Eradication of Hepatocellular Carcinoma by NKG2D-Based CAR

Published OnlineFirst September 4, 2019; DOI: 10.1158/2326-6066.CIR-19-0026

Research Article Cancer Immunology Research Eradication of Hepatocellular Carcinoma by NKG2D-Based CAR-T Cells Bin Sun1,2,3, Dong Yang1,2,3, Hongjiu Dai3, Xiuyun Liu2, Ru Jia4, Xiaoyue Cui2,6, Wenxuan Li5, Changchun Cai6, Jianming Xu4, and Xudong Zhao1,2,7

Abstract

Despite the great success of chimeric antigen receptor T NKG2D-BBz CAR-T cells efﬁciently killed the HCC cell lines (CAR-T)–cell therapy in the treatment of hematologic malig- SMMC-7721 and MHCC97H in vitro, which express high levels nancies, CAR-T–cell therapy is limited in solid tumors, includ- of NKG2DLs, whereas they less efﬁciently killed NKG2DL- ing hepatocellular carcinoma (HCC). NK group 2 member D silenced SMMC-7721 cells or NKG2DL-negative Hep3B cells. (NKG2D) ligands (NKG2DL) are generally absent on the Overexpression of MICA or ULBP2 in Hep3B improved the surface of normal cells but are overexpressed on malignant killing capacity of NKG2D-BBz CAR-T cells. T cells expressing cells, offering good targets for CAR-T therapy. Indeed, analysis the NKG2D-BBz CAR effectively eradicated SMMC-7721 HCC of The Cancer Genome Atlas and HCC tumor samples showed xenografts. Collectively, these results suggested that NKG2D- that the expression of most NKG2DLs was elevated in tumors BBz CAR-T cells could potently eliminate NKG2DL-high HCC compared with normal tissues. Thus, we designed a novel cells both in vitro and in vivo, thereby providing a promising NKG2D-based CAR comprising the extracellular domain of therapeutic intervention for patients with NKG2DL-positive human NKG2D, 4-1BB, and CD3z signaling domains (BBz). HCC.

Introduction early-stage HCC (stages 0 and A), providing median survival rates of 60 months and beyond (2, 4). Unfortunately, most Liver cancer is the sixth most common cancer type and the patients with HCC, especially in developing countries, are fourth most common cause of cancer-related deaths world- diagnosed at a later disease stage because the symptoms of wide (1) Hepatocellular carcinoma (HCC) accounts for more liver cancer are not obvious until it is in its later stages (3, 5). than 75% to 85% of all liver cancer cases (1). In developed For more developed stages of HCC, only a few treatments have countries, approximately 40% of patients with HCC are diag- shown survival benefits. Patients at intermediate stages (stage nosed at an early stage due to health surveillance programs (2, 3). B) benefit from chemoembolization and have an estimated According to the Barcelona Clinic Liver Cancer staging system, median survival of 26 months (2, 6). For patients at advanced many therapies, such as partial liver resection, transplantation, stages (stage C), only two therapies have been approved for and local ablation, have excellent effects on patients with clinical use by the FDA, sorafenib as a first-line treatment and regorafenib as a second-line treatment (7, 8); these drugs 1Laboratory of Animal Tumor Models, State Key Laboratory of Biotherapy and extend the overall survival of patients by 2–3 months but are Cancer Center, West China Hospital, Sichuan University, Chengdu, Sichuan, often accompanied by treatment-induced adverse events, such 2 China. Key Laboratory of Animal Models and Human Disease Mechanisms of as hypophosphatemia, weight loss, hand–foot skin reaction, Chinese Academy of Sciences/Key Laboratory of Bioactive Peptides of Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunm- hypertension, etc. (7, 8). Therefore, novel strategies for the ing, Yunnan, China. 3Nanjing Kaedi Biotech Co. Ltd., Nanjing, Jiangsu, China. treatment of advanced HCC, such as immunotherapy with PD- 4Department of GI Oncology, the 307 Hospital of Academy of Military Medical 1 antibodies or chimeric antigen receptor T (CAR-T) cells, are Science, Beijing, China. 5College of Life Sciences, Sichuan University, Chengdu, currently being tested in clinical trials (2, 3, 9). 6 Sichuan, China. Department of Gastroenterology, The Affiliated Hospital of Immunotherapy is an effective treatment strategy for several 7 Jiujiang University, Jiujiang, Jiangxi, China. Center for Excellence in Animal cancers, including HCC. For example, administration of a cyto- Evolution and Genetics, Chinese Academy of Sciences, Kunming, China. toxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitor Note: Supplementary data for this article are available at Cancer Immunology enhances antitumor immunity in a murine HCC model, with a Research Online (http://cancerimmunolres.aacrjournals.org/). tumor rechallenge rejection rate of 90% and an elimination rate of B. Sun, D. Yang, and H. Dai contributed equally to this article. 50% for metastatic tumor (10). In addition, nivolumab (a fully Corresponding Authors: Xudong Zhao, Kunming Institute of Zoology, Chinese human programmed death-1 inhibitor) shows potential as a Academy of Sciences, 21 Qingsong Road, Kunming, Yunnan 650203, China. treatment for HCC with a manageable safety profile (11). CAR- Phone: 8687-1681-25430; Fax: 8687-1681-25430; E-mail: T-cell therapy is another emerging immunotherapeutic option for [email protected]; and Hongjiu Dai, Nanjing Kaedi Biotech Co. Ltd., 18 cancer treatment (2, 3). CAR-T cells are engineered to express a Zhilan Road, Building 5, Room 402, Science Park, Jiangning District, Nanjing, fi Jiangsu 211100, China. Phone: 8625-5218-7062; E-mail: [email protected] speci c CAR, which recognizes tumor-associated antigens (TAA) on the surface of tumor cells and then kills these cells in a targeted – Cancer Immunol Res 2019;7:1 11 manner (12). However, clinical application of this approach doi: 10.1158/2326-6066.CIR-19-0026 requires the identification of the TAAs and the design of highly 2019 American Association for Cancer Research. specific CARs.

www.aacrjournals.org OF1

Sun et al.

