Gene Expression Profiling and Functional Activity of Human Dendritic Cells Induced with IFN-␣-2B: Implications for Cancer Immunotherapy1

2022 Vol. 9, 2022–2031, June 2003 Clinical Cancer Research

Advances in Brief Gene Expression Profiling and Functional Activity of Human Dendritic Cells Induced with IFN-␣-2b: Implications for Cancer Immunotherapy1

Federica Moschella, Brygida Bisikirska, tumor peptide Ag-specific autologous CD8؉ T cells to a Antonella Maffei, Kyriakos P. Papadopoulos, greater extent than DC4. Conclusions: The unique phenotype conferred by cul- Donna Skerrett, Zhuoru Liu, ␣ 2 turing DCs in IFN- -2b may be useful in adoptive transfer Charles S. Hesdorffer, and Paul E. Harris regimens where the destruction of tumor cells in situ, initi- The International Institute of Genetics and Biophysics, Naples, Italy ation of T-cell responses toward tumor tissue with unknown [A. M.], the Department of Pathology [D. S.], the Department of Ags, and/or enhancement of pre-existing Ag-specific mem- Surgery [Z. L.], the Division of Medical Oncology, Department of Medicine [F. M., B. B., K. P. P., C. S. H., P. E. H.], College of ory responses are desired outcomes. Physicians and Surgeons, Columbia University, New York, New York 10033 Introduction IFN-␣ is an immunoregulatory cytokine presently used Abstract clinically in a recombinant form for the treatment of tumors and chronic viral infections (1–3). Although the exact mechanism(s) Purpose: In this study, we have compared patterns of by which IFN-␣ promotes antitumor and antiviral responses is gene expression and functional activity of human dendritic still under investigation, it is known that IFN-␣ can act via cells (DCs) cultured under defined conditions in IFN-␣-2b selective toxicity toward transformed or virally infected cells, and recombinant human granulocyte macrophage colony- and that it modulates immune response (4). However, systemic stimulating factor (DCA) with cells grown in granulocyte administration of type I IFNs is associated with severe toxicity macrophage colony-stimulating factor and IL-4 (DC4) as an and significant side effects, thereby limiting its clinical appli- initial step in evaluating the clinical utility of DCA in cancer cations (5, 6). immunotherapy. DCs3 are central regulatory elements of both adaptive and Experimental Design and Results: Comparison of innate immune responses by virtue of their ability to activate mRNA transcript profiles between DCA and DC4 revealed naı¨ve T cells and recognize pathogen-associated molecule pat- different expression patterns for cytokines, chemokines, che- terns (7, 8). Our current understanding of DC biology in the mokine receptors, costimulatory molecules, and adhesion context of adaptive immunity suggests that the differentiation proteins. Many genes involved in antigen (Ag) processing state of the DC qualitatively affects their interaction with T were equally expressed in both populations; however, ex- lymphocytes. It is well documented that, depending on the pression of transcripts involved in Ag presentation was in- degree of maturation and direction of maturation, DCs will creased in DCA. DCA also showed up-regulation of Toll-like elaborate different profiles of cytokines and cell surface recep- receptor 2 and 3, as well as several tumor necrosis factor tors, and express different Ag processing and presenting abilities family ligands. Consistent with expression profiling, func- (9–11). Recent studies show that IFN-␣ strongly modulates DC tional assays demonstrated that DCAs were more potent function and maturation (12–17). For example, treatment of stimulators of naive T-cell responses than DC4 in an inter- peripheral blood monocytes with GM-CSF plus IFN-␣ induces leukin 15 and interleukin 1␤-dependent manner. DCA- rapid maturation of these cells into potent APCs for viral mediated tumor cell-directed cytotoxicity induced apoptosis epitopes (14). Other studies have found that type I IFNs induce in different human tumor cell lines and internalized apo- apoptotic cell death in cultures of mature DCs (15, 16). ptotic bodies to a greater extent than DC4. Lastly, in vitro We have developed GMP compatible culture methods for priming experiments, using apoptotic cells or peptide as the production of DCs used in cancer immunotherapy (18). To sources of Ag, showed that DCA drove the expansion of broaden our understanding of DC phenotypes obtainable under these culture conditions, we have systematically compared gene

Received 12/23/02; revised 2/18/03; accepted 2/20/03. The costs of publication of this article were defrayed in part by the 3 The abbreviations used are: DC, dendritic cell; GM-CSF, granulocyte payment of page charges. This article must therefore be hereby marked macrophage colony-stimulating factor; GMP, good manufacturing pro- advertisement in accordance with 18 U.S.C. Section 1734 solely to cedure; PBMC, peripheral blood mononuclear cell; IL, interleukin; Ag, indicate this fact. antigen; APC, antigen presenting cell; mAb, monoclonal antibody; Ab, 1 Supported by grants from the USPHS, NIH 1 K23 RR16078 (to antibody; CLIP, class II-associated invariant chain peptide; RT-PCR, K. P. P.), the Herbert Irving Cancer Center, and the Octoberwoman reverse transcription-PCR; ELISPOT, enzyme-linked immunospot Foundation. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF, tumor ne- 2 To whom requests for reprints should be addressed, at Medical On- crosis factor; TRAIL, tumor necrosis factor-related apoptosis-inducing cology, BB 20–13, 650 West 168th Street, New York, NY 10032. Phone: ligand; TWEAK, tumor necrosis factor-like weak inducer of apoptosis; (212) 305-7363; Fax: (212) 305-7348; E-mail: [email protected]. ATC, apoptotic tumor cell. Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. Clinical Cancer Research 2023

expression in DCA and DC4 using oligonucleotide microarrays. Cultures containing GM-CSF and IFN-␣2b yielded approxi- As a partial confirmation of gene profiling results we performed mately one-fifth the number of cells found in the GM-CSF and several semiquantitative assays of T-cell growth and effector IL-4 cultures. After culture, DCs were cryopreserved in autol- function. Our data show that type 1 IFN-treated DCs relative to ogous serum and 10% sterile DMSO, and stored in liquid cells cultured in GM-CSF and IL-4 have higher expression of nitrogen until use. In some experiments, the CD34-negative genes associated with immature DCs, e.g., genes involved in fraction of aphaeresis products were obtained from HLA- -positive breast cancer patients. DC cultures were initi 0201ءinflammatory site homing or chemoattraction of inflammatory A cells, yet at the same time, display increased levels of transcripts ated as described above, and CD8ϩ lymphocytes were isolated for costimulatory, adhesion and Ag presenting molecules. Func- from the nonadherent fraction using a CD8ϩ isolation and tional experiments demonstrated that IFN-␣-treated DCs have detachment kit (Dynal Biotech, Lake Success, NY) according to an increased capacity, relative to DCs produced in GM-CSF and the manufacturer’s instructions. CD8ϩ lymphocytes were cryo- IL-4, to: (a) stimulate naive T-lymphocyte allogeneic prolifer- preserved and stored in liquid N2 until use. ative responses; (b) induce apoptotic cell death in tumor cell Immunophenotyping of DCs. Immunophenotyping of lines; (c) internalize ATCs; and (d) drive Ag-specific CD8 the cultured cells was performed using a FACScan flow cytom- T-cell responses. eter and the CellQuest software. The mAb panel used included fluorochrome-conjugated Abs to CD1A, CD2, CD3, CD11B, CD11C, CD14, CD19, CD20, CD45, CD45RA, CD45RO, Materials and Methods CD56, CD80, CD83, CD86, and HLA-DR (Becton-Dickinson, Cells and Cell Culture. The tumor cell lines U87 and San Jose, CA). The amount of MHC CLIP bound to MHC class SK-BR-3 were cultured under standard conditions (humidified II, was measured using the CerCLIP mAb (Becton-Dickinson).

