Molecular Systematics of Syzygium and Allied Genera (Myrtaceae): Evidence from the Chloroplast Genome Author(S): Ed Biffin, Lyn A

Molecular Systematics of Syzygium and Allied Genera (Myrtaceae): Evidence from the Chloroplast Genome Author(s): Ed Biffin, Lyn A. Craven, Michael D. Crisp and Paul A. Gadek Source: Taxon, Vol. 55, No. 1 (Feb., 2006), pp. 79-94 Published by: International Association for Plant Taxonomy (IAPT) Stable URL: http://www.jstor.org/stable/25065530 Accessed: 07-04-2016 23:56 UTC

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at http://about.jstor.org/terms

JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact [email protected].

International Association for Plant Taxonomy (IAPT) is collaborating with JSTOR to digitize, preserve and extend access to Taxon

This content downloaded from 129.127.100.248 on Thu, 07 Apr 2016 23:56:33 UTC All use subject to http://about.jstor.org/terms TAXON 55 (1) February 2006: 79-94 Biffin & al. Molecular systematics of Syzygium

Molecular systematics o? Syzygium and allied genera (Myrtaceae): evidence from the chloroplast genome

Ed Biffin1'2, Lyn A. Craven1, Michael D. Crisp2 & Paul A. Gadek3

1 Australian National Herbarium, CPBR, CSIRO Plant Industry, GPO Box 1600, Canberra, ACT, 2601, Australia. [email protected] (author for correspondence) 2 Division of Botany and Zoology, Australian National University, Canberra, ACT, 2601, Australia 3 School of Tropical Biology, James Cook University, Cairns, Queensland, 4870, Australia

With as many as 1000 included species, Syzygium s.l. (including Syzygium and segregate genera such as Acmena, Acmenosperma, Cleistocalyx, Piliocalyx, and Waterhoused) comprises one of the major lineages within Myrtaceae, and is an important component of the Old-World tropical rainforest flora. As with other large genera, high species richness, an extensive distribution and relative homogeneity in morphology have hindered attempts to divide Syzygium s.l. Here, we investigate higher level relationships within the group, using parsimony and Bayesian analyses of cpDNA sequences from the matK and ndhF genes and the rpl\6 intron, generated for a total of 87 species from the Syzygium group and eight outgroup taxa. Within the ingroup, four major well supported clades are found, which form a basal polytomy along with S. wesa and monotypic Anetholea. Generally, the molecular data provide little support for traditional divisions of Syzygium s.l., and the recognition of segregate groups such as Acmena, Acmenosperma, Cleistocalyx, Piliocalyx and Waterhousea. While homoplasy amongst morphological characters has misled attempts to divide the group, detailed and critical assessments of placental, ovular and seed morphology may provide novel insights into evolutionary relationships, and are an important future step in the development of a sound higher level taxon omy for Syzygium s.l.

KEYWORDS: Acmena, Acmenosperma, Cleistocalyx, morphology, multigene analysis, Myrtaceae, Piliocalyx, Syzygium, taxonomy, Waterhousea.

consider relationships within the group, in the context of I INTRODUCTION phylogenetic analysies (but see Parnell, 1999; In a family replete with taxonomic difficulties, the Harrington & Gadek, 2004). At present, Syzygium exists taxonomy of the large genus Syzygium Gaertn., and allied as a large, heterogeneous assemblage of species of uncer genera such as Acmena DC, Acmenosperma Kausel, tain affinity, and depending upon the whim of the indi Piliocalyx Brogn. & Gris, and Waterhousea B. Hyland, vidual taxonomist, several satellite genera are variously presents one of the more vexing problems in Myrtaceae recognised. With broad disparities in the regional nomen (Schmid, 1972a). The group includes between 500 (Airy clature, the current situation is unacceptable, hindering Shaw, 1966) and 1000 species (Merrill & Perry, 1939; our understanding of these plants at virtually every level. Mabberley, 1997; Parnell, 2003), predominantly rainfor The Syzygium group has had a long association with est trees, occupying much of the humid Old World trop the predominantly New World myrtaceous genus ics and subtropics. Generally, species are reasonably dis Eugenia L. Bentham & Hooker (1865) including the for tinct from one-another, although in the circumscription mer, along with Jambosa Adans., within Eugenia, pre of higher taxa they are "distressingly alike" (McVaugh, sumably due to the common possession of a fleshy, 1968) and generic concepts have been based upon rela large-seeded fruit. The weight of evidence supports sep tively fine levels of morphological distinction (Craven, arate origins for the Syzygium (including Jambosa) and 2001). In attempting to deal with the enormous diversity Eugenia lineages (Merrill & Perry, 1939; Ingle & Dads in Syzygium s.l., taxonomists have tended to work local well, 1953; Schmid, 1972b; Briggs & Johnson, 1979; ly (e.g., Hyland, 1983; Smith, 1985; Chantaranothai & Johnson & Briggs, 1984; Wilson & al, 2001), a position Parnell, 1994; Dawson, 1999), favouring as higher taxa now accepted by most taxonomists. In accepting Syzy those groups that can be cleanly circumscribed, without gium s.l., there have been logical arguments for the ac view to the whole. There have been few attempts at an ceptance of various segregates from Syzygium, such as overall assessment of Syzygium s.l. (e.g., Airy-Shaw, Acmena, Cleistocalyx Blume, and Piliocalyx, which are 1966; Schmid, 1972b; Briggs & Johnson, 1979) or to similarly, if not more distinct from Syzygium, than is

This content downloaded from 129.127.100.248 on Thu, 07 Apr 2016 23:56:33 UTC All use subject to http://about.jstor.org/terms Biffin & al. Molecular systematics of Syzygium TAXON 55 (1) February 2006: 79-94

Syzygium from Eugenia (e.g. Merrill, 1950; Smith, Molecular phylogenetic data have proved valuable 1985). While this line of argument has been followed in in resolving several taxonomic issues within the most recent treatments of the group, generic circum Myrtaceae, where morphology alone has been insuffi scriptions have proved contentious, and there is little cient (O'Brien & al., 2000; Brown & al., 2001; Wilson & agreement as to which, or how many genera should be al., 2001; Wright & al., 2001; Harrington & Gadek, recognised (Schmid, 1972a; Craven, 2001, for a recent 2004) and may reveal "cryptic clades" that are not read review). For example, Hyland (1983; Australian repre ily diagnosed by morphological data (sensu Wojcie sentatives of Syzygium s.l.) recognises Acmenosperma chowski & al. 1993). In the present study, we present but not Cleistocalyx, Chantaranothai & Parnell (1994; results of the phylogenetic analysis of three chloroplast Thai representatives of Syzygium s.l.) do the opposite, (cpDNA) data sets, including partial sequences from the while Turner (1997) adopts an inclusive concept of rpl\6 intron, and the protein coding genes matK and Syzygium (including Acmena, Acmenosperma, Cleisto ndhF, for the Syzygium group of genera. Specifically, we calyx, Pseudoeugenia Scortechini and Stereocaryum aim to test the robustness of morphologically defined Burrit) for the Malay species, in recognition of the need higher taxa including Briggs and Johnson's (1979) for an overall assessment of the group. Several segregate Acmena and Syzygium informal sub-alliances (Table 1) genera appear to be artificial, including Jambosa (e.g., and several of the generic segregates from Syzygium s.l. Merrill & Perry, 1939, but see Parnell, 1999, 2003), noted above. Taxon sampling is focussed upon Austral Pseudoeugenia (as Aphanomyrtus Miq; Airy-Shaw, ian and South Pacific Syzygium groups, which, although 1949) and Cleistocalyx (Hyland, 1983; Craven, 1998, but relatively species poor in comparison with New Guinea see Merrill & Perry, 1937; Backer & Bakhuizen van den (ca. 200 spp.; Hartley & Perry, 1973; Hartley & Craven, Brink, 1963; Smith, 1985; Chantoranothai & Parnell, 1977), Malaya (ca. 200 spp.; Turner, 1997) and Borneo 1993). Other proposed segregates, such as Piliocalyx, (ca 150 spp.; Merrill & Perry, 1939), represent major Acicalyptus A. Gray and Cupheanthus Seem., while centres of morphological diversity within Syzygium s.l. locally distinctive, have not been tested within the wider (Craven, 2001; Table 1). The molecular data identify context of the group. clades which are inconsistent with conventional higher Conventionally recognised genera and species taxonomic schemes, and we find little support for gener groups have been defined by combinations of morpho ic level morphology, at least as it is presently interpreted. logical characters, including calyx, anther, and seed mor The chloroplast phylogeny provides a reasonable work phology, the position of the placentae, and insertion of ing hypothesis for higher relationships within Syzygium ovules, although the diagnostic characters of higher taxa s.L, as a basis for more detailed assessments. overlap considerably (Table 1). Particular difficulties arise in the treatment of several "anomalous" species which are not readily accommodated within convention ally accepted higher taxa. For example, the range of | MATERIALS AND METHODS character states in species such as S. wesa B. Hyland and Sampling. ? Chloroplast sequences of the rpl\6 S. monimioides Craven are suggestive of both Acmena intron and the protein coding regions matK and ndhF (floral morphology) and Syzygium (embryo structure) were generated for 62, 88 and 78 taxa respectively, the while, depending on the perceived significance of vari taxon samples for ndhF and rpl\6 data representing sub ous morphological traits, S. gustavioides B. Hyland samples of the matK dataset. A further seven matK could be reasonably referred to Syzygium, Cleistocalyx or sequences were added from Genbank (Appendix). possibly an acmenoid taxon (Table 1; Craven, 2001, As there is considerable uncertainty surrounding the 2003). Craven (2001) has argued that if genera such as circumscription of higher taxa within Syzygium s.L, we Acmena, Acmenosperma and Waterhousea are to be have attempted to include a geographically broad taxon maintained, taxa such as S. wesa and S. gustavioides sample that is reasonably representative of morphologi would be referable to new genera, as would many weak cal diversity within the group. Within Syzygium s.L, we ly distinguished species groups within heterogenous have sampled representatives from each of Acmena and Syzygium. These observations serve to strengthen calls the acmenoid genera (sensu Briggs & Johnson, 1979) for a more pragmatic approach to the taxonomy of Syzy Acmenosperma, Piliocalyx and Waterhousea. Within the gium s.l, based upon an inclusive concept of Syzygium syzygioid group we have sampled one to several species (Turner, 1997; Craven, 2001, 2003), a view that receives from the proposed segregate genera Acicalyptus, support from the molecular phylogeny of Harrington & Cleistocalyx, Cupheanthus, Gelpkea, Jambosa, Par Gadek (2004) for Australian syzygioid species, using se eugenia and Syzygium s.s. Several taxa (e.g., Syzygium quences of ITS and ETS regions of 18S-26S nuclear wesa, S. monimioides, S. glenum; Table 1), possibly at ribosomal DNA. tributable to new genera within conventional taxonomic