CAR-T immunotherapy has shown promise in the fight against GCAGAAGATGTCCTGGGAAAT; shMICA-2, ATTCAATTCCC- cancer, especially for hematologic malignancies (12, 13). Cur- TGCCTGGAT; shULBP2-1, CCTCCTCTTTGACTCAGAGAA; and rently, the FDA has approved two CAR-T therapies for blood shULBP2-2, TGAGCACGGTCTTGATCAAAC. A codon-optimized cancer: Yescarta (axicabtagene cioleucel), developed by Kite targeting domain comprising the extracellular domain of human Pharma Inc., and Kymriah (tisangenlecleucel), developed by NKG2D or CD19 scFv (as shown in Supplementary Table S1) was Novartis International AG (14). However, insufficient persistence synthesized (Idobio) and fused to a CAR backbone comprising a of tumor-specific antigens (15), heterogeneity among tumor human CD8 hinge spacer and transmembrane domain, 4-1BB cells (16, 17), presence of an immunosuppressive microenviron- costimulatory domain, and CD3z (BBz; as shown in the Supple- ment (16), and toxicity due to off-target effects currently (17) mentary Table S1). The entire encoding sequence of the CAR compromise the therapeutic efficiency of CAR-T immunotherapy expression molecule (as shown in Supplementary Table S1) was in solid cancers. There are a few of ongoing preclinical studies of cloned into the lentiviral vector LentiGuide-Puro (Addgene) CAR-T therapies for HCC, which target the HCC-associated anti- between the SmaI and MluI restriction sites to replace PuroR and gens GPC-3, MUC-1, and CEA. However, the clinical results of an EF1a promoter was inserted in front of the CAR sequences by CAR-T cells in HCC have been disappointing and associate with SmaI single digestion. For lentiviral package, the lentiviral plas- severe side effects (18). Therefore, there is a need to further mids were cotransfected into HEK293T cells with the packaging develop CAR-T therapies for the treatment of HCC. plasmids psPAX2 and pCMV-VSVG (Addgene) at a ratio of 10:8:5. NK group 2 member D (NKG2D) is a type II transmembrane- Lentivirus was harvested as described previously (34). anchored C-type lectin-like protein receptor expressed on natural þ killer (NK) cells, CD8 T cells, subsets of gd T cells, and some Cell lines and culture þ autoreactive CD4 T cells (19, 20). NKG2D recognizes its ligands The human liver cancer cell lines SMMC-7721, Hep3B, (NKG2DL), such as MHC I chain-related molecules A and B and MHCC97H were purchased from Guangzhou Jennio Biotech (MICA and MICB; ref. 21) and six cytomegalovirus UL16-binding Co., Ltd. in March 2018 and validated using short tandem proteins (ULBP1–6; ref. 22). NKG2DLs are generally absent on repeat profiling in October 2018.Hep3B cells were infected the surface of normal cells but are overexpressed on tumor cells, with pTomo-CMV-ULBP2-IRES-puro and pTomo-CMV-MICA- and their expression can be further increased by chemotherapy or IRES-EGFP lentivirus [multiplicity of infection (MOI) ¼ 10] radiation (23). Accordingly, NKG2DL is a potential target for to generate Hep3B-ULBP2 and Hep3B-MICA cell lines, respec- CAR-T therapy. Previous studies have indicated that ligation of tively. SMMC-7721 cells were infected with pTomo-CMV-lucif- NKG2D with its ligands can activate NK cells and stimulate T cells erase-IRES-puro, plko-shMICA, and plko-shULBP2 lentivirus in vitro (24), and ectopic expression of NKG2DLs on tumor cells (MOI ¼ 10) and subsequently selected by puromycin (1 mg/mL) was sufficient to cause tumor rejection mediated by NK cells (25). for 2 weeks to generate SMMC-7721-luciferase, SMMC7721- NKG2D-expressing CARs exhibited robust antitumor efficacy in shMICA, SMMC7721-shULPB2, and SMMC7721-shMICA- several different xenograft models, including models of multiple shULBP2 cell lines, respectively. Hep3B, Hep3B-MICA, and myeloma (26), ovarian carcinoma (27), osteosarcoma (28), glio- Hep3B-ULBP2 cells were cultured in DMEM (Life Technologies) blastoma (29), pancreatic cancer (30), and relapsed/refractory supplemented with 10% FBS (Life Technologies), 100 U/mL acute myeloid leukemia (31). NKG2DLs are also overexpressed in penicillin, and 100 mg/mL streptomycin sulfate (Life Technolo- human HCC, and the expression is significantly and negatively gies). SMMC-7721 and MHCC97H cells were cultured in associated with poor prognosis or early recurrence (32, 33). How- RPMI1640 (Life Technologies) supplemented with 10% FBS, ever, no NKG2D-based CAR has been reported for HCC treat- 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate. ment. Therefore, we designed a NKG2D-BBz CAR with high HEK293T cells used for lentiviral package were obtained from specificity and selectivity for HCC, and evaluated its antitumor A. Lasorella (The Institute for Cancer Genetics, Columbia Uni- activities using HCC cell lines in vitro and in a xenograft mouse versity Medical Center, New York, NY) in December 2011 and model in vivo. cultured in DMEM (Life Technologies) supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin sulfate. HEK293T cells were not validated within the past year. All the cells Materials and Methods were cultured at 37 C in a humidified incubator with 5% CO2 and Plasmid construction and lentiviral package routinely confirmed to be Mycoplasma free by PCR. The lentiviral vectors pTomo-pCMV-MICA-IRES-EGFP and pTomo-pCMV-ULBP2-IRES-puro, which were used for overex- Generation of CAR-T cells pression of MICA and ULBP2 in Hep3B cells as described below, Primary T cells were isolated from peripheral blood of three were constructed in a pTomo vector backbone (Addgene). The healthy donors and 2 patients with HCC using the RosetteSep full-length human MICA (accession_NM_000247, primer: For- Human T Cell Enrichment Cocktail (Stemcell technologies) ward, ATGGGGCTGGGCCCGGTCTT; Reverse, CTAGGCGCCCT- according to the manufacturer's protocol. The purity of the CAGTGGAGCCAG) and ULBP2 (accession_NM_025217, primer: isolated cells was detected by flow cytometry using phycoery- Forward, ATGGCAGCAGCCGCCGCTACCAAG; Reverse, TCA- thrin-conjugated anti-human CD3 (BioLegend, 300408). T cells GATGCCAGGGAGGATGAAG) sequences were PCR amplified were cultured in RPMI1640 (Gibco) supplemented with 10% using PrimeSTAR HS DNA Polymerase (Takara) and inserted FBS, 100 U/mL penicillin, 100 mg/mL streptomycin sulfate, and into the plasmids between the XbaI and BamHI restriction sites. 200 U/mL IL2 (PeproTech). To generate CAR-T cells, T cells were For the MICA andULBP2 shRNA plasmids, the target sequences stimulated with CD3/CD28 beads (Life Technologies) at a ratio of were cloned into a plko.1 puro vector obtained from Addgene 1:1 for 48 hours and then infected with lentiviral particles at a according to the manufacturer's protocol (http://www.addgene. MOI of 10. All the patient studies were approved by the Institu- org/8453/). The target sequences were as follow: shMICA-1, tional Review Board at Kunming Institute of Zoology, Chinese

