Regulatory Roles of FACIT Collagens XII and XIV in Cornea Stromal And

University of South Florida Scholar Commons

Graduate Theses and Dissertations Graduate School

4-10-2014 Regulatory Roles of FACIT Collagens XII and XIV in Cornea Stromal and Endothelial Development and Function Chinda Hemmavanh University of South Florida, [email protected]

Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the Cell Anatomy Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons

Scholar Commons Citation Hemmavanh, Chinda, "Regulatory Roles of FACIT Collagens XII and XIV in Cornea Stromal and Endothelial Development and Function" (2014). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/5038

This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected].

Regulatory Roles of FACIT Collagens XII and XIV in Cornea Stromal and Endothelial

Development and Function

Chinda Hemmavanh

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Molecular Pharmacology and Physiology College of Medicine University of South Florida

Major Professor: David E. Birk Ph.D. Edgar M. España M.D. Byeong Cha Ph.D. Mack H. Wu M.D. Daniel K.P. Yip, Ph.D.

Date of Approval: April 10, 2014

Keywords: Cornea, Collagen, FACIT Collagen, Endothelium, Collagen XII, Collagen XIV, Stroma

DEDICATION

I dedicate this dissertation to my family.

ACKNOWLEDGMENTS

Mom and Dad, thank you for encouraging all my dreams. To my brother and sister, Mjay and Nona, you have taught me all I need to know about life. Thank you, Mandy for being my soul sister and guiding me with your honesty and love. LJ, Joi, Preston, Bobby, Ryan, Adam,

Jon, Mrs. Lee and Kulvir your support and friendship throughout the years meant so much to me.

I will always be eternally grateful for my lab members. I have never met a group of people in such a small space with so much integrity and consideration. Sheila Adams, you were my mom away from home. Yayoi and Mike, you will always be an inspiration. Shojun, your words of wisdom will always resonate in my head. Chris, this would not have been possible without you. Simone, your wit made every day better. Mei, I do not know how the world runs without people like you. Thank you, Dr. Cha for your patience, support, and time. Amanda, your support and presence was a great relief.

To my committee: Dr. España, Dr. Cha, Dr. Wu, Dr. Bennett, Dr. Chakravarti, and Dr.

Yip thank you for sticking with me through this process. I would also like to thank Dr. España for being essential in finishing my thesis.

I will always be grateful to my mentor Dr. Birk. I know the lessons learned and good habits instilled upon me will forever benefit me from this day forward. I grew up a lot in these past years and will always appreciate your patience.

TABLE OF CONTENTS

List of Figures ...... iii

List of Tables ...... v

Abstract...... vii

Chapter One: Introduction ...... 1 The Cornea ...... 1 Structure of the Cornea ...... 2 Corneal Development ...... 5 Collagen Structure ...... 6 Collagen Classes ...... 7 Structure /Function of the Stroma ...... 7 Stromal Pathophysiology ...... 11 Structure/Function of the Corneal Endothelium ...... 12 Endothelial Pathophysiology ...... 15 Extracellular Matrices of the Posterior Stroma and the Cornea Endothelium ...... 17 FACIT Collagens ...... 18 Structure of FACIT Collagens XII and XIV ...... 18 Collagen XII in the Extracellular Matrix ...... 19 Collagen XIV in the Extracellular Matrix ...... 20 Collagen XII in Wound Healing ...... 21 Collagens XII and XIV in Basement Membrane Zones ...... 22 Introduction to Experiments ...... 23

Chapter Two: Collagen XIV Regulates Corneal Stromal Extracellular Matrix Assembly during Development ...... 27 Abstract ...... 27 Introduction ...... 28 Materials and Methods ...... 29 Results ...... 32 Discussion ...... 35

Chapter Three: Collagen XII Regulates Fibril Packing, Lamellar Assembly, and Stromal Organization in the Cornea...... 40 Abstract ...... 40 Introduction ...... 41 Materials and Methods ...... 43 Results ...... 46 Discussion ...... 52

Chapter Four: Collagens XII and XIV Regulate Corneal Endothelial Maturation ...... 57 Abstract ...... 57

Introduction ...... 58 Materials and Methods ...... 60 Results ...... 63 Discussion ...... 75

Chapter Five: Conclusions ...... 80 Future Directions ...... 84

References ...... 86

Appendix: IACUC and Copyright Permissions ...... 94

LIST OF FIGURES

Figure 1. Structure of the Eye ...... 1

Figure 2. Structure of the Cornea ...... 4

Figure 3. Development of the Cornea ...... 6

Figure 4. Stromal Structure ...... 9

Figure 5. Keratocyte Network ...... 10

Figure 6. Collagen Fibrils in the Cornea ...... 11

Figure 7. Tight Junctions ...... 12

Figure 8. Corneal Endothelium in the Posterior Cornea ...... 13

Figure 9. Endothelial Pump Function ...... 15

Figure 10. Endothelial Dysfunction ...... 17

Figure 11. FACIT Collagens on the Surface of Collagen Fibrils ...... 19

Figure 12. Structure of FACIT Collagens XII and XIV ...... 20

Figure 13. Collagen XII Interactions in the ECM ...... 22

Figure 14. Restricted Temporal Expression of Collagen XIV in Developing Mouse Cornea ...... 33

Figure 15. Collagen XIV is Localized throughout the Corneal Stroma ...... 34

Figure 16. Collagen XIV Regulates Fibril Assembly ...... 36

Figure 17. Altered Fibril Packing in the Absence of Collagen XIV ...... 37

Figure 18. Irregular Spacing of Fibrils in the Absence of Collagen XIV ...... 37

Figure 19. Collagen XII is Expressed in the Cornea from Early Postnatal Development to Maturation ...... 47

Figure 20. Collagen XII is Localized throughout the Corneal Stroma ...... 49

iii

Figure 21. Altered Fibril Packing in the Absence of Collagen XII ...... 50

Figure 22. Abnormal Formation of Lamellae in Early Postnatal Development in the Absence of Collagen XII ...... 50

Figure 23. Irregular Lamellae in the Mature Cornea in the Absence of Collagen XII ...... 51

Figure 24. Increased Thickness in the Mature Cornea in the Absence of Collagen XII ...... 52

Figure 25. Irregular Keratocyte Shape in the Absence of Collagen XII ...... 53

Figure 26. Corneal Endothelial Maturation ...... 64

Figure 27. Localization of Collagens XII and XIV in the Posterior Corneal Stroma ...... 65

Figure 28. Mouse Models Null for Corneal Collagens XII and XIV ...... 67

Figure 29. Delayed Endothelial Maturation in Absence of Collagen XII and/or XIV ...... 69

Figure 30. Endothelial Junction Maturation in Immature and Mature Wild Type Mice ...... 70

Figure 31. Delayed Endothelial Junction Maturation in Col12a1-/- Mice ...... 71

Figure 32. Delayed Endothelial Junction Maturation in Col14a1-/- Mice ...... 73

Figure 33. Increased Corneal Thickness in Collagen XII and/or XIV Deficient Mice ...... 74

Figure 34. Corneal Endothelial - Stromal Interactions ...... 78

Figure 35. Model of FACIT on Fibril Surface ...... 81

Figure 36. Differences in Corneal Thickness in P60 WT, Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/- Mice ...... 83

LIST OF TABLES

Table 1. Collagen Classifications ...... 8

Table 2. Decrease in Inter-fibrillar Distance in the Absence of Collagen XII ...... 48

Table 3. Differences in Corneal Thickness in P30 WT, Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/- Mice ...... 72

LIST OF ABBREVIATIONS

COL: Collagenous Domain Col: Collagen WT: Wild Type ECM: Extracellular Matrix En: Endothelium S: Stroma K: Keratocyte Epi: Epithelium DM: Descemet‟s Membrane FACIT: Fibril Associated Collagen with Interrupted Triple Helix Gly: Glycine MCD: Macular Corneal Dystrophy NC: Non-Collagenous Domain P: Postnatal Day RVD: Regulatory Volume Decrease SLRP: Small Leucine Rich Proteoglycan ZO-1: Zonula Occludens HS: Heparan Sulfate OCT: Optical Coherence Tomography ROI: Region of Interest Std Err: Standard Error TEM: Transmission Electron Microscopy PCR: Polymerase Chain Reaction qPCR: quantitative polymerase chain reaction

ABSTRACT

Purpose: Corneal transparency depends upon the precise organization of corneal stromal extracellular matrix and corneal endothelial function. Stromal structure and extracellular matrix organization is responsible for proper refraction of light into the eye. The corneal endothelium is responsible for pumping excess fluid out of the cornea, effectively maintaining corneal hydration and thickness. Corneal transplantation is the current form of treatment for corneal endothelial and stromal dystrophies. The mechanisms controlling stromal collagen fibril packing and organization into orthogonal layers as well as maturation of the endothelium into a fully functioning cellular layer are unknown. Collagens XII and XIV, fibril associated collagens with interrupted triple helices (FACIT), have been implicated in matrix-matrix interactions regulating structure, cell behavior, and cell-matrix interactions. The overall aim is to determine the role of collagens XII and XIV in fibril assembly, fibril packing, lamellar assembly, stromal organization, corneal thickness, and endothelial maturation. The general hypothesis is that collagens XII and

XIV regulate cornea stromal matrix development and structure, endothelial development, and corneal function. This dissertation assesses three specific hypotheses: 1) Collagen XIV regulates lateral fibril growth and fibril packing through fibrillar surface interactions; 2) Collagen

XII regulates fibril packing, lamellar assembly, stromal organization, corneal thickness, and therefore, corneal function; and 3) FACIT collagens in the specialized posterior stroma regulate the acquisition of function in the corneal endothelium.

Materials and Methods: The temporal and spatial expression patterns of collagens XII and XIV were determined in the murine cornea using quantitative PCR, semi-quantitative immuno-blots and immuno-localization approaches. To determine the regulatory roles of collagens XII and XIV

vii in stromal and endothelial development, mouse models null for collagens XII or XIV were utilized. This was coupled with ultrastructural and morphometric analyses of fibril assembly, fibril packing, lamellar organization, and endothelial maturation. The roles of collagens XII and XIV in corneal structure were determined using measurements of corneal thickness at postnatal day

(P) 30 and P60.

Results: Collagen XIV had a dynamic expression pattern in wild type (WT) corneal development. Corneas at P4 expressed the highest amount of collagen XIV with a sharp reduction by P10. Collagen XIV localized in the full thickness of the stroma at P4 and P14. At P30 and P90 there was less immuno-reactivity for collagen XIV in the WT stroma. The collagen XIV null stromas contained larger diameter fibrils when compared to P30 WT stromas. The null stromas also exhibited irregular spacing of fibrils. In the absence of collagen XIV there was an abnormal increase in corneal thickness. Unlike collagen XIV, collagen XII localized homogenously throughout the WT corneal stroma from P4 to P90. Collagen XII content was relatively constant in the cornea from

P4 to P90. The collagen XII P30 null stromas contained areas of increased fibril density and disruption of lamellar organization. Corneal thickness increased in the absence of collagen XII at P60. Corneas deficient in Col12a1-/- and/or Col14a1-/- exhibited a delay in maturation. The null corneal endothelia retained vacuoles seen only in the immature WT P4 cornea. The P30

Col12a1-/- and Col14a1-/- endothelia had patchy localization of ZO-1 similar to that of an immature endothelium. There was an abnormal increase in thickness at P30 in the absence of collagens XII and XIV suggesting an increase in stromal hydration.

Conclusions: Collagen XIV regulates fibril assembly, and regular fibril packing in early stromal development. Collagen XII regulates fibril packing, lamellar assembly, stromal organization, and influences the keratocyte network. Both collagens XII and XIV regulate endothelial maturation and acquisition of function through interactions between the stroma and underlying endothelium.

Understanding the mechanisms behind stromal organization and endothelial maturation will

viii improve treatment of stromal and endothelial dystrophies, as well as other diseases that involve extracellular matrix-cell interactions mediated by FACIT collagens.

CHAPTER 1: INTRODUCTION

The Cornea

The cornea is a transparent tissue located on the anterior surface of the eye. It is continuous with the sclera with the junctional region termed the limbus. Together they form a protective sphere with high mechanical stability. The cornea has a smaller radius of curvature when compared to the sclera, and it is the major refractive surface of the eye. Because of their differences in curvature, the limbus bears the mechanical strain caused by the change in curvature.

Figure 1. Structure of the Eye. The cornea is on the outer surface of the eye and is the major refractive surface of the eye. After light travels through the cornea, the amount entering the eye is controlled by the iris, fine focus occurs at the lens and photo transduction occurs in the retina. (Blaus 2013)

The curvature of the cornea refracts light through the iris into the lens. Then the lens focuses light onto the retina where the signal is transduced and transmitted to the visual cortex via the optic nerve. The iris, the colored portion of the eye, acts as a diaphragm to regulate the amount of light entering the eye. Behind the iris, the lens focuses light onto the retina located in the back of the eye (Fig. 1) (Meek and Andrew 2008; Hogan et al. 1971). The cornea is unique in that it maintains transparency while being mostly composed of collagen fibrils. Its curvature derives its mechanically strong structure from highly organized collagen fibrils in the stroma.

The rigid structure of the cornea also serves to support the spherical integrity of the eye. It acts as a protective barrier from the outside environment. Most UV light is absorbed by the cornea before traveling through the eye and damaging the lens and retina (Cai et al. 1998).The cornea receives nutrients through vasculature in the limbus, fluid from the anterior chamber, and through a tear film attached to the epithelium. (Maurice 1957; Hart and Farrell 1969; Benedek

1971; Hogan et al. 1971; Hassell and Birk 2010).

Structure of the Cornea

The cornea consists of five layers: the epithelium, Bowman‟s layer, stroma, Descemet‟s membrane, and the endothelium (Fig. 2). The corneal epithelium is the anterior most layer of the cornea. It is a non-keratinized, stratified squamous epithelium that rests on a basement membrane. It consists of three major cell types: basal, wing and squamous cells. The basal cells that rest on Bowman‟s membrane are columnar. Wing cells exist in two-three layers and attach to adjacent wing cells through desmosomes. The superficial epithelial squamous cells attach to a tear film that hydrates the non-keratinized epithelium. There are also nerve cells and lymphocytes located in the corneal epithelium (Hassell and Birk 2010; Hogan et al. 1971).

Separating the epithelium and stroma is Bowman‟s layer. This region is acellular and characterized by small diameter, randomly organized collagen fibrils. Because of its dense

2 composition, Bowman‟s layer serves as a defense from an infection spreading into the stroma.

Bowman‟s layer does not exist in the mice, but exist in humans. Collagen fibrils in Bowman‟s layer are homogenous in diameter, but they are disorganized and smaller when compared to those in the stroma. Even though this layer serves as a protection to the stroma, there are no lymphocytes (Hassell and Birk 2010; Hogan et al. 1971).

The major portion of the cornea is the stroma. Separating it from the epithelium and endothelium is the Bowman‟s layer and Descemet‟s membrane respectively. Differing from the

Bowman‟s layer where the fibrils randomly arrange in different directions, individual collagen fibrils in the central stroma lay parallel within orthogonal lamellae. The evenly spaced fibrils must have spacing between them that is less than the wavelength of light for transmission of light and optimal transparency (Benedek 1971). An experiment supported this idea by causing disorganization of fibrils through physical perturbation of the cornea that resulted in decreased transparency (Potts 1962). Major cell types in the stroma are keratocytes that produce the collagen and nerve cells that only exist in the anterior stroma. The stroma represents ~90% of the corneal thickness. It is essential for maintaining corneal curvature and transparency. The curvature of the cornea determines the focal point of light traveling into the eye.

Separating the stroma from the endothelium is Descemet‟s membrane. This is a specialized interfacial matrix characterized by a collagenous network formed by collagen VIII

(Hogan et al. 1971). At birth, the Descemet‟s membrane has the same thickness as the endothelial cell layer below it. The membrane gradually thickens throughout maturity until it is about twice the thickness of the endothelial layer. This membrane is made from extracellular matrix components and does not contain cells (Hay 1980).

Figure 2. Structure of the Cornea. The most apical layer of the cornea is the epithelium, followed by bowman‟s layer, the stroma, Descemet‟s membrane and the endothelium. Modified from (Hassell and Birk 2010).

Finally, the posterior layer is the corneal endothelium. It consists of a single layer of thin polygonal cells that are adjacent to each other with functional tight junctions and gap junctions at the interface of these polygonal cells. The endothelium functions to pump fluid out of the stroma against a strong osmotic gradient to maintain stromal hydration within a narrow range required for transparency (Maurice 1972; Srinivas 2010).The avascular cornea must receive nutrients from circulating fluids originating from the limbus, tear film, and aqueous humor. As

4 mentioned above, the endothelium functions to pump out excess fluids out into the aqueous humor. This pump function maintains corneal transparency by reducing abnormal swelling and perturbation of corneal ECM organization (Hogan et al. 1971).

Corneal Development

During avian embryonic corneal development, the optic vesicle comes into contact with the surface ectoderm. This causes a thickening of the ectoderm to form the lens placode that invaginates to separate itself from the ectoderm as the lens vesicle. The lens then causes the ectoderm to differentiate into the corneal epithelium, and the optic vesicle to become the optic cup.

The retina and retinal pigment epithelium originate from the optic cup. Then the first set of neural crest cells invades the space between the epithelium and lens to become the endothelium. Other neural crest cells migrate into an area between the epithelium and endothelium to transform into keratoblasts. The keratoblasts proliferate and produce hyaluronan to form an embryonic corneal stroma extracellular matrix (ECM). Keratoblasts then differentiate into keratocytes (Hassell and Birk 2010). Figure 3 shows the orientation of the optic cup, conjunctival epithelium, and the lens vesicle (Fig. 3). This model of development is a good representation of mouse and human embryonic corneal development (Hay 1980).

Corneal development is complete at birth in the human. In the mouse, corneal development continues in the postnatal period. Before the eyelid opens in the mouse (~P10), there is a distinct epithelium, stroma, Descemet‟s membrane and endothelium. The epithelium consists of two to three layers of cells just before eyelid opening. The stroma swells at postnatal day 10 (P10). The eyelids of the mouse do not open until P10.

Figure 3. Development of the Cornea. The lens in the optic cup forms a space between the epithelium and itself. A first wave of neural crest cells forms the corneal endothelium between the lens and epithelium. The second wave between the endothelium and epithelium forms the presumptive corneal stroma. Modified from Textbook of Embryology (Bailey 1921).

Finally at P21, ten days after eyelid opening, the epithelium is five to six layers deep and the cornea is similar to that of an adult mouse (Hay 1980; Zieske 2004). Using corneal thickness as a measurement of maturation, the murine cornea is believed to be mature at 8 weeks of age

(Hanlon et al. 2011).

Collagen Structure

Collagens are proteins containing three α-chains. Each α-chain has a primary sequence of (Gly-X-Y)n repeats. The (Gly-X-Y)n sequence has an important structural role. The glycine is needed for its small size, so it can be coiled into the helix. The X is frequently proline and Y is often hydroxyproline. Proline and hydroxyproline stabilize the triple helix by averting chain rotation. The Y-position may also be lysine. In the case that the lysine is post-translationally converted to hydroxylysine, this amino acid facilitates cross linking (Hay 1991; Linsenmayer et

6 al. 1998). These three α chains are then twisted into a left-handed helix (Van der Rest and

Garrone 1991; Birk 2005; Gordon and Hahn 2010; Birk and Bruckner 2011). Non-striated collagens, like FACITs, have left handed helical portions interspersed between non-collagenous portions. Because of their non-collagenous regions, they cannot form striated collagen fibrils.

Collagen Classes

All collagens have at least one collagen domain, but different collagen classes have different structures and functions (Table 1). The mixture of non-collagenous and collagenous domains in a completed collagen protein allows them to be a standalone ECM protein and/or biomolecular bridge between cells and ECM components. The cornea contains fibrillar collagens I and V. In basement membranes, collagen IV forms a chicken–wire-like network.

