The Rnai Consortium

The RNAi Consortium

Section II: Preparation of Transfection-Quality DNA for the TRC Library

Introduction:

We have used two methods for 96-well plate-based transfection-grade DNA preparations: 1.) The commercial plate-based PureLink prep from Invitrogen. 2.) A TRC-developed protocol that uses commercial low-grade Whatman prep with a subsequent magnetic bead purification step.

A DNA preparation of pLKO.1 by either of these methods exhibited high transfection efficiencies in 293T cells, comparable to the transfection efficiencies achieved with maxi-prepped DNA. The PureLink method is more expensive but provides more consistent well-to-well yields than the current version of the bead- based protocol.

(1) Commercial DNA Prep Instructions: We used the Invitrogen PureLink kit according to manufacturers instructions except that we grew cells as described in Section III.A and performed an additional heating step described in Section III.C3 (see below).

(2) TRC-Developed DNA Prep Instructions: We developed a low-cost method using Whatman 96-well filter plates to extract crude DNA followed by Agencourt magnetic particles for purification. This protocol is currently being modified to decrease well- to-well variation in yields. The current Whatman/magnetic bead method is described below.

Whatman/Magnetic Bead DNA Prep and Modifications to Invitrogen PureLink Prep

1. Materials 1. 2.2ml Deep well plate filled with 1.2ml TB (terrific broth) containing 100 ug/ml Ampicillin (Marsh Abgene, Cat# DW 9622). 2. Round-bottom plates (Costar, Corning, Cat# 3795). 3. Gas permeable seals (Marsh BioProduct, Cat# AB-0718). 4. Filter plates (ISC BioExpress, Cat# t-3180-1.) 5. Whatman uniplate receiving plates (Whatman, Cat# 77001800) 6. Agencourt beads (Sera-Mag Magnetic Carboxylate-Modified Particles) (Agencourt, Cat# 4415-2100). 7. 16% PEG in 2M NaCl. 8. P1 (50 mM Tris.HCI, pH8.0, 10 mM EDTA, 100ug/ml RNase A, available from Qiagen). 9. P2 (200 mM NaOH, 1% SDS, may purchase from Qiagen). 10. P3 (3.0 M potassium acetate, pH5.5, may purchase from Qiagen).

II. Equipment 1. Plate Shaker (New Brunkswick, Model: Innova 2300). 2. Hydra 96-well pipettor (Robbins Scientific Corp, Cat# HYDR96 UG RB). 3. Heat sealer (Abgene, Cat# ALPS-300). 4. Jouan centrifuges (Jouan, Model: KR422. Cat# 11178608). 5. Magnetic plate stands (In-house made). 6. Vortex (VWR, Model G-560).

11/23/2005

1 7. Beckman Benchtop Centrifuge (Allegro 6).

III. Instructions A. GROW CELLS: 1. Inoculate a deep-well containing 1.2ml TB and 100 ug/ml Ampicillin, following protocol from “RNAi Library Handling, Inoculation and Duplication”, section B. “INOCULATION & GROWTH”. 2. After inoculation, deep-well plates are sealed with gas permeable seals and loaded on plate shaker in 37C warm room. 3. Set shaker at 300rpm. Deep well plates should grow no longer than 17 hours at 37C. Over-growing the cells causes low DNA yield. 4. Cells are harvested by centrifuging at 4760 x g for 6min.

B. WHATMAN FILTER DNA PREP: 1. Resuspension: -Add 150ul of solution P1 to the deep well plate. Seal plate with Costar Scotch seal. -Resuspend cells well by vortexing. Make sure each well is free of cell clumps). 2. Lysing: -Add 150ul of solution P2. Re-seal plate with Costar Scotch seal. -Mix with vortex on speed 3 for about 5 seconds. - Leave the plate at RT for 4 min. 3. Neutralization: - Add 150ul of solution P3. Re-seal plate with Costar Scotch seal. - Mix with vortex on speed 3 for about 5 seconds. - Put deep well plate on ice or in freezer for 10 minutes. 4. Pellet debris in Jouan centrifuge (25 mins. @ 4000 x g). 5. Fill Whatman receiving plates with 280ul 99% Isopropanol. Put filter plate on top of the receiving plate and tape them together. Label both receiving and filter plates. 6. Transfer supernatant from the just-centrifuged deep well plate into the Whatman filter plate using the Hydra. Make sure to adjust the Hydra tip height so that no cell debris is transferred. 7. Wash the hydra tips between transfers of different plates using dd-H2O. 8. Spin the pair of filter plate and receiving plates in the Jouan centrifuge (5 min @ 1800 x g). This step is to make sure liquid flows through the filter, while residual debris stays at top of the filter. 9. Discard filter and put the receiver plates back in the Jouan centrifuge for precipitation (15min @ 4000 x g). Carefully decant off isopropanol. 10. Add 200ul cold 70% ethanol to receiving plate. 11. Spin using Jouan centrifuge (7 min at 4000 x g). 12. Dump ethanol supernatant. Add 200ul cold 70% ethanol to receiving plate. 13. Spin using Jouan centrifuge (7 min at 4000 x g). 14. Dump ethanol. Air dry on bench top for 10 min.

C. MAGNETIC BEAD (SPRI) CLEAN-UP:

1. After the DNA is dry in the Whatman receiving plate, elute DNA with 50ul de-ionized water. Shake the DNA plate gently for 3 minutes at 600rpm and then briefly spin it in the Beckman centrifuge at 500rpm (~ 47 xg). Transfer 42ul DNA into a 96 costar round bottom plate. 2. Buffer the DNA by adding 5ul of 10x PCR Buffer II (Roche) and 3ul of MgCl2 (25mM). 3. Heat the DNA plate at 70C for 30min using a water bath (Potentially helps by disrupting aggregation).

11/23/2005

2 4. Add 20ul of magnetic beads (Agencourt) to each well. Then add 80uL of hybridization buffer (16% PEG in 2M NaCl) to each well; mix well by shaking the round bottom plate on a single plate shaker for 3 minutes at 600rpm. 5. Let the plate sit at room temperature for 10 minutes. 6. Place the plate on a magnetic stand for 5 minutes. When the supernatant is clear, discard the supernatant by inverting the plate while keeping the plate attached to the magnate. 7. Wash the plate with 150ul EtOH (10mM Tris-Acetate, 95% Ethanol) 3 times. Air dry on bench top for 10 min. 8. Elute the DNA with 50ul of water. Shake the DNA plate gently at room temperature for 30min, or leave it o/n at 4oC. Use the magnetic stand to pull down the beads, so that the clear DNA solution can be transferred to a new plate.

11/23/2005

The RNAi Consortium

1/18/07

Section II: Lentiviral Production

Introduction: This section contains protocols for the production of lentivirus stocks from hairpin-pLKO.1 plasmids in 6 cm plates and in high-throughput format (96-well plates).

Lentiviral production consists of the following steps:

Day 0 Seed 293T packaging cells

Day 1 (pm) Transfect packaging cells with 3 lentivirus plasmids (hairpin-pLKO.1 vector, packaging plasmid, envelope plasmid)

Day 2 (am) 18 hours post-transfection: Remove media; replace with fresh high-BSA or high-serum media

Day 3 (am) 24 hours after media change: Harvest virus; replace with fresh high-BSA or high-serum media

Day 4 (am) 24 hours after harvest 1: Harvest virus; discard packaging cells

These procedures should be carried out in accordance with biosafety requirements of the host institution

Part 1: Lentiviral Production in 6 cm plates

I. Materials Transfection-quality plasmid DNA for: - hairpin-pLKO.1 vector (TRC library plasmid – see Section I) - 2nd generation packaging plasmid containing gag, pol and rev genes (e.g. pCMV-dR8.91 or pCMV- dR8.74psPAX2)* - envelope plasmid (e.g. VSV-G expressing plasmid, pMD2.G)* * recommended: use endotoxin-free plasmid isolation kits (Qiagen) TransIT-LT1 transfection reagent (Mirus Bio, MIR 2300/5/6) alternative: FuGENE 6 (Roche, #1 814 443 or #1 988 387) OPTI-MEM serum-free media (Invitrogen, #31985-070) 293T packaging cells (recommended: passage number < 10) Cell seeding media: Low-antibiotic 293T growth media (DMEM + 10% iFBS + 0.1x Pen/Strep) 500 mL DMEM (Dulbecco's Modification of Eagle's Medium; e.g. Mediatech #10-013-CV) 50 mL iFBS (heat-inactivated Fetal Bovine Serum; e.g. HyClone #SH30071.03) 0.5 mL 100x Pen/Strep (10,000 IU/mL penicillin, 10,000 µg/mL streptomycin; e.g. Mediatech #30-002-CI) Viral harvest media: High-BSA 293T growth media (DMEM + 10% iFBS + 1.1g/100mL BSA + 1x Pen/Strep) 500 mL DMEM (Dulbecco's Modification of Eagle's Medium; e.g. Mediatech #10-013-CV) 50 mL iFBS (heat-inactivated Fetal Bovine Serum; e.g. HyClone # SH30071.03) 32 mL 20g/100mL BSA stock (microbiology-grade Bovine Serum Albumin; VWR #14230-738) 5 mL 100x Pen/Strep (10,000 IU/mL penicillin, 10,000 µg/mL streptomycin; e.g. Mediatech #30-002-CI) alternative viral harvest media: High-serum 293T growth media (DMEM + 30% iFBS + 1x Pen/Strep) 500 mL DMEM (Dulbecco's Modification of Eagle's Medium; e.g. Mediatech #10-013-CV) 200 mL iFBS (heat-inactivated Fetal Bovine Serum; e.g. HyClone # SH30071.03) 5 mL 100x Pen/Strep (10,000 IU/mL penicillin, 10,000 µg/mL streptomycin; e.g. Mediatech #30-002-CI) 6 cm tissue culture plates Polypropylene storage tubes

The RNAi Consortium

II. Instructions 1. Seed 293T packaging cells at 1.3-1.5x105 cells/mL (6 mL per plate) in low-antibiotic growth media (DMEM + 10% iFBS + 0.1x Pen/Strep) in 6 cm tissue culture plates.

2. Incubate cells for 24 hours (37 °C, 5% CO2), or until the following afternoon. After ~24 hours, the cells should be ~70% confluent.

3. Transfect packaging cells: a. Prepare a mixture of the 3 transfection plasmids: Reagent per 6 cm plate packaging plasmid (e.g. pCMV-dR8.91 or pCMV-R8.74psPAX2) 900 ng envelope plasmid (e.g. VSV-G/pMD2.G) 100 ng hairpin-pLKO.1 vector 1 µg OPTI-MEM to total volume 10 to 30 µL* * The volume of OPTI-MEM per well can be adjusted for optimal handling.

b. Dilute TransIT-LT1 transfection reagent in OPTI-MEM. Add the TransIT-LT1 reagent dropwise and mix by swirling the tip or gently flicking the tube (do not mix by pipetting or vortexing). Incubate 5 minutes at room temperature. Reagent per 6 cm plate TransIT-LT1 6 µL OPTI-MEM to total volume 90 µL

c. Add the 3 plasmid mix dropwise to the diluted TransIT-LT1 reagent and mix by swirling the tip or gently flicking the tube.

d. Incubate the transfection mix for 20 - 30 minutes at room temperature.

e. Carefully transfer the transfection mix to the packaging cells (in low-antibiotic growth media). The packaging cells can be sensitive to perturbation - take care not to dislodge the cells from the plate. The total volume of transfection mix should be 100 to 125 µL per plate.