OF2 Cancer Immunol Res; 7(11) November 2019 Cancer Immunology Research

NKG2D-BBz CAR-T Eliminates Hepatocellular Cancer

Academy of Sciences (approved ID: SMKX-2019022) with written (BD Biosciences, 550613), TNFa (BD Biosciences, 550610), informed consent obtained from participants and conducted in and IL2 (BD Biosciences, 550611) were determined using accordance with the international ethical guidelines for biomed- respective ELISA kits as described above according to the ical research involving human subjects. manufacturer's instructions. The quantification was performed on the Synergy H1 (BioTek) by measuring absorbance at In vitro cytotoxicity assays 450 nm. The specific cytotoxicity of the CAR-modified T cells was tested against the various HCC cell lines at variable effector-to- In vivo HCC xenograft model target (E/T) ratios of 0.5:1, 1:1, 2:1, 4:1, and 8:1. After 16 hours All protocols were approved by the animal ethics committee of of culture in RPMI1640 (Gibco) supplemented with 10% FBS, the Kunming Institute of Zoology, Chinese Academy of Sciences. 100 U/mL penicillin, 100 mg/mL streptomycin sulfate, cyto- Five- to 6-week-old NOD-Prkdcscid Il2rgtm1/Bcgen mice (B-NDG) toxicity was measured using Cell-Mediated Cytotoxicity Fluo- were purchased from Jiangsu Biocytogen Co., Ltd. A total of 1 rometric Assay Kit (BioVison, K315-100) according to the 106 SMMC-7721-luciferase cells were suspended in PBS contain- manufacturer's protocol. ing 30% Matrigel (BD Bioscience) and subcutaneously injected into the B-NDG mice. When the mean tumor bioluminescence Flow cytometry reached approximately 5 106 photons/second at 1-week after Cells were harvested, washed twice with 1 PBS, and tumor cell injection, the mice were anesthetized with 2.5% avertin resuspended in cold PBS containing 2% FCS, 1% sodium azide by intraperitoneal injection (15 mL/kg) followed by the intra- (atadensityof1 106 cells/mL). Subsequently, labeled peritoneal injection of 150 mg/kg D-luciferin (BioVison). Ten primary antibodies were added into the cell suspension accord- minutes later, bioluminescent signals were recorded using an ing to the manufacturer's instructions and incubated for 1 hour in vivo imaging software (IVIS) system (Lumina Xr), and the mice at 4Cinthedark.ToevaluateCARexpression, CD19-BBz CAR- were randomly divided into the following four groups: (i) tail T cells and NKG2D-BBz CAR-T cells were incubated with intravenous injection of 100 mL of sterile saline only without Alexa Fluor 647–conjugated goat anti-mouse F(ab)2 (Jackson T cells; (ii) 1 107 nontransduced T cells (NTD) in sterile saline; ImmunoResearch, 115-606-006) and allophycocyanin (APC)- (iii) 1 107 genetically modified CD19-BBz CAR-T cells in sterile conjugated anti-NKG2D (BioLegend, 320808), respectively. saline (CD19-BBz CAR); and (iv) 1 107 genetically modified APC-conjugated MICA (R&D Systems, FAB1300A), MICB (R&D NKG2D-BBz CAR-T cells in sterile saline (NKG2D-BBz CAR). Systems, FAB1599A), ULBP1 (R&D Systems, FAB1380A), After that, the bioluminescent signals were measured approxi- ULBP2/5/6 (R&D Systems, FAB1298A), and ULBP3 (R&D mately every 10 days. The data were quantified using Living Image Systems, FAB1517A) were used to determine the expression Software (Caliper Life Science). The mice were sacrificed when the of NKG2DLs on different HCC cells. APC-anti-CD4 (BioLe- tumor volume reached approximately 2,000 mm3. gend, 357408) and FITC-anti-CD8 (BioLegend, 344704) were þ þ used to detect the ratio of CD4 to CD8 Tcells.Allflow Tissue microarray and IHC analysis cytometry readings were performed on the BD LSR Fortessa IHC analysis was performed as described previously (34). system and analyzed using FlowJo software. Briefly, sections cut from paraffin-embedded samples were depar- affinized, rehydrated, and processed for antigen retrieval with Cell growth analysis sodium citrate buffer (Beyotime). The sections were blocked with To detect the proliferation capacity, a 5-ethynyl-uridine 10% serum from the same species as the source of the secondary (EdU)-labeling assay was performed using Click-iT EdU Imag- antibody for 1 hour at room temperature and incubated with ing Kits (Invitrogen, C10337). Briefly, EdU was added to the primary antibodies at 4 C overnight. Then, the sections were cell culture medium at a final concentration 10 mmol/L and washed thrice in TBS 0.025% Triton with gentle agitation and incubated for 1 hour at 37Cinahumidified incubator with incubated with secondary antibodies for 1 hour at room temper- 5% CO2. Then the cells were harvested and fixed with 4% ature. Chromogenic staining was performed on the sections using 0 paraformaldehyde. Permeabilization was performed with 0.3% 3,3 -Diaminobenzidine (Beyotime, P0203) according to the Triton X-100 followed by incubation with Click-iT reaction manufacturer's protocol. The OD-CT-DgLive02-002 Microarray cocktail containing Alexa Fluor azide for 30 minutes at room (Outdo Biotech) containing 32 human liver cancer samples, temperature. The EdU incorporation rate was analyzed by flow HOrgN090PT02 Microarray (Outdo Biotech) containing 90 nor- cytometry. To measure the proportion of apoptotic cells, cells mal tissues from major human organs (including the thyroid, were harvested, washed with 1 PBS, and resuspended at a tongue, esophagus, stomach, duodenum, colon, liver, pancreas, density of 1 106 cells/mL. Thereafter, 7-aminoactinomycin D trachea, lung, heart, artery, skeletal muscle, skin, seminal vesicle, (Sangon Biotech, E607304-0200) was added according to the prostate, testis, bladder, brain, and spleen), and HLivH060CD03 manufacturer's protocol and the ratio of stained cell was Microarray (Outdo Biotech) containing 7 nontumor cirrhotic analyzed by flow cytometry. liver tissues were immunostained using anti-MICA (Abcam, ab93170) at a dilution ratio of 1:200 or anti-ULBP2 (Thermo Cytokine release assay Fisher Scientific, PA5-47118) at a dilution ratio of 1:50. To CD19-BBz CAR-T and NKG2D-BBz CAR-T cells were cocul- investigate the persistence of the administrated human T cells in tured with SMMC-7721 cells in RPMI1640 (Gibco) supple- the mice, the sections of formalin-fixed, paraffin-embedded lung, mented with 10% FBS, 100 U/mL penicillin, 100 mg/mL liver, bone marrow, hippocampus, spleen, kidney, pancreas, and streptomycin sulfate at an E/T ratio of 0:1 and 5:1, respectively, tumor tissues from the CD19-BBz CAR-T group and NKG2D-BBz for 16 hours. A total of 10 mLofthesupernatantwascollected CAR-T groups were immuno-stained using an CD3-x antibody and the concentrations of IFNg (BD Biosciences, 550612), IL10 (Santa Cruz Biotechnology, sc-1239) at a dilution ratio of 1:100.

www.aacrjournals.org Cancer Immunol Res; 7(11) November 2019 OF3

Sun et al.