Collagen IV localizes in the interfacial regions of Descemet‟s in the human cornea. Collagen

VIII, a network forming collagen localizes to Descemet‟s membrane in human corneas (Tamura et al. 1991). Collagen VI forms thin-beaded filaments that interact with fibrils and cells in the human stroma (Kabosova et al. 2007). Collagen VII, an anchoring collagen localizes in the basement membrane zones and the interfacial regions of Bowman‟s layer in the human. FACIT collagens XII and XIV exist in the corneal stroma on the surface of collagen fibrils. (Birk 2005)

Structure/Function of the Stroma

The precise structural organization of the stroma is critical for corneal transparency.

Corneal transparency requires tight, regular packing of small diameter collagen fibrils in the stroma. Proteoglycans and other collagens have been implicated in regulation of corneal fibril assembly and packing, but the exact mechanism remains unknown (Zhang et al. 2009; Sun et al. 2011). Proteoglycans and FACIT collagens exist on the surface of fibrillar collagens. The proteoglycans on the surface of fibrils project away from the axis of the fibrils and create another columnar layer of hydration around the fibrils (Fratzl and Daxer 1993). The hydration is

7 necessary to maintain a certain amount of space between adjacent fibrils for transparency

(Maurice 1972).

Table 1. Collagen Classifications Classification Collagen Supramolecular Structure Expression in Expression in Types Mouse Cornea Human Cornea Fibril forming I, II, III Striated fibrils Stroma Stroma collagens Regulatory fibril- V, XI Striated fibrils, retain regulatory Stroma Stroma, forming collagens noncollagenous N-terminal domains Bowman's Membrane Fibril associated IX, XII, XIV Associated with fibrils, other ECM Stroma Stroma collagens with proteins, interfacial regions, and interrupted triple basement membrane zones helices (FACIT) Beaded filament- VI Beaded filaments, networks Stroma forming collagen Basement IV Chicken-wire network with lateral DM DM, Bowman's membrane associations Membrane collagens Anchoring fibrils VII Laterally associated antiparallel DM, Bowman's dimmers Membrane Network-forming VIII, X Hexagonal lattices DM DM collagens Modified from Birk and Bruckner 2011.

Fibrils in the stroma have small diameters with a homogenous distribution of diameters.

These small diameter fibrils are regularly packed with an even distribution of inter-fibrillar distances. Regularly packed fibrils are organized into sheets or lamellae (Fig. 4).

The length of each lamellae runs roughly parallel to the corneal surface. Fibril orientation within each lamella is approximately orthogonal to adjacent lamella in the central cornea. The stacking of orthogonal lamellae provides destructive interference of scattered light (Maurice

1957; Benedek 1971; Hassell and Birk 2010). This level of organization, from fibril diameter to lamellar orientation, is necessary for transparency.

Figure 4. Stromal Structure. Fibrils with small, homogeneous diameters are regularly packed. Collagen fibrils are arranged in orthogonal layers. Modified from Hassell and Birk 2010.

Networks of flattened keratocytes that exist between lamellar layers are responsible for the production of collagens and proteoglycans in the corneal stroma. Keratocytes with dendritic processes allow keratocytes to form communicating networks via gap junctions (Fig. 5) (Jester et al. 1994). These normally quiescent keratocytes make up 5% of the stroma. Keractocytes produce collagen. They also synthesize and store crystallins in the cytoplasm at high concentrations. This accumulation of crystallins within the keratocytes contributes to stromal transparency.

Each collagen fibril consists of mostly collagen I with a small amount of collagen V; both

are fibrillar collagens. Collagen V comprises ~20% of the collagen fibril. It is physically longer than the collagen I molecule, causing a portion of the collagen V molecule to protrude from the

staggered fibril structure (Fig. 6). The fibrillar collagen V is considered a fibril nucleator and a

9 regulator of initial lateral fibril growth in the tendon and cornea (Sun et al. 2011; Wenstrup et al.

2011). In the absence of collagen V there is a decrease in fibril number and variance of fibril diameter. There are six small leucine rich proteoglycans (SLRP) that are expressed in the corneal stroma: keratocan, lumican, fibromodulin, biglycan, decorin, and osteoglycan.

Figure 5. Keratocyte Network. A cross section of the cornea shows a sparse population of keratocytes (yellow arrows) (A). An en face section shows that keratocytes are connected through a network with dendritic processes (B). (Jester et al. 1994).

Based on their different temporal and spatial expression, each SLRP has a unique role in stromal structure and development (Chen and Birk 2013). Decorin and biglycan compensate each other in the corneal stroma, and a compound knockout produced fibrils of abnormally large diameter (Zhang et al. 2009). A lumican null mouse model produced a cornea with increased haze and backscattering of light, produced by ECM disorganization and abnormally large fibrils in the posterior stroma (Chakravarti et al. 2000).

Figure. 6. Collagen Fibrils in the Cornea. Collagen I/V heterotypic fibril. Collagen I (black) Collagen V (red). Modified from Bruckner and Birk 2011.

Stromal Pathophysiology

The normal mature corneal stroma is avascular with quiescent keratocytes. In the event of injury or infection, the keratocytes will differentiate into myofibroblasts and wound fibroblasts.

When myofibroblasts reconstruct the corneal stroma, there can be an abundant amount of hyaluronan and densely packed cells inconsistent with transparency (Hassell and Birk 2010).

There is also an invasion of blood vessels during the initial inflammation, and this can cause corneal scarring (Calvo et al. 2012). Pathologies with corneal haze and opacity involve improper organization of ECM. These areas of opaque cornea can be treated with corneal grafts.

Knowledge of the role of collagen XII in wound healing and matrix stabilization would be useful in LASIK and keratoconus treatments. LASIK is a procedure that remodels the cornea to improve vision. The results are not permanent, because the cornea slowly regresses back to its imperfect form. Figuring out the mechanism to prolong the structural changes made during

LASIK would reduce the need for follow-up LASIK procedures (Kulkarni et al. 2013).

Keratoconus is an affliction where the curvature of the cornea is exaggerated to a debilitating

11 degree. Re-shaping the cornea with UV-induced crosslinking is a current form of treatment

(Wollensak 2003; Chan and Snibson 2013). LASIK and keratoconus treatments focusing on the re-structuring of the cornea supports the idea that knowing the mechanistic roles of collagen XII and XIV behind matrix stability, remodeling, and wound healing is beneficial for clinical treatments.

Figure. 7. Tight Junctions. Tight junctions consist of occludins, claudins, and ZO-1 attached to the cytoskeleton.

Structure/Function of the Corneal Endothelium

The corneal endothelium is a simple squamous non-vascular epithelium that rests on a specialized basement membrane called Descemet‟s membrane (Fig. 8). It is derived from neural crest cells that invade the space between the lens and epithelium during embryonic development.

The monolayer of cells thin during maturation, and the formation of functional tight junctions occurs (Fig. 7). Paracellular transport of water decreased in the rabbit from birth to young adult, signifying the tight junctional network increases its functionality throughout maturity

(Stiemke et al. 1991). It functions as a semi-permeable membrane that allows a small consistent intake of aqueous humor that hydrates the stroma regulated by tight junctions (Stiemke et al.

1991). The corneal stroma is highly charged with its abundance of SLRPs (Chen and Birk

2013). Because of this, the stroma easily maintains hydration through the passive flow of water from the aqueous humor through the limbus, tear film, and endothelium. The endothelium was hypothesized to regulate the hydration and maintain transparency of the cornea through of system of pumps that displaces fluid in the aqueous humor (Maurice 1972). The presence of gap junctions and adherens junctions are also essential for communication between endothelial cells and expulsion of water from the cornea through co-transport with ions.

Figure 8. Corneal Endothelium in the Posterior Cornea. Labeled are the stroma, Descemet‟s membrane, and the corneal endothelial monolayer denoted by the arrows. Modified from Alomar 2011. Bar 50µm

Regulation of stromal hydration is critical for maintaining corneal transparency. The corneal endothelium acts as a metabolic fluid pump for maintaining stromal hydration required for transparency, and acts as a barrier from the aqueous humor (Maurice 1972). The exact mechanism by which electrolyte movement is coupled to water transport remains unclear.

Studies using oubain to inhibit the Na+/K+ ATPase showed that there was no effect on endothelial permeability or tight junction structure, reaffirming that tight junctions are the main regulators of endothelial permeability (Watsky et al. 1990). There are many proposed mechanisms that include coupling of water transport with anions, paracellular transport from changes in cell volume, lactate co-transport to the aqueous humor, etc. (Fig. 9). A main

13 regulator of endothelial function is the Na+/K+ ATPase. It maintains a negatively charged cell by transporting in two potassium ions for every three sodium ions expelled from the cell (Bonanno

2012). Negative charge generated by the Na+/K+ ATPase attracts ions from the stroma that facilitate the co-transport of anions into the endothelium.

Because of the Na+/K+ ATPase, there is a lower concentration of sodium in the cell. This

+ + - - allows the Na /H exchanger to indirectly load Cl and HCO3 into the cell from the stroma. This is supported by the fact that the basolateral stromal side of cultured corneal endothelial cells

- had a higher permeability for HCO3 than the apical side (Bonanno et al. 1999). The net flux of

- - NaHCO3 and/or NaCl is thought to be the driving force for water movement out of the cell

(Fischbarg and Lim 1974).

Periodic changes in cell volume may also induce solvent flow across leaky epithelia.

Corneal endothelial cells in culture are known to rapidly change volume (Srinivas et al. 2010).

The changes in shape and volume of neighboring endothelial cells may cause shifting of the tight junction structural bonds between claudins and occludins (Fig. 7). The change in cell volume may also activate a set of regulatory volume decrease (RVD) responses on the apical side of the endothelium (Fischbarg 2003).

Actin-myosin contraction effected tight junction physiology in epithelial models studying tight junction regulation. Phosphorylation of myosin II regulatory light chain causes a conformational shift that facilitates in actin-myosin contraction. In vitro studies with epithelial monolayers showed that the addition of myosin light chain kinase inhibitors prevented an increase of paracellular permeability after Na+ -Glucose co-transport (Turner et al. 1997). Na+ -

Glucose co-transport is usually followed by a temporary increase in paracellular permeability in the small intestine (Madara and Pappenheimer 1987).

Figure 9. Endothelial Pump Function. Lactate co-transport, cytoskeleton contraction, and anion co-transport are three proposed mechanisms for endothelial pump function. Modified from Srinivas 2010.

The glucose/lactate transporter is seen as a potential regulator of endothelial pump function. The endothelium has a high mitochondrial content because of its high activity. There is a high concentration of lactate in the endothelium due to glucose breakdown, and the lactate needs to be expelled through the apical end of the endothelium. There is evidence that lactate is a major osmolyte that facilitates the driving force of the fluid pump (Giasson and Bonanno

1994).

Endothelial Pathophysiology

There is evidence indicating that once the mature endothelial monolayer has formed, proliferation ceases and cells remain non-replicative throughout the normal lifespan or do not

15 proliferate enough to keep up with cell loss (Joyce 2003). A dramatic decrease of cell density can decrease endothelial pump function that leads to corneal edema. Corneal edema is the thickening of the cornea due to excess hydration that causes decreased transparency. The average endothelial cell density in neonates is 3500-4000 cell/mm2, while the average in adults is 2000 cells/mm2 (Murphy et al. 1984). This age related decrease in cell density is not enough to affect corneal function, because only at a cell density of 1000 cells/mm2 or less does pump activity decrease (Crawford et al. 1995). Patients who need treatment for dysfunctional endothelial cells have been the victim of an injury or disease such as Fuchs‟ endothelial dystrophy (McCartney et al. 1987). The loss of endothelial cells after injury causes the remaining endothelial cells to stretch. An age related increase in endothelial cell size supports this (Fig. 10) (Murphy et al. 1984). This aberrant stretching of the cell may disturb cell polarization needed for endothelial pump function.

Many human corneal complications involve endothelial dystrophies. Understanding the regulatory steps in endothelial development and proliferation is the foundation for expanding our knowledge for future treatments of endothelial dysfunction. At the moment, the only treatment for endothelial dystrophies is transplantation. Collagens XII and XIV are needed for proper maturation of the cornea (Hemmavanh et al. 2013). Elucidating their roles in endothelial maturation will allow us to unveil important developmental step that leads to a mature endothelium and loss of cell proliferation. Finding a way to rescue the proliferative capabilities of the cornea endothelium would be advantageous.

Figure 10. Endothelial Dysfunction. Loss of endothelial cells causes stretching of remaining cells in the endothelial monolayer. The normal endothelial cell population is seen in (A,B). A decrease in cell density causes larger endothelial cells (C,D). (Jonuscheit et al. 2011)

Extracellular Matrices of the Posterior Stroma and the Corneal Endothelium

The stroma is bound by two specialized ECMs: Bowman‟s layer and Descemet‟s membrane. FACIT collagens XII and XIV also demonstrate enrichment in interfacial regions near Bowman‟s layer and Descemet‟s membrane. In addition, Descemet‟s membrane is rich in network forming collagen IV (Marchant et al. 2002; Young et al. 2002).

The corneal endothelium interacts with three different extracellular matrices: basement membranes, Descemet‟s membrane, and the specialized posterior stroma enriched in collagens

XII and XIV. These three specialized matrices are rich in different collagens suggesting a potential functional specificity for interactions between the endothelium and collagens.

FACIT collagens XII and XIV have been implicated in regulation of cell development and basement membrane stabilization (Izu et al. 2011; Bader et al.). FACIT collagens in the specialized basement membrane or posterior stroma may stabilize the stromal ECM and influence connections from the stroma to the endothelium through physical interactions with

ECM elements in basement membranes and Descemet‟s membrane.

FACIT Collagens

FACIT collagens are collagens that do not form fibrils, but are associated with the surface of collagen fibrils where they can function to modulate fibril interactions with other fibrils and matrix macromolecules (Van der Rest et al. 1990) (Fig. 11). FACIT collagens are found in basement membrane zones where they can influence cellular behavior and interactions between cell-cell and cell-extracellular matrix (Gordon and Hahn 2010; Birk and Bruckner 2011).

It is proposed that FACIT collagens XII and XIV have a regulatory role in stromal stability and endothelial maturation.

Structure of FACIT Collagens XII and XIV

There are three functional regions of FACIT collagens XII and XIV: a collagenous triple helical region that interacts with fibrillar collagens, an NC3 domain that projects away from the fibril, and a non-collagenous (NC) region without a triple helix that can interact with other elements of the extracellular matrix (ECM) (Lethias et al. 1993). The NC3 domain of both XII and XIV contain fibronectin type III repeats and von Willebrand factor A-like domains.

Figure 11. FACIT Collagens on the Surface of Fibrils. Collagens XII (blue) and XIV (red) are localized on the surface of fibrillar collagens. (Birk and Bruckner 2011).

An isoform of Collagen XII has an extra heparin binding domain (Koch et al. 1995;

Montserret et al. 1999). FACIT collagens XII and XIV have three non-collagenous domains and two collagenous domains: NC1, NC2, NC3, COL1, and COL2 (Fig. 12) (Gordon et al. 1987,

1990; Dublet and van der Rest 1991; Yamagata et al. 1991; Aubert-Foucher et al. 1992; Walchli et al. 1993; Gerecke et al. 2004; Birk and Bruckner 2011).

Collagen XII in the ECM

Collagen XII is expressed in the adult human stroma (Wessel et al. 1997). Collagen XII is expressed in the rabbit and avian corneal stroma (Anderson et al. 2000). Collagen XII is also localized in dense connective tissues like tendon and ligaments (Oh et al. 1993). The prolonged expression of collagen XII may suggest a role in stabilizing the unique organization of the cornea stroma and surrounding matrix (Young et al. 2002). In the developing avian cornea, collagen XII is localized between adjacent matrices where the stroma meets the epithelium and endothelium (Gordon et al. 1996). Collagen XII has been implicated to affect matrix remodeling through interactions between collagen fibrils in gel contraction (Nishiyama et al. 1994; Chiquet et al. 1996; Chiquet 1999). When collagens gels were incubated with the NC3 domains of collagen XII and XIV, gel contraction was significantly increased when compared to controls.

This suggested that the mediator of interaction and mobility between collagen fibrils was

FACIT collagens. Its role in matrix remodeling is further supported by its implications in wound healing and interactions with stromal growth factors (Massoudi et al. 2012; Runager et al. 2013).

The heparin binding domains and glycosaminoglycan side chains may facilitate in physical interactions between cell surfaces and the ECM (Yayon et al. 1991; Gerecke et al. 1997). There is also evidence that collagen XII regulates cell-cell communication and cell polarization (Izu et al. 2011). This suggests a role for collagen XII in areas where extra cellular matrices interact with cells.

Collagen XIV in the ECM

Collagen XIV also has been found to be expressed in the adult human stroma (Maguen et al. 2008). Collagen XIV is associated with the surface of collagen I/V fibrils in avian stroma, and collagen V has been implicated in regulation of nucleation and early lateral growth of fibrils

(Ansorge et al. 2009; Sun et al. 2011). This close interaction with collagen I/V heterotypic fibrils may suggest involvement of collagen XIV in regulating lateral fibril growth. There was an increase of collagen XIV mRNA before corneal compaction and early temporal expression in the avian cornea suggesting a role in fibril assembly and stromal compaction (Gordon et al. 1996;

Figure 12. Structure of FACIT Collagens XII and XIV. The structure of collagen XII (top) contains 18 fibronectin type III units with 4 von Willebrand factor domains interspersed. The triangle is the thrombospondin like domain. Collagen XIV (bottom) contains 8 fibronectin type III units and one less heparin binding domain than collagen XII. (Yamagata et al. 1991; Koch et al. 1995; Montserret et al. 1999; Gerecke et al. 2004).

Young et al. 2002). Collagen XIV localizes in the epithelial basement membrane of zebra fish. In zebrafish, collagen XIV knock down induces epidermal detachment (Bader et al. 2013). This also suggests a structural role of collagen XIV in interaction between matrices and surrounding cellular layers.

Collagens XII and XIV in Corneal Wound Healing

Development of the stroma into a highly organized connective tissue is essential for transparency. Small diameter fibrils that are evenly packed into orthogonal layers cause destructive interference of scattered light and contribute to the structural integrity of the cornea

(Maurice 1957). Macular corneal dystrophies (MCD) contain irregular spacing of collagen fibrils and areas that contain larger than normal diameter collagen fibrils leaving opaque areas on the cornea (Palka et al. 2010). These areas of opaque cornea can be treated with corneal grafts. In areas of corneal scarring there is an over expression of collagen XII (Massoudi et al. 2012).

Collagen XII has also been suggested as a marker of myofibroblast in cancer (Karagiannis et al.

2012). Myofibroblast are derived from keratocytes in the corneal stroma during wound healing

(Hassell and Birk 2010). Collagen XII also interacts with TGFβ (Fig. 13), a growth factor highly expressed during corneal healing and remodeling, and collagen XII‟s expression is increased in the presence of TFGβ while collagen XIV expression does not change (Arai et al. 2002;

Runager et al. 2013). Collagen XII interaction with TGFβ may function as feedback inhibition for

TGFβ by neutralizing its effects on stromal wound healing as seen in other proteoglycans

(Yamaguchi et al. 1990).

Precise spacing and longitudinal assembly of collagen fibrils is necessary to produce a transparent cornea after injury or infection. Both collagens XII and XIV have been implicated to have a respective role in these matters. Collagen XIV has been suggested to regulate early lateral fibril growth in tendon (Ansorge et al. 2009). Revealing the role of FACITs in stromal

21 development and organization will uncover the reasons behind corneal opacity through disease or injury, and possibly facilitate preventative treatments when corneal transplantation is not an option.