Table 1. Distribution (A, Australia; PA, Papuasia (incuding Wallacea); SWP, south western Pacific; WM, western Malesia), conventional character states, and exemplar included in the present study (bold typeface indicates the type of the genus), for proposed and conventionally accepted generic segregates from Syzygium s.l. Syzygium wesa, S. monimioides and S. glenum are included as examples of "anomalous" taxa sensu Craven (2001). The broken line di vides taxa included in Briggs and Johnson (1979) Syzygium informal sub-alliance (upper) and Acmena informal sub alliance (lower). Data from Hyland (1983), Craven (2001) and personal observation. Anther Seed Distinguishing Exemplar included Taxon Distribution sacs Placentation morphology characteristics in this study_ Acicalyptus SWP parallel, axile-central, ov seed testal, subulate calycine Cleistocalyx opening by ules scattered intercotyle calyptra, long, longiflorus longitudinal or axile, ovules donary inclu angular (A.C. Smith) slits in 2 longitudi sion absent hypanthium Merr. & Perry nal rows (rarely) Cleistocalyx A, PA, WM, SWP calycine calyptra S. nervosum D.C. Cupheanthus SWP hypanthium tube S. laxeracemosum J. very long Dawson relative to ovular cavity Jambosa A, PA, WM, SWP large calyx lobes, S. jambos (L.) Alston petals free Pareugenia SWP stamens coherent S. brackenridgeii (A. into phalanges Gray) C. Muell. Syzygium s.s. A, PA, WM, SWP indistinct calyx S. buettnerianum (K. lobes, petals Scum.) Niedenzu coherent S. monimio parallel, open axile-apical, floral morphol n/a ides Craven ing by longi ovules arranged in ogy resembling tudinal slit transverse row(s) "acmenoid" taxa S. wesa B. parallel axile-apical, seed testal, Hyland divergent ovules arranged in intercotyledonary n/a

intermediate transverse row(s) intrusion absent Acmena A, PA, WM divergent, axile-apical, testa apparently intercotyledonary A. smithii (Poir.) opening by ovules arranged absent tissue entering Merr. & Perry apical slits in transverse intercotyle from the fruit row(s) donary intru apex sion present Piliocalyx SWP calycine calyptra P. robustus Brong. & Gris S. glenum A parallel, floral character n/a Craven opening by istics of Acmena, longitudinal Piliocalyx and slits Waterhousea Waterhousea A intercotyledonary W floribunda (F. tissue entering Muell.) B. Hyland from base of fruit Acmeno A, PA, WM axile, ovules in 2 intercotyledonary A. claviflorum sperma longitudinal rows tissue entering (Roxb.) E. Kausel from side of fruit

schemes (see Craven, 2001, 2003), are also included. In focus on taxa from the Australian and the South-Western total, our taxon sample encompasses virtually all of the Pacific regions (Appendix). major variation in several key morphological characters, The selection of potential outgroup taxa was guided including embryo morphology (an exception may be the by a recent cladistic analysis of molecular (matK se Malayan species Syzygium flosculifera (Henderson) I. M. quences) and morphological data (Wilson & al., 2001) Turner, described in detail by Henderson, 1949), number for a broad sample of myrtaceous genera. These data of perianth parts, degree of fusion of perianth parts, place the monotypic Anetholea (A. anisatd) within a anther morphology and placentation. These characters strongly supported clade including Syzygium and have been considered important in the circumscription of Acmena although relationships within this group higher taxa within Syzygium s.L (Craven, 2001; Table 1). {Acmena group) are unresolved. In the present study, Geographic sampling extends from the Western Pacific Anetholea is included as a possible sister-taxon to to Australia, South East Asia and Africa with particular Syzygium s.L (Wilson & al., 2000), although in Har

rington & Gadek's (2004) analyses of ITS and ETS data, tion and deletion events (indels) were coded as binary Anetholea is nested within, rather than sister to, characters, and given the same weight as nucleotide posi Syzygium s.l. We also include several taxa as unambigu tions for parsimony analysis. The sequence alignment is ous outgroups, and possible sister-taxa. In either the available on Treebase. molecular (Metrosideros nervulosa, Thaleropia queens Phylogenetic analysis. ? The data were landica, Tristania nerifolia) or combined morphological analysed under equally-weighted parsimony in PAUP* molecular data (Backhousia myrtifolia, Choricarpia sub 4.08 (Swofford, 1998) using an heuristic search strategy argentea Johnson, Osbornia octadonta) of Wilson & al. (TBR and MULPARS, 100 random addition sequence (2001), these taxa are resolved on strict consensus trees (RAS) replicates, holding a maximum of 100 trees per within groups that include Syzygium s.l. Eugenia uniflo replicate) to identify most parsimonious trees (MPTs). ra L. and Pimenta racemosa are included as representa The MPTs were used as starting trees for a second tives of the fleshy-fruited Myrteae. search, using TBR and MULPARS, saving a maximum Tissue for DNA extraction was obtained from a vari of 10,000 trees. Clade support was assessed using boot ety of sources, including field collections made by our strapping (Felsenstein, 1985), implemented in PAUP* selves or colleagues, and from cultivated sources includ with 100 bootstrap pseudoreplicates and 10 RAS repli ing the following: the private collection of J. Wrigley, cates, holding a maximum of 100 trees in each replicate. Coffs Harbour, Australia; Australian National Botanic Branches with BS values of 50-70% are considered to be Garden, Canberra, Australia; CSIRO Tropical Forestry weakly supported, 70-90% moderately supported, while Research Centre arboretum, Atherton, Australia; Kebun clades with BS support > 90% are considered to be Raya Botanic Gardens, Bogor, Indonesia; Singapore robust. Botanic Gardens, Singapore (Appendix). Several parsimony based statistical tests have been DNA extraction, sequencing and alignment. developed to gauge conflict among estimated trees from ? Genomic DNA was extracted from fresh tissue, multiple phylogenetic data sets. The incongruence length herbarium specimens, and tissues stored in CTAB (hexa difference test (ILD; Farris & al., 1995) is widely used, decyltrimethyl ammonium bromide) buffer or silica-gel, although this test is inconclusive, as reduced phylogenet using either the hot CTAB method of Doyle and Doyle ic accuracy is not a necessary outcome from the com (1990) or the plant DNeasy Minikit (QIAGEN; follow bined analysis of statistically incongruent data (e.g., ing manufacturer's protocols). Following CTAB extrac Gatsey & al., 1999; Yoder & al., 2001; Hipp & al., 2004). tion, DNA was cleaned using the GENECLEAN SPIN Similarly, the incongruence tests of Kishino & Hasegawa kit (BIO 101). Polymerase chain reactions (PCR) were (1989, KH test) and Templeton (1983) may be oversen performed using a Hybaid PCR Express thermocycler, sitive, being easily misled by tree structure that reflects with standard reaction conditions and annealing temper sampling error rather than phylogenetic signal (Cun ature of 55?C, and the amplified double-stranded tem ningham, 1997). Rates and modes of evolution are plate purified using a Qiaquick PCR Purification Kit known to vary substantially across the chloroplast (QIAGEN). Sequences were obtained using fluorescent genome (e.g., between protein coding regions such as dye-labelled terminators (BigDye v.2.0, 2.1, 3.1; Perkin matK and ndhF, and group II introns such as rpl\6), giv Elmer) on an ABI Prism 377 DNA sequencer. In most ing rise to potential sequence bias differences which, if cases forward and reverse strands were sequenced, so as sufficiently strong, may confound phylogenetic estimates to check for possible sequence misreads. Electrophero under unweighted parsimony. On the other hand, where grams were processed using Sequencher (Gene Codes conflict amongst trees from individual data sets is weak, Corporation). The amplification and sequencing primers noise, such as that due to sampling error on short branch used are listed in Table 2. es, provides a reasonable explanation for discordance Sequences were aligned by eye. Hypothesised inser (Graham & al., 1998). In this case, a combined analysis

Table 2. Primers used for amplification and sequencing. Region Name Primer sequence (5-3f) Source matK 2516 TATGCACTTGCTCATGATCA Gadek & al., 1996 2519r TTTACGAGCCAAAGTTTTAA Gadek&al, 1996 ndhF 748f CAGTTGCTAAATCGGCACAATT E. Biffin, this study. 1318r CGAAACATATAAAATGCGGTT L. Cook, pers. comm. 1252f GATGAAATTMTTAATGATAGTTGGT L. Cook, pers. comm. 2063r CATTTGGAATTCCATCAATTA L. Cook, pers. comm. rpll? F71 GCTATGCTTAGTGTGTGACTCG Jordan & al., 1996 1516r CCCTTCATTCTTCCTCTATGTTG Kelchner & Clark, 1997