Karyotype assays Results NKG2D-BBz CAR-T cells were collected 10 days after infec- NKG2DLs were overexpressed in human liver cancer tion with NKG2D-BBz CAR and normal T cells were used as To clarify the expression of NKG2DLs in clinical samples, we controls. Karyotype assays were conducted as described previ- analyzed the RNA sequencing data of paired liver cancer and ously (35). Briefly, cells were treated with colcemid (Sangon normal tissues from The Cancer Genome Atlas (N ¼ 50). The Biotech, A600322) at 37C for 2 hours, then harvested, washed results showed that MICA, MICB, ULBP1, ULBP2, ULBP4, and in 0.075 mol/L KCl at 37C for 10 minutes. Then the cells were ULBP5 were upregulated compared with those in paired normal fixed in freshly prepared fixative (methanol/glacial acetic acid ¼ tissues (Supplementary Fig. S1). Similarly, IHC in human liver 3/1), dropped onto slides, and dried at room temperature. The cancer specimens on the OD-CT-DgLive02-002 microarray chip chromosome images were captured on the Olympus DP71 showed that expression levels of MICA and ULBP2 were elevated microscope. in 72% (23/32) and 97% (31/32) of the liver cancer tissues, respectively (Fig. 1A and B). Although the leading cause of HCC is Statistical analysis cirrhosis and most patients with HCC have liver cirrhosis, the All statistical analyses were performed using GraphPad Prism expression of MICA and ULBP2 was absent in nontumor cirrhotic 7.0 statistical software. The data are all presented as mean SD. liver tissue (Supplementary Fig. S2). In addition, flow cytometry Statistical differences between two groups were analyzed using showed that the expression levels of all NKG2DLs were low in the Student t tests with Welch correction. Statistical differences among Hep3B cell line, while MICA and ULBP2 were highly expressed in three or more groups were analyzed by one-way ANOVA with the SMMC-7721 and MHCC97H cell lines (Fig. 1C). These results Sidak correction. Statistical significance was defined as , P 0.05; clearly supported the possibility of using NKG2DL as a target in , P 0.01; , P 0.001. HCC therapy.

Figure 1. NKG2D ligands were overexpressed in liver cancer. The 32 liver cancer specimens in the OD-CT-DgLive02-002 microarray were stained with MICA antibody (A) and ULBP2 antibody (B), respectively. The samples with overexpression of MICA or ULBP2 are marked with a triangle. Scale bar, 500 mm. C, NKG2D ligand expression in Hep3B, SMMC-7721, and MHCC97H cell lines was detected by ﬂow cytometry. Data are representative or two independent experiments. Percentage of positive cells is detailed in the histograms.

OF4 Cancer Immunol Res; 7(11) November 2019 Cancer Immunology Research

NKG2D-BBz CAR-T Eliminates Hepatocellular Cancer

NKG2D-BBz CAR-T cells lysed HCC cells in an NKG2DL- To investigate whether the cytotoxicity of NKG2D-BBz CAR-T dependent manner cell was positively correlated with the cell surface expression of We designed the lentiviral expression vectors encoding CD19- NKG2D ligands, lentiviral particles that induced MICA or ULBP2 BBz and NKG2D-BBz as shown in Fig. 2A. T cells were isolated silencing were constructed and used to infect SMMC-7721 from peripheral blood mononuclear cells of healthy donors, cells (Supplementary Fig. S4). Silencing MICA and ULBP2 in þ and 99.2% of the cells were confirmed to be CD3 by flow SMMC7721-shMICA-shULBP2 cells was confirmed by flow cyto- cytometry (Supplementary Fig. S3). After activation with CD3/ metry (MICA, 72.5%; ULBP2, 80.1%; Fig 3A). Correspondingly, 28 beads for 48 hours, T cells were infected with CD19-BBz and NKG2D-BBz CAR-T cells showed less potent cytotoxicity against NKG2D-BBz lentivirus. After 72 hours, CD19 and NKG2D-BBz SMMC7721-shMICA-shULBP2 cells compared with other cell CAR were detected in 42.3% and 46.1% of the T cells, respectively lines (Fig. 3B). Ectopic NKG2DL-expressed cell lines Hep3B- (Fig. 2B). The results of the cytotoxicity assay showed that at the MICA and Hep3B-ULBP2 were also generated (Fig. 3C). The E:T ratio of 8:1, NKG2D-BBz CAR-T cells could efficiently lyse cytotoxicity of NKG2D-BBz CAR-T cells toward the Hep3B- SMMC-7721 and MHCC97H cells (100%), but not the MICA or Hep3B-ULBP2 cells was greater than 60%, even at the NKG2DLs-negative Hep3B cell line (less than 30%). In contrast, lowest E:T ratio of 0.5:1 (Fig. 3D), whereas the cytotoxicity toward CD19-BBz CAR-T cells failed to initiate the specific lysis of the wild-type Hep3B cells was only about 10% at the same E:T these HCC cell lines (Fig. 2C). Cytotoxic T cells secrete several ratio (Fig. 3D). These data indicate that the cytotoxicity of cytokines upon killing target cells. To confirm the specific cyto- NKG2D-BBz CAR-T on HCC cells is NKG2DL dependent. toxicity of NKG2D-BBz CAR-T cells, cytokine were assessed in the cell culture medium, demonstrating that TNFa, IFNg, IL10, and NKG2D-BBz CAR-T cells suppressed the growth of SMMC-7721 IL2 were significantly increased in SMMC-7721 cells cultured with xenografts NKG2D-BBz CAR-T cells, but not in the culture medium of CD19- To explore the therapeutic efficacy of NKG2D-BBz CAR-T cells BBz CAR-T or NTD T cells (Fig. 2D). in vivo, subcutaneous xenografts were established by injecting

Figure 2. NKG2D-BBz CAR-T cells efficiently lysed HCC cells. A, Schematic representation of CD19-BBz CAR and NKG2D-BBz CAR. B, CD19 and NKG2D-based CAR expression on human T cells transduced with a lentivirus and analyzed using flow cytometry. Data are representative of three independent experiments. Percentage of positive cells is detailed in the histograms. C, Primary human T cells transduced with the indicated lentivirus were coincubated with the three HCC cell lines at varying E:T ratios for 16 hours, respectively. Cell lysis was determined by a standard nonradioactive cytotoxic assay. Two independent experiments were performed. Data are presented as the mean SD of triplicates. Statistical significance between the NKG2D-BBz group and the other two groups was calculated using one-way ANOVA with Sidak correction. , P < 0.05; , P < 0.001. ns, not significant. D, Cytokines released in the coculture supernatant by NTD, CD19-BBz, and NKG2D-BBz CAR-T cells when cocultured with SMMC-7721 cells at E:T ratios of 0:1 and 5:1; TNFa, IL10, IL2, and IFNg were detected in the supernatant collected 16 hours after the culture. Two independent experiments were performed. Data are presented as the mean SD of triplicates and analyzed by two-tailed unpaired Student t test with Welch correction (, P < 0.001). ns, not significant.

www.aacrjournals.org Cancer Immunol Res; 7(11) November 2019 OF5

Sun et al.