37°C, 5% CO2 atmosphere) using DMEM/F12 medium (Invit- Staining, washing, and analysis were performed as per the rogen Life Technologies, Inc., Carlsbad, CA), supplemented manufacturer’s recommendations (Becton Dickinson). with 10% heat-inactivated FCS (Atlanta Biologicals, Norcross, RNA Preparation and Array Hybridization. HG- GA) and Gentamicin (Life Technologies, Inc.). A closed GMP U95A GeneChips (Affymetrix, Santa Clara, CA), which query compliant system for culturing populations of monocyte- 10,000 genes (12,000 probe sets), were used for all of the enriched PBMCs, using flexible gas permeable cell culture bags analyses. The cRNA probes were synthesized as recommended and sterile connecting devices, was used as described previously by Affymetrix. Briefly, total RNA from nonadherent DCs (18). Aphaeresis products were obtained with Institutional Re- (1.5 ϫ 107 cells) was prepared in two steps using TRIzol view Board approval and informed consent. All of the materials (Invitrogen) followed by RNeasy (Qiagen, Valencia, CA) puri- and reagents used for the aphaeresis and DC culture were sterile fication. Double-stranded cDNA was generated from 5 ␮gof and endotoxin free (Ͻ0.05 endotoxin unit/ml by LAL assay). total RNA using the Superscript Choice System kit (Invitrogen). All of the DC culture materials and reagents were FDA ap- Biotinylated cRNA was generated by in vitro transcription using proved for human use with the exception of the plastic beads the Bio Array High Yield RNA Transcript Labeling System and IL-4. The PBMC product obtained from the aphaeresis (Enzo, Farmingdale, NY). The cRNA was purified using system (Spectra; COBE BCT, Lakewood, CO) was enriched for RNeasy. cRNA was fragmented according to the Affymetrix CD11C- and CD14-positive cells (ranging from 15% to 55% protocol, and 15 ␮g of biotinylated cRNA were hybridized to CD14 positive), and platelet-depleted relative to peripheral U95A microarrays (Affymetrix). After scanning, the expression blood. Cells were allowed to adhere to the beads and inner values for each gene were determined using Affymetrix Gene- surface of the beads, and nonadherent cells were removed by Chip software version 4.0 using algorithms that determine washing with serum-free AIM V medium (Therapeutic Grade; whether a gene is absent or present and whether the expression Invitrogen Life Technologies 0870112DK) containing L-gluta- level of a gene in experimental samples are significantly in- mine, 50 ␮g/ml streptomycin sulfate, and 10 ␮g/ml gentamicin creased or decreased relative to control samples. The fold sulfate. In some experiments, residual platelets were reduced to change score for each transcript was calculated using the aver- 5–10% of the level in the MNC product by centrifugation over age difference values, a measurement describing the hybridiza- Ficoll-Hypaque (Lymphoprep; Nycomed Pharma, Oslo, Nor- tion performance of each probe set member to the cRNAs way). Adherent cells were cultured in therapeutic grade AIM-V prepared from either DCA or DC4. Our selection of differen- medium containing recombinant human GM-CSF (50 ng/ml; tially expressed genes was based on the absolute call (Present), Sargramostim; Immunex, Seattle, WA) and IL-4 (1000 units/ml; average difference call (Increased or Decreased), and fold R&D Systems, Minneapolis, MN) or GM-CSF and IFN-␣2b change score Ͼ2. (10,000 units/ml; Intron A; Schering Co., Kenilworth, NJ). Semiquantitative RT-PCR. Total RNA (5 ␮g) from Neither FCS nor autologous human serum was added to the each sample was used as template for the reverse transcription culture medium. The bags were placed in a dedicated, HEPA- reaction. cDNA was synthesized using oligodeoxythymidylic filtered, humidified 37°C, 5% CO2 incubator. On the third day acid 18 primer (Invitrogen) and SuperScript II reverse tran- of culture, 50 ml of fresh AIM-V medium with GM-CSF and scriptase (Invitrogen). Oligonucleotides primers for the semi- IL-4 or IFN-␣2b was added to each bag (cultures and cells quantitative PCR of human IL-15, IL-2, and IL-1␤ were ob- designated DC4 or DCA, respectively). On day 6, nonadherent tained from Ambion (Relative RT-PCR kit; Ambion, Austin, cells were harvested and washed for additional testing. The yield TX). Primers for the semiquantitative PCR of human GAPDH of nonadherent cells from cultures using GM-CSF and IL-4 was were synthesized by Invitrogen and have the following se- routinely 1% of the total number of cells introduced into the bag. quences: (GAPDH-F) CGCTCTCTGCTCCTCCTGTTCG and