(i.e., including more characters per taxon) should provide parsimony-informative and 142 (10.5%) uninformative a better estimate of the true chloroplast phylogeny. sites. The alignment of the rpl\6 data introduced 22 gaps, In this study, we use the ILD test, as implemented in and the aligned sequence length was 1093 nucleotides PAUP* (with >1000 partition homogeneity replicates, 10 including 188 (17%) variable sites, 96 (8.5%) of which RAS replicates holding a maximum of 100 at each step, where parsimony-informative, and 92 (8.5%) which missing data and uninformative characters removed) to were autapomorphic. The concatenated sequences thus provide a first estimate of data set congruence. Data sets comprise 3725 nucleotides, including complete charac found to be incongruent under this method were further ters for 62 taxa, while for a 95 taxon data set, 33 taxa assessed, using a modified KH test, which considers only were not scored for rpl\6, 19 of which were not scored well supported phylogenetic structure among rival trees for ndhF (Appendix). The complete (95 taxon) data (Mason-Gamer & Kellogg, 1996; Graham & al., 1998). matrix included 335 (9%) parsimony-informative and The MPTs from one data set ("test" data) are compared 378 (10%) autapomorphic nucleotide sites, and 31 with a summary tree from the other ("rival" data), which sequence length mutations (17 informative). Amongst retains only well supported nodes (e.g., bootstrap support the ingroup, pair-wise sequence divergences (uncorrect > 70%; Hillis & Bull, 1993). For each data set in ques ed p) were generally below 2.5%, and often below 1%. tion, the KH test was performed using summary trees Phylogenetic analysis. ? For each of the three retaining nodes with BS support > 50%, > 60% and so data sets, parsimony analysis found at least 10,000 MPTs on. Polytomies on the summary tree were resolved in a and as some of the resolution in the strict consensus manner consistent with the test data, so as to minimise topologies may be unwarranted, we focus upon support length differences between data sets arising from poorly ed resolution (i.e., BS > 50%). Tree statistics are shown supported nodes (Graham & al, 1998). Reciprocal com in Table 3. In each instance, the Bayesian trees were parisons were used, in the event that conflict was in one highly congruent with those estimated by parsimony, the direction only. only differences occurring amongst unsupported, or Bayesian inference was used to test the robustness of weakly supported nodes along the backbone of trees. The topologies estimated by parsimony. Analyses were per Bayesian analyses are therefore considered in the context formed using MrBayes 2.01 (Huelsenbeck & Ronquist, of parsimony topologies. 2001) approximating a GTR + T+ I model with parame The rpl\6 data provides little support for relation ters for each data partition estimated by ModelTest ships within Syzygium s.L, although both the matK and (Posada & Crandall, 1998). For the combined analysis, ndhF data produced reasonably well supported topolo the data were optimised simultaneously, using model gies, with moderate to strong support for some relation parameters estimated for the individual data partitions. ships (Figs. 1, 2). All three data sets support the mono Bayesian analyses were run over 1,000,000 generations, phyly of Syzygium s.l. (including Anetholea) and a using four starting chains, saving every hundredth gener mongst supported nodes there are few discrepancies with ation. Each analysis was repeated three times to check respect to relationships within this group. Concerning that runs converged on the same topology and majority higher level relationships, the ndhF data support four rule consensus trees were generated in PAUP*, exclud major clades (Groups I, II, III, IV), while the relation ing trees generated during burn-in time (first 10% of ships of Anetholea and S. wesa are unresolved (Fig. 1). saved trees). The 95% confidence interval of likelihood For the rpl\6 data (not shown) the parsimony trees are scores (posterior probability: PP) was deemed to convey broadly consistent with the ndhF data, although only significant support for a node. Groups III (BS 82%) and IV (BS 63%) received statisti cally significant support values. The Bayesian analysis of the rpl\6 data provides strong support for Group I (PP 100%) and III (PP 100%), while Group II (PP 80%) and | RESULTS Sequence data. ? The aligned matK data set, Table 3. Tree statistics for separate and combined DNA with length variations which introduced 6 gaps, com matrices analysed under parsimony criteria. prised 1270 nucleotides, corresponding to position 100 rpll6 ndhF matK combined to 1370 on the matK sequence for Acmena graveolens _intron gene gene data (GenBank accession AF368194). The matK alignment Tree length 277 328 409 1039 contained 287 variable sites (22.5% of total sites), Consistency index 0.772 0.831 0.805 0.779 Retention index 0.828 0.872 0.848 0.831 including 143 (11.25%) parsimony-informative and 144 Rescaled consistency index 0.639 0.726 0.683 0.647 (11.25%) autapomorphic sites. For ndhF, aligned Proportion nodes BS > 50% 0.31 0.33 0.38 0.52 sequences with 3 gaps had a length of 1362 nucleotides, Average (%) BS > 50% 75 80.25 74.5 81 242 (18%) of which were variable including 100 (7.5%)

,S. laxeracemosum n-S. malaccense S. macilwraithianum S. ngyonense S. austrocaledonicum

I?S.I-S. aromaticumseemanianum |? S. puberulum S. tiemeyanum S. sexangulatum r-r- S. nervosum S. sp. SumatraBCHO ? S. branderhorstii -S. amplifolium - S. brackenridge ? S. purpureum S. sp. SulawesiBC8 -S. sp. SulawesiBC90 I- S. cordatum Group I \- S. crebrinerve S. pycnanthum h S. acre S. lateriflorum ? S. racemosum k Cleistocalyx longiflorus I- S. muelleri jj-S. cumini "HS. gui??ense |-S. cormiflorum S. bungadinnia S. sp. SulawesiBC92 S.pseudofastigiatum S. aqueum Cleistocalyx decussatus [*?S- fibrosum j?S. jambos L- S. paniculatum 'S. moorei *\PiliocalyxXirlllOC bullatus Piliocalyx robustus Piliocalyx francii LPilioc Piliocalyx concinnus rf="p - Acmena acuminatissima Acmena smithii n_Acme Acmena ingens Group II Acmena divaricata Acmena graveolens Acmena mackmnoniana Waterhousea floribunda Waterhousea unipunctata - Waterhousea mulgraveana - S. glenum : Waterhousea hedraiophylla S. monimioides S. gustavioides ^i S. buxifolium ^^S. tetrapterum Group -S. wilsonii -S. francisii S. luehmannii -S.arboreum kuebiniense S. maire multipetalum Group IV -S. fullagarii S. apodophyllum S. canicortex Acmenosperma claviflorum - Anetholea anisata S. wesa _ Thaleropia queenslandica -Tristania nerifolia -Backhousia myrtifolia Outgroup ^^^^^ Choricarpia subargentea -Osbornia octadonta -h/letrosideros nervulosa

5 changes

Fig. 1. One of 10,000 MPTs found in the parsimony analysis of the ndhF data set. Branch lengths are proportional to the number of character changes. Bold branches indicate BS = 90%, semi-bold 50-89%, and branches receiving Bayesian PP values = 95% are indicated by an asterisk.

r S. buettnerianum S. puberulum S. samarangense S. tierneyanum -S. moorei S. pseudofastigiatum S. bungadinnia 0 kS ., S. racemosum *' S. sp. SulawesiBC92 S. muelleri S. pycnanthum S. branderhorstiii S. sp. SulawesiBC8 o_l? S. sp. Sulawes?BC90 i *, S. auriculatum J-S. lateriflorum H ' S. tenuiflorum l? S. acre ?S. neryosum ".ape AS. cormitlorum nffon LS. erythrocalyx -S. angophoroides Group r S. australe ?Sjzr?brinerve ,-S. fibrosum I? S. oleosum 1?S. paniculatum * i Cleistocalyx longiflorus - Cleistocalyx eliipticus Cleistocalyx decussatus * ,S. cordatum S. gui??ense S. masukuense S. pondoense S. ?ambos ? S. cumini * -S. amplifolium S. gracilipes S. purpureum S. sanderwicense ?S. brack?nridgei S. seemamanum 1? S. aromaticum , * ,-S. sexangulatum ^^m*S. sp. SumatraBC140 IjS. austrocaledonicum 1 S. laxeracemosum S. malaccense -S. ngyonense ?S. ;sayer/ 0 S. macilwraithianum - S. i^esa *i,3 Piliocalyxriiiocalyx bullatus P Piliocalyx robustus ' Piliocalyx concinnus Piliocalyx francii S. glenum ?dj Waterhousea mulgraveana n-H/afer/?ousea unipunctata Group II Waterhousea floribunda l/l/afer/)ot/sea hedraiophylla Acmena acuminatissima Acmena smithii Acmena ingens Acmena divaricata Acmena mackinnoniana Acm graveolens S. monimioides

S. buxifolium S. gustavioides_ S. tetrapterum S. zeylanicum ~ jancisiim Group III _. luehm?nnii S. wilsomi Acmenosperma claviflorum Hi -S. canicortex S. apodopnyllum S. corynanthum S, arboreum Group IV kuebimense Arm S. multipetalum S. maire S. fullagarii ?Anetholea anisata - Thaleropia queenslandica -Tristania nerifolia ?Metrosideros nervulosa Outgroup Backhousia myrtifolia y? Choricarpia subargentea Osbornia octadonta - Eugenia uniflora ? Pimenta racemosa

" 1 change

Fig. 2. One of 10,000 MPTs found in the parsimony analysis of the matK data set for 86 ingroup taxa. Branch lengths are proportional to the number of character changes. Symbols as in Fig. 1.

,S. amplifolium _Pl?S. gracilipes iS.sanderwicense ?S. purpureum -S. aromaticum ? S. seemanianum S. brackenridgei S. sexangulatum S. sp. SumatraBC140 buettnerianum S. tierneyanum S. puberulum aqueum 1 \S, samarangense H$ 1-S. brandernorsti S. laxeracemosum - S. austrocaledonicum ? S. macilwraithianum r* ? S. malaccense ? S. sayeri L S. ngyonense S. nervosum _rS. mooreii .?JiS. pseudofastigiatum ?- S. bungadinnia . cordatum n S. masukuense S. gui??ense Group I S. pondoense?S. cumini S.jambos ?.S. racemosum S. sp. SulawesiBC92 - S. muelleri ?S. pycnanthum S. sp. SulawesiBC8 ? S. sp. SulawesiBC90 Cleistocalyx ellipticus - Cleistocalyx decussatus Cleistocalyx longiflorus 1 S. tenuiflorum S. auriculatum S. acre ?S. cormiflorum S. erythrocalyx S. bamagense S. oleosum S. angophoroides S. crebrinerve ?S. fibrosum S. paniculatum S. australe * rPiliocalvx bullatus jry-Piliocalyx robustus wmmfPiliocalyx concinnus 1?Piliocalyx fran?ii [Acmena divancata Acmena mackinnoniana Acmena graveolens -?cmena acuminatissima Acmena smithii Group II Acmena ingens " 'aterhousea mulgraveana Waterhousea unipunctata Waterhousea floribunda Waterhousea hedraiophylla -S. monimioides -S. glenum -S. gustavioides S. tetrapterum S. zeylanicum 'S. buxifolium S. francisii Group III S. luehmannii wilsonii _ , -S. arboreum S. kuebiniense S. multipetalum ? S. fullagarii S. maire ,S. apodophyllum Group IV S. corynanthum S. canicortex -Acmenosperma claviflorum - Anetholea anisata - S. wesa Thaleropla queenslandica - Tristania nerifolia - Metrosideros nervulosa Backhousia myrtifolia '? Choricarpia subargentea Outgroup Osbornia octadonta I " Eugenia uniflora Pimenta racemosa

? 5 changes

Fig. 3. One of 10,000 MPTs found in the parsimony analysis of the combined data set. Branch lengths are proportional to the number of character changes. Symbols as in Fig. 1.

