Flightless-I, a Gelsolin Family Member and Transcriptional Regulator, Preferentially Binds Directly to Activated Cytosolic Camk-II

FEBS Letters 582 (2008) 2489–2495

Flightless-I, a gelsolin family member and transcriptional regulator, preferentially binds directly to activated cytosolic CaMK-II

Matthew E. Sewarda,1, Charles A. Easley IVb,2, Jamie J. McLeoda, Alexandra L. Myersa, Robert M. Tombesa,b,c,* a Department of Biology, Virginia Commonwealth University, 1000 West Cary Street, Richmond, VA 23284-2012, United States b Department of Biochemistry, Virginia Commonwealth University, 1101 East Marshall Street, Richmond, VA 23298-0614, United States c Massey Cancer Center, Virginia Commonwealth University, 401 College Street Richmond, Virginia 23298-0037, United States

Received 29 April 2008; revised 29 May 2008; accepted 5 June 2008

Available online 25 June 2008

Edited by Jesus Avila

CaMK-II delta (uniprotkb:Q6PHZ2) physically interacts Abstract In order to evaluate links between Ca2+/calmodulin (CaM)-dependent protein kinase type II (CaMK-II) and cell cy- (MI:0218) with beta 5 tubulin (uniprotkb:P99024), beta 2c cle progression, CaMK-II binding partners were sought in prolif- tubulin (uniprotkb:P68372), alpha 1a tubulin (uniprotkb: erating cells by epitope-tag tandem mass spectrometry. One P68369), b-Actin (uniprotkb:P60710), Tropomodulin-3 (uni- protein identified was the gelsolin family member, flightless-I protkb:Q9JHJ0), Flightless-I (uniprotkb:Q9JJ28), FLAP1 (Fli-I). Fli-I is not a CaMK-II substrate, but binds directly (uniprotkb:Q3UZ39) and FLAP2 (uniprotkb:Q91WK0) by and preferentially to constitutively active (T287D) CaMK-II over anti tag coimmunoprecipitation (MI:0007) inactive CaMK-II. Fli-I gradually enters the nucleus upon CaMK-II inhibition and is retained in the cytosol by T287D 2008 Federation of European Biochemical Societies. Pub- CaMK-II. CaMK-II inhibition and Fli-I overexpression suppress lished by Elsevier B.V. All rights reserved. transcription of b-catenin dependent transcriptional reporters, whereas Fli-I suppression enhances their transcription. These Keywords: b-Catenin; CaMK-II; Mass spectrometry; findings support a novel mechanism whereby cytosolic CaMK- Flightless-I; Cyclin D1; Actin; Tubulin II influences b-catenin dependent gene expression through Fli-I.

Structured summary: MINT-6603828: delta CaMK-II (uniprotkb:Q6PHZ2) binds (MI:0407) to Flightless-I (uniprotkb:Q9JJ28) by anti bait coimmunoprecipi- 1. Introduction tation (MI:0006)

MINT-6603847: 2+ delta CaMK-II (uniprotkb:Q6PHZ2) phosphorylates (MI:0217) The ‘‘multi-functional’’ Ca /calmodulin (CaM)-dependent MAP2 (uniprotkb:P20357) by protein kinase assay (MI:0424) protein kinase type II (CaMK-II) [1,2] is twice as active in pro- MINT-6603768: liferating cells as it is in growth-arrested cells and promotes cy- beta CaMK-II (uniprotkb:P28652) physically interacts clin D1 expression [3]. However, known cyclin D1 (MI:0218) with Flightless-I (uniprotkb:Q9JJ28) by anti bait transcription factors are not activated by CaMK-II in these coimmunoprecipitation (MI:0006) cells [3] and nuclear-targeted CaMK-II splice variants are ab- MINT-6603759, MINT-6603776, MINT-6603786: sent [4,5]. Therefore, an undetermined extra-nuclear mecha- delta CaMK-II (uniprotkb:Q6PHZ2) physically interacts nism must link CaMK-II with cell cycle progression. (MI:0218) with Flightless-I (uniprotkb:Q9JJ28) by anti bait To identify potential regulatory pathways, binding partners coimmunoprecipitation (MI:0006) of cytosolic CaMK-II variants were sought. Among the pro- MINT-6603724: teins identified was flightless-I (Fli-I), a gelsolin related actin binding and capping protein, which influences diverse pro- cesses including cell migration and gene transcription [6,7].