(GAPDH-R) CCGTTCTCAGCCTTGACGGTGC. PCRs were ELISPOT Assay. Nitrocellulose bottom, 96-well plates performed using Platinum TaqDNA Polymerase (Invitrogen) in (Multiscreen HA cellulose; Millipore) were coated overnight at the presence of 0.5 ␮M forward and reverse primers as recom- 4°C with antihuman IFN-␥ mAb (2 ␮g/ml, 1-D1K; MABTECH, mended by the manufacturer. The samples were amplified for Stockholm, Sweden), washed with PBS, and blocked with 10% 10, 20, and 30 cycles at the following conditions: 30 s at 94°C, human AB serum. Cultured lymphocytes were seeded at 1 ϫ 30 s at the indicated annealing temperature, and 45 s at 72°C. 103,5ϫ 103, and 2 ϫ 104 cells/well. In autologous system The annealing temperatures were: 65°C (GAPDH), 61°C (IL- experiments, 5 ϫ 104 T2 (HLA-A2 positive) target cells were 15), 57°C (IL-2), and 59°C (IL-1␤). The best conditions to incubated overnight with 10 ␮g/ml HER-2 peptide, or T2 cells preserve linear amplification were established as described pre- without peptide were added to wells containing effector lym- viously (11). Electrophoresis of the PCR products was per- phocyte populations. In experiments using alloantigens for T- formed on a 2% agarose gel containing 1 ␮g/ml of ethidium cell activation, irradiated DC4 cells were used as secondary bromide. The images from the ethidium bromide-stained gel stimulator target cells. T cell-APC cultures were incubated for were captured with the Kodak DC120 Zoom digital camera, and 20 h in RPMI 1640 with 10% human AB serum at 37°C, the light intensity of the bands was quantified using the Kodak followed by washing the plates thoroughly with PBS to remove Digital Science 1D image analysis software (Eastman Kodak, cells. To detect T lymphocyte-secreted IFN-␥, a detection mAb Rochester, NY). Lymphokine band intensities were normalized (0.2 mg/ml, 7-B6-1-biotin; MABTECH) was added to each to the signal of GAPDH in each sample and plotted for com- well. After washing and incubation with streptavidin-alkaline parison of the relative amounts of transcripts in DCA versus phosphatase (1 ␮g/ml; MABTECH), a buffered substrate DC4. (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium; Stimulation of Allogeneic T Cells. Allogeneic PBMCs Sigma) solution was added to each well and the plate developed were prepared from heparinized peripheral blood obtained from at room temperature. After washing, the dark-violet spots were normal donors with informed consent and Institutional Review counted under a dissection microscope. Board approval. PBMCs were cultured with various numbers of DC-mediated Killing of Human Tumor Cells. To de- irradiated (50 Gy) stimulator cells (either DCA or DC4) at termine DC-induced tumor cell death, 5 ϫ 104 U87 tumor cells different PBMC:DC ratios using RPMI 1640 supplemented with were incubated with various numbers of DCA or DC4 effector 10% heat-inactivated FCS (Invitrogen) and antibiotics. In the cells for 12 h (E:T ratio 4:1; 20:1). Apoptotic cell death was indicated experiments, a naive T-cell fraction of PBMCs was measured by flow cytometry using FITC-conjugated annexin V prepared by positive selection using anti-CD3, followed by and propidium iodide as per the manufacturer’s protocol (Ap- CD45RA-coated magnetic microbeads (Miltenyi Biotec Inc., optosis Detection kit;R&DSystems). CellQuest software Auburn, CA) according to the manufacturer’s recommendations (Becton-Dickinson) was used for the analysis and gating of and used in the mixed lymphocyte cultures. In the indicated living, necrotic, and apoptotic populations. MLC experiments, neutralizing mAbs to IL-15, IL-1␤,oran Tumor Cell Uptake by DCs. Single cell suspensions isotype-matched control mAb (1.5 and 10.0 ␮g/ml;R&D were prepared from tumor cell cultures (either U87 or SK-BR-3) Systems) were added at the initiation of the cultures. Cultures using EDTA in Caϩ2-free PBS. In some experiments the cells were maintained in a humidified atmosphere at 37°C and 5% were resuspended in phenol red-free RPMI 1640 (Life Technol- 3 5 CO2. Lymphocyte proliferation was determined by [ H]thymi- ogies, Inc., Grand Island, NY) at a concentration of 5 ϫ 10 dine incorporation (1 ␮Ci/well) during the final 18 h of the fifth cells/ml, and apoptosis was induced by irradiating tumor cells day of culture. Experimental samples were plated in triplicate, with 10 J/m2 (UVB 254 nm; UV Stratalinker 1800; Stratagene, harvested, and the radioactivity was measured using a beta La Jolla, CA). For the study of tumor cell internalization by scintillation counter (Perkin-Elmer Biosciences, Shelton, CT). DCs, tumor cells (both UVB-irradiated and controls) were In Vitro Stimulation of Ag-specific CD8 T Cells. Cryo- ␮ stained green with 2 g/ml DiOC16 (Molecular Probes, Eugene, preserved CD8ϩ lymphocytes from breast cancer patients were OR) for 30 min at 37°C in PBS and washed three times in thawed, washed, counted for viability, and resuspended in com- complete medium. A 20-h incubation was performed to allow plete medium. Autologous irradiated DCA or DC4 were loaded for the tumor cells to undergo apoptosis. Tumor cells were then for4hat37°C with the synthetic peptide KIFGSFLAF (10 cocultured with DCs at two different E:T ratios (1:1 and 1:5). ␮g/ml; American Peptide Co., Burlingame, CA) corresponding The cells were harvested 6 h later, and DCs were stained with to residues 369–378 of the human HER-2 protein, then washed phycoerythrin-labeled anti-CD11C mAb. Two-color flow cy- 5 and seeded into 96-well plates (Corning) at 5 ϫ 10 cells per tometry was performed to determine the percentage of cells that well in complete AIM V medium supplemented with 10% phagocytosed ATCs, based on the number of double-positive human AB serum (Sigma, St. Louis, MO). In parallel experi- cells. The same experiment was performed at 4°C to assess ments, DCs were incubated for 2 days with apoptotic HER-2 ϩ passive association of tumor and DCs, and passive transfer of SK-BR-3 cells (1:1) before being used as APCs. CD-8ϩ T cells DiOC16. were added at a 10:1 ratio (T:DC). Cultures were incubated at

37°Cina5%CO2, humidified atmosphere. After 24 h, IL-2 and IL-7 (2.5 ng/ml and 10 ng/ml, respectively, both obtained from Results R & D Systems) were added to the culture wells. Cultures were Immunophenotype of Cultured Cells. The nonadherent fed on days 3, 5, and 7 with additional medium containing IL-2. cell populations were harvested after 6 days of culture with After the expansion period, T-cell cultures were rested for an GM-CSF and IL-4 or GM-CSF and IFN-␣-2b, and immunophe- additional 4 days by feeding with medium alone. notyped using a panel of fluorochrome-conjugated mAbs (Fig.

Fig. 1 Immunophenotype of DCA and DC4. Human myeloid adherent cells were cultured in serum-free medium containing GM-CSF and IFN-␣-2b or GM-CSF and IL-4 for 6 days, and then phenotyped by immunofluorescent flow cytometry. The data are displayed as histograms with cell numbers plotted against fluorescence intensity. The ⅐⅐⅐⅐ represent the isotype-matched negative control Ab. The OOO represent staining with specific Abs. The expression of MHC CLIP on DCA and DC4 populations was determined by indirect immunofluorescence staining using CerCLIP mAb followed by a FITC-conjugated goat antimouse Ab (OOO). DCs stained with FITC goat antimouse alone are shown by ----. Results are representative of more than eight independent experiments using aphaeresis material from healthy individuals (n ϭ 2) as well as patients treated for breast cancer (n ϭ 2), multiple myeloma (n ϭ 3), and other malignancies (n ϭ 3).