4. Incubate cells for 18 hours (37 °C, 5% CO2), or until the following morning.

5. Change media to remove the transfection reagent and replace with 6 mL high-BSA growth media or high serum growth media for viral harvests.

6. Incubate cells for 24 hours (37 °C, 5% CO2).

7. Harvest media containing lentivirus at ~40 hours post-transfection. Transfer media to a polypropylene storage tube. Replace with 6 mL high-BSA growth media or high serum growth media for viral harvests.

8. Repeat viral harvesting every 12-24 hours and replace with 6 mL high-BSA growth media or high serum growth media for viral harvests. Viral titer tends to decrease in later harvests; we typically collect a total of 2-3 time points. After the final harvest, discard the packaging cells. The viral harvests may be pooled as desired.

9. Spin the media containing virus at 1250 rpm for 5 minutes to pellet any packaging cells that were collected during harvesting. Transfer the supernatant to a sterile polypropylene storage tube.

10. Virus may be stored at 4 °C for short periods (hours to days), but should be frozen at -20 °C or -80 °C for long-term storage. To reduce the number of freeze/thaw cycles, aliquot large-scale virus preps to smaller storage tubes prior to long-term storage.

The RNAi Consortium

Part 2: High-Throughput Lentiviral Production (96 well plates)

I. Materials Transfection-quality plasmid DNA for: - hairpin-pLKO.1 vector (TRC library plasmid – see Section I) - 2nd generation packaging plasmid containing gag, pol and rev genes (e.g. pCMV-dR8.91 or pCMV- dR8.74psPAX2) - envelope plasmid (e.g. VSV-G expressing plasmid, pMD2.G) TransIT-LT1 transfection reagent (Mirus Bio, MIR 2300/5/6) alternative: FuGENE 6 (Roche, #1 814 443 or #1 988 387) OPTI-MEM serum-free media (Invitrogen, #31985-070) 293T packaging cells (recommended: passage number < 10) Cell seeding media: Low-antibiotic 293T growth media (DMEM + 10% iFBS + 0.1x Pen/Strep) 500 mL DMEM (Dulbecco's Modification of Eagle's Medium; e.g. Mediatech #10-013-CV) 50 mL iFBS (heat-inactivated Fetal Bovine Serum; e.g. HyClone #SH30071.03) 0.5 mL 100x Pen/Strep (10,000 IU/mL penicillin, 10,000 µg/mL streptomycin; e.g. Mediatech #30-002-CI) Viral harvest media: High-BSA 293T growth media (DMEM + 10% iFBS + 1.1g/100mL BSA + 1x Pen/Strep) 500 mL DMEM (Dulbecco's Modification of Eagle's Medium; e.g. Mediatech #10-013-CV) 50 mL iFBS (heat-inactivated Fetal Bovine Serum; e.g. HyClone # SH30071.03) 32 mL 20g/100mL BSA stock (microbiology-grade Bovine Serum Albumin; VWR #14230-738) 5 mL 100x Pen/Strep (10,000 IU/mL penicillin, 10,000 µg/mL streptomycin; e.g. Mediatech #30-002-CI) alternative viral harvest media: High-serum 293T growth media (DMEM + 30% iFBS + 1x Pen/Strep) 500 mL DMEM (Dulbecco's Modification of Eagle's Medium; e.g. Mediatech #10-013-CV) 200 mL iFBS (heat-inactivated Fetal Bovine Serum; e.g. HyClone # SH30071.03) 5 mL 100x Pen/Strep (10,000 IU/mL penicillin, 10,000 µg/mL streptomycin; e.g. Mediatech #30-002-CI) 96-well tissue culture plates (e.g. Corning/Costar #3628) 96-well polypropylene storage plates (e.g. Corning/Costar #3357)

II. Instructions

1. Seed 293T packaging cells at 2.2x105 cell/mL (100 µL per well) in low-antibiotic growth media (DMEM + 10% iFBS + 0.1x Pen/Strep) in 96-well tissue culture plates. Allow seeded plates to sit undisturbed at room temperature for at least 1 hour before transferring to a tissue culture incubator overnight. Note: allowing cells to settle at room temperature can reduce well-to-well variability and edge effects in microtiter plates.

2. Incubate cells for 24 hours (37 °C, 5% CO2), or until the following afternoon. After ~24 hours, the cells should be ~70% confluent.

3. Transfect packaging cells:

a. Prepare a mixture of the packaging and VSV-G envelope plasmids: Reagent per well* per 96-well plate* packaging plasmid (e.g. pCMV-dR8.91 or 100 ng 10 µg pCMV-dR8.74psPAX2) envelope plasmid (e.g. VSV-G/pMD2.G) 10 ng 1 µg OPTI-MEM to total volume 10 µL** 0.4 to 1 mL * Volumes do not account for excess dead volume required for multichannel pipette reservoirs or liquid handling robots. ** The volume of OPTI-MEM per well can be adjusted for optimal handling and automated setup.

b. Dispense the packaging plasmid mix into a sterile 96-well polypropylene storage plate (10 µL per well). This plate will contain the transfection mix.

The RNAi Consortium

c. Dispense 100 ng hairpin-pLKO.1 plasmid into each well of the transfection mix plate. For 96-well transfections, it is convenient to normalize the concentration of hairpin-pLKO.1 plasmids to 20 ng/µL and dispense 5 µL per well.

d. Dilute TransIT-LT1 transfection reagent in OPTI-MEM. Add the TransIT-LT1 reagent dropwise and mix by swirling the tip or gently flicking the tube (do not mix by pipetting or vortexing). Incubate 5 minutes at room temperature. Reagent per well* per 96-well plate* TransIT-LT1 0.6 µL 60 µL OPTI-MEM to total volume 10 µL** 1 to 1.5 mL * Volumes do not account for excess dead volume required for multichannel pipette reservoirs or liquid handling robots. ** The volume of OPTI-MEM per well can be adjusted for optimal handling and automated setup.

e. Dispense the TransIT-LT1 mix to the transfection mix plate (10 µL per well) and mix gently by pipetting.

f. Incubate the transfection plate for 30 minutes at room temperature.

g. Carefully transfer the transfection mix to the packaging cells (in low-antibiotic growth media). The packaging cells can be sensitive to perturbation - take care not to dislodge the cells from the plate.

4. Incubate cells for 18 hours (37 °C, 5% CO2), or until the following morning.

5. Change media to remove the transfection reagent and replace with 170 µL high-BSA growth media or high serum growth media for viral harvests. Note: Lentivirus will start to appear in the media supernatant ~22 hours post-transfection.

6. Incubate cells for 24 hours (37 °C, 5% CO2), or until the following morning.

7. Harvest 150 µL media containing lentivirus and transfer to a 96-well polypropylene storage plate. Replace with 170 µL high-BSA growth media or high serum growth media for viral harvests. Note: The first harvest may be stored at 4 °C for 24 hours if the harvests will be pooled.

8. Incubate cells for 24 hours (37 °C, 5% CO2), or until the following morning.

9. Harvest 150+ µL media containing lentivirus and transfer to a 96-well polypropylene storage plate. Discard the packaging cells.

10. If desired, pool viral harvests and/or rearray to 96-well or 384-well plates. Virus may be stored at 4 °C for short periods (hours to days), but should be frozen at -20 °C or -80 °C for long term storage.

Version Notes:

1/18/07

High-BSA growth media for viral harvests: We have found that viral harvest growth media containing 10% serum + 1.1g/100mL supplemental BSA is equivalent to viral harvest media containing 30% serum – both produce viral stocks with similar high titer. The BSA-supplemented media is more cost effective, easier to mix in standard 500mL media bottles, and may be preferred when transfecting cells that are sensitive to serum.

The RNAi Consortium

Packaging plasmid: the pCMV-dR8.91and pCMV-dR8.74psPAX2 packaging plasmids are equivalent; both produce equivalent high-titer viral stocks. pCMV-dR8.74psPAX2 (“psPax2”) and the envelope plasmid pMD2.G are available from Addgene (www.addgene.org): psPax2 = plasmid #12260, pMD2.G plasmid #12259.

4/10/06

Transfection reagent: TransIT-LT1 (MirusBio) has the same performance as FuGene 6 (Roche) in our comparison tests. Either transfection reagent may be used for virus production. As of this version date, TransIT-LT1 has a lower list price.

Harvest volume and timeline: In previous HT protocols, we recommended 3 media harvests (100 µL each) at ~36, ~48, and ~60 hours post-transfection. We recover the equivalent (or higher) virus yield with 2 media harvests (150 µL each) at ~36 and ~60 hours post-transfection.

High-serum growth media: We have found that increasing the amount of serum to 30% in the virus production media improves virus yield by ~2-fold.

8 The RNAi Consortium 08.27.2007 Section II: Lentiviral production

Introduction: This contains the protocol for lentiviral production in 6 cm plate.

Lentiviral production consists of the following steps:

Day 1 Seed 293T cells

Day 2 (pm) Transfect cells with 3 plasmids

Day 3 (am) 16 hours post-transfection – change media; replace with BSA-containing media Day 4 (am) 24 hours after media change – harvest virus (1) ; replace with BSA-containing media Day 5 (am) 24 hours after harvest (1) – harvest virus (2); combine harvest (1) and (2); discard cells

I. Materials 1. Cell line: 293T packaging cells 2. Growth meidia: DMEM+10% heat-inactivated FBS (Hyclone) + 1X Pen/Strep 3. BSA-containing media: DMEM+10% heat-inactivated FBS (Hyclone) + 1% (W/V) BSA < Bovine Serum Albumin (Sigma, A9430)> + 1X Pen/Strep 4. Plates: 6 cm tissue culture plate 5. Transfection-quality plasmid DNA-- TRC library plasmid: pLKO.1-shRNA vector packaging plasmid: pCMV-ΔR8.91 (containing gag, pol and rev genes) envelope plasmid: pMD.G (VSV-G expressing plasmid) 6. Transfection reagent: TransIT LT1 (Mirus Bio.) < alternative: FuGene 6 (Roche) > 7. Sterile Polypropylene storage tube

II. Instructions 1. Day 1: Seed 293T cells in 6 cm tissue culture plate. ( seeding density: 1.6*10^5 cells/ml; seeding volume: 5 mL) and incubate cells in the incubator (37 °C, 5% CO2) until the following afternoon. Note: [1] The cells are seeded in no Pen/Strep containing-growth media. [2] Before transferring to a culture incubator, keep cells settled for one hour in hood to reduce uneven distribution.