IV (PP 87%) are weakly supported. The matK data find this group are referable to Syzygium in the broad sense relationships consistent with Group I, III and IV in the adopted by most contemporary workers. However, the ndhF topology, although Piliocalyx and Waterhousea + group includes taxa referable to Caryophyllus (S. aro S. glenum form a clade (BS 53%; PP 98%) and Group II maticum); Cleistocalyx (C. decussatus, C ellipticus, C is not statistically supported. The Bayesian topology sup longiflorus, of the Fijian Acicalyptus type; and S. nervo ports a clade including Group III and the taxa which are sum, a "typical" Cleistocalyx)', Cupheanthus (S. laxer resolved within Group II in the ndhF topology (PP 95%; acemosum); Gelpkea (S. puberulum); Jambosa (e.g., S. Fig. 2). jambos, S. malaccense, S. pycnanthum, S. acre, S. ampli The PHT tests revealed that the rpl\6 data was sta folium); Pareugenia (S. brackenridgei); and Syzygium tistically congruent with both the matK and ndhF data s.S. (e.g., S. buettnerianum, S. angophoroides), if these sets, although the matK and ndhF data were significant groups are to be recognised. ly incongruent with each other, when analysed separate Group II (BS 96%; PP 100%) includes the acmenoid ly (p = 0.036), or in combination with the rpl\6 data. taxa Acmena, Piliocalyx, Waterhousea and S. glenum. Using the modified KH tests, however, the matK and Also included are S. gustavioides and S. monimioides, ndhF topologies were found to be congruent if weakly both of which are syzygioid in the sense of Briggs & supported nodes (ie., BS < 70%) were excluded from Johnson (1979) although the former has a calycine calyp consideration. tra and could be reasonably referred to Cleistocalyx. Analysis of the 62 and 95 taxon data sets both pro Within Group II, Acmena and Piliocalyx form a well duced > 10,000 MPTs, although with respect to the latter, supported clade (BS 94%; PP 100%), although Acmena there is no evidence for spurious placement of taxa with is paraphyletic with respect to Piliocalyx (BS 76%). missing characters. There are no inconsistencies in the Waterhousea forms a monophyletic group (BS 84%; PP resolution of taxa scored for matK only, in the separate 99%) which is sister to S. glenum (BS 97%; PP 100%). A analysis of the matK data set relative to the combined clade including Syzygium gustavioides and S. monimio data analysis (compare Figs. 2 and 3), suggesting the ides (BS 94%; PP 100%) is portrayed as sister to the (S. matK data is sufficiently informative to at least localise glenum + Waterhousea) clade in the parsimony tree, the position of substantially incomplete taxa (see Wiens, although this grouping is statistically unsupported, col 2003). We prefer the combined data with incomplete taxa lapsing to a trichotomy along with the (Acmena + Pilio included, for the greater information content contained calyx) clade. therein. Group III receives 100% BS (PP 100%) in the com Comparison of support values for the separate versus bined data analyses. Within Group III, the western Mal simultaneous data analyses shows an improvement in esian syzygioid taxa S. buxifolium, S. tetrapterum and S. supported resolution, both in terms of the proportion of zeylanicum form a robust monophyletic group (BS 99%; supported nodes, and the average level of support per PP 100%), the Australian taxa S. leuhmannii and S.fran node (Table 3), consistent with improved phylogenetic cisii are resolved as sister taxa (BS 74%). These clades accuracy from the combined data analysis. Given the form a basal polytomy along with S. wilsonii subsp. absence of strong conflict between data sets, the large wilsonii. number of MPTs appears to reflect a lack of phylogenet Group IV (BS 99%; PP 100%) includes the acme ic signal (indicated by short, or zero length branches) in noid taxon Acmenosperma (A. claviflorum) and taxa re several areas of the topology, most notably, amongst the ferable to Syzygium (S. apodophyllum, S. arboreum, S. deeper branches within Group I (Fig. 3). This is true of corynanthum, S. maire, S. multipetalum. Taxa referable both the 62 and 95 taxon data sets, suggesting that weak to Cleistocalyx (S. canicortex, S. fullagarii, S. kue signal is inherent in the data, rather than a manifestation biniense) are resolved in separate, well supported clades of missing data/?er se. within Group IV (Fig. 3). In the combined data set, Syzygium s.l. forms a strongly supported monophyletic group including Anetholea (BS 100%; PP 100%). Within this group, there are four well supported major clades (Groups I, II, III, | DISCUSSION IV), while Anetholea is weakly supported (BS 63%; PP The results of the present study suggest little 86%>) as sister to Group IV Groups II, III, IV, Anetholea prospect for maintaining Syzygium as distinct from the and S. wesa form a weakly supported clade (BS 61%), various segregates from Syzygium s.l. including Acmena, although the relationships within this group are unre Acmenosperma, Cleistocalyx, Piliocalyx and Water solved or poorly supported (Fig. 3). housea. Under most of the recent circumscriptions of Group I is strongly supported (BS 97%; PP 100%) in Syzygium, this group is para- or polyphyletic, with syzy the combined analysis. Generally, the taxa included in gioid species occurring in each of the major well-sup

ported clades. Briggs & Johnson's (1979) Acmena subal phology, show poor correspondence with the topology of liance is polyphyletic, with the genus Acmenosperma the plastid phylogeny. Most of the characters listed in robustly supported within Group IV, while there is at Table 4 are polymorphic within each of Groups I-IV, and least one independent origin for the acmenoid taxa there are no unambiguous synapomorphies defining Acmena, Piliocalyx, S. glenum and Waterhousea within these major clades. While combinations of homoplastic Group II. Acmena is represented as paraphyletic with characters may prove to be "locally informative" (sensu respect to Piliocalyx, and perhaps polyphyletic if Moylan & al., 2004) in diagnosing clades such as Hyland's (1983) concept of Acmena (including S. Acmena + Piliocalyx (anther sacs divaricating, placenta glenum) is accepted. Cleistocalyx is clearly polyphyletic, tion axile-apical, ovules pendulous, intercotyledonary as species referable to this taxon occur in Groups I, II and intrusion present, entering from the apex of the fruit), IV, and within separate, robustly supported clades within most of the clades in Figure 3 are not readily diagnosed the latter. While the monophyly of both Piliocalyx and using conventionally accepted characters, and this is also Waterhousea is supported by the data, these groups are true of the major clades (Table 4). Amongst the conven resolved at relatively low levels within Group II, and tional generic characters listed in Table 4, for example, substantial realignments would be necessary within there is no combination of characters that can distinguish Syzygium s.l. in order to preserve these taxa as presently Group I and Group III. Thus, while molecular data reveal circumscribed. A lack of support for conventional genera phylogenetic structure within Syzygium s.l., morphologi from the chloroplast data is consistent with the conclu cal evolution appears to have been iterative, and this has sions of Harrington & Gadek (2004), based upon an misled attempts to divide the group. analysis of DNA sequences from the ITS/ETS regions of In a group with relatively invariant morphology, nr ribosomal DNA, for sample of Australian taxa refer some of the more obvious variation, such as flower able to Acmena, Acmenosperma, Cleistocalyx, Syzygium mery, degree of prolongation of the hypanthium, promi and Waterhousea. Generally, available molecular evi nence of calyx lobes, and the extent of fusion of the calyx dence supports deeper divergences which are at variance lobes, petals, and stamens, has been of value for alpha with the traditional divisions of Syzygium s.l. taxonomy, although the assumption that these characters Harrington & Gadek's (2004) ITS and ETS phyloge are also useful generic markers has been largely untest ny is in reasonable agreement with the results of the ed. Most of the groups so defined, including Cleistocalyx present study, finding groups that are consistent with (including Acicalyptus), Cupheanthus, Pareugenia and Groups I, III and IV However, Waterhousea is non Jambosa are contentious, being variously cleaved off, or monophyletic, S. wesa is placed as sister to a well sup reunited within Syzygium s.l, depending upon the whim ported clade (Acmena + (W floribunda + W hedraio of the individual taxonomist. Gross floral morphology phylla)), and the relationships of S. gustavioides, S. mon may be of value at levels below genus, and for example, imioides, S. glenum and (W mulgraveana + W. unipunc the chloroplast data supports the monophyly of the New tatd) are unresolved in their data. Thus, relative to the Caledonian species with 3-merous flowers, including S. plastid phylogeny, there is ambiguity in the resolution of auriculatum, S. lateriflorum and S. tenuiflorum , and the Group II and apparently strong conflict in the resolution Fijian calyptrate species (sometimes referred to Gray's of Waterhousea. Incongruence between gene trees from genus Acicalyptus) Cleistocalyx decussatus, C. ellipticus chloroplast and nuclear regions is not uncommon (e.g., and C longiflorus. However, as the calyptrate condition Albach & Chase, 2004; Crisp & Cook, 2004) while con has evidently emerged several times within Syzygium s.l., flict amongst well supported nodes suggests the opera Piliocalyx may be regarded as no more than a calyptrate tion of biological processes (organismal and/or genome Acmena (Craven, 2001) while Cleistocalyx is a clearly level) which may confound phylogenetic reconstruction unnatural grouping (Hyland, 1983; Craven, 1998, 2001; (Wendel & Doyle, 1998). For example, bias in nucleotide Harrington & Gadek, 2004). Our sample includes sever substitution rates is a well-documented source of phylo al taxa referable to Parnell's (1999) "Jambosa" group (S. genetic error in 18S-26S nr. ribosomal DNA (Alvarez & aqueum, S. jambos, S. malaccense, S. pycnanthum, S. Wendel, 2003). Explanation for discordance between samarangense), which is not supported by the chloro phylogenetic hypotheses for Syzygium s.l. requires fur plast data, as these taxa are resolved in separate clades ther investigation. Nevertheless, the reasonable agree within Group I (Fig. 3). Geography appears to be a bet ment amongst the chloroplast data sets suggests we may ter predictor of phylogenetic relatedness. For example, have confidence in the accuracy of the plastid phylogeny within Group I, an "Australian" clade (Australian presented here, and particularly the strongly supported endemic species excepting S. fibrosum, which also Groups I-IV occurs in New Guinea) (BS 68%; PP 100%) includes the Morphological characters considered diagnostic for typically jambosioid taxa S. bamagense, S. cormiflorum higher taxa viz calyx, anther, placental and embryo mor and S. erythrocalyx, while S. angophoroides is typically