1). Flow cytometric measurements showed nearly unimodal for probe preparations, and hybridization conditions were repro- distributions of many of the cell surface markers studied. Both ducible. Differences in intensity scores Ͼ2-fold are likely to DCA and DC4 populations lacked the expression of CD14, reflect real differences in gene expression. This comparison displayed high expression of CD11B, and were positive for analysis showed that 793 genes (6%) were increased (Ͼ2-fold) CD11C, HLA-DR Ags, and CD83. This is consistent with the in the IFN-␣ treated cells and 893 (7%) were decreased (less immunophenotype of DCs produced by the methods we have than one-half) relative to DC4. The overall correlation coeffi- described previously (11, 18). Notably, the DCs produced under cient was 0.78. A partial list of the differentially expressed these conditions have higher expression of CD83 and HLA-DR genes characterized by transcript profiling is presented in Table molecules than those produced using peripheral blood mono- 1. The level of mRNA specific for inflammatory chemokine cytes and GM-CSF plus IL-4 alone, and are similar to the more receptors, typically expressed by immature DCs (CCR1 and mature DCs reported by others (19, 20). In addition, the surface CCR2), was increased in DCA versus DC4; the expression of expression of CD11C and CD80 was up-regulated in IFN-␣- CXCR1 (IL-8R␣) and CCR3 (CCRL2) was unchanged (data not treated cells relative to DC4 cells. Expression of the HLA CLIP, shown). Transcript levels for receptors for lymphoid chemo- bound within the Ag-binding cleft of HLA-DR, was measured kines like CCR4, CCR7, and CXCR4, of which the expressions by flow cytometry. DCA showed no detectable HLA-DR-bound are known to be up-regulated on DC maturation, were either not CLIP, whereas CLIP was detectable on DC4 similar to levels detected, not changed, or decreased. Additionally, inflammatory detected on other APCs (21). Both cell populations studied chemokines such as RANTES, I-309, MIP-1 ␣ and ␤, MIP-2 ␣ contained no CD3-, CD19-, CD20-, or CD56-positive cells (data and ␤, Nap-2, and MCP-1 were shown to be increased in not shown). IFN-␣-treated cells, whereas MCP-4 and MPIF-1 were down- Identification of Differentially Expressed Genes. The regulated. Lymphoid chemokine genes were either equally ex- Affymetrix oligonucleotide arrays used in these experiments pressed in both culture conditions (TARC, MDC, MIF, IL-8, detects 12625 gene products, among which 46.5% were ex- and PARC, data not shown) or not detected (ELC and MIG; data pressed in the DC4 and 50% in DCA. RNA transcript levels for not shown). Increased quantities of transcripts for IL-1, IL-6, different genes were assessed by using Affymetrix software. and IL-15 were detected in DCA, whereas IL-12, IL-10, and The relative abundance of a particular mRNA was expressed as IL-13 transcripts were not detected in either DC subset (data not the “average difference.” This was calculated from the differ- shown). The presence of increased message for IL-1␤ and IL-15 ence in fluorescence intensity given by a labeled RNA sample in DCA relative to DC4 was confirmed by semiquantitative when hybridized to oligonucleotide probe set members built to RT-PCR (Fig. 3). Higher levels of expression of the genes match a particular gene sequence versus the intensity when encoding the receptors for these ILs (IL-15, IL-1, and IL-6), as hybridized to oligonucleotide probes mismatched by one base. well as for IL-7 R and IL-8 R, were found in DCA relative to To get an overall impression of the differences in gene expres- DC4. Genes involved in Ag uptake (CD32␣ and CD64; data not sion between the different types of DCs, we plotted the log base shown) were equally expressed in both DCs, with the exception 2 values for average differences obtained for each gene in DCA of mRNAs encoding CD32 ␤, DEC-205, and Fc-␰ receptor, versus DC4 (Fig. 2). Many of the specific transcripts measured which were down-regulated. in DCs were distributed along the diagonal line of “identity” Comparison of the levels of transcripts for HLA-DM in indicating that cell culture, RNA isolation, reverse transcription DCA with DC4 showed a modest increase, whereas the levels of

Fig. 2 Pair-wise comparison of gene expression in DCA and DC4. Comparison of expression data were performed by XY-scatterplot analysis of log base 2-transformed cRNA hybridization intensity data. Expression profiles were obtained from myeloid-adherent cells cultured in GM-CSF and IL-4 or with GM-CSF and IFN-␣. Each point represents the normalized expression of an indi- vidual gene within both mRNA populations. The OOO represents the predicted line of identity. The ---- indicate the thresholds of Ͼ2-fold or less than one-half expression ratios. Results are from a representative profiling experiment in a series of two.

the HLA-DM inhibitor, HLA-DO, remained unchanged. We more active than DC4s in inducing the proliferation of alloge- wondered whether the change in the balance of HLA-DM and neic PBMCs at intermediate responder:stimulator ratios (Fig. 4). HLA-DO might result in more release of the CLIP from HLA Gene profiling and RT-PCR experiments both demon- class II molecules on DCA. Immunofluorescent flow cytometry strated that DCA expressed higher levels of transcripts for IL-1 analysis demonstrated that there was indeed a decrease in the ␤ and IL-15 than DC4. To determine the relative roles of IL-15 amount of HLA-DR-bound CLIP on the cell surface of DCA and IL-1␤ in the enhanced proliferative responses mediated by (Fig. 1). DCA, we repeated the mixed lymphocyte reaction cultures Increased levels of transcripts for the proteasome activator substituting a naive T-cell population (CD3ϩ and CD45RAϩ) hPA28, TAP-2, HLA-E, the lysosomal trafficking regulator, for total PBMC as allogeneic responders and irradiated DCA or LYST, and CD-1E were also found in DCA, whereas no DC4 as stimulator cells. In these cultures neutralizing Abs to changes in expression were discovered for HLA-DR, HLA-DP, IL-1␤ or IL-15 were added at the initiation of culture. Neutral- CD1A, CD1B, CD1C, CD1D, LAMP1 and 2, HLA-A, HLA-C, ization of IL1␤ or IL-15 (at 10 ␮g/ml) significantly depressed and HLA-G (data not shown). IFN-␣ treated DCs also displayed the T-cell proliferative response in cultures with DCA (Fig. 5, increased amount of transcripts for costimulatory and adhesion top panel). Isotype matched control Abs had no effect on allo- molecules (CD80, integrin ␣ 7, and ICAM-3) and decreased geneic T-cell proliferation. This effect was not observed in expression of integrin ␣ E, integrin ␣ 6B, and integrin ␤ 5. cultures of T cells stimulated by DC4 (Fig. 5, bottom panel)or Furthermore, the expression of six members of the TNF family, when unseparated CD3ϩ lymphocytes (i.e., mixtures of all involved in the induction of apoptosis, TNF-␣, TRAIL, CD45RO and CD45RA) were used (data not shown). After CD30 ligand, homologous to limphotoxins, exhibits inductible secondary allogeneic challenge, cultured T cells that had been expression and completes with HSV glycoprotein D for HVEM primed with DCA showed a greater frequency of IFN-␥- on T-cells, TWEAK, and Fas were found increased in DCA. Transcripts for members of the toll-like receptor family pathway producing cells than cultures primed by DC4 (data not shown). ␣ (TLR 2 and 3, and MyD88), involved in microbial lipopeptide IFN- -treated DCs Induce Apoptotic Cell Death of Tu- ␣ and double-stranded RNA recognition, were increased in DCA. mor Cells. As shown in Table 1 IFN- -treated DCs express a ␣ No T- or B-cell lineage-specific transcripts were detected in higher amount of transcripts for TNF- , TRAIL, CD30L, herpes these arrays (e.g., CD3, CD7, or CD19). virus entry mediator, and TWEAK than DC4. Because this Effect of DCA and DC4 on T-Lymphocyte Activation, group of proteins have been described previously to be involved Proliferation, and Maturation. Both immunofluorescence in the induction of apoptosis, we compared the cytotoxic activity and transcript profiling analysis of DCA and DC4 showed of DCA and DC4 toward a TRAIL-sensitive (death receptor significant alterations in the levels of transcripts for costimula- 5-positive) human glioma tumor cell line (22) using an apoptotic tory molecules (e.g., CD80), as well as quantitative differences cell death assay. The presence of phosphatidylserine on the in several cytokines driving CD4 and CD8 T-cell differentiation outer leaflet of target cell membranes was measured with an- (e.g., IL-1␤, IL-6, and IL-15). To begin to understand the nexin V-FITC, and necrotic cells were enumerated by pro- functional consequences of these differences, we performed pidium iodide uptake (23). Flow cytometric measurements re- several semiquantitative measurements of T-cell development vealed that a significantly higher percentage of U87 glioma cells and acquisition of effector function after interaction with either became apoptotic when incubated with DCA compared with population of DCs. First we compared the ability of irradiated DC4 (20:1 E:T ratio; mean value from two experiments of 19% DCA and DC4 to stimulate allogeneic T-cell responses in a versus 33%; P ϭ 0.03 by paired Student’s t test; Fig. 6). In one-way mixed lymphocyte reaction. DCAs were significantly control experiments, apoptotic cell death of DC4, DCA, or of