2. Day 2: The cell density should be among 50% to 70% confluence for transfection with TransIT LT1 reagent. a. Prepare a mixture of three plasmids: Reagent per 6 cm plate pCMV-ΔR8.91 2.25 μg pMD.G 0.25 μg hairpin-PLKO.1 2.5 μg OPTI-MEM to total volume 250 μl

9 Note: The cell density at transfection, DNA concentration for transfection and reagent to DNA ratio should be optimized according to the different transfection reagent kit.

b. Dilute transfection reagent: Reagent per 6 cm plate TransIT-LT1 15 μl OPTI-MEM to total volume 250 μl

Add the TransIT-LT1 reagent dropwise into OPTI-MEM, mix by swirling the tip or gently flicking the tube (do not mix by pipetting), and incubate at RT for 5 min.

c. Add the plasmid mixture dropwise into the diluted transfection reagent and mix by swirling the tip or gently flicking the tube

d. Incubate the transfection mix for 20-30 minutes at room temperature.

e. Carefully transfer the transfection mix to the cells. 293T cells would be sensitive to perturbation, therefore take care not to dislodge the cells from the plate.

f. Incubate cells in the incubator (37 °C, 5% CO ) for 16 hours. 2

3. Day 3: Change media to remove the transfection reagent and replace with 5 mL BSA- containing media per plate. Incubate cells for 24 hr (37 °C, 5% CO ). 2

4. Day 4: Harvest media containing lentivirus at 40 hours post-transfection. Transfer media to a polypropylene storage tube and store at 4 °C. Replace with 5 mL BSA- containing media for further harvest.

5. Day 5: Harvest media containing lentivirus at 64 hr post-transfection and then discard the cells. Pool the viral harvests and spin the media at 1250 rpm for 5 minutes to pellet the cells that were collected during harvest. Transfer the supernatant to a polypropylene storage tube and then aliquot to smaller storage tubes to reduce the numbers of freeze/thaw cycles. Note: Virus may be stored at 4 °C for a few days but should be stored at -80 °C for long-term storage.

Version Notes: BSA-containing media for viral harvests: By comparison with growth media, viral harvest media containing 1 g/100 mL supplemental BSA can improve virus yield by ~2 fold.

10 Produced with a Trial Version of PDF Annotator - www.PDFAnnotator.com

9/30/05

Introduction: This section contains protocols for large scale (6 cm plates) and high throughput (96-well and 384-well) lentiviral infections to achieve stable shRNA-mediated target gene knockdown.

Lentiviral infection consists of the following steps:

Day 0-1 Seed cells Day 1 Add lentivirus to cells in growth media containing polybrene (optional for 96-well infections: centrifuge cells to promote infection) Day 1-2 Remove media and replace with fresh growth media Day 2+ (optional) Select for infected cells with media containing puromycin Day 4+ Assay infected cells

All lentiviral procedures should be carried out in accordance with biosafety requirements of the host institution.

I. Materials 6 cm tissue culture plates (appropriate for cell-based assay) Human or mouse cell line and appropriate growth media Reagents required for cell-based assay Polybrene (Hexadimethrine bromide; Sigma #H9268) or Protamine sulfate (MP Biomedicals #194729) (Optional) Puromycin Dihydrochloride (Sigma #P8833)

II. Instructions

A. Optimization of lentiviral infection

Lentiviral infections should be optimized for each cell line and cell-based assay. For example, the following parameters should be tested before starting large-scale infections to determine the optimal conditions for a given experiment: • Cell seeding density • Amount of lentivirus • Puromycin concentration • Timecourse

B. Infection protocol

1. Seed cells at appropriate density in 6 mL media in 6 cm plates.

a. Adherent cells: seed 1 day prior to infection. Incubate overnight (37 °C, 5% CO2).

b. Suspension cells: seed day of infection in media containing polybrene* (see table in step 2a).

page 1 11 Produced with a Trial Version of PDF Annotator - www.PDFAnnotator.com

2. Add virus to cells:

a. (Adherent cells) Remove growth media and add fresh media containing polybrene* (see table). Alternatively, remove a portion of the growth media and supplement with media containing polybrene. Adjust volumes and polybrene concentration to achieve the correct final polybrene concentration. Reagent Per 6 cm plate Media containing polybrene* to 6 mL Final polybrene concentration 8 µg/mL Virus (added in step 2b) High MOI ≥0.5 mL Low MOI ≤0.1 mL * Protamine sulfate may be substituted if polybrene is toxic to cells.

b. Add virus to cells (see table in step 2a).

3. Viral infection:

a. Incubate cells overnight (37 °C, 5% CO2).

b. Change media 24 hours post-infection. Remove media and replace with 6 mL fresh growth media. If puromycin selection is desired, use fresh growth media containing puromycin. Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 µg/mL.

4. Incubate cells (37 °C, 5% CO2), replacing growth media (with puromycin, if desired) as needed every few days. Incubation periods are highly dependent on the post-infection assay. Puromycin selection requires at least 48 hours. The following recommendations are general guidelines only, and should be optimized for a given cell line and assay.

Incubation time Incubation time Post-infection assay with puromycin post-infection selection mRNA knockdown (qPCR) 3+ days 2+ days Protein knockdown (Western) 4+ days 3+ days Phenotypic assay 4+ days 3+ days

5. Assay infected cells.

I. Materials 96-well or 384-well tissue culture plates Human or mouse cell line and appropriate growth media Polybrene (Hexadimethrine bromide; Sigma H 9268) or Protamine sulfate (MP Biomedicals #194729) (Optional) Puromycin Dihydrochloride (Sigma #P8833)

II. Instructions

page 2 12 Produced with a Trial Version of PDF Annotator - www.PDFAnnotator.com

A. Optimization of lentiviral infection

B. Infection protocol 1. Seed cells at appropriate density in 96-well (100 µL per well) or 384-well (50 µL per well) tissue culture plates.

a. Adherent cells: seed 1 day prior to infection. Allow seeded plates to sit undisturbed at room temperature for at least 1 hour before transferring to a tissue culture incubator overnight (37 °C, 5% CO2). Note: allowing cells to settle at room temperature can reduce well-to-well variability and edge effects in 96-well plates.

b. Suspension cells: seed day of infection in media containing polybrene* (see table in step 2a).

2. Add virus to cells.

per well, per well, Reagent 96-well plate 384-well plate Media containing polybrene* to 100 µL to 50 µL Final polybrene concentration 8 µg/mL 8 µg/mL Virus (added in step 2b) High MOI 5 to 20 µL 2 to 5 µL Low MOI** ≤1 to 3 µL N.D. * Protamine sulfate may be substituted if polybrene is toxic to cells. ** Low MOI infections may require dilution of virus stock prior to addition to cells.

b. Add virus to cells (see table in step 2a). Note: The indicated range of viral volume for high and low MOI infections assume typical viral yields from the 96-well viral preparation method described in Section II.

3. Option 1: Spin infection

a. Spin cells at 2250 RPM in plate for 90 minutes at 37 °C. Centrifugation can improve viral infection and decreases the length of exposure of cells to polybrene and virus. Note: Centrifugation is not recommended for 6-well plates or larger, as cells may not be fully covered with media during the spin.

b. Change media immediately following spin infection. Remove media and replace with 100 µL (96-well plates) or 50 µL (384 well plates) fresh growth media.

c. Incubate cells overnight (37 °C, 5% CO2).

page 3 13 Produced with a Trial Version of PDF Annotator - www.PDFAnnotator.com

d. If puromycin selection is desired, remove media 24 hours post-infection and replace with 100 µL (96-well plates) or 50 µL (384 well plates) fresh growth media containing puromycin. Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 µg/mL.

Option 2: No-spin infection

a. Incubate cells overnight (37 °C, 5% CO2).

b. Change media 24 hours post-infection. Remove media and replace with 100 µL (96-well plates) or 50 µL (384 well plates) fresh growth media. If puromycin selection is desired, use fresh growth media containing puromycin. Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 µg/mL.

4. Incubate cells, replacing growth media (with puromycin, if desired) as needed every few days. Incubation periods are highly dependent on the post-infection assay. Puromycin selection requires at least 48 hours. The following recommendations are general guidelines only, and should be optimized for a given cell line and assay.

Incubation time Incubation time Post-infection assay with puromycin post-infection selection Viral titer (Puromycin selection/cell viability) 3+ days 2+ days mRNA knockdown (qPCR) 3+ days 2+ days Protein knockdown (Western) 4+ days 3+ days Phenotypic assay 4+ days 3+ days

5. Assay infected cells.

page 4 14 The RNAi Consortium 08.27.2007 Section III: Lentiviral Infection

Introduction: This section contains protocols for large scale (6 cm plates) and high throughput (96-well and 384-well) lentiviral infections to achieve stable shRNA-mediated target gene knockdown.

Lentiviral infection consists of the following steps:

Day 1 Seed cells Day 2 Add lentivirus to cells in growth media containing polybrene (optional for 96-well infections: centrifuge cells to promote infection) Day 2-3 Remove media and replace with fresh growth media Day 3+ (optional) Select for infected cells with media containing puromycin Day 5+ Assay infected cells

All lentiviral procedures should be carried out in accordance with biosafety requirements of the host institution.

Part 1: Lentiviral infection in 6 cm plates

II. Instructions

A. Optimization of lentiviral infection

Lentiviral infections should be optimized for each cell line and cell-based assay. For example, the following parameters should be tested before starting large-scale infections to determine the optimal conditions for a given experiment: Cell seeding density Amount of lentivirus Puromycin concentration Timecourse

B. Infection protocol

1. Seed cells at appropriate density in 5 mL media in 6 cm plates.

a. Adherent cells: seed 1 day prior to infection. Incubate overnight (37 °C, 5% CO2).

b. Suspension cells: seed at the day of infection in media containing polybrene* (see table in step 2a).

15 2. Add virus to cells:

Reagent Per 6 cm plate Media containing polybrene* to 5 mL Final polybrene concentration 8 µg/mL Note: Protamine sulfate may be substituted if polybrene is toxic to cells.

b. Add virus to cells.

3. Incubate cells overnight (37 °C, 5% CO2). Note: If polybrene or protamine sulfate brings toxicity to cells, then remove media and replace with fresh growth media at infection day.

4. Change media at 24 hours post-infection. Remove media and replace with 5 mL fresh growth media. If puromycin selection is desired, use fresh growth media containing puromycin. Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 µg/mL.

5. Incubate cells (37 °C, 5% CO2), replacing growth media (with puromycin, if desired) as needed every few days. Incubation periods are highly dependent on the post-infection assay. Puromycin selection requires at least 48 hours. The following recommendations are general guidelines only, and should be optimized for a given cell line and assay.

6. Assay infected cells.

Incubation time Incubation time with Post-infection assay post-infection puromycin selection mRNA knockdown (qPCR) 3+ days 2+ days Protein knockdown (Western) 4+ days 3+ days Phenotypic assay 4+ days 3+ days

Part 2: Lentiviral infection in 96-well or 384-well plates (high throughput)

II. Instructions

A. Optimization of lentiviral infection

Lentiviral infections should be optimized for each cell line and cell-based assay. For example, the following parameters should be tested before starting large-scale infections to determine the optimal conditions for a given experiment: ٛ Cell seeding density ٛ Amount of lentivirus ٛ Puromycin concentration ٛ Timecourse

B. Infection protocol 1. Seed cells at appropriate density in 96-well (100 µL per well) or 384-well (50 µL per well) tissue culture plates.

a. Adherent cells: seed 1 day prior to infection. Allow seeded plates to sit undisturbed at room temperature for 1 hour before transferring to a tissue culture incubator overnight (37 °C, 5% CO2). Note: allowing cells to settle at room temperature can reduce uneven distribution of cells.

b. Suspension cells: seed day of infection in media containing polybrene* (see table in step 2a).