Figure 3. Cytotoxic effect of NKG2D-BBz CAR-T was dependent on expression of NKG2D ligands. A, MICA and ULBP2 expression in indicated cells was assessed by flow cytometry. Data are representative of two independent experiments. Percentage of positive cells is detailed in the histograms. B, Cytotoxicity of NKG2D-BBz CAR-T cells on SMMC7721-shCOO2, SMMC7721-shMICA, SMMC7721-shULBP2, and SMMC7721-shMICA-shULBP2 cells. Two independent experiments were performed. Data are presented as the mean SD of triplicates. Statistical significance between the SMMC7721-shMICA-shULBP2 group and the other three groups was calculated using one-way ANOVA with Sidak correction. , P < 0.05; , P < 0.01. C, Flow cytometry analysis of MICA and ULBP2 expression in Hep3B-MICA or Hep3B-ULBP2 cells. Data are representative of three independent experiments. Percentage of positive cells is detailed in the histograms. D, Cytotoxic effect of NKG2D-BBz CAR-T on Hep3B-MICA and Hep3B-ULBP2. Two independent experiments were performed. Data are presented as the mean SD of triplicates. Statistical significance between the Hep3B-vector and the other two groups was analyzed by one-way ANOVA with Sidak correction (, P < 0.001).

transfected SMMC-7721-luciferase cells into B-NDG mice, fol- of both the NKG2D-BBz CAR-T and CD19-BBz CAR-T groups lowed by the CAR-T–cell therapy 7 days later. In all mice receiving but were absent in the lung, liver, kidney, and brain (Fig. 4C). saline, NTD, or CD19-BBz CAR-T, SMMC-7721 xenografts pro- These results indicate that NKG2D-BBz CAR-T cells preferen- gressively grew. However, the xenografts in mice receiving tially infiltrated and resided in the HCC tumors, correlating to NKG2D-BBz CAR-T cells had delayed tumor growth than the the efficient suppression of tumor growth. three control groups. Overall, 50% (3/6) of the mice showed no tumors 19 days after infusion with NKG2D-BBz CAR-T cells, while NKG2D-BBz CAR-T cells derived from patients with HCC the other 3 mice only had minimal residual tumor remaining showed antitumor activity (Fig. 4A and B). At the end of the study, 4 of the 6 mice in the group Patients with HCC have reported abnormalities in their receiving the NKG2D-BBz CAR-T cells were tumor free, and the lymphocyte function (36), thus the antitumor activity of other 2 mice had very small tumors remaining with biolumines- NKG2D-based CAR-T cells derived from HCC patient T cells cence of approximately 5 106 photons/second (Fig. 4A and B). needed to be verified. Peripheral blood collected from 2 Collectively, these data demonstrate that NKG2D-BBz CAR-T cells patients with HCC without radiotherapy and chemotherapy can successfully inhibit the tumorigenesis of subcutaneous was used to isolate T cells. Compared with the T cells of a SMMC-7721 xenografts. healthy donor, the patients' T cells proliferated more slowly Because the direct interaction between CAR-T cells and (Supplementary Fig. S5). The T cells were infected with CD19- cancer cells is necessary for a therapeutic effect, human T cells BBz and NKG2D-BBz lentiviral particles and the expression of in the xenograft tumor and normal tissues were detected via CARs was detected by flow cytometry. The patients' CAR-T cells IHC using anti-CD3-x. The IHC results showed that NKG2D- had similar CAR expression efficiency and CD4/CD8 ratios BBz CAR-T cells accumulated in SMMC-7721 xenografts, while to that of T cells derived from healthy donor (Supplementary only small quantities of CD19-BBz CAR-T cells were found in Figs. S6 and S7). To determine the cytotoxicity of NKG2D-BBz tumors. Human T cells were also detected in the bone marrow CAR-T cells from different sources against HCC cells, we

OF6 Cancer Immunol Res; 7(11) November 2019 Cancer Immunology Research

NKG2D-BBz CAR-T Eliminates Hepatocellular Cancer

Figure 4. NKG2D-BBz CAR-T potently suppressed tumorigenesis in an SMMC-7721 xenograft model. A, B-NDG mice bearing SMMC-7721-luciferase xenografts were treated with 100 mL of saline (N ¼ 5), 1 107 NTD cells (N ¼ 5), 1 107 CD19-BBz CAR-T cells (N ¼ 6), and 1 107 NKG2D-BBz CAR-T cells (N ¼ 6) by tail vein injection. All the mice were imaged with an IVIS imager at the indicated times. Tumor growth was assessed by total bioluminescence signals. Data are representative of two independent experiments. B, Growth curve of SMMC-7721-luciferase xenografts treated as described above. C, NKG2D-BBz CAR-T cells accumulated in SMMC-7721-luciferase xenograft tumors. Tumors and normal tissues were collected from mice bearing SMMC-7721-luciferase subcutaneous xenografts treated with CD19-BBz CAR-T cells and NKG2D-BBz CAR-T cells. Formalin-ﬁxed, parafﬁn-embedded tumor sections were consecutively cut and stained for human CD3 expression (brown). Data are representative of two independent experiments. Scale bar, 100 mm. incubated T cells with SMMC7721 cells at different E:T ratios. onstrated the lack of MICA expression in most human tissues The results showed that patients' NKG2D CAR-T cell have (thyroid, tongue, esophageal epithelium, gastric mucosa, jejunal a comparable antitumor activity with NKG2D-based CAR-T mucous membrane, ileal mucous membrane, appendix, mucous cell derived from a healthy donor (Fig. 5A). Correspondingly, membrane of the rectum, liver, pancreas, trachea, lung, myocar- both NKG2D-BBz CAR-T cells showed effective antitumor dium, artery, skeletal muscle, seminal vesicle, prostate, bladder, activity against xenografts formed by SMMC-7721 cells in B- testis, medulla oblongata, telencephalon, epencephalon, brain- NDG mice (Fig. 5B and C). As expected, xenografts treated with stem, and spleen) except for the skin (3/3; Fig. 6A). Considering normal saline, or NTD, CD19-BBz CAR-T cells derived from gene transfer mediated by lentivirus can possibly induce genome patients with HCC grew rapidly (Fig. 5B and C). instability and cell malignant transformation, karyotype and proliferation assays were performed to evaluate the safety of CAR Safety evaluation of CAR-T cells expression by lentiviral infection. NKG2D-BBz CAR-T cells main- The expression of TAAs on normal cells often leads to severe off- tained a normal karyotype compared with that of untransduced T target effects from CAR-T therapy, limiting their clinical applica- cells for up to 14 days post-transduction (Fig. 6B). At 72 hours tion (37). Analysis of the HOrgN090PT02 microarray chip dem- after infection with the lentivirus expressing CD19-BBz CAR and

www.aacrjournals.org Cancer Immunol Res; 7(11) November 2019 OF7

Sun et al.