Table 4. Distribution of conventional generic groupings, and conventional generic level characters, relative to molecu lar groupings (I?IV, Syzygium wesa and Anetholea). I LI, intercotyledonary intrusion. _ Flowers Stamens Anther sacs Placentation Seeds ILI Group I (3)4-5 (6)-merous, free or co parallel, axile-central, ovules testal absent Syzygium (including Cuphe petals free to coher herent in dehiscent by "scattered", radi anthus, Gelpkea, Jambosa, ent, calyx lobes to phalan longitudinal ating to ascending Pareugenia), Cleistocalyx free to fused and ges {Par slits (including Acicalyptus) calyptrate eugenia) Group II 4-5(6)-merous, petals stamens parallel, dehiscent axile-apical, ovules pen testal or present Acmena (including S. free to coherent, free by longitudinal dulous, arranged in trans a-testal or glenum), Piliocalyx, calyx lobes free to slits; or divarica verse row(s); or pendu absent Waterhousea, Syzygium fused and calyptrate ting, opening by lous and "scattered" on (including Cleistocalyx) apical slits an axile-central placenta in S. gustavioides Group III 4(5)-merous, petals stamens parallel, dehiscent axile, ovules horizontal, testal absent Syzygium (including free to coherent, free by longitudinal arranged in two lon Jambosa sect. calyx lobes free slits gitudinal rows; or Leptomyrtus) "scattered" on an axile central placenta

Group IV 4-5(6)-merous, petals stamens parallel, dehiscent axile, ovules horizontal testal or present Acmenosperma, Syzygium coherent, calyx lobes free by longitudinal to pendulous, arranged a-testal or (including Cleistocalyx) free to fused and ca slits in longitudinal rows absent lyptrate, calyptra cir cumcissile or opening as a pore (S. apodo phyllum, S. arboreum) Syzygium wesa 4-(5)-merous, petals stamens parallel to parallel axile-apical, ovules testal (?), absent free to coherent, free divergent, dehis pendulous, arranged cotyledons calyx lobes free cent by longitu in a transverse row thick and dinal slits fleshy Anetholea anisata 4-5 merous, stamens parallel, axile-central, testal, absent petals free to coherent, free dehiscent by lon ovules "scattered", cotyledons calyx lobes free_ gitudinal slits radiating to ascending foliaceous

syzygioid. A "Pacific" clade (BS 60%, PP 100%) within the cotyledons are on the outside of the seed. In this Group I includes the jambosioid taxa S. amplifolium and sense, the intrusive material may be derived from the S. gracilipes but also S. aromaticum (Caryophyllus), S. chalaza, of similar origin to the extensively developed brackenridgei (Pareugenid) and taxa such as S. seemani tissue which almost completely pervades the seed coat in anum and S. purpureum, which have syzygioid floral several southern African species of Eugenia s.l. (Van morphology. Wyk & Botha, 1984). Corner (1976: 203) suspects that There has been a strong emphasis on the phyloge pachychalazal seed coats may occur amongst "several netic significance of seed structure in Syzygium s.l. (e.g., species of Eugenia that are unitegimic" all of which are Merrill & Perry, 1938; Hartley & Craven, 1977; Briggs referable to Syzygium in the sense adopted here. & Johnson, 1979; Hyland, 1983, Smith, 1985), although Pachychalazy may provide an efficient mechanism for many aspects of the morphology, histology, ontogeny, the rapid transfer of "nutrients" to the developing and function of various tissues in the seed are quite poor embryo (Von Teichman & Van Wyk, 1996), and is sig ly understood. To our knowledge, the only published nificantly associated with rainforest taxa with "over account of fruit development in Syzygium s.l. is that of grown" (sensu Corner, 1976) seeds (Von Teichman & Hartley & Craven (1977), for Acmena smithii. They Van Wyk, 1991). Harrington & Gadek (2004) suggest describe the intrusive intercotyledonary material in A. that seed structures in Acmenosperma, relative to smithii as "placental (or funicular)" in origin, and note Acmena and Waterhousea, may be of fundamentally dif the apparent absence of a testa, the "integument" being ferent origin, as a possible explanation for the apparent sloughed off early in the development of the seed. ly polyphyletic nature of the intercotyledonary intrusion, Hyland (1983) also notes the absence of a testa in the as revealed by their nuclear DNA dataset. An alternative acmenoid genera Acmenosperma and Waterhousea, explanation, that the intrusive tissues are in fact homolo while our own observations of Piliocalyx suggests the gous with the seed coats developed more generally in same condition applies in that taxon. According to Syzygium s.l., is presently under investigation in light of Hyland (1983), the absence of a testa amongst the initial observations (E. Biffin, unpubl.) which suggest acmenoid genera could be explained in terms of the seed pachychalazal seed development occurs in at least some being "inside-out": that is, the testa is on the inside, and taxa. In S. macilwraithianum and S. puberulum, which

This content downloaded from 129.127.100.248 on Thu, 07 Apr 2016 23:56:33 UTC All use subject to http://about.jstor.org/terms Biffin & al. Molecular systematics o? Syzygium TAXON 55 (1) February 2006: 79-94

are here included in Group I. in Group IV, while S. buxifolium, S. tetrapterum and S. Unitegmic ovules have been noted in several species zeylanicum have placental structure similar to Group I of Syzygium s.l. (S. jambos (as Eugenia jambos L.), van taxa, although the homology of this variation is uncer der Pijl, 1934; S. paniculatum (as Eugenia paniculata tain. Observations are also needed to establish the signif Banks ex Gaertn.), Mauritzon, 1939; Syzygium cumini, icance of variation in ovule orientation, and whether this Narayanashwami & Roy, 1960; S. malaccense (as reflects differences in ovule shape, or is merely a mani Eugenia malaccensis L.), Roy, 1960; S. fruticosum (as festation of placental position within the locule. Eugenia fruticosa L.), Roy, 1961; S. myrtifolium (as Variations in ovule shape may be overlooked in the Eugenia myrtifolia Roxb.), Roy, 1962; S. macilwraithi course of cursory investigation (Van Wyk & Botha, anum, E. Biffin, unpubl.) but this condition is otherwise 1984). unknown within the Myrtaceae (Tobe & Raven, 1983; Nie Lughadha & Proen?a, 1996). Mauritzon (1939) notes the extensive vasculature in the single integument of S. paniculatum, comprised of elongated conducting cells | CONCLUSION similar to those of the chalaza, which penetrates from the The chloroplast phylogeny suggests little prospect chalaza high into the integument. He speculates that the for the division of Syzygium s.l. into several diagnosable passage of the vascular bundles is facilitated by the monophyletic genera, revealing groups that are inconsis fusion of two integuments, each of three cell layers thick, tent with traditional generic schemes and are not readily to form a single integument of six cell layers. The extent diagnosed using conventional morphological data. of development of untigemy within Syzygium s.l. Generic circumscription has long been considered prob requires further investigation, and amongst the taxa lematic within the group, and this, in part, reflects the which appear to exhibit pachychalazal seeds, whether the labile nature of conventional generic level characters, as pachychalaza develops post-fertilisation, or if in fact the revealed by molecular data. Homoplasy in morphology ovules are already pachychalazal. Elsewhere in the has been cited as a reason for difficulties in successfully Myrtaceae, pachychalazy appears to be associated with dividing several "large genera" (e.g., Astragalus, the former condition (Van Wyk & Botha, 1984) although Wojciechowski & al., 1999; Strobilanthes, Moylan & al., pachychalazal ovules have been noted elsewhere 2004). High levels of homoplasy are perhaps not unex amongst angiosperms (e.g., Anacardiaceae, Robbertse & pected amongst large, species-rich radiations (Sand al., 1986). erson, 1998). In several instances, however, the evidence We also draw attention to details of placentation, for homoplasy in morphology remains conjectural. The including the structure of the placentae, their position, homology of morphological character-states may be dif the insertion of the ovules and their shape, as potentially ficult to establish in the absence of detailed comparative profitable areas for further investigation. In general, tax studies (Givnish & Sytsma, 1997) and for example, rela onomic treatments for Syzygium s.l. have referred to pla tively less weight might be ascribed to seed morphology cental structures in the broadest terms, although notable if the seed coats of the syzygioid group, and the intrusive exceptions include Hyland (1983) and Backer & tissues of the acmenoid taxa, prove to be pachychalazal. Bakhuizen van den Brink (1963), who describe the posi The placement o? Acmenosperma within Group IV sug tion of the placentae, and the arrangement, insertion and gests that placental morphology (i.e., ovules pendulous, orientation of the ovules on the placenta. We note a rea arranged on the placentae in longitudinal rows) may be a sonable correlation with Hyland's descriptive terminolo better predictor of evolutionary relatedness than the pres gy, and Groups I-IV, in our molecular phylogeny. For ence, or otherwise, of an intercotyledonary intrusion example, in Group I the taxa we have so far studied have (Table 4). In this context, the molecular phylogeny pro placentation that is consistently "axile-central" and the vides a powerful framework for identification of charac ovules are "scattered" on the placenta and "radiating to ters that may yield additional insights into relationships, ascending." In Group IV, the ovules are "pendulous" and as the focus for more detailed assessments (e.g., arranged on axile placentae in longitudinal rows in each Pennington & Gemeinholzer, 2000). Detailed studies of locule, while in Group II, the ovules are pendulous, and seed development, and of placentation, ovule morpholo with the exception of S. gustavioides (which has an axile gy and the like, are suggested as fruitful avenues of central placenta) are inserted in a transverse row(s) on an investigation. A further, recent example is to be found in axile-apical placenta. However, it would be premature to the study of Belsham & Orlovich (2003), who record draw relationships based upon Hyland's descriptions and potentially useful variation in androecium development many more observations are needed. In Group III, for in S. australe and Acmena smithii, although more taxa example, the placental structure of S. wilsonii, S. fran require investigation. cisii and S. leuhmannii resembles the condition occurring In general, available molecular data are broadly in