Collagens XII and XIV in Basement Membranes Zones

Collagen XII is restricted to interfacial matrices where the stroma meets the Descemet‟s membrane in the avian cornea, and collagen XIV is found to be localized between epithelia and basement membrane (Sugrue 1991; Gordon et al. 1996; Marchant et al. 2002; Young et al.

2002; Thierry et al. 2004; Bader et al. 2013). Understanding the functional role of FACIT collagens in the posterior cornea during development will elucidate the structural mechanisms that interweave lamellae of the stroma, Descemet‟s membrane, and corneal endothelium together. This knowledge could facilitate the separation of the stroma from the Descemet‟s during endothelial keratoplasty. Endothelial keratoplasty is used to restore vision in patients with corneal endothelial dystrophies. It involves the separation of the endothelium and Descemet‟s membrane from a donor cornea and transplanting the graft into a patient.

Figure 13. Collagen XII Interactions in the ECM. Collagen XII has been shown to interact with extracellular matrix proteins that bind to integrins and other membrane integrated proteins. 1. FACIT collagens may interact with a cell through ECM proteins, TGFβ, or tenascin that interact with integrins (Runager et al. 2013; Veit et al. 2006).2. FACITs may interact with the cell through transmembrane proteins like syndecan. 3. FACITs may physically interact with the cell membrane.

Introduction to Experiments

The cornea derives its unique transparency from regularly packed small diameter fibrils that are not organized into fascicles or fibers like in other tissues; instead the corneal stromal fibrils are arranged into orthogonal layers that run parallel to the corneal surface. The corneal endothelium also functions to maintain transparency by pumping out excess fluid. Maintaining the corneal stroma in a dehydrated state preserves tight packing of collagen fibrils. Stromal swelling disturbs fibril packing by causing pools of fluid that interfere with destructive interference (Meek et al. 2003). Effectively, corneal transparency would be altered if matrix organization was disrupted and the endothelium failed to keep the cornea dehydrated. The exact mechanisms behind collagen fibril assembly, deposition, and organization; assembly of fibrils into orthogonal lamellae; and how the stroma influences endothelial pump functions remain unknown.

Collagens XII and XIV are two different Fibril Associated Collagens with Interrupted

Triple Helices that are similar in structure yet have distinct and important roles in extracellular matrix (ECM) development and function in specialized tissues including: bone, tendon, muscle, and cornea (Marchant et al. 2002; Young et al. 2002; Zhang et al. 2003; Ansorge et al. 2009;

Izu et al. 2011; Tao et al. 2012; Zou et al. 2014). Collagen XIV is expressed during early development in the avian cornea with a high reactivity in the basement membrane zone, then expression decreases in the adult cornea. The spatial expression of collagen XII was restricted to interfacial matrix zones, where the stroma meets Descemet‟s membrane and Bowman‟s layer, in early development then gradually spreads into the stroma after hatching. The literature suggests that collagens XII and XIV have different roles in corneal development, yet the actual mechanism(s) behind how these collagens regulate the development and maintenance of transparency remains elusive. This dissertation aims to elucidate the role of collagen XII and

XIV in corneal maturation, fibril packing, higher order organization, and cell-ECM interactions.

In this thesis, the approach was to define the regulatory roles of these two FACITs using knock out mouse models deficient in one or both collagens. We focused on the corneal stroma and the corneal endothelium to understand the roles of collagens XII and XIV in corneal maturation and matrix development. The stroma has a unique ECM separated from the corneal endothelium by a specialized basement membrane. There is evidence supporting that collagens

XII and XIV facilitate the formation and attachment of basement membranes and play a role in fibrillogenesis (Marchant et al. 2002; Young et al. 2002; Bader et al. 2013). How the stroma coordinates with the endothelium and vice versa is a mystery. My general hypothesis is that

FACIT collagens XII and XIV have important regulatory roles in the development and maturation of the cornea, specifically the stroma and endothelium.

In chapter two, the focus is the role of collagen XIV in the stromal matrix development.

The aim was to determine the regulatory role of collagen XIV in fibril assembly, fibril packing, and corneal function. It was hypothesized that collagen XIV regulates lateral fibril growth and fibril packing through fibrillar surface interactions. Previous studies have suggested that collagen XIV regulates lateral growth of fibrils in tendon, and is primarily involved in early avian corneal development based on the early temporal expression (Gordon et al. 1996; Young et al.

2002; Ricard-Blum and Ruggiero 2005; Ansorge et al. 2009). Even with ample evidence to infer that collagen XIV plays a role in early matrix development, the exact mechanism and function of collagen XIV is unknown. To elucidate the function of collagen XIV in the cornea, mouse models deficient in collagens XIV were studied using TEM, protein immuno-blots, immuno-histochemistry, interfibrillar measurements, and corneal thickness measurements to determine the role of collagen XIV in fibril assembly and stromal development.

In chapter three, the focus is the role of collagen XII in stromal organization and matrix development. The aim was to determine the role of collagen XII in fibril packing, higher order matrix assembly, stromal organization, and corneal function. It was hypothesized that collagen

XII regulates fibril packing and density, lamellar organization, and corneal thickness. Previous studies have suggested that collagen XII regulates osteoblast cell shape and cell-cell communication, and is involved in congenital muscular dystrophy in human patients by influencing muscle extracellular matrix interactions (Young et al. 2002 ;Izu et al. 2011;

Zou et al. 2014). This is important to consider, because keratocytes are suggested to influence lamellar orientation in the corneal stroma (Young et al. 2014). To elucidate the mechanism of collagen XII in the stromal organization and maintenance, mouse models deficient in collagen

XII were studied. The role of collagen XII in stromal maturation and structure were determined by TEM, protein immuno-blots, immuno-fluorescence, interfibrillar measurements, and corneal thickness.

In chapter four, the focus is on how FACIT collagens XII and XIV influence cell maturation in the underlying corneal endothelium (Hemmavanh et al. 2013). The aim was to determine the role of collagens XII and XIV in corneal maturation. We hypothesize that that

FACIT collagens in the specialized posterior stroma interact with developing endothelial cells to regulate endothelial maturation and acquisition of function. There have been previous studies suggesting that collagen XIV regulates the formation of basement membranes, collagen XII regulates cell polarization, and collagen XII is localized in sub-cellular layers in the chick stroma

(Young 2002, Izu 2011, Bader 2013). To determine the influence of collagens XII and XIV on corneal endothelial development and maturation, we used mouse models deficient in collagens

XII, XIV, and XII/XIV with WT controls. The roles of collagens XII and XIV in endothelial maturation were determined using TEM, SEM, protein immuno-blots, immuno-histochemistry, and corneal thickness measurements.

Previous studies of collagens XII and XIV have suggested that they play a role in fibrillogenesis, matrix organization, stabilizing interfacial matrices, formation of basement membranes, and cell polarization. (Zhan et al. 1995; Gordon et al. 1996; Wessel et al. 1997;

Anderson et al. 2000; Young et al. 2002; Ricard-Blum and Ruggiero 2005; Ansorge et al. 2009;

Massoudi et al. 2012; Bader et al. 2013). Proper organization and interaction between matrix- matrix, matrix-muscle, and matrix-cell is necessary for muscle, tendon, and corneal function.

The exact mechanism behind the coordination of adjacent fibrils and adjacent matrices is unknown. In testing my general hypothesis, I aim to elucidate the roles of collagens XII and XIV in fibril assembly, matrix organization, and cell maturation to elucidate the complexities between extracellular matrix components and other adjacent biological system.

Chapter 2: Collagen XIV Regulates Corneal Stromal Extracellular

Matrix Assembly during Development

ABSTRACT

Purpose: The roles of collagen XIV in the development and function of the corneal stroma will be elucidated. It is hypothesized that collagen XIV regulates lateral fibril growth and fibril packing through fibrillar surface interactions.

Materials and Methods: Analysis of collagen XIV expression was performed at postnatal day

(P) P4, P14, P30 and P90 in wild type corneas using RT-PCR, immuno-blots and immuno-fluorescence microscopy. Mouse models deficient in collagen XIV were used to determine the role of collagen XIV in fibril assembly, fibril packing, and corneal stromal development. Fibril assembly and packing as well as stromal organization were evaluated using transmission electron microscopy. Corneal thickness was assessed using optical coherence tomography.

Results: There was a dynamic collagen XIV mRNA expression pattern in the cornea. Collagen XIV had a peak level of expression at P4, then expression dramatically decreased at P30 in the wild type corneas. Collagen XIV localized in the full thickness of the stroma in the P4 and P14 WT corneas. At

P30 and P90 there was less immuno-reactivity in the WT stroma. The null corneal stromas exhibited abnormal collagen fibril assembly with a shift towards larger diameter fibrils, and increased inter- fibrillar spacing with disrupted regular spacing in the absence of collagen XIV. Stromal thickness increased in the P60 null corneas when compared to wild type.

Conclusion: Collagen XIV regulates early corneal development and corneal compaction with its regulatory role in fibril assembly and tight fibril packing in early corneal development.

INTRODUCTION

The cornea stroma is a unique tissue with a highly organized extracellular matrix arrangement necessary for transparency. Small diameter collagen fibrils in the corneal stroma are assembled from fibril-forming collagens, specifically collagens I and V. (Birk and Trelstad

1984; Van der Rest and Garrone 1991; Birk and Bruckner 2011). The assembly and packing of collagen fibrils into orthogonal lamellae is a highly regulated multi-step process that is essential for corneal transparency and function (Birk and Trelstad 1984; Van der Rest and Garrone 1991;

Birk et al. 1995; Birk and Bruckner 2011). The development of the corneal stroma extracellular matrix is dependent on the organization and tight packing of fibrils into higher ordered structures, e.g., corneal lamellae (Birk and Trelstad 1984; Van der Rest and Garrone 1991; Birk et al. 1995; Birk and Bruckner 2011).

Two major groups of fibril-associated molecules present in the stroma are essential for fibril organization and corneal structure (Linsenmayer et al. 1998; Hassell and Birk 2010). These include small leucine-rich repeat proteoglycans and glycoproteins, and the fibril-associated molecules with interrupted triple helices (FACIT), collagen XIV is a member of the latter group

(Birk and Bruckner 2011; Chen and Birk 2013). Collagen XIV is the product of one gene making it a homotrimer of α1 chains. Collagen XIV contains two collagen triple-helical domains (COL1 and COL2) and three non-collagenous domains (NC1, NC2, and NC3) (Walchli et al. 1993;

Gerecke et al. 2004). The triple-helical domains interact with and adhere to the surface of fibrillar collagens. The COL1 and NC1 domains of FACITs interact with collagen I (Gerecke et al. 2004). The NC3 domain is a large amino terminal globular domain that extends away from the fibril. The NC3 subdomain has structural homology to von Willebrand factor A domains and

28 fibronectin type III repeats that confer NC3 with its physical properties (Shaw and Olsen 1991;

Gerecke et al. 2004).

Studies of collagen XIV in chicken (Castagnola et al. 1992; Young et al. 2002), bovine

(Lunstrum et al. 1991; Lethias et al. 1993) mice (Tao et al. 2012) and human (Brown et al. 1993;

Berthod et al. 1997) tissues showed that collagen XIV is prevalent in skin, tendon, cornea, cartilage and myocardium. In addition, collagen XIV is often found specifically in areas of high mechanical stress (Berthod et al. 1997). Localization to these areas indicates that collagen XIV may affect the mechanical properties of a tissue. Collagen XIV has also been implicated in regulation of in corneal stromal compaction (Gordon et al. 1996) and promotes collagen gel contraction in vitro (Nishiyama et al. 1994). In addition, in vivo studies of chicken tendon during embryogenesis and early post-hatching stages showed that collagen XIV expression is high during development, but decreases during tissue maturation (Young et al. 2000). These studies suggest that collagen XIV is important during early development, but the specific roles remain unknown.

The purpose of this study is to determine the functional role(s) of collagen XIV in the development and function of the corneal stroma. Ultrastructural analyses of fibril packing, fibril diameter distribution, and evaluation of corneal thickness were conducted. We hypothesized that collagen XIV has a significant role in the regulation of fibril assembly, fibril packing and, therefore, the development and function of corneal stroma.

MATERIALS AND METHODS

Animals

Wild type and gene-targeted mice null in collagen XIV were used (Ansorge et al. 2009).

The Col14a1-/- cornea did not express collagen XIV as recently demonstrated (Hemmavanh et

29 al. 2013). The dissected whole corneas from mice at postnatal day (P) P4, P10, P30 and P90 were examined. All animal studies were performed in compliance with the Institutional Animal

Care & Use Committee (IACUC) approved animal protocols.

PCR and Immuno-blotting Analysis

Total RNA was isolated from whole corneas dissected from wild type mice at age P4,

P10, P30 and P90 using an RNeasy Lipid Tissue Mini kit (QIAGEN). Reverse transcription was performed using 1 μg of total RNA with random primers (High-Capacity cDNA Archive Kit;

Applied Biosystems). Quantitative real-time PCR analysis was performed using StepOnePlus

(Applied Biosystems). The reaction was performed in a 25 μl reaction mixture containing 200 nM cDNA samples, 50 nM of sense and antisense primers, and 12.5 μl SYBR green PCR

Master Mix (Applied Biosystems). The following primer sequences were used: Col14a1 forward: 5'-ACT GGT TTT CAC GGG TGT TC-3' and reverse: 5'-TAA GTC GAG GAG AGG

CAA GC-3'. The PCR conditions were initially 95°C for 20s followed by 40 cycles at 95°C for 3 s and 60°C for 30s. The mRNA expression levels were normalized by calculating the ratios against 18S expression levels. For protein analysis using immuno-blotting, corneas were dissected from eyes obtained from wild type mice. The whole tissue preparation and immuno-blot were performed as previously described (Gregory et al. 2001; Izu et al. 2011) using anti-collagen XIV (1:1000 dilution; KR47), mouse anti–actin (1:5000 dilution; Millipore), and anti–mouse or anti–rabbit HRP-conjugated secondary antibodies (GE Healthcare).

Immuno-fluorescence Microscopy

To evaluate protein spatial expression and localization of collagen XIV, 6 µm corneal cross sections were evaluated with immuno-fluorescence against collagen XIV. Fresh eyes were harvested from wild type mice at ages P4, P10 and P30. Briefly, whole enucleated eyes were fixed with 4% paraformaldehyde in PBS, cryoprotected with sucrose-PBS in a series of

30 dilutions (10%, 20% and then 30%), embedded and frozen in OCT medium (Sakura Finetek,

Torrance, CA). Cross sections of 6 μm were cut using a HM 505E cryostat followed by immuno-fluorescence localization. Sections were blocked using 5% goat serum and then were incubated with rabbit anti–collagen XIV antibody (1:100 dilution; KR47) using a 1:1,000 dilution at 4°C overnight. The secondary antibody was Alexa Fluor 568 anti–rabbit IgG (Invitrogen) used at 1:500. Vectashield mounting solution with DAPI (Vector Laboratories) was used as a nuclear marker. Images were captured using a fluorescence microscope (DM5500; Leica). Identical conditions and were used to facilitate comparisons between samples.

Transmission Electron Microscopy

Briefly, corneas were fixed in 4% paraformaldehyde, 2.5% gluteraldehyde, 0.1 M sodium cacodylate, pH 7.4, with 8.0 mM CaCl2 followed by post-fixation with 1% osmium tetroxide. After dehydration, corneas were infiltrated and embedded in a mixture of EMbed 812, nadic methyl anhydride, dodecenyl succinic anhydride, and DMP-30 (Electron Microscopy Sciences, Hatfield,

PA). Semithin (1 μm) cross sections from the cornea were cut using a leica ultramicrotome, stained with methylene blue-azur B and examined under light microscopy on an Olympus BX61 microscope and photographed with DP72 digital color camera. Ultra-thin sections were cut using a Leica ultramicrotome and post-stained with 2% aqueous uranyl acetate and 1% phosphotungstic acid, pH 3.2. Central cornea sections were examined and imaged at 80 kV using a JEOL 1400 transmission electron microscope (JEOL Ltd.,Tokyo, Japan) equipped with a Gatan Orius widefield side mount CC Digital camera (Gatan Inc., Pleasanton, CA). All experiments were performed at least 3 times in tissues obtained from 5 different animals.

Fibril Diameter and Fibril Spacing Distribution

For each genotype, 5 different animal corneas at P30 were analyzed. Measurements were made using Metamorph Integrated Morphometry Analysis (IMA) (Sunnyvale, CA) using

31 randomly chosen and masked digital TEM images analyzed at a final magnification of

120,000X. At least 10 images were taken of a cross-sectional profile of a lamella for each animal. Fifty one images were used for both the wild type and null genotype. An ROI measuring

0.261 µm2 was chosen for each image where fibrils were perpendicular/cross-sectional to the viewing plane. From the region of interest, fibril diameter, intensity of fibrils, and interfibrillar distance from center to center were measured.

Optical Coherence Tomography and Corneal Thickness Measurement

The whole eye from euthanized mice was enucleated and measurements were obtained less than 15 minutes after the animals were sacrificed. The enucleated eye was placed in a custom made holder and placed in the Spectral Dominium Cirrus HDT Optical Coherence

Tomography (OCT) (Zeiss, California, USA) device for corneal thickness measurements.

Measurements were taken in less than 3 minutes after enucleating the eye from the orbit. The eyes were kept on balanced saline solution before being mounted on the holder. Five measurements were obtained on the vertical plane and five measurements on the horizontal plane of the central cornea. All experiments were performed at least 3 times in tissue obtained from 3 different animals of each genotype at age P60.

RESULTS

Temporal and Spatial Expression of Collagen XIV in Developing Mouse Corneas

The transcription of Col14a1 in the cornea was analyzed from birth to maturity. Corneal expression of mRNA at P4, P10, P30 and P90 was analyzed using RT-PCR. The highest levels of Col14a1 mRNA were at P4, then mRNA levels decreased sharply between P4 and P10. A very low level of expression was reached by P30, and this was maintained in the mature (P90) cornea (Fig. 14A). Expression of collagen XIV was analyzed using immuno-blots. Protein immuno-blot results were consistent with the mRNA analyses. Corneas at P4 demonstrated the

32 expressed highest amount of collagen XIV with a sharp reduction by P10. Virtually no collagen

XIV was present in extracts from P30 corneas, and there was a small decrease in actin expression at P30 as well (Fig. 14B).

The temporal and spatial expression patterns of collagen XIV in the cornea were investigated utilizing immuno-fluorescence microscopy (Fig. 15). These findings demonstrate homogeneous collagen XIV expression throughout the cornea at P4 and P10 (Figs. 15A and

15B). Immuno-reactivity was stronger around corneal keratocytes. However, by P30 (Fig. 15C) and at P90 (Fig. 15D), reactivity against collagen XIV decreased. Consistent with the immuno- blot and qPCR analyses, a reduction in collagen XIV reactivity was observed between P4 and

P10. The temporal and spatial expression patterns suggest a role(s) for collagen XIV in regulation of early stromal fibril assembly.

Figure 14. Restricted Temporal Expression of Collagen XIV in Developing Mouse Cornea. There is a decrease in collagen XIV expression in the mouse cornea after P4 shown by mRNA expression (A). Protein expression of collagen XIV was almost non- existent at P30 (B).

Absence of Collagen XIV is Associated with Altered Fibril Formation

To analyze fibril assembly during corneal development; ultrastructural analyses were performed using TEM of Col14a1-/- mice and WT controls. At P30, fibrils in the WT corneas were more uniform in shape and smaller than the fibrils in the Col14a1-/- (Fig. 16A). In contrast, the

Col14a1-/- mice contained a higher frequency of larger diameter fibrils (Fig. 16B). The presence

33 of these slightly larger diameter fibrils increased the average diameter of the Col14a1-/- collagen fibrils. The average diameter of WT stromal collagen fibrils was 23±2.61 nm, and the average diameter of Col14a1-/- collagen fibrils was 25±1.86 nm. There was no statistical significant difference in the average fibril diameters using a t-test, but there was a subpopulation of larger diameter fibrils in the Col14a1-/- corneas. Fibril diameter measurements in the mutant cornea also showed a shift to larger diameter fibrils. In contrast to the WT distribution, there was a reduced frequency of smaller diameter fibrils in the null tendons (Fig. 16C). We suggest that this represents the fibrils that prematurely enter the fibril growth phase in the absence of collagen XIV.