* Fli-I is a transcriptional co-activator of the estrogen and the Corresponding author. Address: Department of Biology, Virginia thyroid receptors [8], but suppresses b-catenin dependent pro- Commonwealth University, 1000 West Cary Street, Richmond, VA 23284-2012, United States. Fax: +1 804 828 0503. moters [9]. It has been speculated that Fli-I links signal trans- E-mail address: [email protected] (R.M. Tombes). duction and cytoskeletal regulation [10,11], but the mechanisms by which Fli-I translocates and then promotes 1 Current address: Department of Cell Biology, University of Virginia, or inhibits transcription are unclear. Charlottesville, VA 22908, United States. 2Current address: Department of Obstetrics, Gynecology and Repro- Both b-catenin dependent and independent Wnt family mem- ductive Sciences, University of Pittsburgh, Pittsburgh, PA 15213, bers influence cyclin D1 expression. Canonical Wnts induce the United States. accumulation of b-catenin, which promotes the expression of T-cell factor/lymphoid-enhancer binding factor-1 (Tcf/Lef)- Abbreviations: 2+ CaMK-II, Ca /CaM-dependent protein kinase type II; dependent genes [12], such as cyclin D1. Some non-canonical CaM, calmodulin; Fli-I, flightless-I; Tcf/Lef, T-cell factor/lymphoid- 2+ enhancer binding factor-1; GFP, green fluorescent protein; AIP, auto- Wnts stimulate Ca release, which then acts through CaMK- inhibitory peptide II and PK-C to influence cell polarity and migration [13–15],

0014-5793/$34.00 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.06.037 2490 M.E. Seward et al. / FEBS Letters 582 (2008) 2489–2495 but can also antagonize canonical Wnts by promoting b-cate- source/proteomics/). At VCU, mass spectrometry was conducted using nin degradation [16,17] or suppressing cyclin D1 expression a ThermoFinnigan LTQ XL linear ion trap mass spectrometer with [18]. This study provides evidence that CaMK-II influences b- electron transfer dissociation (ETD) capability. Mass spectra were searched against the murine database using Finnigan Bioworks v.3.2 catenin dependent transcription and thus cell cycle progression (SEQUEST) and Peptide Prophet. through an activity-dependent interaction with Fli-I. 2.6. In vitro translation and immunoprecipitation CaMK-II or Fli-I cDNAs were transcribed and translated using the 2. Materials and methods TnT coupled system (Promega, Madison, WI). About 100–200 lgof total protein lysate or 100 ll of in vitro translated protein was immunoprecipitated as described [24] and then either assayed for CaMK-II 2.1. Cell culture and harvest activity or prepared for SDS–PAGE. NIH/3T3 cells were cultured, cell extracts were prepared, CaMK-II activity was assayed and immunoblots were performed exactly as previously described [4,19,20]. 2.7. Immunoblots Immunoblots were normalized to loaded protein or initial protein and conducted as previously described [20]. CaM overlays used 1 lg/ 2.2. Reagents ml biotinylated CaM in 2 mM CaCl2 followed by 2 lg/ml alkaline Ionomycin, KN-93, KN-92, and biotinylated CaM were obtained phosphatase-conjugated streptavidin (Jackson Labs, West Grove, from CalBiochem (La Jolla, CA). The CaMK-II auto-inhibitory pep- PA). Blots were digitally scanned and densitometry was performed tide (AIP) was from BioMol (Plymouth Meeting, PA). Fli-I and using Image J (National Institutes of Health). FLAG polyclonal antibodies were from Covance (Princeton, NJ). The mouse b CaMK-II antibody was from Invitrogen (Carlsbad, CA). The goat d CaMK-II antibody and the rabbit green fluorescent 2.8. CaMK-II partial purification protein (GFP) antibody were from Santa Cruz Biotechnology (Santa GFP-CaMK-II was purified 50-fold by applying lysates in 2.6 mM Cruz, CA). Goat anti-mouse Texas red, biotinylated donkey anti- EGTA directly to a Superose-12 gel filtration column (Amersham mouse, anti-goat and anti-rabbit IgGs were from Kierkegaard Perry Pharmacia, Piscataway, NJ). Pooled GFP fluorescent fractions [25] Labs (Gaithersburg, MD). The rabbit actin antibody, the FLAG pep- were made 1 mM in CaCl2 and then applied to a CaM-sepharose col- tide (DYKDDDDK) and M2 anti-FLAG agarose were from Sigma umn. GFP-containing fractions were eluted with 2.6 mM EGTA, (St. Louis, MO). pooled and concentrated with a Centricon-30 microconcentrator. Sam- ples were stored at 80 C in 50% glycerol. 2.3. Vectors The ‘‘FLAG’’ tag was linked to the amino terminus of wild type and 2.9. Immunolocalization constitutively active GFP-CaMK-II cDNAs [20] as described [21] Cells were plated on glass cover slips, treated and then fixed with 4% (Fig. 1). GFP was linked to the amino terminus of human Fli-I cDNA formaldehyde and imaged by conventional fluorescent microscopy as (obtained from OPEN Biosystems, Birmingham, AL). The cyclin D1 previously described [24]. Anti-Fli-I IgG was used at 10 lg/ml. For promoter-luciferase vector encompasses the first 1 kb of the cyclin quantitation, regions of interest varied in size and shape, but always D1 promoter [22]. FLAG-tagged human b-catenin was provided by encompassed at least 10000 pixels. Cytosolic regions were always peri- Dr. Barry Gumbiner, University of Virginia. The Super 8X TOPflash nuclear. Fli-I staining intensity was averaged by digital image analysis vector was obtained from Addgene, Cambridge, MA [23]. All vectors from at least 10 cells and at least 10 nuclear and perinuclear regions were analyzed by restriction digestion, DNA sequencing and activity within each cell. assays or immunoblots. 2.10. Luciferase assays 5 2.4. Transfections 5 · 10 NIH/3T3 cells were transfected with 3.0 lg total DNA which Lipofectamine 2000 was used as recommended (Invitrogen) and cells consisted of cyclin D1-luciferase (1.0 lg), Super 8X TOPflash-luciferase (0.5 lg), wild type or S45A FLAG b-catenin (1.0 lg), GFP-Fli-I were sub-cultured, if necessary, to maintain sub-confluence. For mass + spectrometry, 2 · 106 NIH/3T3 cells were typically co-transfected with (0.1–1.0 lg) and pBluescriptKS . After 24–40 h, cells were harvested 4 lg of FLAG vector and 8 lg of pBS-KS+, as carrier. cDNA amounts and assayed in immediate triplicate, using the Moonlight Enhanced were determined empirically to achieve sub-stoichiometric expression Kit (BD Biosciences). Luciferase values were normalized to total pro- relative to endogenous CaMK-II, thus maximizing the spectrum of tein and are represented as fold-activation. proteins identified. 2.11. siRNA siRNAs (up to 100 pmol) were transfected with a total of 3.0 lg 2.5. FLAG immunoprecipitation and tandem mass spectrometry + 5 Twenty-four hours after transfection, cells were harvested in Ca2+- pBluescriptKS or other DNA vectors into 5 · 10 NIH/3T3 cells using Lipofectamine 2000 as described above. Two separate Fli-I siR- free buffer and 1 mg of lysate was subjected to anti-FLAG immunopre- 0 0 cipitation and elution with 0.2 mg/ml ‘‘FLAG’’ peptide as previously NAs (Invitrogen) are listed (5 to 3 ) as follows: si-FliA, described [21]. CaMK-II recovery varied between 10% and 40% of CCGCCGAGUGGUACAACAUUGACUU and AAGUCAAUG the input CaMK-II and was confirmed by anti-GFP immunoblots. UUGUACCACUCGGCGG; si-FliB, ACGCCUUGACUACUCGG Tryptic peptides were prepared from FLAG eluents as described [21] AGUUCUUU and AAAGAACUCCGAGUAGUCAAGGCGU; and then analyzed at either the University of VirginiaÕs W.M. Keck control siRNA, GCGCAGGAUUGAAGAAGAGCAGAAA and Biomedical Mass Spectrometry Lab or at Virginia Commonwealth UUUCUGCUCUUCUUCAAUCCUGCGC. Both siRNAs sup- UniversityÕs Center for Biological Complexity. A partial list of binding pressed Fli-I protein levels in a concentration-dependent manner, but partners has been posted online (http://www.cellmigration.org/re- si-FliA was slightly more effective and was used in all described experiments.