2. Add virus to cells.

per well, per well, 384-well plate Reagent 96-well plate Media containing to 100 µL to 50 µL polybrene* Final polybrene Reagent 8 µg/mL concentration Virus (added in step 2b) High MOI 5 to 10 µL 2 to 5 µL Low MOI** ≤1 to 3 µL N.D.

* Protamine sulfate may be substituted if polybrene is toxic to cells. ** Low MOI infections may require dilution of virus stock prior to addition to cells.

3. Option 1: Spin infection

17 a. Spin cells at 2250 rpm (~1100Xg) in plate for 30 minutes at 37 °C. Centrifugation can improve viral infection and decreases the length of exposure of cells to polybrene and virus. Note: Centrifugation is not recommended for 6-well plates or larger, as cells may not be fully covered with media during the spin.

ٛ b. (Optional) Change media immediately following spin infection. Remove media and .ٛ replace with 100 µL (96-well plates) or 50 µL (384 well plates) fresh growth media ٛ .(ٛ c. Incubate cells overnight (37 °C, 5% CO2 ٛ d. If puromycin selection is desired, remove media 24 hours post-infection and replace with ٛ 100 µL (96-well plates) or 50 µL (384 well plates) fresh growth media containing .ٛ puromycin Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 µg/mL.

Option 2: No-spin infection

.(ٛ a. Incubate cells overnight (37 °C, 5% CO2 ٛ b. Change media 24 hours post-infection. Remove media and replace with 100 µL (96-well ,ٛ plates) or 50 µL (384 well plates) fresh growth media. If puromycin selection is desired .ٛ use fresh growth media containing puromycin Note: Puromycin concentration should be optimized for each cell line; typical concentrations range from 2-5 µg/mL.

Incubation time Incubation time with Post-infection assay post-infection puromycin selection Viral titer (Puromycin selection/cell 3+ days 2+ days viability) mRNA knockdown (qPCR) 3+ days 2+ days Protein knockdown (Western) 4+ days 3+ days Phenotypic assay 4+ days 3+ days

5. Assay infected cells.

Relative Viral Titering Using Cell Viability Assay (RIU Method) (Modified from TRC)

Introduction:

This section describes the protocol for a relative titering method for VSV-G-peudotyped lentivirus, based on selection for transduced cells and cell viability assay to quantify survival. According to the curve of cell viability versus viral dose, the relative titer would be estimated.

The relative titering assay consists of the following steps: Day 1 Seed cells Day 2 c Prepare virus dilutions d Add diluted virus to cells in media containing polybrene e Centrifuge cells to promote infection f (Option!) Remove media and replace with fresh media if cells sensitive to polybrene Day 3 24 hours after virus addition: Remove media; replace with media containing puromycin Day 5 48 hours after puromycin addition: Remove media; replace with media containing 10% MTS. After 40-50 minutes incubation, record the absorbance at 490 nm using plate reader. All lentiviral procedures should be carried out in accordance with biosafety requirements of the host institution.

I. Materials 96-well transparent tissue culture plate (Corning/Costar #3599) A549 cell (do not use cells that have been cultured consecutively for more than 15 passages) A549 growth media: F12K medium +10% FBS + 1X Pen/Strep. Standard virus produced by RNAi Core (shLuc#221; C6-4-1) Phenol red-free DMEM 96-well plate (Corning/Costar #3357; polypropylene) Polybrene (Hexadimethrine bromide; Sigma H 9268, 8 mg/ml stock) Puromycin Dihydrochloride (Sigma #P8833) MTS kit (Promega G3581 or G1111; prepare stock solution according to manufacture’s instruction)

Instruments 96-well plate reader (Absorbance OD=490 nm)

II. Procedures:

Day 1

1. Seed 100 µL per well of A549 cells (adjust A549 cells to a density of 60,000 cells/mL) in 96-well tissue culture plates. Allow seeded plates to sit undisturbed at BSC/ room temperature for 1 hour before transferring to a tissue culture incubator overnight (37°C, 5% CO2). Note: Allowing cells to settle at room temperature can reduce uneven distribution of cells.

Day 2

1. Remove 100 μl of growth medium and add 40 μl of growth medium containing 10 μg/ml of polybrene. 2008/1/22 19

2. Prepare a series of diluted standard virus, with sufficient volumes for four replicate wells per dilution (5 µL will be used per transduction well). Example:

Make standard viruses as follows: (Use a new tip for each dilution) Dilution number 1 2 3 4 5 6 7 8 9 10 11 12 Vo lu me ( μl) corresponding to stock 2.5 2 1.5 1 0.8 0.6 0.4 0.3 0.2 0.1 0.05 0.03 virus in per 5μL transduction

Media added (μl) 75 30 40 60 30 40 60 40 60 100 100 67 shLuc#221 virus stock or previous diluted 75 120 120 120 120 120 120 120 120 100 100 100 virus added (μl) # Total volume (μl) 150 150 160 180 150 160 180 160 180 200 200 167 Removed volume to 120 120 120 120 120 120 120 120 100 100 100 0 next well/ dilution (μl) Remaining volume for 30 30 40 60 30 40 60 40 80 100 100 167 transduction (μl)

3. Dilute virus being measured/ tested: add 5 μl of stock virus to 95 μl medium (20X dilution). Note: The final polybrene concentration is 8 µg/mL (following addition of virus).

4. Add 5 μl of both diluted standard virus and tested virus to each well of cells as follows:

Value in each well represents stock virus in per 5μL infection (shLuc#221) 1 2 3 4 5 6 7 8 9 10 11 12 A B 2.5 2 1.5 1 0.8 0.6 0.4 0.3 0.2 0.1 0.05 0.03 C 0.1 2.5 2 1.5 1 0.8 0.6 0.4 0.3 0.2 0.05 0.03 D 2.5 2 1.5 1 0.8 0.6 0.4 0.3 0.2 0.1 0.05 0.03

E 2.5 2 1.5 1 0.8 0.6 0.4 0.3 0.2 0.1 0.05 0.03 F Tested #1 Tested #2 G Tested #1 Tested #2 Spike 2 μl of Spike 2 μl of 0.2 0.1 H GFP virus GFP virus No puro No puro Arrange tested viruses to remaining wells (duplicate or triplicate).

5. Spin plates at 1200Xg for 30 minutes at 37°C. Centrifugation can improve viral infection and decreases the length of exposure of cells to polybrene and virus.

6. Incubate cells overnight (37°C, 5% CO2).

Day 3

1. Remove media and replace with 100 µL fresh growth media containing 2µg/mL puromycin. Note: c Puromycin concentration may be adjusted for each batch of compound. d Keep several uninfected wells without puromycin treatment.

2008/1/22 20 國家型干擾性核醣核酸核心設施 National RNAi Core Facility

2. Incubate cells for 48 hours (37°C, 5% CO2).

Day 5

1. Remove media 48 hours post-puromycin addition and replace with 100 µL phenol red-free DMEM containing 10% MTS (V/V).

2. Incubate the plate for 40-50 minutes (37°C, 5% CO2).

3. Record the absorbance at 490 nm using a 96-well plate reader.

4. Determine the relative viability by comparison with uninfected wells (setting as 100%). Generate the curve by plotting the survival rate versus viral dose. Define the liner range to determine the relative titer.

Example:

Linear range analysis Standard Curve-1 100 120 90 y = 207.37x + 4.4173 100 80 R2 = 0.9987 70 80 60 50 60 40 40 30 20 Cell Survival Rate (%) Rate Survival Cell Cell Survival Rate (%) Rate Survival Cell 20 10

0 0 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.1 0.2 0.3 0.4 0.5 Virus Volume (uL) Virus Volume (uL)

When A549 is infected by 0.4 µL original stock virus, the survival rate is about 88 %. This is equivalent to 88% * 6000 (=5280) cells got infection. The relative virus titer is: 5280 / 0.4 = 13200 R.I.U /µL (1.3*107 R.I.U./mL) P.S.:R. I.U. stands for relative infection unit.

2008/1/22 21

Lentiviral titering by limiting dilution

I. Materials

6-well cell culture treated plates 15 mL conical vials Polybrene (Hexadimethrine bromide; Sigma #H9268) or Protamine sulfate (Sigma #P4020) Puromycin Dihydrochloride (Sigma #P8833) Crystal Violet Solution (Sigma #HT90132) Dulbecco’s Phosphate Buffered Saline (PBS) Human and mouse cell line and appropriate growth media.(For example, A549 cell and F-12K culture medium containing 10% fetal calf serum and 1 X Pen/Strep).

II. Instructions

A. Optimization of lentiviral infection 1. Lentiviral infections should be optimized for each cell-line. For example, the cell seeding density, the puromycin concentration, cytotoxicity of polybrene and time course should be test before cell-based assay. 2. Growth rate of cell is very greatly. Adjust the number of cell plated to accommodate a confluency of 50% upon transduction. 3. To make sure the cell is always in the fastest growth phase, never let the cell grow more than 80% confluence. 4. Depending on the experimental setting, different types of cells can be used in order to determine the infectious titer. B. Procedure

1. (DAY 1) Plate 2 x 105 A549 cells per well in a 6-well plate and incubates at 37 °C, 5 % CO2 for 18-20 hours. 2. (DAY 2) Make a stock solution of F-12K culture medium with 8 ug/ml polybrene. 3. Thaw lentivirus stock at room temperature and prepare 2 mL 10-fold serial dilutions ranging from 10-2 to 10-6 in 15 ml conical vials. Mix gently by inverting the tubes 10 times. 4. Add 1 ml F-12K culture medium containing polybrene to one well as a mock control. Then add 1ml of each of diluted virus to the remaining wells of the plate. Incubate at incubator at 37 °C, 5 % CO2 for 18-20 hours.

2008/4/23 22 國家型干擾性核醣核酸核心設施 National RNAi Core Facility

5. (DAY 3) Remove the medium containing virus from well and replace with 2 mL of F-12K culture medium (without polybrene). 6. (DAY 4) Remove the medium and replace with 2 mL of F-12K culture medium containing puromycin (2 μg/mL) to select stably transuded cells. 7. (DAY 5-14)Replace medium with fresh medium containing puromycin every 3–4 days. 8. (Day 14)Remove the medium and gently wash each well with 3ml PBS once. Add 1 ml crystal violet solution and incubate 10 minutes at room temperature. 9. Remove crystal violet solution, then gently wash well with 3 ml PBS twice. Count the blue-stained colonies. 10. Titer of the lentiviral stock was determined by: Number of clonies × Folds of dilution (transducting units/ml; TU/mL).