Altered Fibril Organization in the Corneal Stroma of Col14a1-/- Mice

There is a disruption in fibril organization in the stroma of the Col14a1-/- mice. There were fewer fibrils seen within cross sections of lamellae in the Col14a1-/- when compared to the

WT stroma. There were 504.8 ± 43.1 fibrils per micrometer in the WT compared to 412.3 ± 42.8 fibrils per micrometer in the Col14a1-/- mouse. The difference was considered statistically significant, p= 0.025.

Figure 15. Collagen XIV Localizes throughout the Corneal Stroma. Collagen XIV (Red) localizes throughout the entire corneal stroma during development from P4 to P90 (A-D).

After analyzing the same population used for density calculations, we saw a striking difference in regularity of packing in the Col14a1-/- fibril organization. Whereas the WT had

34 evenly spaced fibrils, the Col14a1-/- corneas had areas of evenly spaced fibrils near areas of sparsely spaced fibrils (Fig. 17A). This produced irregular packing in the absence of collagen

XIV. The fibril packing was significantly different in the null mice when compared to the WT (p<

0.05) using the Gibbs model. The mean nearest neighbor distance in the null mice was 5.2 µm greater than that observed WT, and there was a higher frequency of areas with unevenly spaced fibrils in the Col14a1-/- stroma (Fig. 18B).

Absence of Collagen XIV is Associated with a Thicker Corneal Stroma

As an indication of corneal stromal compaction and inter fibril spacing, corneal thickness was analyzed in wild type and Col14a1-/- at P30 using OCT at age P60. Wild type mice had a mean corneal thickness of 98.3 ± 4.9 µm. In contrast, Col14a1-/- corneas had significantly thicker corneas compared to wild type mice. The mean thickness was: 108.8 ± 4 µm. The difference was statistically significant using a student‟s t-test, p=0.0023.

DISCUSSION

Corneal transparency depends on the perfect organization of collagen fibrils, a process that includes fibril assembly, fibril packing, corneal compaction and lamellar organization.

Collagen XIV, a FACIT collagen member, has been implicated in regulation of fibril assembly and organization necessary for corneal transparency. Our results support this role. Collagen XIV expression is dynamic during corneal development, with temporal expression restricted to periods of protofibril assembly and organization in the developing stroma.

Figure 16. Collagen XIV Regulates Fibril Assembly. Collagen fibrils of the cornea appear to be slightly larger in the absence of Collagen XIV (A,B). The median fibril diameter in the WT cornea is 23±2.61 nm, and fibrils had a median diameter of 25±1.86 nm in the absence of collagen XIV (C). Bar 200 nm.

WT P30 Col14a1-/- P30

Figure 17. Altered Fibril Packing in the Absence of Collagen XIV. There is less regular spacing in the null corneas when compared to the WT corneas at P30. There are areas of loosely packed fibrils in the absence of collagen XIV.

WT P30 Col14a1-/- P30

Figure 18. Irregular Spacing in the Absence of Collagen XIV. The spacing between collagen fibrils in the WT stroma was regular; a representative radial distribution graph is shown in (A). In contrast the packing in the absence of collagen XIV was irregular (B). p-value 0.025.

The temporal expression pattern during avian corneal development suggests a regulatory role of collagen XIV in fetal and early postnatal corneal fibrillogenesis (Young et al.

2000; Young et al. 2002; Ansorge et al. 2009). The findings of this manuscript and our previous work support these conclusions. It is known that collagen XIV is present on the surface of fibrils and that the large non-collagenous domain (NC3), is implicated in the regulation of fibril packing and lateral fibril growth (Keene et al. 1991; Young et al. 2000; Young et al. 2002; Gerecke et al.

2004). The NC3 domain projects into the inter-fibrillar space and regulates the entry of fibril intermediates into lateral fibril growth. Therefore, we expected that in Col14a1-/- models, the absence of collagen XIV would be associated with larger fibrils and increased inter-fibril spacing.

The absence of collagen XIV not only affected fibril assembly but also fibril compaction, packing and lamellar organization. Interestingly, null and wild type fibrils had normal circular cross sectional profiles, but the null P30 fibrils demonstrated a shift toward larger diameter fibrils. The increase in fibril diameter suggests that collagen XIV functions to regulate entry into the lateral fibril growth phase during development. Our data also shows that collagen XIV plays a role in fibril compaction as shown by the increased inter-fibril space and the irregular fibril spacing noted in Col14a1-/- models. It can be inferred from these results that collagen XIV plays a major role in corneal compaction and influences corneal thickness as demonstrated by our corneal measurements in the mature P60 cornea. However, data in chapter 4 (Hemmavanh et al. 2013) suggested that FACIT collagens regulate endothelial maturation, and it is plausible that some degree of endothelial immaturity might be responsible for the increased inter-fibril spacing.

The structural and functional alterations noted in the corneal stroma of the collagen XIV null model were significant however it is possible that collagen XII compensates for the deficiency of collagen XIV, both structurally and functionally at some stages of corneal development. Therefore, compensation in the null mouse is possible but the role played by collagen XII in compensating the absence of collagen XIV is unknown. Collagens XII and XIV are closely related members of the FACIT collagen class. Collagen XII is more widely expressed throughout development, maturation, and aging (Gordon et al. 1996; Young et al.

2002; Tao et al. 2012).

Another interesting finding is that corneal stroma extracellular matrix composition during development and maturation is dynamic and not homogeneous. Immuno-fluorescence showed stronger reactivity at age P4 that faded at P10. Negligible staining was noted at P30. These findings were confirmed by protein quantification using western blot as shown in results.

Besides, the stroma extracellular matrix is not a homogenous structure but in contrast heterogeneous in composition with differences between the anterior and posterior layers. We found homogeneous collagen XIV expression during development but predominant anterior collagen XIV expression in the mature stroma. These findings suggest that matrix components are dynamic during maturation and development. It could be hypothesized that the dynamic spatial expression of collagen XIV provides changing cues during corneal development and maturation that could potentially influence endothelial and epithelial development and function as we recently reported in endothelium (Hemmavanh et al. 2013).

In summary, collagen XIV expression is restricted to the early stages of normal stromal development. Collage1n XIV is expressed during stromal development and is down regulated during maturation. In collagen XIV deficient mice, alterations in expression were associated with altered regulation of fibril growth and interfibrillar spacing with consequent changes in corneal thickness.

1 I would like to thank Edgar Espana, Sheila Adams, Guiyun Zhang, Inna Chernova, and David Birk for their contributions to this chapter.

Chapter 3: Collagen XII Regulates Fibril Packing, Lamellar Assembly, and Stromal

Organization in the Corneal

ABSTRACT

Purpose: Collagen XII was previously demonstrated to be localized throughout the corneal stroma in the developing and mature cornea. Its developmental expression pattern in the avian cornea was altered during stromal swelling and matrix expansion, suggesting a role in matrix remodeling and organization. Our objective is to determine the role of collagen XII in fibril packing, lamellar organization, matrix stabilization, and overall corneal stromal organization.

The hypothesis is that collagen XII regulates fibril packing, lamellar organization, stromal structure, and corneal function.

Materials and Methods: The temporal mRNA expression and protein expression at postnatal day (P)4, 10, 30, and 90 were determined along with the spatial localization of collagen XII in the cornea. The role of collagen XII in fibril spacing was determined by measuring the radial distribution frequency of fibrils within ultrastructural micrographs at P30. To determine if collagen XII would affect higher order organization of the corneal stroma, lamellar and stromal structure was ultrastructually analyzed at P4 and P30. To determine the role of collagen XII in stabilizing the stromal matrix, the corneal thickness was measured at P60 when normal developmental swelling of the cornea has ceased.

Results: Collagen XII was localized homogenously throughout the corneal stroma from P4 to

P90. During this period, collagen XII mRNA was expressed, but expression decreased after

P10. However, collagen XII content was relatively constant from P4 to P90. There were areas of increased in fibril density in the absence of collagen XII and disruption of lamellar organization in the P30 null stroma. There was an abnormal increase in thickness in the absence of collagen

XII.

Conclusions: Collagen XII regulates lamellar formation, stromal organization, and corneal function by regulating fibril interactions and influencing keratocyte involvement in stromal assembly.

INTRODUCTION

The specialized extracellular matrix (ECM) organization of the corneal stroma is essential for its transparency. The corneal stroma comprises 90% of the corneal thickness and is mainly comprised of water and collagen (Hogan et al. 1971). A highly regulated assembly of stromal collagen fibrils and management of stromal hydration is necessary for corneal transparency (Hassell and Birk 2010). Proteoglycans and other non-fibrillar collagens that exist in the inter-fibrillar spaces are implicated in the regulation of fibril assembly and packing (Robert et al. 2001; Muller et al. 2004; Hassell and Birk 2010). Stromal structure and function is not only dependent on extracellular matrix (ECM) organization, it also has a cellular component (Hart and Farrell 1969; Doughty et al. 2001; Young et al. 2014). Between the orthogonal layers of parallel collagen fibrils are networks of unique neural crest derived cells known as keratocytes that are connected through gap junctions to form a communicating network (Jester et al. 1994).

Aberrant formation of keratocyte networks would affect cell communication and network stability, thus affecting the overall stromal structure. However, the exact mechanisms behind even packing of collagen fibrils into orthogonal lamellae separated by the keratocyte network have not been defined.

Fibril-associated collagens with interrupted triple helices (FACIT)s interact on the surface of collagen fibrils, as well as, basement membranes and have been implicated in regulation of matrix organization and cell behavior (Birk and Bruckner 2011). Collagen XII is a homotrimer of

α1 chains and has three non-collagenous domains (NC1, NC2, and NC3) separated by two collagenous domains (COL1 and COL2) (Koch et al. 1995). The long isoform of collagen XII possesses sulfated glycosaminoglycans making it a proteoglycan as well. In the chicken cornea, collagen XII expression is detected in the sub-epithelial and sub-endothelial region until hatching. After hatching collagen XII gradually localizes throughout the entirety of the stroma possibly facilitating in matrix stabilization (Young et al. 2002).

Collagen XII also has been characterized in the developing avian cornea, where there are many stages of postnatal corneal growth involving compaction and subsequent thickening of the cornea (Gordon et al. 1996; Young et al. 2002). During avian embryonic development, keratocytes invade the stroma that concurs with stromal swelling and matrix expansion until 12 day (D) (Hay 1980). After 12D there is a decrease in the short isoform of collagen XII, suggesting that collagen XII promotes matrix expansion (Young et al. 2002). The task of collagen XII restricting or promoting growth as a fibril associated collagen is applicable. Early localization of collagen XII at sites where the stroma meets Bowman‟s layer and Descemet‟s membrane also implies a role in matrix stability and integration of different corneal layers

(Sugrue 1991; Gordon et al. 1996; Linsenmayer et al. 1998; Marchant et al. 2002). The localization pattern of collagen XII in development also supports a structural role for collagen XII

(Young et al. 2002).

Our hypothesis is that collagen XII regulates fibril packing, fibril density, lamellar assembly, and stromal organization impacting corneal thickness and function. The regularity of the fibril packing and lamellar assembly and stromal organization was analyzed in mouse models deficient in collagen XII.

MATERIALS AND METHODS

Animals

Wild type and gene-targeted mice null in collagen XII were used (Izu et al. 2011). As expected, the Col12a1-/- cornea did not express collagen XII as shown recently (Hemmavanh et al. 2013)

Corneas from mice at postnatal day (P) P4, P10, P30 and P90 were examined. All animal studies were performed in compliance with the Institutional Animal Care & Use Committee

(IACUC) approved animal protocols.

PCR and Immuno-blotting Analysis

RNA was isolated from whole corneas dissected from wild type and Col12a1-/- mice at age P4, P10, P30 and P90 using an RNeasy Lipid Tissue Mini kit (Qiagen, Venlo, Limburg).

Reverse transcription was performed using 1 μg of total RNA with random primers (High-

Capacity cDNA Reverse Transcription kit; Applied Biosystems, Carlsbad, Ca). Quantitative real-time PCR analysis was performed using StepOnePlus (Applied Biosystems). The reaction was performed in a 25μl reaction mixture containing 200 nM cDNA samples, 50 nM of sense and antisense primers, and 12.5μl SYBR green PCR Master Mix (Applied Biosystems). PCR conditions were 95°C for 20s followed by 40 cycles at 95°C for 3s and 60°C for 30s. The forward primer was ACCCACCTTCCGACTTGAATT and the reverse primer used was

TAGGCCCATCTGTTGTAGGG. The mRNA expression levels were normalized by calculating the ratios against 18S expression levels. For protein analysis using western blotting, corneas were dissected from eyes obtained from wild type and Col12a1-/- mice. The whole tissue preparation and immuno-blot were performed as previously described (Hemmavanh et al.

2013) using anti-collagen XII (1:100 dilution; KR33) (Veit et al. 2006) mouse anti–actin

(1:5,000 dilution; Millipore, Billerica, Ma), and anti–mouse or anti–rabbit HRP-conjugated secondary antibodies (GE Healthcare, Little Chalfont, United Kingdom).

Immuno-fluorescence Microscopy

Immuno-fluorescence analysis was performed as previously described (Sun et al. 2011).

Eyes were enucleated from wild type and Col12a1-/- mice at ages P4, P30 and P90. Briefly, whole enucleated eyes were fixed with 4% paraformaldehyde in PBS, cryoprotected with sucrose-PBS in a series of dilutions (10%, 20% and then 30%), embedded and frozen in OCT medium (Sakura Finetek, Torrance, CA). Cross sections of 6 μm were cut using a HM 505E cryostat followed by immuno-fluorescence localization. Sections were blocked in 5% bovine serum albumin (BSA) (Sigma Aldrich, St. Louis, MO) and then incubated overnight at 4°C in anti- collagen XII antibody (1:100 dilution; KR33) (Veit et al. 2006) using a 1:200 dilution at 2 hours room temperature. The secondary antibody was Alexa Fluor 568 anti–rabbit IgG (Invitrogen,

Carlsbad, Ca) used at 1:200. Vectashield mounting solution with DAPI (Vector Laboratories,

Burlingame, CA) was used as a nuclear marker. Images were captured using a fluorescence microscope (Olympus FV-1000). Identical conditions were used to facilitate comparisons between samples and genotypes.

Transmission Electron Microscopy

Briefly, corneas were fixed in 4% paraformaldehyde, 2.5% gluteraldehyde, 0.1 M sodium cacodylate, pH 7.4, with 8.0 mM CaCl2 followed by post-fixation with 1% osmium tetroxide. After dehydration corneas were infiltrated and embedded in a mixture of EMbed 812, nadic methyl anhydride, dodecenyl succinic anhydride, and DMP-30 (Electron Microscopy Sciences, Hatfield,

44 a Gatan Orius widefield side mount CC Digital camera (Gatan Inc., Pleasanton, CA). All experiments were performed at least 3 times in tissues obtained from five different animals.

Fibril Diameter and Fibril Spacing Distribution

For each genotype, 5 different corneas at P30 were analyzed. Measurements were made using Metamorphs Integrated Morphometry Analysis (IMA) (Sunnyvale, CA) using randomly chosen and masked digital TEM images analyzed at a final magnification of

120,000X. At least 10 images were taken of a cross-sectional profile of a lamella for each animal. Fifty one images were used for both the wild type and null genotype. A region of interest measuring 0.261µm2 was chosen for each image where fibrils were perpendicular/cross- sectional to the viewing plane. From the region of interest, fibril diameter, intensity of fibrils, and interfibrillar distances from center to center were measured.

Optical Coherence Tomography and Corneal Thickness Measurement

Whole eyes from euthanized mice were enucleated, and measurements were obtained less than 15 minutes after animals were sacrificed. The enucleated eye was placed in a custom made holder and placed in the Spectral Dominium Cirrus HDT Optical Coherence Tomography

(OCT) (Zeiss, California, USA) device for corneal thickness measurements. Measurements were taken in less than 3 minutes after enucleation. The eyes were kept on balanced saline solution before being mounted on the holder. Five measurements were obtained on the vertical plane and five measurements on the horizontal plane of the central cornea. All experiments were performed at least 3 times in tissue obtained from 3 different animals of each genotype at age P60.

Analysis of Keratocyte Shape

In vivo analysis of keratocytes shape was performed in Col12a1-/- and WT P30 mice.

Whole eyes were enucleated from each genotype at P30. Circular pieces of cornea were excised after fixation in 4% paraformaldehyde at 4°C for 40 minutes. The circular pieces of the cornea were then stained for actin in phalloidin for 2 hours in 4°C (Phalloidin, Life Technologies,

Carlsbad, Ca). The whole portion of fixed and stained cornea that was excised from the eye was then laid flat on a slide and imaged on a confocal laser-scanning microscope (FV1000 MPE;

Olympus) with a 60X 1.42 NA oil immersion lens.

RESULTS

Collagen XII is Expressed throughout Stromal Development and Maturation

To assess the developmental role of collagen XII, its temporal expression and spatial localization was examined in postnatal development and maturation. Col12a1 mRNA was expressed throughout postnatal development and in the mature cornea when measured in the whole cornea using qPCR (Fig. 19A). Collagen XII expression was highest during postnatal development (P4-P30), and decreased in the mature (P90) cornea. Collagen XII content was comparable throughout this period (Fig. 19B). Semi-quantitative analysis using immuno-blots demonstrated a modest increase in accumulation of collagen XII in the cornea from P4 to P30.

Even though mRNA expression decreased in the mature (P30) cornea, collagen XII protein levels were maintained in the mature corneal stroma. Collagen XII was homogeneously expressed throughout the entire stroma from P4 to P90 as shown using immuno-fluorescence localization. (Fig. 20A,C,D,G). In the P90 mature cornea there was increased reactivity for collagen XII in the posterior stroma (Fig. 20G). These data shows that collagen XII is expressed in the cornea in early development and throughout maturation.

Collagen XII Influences Corneal Stromal Fibril Packing

To define the role of collagen XII in collagen fibril packing we used an ultrastructural analysis of the P30 stroma in Col12a1-/- and WT mice. Fibrils in the WT P30 posterior stroma were evenly distributed within each layer.

Figure 19. Collagen XII is Expressed in the Cornea from Early Postnatal Development to Maturation. There was constant temporal and spatial expression of collagen XII during development and maturation. mRNA expression was constant from P4 to P30 with a small drop at P90 (A).Corneal protein content was constant from P4 to P30 (B).

Wild type fibrils had small diameters (23 ± 2.61 nm) with an even circumference. Fibrils from the P30 null cornea also had small diameters (24 ±1.62 nm) fibrils with an even circumference. Collagen fibrils in the Col12a1-/- posterior stroma were more tightly packed compared to WT fibril packing (Fig. 21A, 21B). The shape of the fibrils in the P30 Col12a1-/- was similar to that seen in the WT, round with small diameters. This data suggests that collagen XII regulates fibril packing within stromal lamellae.

The major difference observed using ultrastructural analysis was a substantial decrease in inter-fibrillar spacing in the collagen XII-null when compared to WT stromas. To define the role of collagen XII in fibril packing, fibril density and the nearest neighbor distance was calculated. It was determined that there was a significantly higher fibril density in the Col12a1-/- posterior stroma when compared to the WT (p=0.002). The WT stroma had 191 fewer fibrils per

0.261µm2 than the collagen XII-null stroma (Table 2). The fibrils in the collagen XII-null stroma

47 had a significantly decreased inter-fibrillar distance compared to wild type controls (p<0.001).