3. Results

Fig. 1. FLAG-GFP-CaMK-II map. The FLAG-tag was linked to the 3.1. Cytosolic CaMK-II binding partners amino terminus of monomerized EGFP (mEGFP), which was NIH/3T3 embryonic ﬁbroblasts express dC, dE and be followed by the 316 residue catalytic and CaM binding domain, the 30 residue variable domain and the 132 residue association domain of CaMK-II splice variants [2,4,5]. These isoforms are all cytosolic and are generated by alternative splicing of common dC CaMK-II. Deletion constructs reﬂect these residues. Constitutively 287 active CaMK-II is achieved through a Thr Asp mutation (arrow). and unique exons in the central variable domain (Fig. 1). dC M.E. Seward et al. / FEBS Letters 582 (2008) 2489–2495 2491

CaMK-II is the most prevalent, but also the simplest variant, identified by tandem mass spectrometry over seven replicate as it is encoded by only common exons in the variable domain analyses conducted between two mass spectrometry facilities [2]. When linked to GFP, these CaMK-IIs retain their intracel- (Table 1). Heat shock proteins and keratins, were excluded. lular location [25] and oligomerize properly [20]. In order to Since highly conserved protein families, like CaMK-IIs and screen for binding partners, a ‘‘FLAG’’ tag was linked to the tubulins, have a significant fraction of identical peptides, only amino terminus of GFP-CaMK-II (Fig. 1), cells were transfec- proteins identified by their unique peptides are included. For ted and CaMK-II was immunopurified. Proteins were then each protein, gene names, Mr, the average number of peptides

Table 1 Cytosolic (dC) CaMK-II binding partners

Protein name Gene symbol Mr (kDa) Average peptide % unique % coverage d CaMK-II CAMK2D 52 9.0 19 30.2 b5 tubulin TUBB5 50 7.5 33 47.9 b2c tubulin TUBB2C 50 4.3 35 27.5 a1a tubulin TUBA1A 50 8.4 26 19.5 b-Actin ACTB 43 6.1 38 63.0 Tropomodulin-3 TMOD3 40 8.6 35 32.1 Flightless-I FLII 145 9.8 47 12.7 FLAP1 LRRFIP1 89 5.4 38 30.1 FLAP2 LRRFIP2 82 3.7 100 5.4

The names, gene symbols, relative masses (Mr), average number of peptides detected per analysis, the percentage of these peptides that were unique to that protein and the percentage of the entire protein sequence that was covered by identiﬁed peptides are listed.