Example: The colony counts were shown at table,

Dilution Mock 10-2 10-3 10-4 10-5 10-6 number of No UD* UD UD 38 4 colony colonies

*UD: undeterminable

Thus, the titer of the lentiviral stock is 3.9 x 106 TU/ml (i.e . average of 3.8 x 105 and 4 x 106)

2008/4/23 23

GFP expressed lentiviral titering

I. Materials

1. 96-well cell culture treated plates 2. 15 mL conical vials 3. 5 ml Polypropylene Test Tube 4. Polybrene (Hexadimethrine bromide; Sigma #H9268) or Protamine sulfate (Sigma #P4020) 5. 1x Dulbecco’s Phosphate Buffered Saline (PBS) 6. Trypsion-EDTA 7. Human and mouse cell line and appropriate growth media.(For example, HEK 293T cell and DMEM culture medium containing 10% heat inactivated fetal calf serum and 1 X Pen/Strep.)

II. Instructions

A. Optimization of lentiviral infection

1. (DAY 1) Plate 4 x 105 293T cells per well in a 6-well plate and incubate at 37 °C, 5% CO2 for 18-20 hours 2. (Day 2) Prepare 15ml of DMEM culture medium containing polybrene (final concentration 8 ug/ml). 3. Thaw lentivirus stock at room temperature and store the virus stock on ice. Mix by gently tapping the tube several times with finger. 4. Prepare 2 mL 10-fold serial dilutions ranging from 10-1 to 10-4 in 15 ml conical vials. Mix gently by inverting the tubes 10 times. 5. Add 1 ml DMEM culture medium containing polybrene to one well as a mock control. Then add 1ml of each of diluted virus to the remaining wells of the plate. Incubate at 37 °C for 18-20 hours. 6. (Day 3) Remove the medium containing virus from well and replace with 2 ml of DMEM culture medium (without polybrene). 7. (Day 4 and forward) Replace medium every 2-3 days until GFP expression. Trypsinize cells, inactivate with culture media, spin and resuspend in cold PBS for FACS analysis. 8. FACS analyzes for GFP expression and record the percentage of cells that are GFP positive. Use a well that has between 1% and 20% of cells expressing GFP to determine titer.

2008/4/23 24 國家型干擾性核醣核酸核心設施 National RNAi Core Facility

Formula for virus titer calculation: titer = {(F × Cn) /V} × DF F: The frequency of GFP-positive cells determined by flow cytometry; Cn: The total number of target cells infected. V: The volume of the inoculum. DF: The virus dilution factor.

Example:

Dilution 0 10-1 10-2 10-3 10-4

DF 0 10 100 1000 10000

0 0.12 0.003 0.0004 F 0.01 (1%) (0%) (12%) (0.2%) (0.05%)

Cn 2 x 105 2 x 105 2 x 105 2 x 105 2 x 105

V (ml) 1 1 1 1 1

Titer 0 2.4 x 105 2 x 105 6 x 105 8 x 105 (TU/ml)

Thus, the titer of the lentiviral stock is 2.2 x 105 TU/ml (i.e. .average of 2.4 x 105 and 2 x 105)

2008/4/23 25 TRC Assay Development for HTS Guidelines

Version 8/10/06

One goal of the RNAi Platform at Broad is to enable high-throughput screening collaborations with other members of the TRC, the Broad community, Broad associates, and the wider biological research community. Successful, high quality HT screens require a period of assay development to test and optimize the screening conditions. This document provides a guideline to assay development experiments specific to arrayed RNAi screening with the TRC lentivirus library.

Assay Development Experiments

Stage I: Proof-of-concept

• Lentivirus transduction: Infect cells with GFP-expressing lentivirus, for example 0 !L, 1 !L, 2 !L, 5 !L, 10 !L, 20 !L PGK-GFP in 24-well plates. Starting two days post-infection, estimate infection efficiency by visual inspection (or by FACS). Increasing amounts of virus should result in increasing numbers of GFP-positive cells, and at high MOI, in increasing GFP signal per cell. Test whether virus is tolerated by the cells overnight or must be removed immediately following spin infection.

• Polybrene toxicity: Expose cells to media containing 8 µg/mL polybrene to determine polybrene toxicity. At a minimum, assess cell growth and cell morphology for several days following 24 hour polybrene exposure (compared to no polybrene exposure); ideally, compare actual screening assay results +/- polybrene exposure. If polybrene is toxic, test shorter exposure times (minimum ~2 hours) or substitute protamine sulfate.

• RNA interference: Co-infect cells with GFP-expressing lentivirus and with shGFP-expressing knockdown lentivirus. Use a control shRNA (non-GFP targeting) lentivirus as a control in parallel. Starting two days post-infection, compare the level of GFP-expressing in cells infected with shGFP virus compared to the control (non-GFP targeting shRNA). If available, a stable GFP-expressing derivative cell line may be used – compare GFP levels following infection with shGFP virus vs. infection with a control shRNA virus. Cells infected with shGFP virus should have lower GFP levels than the control shRNA.

• Test phenotypic assay(s) under high throughput conditions: scale down assays to small numbers of cells and small assay volumes to mimic 96 well or 384 well conditions (divide a large sample into many small samples or test directly in plates). The assay should be reproducible across large numbers of replicates. Ideally, include a positive control (drug, siRNA, shRNA, etc) to demonstrate the phenotype of interest. The RNAi Platform is familiar with several types of high-throughput phenotypic assays, check with Screening Project Manager for details.

Stage II: Validation and Optimization of Screening Conditions

• Test assay in 96 well and/or 384 well plates.

26 The following tests may require a few iterations to optimize conditions. Different assay timelines will have different optimal seeding densities, and different seeding densities may have different optimal puromycin selection. • Cell seeding density: seed at several densities (e.g. 96 well plates: 1,000 – 10,000 cells per well; 384 well plates: 100-1,000 cells per well), infect with test virus (e.g. shGFP), select +/- puromycin, inspect over several days, assay if needed. Some assays are optimized for the highest density wells to be nearing confluency at the time of the assay, while others require lower confluency (e.g. high content imaging).

• Puromycin selection: seed cells, infect with titration series of test virus (e.g. shGFP) covering low to high MOI conditions and mock-infected control, select with range of puromycin (0, 1, 2, 3, 4, 5 µg/mL), assay. Determine optimal puromycin concentration for selection such that mock-infected samples are dead while samples infected at high MOI have good survival and growth. Low MOI samples should have a mix of live and dead cells under visual inspection, and should have a cell count or cell viability in between high MOI and mock-infected wells.

• Effect of viral titer on assay: seed cells, infect with a titration series of virus from a library test plate, assay. Include duplicate infection plates for each virus volume, treat one plate with puro selection and one without to have paired +/- puro wells for analysis. Analyze data to assess whether increasing amounts of virus affect the screening results. For example, does increased virus lead to decreased cell counts/cell viability?

• Assay timeline: seed cells, infect with test virus (e.g. shGFP), select +/- puromycin, assay at different timepoints.

When screening protocol is optimized • Assay reproducibility: seed cells, infect at least 2 plates with one volume of 1-5 viral stocks (e.g. 1 uL of shGFP in 50 wells per plate), grow under screening conditions (e.g. +/- puromycin), assay. Include uninfected and/or mock-infected cells in parallel. Analyze data for distribution and variation – test various forms of the data for normal distribution (e.g. raw data, background-subtracted, log transformed); compute standard deviation,

Stage III: Prescreen

• Prescreen using a sampling of screening set virus plates with optimized HTS protocol. Test ~4 virus infection volumes for 2-4 library (96 well) plates in the screening set, which are selected to represent the range of titer in the screening set. The idea of the prescreen is to run a small number of plates in the exact HTS conditions before beginning the large scale screen; this also determines the amount of virus to use in the final screen.

Stage IV: Screen!

27 Cell types shown to be transduced by TRC library lentivirus last updated September 2008

Cell Line Name Reference 5A97 Kelly Fahrbach et al., (2007) 82HTB Hansoo Lee et al., (2007) A172 Jung-Sik Kim et al., (2007) A431 Jeffrey A. Engelman et al., (2005) A549 Jeffrey A. Engelman et al., (2005) A549 Yohei Hirai et al., (2007) Ba/F3 Takeshi Shimamura et al., (2008) BE R Vasilcanu et al., (2008) BJAB Shalini Oberdoerffer et al., (2008) BL41 Shalini Oberdoerffer et al., (2008) Calu-3 Jeffrey A. Engelman et al., (2005) CEM Nana Ueffing et al., (2008) CMK Claudia Scholl et al., (2007) DLD1 Carme Cortina et al., (2007) Du145 Phillip Gray et al., (2007) EOL-1 Claudia Scholl et al., (2007) ES-2 Jiangyong Miao et al., (2007) GBM lines Ruprecht Wiedemeyer et al., (2008) GIST430 M-J Zhu et al., (2007) GIST48 M-J Zhu et al., (2007) H3255 Takeshi Shimamura et al., (2008) H358 Jeffrey A. Engelman et al.,(2005) HEL Claudia Scholl et al., (2007) HepG2 Hai-Lin Fang et al., (2007) HL-60 Claudia Scholl et al., (2007) HMEC Jesse Boehm et al., (2007) HMECtert Tobias Schmelzle et al., (2007) HMLER Tamer Onder et al., (2008) Hs 840.T Tsan-Chi Chen et al., (2007) HSC-5 Yohei Hirai et al., (2007) hTERT-HME1 Hui Li et al., (2008) HUVEC Yohei Hirai et al., (2007) IMR-90 Ole Gjoerup et al., (2007)

28 Cell types shown to be transduced by TRC library lentivirus last updated September 2008

Cell Line Name Reference IMR-90 Ole V. Gjoerup et al., (2007) IMR32 Tsan-Chi Chen et al., (2007) IOSE80 Jiangyong Miao et al., (2007) K-562 Claudia Scholl et al., (2007) Kasumi-1 Claudia Scholl et al., (2007) KG-1 Claudia Scholl et al., (2007) LiBr Sabine H. Wimmer-Kleikamp et al., (2008) MCF-10A-2A Tobias Schmelzle et al., (2007) MCF-12A Tobias Schmelzle et al., (2007) MCF10A Bin Zhao et al., (2008) MCF10A Jung-Sik Kim et al., (2007) MCF7 Jesse Boehm et al., (2007) MCF7 Suntaek Hong et al., (2007) MCF7 Yohei Hirai et al., (2007) MEF Yasemin Sancak et al., (2007) MOLM-14 Claudia Scholl et al., (2007) MONO-MAC-6 Claudia Scholl et al., (2007) MRC-5 Tsan-Chi Chen et al., (2007) MV4-11 Claudia Scholl et al., (2007) NB4 Claudia Scholl et al., (2007) NOMO-1 Claudia Scholl et al., (2007) OCM1 R Vasilcanu et al., (2008) OCM3 R Vasilcanu et al., (2008) OV-30 Jiangyong Miao et al.,(2007) OV-90 Jiangyong Miao et al.,(2007) OVCAR-3 Jiangyong Miao et al.,(2007) P12 R Vasilcanu et al., (2008) P6 R Vasilcanu et al., (2008) PC3 Phillip Gray et al., (2007) PC9 Takeshi Shimamura et al., (2008) Phoenix amphotropic Ole V. Gjoerup et al., (2007) PSR-1E Tobias Schmelzle et al., (2007) PT67 Yohei Hirai et al., (2007)