Table 1 Gene expression changes in DCs cultured with GM-CSF ϩ Table 1 Continued IFN-␣-2b versus GM-CSF ϩ IL-4 Fold change Genebank Fold change Genebank Functional family/gene name DCA/DC4 accession no. Functional family/gene name DCA/DC4 accession no. Chemokine receptors LIGHT 2.7 AF064090 CCR2 14.9 U03905 TWEAK 2.3 AF055872 CCR2, alternate splice variant 11.7 U03905 RANK Ϫ5.6 AF018253 CCR1 1.8 L09230 TRAF5 Ϫ2.5 AB000509 CXCR4 Ϫ2 L06797 Toll Pathway CCR4 NDa X85740 MyD88 3.5 U70451 Chemokines Toll-like receptor 3 (TLR3) 6.9 U88879 MCP-2 30.5 Y16645 Toll-like 2 (TLR2) 3.7 AF051152 I-309 23.6 M57506 Miscellaneous Nap2 10.6 M54995 Leukocyte immunoglobulin- RANTES 5.2 M21121 like receptor-3 Small inducible cytokine b11 4.2 AF030514 (ILT5 or LR-3) similar to 3.0 AF025533 MCP-1 4 M26683 ILT-3 MIP-2 B 3.3 M36821 Leukocyte immunoglobulin- MIP-1 B 3.1 J04130 like receptor-7 Ϫ MIP-2 A 3 M36820 (ILT 1 or LIR-7) 2.7 AF025531 MIP-1 A 2 D90144 Leukocyte immunoglobulin- MCP-4 Ϫ4.7 AJ001634 like receptor-4 Ϫ MPIF-1 Ϫ11 AF088219 (ILT 6 or LIR-4) 2.6 AF025527 Interleukins a ND, not detected. IL-1B 45.7 X04500 IL-1B Converting Enzyme 7.1 U13697 IL-15 5.2 AF031167 Flt ligand 3.7 U03858 IL-6 2.0 X12830 the tumor cell line alone was determined. As shown in Fig. 6, Interleukin Receptors there was little apoptotic death in DC4 or DCA cell populations. IL-7 R 11 M29696 Increased Uptake of ATCs by DCA. The ability of DCA ␣ IL-15 R 7.3 U31628 and DC4 to uptake tumor cells was evaluated using a flow cytom- IL-1 R2 4.8 X59770 IL-3 R␣ 3.3 D49410 etry-based assay (24). We first compared the efficiency of DCA IL-8 R␤ 2.9 L19593 and DC4 in internalizing apoptotic U87 glioma cells. After induc- GM-CSF R 2.5 M73832 tion of apoptosis by UVB irradiation, ATCs were cocultured for 6 h IL-6 R 2.1 X12830 with either DCA or DC4 at two DC:tumor cells ratios, 1:1 (data not Ag uptake and Presentaion TAP-2 43.7 M74447 shown) and 1:5. A significant increase in the percentage of CD11C LYST 3.6 U70064 and DiOC16 double-positive cells (Fig. 7B), at both cell ratios, was HLA-DQB1 3.2 M60028 seen in experiments with DCA relative to DC4 (3–5-fold increase; HSP70-2 2.8 M59830 P Ͻ 0.05 by paired Student’s t test). To assess whether DCAs were Proteasome activator hPA28 2.4 D45248 able to internalize living tumor cells (presumably after inducing HLA-E 2.9 X56841 HLA-DMB 2.8 U15085 apoptosis), living unirradiated tumor cells were coincubated with HLA-DMA 2.4 X62744 DCA and DC4. Again, DCA showed greater uptake of tumor cells CD-1E 2.4 X14975 relative to DC4 (Fig. 7C;2–5-fold increase; P Ͻ 0.01 by paired ␣ HLA-D Class II DO chain NC M29335 Student’s t test). The same series of experiments was also per- HLA-D Class II DO ␤ chain NC X03066 CD-32 ␤Ϫ3.5 M28696 formed at 4°C to show that the uptake of tumor cells was inhibited DEC-205 Ϫ6.7 AF011333 at low temperature, indicating an active uptake rather than a tight Fc-⑀ receptor Ϫ76.8 M15059 association of DCs with U87 cells (Fig. 7, B and C). Similar results Costimulatory and Adhesion Molecules showing that increased uptakes of SK-BR-3 cells by DCA relative CD-80 12.9 M27533 to DC4 were also obtained using this assay (data not shown). Integrin ␣ 7 2.5 AF032108 -ICAM-3 2.1 X69819 DCAs Induce Increased Ag-specific CD 8؉ T-Cell Re Integrin ␣ E Ϫ8.6 L25851 sponses. Transcript profiling characterization of DCA overall Integrin ␣ 6B Ϫ3.7 S6213 showed up-regulation of many genes that, acting in concert, ␤ Ϫ Integrin 5 2.8 M35011 could result in enhanced Ag presentation and T-cell effector Other CD CD44 Ϫ1.9 L05424 function. To test this hypothesis, we prepared DCA and DC4 CD59 Ϫ2.5 M84349 from the CD34-negative fraction of aphaeresis products from positive. At-0201ءCD43 Ϫ7.3 X52075 two breast cancer patients who were HLA-A CD3E ND M23323 the same time CD8ϩ T cells were isolated for later use. At the CD19 ND M28170 end of the DC culture period, we prepared apoptotic cells from TNF Family TRAIL 67.7 U37518 the HER-2/neu-overexpressing cell line SK-BR-3 (25). DCs CD30 ligand 5.7 L09753 were cultured with apoptotic SK-BR-3 cells for 2 days and then TNF␣ 5.1 X02910 used for priming autologous CD8ϩ lymphocytes. In some cul- Fas/apo-1 2.8 X63717 tures we substituted tumor cells with a synthetic peptide corre-