Fig. 2. Interaction of CaMK-II and Fli-I. (A) Fli-I (145 kDa) immunoblot of 20 lg cell lysate (lane 1) and immunoprecipitates from 200 lg lysate using anti-d CaMK-II (lane 2), anti-b CaMK-II (lane 3) and secondary antibody alone (lane 4). (B) Biotinylated CaM overlay of 20 lg cell lysate (lane 1) and Fli-I immunoprecipitate (200 lg cell lysate; lane 2). (C) Fli-I immunoblot of anti-FLAG immunoprecipitates (200 lg cell lysate) from cells transfected with FLAG-GFP-tagged wild type dC CaMK-II (lane 1), FLAG-GFP-tagged constitutively active dC CaMK-II (lane 2) or FLAG- GFP-tagged wild type dC CaMK-II treated for 20 h with 10 lM KN-93 (lane 3). CaMK-II levels were determined by anti-GFP. Ratios of Fli-I to CaMK-II were determined by densitometry and are averaged over three separate experiments. (D) Fli-I binding to full-length and deletion constructs of dC CaMK-II after immunoprecipitation with anti-GFP; ratios of Fli-I to GFP CaMK-II were determined by densitometry and averaged over three experiments. (E) Fli-I and GFP immunoblot of in vitro translated Fli-I, which had been mixed for 1 h with in vitro translated FLAG-GFP-tagged wild type dC CaMK-II (lane 1) or FLAG-GFP-tagged constitutively active dC CaMK-II (lanes 2 and 3) and then immunoprecipitated with anti- FLAG IgG. These same immunoprecipitates and one fifth of the volume of the original reticulocyte lysate were probed for actin. (F) Purified CaMK- II was incubated in the presence of Ca2+/CaM and 32P-c-ATP for 30 min with no substrate (lanes 1 and 3), purified MAP2 (lane 2), or in vitro translated Fli-I (lane 4). 2492 M.E. Seward et al. / FEBS Letters 582 (2008) 2489–2495 identified per analysis, the percentage of predicted peptides binding proteins demonstrated enhanced activity-dependent that were unique and the percentage of total protein coverage binding. Fli-I binding was strongest with full-length CaMK- are listed. In addition to CaMK-II itself, the binding proteins II (Fig. 2D) when compared to truncated constructs, which en- identified included b5 tubulin, b2c tubulin, a1a tubulin, b code the variable and association (311–478), the variable (311– actin, tropomodulin-3, Fli-I, and two Fli-I associated proteins, 404) or association (339–478) domains alone [25]. LRRFIP1 (FLAP1) and LRRFIP2 (FLAP2). 3.3. CaMK-II directly binds, but does not phosphorylate Fli-I 3.2. Endogenous Fli-I and CaMK-II interact To assess whether CaMK-II and Fli-I bind directly to each Although the interaction of CaMK-II with tubulins, actin other, FLAG-GFP dC CaMK-II and Fli-I cDNAs were and actin binding proteins posed intriguing functional consid- in vitro translated, then mixed and immunoprecipitated erations, the association of Fli-I was pursued in more detail in (Fig. 2E). As with transfected CaMK-II, Fli-I preferentially this study. Endogenous Fli-I (145 kDa) and endogenous interacted with constitutively active (T287D, lane 2) over wild CaMK-II interact as determined by reciprocal CaMK-II type CaMK-II (WT, lane 1). Interestingly and as observed with (Fig. 2A) and Fli-I (Fig. 2B) immunoprecipitations. Approxi- transfected CaMK-IIs [26],T287D CaMK-II was in vitro trans- mately 25% of the input CaMK-II activity was recovered in lated at about one third of the rate of wild type CaMK-II (data Fli-I immunoprecipitates. In transfected cells, constitutively not shown), presumably due to feedback translational influ- 287 active dC CaMK-II (T D) co-precipitated approximately ences. Samples treated with AIP to block CaMK-II catalytic 10-fold more Fli-I (lane 2) than wild type CaMK-II cells (lane activity only slightly decreased Fli-I binding to T287D 1) treated with KN-93 (lane 3). None of the other CaMK-II- CaMK-II, indicating that persistent activity is not required

Fig. 3. Fli-I translocates to nucleus when CaMK-II is inhibited. Fli-I was localized in NIH/3T3 cells by indirect immunofluorescence after (A) 18 h serum starvation, (B) return to serum-containing medium for 12 h in the absence or (C) presence of 10 lM KN-93 or (D) retention in serum-free medium but treatment with 1 lM ionomycin. (E and F) At the indicated time, the nuclear percentage of total fluorescence was determined for cells (n > 10 for each time point) starved in serum-free medium (Starved), subsequently stimulated with serum-containing medium (Stimulated), stimulated in the presence of KN-93 (Stim/KN-93), treated with KN-93 in serum-containing medium (KN-93) or treated with 1 lM ionomycin in the absence of serum (IONO). M.E. Seward et al. / FEBS Letters 582 (2008) 2489–2495 2493 for enhanced binding. Although the reticulocyte lysate, within which in vitro translation was conducted, contained significant amounts of actin (retic lysate), actin did not persist in any of the complexes assembled in vitro. The microtubule associated protein, MAP2, is an excellent substrate of partially purified CaMK-II (Fig. 2F, lane 2). How- ever, neither in vitro translated Fli-I (lane 4) or immunoprecipitated Fli-I (not shown) were phosphorylated by CaMK-II, even when gels were exposed for 10 times longer than the MAP2 gel.