The fibrils in the WT stroma had a an average nearest neighbor distance of 44.2 ± 1.6 nm and the Col12a1-/- stroma had an average nearest neighbor distance of 35.7 ± 1.6 nm. Fibrils in the collagen XII-null stroma were on average 8.5 nm closer than in the WT stroma (Table 2).

Table 2. Abnormal Fibril Packing in the Absence of Collagen XII Genotype Wild Type *Col12a1-/- Difference (WT versus Col12a1-/-) Nearest Neighbor 8.5 nm Distance 44.2 ± 1.6 nm 35.7 ± 1.6 nm 95%CI: 4.0nm, 12.9nm p<0.001 -191 fibrils Fibril Density 505 ± 43 fibrils 695 ±44 fibrils 95%CI: -311.4 fibrils, -69.6 fibrils

p=0.002 There was a significant decrease in space between fibrils in the absence of collagen XII. The density of fibrils also significantly increased in the null corneas. * values are mean ± Std Err.

Disrupted Lamellar and Higher Order Stromal Organization in the Absence of

Collagen XII

To determine if collagen XII affects higher order organization of the corneal stroma, the lamellar structures in the posterior stroma during post-natal development (P4) and at the onset of maturity (P30) were analyzed. In the P4 WT posterior stroma there are formations of orthogonally arranged fibrils in loosely packed lamellae (Fig. 22A). There were less distinct formations of orthogonal lamellae in the P4 Col12a1-/- posterior stroma. There were sparse distributions of fibrils within immature lamellae in the P4 Col12a1-/- posterior stroma (Fig. 22B) when compared to the P4 WT posterior stroma (Fig. 22A). In the P4 Col12a1-/- stroma the loose bundles of orthogonally arranged fibrils do not form a layer that is parallel to the cornea (Fig.

22B). The immature lamellae in the P4 Col12a1-/- posterior stroma are not as long in length as in the P4 WT posterior stroma when traversing the cornea in the nasal to temporal direction.

WT Col12a1-/-

Figure 20. Collagen XII is Localized throughout the Corneal Stroma. Collagen XII is localized throughout the corneal stroma from P4 to P90, with increased reactivity in the posterior stroma at P90. Null corneas at each respective age were negative for collagen XII (B,D,F,H). (Epi) Epithelium, (S) Stroma, (En) Endothelium

WT P30 Col12a1-/- P30

Figure 21. Altered Fibril Packing in the Absence of Collagen XII. Decreased spacing between collagen fibrils in the collagen XII-null cornea.

In contrast, the P30 WT posterior stroma demonstrated distinct layers of fibrils that traveled in parallel with the cornea from left to right. Although the thickness of different lamellae varied slightly, the thickness of a single lamella from left to right was fairly constant in the P30

WT (Fig. 23A). At P30 the Col12a1-/- cornea did recover from its sparsely packed fibrils (Fig.

21) with abnormal densely packed fibrils. (Fig. 23B). Even though the P30 Col12a1-/- retained tightly packed fibrils, it had lamellae that were bulbous and not parallel to Descemet‟s membrane (Fig. 23B). These data indicate that collagen XII influences the overall organization of the ECM in the cornea stroma by regulating fibril packing and lamellar assembly.

WT P4 Col12a1-/- P4

Figure 22. Abnormal Formation of Lamellae in Early Postnatal Development in the Absence of Collagen XII. Less distinct formations of lamellae during early development in the absence of collagen XII. In the P4 WT posterior cornea, there are two distinct populations of fibrils that are orthogonal to each other (A). In the collagen XII null cornea the fibrils are sparsely packed and while there is the presence of fibrils that are orthogonal to each other, they do not start the formation of layers (B). Mag bar 2 μm.

WT P30 Col12a1-/- P30

Figure 23. Irregular Lamellae in the Mature Cornea in the Absence of Collagen XII. The mature WT posterior corneal stroma contains organized lamellae with parallel fibrils (A). There is loss of distinct lamellae in certain areas of the posterior stroma in the Col12a1-/- stroma (B).The yellow arrows denote the span of a single lamellar layer, an adjacent layer has fibrils orthogonal fibrils. P30 WT (A) P30 Col12a1-/- (B) Mag Bar 2 μm.

Collagen XII Influences Corneal Thickness

To evaluate the functional role of collagen XII in matrix deposition and transparency, corneal thickness was measured in P60 WT and Col12a1-/- mice using optical coherence tomography (OCT). Corneal thickness plateaus by P56 and can be considered mature (Hanlon et al. 2011). The mature P60 WT cornea had a thickness of 94±4.9 µm. The P60 Col12a1-/- thickness was measured at 117±9.5 µm (Fig. 24). In the absence of collagen XII the corneal thickness was significantly different at a p-value<0.01.

Keratocyte Shape Is Influenced by Collagen XII

We analyzed keratocyte morphology since collagen XII is associated with regulation of cell-ECM interactions. Whole eyes obtained from P30 WT and Col12a1-/- were stained with phalloidin to visualize the actin cytoskeleton of keratocytes. The keratocytes in the Col12a1-/- stroma were irregularly shaped and lacked defined boundaries between adjacent keratocytes

(Fig. 25B). Flat mount staining for the actin cytoskeleton and nuclei (blue) showed more cells within a vertical section with smaller cell bodies in the Col12a1-/- anterior stroma. We concluded

51 that in the absence of collagen XII the mature cornea contained irregularly shaped keratocytes that would influence cell communication and cell network organization.

DISCUSSION

Investigating the mechanisms behind fibril packing, stromal organization, and cell-matrix interactions is important for understanding the molecular mechanisms behind corneal transparency. Proper stromal organization that includes formation of interwoven orthogonal lamellae and regular packing of collagen fibrils is necessary for corneal transparency and function. The assembly of collagen fibrils and the higher order organization of fibrils into lamellae is an intricate process with many stages that are highly regulated (Birk and Trelstad

1984; Birk et al. 1995). Transparency is also dependent on the cellular changes that occur in the stroma and proper communication between keratocytes (Song et al. 2003; Moller-Pedersen

2004; Young et al. 2014). However, the mechanism that determines the packing of fibrils into orthogonal lamellae and subsequent stromal organization is unknown.

Figure 24. Irregular Increase of Corneal Thickness in the Absence of Collagen XII. In the mature P60 cornea, the WT cornea had a thickness of 94±4.9 µm. In the absence of collagen XII the thickness was measured at 117±9.5 µm.

WT P30

Col12a1-/- P30

Figure 25. Altered Keratocyte Shape in the Absence of Collagen XII. The Col12a1-/- mature cornea contained irregularly shaped keratocytes with thin processes and had a less stellate shape. (Fig. 25A) The junctions between adjacent keratocytes were not clearly defined, denoted by the yellow arrows. Bar 10 µm

Collagen XII is expressed in the corneal stroma from early development and throughout maturation, suggesting roles in stromal ECM development and structural maintenance.

Differences in orthogonal lamellae and packing were seen in the early developmental P4

Col12a1-/- mouse stroma when compared to the WT P4 stroma. Then at P30 the Col12a1-/- mouse stroma had significantly higher density of fibrils within lamellae when compared to the

P30 WT stroma. There was also less distinction between orthogonal lamellae in the P30

Col12a1-/- stroma than in the P30 WT stroma. The decreased distance between fibrils in the P30 mutant cornea could suggest that collagen XII plays a role in bridging adjacent fibrils, and maintains fibril hydration creating a small amount of space between adjacent fibrils with the

GAG chains found in long form collagen XII. Less distinction of orthogonal layers in the mutant

P4 stroma implied that collagen XII influences the inter-facial matrix formation during early development, and the aberrant phenotype that persists into the mutant P30 cornea shows that collagen XII is responsible for maintaining higher ordered organization in the mature cornea.

The data presented in this chapter shows decreased inter-fibrillar spacing and lamellar disruption. To determine if this was a result of less hydration in the corneal stroma, we measured the corneal thickness. At P60 the murine cornea is mature and has reached its maximum thickness (Hanlon et al. 2011). Surprisingly, the P60 Col12a1-/- cornea was significantly thicker than the P60 WT cornea. The decreased inter-fibrillar space and abnormal lamellae seen in the mature Col12a1-/- corneas supports the idea that the increased thickness may only not be the result of increased hydration from a dysfunctional endothelium. The increased stromal thickness may stem from a structural defect in the absence of collagen XII

(Gordon et al. 1996; Marchant et al. 2002). It is possible that collagen XII regulates the overall structure and organization of the stromal matrix needed for maintaining the integrity of the cornea. When comparing the expression pattern of collagen XIV and XII in the mouse cornea

(Chapters 2 and 3), collagen XII has a more dominant role in stromal development and

54 structure. The results from ultrastructural analyses and corneal thickness support this. The double deficient, collagens XII and XIV, mature mouse model should have an aberrant stromal phenotype similar to that seen in the P30 collagen XII null cornea because the major role of collagen XII in stromal structure.

The lack of organized lamellae in the stroma from P4 to P30 in the absence of collagen

XII suggests a role in maintaining keratocyte organization. In the absence of collagen XII, keratocyte shape was altered. Keratocytes in the P30 mutant cornea had less dendritic processes and the connections between adjacent cells were not focused in one area as they were in the WT stroma.

Collagen XII is suggested to regulate cell polarity and cell-cell communication (Izu et al.

2011). By acting as a bridge separating adjacent fibrils, collagen XII may facilitate the formation of healthy cell processes by creating more space in the surrounding matrix. Because of the altered cell shape in the mutant P30 corneas, the communication between keratocytes via gap junctions may be impaired. The formation of an organized keratocyte network is dependent on proper intralamellar and translamellar communication. There has been evidence suggesting that the formation of orthogonal lamellae relies on the orientation of the keratocyte network (Young et al. 2014). These data suggest that collagen XII influences keratocyte communication and network formation, altering orthogonal lamellar orientation needed for transparency.

The collagen XII null cornea exhibited decreased inter-fibrillar spacing, disruption of lamellar organization, and an irregular increase in thickness. Absence of collagen XII between collagen fibrils disturbed the normal organization of fibrils, possibly affecting the keratocyte network. Abnormal lamellar organization may result from disruption of the keratocyte networks

55 during development. In conclusion we propose that collagen XII influences keratocyte organization, lamellar orientation, an2d maintains ECM stromal organization.

2 2 I would like to thank Edgar Espana, Sheila Adams, Guiyun Zhang, Inna Chernova, and David Birk for their contributions to this chapter.

Chapter 4: Collagens XII and XIV Regulate Corneal Endothelial Maturation1

ABSTRACT

Purpose: Maturation of the endothelium and the adjacent matrix was characterized in wild type mice. The influence of FACIT collagen XII and XIV deficiency on the morphology, maturation and function of the corneal endothelium was examined.

Methods: Analysis of the endothelium and Descemet‟s membrane was performed using transmission electron microscopy at postnatal day (P) P4, P14 and P30 in wild type,

Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/- mice. Endothelial junctions were analyzed using

ZO-1. The presence of endothelial – stromal communications was evaluated with phalloidin staining, as well as, electron microscopy. Finally, corneal thickness was assessed.

Results: A thin DM, clefts between endothelial cells and DM, and large „vacuole-like‟ structures were present in the endothelial cells of WT mice at P4 and not noted at P30. The endothelia of

Col12a1-/-, Col14a1-/- and compound Col12a1-/-/Col14a1-/- in the P30 cornea maintained the

“vacuole-like‟ structures seen at P4. A mature endothelial junction pattern was delayed in the null corneas. Expression of ZO-1 in3 WT endothelia at P14 was diffused and localized to the basolateral and apical cell membrane. At P30, staining was localized to intercellular junctions.

3 3 Note to Reader: This chapter has been previously published as Hemmavanh, C., M. Koch, D. E. Birk and E. M. Espana (2013). "Abnormal Corneal Endothelial Maturation in Collagen XII and XIV Null Mice." Invest Ophthalmol Vis Sci 54(5): 3297-3308 and has been reproduced with permission from the Association for Research in Vision and Ophthalmology (ARVO)

ZO-1 reactivity was patchy in Col12a1-/-, Col14a1-/- and compound Col12a1-/-/Col14a1-/- corneas at

P14 and P30. Stromal thickness was increased in P30 null corneas. Endothelial cell processes were demonstrated penetrating the DM and into the underlying stroma, throughout the entire endothelial layer in the P4 cornea.

Conclusions: Collagen XII and XIV null mice demonstrate delayed endothelial maturation. The structural alterations suggest functional changes including endothelial structural integrity and corneal thickness. Endothelial-stromal interactions suggest a pathway for signal transduction.

INTRODUCTION

The corneal endothelium is a monolayer of hexagonal cells essential to maintain optimal corneal hydration and transparency. Corneal endothelial dysfunction is a common indication for corneal transplantation. Patients with advanced endothelial dysfunction present with eye discomfort and pain, blistering of the corneal surface, and decreased visual acuity. New surgical techniques for endothelial transplantation include Descemet‟s Stripping Endothelial Keratoplasty and Descemet‟s Membrane Endothelial Keratoplasty. The underlying basis and continued development of these new surgical techniques requires a better understanding of the structure and function of the posterior corneal stroma, DM and endothelium (Price and Price 2006;

Koenig et al. 2007; Anshu et al. 2012; Tan et al. 2012).

The family of fibril-associated collagens with interrupted triple helical domains (FACIT collagens) is important in the assembly of collagen fibrils and organization of fibrillar matrices. It is suggested that FACIT collagens are essential for corneal transparency and corneal function

(Gordon et al. 1996; Linsenmayer et al. 1998; Young et al. 2002). Collagens XII and XIV, members of the FACIT family, are expressed in a variety of tissues including the cornea (Young et al. 2002; Gordon and Hahn 2010; Birk and Bruckner 2011). Both collagens XII and XIV have

58 been shown to be expressed in the human cornea (Ljubimov et al. 1996; Wessel et al. 1997;

Maguen et al. 2008)10-12 indicating that the mouse cornea is a valid model for these studies.

Collagens XII and XIV are associated collagen I containing fibrils. Collagen XII and XIV also interact with different extracellular matrix components like proteoglycans and are found in basement membrane zones (Gordon and Hahn 2010; Birk and Bruckner 2011).

Collagen XII is expressed at interfaces where tissues interact. Although the function of collagen XII is poorly understood, it is believed that collagen XII is a stress molecule secreted in response to stress and shear. Studies reported that the Col12a1 gene is stimulated by mechanical forces in fibroblasts, endothelial cells, and osteoblasts (Nishiyama et al. 1994; Fluck et al. 2003). In the chicken, collagen XII is expressed in interfacial regions of the cornea,

Bowman and Descemet‟s membrane, until hatching, suggesting a major role in the integration of different corneal layers (Marchant et al. 2002).

Collagen XIV expression is homogeneous during stromal development and decreases in the mature stroma suggesting a major role for collagen XIV during initial stages of fibrillogenesis and early stromal development and compaction (Linsenmayer et al. 1998; Young et al. 2002). In avian species, collagen XIV is expressed throughout the entire stroma, as well as, Bowman membrane and DM during development. However, mature corneas are not reactive against collagen XIV (Young et al. 2002).

Descemet‟s membrane is composed of collagen VIII assembled as a hexagonal lattice

(Birk 2005). In contrast to the human DM, not much is known about the structure of DM in mice.

However, recent work indicates that the mouse is a good model of the human DM. Hopfer et al. studied two to six month old wild type mice and described abundant banded material within the posterior layer of DM (Hopfer et al. 2005). An uneven appearance with focal thickening in 2-

59 year-old mice also was described. Jun et al. studied 2 to 16 week old mice and described a banded layer with 110 nm periodicity comprising 90 to 100% of the total DM thickness. An accumulation of banded material continued between 2 and 6 weeks of age, suggesting an attenuated endothelial cell biosynthetic activity (Jun et al. 2006). However, the specific effects of collagens XII and XIV in DM and endothelial function remain largely unknown. This report supports the hypothesis that collagens XII and XIV in the posterior corneal stroma have a functional role in the regulation of corneal endothelial maturation.

MATERIALS AND METHODS

Animals

-/- Gene-targeted mice null in Col12a1 (Izu et al. 2011), or Col14a1-/- (Ansorge et al. 2009) compound Col12a1/Col14a1 null mice and WT control mice were utilized. Compound collagen

Col12a1/Col14a1 null mice were generated by cross-breeding the single null mice. Corneal tissue from mice at P4, P14 and P30 were examined. All experiments conformed to the use of

Laboratory Animals and the ARVO statement for the Use of Animals in Ophthalmic and Vision

Research and were approved by the Institutional Animal Care and Use Committee of the

University of South Florida, College of Medicine.

Immuno-blotting

Immuno-blotting was performed as previously reported. Briefly, protein extracts were prepared in extracting buffer containing 50 mM Tris-HCl, pH 6.8, 1% SDS and proteinase inhibitor cocktail (Roche). Cornea extracts (5 µg) were separated on 4–12% Bis-Tris gels

(Invitrogen) and transferred onto Hybond-C membranes (GE Healthcare). Anti-collagen XII antibody KR33 (Veit et al. 2006) at 1:200 and anti-collagen XIV at 1:200 (Ansorge et al. 2009) were used. Actin was used as a protein loading control. Actin antibody was purchased from

Millipore (Billerica, MA). All experiments were performed at least 3 times in tissue obtained from

3 different animals.

Immuno-fluorescence Microscopy

Immuno-fluorescence analysis was performed as previously described (Sun et al. 2011).

Briefly, corneas were fixed with 4% paraformaldehyde in PBS, cryoprotected with sucrose-PBS in a series of dilutions (10%, 20% and then 30%), embedded and frozen in OCT medium

(Sakura Finetek, Torrance, CA). Cross sections of 6 μm were cut using a HM 505E cryostat followed by immuno-fluorescence localization. Sections were blocked in 5% bovine serum albumin (BSA) and incubated overnight at 4°C in anti-collagen IV at 1:100 (Southern Biotech,

Birmingham, Al), anti-collagen VIII at 1:100 (Santa Cruz Biotechnology, Santa Cruz, Ca.), anti- collagen XII antibody KR33 at 1:200, anti-collagen XIV at 1:200 (Veit et al. 2006; Ansorge et al.

2009) and anti-ZO1 (Molecular Probes, Eugene, OR), followed by Alexa Fluor 488-conjugated goat anti-rabbit IgG (Molecular Probes, Eugene, OR) at 1:200. Alexa fluor ® 594 phalloidin

(Molecular Probes, USA) also was used. Positive and negative controls were processed. The nuclei were counterstained using Vectashield mounting solution with DAPI (Vector Lab Inc.,

Burlingame, CA). Images were captured using a confocal laser-scanning microscope (FV1000

MPE; Olympus) with a 60X 1.42 NA oil immersion lens. To avoid bleed through between fluorescence emissions, samples were scanned sequentially with 488- and 543-nm lasers, and emissions were collected with appropriate spectral slit settings.

Scanning and Transmission Electron Microscopy

Corneas were analyzed using transmission electron microscopy as previously described

(Zhang et al. 2009). Briefly, corneas were fixed in 4% paraformaldehyde, 2.5% gluteraldehyde,

0.1 M sodium cacodylate, pH 7.4, with 8.0 mM CaCl2 followed by post-fixation with 1% osmium tetroxide. After dehydration corneas were infiltrated and embedded in a mixture of EMbed 812,

61 nadic methyl anhydride, dodecenyl succinic anhydride, and DMP-30 (Electron Microscopy

Sciences, Hatfield,PA). Semithin (1µm) cross sections from the cornea were cut using a Leica

UCT ultramicrotome, stained with methylene blue-azur B and examined under light microscopy on an Olympus BX61 microscope and photographed with DP72 digital color camera. Ultra-thin sections were cut using a Leica ultramicrotome and post-stained with 2% aqueous uranyl acetate and 1% phosphotungstic acid, pH 3.2. Central cornea sections were examined and imaged at 80 kV using a JEOL 1400 transmission electron microscope (JEOL Ltd., Tokyo,

Japan) equipped with a Gatan Orius widefield side mount CC Digital camera (Gatan Inc.,

Pleasanton, CA). To evaluate the possible interaction between corneal endothelium and the adjacent matrix, P4 mouse corneas were dissected in PBS under an operating microscope immediately after harvesting, and processed for scanning electron microscopy. Tissue was fixed overnight in 3% glutaraldehyde in 0.1 M sodium cacodylate buffer, washed three times for ten minutes each in 0.1 M sodium cacodylate buffer, postfixed in osmium tetroxide for 1 h, and rinsed three times for five minutes in 0.1 M sodium cacodylate buffer. Corneas were then dehydrated in an ethanol series, dried in an Electron Microscopy Sciences 850 critical point dryer, mounted onto metal stubs. Scotch tape (3M, Minnesota, USA) was then used to remove endothelial cells from the surface, exposing the DM. The corneal endothelial surface was examined using a scanning electron microscopy, (JEOL model 6490LV). All experiments were performed at least three times in tissues obtained from five different animals.