Figure 5. Patient-derived NKG2D-BBz CAR-T potently suppress liver cancer both in vitro and in vivo. A, Cytotoxic effect of patient-derived NKG2D-BBz CAR-T cells on SMMC-7721 cells. Two independent experiments were performed. Data are presented as the mean SD of triplicates. Statistical signiﬁcance between the NKG2D-BBz group and the corresponding CD19-BBz group was calculated using two-tailed unpaired Student t test with Welch correction. , P < 0.001. B, B-NDG mice bearing SMMC-7721-luciferase xenografts were treated with 100 mL of saline or 1 107 patient-derived T cells by tail vein injection. NKG2D-BBz CAR-T cells derived from healthy donor were used as the positive control. Mice were imaged at the indicated times. Tumor growth was assessed by total bioluminescence signals. This experiment was done once. C, Growth curve of SMMC-7721-luciferase xenografts treated with indicated T cells or saline (n ¼ 4 per group).

NKG2D-BBz CAR, there were no significant alterations detected in HCC cells in an NKG2DL-dependent manner, providing a the proliferation and apoptotic status of T cells (Supplementary scientific basis for proceeding to a clinical trial for NKG2DL- Fig. S8). positive patients. CAR-T immunotherapy has excellent effects in hematologic malignancies (38). Accordingly, many studies have been per- Discussion formed to extrapolate the success to solid tumors, yet few The potential therapeutic efficacy of NKG2D-based CAR-T have shown success (39). To date, several TAAs expressed cells has been tested in several malignant tumors but in liver tumor cells have been exploited for CAR-T therapy, their efficacy in liver cancer has not been assessed until now. andweredemonstratedtolyseHCCcellsin vitro and In this study, we designed a novel NKG2D-BBz CAR using the eliminate mouse xenografts in vivo, including GPC-3 (40), extracellular domain of NKG2D instead of the full-length MUC1 (41), AFP (42), and CEA (43). However, the clinical sequence, followed by 4-1BB and CD3z, and successfully results of CAR-T cells in the treatment of HCC have yielded produced NKG2D-BBz CAR-T cells that showed strong cyto- poor therapeutic responses (18, 44). The immunosuppressive toxicity against HCC cell lines in vitro as well as a therapeutic tumor microenvironment is one of the main contributors effect against HCC cell xenografts in vivo. These results dem- to the limited antitumor effects of CAR-T in liver can- onstrated that NKG2D-BBz CAR-T can specifically eradicate cers (18, 36). NKG2D-based CAR-T cells eliminate the

OF8 Cancer Immunol Res; 7(11) November 2019 Cancer Immunology Research

NKG2D-BBz CAR-T Eliminates Hepatocellular Cancer

Figure 6. Safety assessment of NKG2D-BBz CAR-T. A, The 90 normal human tissues in the HOrgN09PT02 microarray were stained with MICA antibody. The samples containing more than 10% MICA-positive cells are marked in red. A1–A4, thyroid; A5–A7, tongue; A8–A11, esophageal epithelium; A12–B5, gastric mucosa; B6 and B7, duodenal mucosa; B8–C1, jejunal mucous membrane; C2–C4, ileal mucous membrane; C5–C9, appendix; C10–D1, mucous membrane of the colon; D2 and D3, mucous membrane of the rectum; D4 and D5, liver; D6 and D7, pancreas; D8–D10, trachea; D11–E3, lung; E4–E6, myocardium; E7–E9, artery; E10–F4, skeletal muscle; F5–F7, skin; F8, seminal vesicle; F9–F11, prostate; F12–G6, testis; G7–G10, bladder; G11, medulla oblongata; G12 and H1, telencephalon; H2 and H3, epencephala; H4, brainstem; and H5 and H6, spleen. Scale bar, 500 mm. B, Karyotype of NTD cells and NKG2D-BBz CAR-T cells. Data are representative of two independent experiments. inhibitive tumor microenvironment through the following A major concern of CAR-T cells in clinical practice is their mechanisms: (i) killing the tumor neovasculature expressing potential off-tumor effects. For example, treatment with the receptor NKG2DLs to ameliorate the microenvironment and enhance the tyrosine-protein kinase ERBB2-CART resulted in acute respiratory immunotherapy effect (45); (ii) killing immunosuppressive mye- distress syndrome in a patient with colorectal liver metastasis due to loid-derived suppressor cells and regulatory T cells; and (iii) the expression of Erbb2 in the lungs (50). In addition, treatment of recruiting myeloid cells and activated macrophages to modulate CEA antigen-directed CAR-T cells in patients with colon cancer the immune tumor microenvironment (46, 47). Tumor hetero- resulted in severe colitis due to antigen recognition of the normal geneity is a major cause of tumor immune escape and often leads to colonic tissue (51). Therefore, the specificity of TAAs is of great recurrence and metastasis. NKG2D-based CAR-T cells can target importance in the application of CAR-T therapy. Using a tissue chip multiple ligands expressed in tumor cells and thus may be ben- including 96samples from 27 tissuetypes, we confirmed thatMICA, eficial for the radical treatment of tumors (48). T lymphocytes, one of the most important NKG2DLs, is not expressed in most þ þ both CD4 Th cells and CD8 cytotoxic T cells usually play an normal tissues, which is in-line with previous reports (52, 53). important role in tumor suppression, and a significant decrease in MICA is localized in the cytoplasm of most MICA-positive epithelial T-cell activity has been observed in patients with HCC (36). cells (54), suggesting that these MICA-positive epithelial cells would þ þ However, in this study, the CD4 /CD8 ratio in NKG2D CAR-T not be targeted by NKG2D-BBz CAR-T cells. CAR NKR-2 (developed cells in patients with HCC was still within the normal range (from by Celyad) was the first-generation NKG2D-based CAR with infu- 0.39 to 7.43; ref. 49). In addition, NKG2D CAR-T derived from sion of full-length NKG2D, DAP10, and the CD3z cytoplasmic patient T cells showed strong killing activity specifically toward domain. Although MICA was found to be slightly expressed in the liver cancer cells. These findings suggest NKG2D-based CAR-T as a skin, a phase I clinical trial of NKR-2 (NCT02203825) revealed that potential multi-functional CAR-T therapy. 7 patients with acute myeloidleukemia and 5 patientswithmultiple

www.aacrjournals.org Cancer Immunol Res; 7(11) November 2019 OF9

Sun et al.

myeloma were successfully treated with NKR-2 cells without obvi- Writing, review, and/or revision of the manuscript: B. Sun, D. Yang, H. Dai, ous toxicities or other adverse events (55). These data demonstrated J. Xu, X. Zhao the safety of NKG2D-based CAR-T therapy. Administrative, technical, or material support (i.e., reporting or organizing fi data, constructing databases): D. Yang, H. Dai, J. Xu, X. Zhao Taken together, this study clari ed the therapeutic roles of Study supervision: H. Dai, X. Zhao NKG2D-BBz CAR-T cells in preclinical HCC models. Considering the proven safety of NKG2D-based CAR-T cells in clinical trials Acknowledgments with other cancers, their use can be expected to be applied in The authors would like to thank Guolan Ma from the Public Technology clinical trials for NKG2DL-positive patients. Service Center, Kunming Institute of Zoology, Chinese Academy of Sciences for her technical support in the flow cytometric analysis. This work was financially Disclosure of Potential Conflicts of Interest supported by the National Natural Science Foundation of China (U1702289, to No potential conflicts of interest were disclosed. X. Zhao, and 81802976, to D. Yang).