Fig. 4 Comparison of stimulation of allogeneic PBMC by DCA and Fig. 3 Relative levels of transcripts for IL-15, IL-1␤, and IL-2 in DCA DC4. Irradiated DCA or DC4 cells were cultured with fixed numbers of and DC4. Total mRNA from the same DCA and DC4 samples used in allogeneic PBMCs at the indicated ratio. After 5 days of culture, transcript profiling experiments were reverse transcribed and analyzed proliferation was determined by [3H]thymidine incorporation assay. The for content of specific transcripts for IL-15, IL-1␤, IL-2, and GAPDH results from two experiments are shown using PBMCs from two dif- using a semiquantitative PCR assay. The amount of amplified products ferent individuals and DCs cultured from two different individuals; bars, were measured and normalized to the signal of GAPDH. Data are ϮSE of triplicate determinations. Significance of the difference between representative from two repeat determinations. mean values of proliferation for DCA and DC4 was calculated by the method of Student. The P for the difference in means at the peak of proliferation is shown.

sponding to residues 369–378 of the HER-2 oncoprotein. Cul- tured T cells were expanded with IL-2 and -7. Ag-specific T-cell effector frequencies were measured at the end of the culture soluble factor that is involved in mediation of inflammatory re- ␥ period using an IFN- ELISPOT assay. Although the effector sponses in innate immunity as well as in adaptive immunity, acting ϳ frequencies were low ( 0.1%) we were able to detect enhanced as a costimulator or growth factor driving T-cell expansion after HER-2 peptide-specific HLA-A2-restricted T-cell responses activation. DCAs were also shown to have increased levels of when DCAs were used as APCs and when apoptotic cells were mRNA for IL-1-␤ converting enzyme isoform ␤, IL-6, and IL-15. used as a source of Ag (Fig. 8). HER-2 Ag-specific T-cell The combination of augmented levels of transcripts for these responses were generally lower in the T-cell population ob- growth factors, all characterized previously to be active in support- tained from a patient whose tumor did not express HER. ing naive T-cell proliferation (30–32) suggested that DCAs might also be more effective than DC4s in supporting naive T-cell pro- Discussion liferation. Our experiments using neutralizing Abs to IL-1␤ and Although the in vivo relevance of DCA remains to be estab- IL-15 demonstrate the role of these cytokines in the proliferative lished, it is tempting to postulate that certain manifestations of responses driven by DCA. We were unable to detect expression of autoimmunity (26) or the antitumor effects associated with IFN-␣ IL-12 p35 and p40 subunits in either DC population, suggesting therapy are related to the patterns of gene expression and functional that the proliferative effects of IL-12 were subordinate to the activity of DCA described in this and similar studies (12–17). actions of IL-1␤ and IL-15. Transcript profiling of DCA also On the basis of the expression levels of a series of chemo- demonstrated increased levels of transcripts for several IL-recep- kines, cytokines, and receptors, this study reveals that IFN-␣- tors, additionally supporting the concept of autocrine activation of treated DCs share many characteristics of mature DCs, yet retain DCA mediated by IL-15, IL-6, and IL-1␤ (17, 33). expression of many genes associated with an immature pheno- Immature myeloid lineage DCs are characterized by their type (Table 1). Compared with DC4, DCAs express more tran- proficiency in Ag capture. After maturation-induction, Ag cap- scripts for inflammatory chemokine receptors responsible for ture proficiency is exchanged for enhanced capacity of Ag DC migration to inflamed tissues and reduced quantities of presentation and T-cell activation (7). In this context, our mo- lymphoid chemokine receptors that drive DC migration to the lecular and functional data suggest that DCAs share character- lymph nodes (10). The pattern of inflammatory chemokine istics of both immature and mature DCs. The expression of a transcripts in DCA was typical of DCs found in peripheral large group of genes involved in Ag uptake was similar in DCA tissues (i.e., MIP-1 ␣ and ␤, MIP-2 ␣ and ␤, Nap-2, I-309, and and DC4 populations. However, we did detect a modest increase MCP-1). Such inflammatory chemokines are responsible for the in transcripts encoding two subunits of HLA-DM (HLA-DMA recruitment of immature DCs, macrophages, granulocytes, and and HLA-DMB), a complex that catalyzes not only the release effector/memory T cells to the site of inflammation (27, 28). of the invariant chain remnant, CLIP, but other low-stability DCA are also characterized by augmented expression of typ- peptides, resulting in the favored binding of high-stability pep- ically DC maturation-induced genes such as pro-IL-1 ␤ (29), a tides (34). As a consequence of higher HLA-DM expression, we

Fig. 5 Effect of neutralizing Abs to IL-1␤ and IL-15 on naive allogeneic T-cell stimulation by DCA and DC4. Varying numbers of irradiated Fig. 6 Induction of apoptosis by DCA and DC4. U87 glioma cells (5 ϫ ϩ ϩ DCA or DC4 were added to cultures of allogeneic CD3 , CD45RA 104) were incubated with DC effector cells for 12 h (E:T ratio 4:1 and ␤ lymphocytes. At the initiation of culture, neutralizing mAbs to IL-1 20:1). Cells were stained with FITC-conjugated annexin V and pro- ␮ ␮ (10 g/ml), IL-15 (10 g/ml), or control isotype-matched mAbs were pidium iodide, and analyzed by flow cytometry. Tumor cells and DCs added. Proliferation was determined on the fifth day of culture by 3 were discriminated on the basis of forward and side scatter. DCA and [ H]thymidine incorporation assay. Results are presented as a stimula- DC4 samples (without glioma cells) are included as controls to measure tion index where the proliferative response to allostimulation is shown their contribution to the apoptotic population captured in the analysis relative to the thymidine incorporation of T cells alone. Cryopreserved gate The percentage of apoptotic cells (FITC-annexin V-positive and DCs were used in these experiments. Data obtained from three inde- propidium iodide-negative) within the analysis gate is indicated in the pendent experiments using DCs from three individuals. Top panel, bottom right quadrant. Dot plot data shown is from one of the three DCA. Bottom panel, DC4. Significance of the difference between mean separate experiments. values of proliferation in the presence or absence of neutralizing Abs was calculated by the method of Student. The P for the difference in means at the peak of proliferation is shown; bars, ϮSD.

CD-34ϩ progenitor-derived DCs (cultured with GM-CSF and TNF-␣) and peripheral blood monocyte-derived DCs (cultured in observed that the amount of CLIP bound to cell surface MHC-II GM-CSF plus IL-4) were maturation-induced with IFN-␤ (37). molecules of DCA was reduced relative to DC4. Under the conditions used in this study (without additional matu- Our functional studies demonstrate that myeloid DCs treated ration factors), we found that DCAs express high levels of tran- with IFN-␣-2b acquire cytotoxic activity similar to other effectors scripts encoding TRAIL and four additional members of the TNF of innate immunity. Previous reports have demonstrated that IFN- family involved in the induction of programmed cell death, TNF-␣, stimulated lymphoid cells (T cells and natural killer cells) can CD-30 Ligand, herpes virus entry mediator, and TWEAK. Accord- express TRAIL and kill TRAIL-sensitive target cells (35). Other ing to the gene expression pattern, we found that DCAs were more investigators have shown that IFN-stimulated human monocytes effective than DC4s in inducing apoptosis in TRAIL-susceptible and DCs can mediate cellular apoptosis in TRAIL-sensitive tumor tumor cell lines. cell targets. In one study, DCs were cultured with IFN-␥, IFN-␣, We compared the capacity of DCA and DC4 to phagocytose GM-CSF, and CD40L or lipopolysaccharide (36); in other studies ATCs. As shown by flow cytometric measurements, DCAs more