Optical Coherence Tomography and Corneal Thickness Estimation

Whole eyes from euthanized mice were enucleated and measurements were obtained less than fifteen minutes after animals were sacrificed. The enucleated eye was placed in a custom made holder and placed in the Spectral Dominium Cirrus HDT Optical Coherence

Tomography (OCT) (Zeiss, California, USA) device for corneal thickness measurements.

Measurements were taken in less than three minutes after enucleating the eye. The eyes were

62 kept on balanced saline solution before being mounted on the holder. Five measurements were obtained on the vertical plane and five measurements on the horizontal plane of the central cornea. All experiments were performed at least three times in tissue obtained from 3 different animals at P30.

Statistical Analysis

An Analysis of Variance (ANOVA) test was performed with four different groups, each group represented a genotype. An ANOVA test was done against all four genotypes at P30 and at P60. If the ANOVA test reported a significant difference between the groups, t-tests were done pairing each null-genotype against the control group.

RESULTS

Normal Maturation of Corneal Endothelium and Adjacent Matrix

To establish the normal process of corneal endothelial and adjacent extracellular matrix maturation in the WT cornea, an ultrastructural analysis was performed at P4, P14, and P30.

Significant changes in the morphology of DM were observed from P4 to P30 (Fig. 26). DM was a thin single homogenous layer at P4 (Fig. 26B) that progressively became thicker at ages P14

(not shown) and P30 (Fig. 26D). In addition, clefts between the endothelium and DM were noted at P4 (Fig. 26B) and were not seen at P30 (Fig.26D). A distinct basal lamina was not observed at either P14 or P30. The most striking findings with maturation were observed in the corneal endothelial monolayer.

From P4 to P30, the endothelium became thinner with maturation. Large endothelial vacuoles were noted at P4 (Fig. 26A) and not seen at P30 (Fig. 26C). There was also a disappearance of clefts between the endothelium and DM. In conclusion, 3 morphological findings were associated with normal maturation of the wild type corneal endothelium:

63 monolayer thinning; loss of vacuoles within the monolayer; and disappearance of clefts between the endothelium and thickening of DM.

Figure 26. Corneal Endothelial Maturation. Normal maturation of the corneal endothelium (En), and Descemet‟s membrane was studied using transmission electron microscopy. (A,B) Immature (P4) and (C,D) mature (P30) wild type corneas were compared. Endothelial maturation is associated with a thickening of the DM, thinning of the endothelium. Immature endothelia have large endothelial vacuoles (Asterisks) and clefts (black arrows) between the DM and the endothelium (A,B). These disappear during maturation and the corneal endothelial monolayer thins (C,D) (S) stroma, Descemet‟s membrane, (En) endothelium. Bars = 2 μm.

Collagen XII and XIV are Present in the Wild Type Posterior Stroma

The potential roles of collagens XII and XIV in endothelial maturation were addressed using immuno-localization. Collagen XII was expressed in the posterior stroma and adjacent to

DM (Figs. 27A, C). Collagen XII reactivity was excluded from the DM proper indicated by no

Figure 27. Localization of Collagens XII and XIV in the Posterior Corneal Stroma. (A,C) Collagen XII is localized in the posterior stroma (S). (B,D) Collagen XIV also is localized in the posterior stroma. Descemet‟s Membrane separates the endothelium from the stroma. (A,B) Collagen IV (red) is located in the inner and outer borders of Descemet‟s membrane. (C,D) Collagen VIII (red) is localized throughout Descemet‟s Membrane. The arrows denote endothelial cells. (S) stroma, Descemet‟s membrane. Bar = 10 μm.

65 collagen XII reactivity being co-localized with an anti-collagen VIII antibody in DM (Fig. 27C).

Collagen XIV expression was restricted to the posterior stroma and no collagen XIV reactivity was co-localized with an anti-collagen VIII antibody in DM (Fig. 27D). The localization and limits of DM were defined by the expression of collagen IV and VIII. The outer limit of DM demonstrated a patchy pattern of reactivity with anti-collagen IV antibody as previously reported in the chicken. In contrast, the collagen IV immuno-reactivity along the inner layer of DM was continuous and linear (Figs. 27A,B). Collagen VIII immuno-reactivity was confined to the DM proper (Figs. 27C,D).

-/- -/- Characterization of Col12a1 and Col14a1 Mouse Corneas

The Col12a1-/- and Col14a1-/- mouse models were previously characterized as null for collagens XII and XIV respectively (Ansorge et al. 2009; Izu et al. 2011). The corneas from these mouse models were analyzed for collagen XII and XIV expression. Corneal expression of collagen XII (Fig. 28B) or collagen XIV (Fig. 28D) was not present by immuno-localization in the respective null mice. However, as expected, reactivity against collagen XII (Fig. 28A) and collagen XIV (Fig. 28C) was homogeneously localized throughout the wild type stroma. These results were confirmed using immuno-blots. Collagen XII was not present in the Col12a1-/- mouse corneal extracts (Fig. 28E) and there was no collagen XIV expression in the corneal

-/- extract of the Col14a1 mouse corneas (Fig. 28F). These data indicate that corneas obtained from the Col12a1-/- and Col14a1-/- mouse models do not express collagen XII or collagen XIV, respectively.

Figure 28. Mouse Models Null for Corneal Collagen XII and XIV. In the WT mouse, collagen XII expression localizes to the corneal stroma (A). In contrast, the Col12a1-/- mouse model did not express collagen XII (B). Immuno-fluorescence shows expression of collagen XIV in the full thickness corneal stroma (C). There is no immune-reactivity in the Col14a1-/- corneas (D). (S) stroma, (DM) Descemet‟s membrane, (En) endothelium, (Epi) epithelium. Immuno-blots confirmed the absence of collagen XII expression in the Col12a1-/- cornea (E) and collagen XIV expression in the Col14a1-/- (F). Bar = 10 μm.

Delayed Corneal Endothelial Maturation in Col12a1-/-, Col14a1-/- and Compound

Col12a1-/-/Col14a1-/- mice

-/- -/- -/- -/- The endothelium from Col12a1 , Col14a1 and compound Col12a1 /Col14a1 mouse corneas was evaluated at P30 and compared to comparable wild type endothelium (n=5).

Evaluation of the Col12a1-/- mice demonstrated intercellular vacuoles with subendothelial clefts

(Fig. 29A). Col14a1-/- corneas also had intercellular vacuoles and subendothelial clefts that were

-/- -/- moderately more numerous than in Col12a1 mice (Fig. 29B). Compared to Col12a1 and

Col14a1-/- mice, compound deficient Col12a1-/-/Col14a1-/- mouse corneas had more numerous intercellular vacuoles as well as more subendothelial clefts than either of the single mutants

(Fig. 29C). In contrast, WT corneas did not show any intercellular vacuoles in the mice examined (Fig. 29D). The presence of endothelial vacuoles was always associated with the presence of subendothelial clefts between the endothelium and DM (Figs. 29 B,D). The endothelial phenotype observed in the P30 FACIT collagen-null mice was comparable to the immature endothelium at P4 (Fig. 26). There was thickening of DM in the wild type and mutant models. Taken together, these morphological findings were suggestive of delayed endothelial maturation in Col12a1-/-, Col14a1-/- and compound Col12a1-/-/Col14a1-/- mice.

Corneal Endothelial Barrier Maturation Is Delayed in Collagen XII and XIV Deficient Mice

ZO-1, a component of tight junctions, was used as a marker to follow endothelial barrier maturation. ZO-1 expression in the wild type corneal endothelium was diffuse and localized to both the apical and lateral corneal endothelial membrane in immature wild type mice at P14.

The ZO-1 reactivity pattern was also irregularly spaced (Fig. 30A). The expression of ZO-1 became more localized to the lateral membrane and more regularly spaced at P30 in WT

Figure 29. Delayed Endothelial Maturation in Absence of Collagen XII and/or XIV. (A) The mature wild type endothelium (P30) is thin with an absence of vacuoles and clefts. The mice null for collagen XII and /or XIV all demonstrate features of immature endothelia. There is a retention of large vacuoles (asterisks) in the endothelium and clefts (arrows) between the endothelium and DM at P30 in (B) Col12a1-/-, (C) Col14a1-/- and (D) Col12a1- /- /Col14a1-/- corneas. (S) Stroma, (DM) Descemet‟s membrane, (En) endothelium Bar = 2 μm.

69 endothelia (Figs. 30B,C). In contrast, the expression of ZO-1 in Col12a1-/- and Col14a1-/- mice was noted in the apical and lateral endothelial cell membrane at P14 (Figs. 31A,32A) and did not localize to the lateral cell membrane at P30. (Figs. 31B,C and 32B,C)

The pattern of ZO-1 reactivity also remained irregularly spaced comparable to that observed in the immature, P14 endothelium. This finding was suggestive of delayed endothelial barrier maturation and suggestive of impaired structural integrity of the endothelium in deficient mice.

Figure 30. Endothelial Junction Maturation in Immature and Mature Wild Type Mice. ZO-1 (red) expression in the corneal endothelium of the wild type mouse. (A) ZO-1 is expressed in the apical and lateral corneal endothelial membrane in immature (P14) mice. (B, C) The expression of ZO-1 becomes localized to the lateral membrane in mature (P30) wild type corneas. The yellow box in (B) outlines the area in (C). (S) stroma, (En) endothelium Bars = 40 μm.

Figure 31. Delayed Endothelial Junction Maturation in Col12a1-/- Mice. ZO-1 (red) expression in the corneal endothelium of the Col12a1-/- mouse. (A) ZO-1 is expressed in the apical and lateral corneal endothelial membrane at P14. (B, C) The expression of ZO-1 does not localize exclusively to the lateral membrane in the endothelia of mature (P30) mice instead retaining the less mature localization. The yellow box in (B) outlines the area in (C). (S) stroma, (En) endothelium Bars = 40 μm.

Corneal Thickness Alterations in Collagen XII and XIV Deficient Mice

As an indication of corneal endothelial dysfunction, corneal thickness was analyzed in wild type and mutant genotypes at P30 using OCT (Fig. 33). Wild type mice had a mean corneal thickness of 101.3 ± 3.8 μm. In contrast, all 3 mutant genotype had significantly thicker

-/- corneas compared to wild type mice. The mean thicknesses were: Col12a1 132.1 ± 9.2 μm;

Col14a1-/- 119.8 ± 9.1 μm; and compound Col12a1-/-/Col14a1-/-, 124.4 ± 11.3 μm. The ANOVA test at P30 reported a p-value<0.001 among all four genotypes. This signified that the means of

71 all four genotypes were not equal (Fig. 33C). The following t-test done on the three null- genotypes (Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/-) against the control WT corneal thickness reported that all null-genotypes were significantly thicker than the control with a p- value<0.001. An ANOVA test done at P60 reported a p-value<0.001 among all four genotypes.

The consequent t-test of the P60 null-genotypes against the control confirmed that only

Col12a1-/-and Col14a1-/- P60 corneas were thicker than the control with a p-value<0.0001. The

-/- -/- compound Col12a1 /Col14a1 had a p-value=0.0018, supporting the null hypothesis at

α=0.001.These findings suggest delayed stromal compaction in the collagen XII and XIV deficient mice (Table 3).

Table 3. Differences in Corneal Thickness in P30 WT, Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/-. Source SS df MS F p Regression 3084.360 3 1028.120 13.84 0.000 Error 1547.900 20 77.395 Total 4632.260 23 Table 3. The above table contains the ANOVA results against P30 corneal thickness in WT, Col12a1-/-, Col14a1-/-, and Col12a1-/-/Col14a1-/-. The p-value of 0.000 was less than 0.05 so the resulting slope was significantly different from zero. The F statistical value of 13.284 shows that the slope is far from zero, because F > 4.

Corneal Endothelial - Stromal Interaction

The data indicate that in the absence of collagens XII and XIV endothelial maturation is abnormal. Corneal sections were evaluated after phalloidin staining and DAPI counterstaining.

Phalloidin staining demonstrated endothelial processes penetrating the DM allowing communication between endothelial cells and the underlying stroma along the entire P4 corneal endothelium (Fig. 34A). Transmission electron microscopy also demonstrated the presence of cytoplasmic processes crossing DM (Fig. 34B). An analysis of the DM using scanning electron microscopy demonstrated the presence of pores through the DM allowing passage of endothelial processes and communication between the endothelium and posterior stroma

(Fig.34C,D). Similar endothelial-stromal interactions have been described in the rabbit and avian corneas (Cintron et al. 1988; Fitch et al. 1990).

Figure 32. Delayed Endothelial Junction Maturation in Col14a1-/- Mice. ZO-1 (red) expression in the corneal endothelium of the Col14a1-/- mouse. (A) ZO-1 is expressed in the apical and lateral corneal endothelial membrane at P14. (B,C) The expression of ZO-1 does not localize exclusively to the lateral membrane in the endothelia of mature (P30) mice instead retaining the less mature localization. The yellow box in (B) outlines the area in (C). (S) stroma, (En) endothelium Bars = 40 μm.

Figure 33. Increased Corneal Thickness in Collagen XII and/or XIV Deficient Mice. (A) Five different measurements of central corneal thickness were taken. Each measurement is denoted by a green or blue line. (B) Example of a measured area: 1. cornea, 2. anterior chamber, 3. lens. The measured corneal thickness was taken from the apical end of the cornea to the posterior corneal border. (C) Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/- corneas were all significantly thicker than the WT cornea at a p-value< 0.01.

Figure 34. Corneal Endothelial - Stromal Interactions. (A) The presence of endothelial processes extending through Descemet‟s membrane was observed using anti-phalloidin staining (arrows) in the central cornea. (B) Transmission electron micrograph showing endothelial processes extending through DM (arrows). (C) Scanning electron micrograph, after stripping the endothelium, the Descemet‟s membrane is exposed within area denoted by the dotted white line. (D) Scanning electron micrograph showing an enface (endothelial surface) view of DM. Pore-like structures are the exposed penetrating Descemet‟s membrane. The presence of pores in the Decemet‟s membrane would allow communication between the stroma and the corneal endothelium. Wild type P4 mice, (S) stroma, (DM) Descmet‟s membrane, (En) endothelium Bars = 15 μm (A), 0. 2 μm (B), 5 μm (C) and 1 μm (D).

DISCUSSION

The influence of FACIT collagens XII and XIV on corneal endothelium and adjacent matrix maturation and function is unknown and has not been previously investigated. In the current study, we demonstrate that in the absence of collagen XII and/or XIV normal corneal endothelial maturation is delayed. In addition, the normal corneal thinning that is essential for corneal clarity is altered. These data support the hypothesis that collagens XII and XIV influence corneal endothelial maturation and development of normal corneal function.

The molecular regulator(s) or factor(s) that dictate stromal thinning in the first days of life are unknown. Plausible mechanisms include at least one of the following two factors, or a combination of both: 1- deturgescense of the stroma by an activated and functional mature endothelium; and/or 2- subsequent compaction of collagen fibrils. Early corneal thinning in mammals has been previously studied in rabbits and was attributed to activation of the endothelial pump function that seems to correlate with the time of eyelid opening (Joyce et al.

1998; Zieske 2004). Our current work shows characteristic morphological and functional changes in the mouse corneal endothelium and adjacent matrix during maturation from P4 to

P30 including thickening of DM and changes in the endothelial monolayer. A striking finding in the P4 mouse corneal endothelium is the presence of intracellular and sub-basal vesicles in the immature mouse endothelium that are not present in the mature P30 cornea. These changes, suggestive of corneal endothelium and adjacent matrix immaturity, are similar to those described in the rabbit (Stiemke et al. 1991; Edelhauser 2006).

To begin to evaluate endothelial structural integrity and corneal endothelial dysfunction, we used immuno-localization of ZO-1, a membrane protein associated with tight junctions

(zonula occludens) in epithelial cells. The role of the endothelial tight junctions is of paramount importance in the maintenance of corneal transparency (Edelhauser 2006). If the junctions are perturbed, stromal hydration increases causing loss of stromal proteoglycans, disarray of the collagen fibrils, and loss of transparency. Confocal microscopy of rat corneas on P1 and 10 demonstrated positive staining for ZO-1 on the apical and lateral aspects of the cells. By P21 and in the endothelium of adult rats, staining was restricted to the lateral aspect of the plasma membrane (Joyce et al. 1998). Similarly, we noted a diffuse pattern of ZO-1 staining in the P14 mice that became more organized and localized to the basolateral endothelial membrane in the

P30 mouse. We believe that the basolateral membrane localization of ZO-1 together with the

76 morphological changes noted in the endothelium at P30 are all synchronized and suggestive of a mature functional endothelium that is able to maintain corneal deturgescense.

To begin to define the influence of collagens XII and XIV on the function of the corneal endothelium, the corneal thickness was measured for all four genotypes. A normal P30 mouse cornea has reached its maturity and has a fully functional endothelium that works as an active pump that maintains corneal thickness. At P30, all null mice were significantly thicker than the control mice, signifying a delay of endothelial maturation and disruption of endothelial structure.

To determine if this thicker phenotype was from a delay of maturation, corneal thickness was

-/- -/- measured again at P60 (data not shown). The Col12a1 and Col14a1 P60 corneas maintained

-/- -/- a significantly thicker cornea than the control. The Col12a1 /Col14a1 was still thicker than the control thickness at P60, but failed the test for significance at α=0.001. The compound knockout cornea could be thicker because of structural weaknesses brought upon by the absence of both collagens XII and XIV. A synergistic interaction between collagen XII and XIV also is suggested by the more striking morphological endothelial changes noted in the compound Col12a1-/-

-/- /Col14a1 mice compared to the single mutants. We conclude that collagens XII and XIV influence the function of the corneal endothelium. In their absence the cornea is abnormally thicker. However, we cannot exclude the lack of structural interactions within the stroma as contributing to the increased thickness.

-/- -/- -/- -/- We have demonstrated that Col12a1 , Col14a1 and compound Col12a1 /Col14a1 mice had an immature endothelial phenotype at P30. The higher proportion of corneas with intercellular vacuoles and diffuse, interrupted Z0-1 staining, compared to WT and comparable to immature P14 wild type endothelium, suggested that the corneal endothelium was immature in these mice. Although the exact mechanism how FACIT collagens influence endothelial maturation is unknown, similar findings in the mouse corneal endothelium were recently noted in

77 mutant mice at age 8 - 22 weeks old that either under expressed or over expressed PAX6 (Mort et al. 2011). In osteoblasts, collagen XII is involved in the regulation of differentiation and maturation, alignment, gap junction formation, and polarization. The deletion of collagen XII results in abnormal osteoblast differentiation and function, decreased bone matrix deposition, and decreased bone quality. A similar effect can be suggested in the developing corneal endothelial cells (Izu et al. 2011).

A potential mechanism whereby collagens XII and XIV may influence endothelial development and function is the presence of connections between the endothelium and stroma.