agreement with the views expressed by Craven (2001) who, for largely pragmatic reasons, has argued that the fl| LITERATURE CITED various segregates from Syzygium s.l. would be best Airy Shaw, H. K. 1949. Additions to the flora of Borneo and other Malay Islands. 20. The Myrtaceae of the Oxford placed in the synonymy of Syzygium. This conclusion is University Expedition to Sarawak, 1932. Kew Bull. 4: perhaps most difficult to accept with respect to relatively 117-125. distinct groups such as Acmena and Waterhousea, Airy Shaw, H. K. 1966. J C. Willis, A Dictionary of the although with their ongoing acceptance, there are well Flowering Plants and Ferns, ed. 7. Cambridge Uni v. supported, logical arguments for the recognition of sev Press, Cambridge. eral to many additional segregates from Syzygium s.l., Albach, D. C. & Chase, M. W. 2004. Incongruence in which are also diagnosed by combinations of homoplas Veroniceae (Plantaginaceae): evidence from two plastid and a nuclear ribosomal DNA region. Molec. Phylog. tic characters. For example, taxa such as S. monimioides, Evol 32: 183-197. S. gustavioides and S. glenum could be reasonably placed Alvarez, I. & Wendel, J. F. 2003. Ribosomal ITS sequences within new, monotypic genera if Acmena, Piliocalyx, and plant phylogenetic inference. Molec. Phylog. Evol. 29: Syzygium and Waterhousea are to be recognised (Craven, 417-434. 2001, 2003; Fig. 3). While each would possess a distinct Backer, C. A. & Bakhuizen van den Brink, R. C. 1963. combination of character states, these genera would not Myrtaceae. Pp. 333-351 in: Flora of Java, vol. 1. Wolters be readily distinguishable from each other. It is thus dif Noordhof NV, Groningen. ficult to avoid the conclusion that widely accepted, pop Belsham, S. R. & Orlovich, D. A. 2003. Development of the hypanthium and androecium in Acmena smithii and Syzy ular concepts such as Acmena would be best treated gium australe (Acmena Alliance: Myrtaceae). Austral. within Syzygium. In mitigation, well-supported, readily Syst. Bot. 16: 621-628. diagnosable clades such as Acmena + Piliocalyx could be Bentham, G & Hooker, J. D. 1865. Myrtaceae. Pp. 690-725 recognised as subgeneric taxa. However, finding support in: Genera Plantarum, vol. 1. Reeve & Co., London. from morphology for several of the molecular groups Briggs, B. G & Johnson, L. A. S. 1979. Evolution in the identified in this study remains a major challenge in Myrtaceae?evidence from inflorescence structure. Proc. Linn. Soc. New South Wales 102: 157-256. developing a satisfactory infrageneric taxonomy for Brown, G K., Udovicic, F. & Ladiges, P. Y. 2001. Molecular Syzygium s.l. phylogeny of Melaleuca, Callistemon and related genera (Myrtaceae). Austral. Syst. Bot. 14: 565-585. Chantaranothai, P. & Parnell, J. 1994. A revision o? Acmena, Cleistocalyx, Eugenia s.s. and Syzygium (Myrtaceae) in | ACKNOWLEDGEMENTS Thailand. Thai Forest Bull. 21: 1-123. The Directors and/or Curators of the following herbaria are Corner, E. J. H. 1976. The Seeds of Dicotyledons. Vols. 1 & 2. thanked for providing access to collections in their care: A, BISH, Cambridge Univ. Press, Cambridge. Craven, L. A. 1998. Cleistocalyx fullagarii transferred to CANB, GH, K, NOU, QRS, SUVA. John Wrigley and Gary Syzygium (Myrtaceae). Muelleria 11: 95-96. Sankowsky kindly permitted access to their private collections and Craven, L. A. 2001. Unravelling knots or platting rope: what John Dawson (Wellington University) made available material of are the major taxonomic strands in Syzygium sens. lat. New Caledonian species. The following are thanked for their gen (Myrtaceae) and what should be done with them? Pp. erosity and assistance during fieldwork: Marika Tiuwawa, 75-85 in: Saw, L. G, Chua, L. S. & Khoo, K. C. (eds.), Alifereti Naikatini, Isaac Rounds, Mosese Moceyawa (South Taxonomy: the Cornerstone of Biodiversity. Proceedings Pacific Regional Herbarium, Suva), Stephane McCoy (INCO, of the Fourth International Flora Malesiana Symposium, 1998. Institute Penyelidikan, Kuala Lumpur. Noumea), and Tanguy Jaffr? (IRD, Noumea). The following are Craven, L. A. 2003. Four new species of Syzygium thanked for supplying tissues for DNA extraction: Siti Sunarti (Myrtaceae) from Australia. Blumea 8: 479-488. (Kebun Raya, Bogor), J. Smith (Lord Howe Island) and staff of the Crisp, M. D. & Cook, L. M. 2004. Molecular evidence for Singapore Botanic Gardens. Marlien van der Merwe (Pretoria definition of genera in the Oxylobium group (Fabaceae: University) supplied DNA for Syzygium cordatum, S. gui??ense Mirbelieae). Syst. Bot. 28: 705-713. and S. pondoense and Mark Harrington (James Cook University, Cunningham, C. W. 1997. Is congruence between data parti Cairns) for Thaleropia queenslandica. Lyn Cook (Australian tions a reliable predictor of phylogenetic accuracy? Empirically testing an iterative procedure for choosing National University, Canberra) is thanked for supplying ndhF among phylogenetic methods. Syst. Biol. 46: 464-464. primer sequences. Field work in Fiji and New Caledonia was made Dawson, J. W. 1999. Myrtaceae. Myrtoideae I: Syzygium. In: possible through a grant from the Pacific Biological Foundation. Morat, Ph. (ed.), Flora de la Nouvelle-Cal?donie, vol. 23. Ed Biffin holds an ABRS Postgraduate Scholarship from the Mus?um d'Histoire Naturelle, Paris. Australian Biological Resources Study, and a Scholarship from the Doyle, J. J. & Doyle, J. L. 1990. The isolation of plant DNA Australian National University. This support is gratefully from fresh tissue. Focus 12: 13-15. acknowledged. We thank two anonymous reviewers for their com Farris, J., Kallersjo, S. M., Kluge, A. G & Bult, C. 1995. ments. Testing significance of incongruence. Cladistics 10:

This content downloaded from 129.127.100.248 on Thu, 07 Apr 2016 23:56:33 UTC All use subject to http://about.jstor.org/terms Biffin & al. Molecular systematics ai Syzygium TAXON 55 (1) February 2006: 79-94

315-315. Hominoidea. J. Molec. Evol. 29: 170-179. Felsenstein, J. 1985. Confidence limits on phylogenies: An Mabberley, D. J. 1997. The Plant Book, ed. 2. Cambridge approach using the bootstrap. Evolution 39: 783-791. Univ. Press, London. Gadek, P. A., Wilson, P. G & Quinn, C. J. 1996. Phylog Mason-Gamer, R. J. & Kellogg, A. E. 1996. Testing for phy enetic reconstruction in Myrtaceae using matK, with par logenetic conflict among molecular data sets in the tribe ticular reference to the position of Psiloxylon and Triticeae (Gramineae). Syst. Biol. 45: 524-525. Heteropyxis. Austral. Syst. Bot. 9: 283-290. Mauritzon, J. 1939. Contributions to the embryology of the Gatsey, J., O'Grady, P. & Baker, R. H. 1999. Corroboraron orders Rosales and Myrtales. Acta Univ. Lund. 35: 1-121. among data sets in simultaneous analysis: Hidden support McVaugh, R. 1968. The genera of American Myrtaceae?an for phylogenetic relationships among higher level interim report. Taxon 17: 354^18. Artiodactyl taxa. Cladistics 15:271-313. Merrill, E. D. 1950. Readjustments in the nomenclature of Givnish, T. J. & Sytsma, K. J. 1997. Homoplasy in molecular Philippine Eugenia species. Philipp. J. Sei. 79: 351-430. vs. morphological data: the likelihood of correct phyloge Merrill, E. D. & Perry, L. M. 1937. Reinstatement and revi netic inference. Pp. 55-102 in: Givnish, T. J. & Sytsma, K. sion of Cleistocalyx Blume including Acicalyptus A. Gray, J. (eds.), Molecular Evolution and Adaptive Radiation. a valid genus of the Myrtaceae. J. Arnold Arbor. 18: Cambridge Univ. Press, Cambridge. 322-343. Graham, S. W., Kohn, J. R., Morton, B. R., Eckenwalder, J. Merrill, E. D. & Perry, L. M. 1938. A synopsis of Acmena E. & Barrett, S. C. H. 1998. Phylogenetic congruence DC, a valid genus of the Myrtaceae. J. Arnold Arbor. 19: and discordance among one morphological and three 1-20. molecular data sets from Pontederiaceae. Syst. Biol 47: Merrill, E. D. & Perry, L. M. 1939. The myrtaceous genus 545-567. Syzygium Gaertner in Borneo. Mem. Amer. Acad. Arts 18: Harrington, M. G & Gadek, P. A. 2004. Molecular systemat 135-202. ics of the Acmena Alliance (Myrtaceae): phylogenetic Moylan, E. C, Bennett, J. R., Carine, M. A., Olmstead, R. analyses and evolutionary implications with respect to G & Scotland, R. W. 2004. Phylogenetic relationships Australian taxa. Austral Syst. Bot. 17: 63-72. amongst Strobilanthes s.l. (Acanthaceae): evidence from Hartley, T. G & Craven, L. A. 1977. A revision of the ITS nrDNA, trnL-F cpDNA, and morphology. Amer. J. Papuasian species of Acmena (Myrtaceae). J. Arnold Bot. 91: 724-735. Arbor. 58: 325-342. Narayanaswami, S. & Roy, S. K. 1960. Embryo sac develop Hartley, T. G & Perry, L. M. 1973. A provisional key and ment and polyembryony in Syzygium cumini. Bot. Not. enumeration of species of Syzygium (Myrtaceae) from 1960: 273-284. Papuasia. J. Arnold Arbor. 54: 160-227. Nie Lughadha, E. & Proen?a, C. 1996. A survey of repro Henderson, M. R. 1949. The genus Eugenia (Myrtaceae) in ductive biology of the Myrtoideae (Myrtaceae). Ann. Malaya. Gard. Bull. Singapore 12: 1-293. Missouri Bot. Gard. 83: 480-503. Hillis, D. M. & Bull, J. J. 1993. An empirical test of boot O'Brien M. M., Quinn, C. J. & Wilson, P. G 2000. strapping as a method of assessing confidence in phyloge Molecular systematics of the Leptospermum suballiance netic analysis. Syst. Biol 42: 182-192. (Myrtaceae). Austral. J. Bot. 48: 621-628. Hipp, A. L., Hall, J. C. & Sytsma, K. J. 2004. Congruence Parnell, J. 1999. Numerical analysis of Thai members of versus phylogenetic accuracy: Revisiting the Incongru Eugenia-Syzygium group (Myrtaceae). Blumea 44: ence Length Difference test. Syst. Biol. 53: 81-89. 351-379. Huelsenbeck, J. P. & Ronquist, F. 2001. MrBayes 2.01: Parnell, J. 2003. Pollen of Syzygium (Myrtaceae) from SE Bayesian Analysis of Phylogeny. Computer program avail Asia, especially Thailand. Blumea 48: 303-317. able at http://morphbank.ebc.uu.se/mrbayes/ Pennington, R. T. & Gemeinholzer, B. 2000. Cryptic clades, Hyland, B. P. M. 1983. A revision o? Syzygium and allied gen fruit wall morphology and biology of Andira era (Myrtaceae) in Australia. Austral J. Bot. Suppl Ser 9: (Leguminosea: Papilionoideae). Bot. J. Linn. Soc. 134: 1-164. 267-286. Ingle, H. D. & Dadswell, H. E. 1953. The anatomy of the tim Posada, D. & Crandall, K. A. 1998. ModelTest: Testing the bers of the south-west Pacific area. III. Myrtaceae. model of DNA substitution. Bioinformatics 14: 817-818. Austral J. Bot. 1: 353-401. Robbertse, P. J., Von Teichman, I. & Van Rensburg, H. J. Johnson, L. A. S. & Briggs, B. G 1984. Myrtales and 1986. A re-evaluation of the structure of the mango ovule Myrtaceae?a phylogenetic analysis. Ann. Missouri Bot. in comparison with a few other Anacardiaceae species. S. Gard. 71:700-756. African J Bot. 52: 17-24. Jordan, W. C, Courtney, M. W. & Neigel, J. E. 1996. Low Roy, S. K. 1960. Embryology of Eugenia jambos. Curr. Sei. levels of intraspecific genetic variation at a rapidly evolv 29: 189-190. ing chloroplast locus in North American Duckweeds Roy, S. K. 1961. Embryology of Eugenia fruticosa. Proc. Nati. (Lemnaceae). Amer. J. Bot. 83: 430-^39. Acad. Sei. India, 5 31: 80-87. Kelchner, S. A. & Clark, L. G 1997. Molecular evolution and Roy, S. K. 1962. Embryology o? Eugenia myrtifolia. Sei. Cult. phylogenetic utility of the chloroplast rpl\6 intron in 28: 376-378. Chusquea and the Bambusoideae (Poaceae). Molec. Sanderson, M. J. 1998. Reappraising adaptive radiation. Phylog. Evol 8: 385-397. Amer. J. Bot. 85: 1650-1655. Kishino, H. & Hasegawa, M. 1989. Evaluation of the maxi Schmid, R. 1972a. A resolution of the Eugenia-Syzygium con mum likelihood estimate of evolutionary tree topologies troversy (Myrtaceae). Amer. J. Bot. 59: 423-436. from DNA sequence data, and the branching order in Schmid, R. 1972b. Floral anatomy of Myrtaceae. 1. Syzygium.