29 Cell types shown to be transduced by TRC library lentivirus last updated September 2008

Cell Line Name Reference RD Tsan-Chi Chen et al., (2007) SCp2 Yohei Hirai et al., (2007) SKM-1 Claudia Scholl et al., (2007) THP-1 Claudia Scholl et al., (2007) TOV112D Jiangyong Miao et al., (2007) U-937 Claudia Scholl et al., (2007) U343MG R Vasilcanu et al., (2008) WI-38 Ole V. Gjoerup et al., (2007) 1355T Wenjun Guo et al., (2006) 16HBE Weidong Ji et al., (2008) 2091 and IMR90 Jagruti H. Patel et al., (2007) 293FT Ole V. Gjoerup et al., (2007) 293T Emilie Vander Haar et al., (2007) 293T Jung-Sik Kim et al., (2007) 293T Suntaek Hong et al., (2007) 293T Zheng Fu et al., (2006) 3T3 Amit Dutt et al., (2008) 3T3 Bin Zhao et al., (2008) 3T3-L1 Jun Eguchi et al., (2008) 3Y1 Sudharkar Kalakonda et al., (2007) 5ADL Kelly Fahrbach et al., (2007) 7 T-ALL lines Teras Palomero et al., (2006) A549 Kathleen Smoak et al., (2006) ALCL Roberto Piva et al., (2006) astrocytoma samples Stefan Pfister et al., (2008) BaF3 Stephen Frohling et al., (2007) CD34+ Benjamin Ebert et al., (2008) CD34+ Claudia Scholl et al., (2007) CLL Victoria Del Gaizo Moore et al., (2007) Co115 Carme Cortina et al., (2007) COLO205 Daciana H. Margineantu et al., (2007) COS7 Susan Sullivan et al., (2007) DAS Lucia Wille et al., (2007)

30 Cell types shown to be transduced by TRC library lentivirus last updated September 2008

Cell Line Name Reference DFB R Vasilcanu et al., (2008) DU145 JuanJuan Yin et al., (2008) frozen tumor Ruprecht Wiedemeyer et al., (2008) GIST430 Michael Heinrich et al., (2006) GIST882 M-J Zhu et al., (2007) H1299 Jeffrey A. Engelman et al., (2005) H1299 Yikun Li et al., (2008) HCT116 Farjana Fattah et al., (2008) HCT116 Michael DeRan et al., (2007) HeLa Duarte C. Barral et al., (2008) HeLa Jocelyn Lee et al., (2007) HeLa Kumar M. R. Bhat et al., (2006) HeLa Laura A. Lee et al., (2005) HeLa Shida Yousefi et al., (2006) HeLa Yasemin Sancak et al., (2007) HEp-2 carcinoma Dmitri G. Negorev et al., (2006) HMEC Yohei Hirai et al., (2007) HMGA1 S Liau et al., (2007) HMLE Tamer Onder et al., (2008) HT1080 Wan Seok Yang et al., (2008) HT29 Jason Moffat et al., (2006) HuT78 Nana Ueffing et al., (2008) HUVEC Olga tatti et al., (2008) JS-1 Hansoo Lee et al., (2007) JSL1 Shalini Oberdoerffer et al., (2008) LK63 Sabine H. Wimmer-Kleikamp et al., (2008) LLC-PK1 Kuan-Hua Lina et al., (2008) LN308 David Zagzag et al., (2006) LnCap Phillip Gray et al., (2007) MC3T3-E1 Dallas C. Jones et al., (2006) MCF-10A Tobias Schmelzle et al., (2007) MCF-7-ras Akira Orimo et al., (2005) MCF10A Jianmin Zhang et al., (2008)

31 Cell types shown to be transduced by TRC library lentivirus last updated September 2008

Cell Line Name Reference MCH58 David Pagliarini et al., (2008) MEF Hui Li et al., (2008) MEF Padmaja Gade et al., (2008) MiaPaCa Rebecca Schmidt et al., (2007) MiaPaCa2 Siong-Seng Liau et al., (2006) mouse embryo cortical neuroepithelium Aiwu Cheng et al., (2007) mouse primary neurons Katharine Sepp et al., (2008) N18 A-M Lepagnol-Bestle et al., (2008) NCI-H1299 and U2OS Dongpo Cai et al., (2006) NCI-H1975 and NCI-H820 NSCLC Takeshi Shimamura et al., (2008) NSCLC Jeffrey A. Engelman et al., (2006) p53ER lymphoma Ravi K. Amaravadi et al., (2007) PC3 Jesse Boehm et al., (2007) PC9 S. Michael Rothenberg et al., (2008) PC9 NSCLC Sven Diedrichs et al., (2008) primary hepatocytes Hai-Lin Fang et al., (2007) primary mouse melanocytes Minjung Kim et al., (2006) SH-SY5Y Tsan-Chi Chen et al., (2007) siC and siPML2 Roger D. Everett et al., (2006) SK-N-BE Lawrence Gardner et al., (2006) SKOV-3 Jiangyong Miao et al., (2007) SKOV-3 Zhenfeng Duan et al., (2008) Sup-M2-TS Luca Primo et al., (2007) TF-1 Yuan Ren et al., (2007) U20 Winfried Elis et al., (2008) U20S Kristel Vercauteren et al., (2008) U20S M. Guy Roukens et al., (2008) V6.5 mES Megan Cole et al., (2008) WI-38 Ole Gjoerup et al., (2007)

32 Cell types transduced by TRC library lentivirus

Detailed Report of cell types used in collaboration or consultation with the Broad Institute RNAi Platform last updated September 2008

All conditions listed here should be used only as guidelines towards beginning your own optiimization; please note that cell lines with the same name grown in different laboratories can often behave quite differently. All conditions listed here were developed in the context of specific assays and cell lines; for example, you may need different cell densities if the timeline of your assay is longer or shorter than the one described below. Each row represents an individual assay design; therefore there are often multiple rows per cell line. We have also observed differences between batches of puromycin in the concentration required for complete selection of transduced cells.

96w seeding 384w seeding Virus Volume Polybrene Puromycin If yes, how Cell line name Tissue Type Organism ATCC ID density density (uL/well) Concn (ug/mL) (ug/mL) Spin Infect? long? Infection Efficiency Virus incubation time Notes 697 B-ALL Homo sapiens no n/a >70% infection overnight 293T Renal Cells Homo sapiens 2500 or 1000 3.0 8.0 2 yes 30 minutes 100% infection overnight 3T3-L1 adipocyte Mus musculus CL-173 yes 90 minutes 100% infection overnight 786-0 Renal Cancer Homo sapiens CRL-1932 3.0 8.0 2 no n/a 100% infection 4 hours 786-0 renal cell carcinoma Homo sapiens CRL-1932 0.5 8.0 no n/a 100% infection 4 hours 786-0 renal cell carcinoma Homo sapiens CRL-1932 1.0 8.0 2 no n/a 100% infection 4 hours 786-0 renal cell carcinoma Homo sapiens CRL-1932 300 1.0 8.0 3.5 no n/a 100% infection overnight A431 epidermoid carcinoma Homo sapiens CRL-1555 yes 30 minutes 40-70% infection overnight use high amount of virus (>20uL virus per 200 uL infection volume) A549 Lung Cancer Homo sapiens CCL-185 0.6 8.0 2.5 yes 30 minutes 100% infection overnight A549 lung carcinoma Homo sapiens CCL-185 0.6 8.0 yes 90 minutes 100% infection overnight A549 Lung Cancer Homo Sapiens CCL-185 yes 90 minutes 100% infection overnight A549 Lung Cancer Homo sapiens CCL-185 yes 30 minutes 100% infection overnight A549 lung carcinoma Homo sapiens CCL-185 yes 90 minutes 100% infection overnight A549 Lung Cancer Homo sapiens CCL-185 A549 lung carcinoma Homo sapiens CCL-185 yes 30 minutes 100% infection overnight A549 Lung Cancer Homo sapiens 250 1.5 8.0 2 yes 30 minutes >70% infection overnight B6 MEF mouse embryo fibroblasts Mus musculus N/A Balb/c MEF mouse embryo fibroblasts Mus musculus N/A BJ fibroblast Homo sapiens yes 90 minutes 100% infection overnight BJ/hTERT fibroblast line immortalized with hTERT Homo sapiens CRL-4001 yes 90 minutes overnight BT549 Breast Cancer Homo sapiens 500 2.5 8.0 2 yes 30 minutes >70% infection overnight C2C12 Myoblast Mus musculus CRL-1772 yes 30 minutes <40% but useable overnight C2C12 myotube Differentiated skeletal muscle Mus musculus CRL-1772 yes 90 minutes 40-70% infection overnight Requires high volume of virus (i.e. 30uL virus / 50uL culture volume) CEM-c1 T-ALL Homo sapiens CRL-2265 no n/a >70% infection overnight CH12 B-Cells Mus musculus 5000 15.0 10.0 0.5 no n/a overnight DDLS8817 Dedifferentiated Liposarcoma Homo sapiens 1.0 8.0 2 yes 30 minutes >70% infection overnight Dendritic Cells Primary Dendritic Cells Mus musculus 7.0 8.0 yes 45 minutes <40% but useable overnight DKS-8 Colon Cancer Homo sapiens N/A yes 30 minutes 100% infection overnight DLD-1 Colon Cancer Homo sapiens CCL-221 yes 30 minutes 100% infection overnight FINE 0308 Tumor initiating cells from glioblastoma Homo sapiens 500 2.5 1.0 0.4 yes 30 minutes > 90% Infection 1 hour FUDDLS1 Dedifferentiated Liposarcoma Homo sapiens 1.0 8.0 2 yes 30 minutes 100% infection overnight H1299 Non-Small Cell Lung Cancer Homo sapiens 2000 0.5 and 1.0 n/a 2.5 yes 30 minutes overnight HCT-116 Colon Cancer Homo sapiens CCL-247 3.0 8.0 2 no 90 minutes 100% infection overnight HEL Leukemia Homo sapiens yes 32 minutes 100% infection 2 hours Hela cervical cancer Homo sapiens CCL-2 yes 30 minutes 100% infection overnight HL-60 Acute myeloid leukemia Homo sapens CCL-240 yes 30 minutes > 90% Infection 48 hours HMEC-hTERT Immortalized mammary epithelial Homo sapiens N/A 3.0 8.0 2 no N/A 100% infection 4 hours hMSC mesenchymal stem cell Homo sapiens N/A no N/A 100% infection overnight HMSC mesenchymal stem cell Homo sapiens no N/A 100% infection overnight HS578T Breast Cancer Homo sapiens 500 1.9 8.0 2 yes 90 minutes 40-70% infection overnight HT29 Colon Cancer Homo sapiens HTB-38 2 or 3 8.0 yes 30-45 minutes 100% infection overnight INA6 Multiple Myeloma Homo sapiens NA yes 30 minutes 100% infection 4 hours J774A.1 macrophage Mus musculus yes 30 minutes <40% but useable 3 hours K562 CML Homo sapiens CCL-243 yes 120 minutes 100% infection overnight LN-229 Glioblastoma Homo sapiens CRL-2611 3.0 8.0 2 yes 30 minutes 100% infection overnight LN229 Glioblastoma Homo sapiens CRL-2611 yes 120 minutes 100% infection overnight LNCaP Prostate Cancer Homo sapiens CRL-1740 3.0 8.0 2 yes 30 minutes 100% infection overnight LS141 Dedifferentiated Liposarcoma Homo sapiens 1.0 8.0 2 yes 30 minutes 90% infection overnight MCF7 Breast Cancer Homo sapiens HTB-22 3.0 8.0 2 yes 90 minutes 100% infection overnight MCF7 Breast Cancer Homo sapiens HTB-22 yes 90 minutes 100% infection overnight MCF7 Breast Cancer Homo sapiens HTB-22 1.0 8.0 2 yes 30 minutes 100% infection overnight MCF7 Breast Cancer Homo sapiens HTB-22 500 4.0 8.0 2 yes 30 minutes 90% infection overnight MCH58 fibroblast Homo sapiens yes 45 minutes 100% infection overnight MDA-MB-231 Breast Cancer Homo sapiens HTB-26 3.0 8.0 2 yes 30 minutes 100% infection overnight MDA-MB-468 breast cancer (mammary gland) Homo sapiens HTB-132 yes 30 minutes 100% infection overnight MM1.S Multiple Myeloma Homo sapiens NA yes 30 minutes 100% infection 4 hours NCI-H1437 Lung Cancer Homo sapiens NCI-H1437 600 1.5 8.0 2 yes 30 minutes 100% infection overnight NCI-H1568 Lung Cancer Homo sapiens NCI-H1568 800 1.5 8.0 2 yes 30 minutes 40-70% infection overnight NCI-H1650 Lung Cancer Homo sapiens CRL-5883 yes 120 minutes 100% infection overnight NCI-H1792 Lung Cancer Homo sapiens NCI-H1792 300 1.0 8.0 2 yes 30 minutes >70% infection overnight NCI-H187 Lung Cancer Homo sapiens CRL-5804 yes 120 minutes 100% infection overnight NCI-H1975 Lung Cancer Homo sapiens CRL-5908 yes 120 minutes 100% infection overnight NCI-H1975 Lung Cancer Homo sapiens NCI-H1975 600 1.5 8.0 2 yes 30 minutes >70% infection overnight NCI-H2009 Lung Cancer Homo sapiens NCI-H2009 400 1.0 8.0 2 yes 30 minutes > 90% Infection overnight NCI-H23 Lung Cancer Homo sapiens NCI-H23 700 1.0 8.0 2 yes 30 minutes >70% infection overnight NCI-H522 Lung Cancer Homo sapiens NCI-H522 1000 1.0 8.0 2 yes 30 minutes 100% infection overnight NCI-H82 Lung Cancer Homo sapiens HTB-175 yes 120 minutes 100% infection overnight Nomo Acute myeloid leukemia Homo sapiens 4000 5.0 8.0 2 90 minutes PANC1 pancreatic cancer Homo sapiens CRL-1469 1.4 8.0 yes 90 minutes 100% infection overnight PC3 Prostate Cancer Homo sapiens CRL-1435 3.0 8.0 2 yes 90 minutes 100% infection overnight PC3 prostate cancer Homo sapiens CRL-1435 2.0 8.0 yes 90 minutes 100% infection overnight PC3 prostate cancer Homo sapiens CRL-1435 yes 90 minutes 100% infection overnight PC3 prostate cancer Homo sapiens CRL-1435 1.5 8.0 2 yes 30 minutes 100% infection overnight primary bone marrow dendritic cells Bone marrow Mus musculus N/A yes 45 minutes >70% infection add media immediately post spin Primary CD34+ bone marrow cells Hematopoietic progenitor cells Homo sapiens yes 30 minutes >70% infection 2 hours Requires high volume of virus (i.e. 30uL virus / 100uL culture volume) Primary CD34+ cord blood cells Hematopoietic progenitor cells Homo sapiens yes 31 minutes >70% infection 2 hours Requires high volume of virus (i.e. 30uL virus / 100uL culture volume) Primary Cortical Neuron Primary Cortical Neuron Mus musculus 10000 n/a 4.0 n/a 0.5 yes 30 minutes >70% infection 3 hours Primary Cortical Neuron Primary Cortical Neuron Mus musculus 10000 n/a 7.0 n/a 0.5 yes 30 minutes >70% infection overnight RAW 264.7 leukaemic monocyte macrophage Mus musculus TIB-71 RawgNO macrophage Mus musculus CRL-2278 no n/a 100% infection overnight RDD2213 Dedifferentiated Liposarcoma Homo sapiens 1.0 8.0 2 yes 30 minutes >70% infection overnight RPMI8226 Multiple Myeloma Homo sapiens NA yes 30 minutes 100% infection 4 hours