These endothelial projections penetrate the DM. The existence of such trans-layer processes supports the hypothesis that the endothelium takes maturation cues from the developing stroma. The current understanding of the endothelial - Descemet‟s membrane - posterior stroma interaction is poor. The traditional view is that neural crest derived endothelial cells are essential for corneal transparency (Edelhauser 2006). Adult endothelial cells are described as quiescent cells without in vivo replicative capabilities, in most species, that are isolated from the surrounding environment by DM (Joyce et al. 1998; Joyce 2012). However, previously scientists have suggested that corneal endothelial cells interact directly with the underlying stroma.

Cintron et al. reported the presence of direct stroma – endothelial cell connections and the presence of pores in DM suggestive of direct endothelial –stromal cell interaction in the developing rabbit cornea (Cintron et al. 1988). Similarly, Fitch et al. showed the presence of collagen IV- rich matrix penetrating DM and connecting endothelial cells to the stroma at regular intervals in the chicken (Fitch et al. 1990). Although the implications of such findings are unknown, the presence of direct endothelial – stromal contact contradicts the dogma that endothelial cells are isolated from the stroma by DM.

The statistically significant difference noted in corneal thickness between WT mice and the collagen XII and XIV deficient mice at P30 supports an immature endothelium in the deficient genotypes. Furthermore, mutant corneas become more compact at P60 although corneas were not as thin as the WT phenotype suggesting a slow maturation of the endothelium. It could be hypothesized that poor endothelial function or maturation are responsible for increased hydration of these corneas although no corneal edema was evident in these eyes and no quantification of corneal hydration was performed. Collagens XII and XIV in the cornea have been implicated in the assembly of collagen fibrils and organization of fibrillar matrices and influences in this context require evaluation. Other extracellular matrix deficient mice models have shown stromal thinning. Lumican deficient corneas also showed stromal thinning after eyelid opening, suggesting that endothelial development and function may be normal in these mice. However, stromal compaction in the lumican deficient mouse led to increased light scattering and corneal opacification (Song et al. 2003).

In conclusion, this study revealed that in the absence of collagens XII and XIV, the maturation of the corneal endothelium is delayed and corneal compaction is abnormal. These

FACIT collagens are critical for the development of normal corneal properties including hydration and thickness and therefore transparency. The data support the hypothesis that collagens XII and XIV are involved in the regulation of endothelial maturation and corneal function. However, the mechanism(s) whereby collagens XII and XIV affect the corneal endothelium is unknown. The mechanism could be a direct interaction; involve macromolecular complexes; and/or sequestration of factors. The elucidation of specific mechanisms requires continued study.

CHAPTER 5: CONCLUSIONS

The purpose of this thesis was to determine the role of FACIT collagens XII and XIV in corneal development and ECM maintenance. Collagens XII and XIV are similar FACIT collagens in sequence and structure. They are both associated with collagen I and expressed in different tissues during chick and murine development suggesting different functions during development (Walchli et al. 1994). Whereas collagen XII is constantly expressed in the avian cornea, collagen XIV has a more dynamic expression pattern after embryonic day 17 (Young et al. 2002).

Our results showed that both collagens XII and XIV were expressed in the corneal stroma during early postnatal development and that collagen XIV protein expression levels were fairly depleted after maturation. Collagen XII protein expression was constant throughout development and maturation. This indicated that collagens XII and XIV most likely played different roles in corneal development. Knock-out mouse models were used to discern the role of FACIT collagens XII and XIV in corneal development, stromal ECM development, and ECM maintenance. We were able to determine that not only did FACIT collagens mediate matrix interactions, but influenced cell maturation as well.

Multiple studies involving the transmittance of light through lattices have determined that the space between fibrils must be less than the wavelength of light in order for transparency to occur (Maurice 1957; Feuk 1970). Results from the radial distribution function demonstrate that in the absence of collagen XII there was a decrease in inter-fibrillar space. In the absence of

80 collagen XIV there was an increase of space, and the results from the radial distribution function concluded that the packing was irregular. It was suggested from this data that collagen XII may act as a physical bridge between adjacent fibrils creating space between fibrils. This model of collagen XII facilitating in creating a space around the fibrils is similar to the model that fibrils have an inner core consisting of fibrillar collagens and an outer core consisting

Figure 35. Model of FACIT on Fibril Surface. The black circle represents a cross section of a fibril. Collagen XII is drawn as outward projecting red lines.

of proteoglycans that retain water and hydrate the collagen fibril (Fig. 35) (Fratzl and Daxer

1993). The long form of collagen XII could serve as a surface proteoglycan assisting in maintaining sufficient space and hydration between fibrils to promote transparency. Collagen

XIV on the other hand may act as another type of molecular bridge that connects adjacent fibrils closer together in a regular fashion. These two sets of data have shed light on the roles of

FACITs on fibrillar surface interactions that regulate corneal function.

Previous studies have also shown that collagens XII and XIV have aided in the adherence of epithelia and basement membranes, embryological basement membrane development, and stabilized interfacial matrices (Marchant et al. 2002; Thierry et al. 2004;

Bader et al. 2013). Lamellae near the apical and basal ends of the stroma are more interwoven than lamellae in the central stroma (Morishige et al. 2006). This signifies that there is a

81 difference in matrix components in certain areas of the stromal matrix, and the difference affects the level of adherence between adjacent lamellae. In the absence of collagen XIV in the P30 cornea, there were disruptions within the strips of lamellae. The disruptions consist of areas of loosely packed fibrils resembling “stromal lakes seen in human corneas with Fuch‟s dystrophy

(Meek et al. 2003). In the absence of collagen XII, bulges were also found in lamellar strips, but the bulges consisted of packed fibrils. There was also less distinction between adjacent orthogonal layers in the Col12a1-/- corneas. In terms of mechanism behind formation of orthogonal layers, collagen XIV regulates tight fibril packing and collagen XII regulates the integration of adjacent lamellae.

The endothelial monolayer on the basal side of the cornea is essential for function and structure of the cornea. As the endothelium matures, the formation of tight junctions prevents excess aqueous humor from entering the corneal stroma. During the study discussed in chapter

4, it was found that there were processes extending from the endothelium through Descemet‟s membrane. In the absence of collagens XII and XIV there was a delay in endothelial maturation.

It was shown in a number of phenotypes, including presence of an immature endothelium, irregular spatial ZO-1 expression, and abnormal increase in corneal thickness in the null corneas. This suggested that collagens XII and XIV interact not only will adjacent ECM, but influence adjacent cellular layers. Essentially the data showed that collagens XII and XIV were essential for proper maturation of the endothelium, including loss of clefts between the DM and endothelium, formation of gap junctions, and maintaining a dehydrated cornea.

Current models of the corneal stroma show a highly connected network of keratocytes.

There is evidence that each layer communicates trans-lamellae with cell networks above and below with 30µm cellular protrusions (Young et al. 2014). There were irregularities in cell shape and changes in physical cell-cell connections in the absence of collagen XII. Abnormal cell

82 shape could affect many aspects of cell function including formation of gap junctions and cell communication. This suggests a significant role of collagen XII in regulating both cell organization and matrix organization. The disruption in cell network may be the cause of lamellar disruption seen in the Col12a1-/- .

Previous literature has alluded to collagen XIV having an earlier developmental role in matrix development while collagen XII is localized to basement membrane zones and interfacial matrices after development (Young et al. 2002). Our corneal thickness data at P60 supports the idea that collagen XII has larger role in maintaining stromal structure than closely related collagen XIV. When comparing all three mutant genotypes, collagen XII alone has the largest influence in corneal thickness in the mature cornea possibly acting as critical component in the maintenance of corneal stroma structure (Fig. 36).

P60 Corneal Thickness 150

140

130 m) μ 120

110

Thickness( 100

80 WT Col12a1-/- Col12a1-/- , Col14a1-/- Col14a1-/-

Figure 36. Differences in Corneal Thickness in P30 WT, Col12a1-/-, Col14a1-/- and Col12a1-/-/Col14a1-/-

In conclusion, our studies have shown that while collagens XII and XIV influence both cell and matrix components of the cornea they each have different and important roles.

Collagen XIV regulates fibril assembly and fibril packing, and may have a larger role in

83 regulating corneal endothelial maturation. Collagen XII has a larger role in inter-lamellar interactions and formation, while also influencing endothelial maturation and keratocyte interaction with the surrounding ECM.

Future Directions

Interestingly, we have found that collagens XII and XIV influence endothelial development although they are not localized to the corneal endothelium. Studying the effect of

FACITS on formation of cell processes would be essential for finding the exact mechanism of

FACITs on cell maturation.

Collagen XII has been found in other tissues where high mechanical stress is placed, and expression is up-regulated through force displacement and wounding. This can be done by collagen XII acting as a physical molecular bridge between collagen fibrils or through interactions between cellular growth factors and other proteoglycans. The results in chapter 3 suggested an important role in fibril surface interactions. Other proteoglycans and TGF-β are known to interact with collagen XII (Font et al. 1996; Runager et al. 2013). TGF-β is known to effect cell motility in culture. There is a possibility that the interaction between collagen XII and growth factors could influence cell network growth and organization. Understanding how collagen XII affects cell mobility and activity during wounding would further the knowledge of how collagen XII regulates matrix organization during stromal development.

Previous studies have made strong arguments suggesting that collagen XII acts as an important biomolecular bridge between interfacial matrices and muscular connective tissues.

(Wessel et al. 1997; Zou et al. 2014). Collagen XII mutations in patients create joint hyperlaxity and muscle weakness. This shows the importance of non-fibrillar collagens in complex tissue systems with different types of biological tissue. These studies have established the basis for

84 elucidating the mechanism of collagens XII and XIV in in biological systems. Studies involving the influence of collagen XII and XIV on adherence and stability between matrices are needed.

This dissertation has provided ample evidence for the importance of FACITs in matrix and cell organization and development. The results serve as a basis for future mechanistic studies of FACIT collagens in development of matrix and cell maturation and organization.

REFERENCES

Alomar, T. A. Mouhamed, T. Gray, J. Lowe and H. S. Dua. (2011). “Histological and confocal microscopy changes in chronic corneal edema: implications for endothelial transplantation”. Invest Ophthalmol Vis Sci 52(11): 8193-8207. Anderson, S., S. SundarRaj, D. Fite, H. Wessel and N. SundarRaj (2000). "Developmentally regulated appearance of spliced variants of type XII collagen in the cornea." Invest Ophthalmol Vis Sci 41(1): 55-63. Anshu, A., M. O. Price, D. T. Tan and F. W. Price, Jr. (2012). "Endothelial keratoplasty: a revolution in evolution." Surv Ophthalmol 57(3): 236-252. Ansorge, H. L., X. Meng, G. Zhang, G. Veit, M. Sun, J. F. Klement, D. P. Beason, L. J. Soslowsky, M. Koch and D. E. Birk (2009). "Type XIV Collagen Regulates Fibrillogenesis: Premature Collagen Fibril Growth and Tissue Dysfunction in Null Mice." J Biol Chem 284(13): 8427-8438. Arai, K., Y. Kasashima, A. Kobayashi, A. Kuwano and T. Yoshihara (2002). "TGF-beta alters collagen XII and XIV mRNA levels in cultured equine tenocytes." Matrix Biol 21(3): 243- 250. Arai, K., Y. Nagashima, T. Takemoto and T. Nishiyama (2008). "Mechanical strain increases expression of type XII collagen in murine osteoblastic MC3T3-E1 cells." Cell Struct Funct 33(2): 203-210. Aubert-Foucher, E., B. Font, D. Eichenberger, D. Goldschmidt, C. Lethias and M. van der Rest (1992). "Purification and characterization of native type XIV collagen." J Biol Chem 267(22): 15759-15764. Bader, H. L., E. Lambert, A. Guiraud, M. Malbouyres, W. Driever, M. Koch and F. Ruggiero (2013). "Zebrafish Collagen XIV Is Transiently Expressed in Epithelia and Is Required for Proper Function of Certain Basement Membranes." J Biol Chem 288(10): 6777-6787. Bailey, F. R. (1921). Textbook of Embryology. New York, William Wood and Co. Bastien D. Gomperts, I. M. K., Peter E.R. Tatham (2009). Signal Transduction. London, United Kingdom, Academic Press. Benedek, G. B. (1971). "Theory of transparency of the eye." Appl Opt 10(3): 459-473. Berthod, F., L. Germain, R. Guignard, C. Lethias, R. Garrone, O. Damour, M. van der Rest and F. A. Auger (1997). "Differential expression of collagens XII and XIV in human skin and in reconstructed skin." J Invest Dermatol 108(5): 737-742. Birk, D. E., and Bruckner, P. (2005). Topics in Current Chemistry: Collagen. Berlin, Springer- Verlag. Birk, D. E. and P. Bruckner (2011). Collagens, Suprastructures, and Collagen Fibril Assembly. Berlin, Germany, Springer Berlin Heidelberg. Birk, D. E., M. V. Nurminskaya and E. I. Zycband (1995). "Collagen fibrillogenesis in situ: fibril segments undergo post-depositional modifications resulting in linear and lateral growth during matrix development." Dev Dyn 202(3): 229-243. Birk, D. E. and R. L. Trelstad (1984). "Extracellular compartments in matrix morphogenesis: collagen fibril, bundle, and lamellar formation by corneal fibroblasts." J Cell Biol 99(6): 2024-2033.

Blaus B. (2013). "Eye Anatomy". Wikimedia Commons, from http://commons.wikimedia.org/wiki/ File:Blausen_0389_EyeAnatomy_02.png Bonanno, J. A. (2012). "Molecular mechanisms underlying the corneal endothelial pump." Exp Eye Res 95(1): 2-7. Bonanno, J. A., Y. Guan, S. Jelamskii and X. J. Kang (1999). "Apical and basolateral CO2- HCO3- permeability in cultured bovine corneal endothelial cells." Am J Physiol 277(3 Pt 1): C545-553. Brown, J. C., K. Mann, H. Wiedemann and R. Timpl (1993). "Structure and binding properties of collagen type XIV isolated from human placenta." J Cell Biol 120(2): 557-567. Cai, C. X., D. E. Birk and T. F. Linsenmayer (1998). "Nuclear ferritin protects DNA from UV damage in corneal epithelial cells." Mol Biol Cell 9(5): 1037-1051. Calvo, C. M., S. Sikder, N. Mamalis and M. D. Mifflin (2012). "Linear interstitial keratitis: a distinct clinical entity revisited." Cornea 31(12): 1500-1503. Castagnola, P., S. Tavella, D. R. Gerecke, B. Dublet, M. K. Gordon, J. Seyer, R. Cancedda, M. van der Rest and B. R. Olsen (1992). "Tissue-specific expression of type XIV collagen--a member of the FACIT class of collagens." Eur J Cell Biol 59(2): 340-347. Chakravarti, S., W. M. Petroll, J. R. Hassell, J. V. Jester, J. H. Lass, J. Paul and D. E. Birk (2000). "Corneal opacity in lumican-null mice: defects in collagen fibril structure and packing in the posterior stroma." Invest Ophthalmol Vis Sci 41(11): 3365-3373. Chan, E. and G. R. Snibson (2013). "Current status of corneal collagen cross-linking for keratoconus: a review." Clin Exp Optom 96(2): 155-164. Chen, S. and D. E. Birk (2013). "The regulatory roles of small leucine-rich proteoglycans in extracellular matrix assembly." FEBS J 280(10): 2120-2137. Chiquet, M. (1999). "Regulation of extracellular matrix gene expression by mechanical stress." Matrix Biol 18(5): 417-426. Chiquet, M., M. Matthisson, M. Koch, M. Tannheimer and R. Chiquet-Ehrismann (1996). "Regulation of extracellular matrix synthesis by mechanical stress." Biochem Cell Biol 74(6): 737-744. Cintron, C., H. I. Covington and C. L. Kublin (1988). "Morphogenesis of rabbit corneal endothelium." Curr Eye Res 7(9): 913-929. Crawford, K. M., S. A. Ernst, R. F. Meyer and D. K. MacCallum (1995). "NaK-ATPase pump sites in cultured bovine corneal endothelium of varying cell density at confluence." Invest Ophthalmol Vis Sci 36(7): 1317-1326. Doughty, M. J., W. Seabert, J. P. Bergmanson and Y. Blocker (2001). "A descriptive and quantitative study of the keratocytes of the corneal stroma of albino rabbits using transmission electron microscopy." Tissue Cell 33(4): 408-422. Dublet, B. and M. van der Rest (1991). "Type XIV collagen, a new homotrimeric molecule extracted from fetal bovine skin and tendon, with a triple helical disulfide-bonded domain homologous to type IX and type XII collagens." J Biol Chem 266(11): 6853-6858. Edelhauser, H. F. (2006). "The balance between corneal transparency and edema: the Proctor Lecture." Invest Ophthalmol Vis Sci 47(5): 1754-1767. Feuk, T. (1970). "On the transparency of the stroma in the mammalian cornea." IEEE Trans Biomed Eng 17(3): 186-190. Fischbarg, J. (1997). "Mechanism of fluid transport across corneal endothelium and other epithelial layers: a possible explanation based on cyclic cell volume regulatory changes." Br J Ophthalmol 81(1): 85-89. Fischbarg, J. (2003). "On the mechanism of fluid transport across corneal endothelium and epithelia in general." J Exp Zool A Comp Exp Biol 300(1): 30-40. Fischbarg, J. and J. J. Lim (1974). "Role of cations, anions and carbonic anhydrase in fluid transport across rabbit corneal endothelium." J Physiol 241(3): 647-675.

Fitch, J. M., D. E. Birk, C. Linsenmayer and T. F. Linsenmayer (1990). "The spatial organization of Descemet's membrane-associated type IV collagen in the avian cornea." J Cell Biol 110(4): 1457-1468. Fluck, M., M. N. Giraud, V. Tunc and M. Chiquet (2003). "Tensile stress-dependent collagen XII and fibronectin production by fibroblasts requires separate pathways." Biochim Biophys Acta 1593(2-3): 239-248. Font, B., D. Eichenberger, L. M. Rosenberg and M. van der Rest (1996). "Characterization of the interactions of type XII collagen with two small proteoglycans from fetal bovine tendon, decorin and fibromodulin." Matrix Biol 15(5): 341-348. Fratzl, P. and A. Daxer (1993). "Structural transformation of collagen fibrils in corneal stroma during drying. An x-ray scattering study." Biophys J 64(4): 1210-1214. Gerecke, D. R., X. Meng, B. Liu and D. E. Birk (2004). "Complete primary structure and genomic organization of the mouse Col14a1 gene." Matrix Biol 22(7): 595-601. Gerecke, D. R., P. F. Olson, M. Koch, J. H. Knoll, R. Taylor, D. L. Hudson, M. F. Champliaud, B. R. Olsen and R. E. Burgeson (1997). "Complete primary structure of two splice variants of collagen XII, and assignment of alpha 1(XII) collagen (COL12A1), alpha 1(IX) collagen (COL9A1), and alpha 1(XIX) collagen (COL19A1) to human chromosome 6q12- q13." Genomics 41(2): 236-242. Giasson, C. and J. A. Bonanno (1994). "Facilitated transport of lactate by rabbit corneal endothelium." Exp Eye Res 59(1): 73-81. Gordon, M. K., J. W. Foley, T. F. Lisenmayer and J. M. Fitch (1996). "Temporal expression of types XII and XIV collagen mRNA and protein during avian corneal development." Dev Dyn 206(1): 49-58. Gordon, M. K., D. R. Gerecke, B. Dublet, M. van der Rest, S. P. Sugrue and B. R. Olsen (1990). "The structure of type XII collagen." Ann N Y Acad Sci 580: 8-16. Gordon, M. K., D. R. Gerecke and B. R. Olsen (1987). "Type XII collagen: distinct extracellular matrix component discovered by cDNA cloning." Proc Natl Acad Sci U S A 84(17): 6040- 6044. Gordon, M. K. and R. A. Hahn (2010). "Collagens." Cell Tissue Res 339(1): 247-257. Gregory, K. E., D. R. Keene, S. F. Tufa, G. P. Lunstrum and N. P. Morris (2001). "Developmental distribution of collagen type XII in cartilage: association with articular cartilage and the growth plate." J Bone Miner Res 16(11): 2005-2016. Hanlon, S. D., N. B. Patel and A. R. Burns (2011). "Assessment of postnatal corneal development in the C57BL/6 mouse using spectral domain optical coherence tomography and microwave-assisted histology." Exp Eye Res 93(4): 363-370. Hart, R. W. and R. A. Farrell (1969). "Light scattering in the cornea." J Opt Soc Am 59(6): 766- 774. Hassell, J. R. and D. E. Birk (2010). "The molecular basis of corneal transparency." Exp Eye Res 91(3): 326-335. Hay, E. (1980). "Development of the Vertebrate Cornea." Internation review of Cytology 63: 263-322. Hay, E. D., Ed. (1991). Cell Biology of the Extracellular Matrix. New York, Springer-Verlag. Hemmavanh, C., M. Koch, D. E. Birk and E. M. Espana (2013). "Abnormal Corneal Endothelial Maturation in Collagen XII and XIV Null Mice." Invest Ophthalmol Vis Sci 54(5): 3297- 3308. Hogan, M. J., J. A. Alvarado and J. E. Weddel (1971). Histology of the Human Eye. Philadelphia, PA, W.B. Saunders Company. Hopfer, U., N. Fukai, H. Hopfer, G. Wolf, N. Joyce, E. Li and B. R. Olsen (2005). "Targeted disruption of Col8a1 and Col8a2 genes in mice leads to anterior segment abnormalities in the eye." FASEB J 19(10): 1232-1244.