Bot. Jahrb. Syst. 92: 433^89. Donoghue, M. J. 1993. Monophyly of aneuploid Smith, A. C. 1985. (ed.), Flora Vitiensis Nova, vol. 3. Pacific Astragalus (Fabaceae): evidence from nuclear ribosomal Tropical Botanical Garden, Hawaii. DNA internal transcribed spacer sequences. Amer. J. Bot. Swofford, D. L. 1998. PAUP*: Phylogenetic Analysis Using 80: 711-722. Parsimony (*and Other Methods). Version 4.08. Sinauer, Wojciechowski, M. F., Sanderson, M. J. & Hu, J. M. 1999. Massachusetts. Evidence on the monophyly o? Astragalus (Fabaceae) and Templeton, A. R. 1983. Phylogenetic inference from restric its major subgroups based on nuclear ribosomal DNA ITS tion endonuclease cleavage sites with particular reference and chloroplast DNA trnL intron data. Syst. Bot. 24: to the evolution of humans and apes. Evolution 37: 409^09. 211-244. Wright, S. D., Yong, C. G, Wichman, S. R., Dawson, J. W. Tobe, H. & Raven, P. H. 1983. An embryological analysis of & Gardner, R. C. 2001. Stepping stones to Hawaii: a Myrtales: its definition and characteristics. Ann. Missouri trans-equatorial dispersal pathway for Metrosideros (Myr Bot. Gard. 70: 71-94. taceae) inferred from nrDNA ITS + ETS. J Biogeogr. 28: Turner, L M. 1997 ["1996"]. What should the kelat trees of 769-774. Malaya be called? J. Singapore Nati Acad. Sei. 22-24: Yoder, A. D., Irwin, J. A. & Payseur, B. A. 2001. Failure of 15-27. the ILD to determine data combinability for Slow Loris Van der Pijl, L. 1934. ?ber die Polyembryonie bei Eugenia. phylogeny. Syst. Biol. 50: 408-424. Recueil Trav. Bot. N?erl 31: 113-187. Van Wyk, A. E. & Botha, R. 1984. The genus Eugenia L. (Myrtaceae) in Southern Africa: Ontogeny and taxonomic value of the seed. S. African J. Bot. 3: 63-80. Von Teichman, I. & Van Wyk, A. E. 1991. Trends in the evo lution of dicotyledonous seeds based on character associa tions, with special reference to pachychalazy and recalci trance. Bot. J. Linn. Soc. 105: 211-237. Von Teichman, I. & Van Wyk, A. E. 1996. Taxonomic signif icance of pericarp and seed structure in Heeria arg?ntea Thunb. Meisn. (Anacardiaceae), including reference to pachychalazy and recalcitrance. Bot. J. Linn. Soc. 122: 335-352. Wendel, J. F. & Doyle, J. J. 1998. Phylogenetic incongruence: Window into genome history and molecular evolution. Pp. 265-296 in: Soltis, D. E., Soltis, P. S. & Doyle, J. J. (eds.), Molecular Systematics of Plants II: DNA Sequencing. Kluwer, Boston. Wiens, J. A. 2003. Missing data, incomplete taxa and phylo genetic accuracy. Syst. Biol 52: 528-538. Wilson, P. G, O'Brien, M. M., Gadek, P. A. & Quinn, C. J. 2001. Myrtaceae revisited: a reassessment of infrafamilial groups. Amer. J. Bot. 88: 2013-2025. Wilson, P. G, O'Brien, M. M. & Quinn, C. J. 2000. Anetholea (Myrtaceae), a new genus for Backhousia anisata: a cryptic member of the Acmena Alliance. Austral Syst. Bot. 13: 429-435. Wojciechowski, M. F., Sanderson, M. J., Baldwin, B. G &

Appendix. Taxa used in this study, including distribution, Genbank numbers and voucher details. Abbreviations as fol lows: A, Australia; Af, Africa; C, widely cultivated (possible region of origin?); EM, eastern Malesia, FJ, Fiji Islands; LHI, Lord Howe Island; NC, New Caledonia; NZ, New Zealand; PA, Papuasia (including Wallacea); WM, western Malesia; ?, uncertainty in the geographic origin of the taxon; CANB, Australian National Herbarium, Canberra; JCU, James Cook University, Cairns; JCT, James Cook University, Townsville; PRU, Pretoria University Herbarium; QRS, CSIRO Tropical Forestry Research Centre, Atherton; SBG, Singapore Botanic Gardens, Singapore. GenBank accession numbers in bold typeface indicate sequences downloaded from GenBank (not vouchered for the present study)._ Species; Distribution; matK; ndhF; rpll?; Voucher_ Acmena acuminatissima (Blume) Merr. & Perry; PA, WM; DQ088537; DQ088462; DQ088399; Gadek s.n. - JCT. A. divaricata Merr. & Perry; A; DQ088538; DQ088463; -; CSU61 - QRS. A. graveolens (F.M. Bail.) L.S. Smith; A; DQ088540; DQ088465; DQ088401; Hyland 6019 - QRS. A. ingens (F. Muell ex C. Moore) Guymer & B. Hyland; A; DQ088542; DQ088466; DQ088402; Beasley and Ollerenshaw 1018 - CANB. A. mackinnoniana B. Hyland; A; DQ088543; DQ088467; DQ088403; RFK2831 - QRS. A. smithii (Poir.) Merr. & Perry; A; DQ088545; DQ088469; DQ088405; Beasley, Donaldson and Ollerenshaw 186 - CANB. Acmenosperma claviflorum (Roxb.) E. Kausel; A, PA, WM; DQ088546; DQ088470; DQ088406; Hyland 11316 - QRS. Anetholea anisata (Vickery) P.G. Wilson; A; AF368195; DQ088471; DQ088407; Barnsley 1603 - CANB. Backhousia myrtifolia Hook.; A; AF368200; DQ088472; DQ088408; CBG8501263 - CANB. Choricarpia subargentea (C.T. White) L. Johnson; A; AF368202; DQ088473; DQ088409; Telford and Butler 9041 - CANB. Cleistocalyx decussatus A.C. Sm.; FJ; DQ088547; DQ088474; DQ088410; Biffin and Craven 36 - CANB. C. ellipticus (A.C. Sm.) Merr. & Perry ; FJ; DQ088549; -; -; Biffin and Craven 65 - CANB. C. longiflorus (A.C. Sm.) Merr. & Perry; FJ; DQ088548; DQ088475; DQ088411; Biffin and Craven 58 - CANB . Eugenia uniflora L.; C; AF368207; DQ088457; -. Metrosideros nervulosa C. Moore & F. Muell; LHI;