33 SKBR3 Breast Cancer Homo sapiens HTB-30 1.5 8.0 2 yes 120 minutes 100% infection overnight Sup-T1 T-ALL Homo sapiens CRL-1942 yes 120 minutes 100% infection overnight T47D Breast Cancer Homo sapiens HTB-133 1.5 8.0 2 yes 120 minutes 100% infection overnight T47D Breast Cancer Homo sapiens HTB-133 500 3.0 8.0 2 yes 30 minutes >70% infection overnight TEC thymic epithelial Homo sapiens 500 1.0 8.0 2 no n/a 100% infection overnight TF-1 Leukemia Homo sapiens yes 33 minutes 100% infection 2 hours THP-1 Acute myeloid leukemia Homo sapiens yes 90 minutes overnight THP-1 Acute myeloid leukemia Homo sapiens 5500 6.0 8.0 0.5 yes 90 minutes >70% infection U-87 MG Glioblastoma Homo sapiens HTB-14 yes 120 minutes 100% infection overnight U20S osteosarcoma Homo sapiens 1.5 1.0 2 yes 30 minutes >70% infection overnight U20S osteosarcoma Homo sapiens 500 1.5 8.0 1.5 U2OS osteosarcoma Homo sapiens 1.5 8.0 1.5 yes 30 minutes 90% infection overnight U87 Glioblastoma Homo sapiens HTB-14 3.0 8.0 2 yes 90 minutes 100% infection overnight V6.5 Embryonic Stem Cells Mus musculus 1500 2.0 8.0 3.5 yes 30 minutes overnight WT MEF mouse embryo fibroblasts Mus musculus N/A yes 30 minutes 100% infection overnight very sensitive for virus titer, high viral toxicity at good infection ratio

34 09/10/08

Section V: Validation of Target Gene Knockdown with Quantitative PCR

Introduction: This section contains protocols to use quantitative PCR (qPCR) for: - pre-validation of gene expression in different cell lines and - high-throughput validation of target gene knockdown following lentiviral delivery of TRC shRNA constructs. We recommend first determining gene expression levels in cultured cells to establish that a gene is expressed and can be quantified by qPCR (“pre-screen”) prior to validating target gene knockdown with TRC shRNA constructs. Knockdown validation consists of infecting cells with lentiviral shRNA stocks, selecting for transduced cells, isolating total RNA, synthesizing cDNA, and quantifying expression of the target gene and an endogenous control gene with qPCR. It is important to include reference infections with non-targeting constructs for comparison. This protocol describes a high-throughput qPCR method using SYBR green assays and ΔΔCt analysis to calculate target gene knockdown; other qPCR assays and analysis methods are feasible but may require some changes to the protocol below.

Knockdown validation consists of the following steps: Pre-screen Test qPCR assay on cDNA sample from non-transduced cells Day 0 Seed cells Day 1 Infect cells (see Section III: Lentiviral Infection)

Day 2 24 hours after virus addition: Remove media; replace with fresh media containing puromycin Day 4+ ≥ 48 hours after puromycin addition: Lyse cells for RNA isolation Isolate total RNA Synthesize cDNA Quantify gene expression with qPCR All lentiviral procedures should be carried out in accordance with biosafety requirements of the host institution.

Part 1: Pre-screen: Confirmation of gene expression and assay quality

I. Materials Human or mouse cell line and appropriate growth media TriZol/TriReagent (e.g. Molecular Research Center, #TR-118) Falcon tubes Chloroform M-MLV Reverse Transcriptase (Sigma, #M1302) Oligo dT20 (ordered from oligo vendor such as IDT) Random 9-mer oligos (ordered from oligo vendor such as IDT) dNTPs (e.g. Stratagene, #200415-51) RNAse-free PCR plate Plate seal RNase-free water (e.g. Ambion, #9922) SYBR Green assay for target gene (e.g. selected from PrimerBank) SYBR Green assay for endogenous control gene (e.g. selected from PrimerBank) SYBR Green qPCR Master Mix (e.g. Sigma, # S9194) qPCR 384-well optically clear plate and seal (e.g. Roche, # 5102430001)

35 II. Instructions 1. Grow cells to 80-95% confluency in a tissue culture flask. Optional: treat these cells as you would for TRC shRNA knockdown (e.g. infect with control virus, select with puromycin) to generate a representative sample to pre-validate target gene expression. 2. Isolate total RNA according to the TriReagent protocol, with the following recommendations and changes: a. Remove media completely. Optional: wash cells gently with PBS; remove completely. Lyse cells with 1 mL TriReagent per cm2 flask surface area. Gently shake or rock the flask for 5 minutes at room temperature to promote lysis. Pipet up and down to mix well, then transfer TriReagent to a Falcon tube. Note: for suspension cells, use TriReagent LS (Mol. Research Center, #TS-120) as per protocol. Samples may be stored in TriReagent at -80 °C. b. Add 0.2mL of chloroform for every 1mL of TriReagent. Mix by pipetting, then shake vigorously for 45-60 seconds, or until the mixture is pink and homogeneous. Incubate at room temperature for 2-3 min. c. Pre-chill a centrifuge to 4 ºC. Centrifuge for 15 minutes at 10,000g (or as fast as possible) at 4 ºC. The sample should resolve into a clear aqueous layer above a pink organic layer; there may be white material at the interface. Be careful not to shake or invert the sample or disturb the interface. d. Transfer the top aqueous phase to a fresh Falcon tube, being extremely careful to not disrupt or disturb the interface, or to transfer any white or pink material. It is much better to sacrifice yield than to get the final drops of the aqueous layer and risk contamination with the interface or the organic layer. Dispose of the pink organic layer as phenol waste. e. Option 1: proceed with RNeasy column (recommended). Option 2: precipitate the RNA by adding 0.5 volume isopropanol and mix well. Centrifuge for 15 minutes at 10,000g (or as fast as possible) at 4 ºC (mark the tube for centrifuge orientation to be able to locate a pellet). Carefully pour off the supernatant. Wash pellet with 70% ethanol and spin again (same orientation). Carefully pour off the supernatant and remove residual liquid. Allow the pellet to dry for at least 5 minutes, then resuspend in RNAse-free water. After the RNA pellet is resuspended, keep the RNA sample on ice at all times. Store at -80 ºC.