Fig. 8 Stimulation of Ag-specific CD 8ϩ T-cell responses by DCA and DC4. DCA and DC4 cells were cultured from aphaeresis products of two breast cancer patients. DCs were then loaded with apoptotic SK-BR-3 cells or synthetic HER-2 tumor Ag peptide. Autologous CD8ϩ T cells were added to the cultures. Responding T cells were expanded with additional IL-2 and IL-7. After 12 days the frequency of HER-2 peptide-specific T cells was determined by IFN-␥-specific ELISPOT assay. Wells containing T cells alone showed no significant signal. Results are representative from two repeat experiments using cells from two donors. Bars, ϮSE from triplicate measurements. Sig- nificance of the difference between mean values of the frequency IFN-␥-producing cells was calculated by the method of Student.

receptor family, support the concept that innate immune responses can be channeled by DCs to support the adaptive immunity. It has been proposed that the exchange of Ag uptake and processing capacity for efficient Ag presentation and T-cell priming during DC maturation is a regulatory mechanism preventing T-cell auto- reactivity. Our results suggest that DC maturation in the presence of IFN-␣-2b partially uncouples this exchange and that DCs with this phenotype may be useful in tumor immunotherapy. Clinical DC-based tumor immunotherapy has mainly Fig. 7 Internalization of tumor cells by DCs. U87 cells were stained ϫ 5 focused on the use of tumor-associated Ag-derived peptides green with DiOC16 for 30 min at 37°C in PBS. Five 10 tumor cells/well were irradiated with 10 J/m2 (UVB 254 nm) and incubated for for the induction of antitumor cytotoxic T lymphocytes. The 20 h to allow cells to undergo apoptosis. In separate experiments alternative strategy, in which whole tumor cells or various unirradiated tumor cells were separately cultured with DCs (E:T ratio tumor preparations are taken-up and presented by DCs to T 1:5). The cells were harvested 6 h later; DCs were stained with phyco- cells, potentially resulting in polyvalent immunization of the erythrin-labeled anti-CD11C Ab (FL2) and analyzed by flow cytometry. Y-axis measurements are the fluorescent intensity of CD11C. X-axis host to multiple (unknown) tumor-associated Ags, is also under study (38). DCs pulsed with necrotic or ATCs, or measurements are the fluorescent measurement of DiOC16. Results are representative from a series of three experiments. possibly introduced into the tumor bed, could represent an alternative to peptide-based DC immunotherapy protocols, particularly where tumor-associated Ags are unknown, and IFN-␣ might represent a potent factor to be used for the readily internalized ATCs than DC4s. When live tumor cells were production of DCs used in this latter approach, although substituted for ATCs in culture, this activity was retained. Conso- certainly to be used with caution. nant with these observations, we found that DCAs were more effective than DC4 APCs in generating a HER-2-specific CTL response when ATCs were used as an Ag source. References Overall our results demonstrate that IFN-␣-treated DCs have 1. Dowding, C., Gordon, M., Guo, A. P., Maison, D., Osterholz, J., Siczkowski, M., and Goldman, J. Potential mechanisms of action of a mixed immature-mature phenotype, efficiently take-up apoptotic interferon-␣ in CML. Leuk. Lymphoma, 11: 185–191, 1993. cells and Ags, and readily stimulate T-lymphocyte activation and 2. Wetzler, M., Kantarjian, H., Kurzrock, R., and Talpaz, M. Interfer- proliferation. These characteristics, coupled with the cytotoxic ac- on-␣ therapy for chronic myelogenous leukemia. Am. J. Med., 99: tivity of DCA and increased expression of members of toll-like 402–411, 1995.