Appendix (continued.)_ Species; Distribution; matK; ndhF; rpll6; Voucher DQ088535; DQ088458; DQ088395; Biffin 34 - CANB. Osbornia octa DQ088505; DQ088436; Biffin and Craven 148 - CANB (NC). S. leuh donta F. Muell.; A; DQ088536; DQ088459; DQ088396; Lyne 36 - CANB. mannii (F.Muell.) L. Johnson; A; DQ088587; DQ088506; DQ088437; Pilioclayx bullatus Brongn. & Gris.; NC; DQ088552; DQ088478; Gadek s.n. - JCT. S. macilwraithianum B. Hyland; A; DQ088588; DQ088413; Biffin and Craven 121 - CANB. P. concinnus A.C. Sm.; FJ; DQ088507; -; RFK 3298 - QRS. S. maire (A. Cunn.) Sykes & P. J. DQ088550; DQ088476; DQ088412; Biffin and Craven 61 - CANB. P. Garnock-Jones; NZ; DQ088589; DQ088508; DQ088438; francii Guillaumin; NC; DQ088551; DQ088477; -; Biffin and Craven 114 Gardner 8470 - CANB (NZ). S. malacense (L.) Merr. & Perry; C (A, PA?); - CANB. P. robustus Brongn. & Gris.; NC; DQ088553; DQ088479; DQ088590; DQ088509; -; Hyland 10227 - QRS. S. masukuense; Af; DQ088414; Biffin and Craven 133 - CANB. Pimenta racemosa (Mill.) DQ088591; -; -; Gadek s.n. - JCT S. monimioides Craven; A; DQ088544; J.W. Moore; C; DQ088554; -; -. Syzygium acre (Pancher ex Guillaumin) DQ088468; DQ088404; Sankowsky s.n. S. moorei (F. Muell.) L. Johnson; J.W. Dawson; NC; DQ088555; DQ088480; DQ088415; Biffin and Craven A; DQ088592; DQ088510; -; Biffin 50 - CANB. S. muellerii Miq.; WM; 107 - CANB. S amplifolium Perry; A; DQ088556; DQ088481; DQ088593; DQ088511; DQ088439; Brown and Craven 136 - CANB DQ088416; Biffin and Craven 1 - CANB. S. angophoroides (F. Muell.) B. (cult.). S. multipetalum Pancher ex Brongn. & Gris.; NC; DQ088594; Hyland; A; DQ088557; -; -; Gadeks.n. - JCT. S. apodophyllum (F. Muell.) DQ088512; DQ088440; Biffin and Craven 75 - CANB (NC); S. nervosum B. Hyland; A; DQ088558; DQ088482; DQ088417; Biffin 35 - CANB. S D.C.; A, PA, WM; DQ088595; DQ088513; -; Slee et al 2386 - CANB (A). aqueum (Burm. f.) Alston; C (A, PA?); DQ088559; DQ088483; -; Hyland S. ngyonense (Schltr.) Guillaumin; NC; DQ088596; DQ088514; -; Percy 10801 - QRS. S. arboreum (Baker f.) J.W. Dawson; NC; DQ088560; s.n. S. oleosum (F. Muell.) B. Hyland; A; DQ088597; -; -; Gadek s.n. - JCT. DQ088484; DQ088418; Biffin and Craven 111 - CANB. S. aromaticum S. paniculatum Gaertn.; A; DQ088598; DQ088515; DQ088441; (L.) Merr. & Perry; C (PA?); DQ088561; DQ088485; DQ088419; Brown Richardson, Butler and Corhett 49a - CANB. S. pondoense EngL; Af; and Craven 130 - CANB. S. auriculatum Brongn. & Gris.; NC; DQ088699; -; -; van der Merwe 502 - PRU. S. psuedofastigiatum B. DQ088562; -; -; Biffin and Craven 141 - CANB. S. australe (Wendl. ex Hyland; A; DQ088600; DQ088516; -; Biffin 44 - CANB. S. puberulum Link) B. Hyland; A; AF368221; -; -. S. austrocaledonicum (Seem.) Hartley & Perry; A, PA; DQ088601; DQ088517; -; Gadek s.n. - JCT/Biffin Guillaumin; NC; DQ088563; DQ088486; DQ088420; Percy s.n. - CANB. 51 - CANB. S. purpureum (Perr.) A.C. Sm.; FJ; DQ088602; DQ088518; S. bamagense B.Hyland; A; DQ088564; -; -; Gadek s.n. - JCT. S. bracken DQ088442; Biffin and Craven 19 - CANB. S. pycnanthum Merr. & Perry; ridgei C. Muell.; FJ; DQ088565; DQ088487; DQ088421; Biffin and WM; DQ088603; DQ088519; DQ088443; Brown and Craven 139 - Craven 59 - CANB. S. branderhorstii Lauterb.; A, PA; DQ088566; CANB. S. racemosum D.C.; WM; DQ088604; DQ088520; DQ088444; DQ088488; DQ088422; Hyland 10266 - QRS. S. buettneranum (K. Brown and Craven 137 - CANB. S. samarangense (Blume) Merr. & Perry; Schum.) Niedenzu; A, PA; DQ088567; DQ088489; -; Hyland 10267 - C (EM?); DQ088605; -; - ; Gadek s.n. - JCT S. sandwicense C. Muell; H; QRS. S. bungadinnia (F.M. Bail.) B. Hyland; A; DQ088568; DQ088490; DQ088606; -; -; Gadek s.n. - JCT S. sayeri (F. Muell) B. Hyland; A; DQ088423; Biffin 36 - CANB. S buxifolium Hook. & Arn.; WM; DQ088607; -; -; Gadek s.n. - JCT S. seemannianum Merr. & Perry; FJ; DQ088569; DQ088491; DQ088424; Brown and Craven 134 - CANB DQ088608; DQ088521; DQ088445; Biffin and Craven 32 - CANB. S. (cult. Bogor). S. canicortex B. Hyland; A; DQ088570; DQ088492; sexangulatum (Miq.) Amshoff; WM; DQ088609; DQ088522; - \Brown DQ088425; Biffin 37 - CANB. S. cordatum H?chst, ex C. Krauss; Af; and Craven 141 - CANB. S. sp. "Sulawesi 1"; PA, (EM WM?); DQ088571; DQ088493; DQ088426; van der Merwe 500 - PRU. S. cormi DQ088610; DQ088523; -; Brown and Craven 8 - CANB. S. sp. "Sulawesi florum (F. Muell.) B. Hyland; A; DQ088572; DQ088494; DQ088427; 2"; PA, (EM WM?); DQ088611; DQ088524; -; Brown and Craven 90 - Biffin 38 - CANB. S. corynanthum (F. Muell.) B. Hyland; A; DQ088573; - CANB. S. sp. "Sulawesi 3"; PA, (EM WM?); DQ088612; DQ088525; -; ; -; Biffin 39 - CANB. S. crebrinerve (C.T. White) L. Johnson; A; Brown and Craven 92 - CANB. S. sp. "Sumatra 1"; WM; DQ088613; DQ088574; DQ088495; DQ088428; Biffin 40 - CANB. S. cumini (L.) DQ088526; DQ088446; Brown and Craven 140 - CANB; S. tenuiflorum Skeels; C (WM?); DQ088575; DQ088496; -; Biffin and Craven 66 - Brongn. & Gris.; NC; DQ088614; - ; DQ088447; Biffin and Craven 121 - CANB (FJ). S. erythrocalyx (C.T. White) B. Hyland; A; DQ088576; -; -; CANB. S. tetrapterum (Miq.) Chantaranothai & J. Parn.; WM; DQ088615; Gadek s.n. - JCT. S. fibrosum (F.M. Bail.) Hartley & Perry; A, PA; DQ088527; DQ088448; Brown and Craven 135 - CANB. S. tierneyanum DQ088577; DQ088497; DQ088429; RFK 2872 - QRS. S. francisii (F.M. (F. Muell) Hartley & Perry; A, PA; DQ088616; DQ088528; DQ088449; Bail.) L. Johnson; A; DQ088578; DQ088498; DQ088430; Hyland 6677 - Biffin 51 - CANB. S. wesa B. Hyland; A; DQ088617; DQ088529; QRS. S. fullagarii (F. Muell.) Craven; LHI; DQ088579; DQ088499; DQ088450; Gadek s.n. - JCT/Biffin 52 -CANB. S. wilsonii (F. Muell) B. DQ088431; Smith s.n. - CANB (LH). S. glenum Craven; A; DQ088539; Hyland subsp. wilsonii; A; DQ088618; DQ088530; DQ088451; Biffin 46 - DQ088464; DQ088400; Sankowsky 1701 - CANB (A). S. gracilipes (A. CANB. S. zeylanicum D.C.; WM; DQ088619; -; DQ088452; SBG 5 - Gray) Merr. & Perry; FJ; DQ088580; -; -; Biffin and Craven 4 - CANB CANB. Thaleropia queenslandica P.G Wilson; A; AF368223; DQ088460; (FJ). S. gui??ense Guill. & Perr.; Af; DQ088581; DQ088500; DQ088432; DQ088397; Harrington 283 - JCT Tristania neriifolia (Sims) R. Br.; A; van der Merwe 501 - PRU. S. gustavioides (F.M. Bail.) B. Hyland; A; AF368224; DQ088461; DQ088398; Telford 10900 - CANB. Waterhousea DQ088582; DQ088501; DQ088433; Biffin 41 - CANB. S. jambos (L.) floribunda (F. Muell) B. Hyland; A; DQ088620; DQ088531; DQ088453; Alston; C (WM?); DQ088583; DQ088502; DQ088434; Biffin 42 - CANB. Biffin 47 - CANB. W. hedraiophylla (F. Muell.) B. Hyland; A; DQ088621; S. kuebiniense J.W. Dawson; NC; DQ088584; DQ088503; -; Biffin and DQ088532; DQ088454; Biffin 48 - CANB. W. mulgraveana B. Hyland; A Craven 104 - CANB (NC). S. lateriflorum Brongn. & Gris.; NC; ; DQ088622; DQ088533; DQ088455; Gadek s.n. - JCT/Biffin 53 - CANB. DQ088585; DQ088504; DQ088435; Biffin and Craven 110 - CANB (NC). W. unipunctata B. Hyland; A; DQ088623; DQ088534; DQ088456; Biffin S. laxeracemosum (Guillaumin) J.W. Dawson; NC; DQ088586; 49 - CANB._

This content downloaded from 129.127.100.248 on Thu, 07 Apr 2016 23:56:33 UTC All use subject to http://about.jstor.org/terms