3.4. Fli-I enters the nucleus upon CaMK-II inhibition Fli-I gradually accumulates in the nucleus as cells reach confluence [27] and upon serum deprivation (Fig. 3A). When starved cells were serum-stimulated, cytosolic Fli-I was observed in association with fibrous elements in the perinuclear region (Fig. 3B). If serum-stimulation was conducted in the presence of KN-93, Fli-I remained in the nucleus (Fig. 3C). Similarly, KN-93 treatment of cells in serum resulted in the gradual nuclear accumulation of Fli-I. Cells maintained in serum-free medium, but treated with the Ca2+ ionophore, ionomycin, also resulted in a gradual nuclear export of Fli-I (Fig. 3D). Translocation kinetics demonstrated that Fli-I nu- Fig. 4. Fli-I is retained in cytosol by CaMK-II. GFP-Fli-I was 287 clear accumulation (Fig. 3E) requires 8–10 h to complete transfected alone (A and B) or with constitutively active (T D) dC whether by starvation or CaMK-II inhibition. Fli-I nuclear CaMK-II (C) and then either maintained in (A) complete medium or export was also a gradual process, requiring 3–6 h (Fig. 3F). (B and C) serum starved for 18 h. Live conventional epifluorescent KN-93 is the only CaMK-II inhibitor effective in these cells microscopy was used to image cells. Scale bar = 10 lm. (D) The percentage of total fluorescence that is nuclear was averaged from at over this time period, since membrane-permeant derivatives least 10 cells per condition and 10 regions of interest per cell. (E) of AIP (myr-AIP) have a short half-life of 3h [24] and Twenty micrograms of lysate from untransfected (left lane) and GFP- CaMK-II is relatively stable in NIH/3T3 cells. In these cells, Fli-I transfected cells (right lane) were immunoblotted with anti-Fli-I. neither dominant negative constructs nor siRNAs significantly Fli-I migrates at 145 kDa and GFP-Fli-I at 170 kDa. interfered with CaMK-II, even though they are effective in other cell types [26,28]. Live cell imaging of GFP-Fli-I was next conducted because constitutively active CaMK-II trans- 4. Discussion fected cells are less adherent and do not remain attached through immunostaining. GFP-Fli-I translocated from the Of the CaMK-II binding proteins identified in this study, cytosol (Fig. 4A) to the nucleus after 18 h of serum starvation only actin and tubulin had previously been reported [24,29]. (Fig. 4B) unless constitutively active CaMK-II was co-trans- This is not surprising since CaMK-II co-localizes with the ac- fected (Fig. 4C). Quantitation reveals the relative, not com- tin cytoskeleton and influences cytoskeletal and focal adhesion plete, retention of Fli-I by constitutively active CaMK-II in dynamics [24,25,29–31]. Certain CaMK-IIs bind more strongly the cytosol (Fig. 4D). GFP-Fli-I is shown at the expected Mr to actin stress-fibers than other variants [30], but those CaMK- and abundance relative to endogenous Fli-I (Fig. 4E). IIs were not used in this study and are not expressed in these cells. The actin–CaMK-II interaction characterized in this 3.5. Fli-I suppresses transcription and previous studies [25] may be mediated by the actin binding The influences of CaMK-II activity and Fli-I expression proteins identified here. Amongst the CaMK-II binding part- were next evaluated using the Super TOPflash-luc (TOPflash) ners, b5 tubulin (class V) has a functionally distinct role from and the cyclin D1-luc vectors. Fli-I induced a dose-dependent other tubulins in microtubule fragmentation and paclitaxel inhibition of transcription whether wild type or degradation resistance [32] and tropomodulin-3 acts differently from other resistant (S45A) b-catenin was used (Fig. 5A). TOPflash was tropomodulins in regulating cell migration and cell height [33]. inhibited by KN-93 in the same dose-dependent manner as it Proteins other than Fli-I have also been shown to bind pref- blocks G1-phase cell cycle progression [3,4]. Like Fli-I, KN- erentially to the activated state of CaMK-II, including histone 93 inhibited transcription regardless of whether wild type or deacetylase-4 [34] and the glutamate receptor [35]. Auto-phos- non-degradable b-catenin was used. Furthermore, wild type phorylation is believed to influence the overall structure of FLAG b-catenin was not diminished in cells treated with CaMK-II [36], by expanding the core of the CaMK-II holoen- 10 lM KN-93 (inset, Fig. 5A). Cyclin D1-luc expression exhib- zyme, thus exposing potential binding sites or placing CaMK- ited similar sensitivity to Fli-I and KN-93 (Fig. 5B). In comple- II in the proper spatial context to bind to extended proteins mentary findings, two separate Fli-I siRNA oligonucleotide like Fli-I. In proliferating cells, Fli-I and CaMK-II co-localize pairs caused a dose-dependent decrease in Fli-I protein levels in the perinuclear region [25,27]. It is possible that when Fli-I is and b-catenin-independent increase in cyclin D1-luc transcrip- bound to CaMK-II, the putative nuclear targeting sequence 1035 1046 tion; one of these is shown (Fig. 5C). Co-transfected GFP-Fli-I (K RKFIIHRGKRK ) is obstructed, preventing the for- reversed siRNA effects (Fig. 5C). Relative levels of endogenous mation of a nuclear import complex. The serum-induced sig- and transfected Fli-I are shown. nals that lead to Fli-I nuclear export are unknown [27]. 2494 M.E. Seward et al. / FEBS Letters 582 (2008) 2489–2495