Izu, Y., H. L. Ansorge, G. Zhang, L. J. Soslowsky, P. Bonaldo, M. L. Chu and D. E. Birk (2011). "Dysfunctional tendon collagen fibrillogenesis in collagen VI null mice." Matrix Biol 30(1): 53-61. Izu, Y., M. Sun, D. Zwolanek, G. Veit, V. Williams, B. Cha, K. J. Jepsen, M. Koch and D. E. Birk (2011). "Type XII collagen regulates osteoblast polarity and communication during bone formation." J Cell Biol 193(6): 1115-1130. Jester, J. V., P. A. Barry, G. J. Lind, W. M. Petroll, R. Garana and H. D. Cavanagh (1994). "Corneal keratocytes: in situ and in vitro organization of cytoskeletal contractile proteins." Invest Ophthalmol Vis Sci 35(2): 730-743. Jonuscheit, S., M. J. Doughty and K. Ramaesh (2011). "In vivo confocal microscopy of the corneal endothelium: comparison of three morphometry methods after corneal transplantation." Eye (Lond) 25(9): 1130-1137. Joyce, N. C. (2003). "Proliferative capacity of the corneal endothelium." Prog Retin Eye Res 22(3): 359-389. Joyce, N. C. (2012). "Proliferative capacity of corneal endothelial cells." Exp Eye Res 95(1): 16- 23. Joyce, N. C., D. L. Harris and J. D. Zieske (1998). "Mitotic inhibition of corneal endothelium in neonatal rats." Invest Ophthalmol Vis Sci 39(13): 2572-2583. Jun, A. S., S. Chakravarti, H. F. Edelhauser and M. Kimos (2006). "Aging changes of mouse corneal endothelium and Descemet's membrane." Exp Eye Res 83(4): 890-896. Kabosova, A., D. T. Azar, G. A. Bannikov, K. P. Campbell, M. Durbeej, R. F. Ghohestani, J. C. Jones, M. C. Kenney, M. Koch, Y. Ninomiya, B. L. Patton, M. Paulsson, Y. Sado, E. H. Sage, T. Sasaki, L. M. Sorokin, M. F. Steiner-Champliaud, T. T. Sun, N. Sundarraj, R. Timpl, I. Virtanen and A. V. Ljubimov (2007). "Compositional differences between infant and adult human corneal basement membranes." Invest Ophthalmol Vis Sci 48(11): 4989-4999. Karagiannis, G. S., C. Petraki, I. Prassas, P. Saraon, N. Musrap, A. Dimitromanolakis and E. P. Diamandis (2012). "Proteomic signatures of the desmoplastic invasion front reveal collagen type XII as a marker of myofibroblastic differentiation during colorectal cancer metastasis." Oncotarget 3(3): 267-285. Keene, D. R., G. P. Lunstrum, N. P. Morris, D. W. Stoddard and R. E. Burgeson (1991). "Two type XII-like collagens localize to the surface of banded collagen fibrils." J Cell Biol 113(4): 971-978. Koch, M., B. Bohrmann, M. Matthison, C. Hagios, B. Trueb and M. Chiquet (1995). "Large and small splice variants of collagen XII: differential expression and ligand binding." J Cell Biol 130(4): 1005-1014. Koenig, S. B., D. J. Covert, W. J. Dupps, Jr. and D. M. Meisler (2007). "Visual acuity, refractive error, and endothelial cell density six months after Descemet stripping and automated endothelial keratoplasty (DSAEK)." Cornea 26(6): 670-674. Kulkarni, S. V., T. AlMahmoud, D. Priest, S. E. Taylor, G. Mintsioulis and W. B. Jackson (2013). "Long-term visual and refractive outcomes following surface ablation techniques in a large population for myopia correction." Invest Ophthalmol Vis Sci 54(1): 609-619. Lethias, C., Y. Descollonges, R. Garrone and M. van der Rest (1993). "Expression of type XIV collagen during the differentiation of fetal bovine skin: immunolabeling with monoclonal antibody is prominent in morphogenetic areas." J Invest Dermatol 101(1): 92-99. Linsenmayer, T. F., J. M. Fitch, M. K. Gordon, C. X. Cai, F. Igoe, J. K. Marchant and D. E. Birk (1998). "Development and roles of collagenous matrices in the embryonic avian cornea." Prog Retin Eye Res 17(2): 231-265. Ljubimov, A. V., R. E. Burgeson, R. J. Butkowski, J. R. Couchman, R. R. Wu, Y. Ninomiya, Y. Sado, E. Maguen, A. B. Nesburn and M. C. Kenney (1996). "Extracellular matrix

alterations in human corneas with bullous keratopathy." Invest Ophthalmol Vis Sci 37(6): 997-1007. Lunstrum, G. P., N. P. Morris, A. M. McDonough, D. R. Keene and R. E. Burgeson (1991). "Identification and partial characterization of two type XII-like collagen molecules." J Cell Biol 113(4): 963-969. Madara, J. L., R. Moore and S. Carlson (1987). "Alteration of intestinal tight junction structure and permeability by cytoskeletal contraction." Am J Physiol 253(6 Pt 1): C854-861. Madara, J. L. and J. R. Pappenheimer (1987). "Structural basis for physiological regulation of paracellular pathways in intestinal epithelia." J Membr Biol 100(2): 149-164. Maguen, E., Y. S. Rabinowitz, L. Regev, M. Saghizadeh, T. Sasaki and A. V. Ljubimov (2008). "Alterations of extracellular matrix components and proteinases in human corneal buttons with INTACS for post-laser in situ keratomileusis keratectasia and keratoconus." Cornea 27(5): 565-573. Marchant, J. K., G. Zhang and D. E. Birk (2002). "Association of type XII collagen with regions of increased stability and keratocyte density in the cornea." Exp Eye Res 75(6): 683-694. Massoudi, D., F. Malecaze, V. Soler, J. Butterworth, A. Erraud, P. Fournie, M. Koch and S. D. Galiacy (2012). "NC1 long and NC3 short splice variants of type XII collagen are overexpressed during corneal scarring." Invest Ophthalmol Vis Sci 53(11): 7246-7256. Maurice, D. M. (1957). "The structure and transparency of the cornea." J Physiol 136(2): 263- 286. Maurice, D. M. (1972). "The location of the fluid pump in the cornea." J Physiol 221(1): 43-54. McCartney, M. D., D. P. Robertson, T. O. Wood and B. J. McLaughlin (1987). "ATPase pump site density in human dysfunctional corneal endothelium." Invest Ophthalmol Vis Sci 28(12): 1955-1962. Meek, K. M., D. W. Leonard, C. J. Connon, S. Dennis and S. Khan (2003). "Transparency, swelling and scarring in the corneal stroma." Eye (Lond) 17(8): 927-936. Meek, K. M., M. Andrew. (2008). "The cornea and sclera". Fratzl, Peter ed. Collagen, Structure and Mechanics. New York, NY. Springer, pp. 359-395. Moller-Pedersen, T. (2004). "Keratocyte reflectivity and corneal haze." Exp Eye Res 78(3): 553- 560. Montserret, R., E. Aubert-Foucher, M. J. McLeish, J. M. Hill, D. Ficheux, M. Jaquinod, M. van der Rest, G. Deleage and F. Penin (1999). "Structural analysis of the heparin-binding site of the NC1 domain of collagen XIV by CD and NMR." Biochemistry 38(20): 6479- 6488. Morishige, N., W. M. Petroll, T. Nishida, M. C. Kenney and J. V. Jester (2006). "Noninvasive corneal stromal collagen imaging using two-photon-generated second-harmonic signals." J Cataract Refract Surg 32(11): 1784-1791. Mort, R. L., A. J. Bentley, F. L. Martin, J. M. Collinson, P. Douvaras, R. E. Hill, S. D. Morley, N. J. Fullwood and J. D. West (2011). "Effects of aberrant Pax6 gene dosage on mouse corneal pathophysiology and corneal epithelial homeostasis." PLoS One 6(12): e28895. Muller, L. J., E. Pels, L. R. Schurmans and G. F. Vrensen (2004). "A new three-dimensional model of the organization of proteoglycans and collagen fibrils in the human corneal stroma." Exp Eye Res 78(3): 493-501. Murphy, C., J. Alvarado, R. Juster and M. Maglio (1984). "Prenatal and postnatal cellularity of the human corneal endothelium. A quantitative histologic study." Invest Ophthalmol Vis Sci 25(3): 312-322. Nishiyama, T., A. M. McDonough, R. R. Bruns and R. E. Burgeson (1994). "Type XII and XIV collagens mediate interactions between banded collagen fibers in vitro and may modulate extracellular matrix deformability." J Biol Chem 269(45): 28193-28199. Oh, S. P., C. M. Griffith, E. D. Hay and B. R. Olsen (1993). "Tissue-specific expression of type XII collagen during mouse embryonic development." Dev Dyn 196(1): 37-46.

Palka, B. P., C. Sotozono, H. Tanioka, T. O. Akama, N. Yagi, C. Boote, R. D. Young, K. M. Meek, S. Kinoshita and A. J. Quantock (2010). "Structural collagen alterations in macular corneal dystrophy occur mainly in the posterior stroma." Curr Eye Res 35(7): 580-586. Potts, A. M. (1962). "Some aspects of the interrelation between corneal hydration and corneal transparency." Invest Ophthalmol 1: 163-169. Price, F. W., Jr. and M. O. Price (2006). "Descemet's stripping with endothelial keratoplasty in 200 eyes: Early challenges and techniques to enhance donor adherence." J Cataract Refract Surg 32(3): 411-418. Ricard-Blum, S. and F. Ruggiero (2005). "The collagen superfamily: from the extracellular matrix to the cell membrane." Pathol Biol (Paris) 53(7): 430-442. Robert, L., J. M. Legeais, A. M. Robert and G. Renard (2001). "Corneal collagens." Pathol Biol (Paris) 49(4): 353-363. Runager, K., G. K. Klintworth, H. Karring and J. J. Enghild (2013). "The Insoluble TGFBIp Fraction of the Cornea Is Covalently Linked via a Disulfide Bond to Type XII Collagen." Biochemistry 52(16): 2821-2827. Shaw, L. M. and B. R. Olsen (1991). "FACIT collagens: diverse molecular bridges in extracellular matrices." Trends Biochem Sci 16(5): 191-194. Song, J., Y. G. Lee, J. Houston, W. M. Petroll, S. Chakravarti, H. D. Cavanagh and J. V. Jester (2003). "Neonatal corneal stromal development in the normal and lumican-deficient mouse." Invest Ophthalmol Vis Sci 44(2): 548-557. Srinivas, S. P. (2010). "Dynamic regulation of barrier integrity of the corneal endothelium." Optom Vis Sci 87(4): E239-254. Srinivas, S. P., J. A. Bonanno, E. Lariviere, D. Jans and W. Van Driessche (2003). "Measurement of rapid changes in cell volume by forward light scattering." Pflugers Arch 447(1): 97-108. Stiemke, M. M., H. F. Edelhauser and D. H. Geroski (1991). "The developing corneal endothelium: correlation of morphology, hydration and Na/K ATPase pump site density." Curr Eye Res 10(2): 145-156. Stiemke, M. M., M. D. McCartney, D. Cantu-Crouch and H. F. Edelhauser (1991). "Maturation of the corneal endothelial tight junction." Invest Ophthalmol Vis Sci 32(10): 2757-2765. Sugrue, S. P. (1991). "Immunolocalization of type XII collagen at the corneoscleral angle of the embryonic avian eye." Invest Ophthalmol Vis Sci 32(6): 1876-1882. Sun, M., S. Chen, S. M. Adams, J. B. Florer, H. Liu, W. W. Kao, R. J. Wenstrup and D. E. Birk (2011). "Collagen V is a dominant regulator of collagen fibrillogenesis: dysfunctional regulation of structure and function in a corneal-stroma-specific Col5a1-null mouse model." J Cell Sci 124(Pt 23): 4096-4105. Tamura, Y., H. Konomi, H. Sawada, S. Takashima and A. Nakajima (1991). "Tissue distribution of type VIII collagen in human adult and fetal eyes." Invest Ophthalmol Vis Sci 32(9): 2636-2644. Tan, D. T., J. K. Dart, E. J. Holland and S. Kinoshita (2012). "Corneal transplantation." Lancet 379(9827): 1749-1761. Tao, G., A. K. Levay, J. D. Peacock, D. J. Huk, S. N. Both, N. H. Purcell, J. R. Pinto, M. L. Galantowicz, M. Koch, P. A. Lucchesi, D. E. Birk and J. Lincoln (2012). "Collagen XIV is important for growth and structural integrity of the myocardium." J Mol Cell Cardiol 53(5): 626-638. Thierry, L., A. S. Geiser, A. Hansen, F. Tesche, R. Herken and N. Miosge (2004). "Collagen types XII and XIV are present in basement membrane zones during human embryonic development." J Mol Histol 35(8-9): 803-810. Turner, J. R. (2000). "'Putting the squeeze' on the tight junction: understanding cytoskeletal regulation." Semin Cell Dev Biol 11(4): 301-308.

Turner, J. R., B. K. Rill, S. L. Carlson, D. Carnes, R. Kerner, R. J. Mrsny and J. L. Madara (1997). "Physiological regulation of epithelial tight junctions is associated with myosin light-chain phosphorylation." Am J Physiol 273(4 Pt 1): C1378-1385. Van der Rest, M., B. Dublet and M. F. Champliaud (1990). "Fibril-associated collagens." Biomaterials 11: 28-31. Van der Rest, M. and R. Garrone (1991). "Collagen family of proteins." FASEB J 5(13): 2814- 2823. Veit, G., U. Hansen, D. R. Keene, P. Bruckner, R. Chiquet-Ehrismann, M. Chiquet and M. Koch (2006). "Collagen XII interacts with avian tenascin-X through its NC3 domain." J Biol Chem 281(37): 27461-27470. Walchli, C., M. Koch, M. Chiquet, B. F. Odermatt and B. Trueb (1994). "Tissue-specific expression of the fibril-associated collagens XII and XIV." J Cell Sci 107 ( Pt 2): 669-681. Walchli, C., J. Trueb, B. Kessler, K. H. Winterhalter and B. Trueb (1993). "Complete primary structure of chicken collagen XIV." Eur J Biochem 212(2): 483-490. Watsky M.A.,M.D. McCartney, B.J. McLaughlin, H.F. Edelhauser. (1990). "Corneal endothelial junctions and the effects of ouabain". Invest Ophthalmol Vix Sci 31(5):933-941. Wenstrup, R. J., S. M. Smith, J. B. Florer, G. Zhang, D. P. Beason, R. E. Seegmiller, L. J. Soslowsky and D. E. Birk (2011). "Regulation of collagen fibril nucleation and initial fibril assembly involves coordinate interactions with collagens V and XI in developing tendon." J Biol Chem 286(23): 20455-20465. Wessel, H., S. Anderson, D. Fite, E. Halvas, J. Hempel and N. SundarRaj (1997). "Type XII collagen contributes to diversities in human corneal and limbal extracellular matrices." Invest Ophthalmol Vis Sci 38(11): 2408-2422. Wollensak G.,E. Spoerl, T.Seiler. (2003). "Riboflavin/ultraviolet-a-induced collagen crosslinking for the treatment of keratoconus". Am J Ophthamol. 135(5):620-7 Yamagata, M., K. M. Yamada, S. S. Yamada, T. Shinomura, H. Tanaka, Y. Nishida, M. Obara and K. Kimata (1991). "The complete primary structure of type XII collagen shows a chimeric molecule with reiterated fibronectin type III motifs, von Willebrand factor A motifs, a domain homologous to a noncollagenous region of type IX collagen, and short collagenous domains with an Arg-Gly-Asp site." J Cell Biol 115(1): 209-221. Yamaguchi, Y., D. M. Mann and E. Ruoslahti (1990). "Negative regulation of transforming growth factor-beta by the proteoglycan decorin." Nature 346(6281): 281-284. Yayon, A., M. Klagsbrun, J. D. Esko, P. Leder and D. M. Ornitz (1991). "Cell surface, heparin- like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor." Cell 64(4): 841-848. Young, B. B., M. K. Gordon and D. E. Birk (2000). "Expression of type XIV collagen in developing chicken tendons: association with assembly and growth of collagen fibrils." Dev Dyn 217(4): 430-439. Young, B. B., G. Zhang, M. Koch and D. E. Birk (2002). "The roles of types XII and XIV collagen in fibrillogenesis and matrix assembly in the developing cornea." J Cell Biochem 87(2): 208-220. Young, R. D., C. Knupp, C. Pinali, K. M. Png, J. R. Ralphs, A. J. Bushby, T. Starborg, K. E. Kadler and A. J. Quantock (2014). "Three-dimensional aspects of matrix assembly by cells in the developing cornea." Proc Natl Acad Sci U S A 111(2): 687-692. Zhan, Q., R. Burrows and C. Cintron (1995). "Localization of type XII collagen in normal and healing rabbit cornea by in situ hybridization." Exp Eye Res 60(5): 551-561. Zhang, G., S. Chen, S. Goldoni, B. W. Calder, H. C. Simpson, R. T. Owens, D. J. McQuillan, M. F. Young, R. V. Iozzo and D. E. Birk (2009). "Genetic evidence for the coordinated regulation of collagen fibrillogenesis in the cornea by decorin and biglycan." J Biol Chem 284(13): 8888-8897.

Zhang, G., B. B. Young and D. E. Birk (2003). "Differential expression of type XII collagen in developing chicken metatarsal tendons." J Anat 202(5): 411-420. Zieske, J. D. (2004). "Corneal development associated with eyelid opening." Int J Dev Biol 48(8- 9): 903-911. Zou, Y., D. Zwolanek, Y. Izu, S. Gandhy, G. Schreiber, K. Brockmann, M. Devoto, Z. Tian, Y. Hu, G. Veit, M. Meier, J. Stetefeld, D. Hicks, V. Straub, N. C. Voermans, D. E. Birk, E. R. Barton, M. Koch and C. G. Bonnemann (2014). "Recessive and dominant mutations in COL12A1 cause a novel EDS/myopathy overlap syndrome in humans and mice." Hum Mol Genet. 23(9):2339-52.

APPENDIX: IACUC AND COPYRIGHT PERMISSIONS

100

101

102

103

104

105

106