3. Kirkwood, J. M., Ibrahim, J. G., Sosman, J. A., Sondak, V. K., hematopoietic progenitor cell line are derived from intracellular pro- Agarwala, S. S., Ernstoff, M. S., and Rao, U. High-dose interferon teins. Blood, 87: 5104–5112, 1996. alfa-2b significantly prolongs relapse-free and overall survival com- 22. Choi, C., Kutsch, O., Park, J., Zhou, T., Seol, D. W., and Ben- pared with the GM2-KLH/QS-21 vaccine in patients with resected stage veniste, E. N. Tumor necrosis factor-related apoptosis-inducing ligand IIB-III melanoma: results of intergroup trial E1694/S9512/C509801. induces caspase- dependent interleukin-8 expression and apoptosis in J. Clin. Oncol., 19: 2370–2380, 2001. human astroglioma cells. Mol. Cell. Biol., 22: 724–736, 2002. ␣ ␤ 4. Biron, C. A. Interferons and as immune regulators–a new look. 23. Wu, M., Das, A., Tan, Y., Zhu, C., Cui, T., and Wong, M. C. Immunity, 14: 661–664, 2001. Induction of apoptosis in glioma cell lines by TRAIL/Apo-2l. J. Neu- 5. Minasian, L. M., Motzer, R. J., Gluck, L., Mazumdar, M., Vlamis, rosci. Res., 61: 464–470, 2000. V., and Krown, S. E. Interferon alfa-2a in advanced renal cell carci- 24. Hoffmann, T. K., Meidenbauer, N., Dworacki, G., Kanaya, H., and noma: treatment results and survival in 159 patients with long-term Whiteside, T. L. Generation of tumor-specific T-lymphocytes by cross- follow-up. J. Clin. Oncol., 11: 1368–1375, 1993. priming with human dendritic cells ingesting apoptotic tumor cells. 6. Vial, T., and Descotes, J. Clinical toxicity of the interferons. Drug Cancer Res., 60: 3542–3549, 2000. Saf., 10: 115–150, 1994. 25. van de Vijver, M. J., Mooi, W. J., Wisman, P., Peterse, J. L., and 7. Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Nusse, R. Immunohistochemical detection of the neu protein in tissue Y. J., Pulendran, B., and Palucka, K. Immunobiology of dendritic cells. sections of human breast tumors with amplified neu DNA. Oncogene, 2: Annu Rev Immunol, 18: 767–811, 2000. 175–178, 1988. 8. Liu, Y. J. Dendritic cell subsets and lineages, and their functions in 26. Blanco, P., Palucka, A. K., Gill, M., Pascual, V., and Banchereau, innate and adaptive immunity. Cell, 106: 259–262, 2001. J. Induction of dendritic cell differentiation by IFN-␣ in systemic lupus 9. Sallusto, F., Palermo, B., Lenig, D., Miettinen, M., Matikainen, S., erythematosus. Science (Wash. DC), 294: 1540–1543, 2001. Julkunen, I., Forster, R., Burgstahler, R., Lipp, M., and Lanzavecchia, 27. Iellem, A., Colantonio, L., Bhakta, S., Sozzani, S., Mantovani, A., A. Distinct patterns and kinetics of chemokine production regulate Sinigaglia, F., and D’Ambrosio. D. Inhibition by IL-12 and IFN-␣ of dendritic cell function. Eur. J. Immunol., 29: 1617–1625, 1999. I-309 and macrophage-derived chemokine production upon TCR trig- 10. Sallusto, F., Palermo, B., Hoy, A., and Lanzavecchia, A. The role of gering of human Th1 cells. Eur. J. Immunol., 30: 1030–1039, 2000. chemokine receptors in directing traffic of naive, type 1 and type 2 T 28. Tomiyama, H., Matsuda, T., and Takiguchi, M. Differentiation of cells. Curr. Top. Microbiol. Immunol., 246: 123–128, 1999. human CD8(ϩ) T cells from a memory to memory/effector phenotype. 11. Moschella, F., Maffei, A., Catanzaro, R. P., Papadopoulos, K. P., J. Immunol., 168: 5538–5550, 2002. Skerrett, D., Hesdorffer, C. S., and Harris, P. E. Transcript profiling of 29. Gardella, S., Andrei, C., Lotti, L. V., Poggi, A., Torrisi, M. R., human dendritic cells maturation-induced under defined culture conditions: Zocchi, M. R., and Rubartelli, A. CD8(ϩ) T lymphocytes induce po- comparison of the effects of tumour necrosis factor ␣, soluble CD40 ligand larized exocytosis of secretory lysosomes by dendritic cells with release trimer and interferon ␥. Br. J. Haematol., 114: 444–457, 2001. of interleukin-1␤ and cathepsin D. Blood, 98: 2152–2159, 2001. 12. Montoya, M., Schiavoni, G., Mattei, F., Gresser, I., Belardelli, F., 30. Joseph, S. B., Miner, K. T., and Croft, M. Augmentation of naive. Borrow, P., and Tough, D. F. Type I interferons produced by dendritic Th1 and Th2 effector CD4 responses by IL-6, IL-1 and TNF. Eur. cells promote their phenotypic and functional activation. Blood, 99: J. Immunol. 28: 277–289, 1998. 3263–3271, 2002. 31. Ge, Q., Palliser, D., Eisen, H. N., and Chen, J. Homeostatic T cell 13. Luft, T., Pang, K. C., Thomas, E., Hertzog, P., Hart, D. N., Trapani, proliferation in a T cell-dendritic cell coculture system. Proc. Natl. J., and Cebon, J. Type I IFNs enhance the terminal differentiation of Acad. Sci. USA, 99: 2983–2988, 2002. dendritic cells. J. Immunol., 161: 1947–1953, 1998. 32. Niedbala, W., Wei, X., and Liew, F. Y. IL-15 induces type 1 and 14. Santini, S. M., Lapenta, C., Logozzi, M., Parlato, S., Spada, M., Di type 2 CD4ϩ and CD8ϩ T cells proliferation but is unable to drive Pucchio, T., and Belardelli, F. Type I interferon as a powerful adjuvant cytokine production in the absence of TCR activation or IL-12/IL-4 for monocyte-derived dendritic cell development and activity in vitro stimulation in vitro. Eur. J. Immunol., 32: 341–347, 2002. and in Hu-PBL-SCID mice. J. Exp. Med., 191: 1777–1788, 2000. 33. Luft, T., Jefford, M., Luetjens, P., Hochrein, H., Masterman, K. A., 15. McRae, B. L., Nagai, T., Semnani, R. T., van Seventer, J. M., and Maliszewski, C., Shortman, K., Cebon, J., and Maraskovsky, E. IL-1 ␤ van Seventer, G. A. Interferon-␣ and -␤ inhibit the in vitro differenti- enhances CD40 ligand-mediated cytokine secretion by human dendritic ation of immunocompetent human dendritic cells from CD14(ϩ) pre- cells (DC): a mechanism for T cell-independent DC activation. J. Im- cursors. Blood, 96: 210–217, 2000. munol., 168: 713–722, 2002. 16. Lehner, M., Felzmann, T., Clodi, K., and Holter, W. Type I inter- 34. Denzin, L. K., Sant’Angelo, D. B., Hammond, C., Surman, M. J., and ferons in combination with bacterial stimuli induce apoptosis of mono- Cresswell, P. Negative regulation by HLA-DO of MHC class II-restricted cyte-derived dendritic cells. Blood, 98: 736–742, 2001. antigen processing. Science (Wash. DC), 278: 106–109, 1997. 17. Mattei, F., Schiavoni, G., Belardelli, F., and Tough, D. F. IL-15 is 35. Kayagaki, N., Yamaguchi, N., Nakayama, M., Eto, H., Okumura, expressed by dendritic cells in response to type I IFN, double- stranded K., and Yagita, H. Type I interferons (IFNs) regulate tumor necrosis RNA, or lipopolysaccharide and promotes dendritic cell activation. factor-related apoptosis-inducing ligand (TRAIL) expression on human J. Immunol., 167: 1179–1187, 2001. T cells: a novel mechanism for the antitumor effects of type I IFNs. J. 18. Maffei, A., Ayello, J., Skerrett, D., Papadopoulos, K., Harris, P., Exp. Med., 189: 1451–1460, 1999. and Hesdorffer, C. A novel closed system utilizing styrene copolymer 36. Fanger, N. A., Maliszewski, C. R., Schooley, K., and Griffith, T. S. bead adherence for the production of human dendritic cells. Transfusion, Human dendritic cells mediate cellular apoptosis via tumor necrosis 40: 1419–1420, 2000. factor-related apoptosis-inducing ligand (TRAIL). J. Exp. Med., 190: 19. Romani, N., Reider, D., Heuer, M., Ebner, S., Kampgen, E., Eibl, 1155–1164, 1999. B., Niederwieser, D., and Schuler, G. Generation of mature dendritic 37. Liu, S., Yu, Y., Zhang, M., Wang, W., and Cao, X. The involve- cells from human blood. An improved method with special regard to ment of TNF-␣-related apoptosis-inducing ligand in the enhanced cy- clinical applicability. J. Immunol. Methods, 196: 137–151, 1996. totoxicity of IFN-␤-stimulated human dendritic cells to tumor cells. 20. Reddy, A., Sapp, M., Feldman, M., Subklewe, M., and Bhardwaj, J. Immunol., 166: 5407–5415, 2001. N. A monocyte conditioned medium is more effective than defined 38. Berard, F., Blanco, P., Davoust, J., Neidhart-Berard, E. M., Nouri- cytokines in mediating the terminal maturation of human dendritic cells. Shirazi, M., Taquet, N., Rimoldi, D., Cerottini, J. C., Banchereau, J., and Blood, 90: 3640–3646, 1997. Palucka, A. K. Cross-priming of naive CD8 T cells against melanoma 21. Harris, P. E., Maffei, A., Colovai, A. I., Kinne, J., Tugulea, S., and antigens using dendritic cells loaded with killed allogeneic melanoma Suciu-Foca, N. Predominant HLA-class II bound self-peptides of a cells. J. Exp. Med., 192: 1535–1544, 2000.

Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. Gene Expression Profiling and Functional Activity of Human Dendritic Cells Induced with IFN- α-2b: Implications for Cancer Immunotherapy

Federica Moschella, Brygida Bisikirska, Antonella Maffei, et al.

Clin Cancer Res 2003;9:2022-2031.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/9/6/2022

Cited articles This article cites 37 articles, 22 of which you can access for free at: http://clincancerres.aacrjournals.org/content/9/6/2022.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/9/6/2022.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/9/6/2022. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.