Authors' Contributions The costs of publication of this article were defrayed in part by the Conception and design: B. Sun, D. Yang, H. Dai, X. Zhao payment of page charges. This article must therefore be hereby marked advertisement Development of methodology: D. Yang, X. Zhao in accordance with 18 U.S.C. Section 1734 solely to indicate Acquisition of data (provided animals, acquired and managed patients, this fact. provided facilities, etc.): B. Sun, D. Yang, X. Liu, R. Jia, X. Cui, W. Li, C. Cai, J. Xu Analysis and interpretation of data (e.g., statistical analysis, biostatistics, Received January 14, 2019; revised June 1, 2019; accepted August 29, 2019; computational analysis): B. Sun, D. Yang, H. Dai published ﬁrst September 4, 2019.

References 1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global 16. Gilham DE, Debets R, Pule M, Hawkins RE, Abken H. CAR-T cells and solid cancer statistics 2018: GLOBOCAN estimates of incidence and mortality tumors: tuning T cells to challenge an inveterate foe. Trends Mol Med 2012; worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68: 18:377–84. 394–424. 17. Kakarla S, Gottschalk S. CAR T cells for solid tumors: armed and ready to 2. Llovet JM, Zucman-Rossi J, Pikarsky E, Sangro B, Schwartz M, Sherman M, go? Cancer J 2014;20:151–5. et al. Hepatocellular carcinoma. Nat Rev Dis Primers 2016;2:16018. 18. Chen Y, E CY, Gong ZW, Liu S, Wang ZX, Yang YS, et al. Chimeric antigen 3. Llovet JM, Montal R, Sia D, Finn RS. Molecular therapies and precision receptor-engineered T-cell therapy for liver cancer. Hepatobiliary Pancreat medicine for hepatocellular carcinoma. Nat Rev Clin Oncol 2018;15: Dis Int 2018;17:301–9. 599–616. 19. Raulet DH. Roles of the NKG2D immunoreceptor and its ligands. Nat Rev 4. Yang JD, Roberts LR. Hepatocellular carcinoma: a global view. Nat Rev Immunol 2003;3:781–90. Gastroenterol Hepatol 2010;7:448–58. 20. Zhang J, Basher F, Wu JD. NKG2D ligands in tumor immunity: two sides of 5. Dimitroulis D, Damaskos C, Valsami S, Davakis S, Garmpis N, Spartalis E, a coin. Front Immunol 2015;6:97. et al. From diagnosis to treatment of hepatocellular carcinoma: an epi- 21. Champsaur M, Lanier LL. Effect of NKG2D ligand expression on host demic problem for both developed and developing world. World J Gastro- immune responses. Immunol Rev 2010;235:267–85. enterol 2017;23:5282–94. 22. El-Gazzar A, Groh V, Spies T. Immunobiology and conflicting roles of the 6. Llovet JM, Real MI, Montana X, Planas R, Coll S, Aponte J, et al. Arterial human NKG2D lymphocyte receptor and its ligands in cancer. J Immunol embolisation or chemoembolisation versus symptomatic treatment in 2013;191:1509–15. patients with unresectable hepatocellular carcinoma: a randomised con- 23. Dhar P, Wu JD. NKG2D and its ligands in cancer. Curr Opin Immunol trolled trial. Lancet 2002;359:1734–9. 2018;51:55–61. 7. Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, et al. Sorafenib 24. Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, et al. Activation of in advanced hepatocellular carcinoma. N Engl J Med 2008;359:378–90. NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. 8. Bruix J, Qin S, Merle P, Granito A, Huang YH, Bodoky G, et al. Regorafenib Science 1999;285:727–9. for patients with hepatocellular carcinoma who progressed on sorafenib 25. Cerwenka A, Baron JL, Lanier LL. Ectopic expression of retinoic acid early treatment (RESORCE): a randomised, double-blind, placebo-controlled, inducible-1 gene (RAE-1) permits natural killer cell-mediated rejection of a phase 3 trial. Lancet 2017;389:56–66. MHC class I-bearing tumor in vivo. Proc Natl Acad Sci U S A 2001;98: 9. Lee S, Loecher M, Iyer R. Immunomodulation in hepatocellular cancer. 11521–6. J Gastrointest Oncol 2018;9:208–19. 26. Barber A, Zhang T, Megli CJ, Wu JL, Meehan KR, Sentman CL. Chimeric 10. Chen ZB, Shen SQ, Peng BG, Tao JP. Intratumoural GM-CSF microspheres NKG2D receptor-expressing T cells as an immunotherapy for multiple and CTLA-4 blockade enhance the antitumour immunity induced by myeloma. Exp Hematol 2008;36:1318–28. thermal ablation in a subcutaneous murine hepatoma model. Int J 27. Barber A, Zhang T, DeMars LR, Conejo-Garcia J, Roby KF, Sentman CL. Hyperther 2009;25:374–82. Chimeric NKG2D receptor-bearing T cells as immunotherapy for ovarian 11. El-Khoueiry AB, Sangro B, Yau T, Crocenzi TS, Kudo M, Hsu C, et al. cancer. Cancer Res 2007;67:5003–8. Nivolumab in patients with advanced hepatocellular carcinoma (Check- 28. Fernandez L, Metais JY, Escudero A, Vela M, Valentin J, Vallcorba I, et al. Mate 040): an open-label, non-comparative, phase 1/2 dose escalation and Memory T cells expressing an NKG2D-CAR efficiently target osteosarcoma expansion trial. Lancet 2017;389:2492–502. cells. Clin Cancer Res 2017;23:5824–35. 12. Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ, et al. Chimeric 29. Weiss T, Schneider H, Silginer M, Steinle A, Pruschy M, Polic B, et al. antigen receptor T cells for sustained remissions in leukemia. N Engl J Med NKG2D-dependent antitumor effects of chemotherapy and radiotherapy 2014;371:1507–17. against glioblastoma. Clin Cancer Res 2018;24:882–95. 13. Curran KJ, Brentjens RJ. Chimeric antigen receptor T cells for cancer 30. Demoulin B, Cook WJ, Murad J, Graber DJ, Sentman ML, Lonez C, et al. immunotherapy. J Clin Oncol 2015;33:1703–6. Exploiting natural killer group 2D receptors for CAR T-cell therapy. 14. Yip A, Webster RM. The market for chimeric antigen receptor T cell Future Oncol 2017;13:1593–605. therapies. Nat Rev Drug Discov 2018;17:161–2. 31. Sallman DA, Brayer J, Sagatys EM, Lonez C, Breman E, Agaugue S, et al. 15. Kershaw MH, Westwood JA, Parker LL, Wang G, Eshhar Z, Mavroukakis SA, NKG2D-based chimeric antigen receptor therapy induced remission in a et al. A phase I study on adoptive immunotherapy using gene-modified T relapsed/refractory acute myeloid leukemia patient. Haematologica 2018; cells for ovarian cancer. Clin Cancer Res 2006;12:6106–15. 103:e424–e6.