subtle changes in the ratio of Fli-I, b-catenin, FLAPs and Tcf/Lef factors. CaMK-II has also been reported to affect b- catenin dependent transcription by promoting the export of Tcf [39,40]. It remains to be determined, whether CaMK-II simultaneously influences b-catenin dependent genes through both Fli-I and Tcf localization. This study provides evidence for a novel, straightforward mechanism by which Ca2+, acting through CaMK-II, can directly influence the expression of b-catenin dependent genes without entering the nucleus. In proliferating cells, total cellular CaMK-II is active and therefore sequesters Fli-I in the cytosol. As cells reach confluence, Ca2+ transients subside, CaMK-II becomes less active, and cells stop migrating, as focal adhesions are no longer turned over [31]. Fli-I gradually dissociates from CaMK-II, as it progressively becomes inactive, to enter the nucleus where it suppresses the transcription of b-catenin dependent genes, such as cyclin D1. Fli-I influences cell proliferation throughout the life cycle including during embryogenesis [41]. The interaction of Fli-I with CaMK-II represents a plausible link between contact-dependent growth inhibition and b-catenin dependent transcription. The interaction of Fli-I with CaMK-II also represents a means by which cross-talk could occur between ‘‘canonical’’ and ‘‘non-canonical’’ (Ca2+-dependent) Wnt pathways during development and through which cytosolic Ca2+ signaling could influence the canonical Wnt pathway and thus influence proliferation deci- sions.

Acknowledgements: Mass spectrometry was performed at the W.M. Keck Biomedical Mass Spectrometry Laboratory through the collaboration of Dr. A.F. (Rick) Horwitz and Dr. Jay W. Fox from the Cell Migration Consortium Center at the University of Virginia and at Vir- ginia Commonwealth University through a collaboration with Dr. Scott Gronert and Dr. David Simpson in the Department of Chemis- try. The authors are grateful to Dr. Mark Mayhew, Dr. Barry Gum- biner, Dr. Edith Wang and Dr. Randy Moon for useful reagents and Fig. 5. CaMK-II acts through Fli-I to suppress cyclin D1 transcrip- discussions. Colleen Brosnahan, Jerry Moxley and Jack Van Vleck tion. Luciferase assays and immunoblots were performed 40 h after provided expert technical assistance. This research was supported by transient transfection of 5 · 105 NIH/3T3 cells in complete medium. National Science Foundation Grant 0238821. Cells were plated so that cultures remained subconfluent. When indicated, KN-93 (final lM, as indicated) was included only during the last 24 h before harvest. (A and B) Fold-activation of luciferase was determined after cells were co-transfected with 1 lg FLAG-b-catenin References (WT or S45A), 0.5 lg TOPflash-luc or 1.0 lg cyclin D1-luc and the indicated amount (lg) of GFP-Fli-I. (A: inset) Anti-FLAG immuno- [1] Hudmon, A. and Schulman, H. (2002) Neuronal Ca2+/Calmod- blot of WT FLAG-b-catenin in cells treated with 0 and 10 lM KN-93. ulin-dependent protein kinase II: the role of structure and (C) Fli-I and control siRNAs (indicated in pmol; pm) were co- autoregulation in cellular function. Annu. Rev. Biochem. 71, transfected with 1 lg cyclin D1-luc or the indicated lg of GFP-Fli-I, 473–510. but not b-catenin. Luciferase values are represented as fold-activation [2] Tombes, R.M., Faison, M.O. and Turbeville, C. (2003) Organi- relative to cells transfected with cyclin D1-luc alone. Anti-Fli-I zation and evolution of multifunctional Ca2+/CaM-dependent immunoblot shows the relative levels of endogenous and transfected protein kinase (CaMK-II) genes. Gene 322, 17–31. Fli-I. [3] Morris, T.A., DeLorenzo, R.J. and Tombes, R.M. (1998) CaMK- II inhibition reduces cyclin D1 levels and enhances the association kip1 The interaction of CaMK-II with Fli-I provides the most of p27 with cdk2 to cause G1 arrest in NIH 3T3 cells. Exp. Cell Res. 240, 218–227. plausible current explanation by which CaMK-II promotes cy- [4] Tombes, R.M., Westin, E., Grant, S. and Krystal, G. (1995) G1 clin D1 expression and cell cycle progression [3,4,37]. Our find- cell cycle arrest and apoptosis are induced in NIH 3T3 cells by ings demonstrate that Fli-I suppresses the b-catenin dependent KN-93, an inhibitor of CaMK-II (the multifunctional Ca2+/CaM transcription of both TOPflash and cyclin D1 reporters with- kinase). Cell Growth Differ. 6, 1063–1070. [5] Tombes, R.M. and Krystal, G.W. (1997) Identification of novel out inducing b-catenin degradation. Fli-I has been proposed human tumor cell-specific CaMK-II variants. Biochim. Biophys. to interfere with transcription by competing with b-catenin Acta 1355, 281–292. and FLAP1, an activator of Tcf/Lef-dependent genes [9] and [6] Cowin, A.J. et al. (2007) Flightless I deficiency enhances wound FLAP2 was shown to be a positive effector of the canonical repair by increasing cell migration and proliferation. J. Pathol. Wnt pathway through its interaction with Disheveled (Dvl) 211, 572–581. [7] Archer, S.K., Behm, C.A., Claudianos, C. and Campbell, H.D. [38]. FLAP1 and FLAP2 were both detected in our screen (2004) The flightless I protein and the gelsolin family in nuclear for CaMK-II binding partners. Evidence suggests that the hormone receptor-mediated signalling. Biochem. Soc. Trans. 32, transcription of b-catenin dependent genes is influenced by 940–942. M.E. Seward et al. / FEBS Letters 582 (2008) 2489–2495 2495

