:463–72.

738 Mol Cancer Res; 14(8) August 2016 Molecular Cancer Research

CITED2 Modulates Human Breast Cancer Metastasis

25. Golembieski WA, Ge S, Nelson K, Mikkelsen T, Rempel SA. Increased 31. Yemelyanov A, Gasparian A, Lindholm P, Dang L, Pierce JW, Kisselijov F, SPARC expression promotes U87 glioblastoma invasion in vitro. Int J Oncol et al. Effects of IKK inhibitor PS1145 on NF-kB function, proliferation, 2009;34:707–15. apoptosis and invasion activity in prostate carcinoma cells. Oncogene 26. Chen J, Wang M, Xi B, Xue J, He D, Zhang J, et al. SPARC is a key regulator of 2006;25:387–98. proliferation, apoptosis and invasion in human ovarian cancer. PLoS One 32. Yamaguchi N, Ito T, Azuma S, Ito E, Honma R, Yanagisawa Y, et al. 2012;7:e42413. Constitutive activation of nuclear factor-kappaB is preferentially involved 27. Mehner C, Hockla A, Miller E, Ran S, Radisky DC, Radisky ES. Tumor-cell in the proliferation of basal-like subtype breast cancer cell lines. Cancer Sci produced matrix metalloproteinase 9 (MMP-9) drives malignant progres- 2009;100:1668–74. sion and metastasis of basal-like triple negative breast cancer. Oncotarget 33. Hoesel B, Schmid JA. The complexity of NF-kB signaling in inﬂammation 2014;5:2736–49. and cancer. Mol Cancer 2013;12:86. 28. Tang L, Han X. The urokinase plasminogen activator system in breast cancer 34. Schutte M, Firuban RH, Hedrick L, Cho KR, Nadasdy GM, Weinstein invasion and metastasis. Biomed Pharmacother 2013;67:179–82. CL, et al. DPC4 gene in various tumor types. Cancer Res 1996;56: 29. Liu Q, Russell MR, Shahriari K, Jernigan DL, Lioni MI, Garcia FU, et al. 2527–30. Interleukin-1b promotes skeletal colonization and progression of meta- 35. Gerritsen ME, William AJ, Neish AS, Moore S, Shi Y, Collins T. CREB- static prostate cancer cells with neuroendocrine features. Cancer Res binding protein/p300 are transcriptional coactivators of p65. Proc Natl 2013;73:1–9. Acad Sci U S A 1997;94:2927–32. 30. Shevde LA, Samant RS. Role of osteopontin in the pathophysiology of 36. Huang WC, Hung MC. Beyond NF-kB activation: nuclear functions of IkB cancer. Matrix Biol 2014;37:131–41. kinase a. J Biomed Sci 2013;20:3.

www.aacrjournals.org Mol Cancer Res; 14(8) August 2016 739

CITED2 Modulates Breast Cancer Metastatic Ability through Effects on IKK α

Swaathi Jayaraman, Michele Doucet, Wen Min Lau, et al.

Mol Cancer Res 2016;14:730-739. Published OnlineFirst May 23, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-16-0081

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2016/06/25/1541-7786.MCR-16-0081.DC1

Cited articles This article cites 36 articles, 14 of which you can access for free at: http://mcr.aacrjournals.org/content/14/8/730.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/14/8/730.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/14/8/730. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.