OF10 Cancer Immunol Res; 7(11) November 2019 Cancer Immunology Research

NKG2D-BBz CAR-T Eliminates Hepatocellular Cancer

32. Kamimura H, Yamagiwa S, Tsuchiya A, Takamura M, Matsuda Y, Ohkoshi 45. Zhang T, Sentman CL. Mouse tumor vasculature expresses NKG2D ligands S, et al. Reduced NKG2D ligand expression in hepatocellular carcinoma and can be targeted by chimeric NKG2D-modified T cells. J Immunol 2013; correlates with early recurrence. J Hepatol 2012;56:381–8. 190:2455–63. 33.FangL,GongJY,WangY,LiuRR,LiZS,WangZ,etal.MICA/B 46. Barber A, Rynda A, Sentman CL. Chimeric NKG2D expressing T cells expression is inhibited by unfolded protein response and associated eliminate immunosuppression and activate immunity within the ovarian with poor prognosis in human hepatocellular carcinoma. J Exp Clin tumor microenvironment. J Immunol 2009;183:6939–47. Canc Res 2014;33:76. 47. Spear P, Barber A, Rynda-Apple A, Sentman CL. Chimeric antigen receptor 34. Yang D, Sun B, Zhang XH, Cheng DM, Yu XP, Yan LZ, et al. Huwe1 sustains T cells shape myeloid cell function within the tumor microenvironment normal ovarian epithelial cell transformation and tumor growth through through IFN-gamma and GM-CSF. J Immunol 2012;188:6389–98. the histone H1.3-H19 cascade. Cancer Res 2017;77:4773–84. 48. Soriani A, Fionda C, Ricci B, Iannitto ML, Cippitelli M, Santoni A. Chemo- 35. Chou CH, Yang NK, Liu TY, Tai SK, Hsu DS, Chen YW, et al. Chromosome therapy-elicited upregulation of NKG2D and DNAM-1 ligands as a thera- instability modulated by BMI1-AURKA signaling drives progression in peutic target in multiple myeloma. Oncoimmunology 2013;2:e26663. head and neck cancer. Cancer Res 2013;73:953–66. 49. Amadori A, Zamarchi R, Desilvestro G, Forza G, Cavatton G, Danieli GA, 36. Sachdeva M, Chawla YK, Arora SK. Immunology of hepatocellular carci- et al. Genetic-control of the Cd4/Cd8 T-cell ratio in humans. Nat Med noma. World J Hepatol 2015;7:2080–90. 1995;1:1279–83. 37. Bonifant CL, Jackson HJ, Brentjens RJ, Curran KJ. Toxicity and management 50. Morgan RA, Yang JC, Kitano M, Dudley ME, Laurencot CM, Rosenberg SA. in CAR T-cell therapy. Mol Ther Oncolytics 2016;3:16011. Case report of a serious adverse event following the administration of T 38. Gauthier J, Yakoub-Agha I. Chimeric antigen-receptor T-cell therapy for cells transduced with a chimeric antigen receptor recognizing ERBB2. hematological malignancies and solid tumors: clinical data to date, current Mol Ther 2010;18:843–51. limitations and perspectives. Curr Res Transl Med 2017;65:93–102. 51. Parkhurst MR, Yang JC, Langan RC, Dudley ME, Nathan DAN, Feldman SA, 39. Harper K. CAR T-cell therapy for solid tumors? Cancer Discov 2018;8:1341. et al. T cells targeting carcinoembryonic antigen can mediate regression of 40. Gao H, Li K, Tu H, Pan X, Jiang H, Shi B, et al. Development of T cells metastatic colorectal cancer but induce severe transient colitis. Mol Ther redirected to glypican-3 for the treatment of hepatocellular carcinoma. 2011;19:620–6. Clin Cancer Res 2014;20:6418–28. 52. Groh V, Bahram S, Bauer S, Herman A, Beauchamp M, Spies T. Cell 41. Ma YD, Wang Z, Gong RZ, Li LF, Wu HP, Jin HJ, et al. Specific cytotoxicity of stress-regulated human major histocompatibility complex class I gene MUC1 chimeric antigen receptor-engineered Jurkat T cells against hepa- expressed in gastrointestinal epithelium. Proc Natl Acad Sci U S A 1996; tocellular carcinoma. Acad J Sec Mil Med Univ 2014;35:1177–82. 93:12445–50. 42. Liu H, Xu Y, Xiang J, Long L, Green S, Yang Z, et al. Targeting alpha- 53. Groh V, Rhinehart R, Secrist H, Bauer S, Grabstein KH, Spies T. Broad fetoprotein (AFP)-MHC complex with CAR T-cell therapy for liver cancer. tumor-associated expression and recognition by tumor-derived gamma Clin Cancer Res 2017;23:478–88. delta T cells of MICA and MICB. Proc Natl Acad Sci U S A 1999;96:6879–84. 43. Burga RA, Thorn M, Point GR, Guha P, Nguyen CT, Licata LA, et al. 54. Hue S, Mention JJ, Monteiro RC, Zhang S, Cellier C, Schmitz J, et al. A direct Liver myeloid-derived suppressor cells expand in response to liver role for NKG2D/MICA interaction in villous atrophy during celiac disease. metastases in mice and inhibit the anti-tumor efficacy of anti-CEA Immunity 2004;21:367–77. CAR-T. Cancer Immunol Immunother 2015;64:817–29. 55. Nikiforow S, Werner L, Murad J, Jacobs M, Johnston L, Patches S, et al. 44. Li K, Lan Y, Wang J, Liu L. Chimeric antigen receptor-engineered T cells Safety data from a first-in-human phase 1 Trial of NKG2D chimeric antigen for liver cancers, progress and obstacles. Tumour Biol 2017;39: receptor-T cells in AML/MDS and multiple myeloma. Blood 2016;128: 1010428317692229. 4052.

www.aacrjournals.org Cancer Immunol Res; 7(11) November 2019 OF11

Eradication of Hepatocellular Carcinoma by NKG2D-Based CAR-T Cells

Bin Sun, Dong Yang, Hongjiu Dai, et al.

Cancer Immunol Res Published OnlineFirst September 4, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/2326-6066.CIR-19-0026

Supplementary Access the most recent supplemental material at: Material http://cancerimmunolres.aacrjournals.org/content/suppl/2019/09/04/2326-6066.CIR-19-0026 .DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerimmunolres.aacrjournals.org/content/early/2019/10/22/2326-6066.CIR-19-0026. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.