[8] Lee, Y.H., Campbell, H.D. and Stallcup, M.R. (2004) Develop- dependent protein kinase II isozyme-specific induction of neurite mentally essential protein flightless I is a nuclear receptor outgrowth in P19 embryonal carcinoma cells. J. Neurochem. 75, coactivator with actin binding activity. Mol. Cell. Biol. 24, 2380–2391. 2103–2117. [27] Davy, D.A., Campbell, H.D., Fountain, S., de Jong, D. and [9] Lee, Y.H. and Stallcup, M.R. (2006) Interplay of Fli-I and Crouch, M.F. (2001) The flightless I protein colocalizes with FLAP1 for regulation of beta-catenin dependent transcription. actin- and microtubule-based structures in motile Swiss 3T3 Nucleic Acids Res. 34, 5052–5059. fibroblasts: evidence for the involvement of PI 3-kinase and Ras- [10] Davy, D.A., Ball, E.E., Matthaei, K.I., Campbell, H.D. and related small GTPases. J. Cell Sci. 114, 549–562. Crouch, M.F. (2000) The flightless I protein localizes to actin- [28] House, S.J., Ginnan, R.G., Armstrong, S.E. and Singer, H.A. based structures during embryonic development. Immunol. Cell (2007) Calcium/calmodulin-dependent protein kinase II-{delta} Biol. 78, 423–429. isoform regulation of vascular smooth muscle cell proliferation. [11] Fong, K.S. and de Couet, H.G. (1999) Novel proteins interacting Am. J. Physiol.: Cell Physiol. 292, C2276–C2287. with the leucine-rich repeat domain of human flightless-I identi- [29] Shen, K., Teruel, M.N., Subramanian, K. and Meyer, T. (1998) fied by the yeast two-hybrid system. Genomics 58, 146–157. CaMK-II b functions as an F-actin targeting module that [12] Hoppler, S. and Kavanagh, C.L. (2007) Wnt signalling: variety at localizes CaMK-II a/b heterooligomers to dendritic spines. the core. J. Cell Sci. 120, 385–393. Neuron 21, 593–606. [13] Ku¨hl, M., Sheldahl, L., Malbon, C.C. and Moon, R.T. (2000) [30] OÕLeary, H., Lasda, E. and Bayer, K.U. (2006) CaMK-II beta Ca2+/calmodulin-dependent protein kinase II is stimulated by association with the actin cytoskeleton is regulated by alternative Wnt and frizzled homologs and promotes ventral cell fates in splicing. Mol. Biol. Cell 17, 4656–4665. Xenopus. J. Biol. Chem. 275, 12701–12711. [31] Easley, C.A., Brown, C.M., Horwitz, A.F. and Tombes, R.M. [14] Sheldahl, L.C., Slusarski, D.C., Pandur, P., Miller, J.R., Ku¨hl, M. (2008) CaMK-II promotes focal adhesion turnover and cell and Moon, R.T. (2003) Dishevelled activates Ca2+ flux, PKC, and motility by inducing tyrosine dephosphorylation of FAK and CaMK-II in vertebrate embryos. J. Cell Biol. 161, 769–777. paxillin. Cell Motil. Cytoskel. 65, 662–674. [15] Veeman, M.T., Axelrod, J.D. and Moon, R.T. (2003) A second [32] Bhattacharya, R. and Cabral, F. (2004) A ubiquitous beta-tubulin canon. Functions and mechanisms of beta-catenin-independent disrupts microtubule assembly and inhibits cell proliferation. Mol. Wnt signaling. Dev. Cell 5, 367–377. Biol. Cell 15, 3123–3131. [16] Topol, L., Jiang, X., Choi, H., Garrett-Beal, L., Carolan, P.J. and [33] Weber, K.L., Fischer, R.S. and Fowler, V.M. (2007) Tmod3 Yang, Y. (2003) Wnt-5a inhibits the canonical Wnt pathway by regulates polarized epithelial cell morphology. J. Cell Sci. 120, promoting GSK-3-independent beta-catenin degradation. J. Cell 3625–3632. Biol. 162, 899–908. [34] Backs, J., Song, K., Bezprozvannaya, S., Chang, S. and Olson, [17] Kremenevskaja, N., von Wasielewski, R., Rao, A.S., Schofl, C., E.N. (2006) CaM kinase II selectively signals to histone deace- Andersson, T. and Brabant, G. (2005) Wnt-5a has tumor tylase 4 during cardiomyocyte hypertrophy. J. Clin. Invest. 116, suppressor activity in thyroid carcinoma. Oncogene 24, 2144– 1853–1864. 2154. [35] Leonard, A.S., Bayer, K.U., Merrill, M.A., Lim, I.A., Shea, [18] Liang, H. et al. (2003) Wnt5a inhibits B cell proliferation and M.A., Schulman, H. and Hell, J.W. (2002) Regulation of calcium/ functions as a tumor suppressor in hematopoietic tissue. Cancer calmodulin-dependent protein kinase II docking to N-methyl-DD- Cell 4, 349–360. aspartate receptors by calcium/calmodulin and alpha-actinin. J. [19] Tombes, R.M., Mikkelsen, R.B., Jarvis, W.D. and Grant, S. Biol. Chem. 277, 48441–48448. (1999) Down regulation of delta CaM kinase II in human tumor [36] Rosenberg, O.S., Deindl, S., Comolli, L.R., Hoelz, A., Downing, cells. Biochim. Biophys. Acta 1452, 1–11. K.H., Nairn, A.C. and Kuriyan, J. (2006) Oligomerization states [20] Lantsman, K. and Tombes, R.M. (2005) CaMK-II oligomeriza- of the association domain and the holoenyzme of Ca2+/CaM tion potential determined using CFP/YFP FRET. Biochim. kinase II. FEBS J. 273, 682–694. Biophys. Acta 1746, 45–54. [37] Rasmussen, G. and Rasmussen, C. (1995) Calmodulin-dependent [21] Mayhew, M.W., Webb, D.J., Kovalenko, M., Whitmore, L., Fox, protein kinase II is required for G1/S progression in HeLa cells. J.W. and Horwitz, A.F. (2006) Identification of protein networks Biochem. Cell Biol. 73, 201–207. associated with the PAK1-betaPIX-GIT1-paxillin signaling com- [38] Liu, J., Bang, A.G., Kintner, C., Orth, A.P., Chanda, S.K., Ding, plex by mass spectrometry. J. Proteome Res. 5, 2417–2423. S. and Schultz, P.G. (2005) Identification of the Wnt signaling [22] Hilton, T.L., Li, Y., Dunphy, E.L. and Wang, E.H. (2005) TAF1 activator leucine-rich repeat in Flightless interaction protein 2 by histone acetyltransferase activity in Sp1 activation of the cyclin a genome-wide functional analysis. Proc. Natl. Acad. Sci. USA D1 promoter. Mol. Cell. Biol. 25, 4321–4332. 102, 1927–1932. [23] Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H. and [39] Lo, M.C., Gay, F., Odom, R., Shi, Y. and Lin, R. (2004) Moon, R.T. (2003) Zebrafish prickle, a modulator of noncanon- Phosphorylation by the beta-catenin/MAPK complex promotes ical Wnt/Fz signaling, regulates gastrulation movements. Curr. 14-3-3-mediated nuclear export of TCF/POP-1 in signal-respon- Biol. 13, 680–685. sive cells in C. elegans. Cell 117, 95–106. [24] Easley, C.A., Faison, M.O., Kirsch, T.L., Lee, J.A., Seward, M.E. [40] Ishitani, T. et al. (2003) The TAK1-NLK mitogen-activated and Tombes, R.M. (2006) Laminin activates CaMK-II to stabilize protein kinase cascade functions in the Wnt-5a/Ca(2+) pathway nascent embryonic axons. Brain Res. 1092, 59–68. to antagonize Wnt/beta-catenin signaling. Mol. Cell. Biol. 23, [25] Caran, N., Johnson, L.D., Jenkins, K.J. and Tombes, R.M. 131–139. (2001) Cytosolic targeting domains of gamma and delta calmod- [41] Deng, H., Xia, D., Fang, B. and Zhang, H. (2007) The flightless I ulin-dependent protein kinase II. J. Biol. Chem. 276, 42514– homolog, fli-1, regulates anterior/posterior polarity, asymmetric 42519. cell division and ovulation during Caenorhabditis elegans devel- [26] Johnson, L.D., Willoughby, C.A., Burke, S.H., Paik, D.S., opment. Genetics 177, 847–860. Jenkins, K.J. and Tombes, R.M. (2000) d Ca2+/calmodulin-