3. Recommended: Purify the RNA sample on an RNeasy column, as described in the protocol. a. Add 1 volume (<9mL) 70% ethanol to the lysate and mix thoroughly by vortexing. b. Use a pipette to transfer up to 15 mL of the sample, including any precipitate, to an RNeasy maxi column and place in a 50mL collection tube (included with RNeasy kit). Close the screw-top collection tube and centrifuge for 5 minutes at 5,000g at 4 ºC and discard flow-through. If there is remaining sample, repeat this step until the sample is fully loaded on the column. Note: The maximum binding capacity for the RNeasy maxi columns is 6 mg, or 107-108 cells. c. Wash the column with 15 mL Buffer RW1. Close the collection tube and centrifuge for 5 minutes at 5,000g at 4 ºC. Discard the flow-through from the collection tube. d. Wash the column with 10 mL Buffer RPE. Close the collection tube and for centrifuge 5 minutes at 5,000g at 4 ºC. Discard the flow-through from the collection tube. (Add Ethanol to Buffer RPE as per RNeasy protocol.) e. Repeat the wash with another 10mL Buffer RPE. Close the collection tube and centrifuge for 10 minutes at 5,000g at 4 ºC. Discard the flow-through from the collection tube. Repeat the spin for 10 minutes at 5,000g at 4 ºC without closing the collection tube. Let the column sit open at room temperature in a chemical fume hood for approximately 10 minutes or until membrane is visibly dry. f. Elution: Transfer the RNeasy column to a new 50 mL collection tube. Pipet 1.0 mL RNase-free water directly onto the RNeasy membrane. Close the collection tube and incubate for 2 minutes at room temperature before centrifuging for 3 minutes at 5,000g at 4 ºC. g. Store at -80ºC.

4. Analyze the purity and concentration of the RNA sample on a spectrophotometer. Minimum purity requirements: A260/A280 > 1.8 A260/A230 > 2, ideally absorption minimum at 230 λ.

36 5. Synthesize cDNA according to the M-MLV Reverse Transcriptase protocol, with the following recommendations and changes: a. Combine the following reagents in a reaction tube: 0.5 µl 25 mM dNTPs 0.33 µl 50 µM oligo dT20 primers 0.66 µl 50 µM random 9mer primers up to 4 µg total RNA bring vol to 15uL RNAse-free water Note: for more than one RNA sample, prepare a master mix of dNTPs, primers, and water. Recommended: In parallel, set up a NTC (No Template Control) sample consisting of a cDNA reaction with RNA template and withoutM-MLV enzyme or a mock cDNA reaction consisting of buffers and primers only. b. Incubate at 70 ºC for 1 minutes to denature RNA. Immediately transfer to wet ice. c. Add the following reagents (in order), and mix: 2 µl 10x RT buffer 1 µl M-MLV Reverse Transcriptase Note: for more than one RNA sample, prepare a master mix of buffer, DTT, and enzyme. d. Incubate at 37 ºC for 50 minutes, then at 75 ºC for 10 minutes to inactivate the enzyme. e. The cDNA reaction may be stored at -20 ºC.

6. Serially dilute the cDNA sample to create a standard curve for qPCR. First, add 160 µl molecular biology-grade water to the cDNA reaction and mix by pipetting up and down. Make 2 further serial dilutions by combining 175µL water with 25 µL diluted cDNA to create a total of 3 standard curve samples. Dilute the NTC sample with 160 µl molecular biology-grade water (no serial dilution is required). Note: RNAse free water is not necessary at this step.

7. Set up qPCR reactions in 384-well optically clear PCR plates as follows: a. For each assay, prepare an Assay Master Mix for all reaction wells, e.g. all cDNA samples/assay * # dilutions * # replicate wells, plus excess: 2.50 µl 2X SYBR Green Master Mix (contains enzyme, buffer and dNTPs) 0.06 µl 80X SYBR Green assay (2 primers each at 20 µM) 0.44 µl molecular biology-grade water We recommend running 3 replicate qPCR reactions for each cDNA dilution for each assay. b. On ice, aliquot 3 µl Assay Master Mix to appropriate wells in the 384-well qPCR plate.* c. On ice, aliquot 2 µl diluted cDNA sample to appropriate wells in the 384-well qPCR plate.* d. Seal the 384-well qPCR plate with an optically-clear seal. Keep on ice or at 4 ºC until running qPCR. Notes on qPCR setup: It is important that all samples being quantified with the same assay be on the same qPCR plate in order to calculate relative levels of gene expression. * Recommended: set up 384-well qPCR reactions with a robotic liquid handling robot such as the MultiProbe II (Perkin Elmer). For manual setup, larger reaction volumes may be required for consistent data quality.

8. Program a 384-well real-time PCR machine (e.g. Roche LightCycler480 or ABI 7900HT) to define the appropriate samples, assays, and detector (SYBR Green) for the qPCR plate layout. Cycling parameters: - incubate 2 minutes at 95 °C (enzyme activation) - cycle 15 seconds at 95 °C / 10 seconds at 60 °C / 20 seconds at 72 °C x40+ cycles - melt curve: ramp from 60 °C to 95 °C at 1 °C per second. Run time is ~ 1 hour on the LightCycler480 instrument.

9. Analyze target gene expression for both detection (e.g. Ct value of highest cDNA input) and for quantification (e.g. linearity and slope of standard curve). Only continue with high-throughput knockdown validation (Part 2) if gene expression is detectable and the assay is quantitative. The ideal assay will also have no signal in the NTC sample, or a sufficient shift in Ct or in the melt curve data to be able to distinguish specific from non- specific signal.

37 Part 2: HT Knockdown Validation

I. Materials Viral infections: 96-well tissue culture plates Human or mouse cell line and appropriate growth media Polybrene (Hexadimethrine bromide; Sigma H 9268) or Protamine sulfate (MP Biomedicals #194729) Puromycin Dihydrochloride (Sigma #P8833)

Quantitative PCR: RNeasy 96 kit (Qiagen, #74182) RNase-free water (e.g. Ambion, #9922) M-MLV Reverse Transcriptase (Sigma, #M1302) Oligo dT20 (ordered from oligo vendor such as IDT) Random 9-mer oligos (ordered from oligo vendor such as IDT) dNTPs (e.g. Stratagene, #200415-51) RNAse-free PCR plate Plate seal SYBR Green assay for target gene (e.g. selected from PrimerBank) SYBR Green assay for endogenous control gene (e.g. selected from PrimerBank) SYBR Green qPCR Master Mix (e.g. Sigma, # S9194) qPCR 384-well optically clear plate and seal (e.g. Roche, # 5102430001)

Note: this protocol requires a 384-well real-time PCR machine, such as the LightCycler480 (Roche) or the 7900HT (ABI), and SYBR Green PCR assays. Use of an alternate real-time PCR machine or an alternate qPCR assay system may require changes to the protocol, for example an alternative qPCR enzyme mix, a larger reaction volume for a 96-well format, etc.

II. Instructions

1. Infect cells in 96-well tissue culture plates as described in Section III: Lentiviral Infections. Infections should be optimized for the following conditions: a. Seed cells such that the density at the time of lysis (RNA isolation) is 80-95% confluent. b. Infect cells with desired viral MOI. Note that low-MOI (<1) infections will lead to significant cell death following selection. c. Select cells with appropriate dose of puromycin for at least 48 hours. d. Include reference infections with non-targeting constructs for comparison to knockdown constructs.

2. Isolate total RNA according to the Qiagen RNeasy 96 protocol, with the following recommendations and changes: a. Remove all media prior to adding lysis buffer. Add lysis buffer and shake back and forth on a flat surface for 30 seconds, then rotate the plate 180 degrees and shake again for 30 seconds. Note: some cell lines may require additional physical scraping in lysis buffer for efficient lysis. b. (Optional) Cell lysates may be stored at -80 °C prior to RNA isolation. Thaw plates at room temperature (~10 mintues) and pipette up and down gently to mix before proceeding. c. Use the centrifugation protocol rather than using a vacuum manifold. Note: we recommend using a high-speed 96-well plate centrifuge such as the 4K15C centrifuge (Qiagen #81210). d. After the final wash step, empty the waste collection plate and spin again for 4 minutes to ensure that the columns are dry. Then let the plate sit at room temp for an additional 4 minutes, ideally in a chemical fume hood with high air flow, for a final drying step. e. Elute total RNA with one addition of RNAse-free water. The volume of RNA that will be recovered is less than the volume of RNAse free water used to elute. Eluting with 60 µl will usually return at least 45 µl, enough for multiple cDNA reactions.

38 f. If possible, move directly from elution to cDNA synthesis without freezing the RNA. Freeze/thaw cycles may decrease RNA quality. RNA should be frozen at -80 °C for long term storage.

3. Synthesize cDNA according to the M-MLV Reverse Transcriptase protocol, with the following recommendations and changes: a. Add 7 µL total RNA per sample to separate wells in an RNAse-free 96-well PCR plate. Store any remaining RNA at at -80 °C. b. Seal the cDNA plate and incubate at 70 ºC for 1 minute to denature RNA. Immediately transfer to wet ice. c. Prepare sufficient Master Mix for all samples (plus excess): 0.5 µl 25 mM dNTPs 0.33 µl 50 µM oligo dT20 primers 0.66 µl 50 µM random 9mer primers 2 µl 10x RT buffer 1 µl M-MLV Reverse Transcriptase 8.5 µl RNAse-free water d. Unseal the PCR plate and add 13 µL Master Mix per well. Mix. e. Seal the plate and incubate at 37 ºC for 50 minutes, then at 75 ºC for 10 minutes to inactivate the enzyme. f. The cDNA reactions may be stored at -20 ºC.

4. Dilute the cDNA samples prior to setting up qPCR reactions. Add 160 µl molecular biology-grade water to each reaction and mix by pipetting up and down. Be careful of cross contamination. Note: RNAse free water is not necessary at this step.

5. Set up qPCR reactions in 384-well optically clear PCR plates as follows: a. For each assay (both target gene and endogenous control gene), prepare an Assay Master Mix for all reaction wells (e.g. all cDNA samples/assay * # replicate wells, plus excess): 2.50 µl 2X SYBR Green Master Mix (contains enzyme, buffer and dNTPs) 0.06 µl 80X SYBR Green assay (2 primers each at 20 µM) 0.44 µl molecular biology-grade water We recommend running 3 replicate qPCR reactions for each cDNA sample for each assay. b. On ice, aliquot 3 µl Assay Master Mix to appropriate wells in the 384-well qPCR plate.* c. On ice, aliquot 2 µl diluted cDNA sample to appropriate wells in the 384-well qPCR plate.* d. Seal the 384-well qPCR plate with an optically-clear seal. Notes on qPCR setup: In addition to target gene reactions, endogenous control gene reactions are required for each sample. It is not necessary for these reactions be on the same plate as the target gene reactions. It is important that all samples being quantified with the same assay be on the same qPCR plate in order to calculate relative levels of gene expression. * Recommended: set up 384-well qPCR reactions with a robotic liquid handling robot such as the MultiProbe II (Perkin Elmer). When manual setup is required, larger reaction volumes may be required for consistent data quality.

6. Program a 384-well real-time PCR machine (e.g. Roche LightCycler480 or ABI 7900HT) to define the appropriate samples, assays, and detector (SYBR Green) for the qPCR plate layout. Cycling parameters: - incubate 2 minutes at 95 °C (enzyme activation) - cycle 15 seconds at 95 °C / 10 seconds at 60 °C / 20 seconds at 72 °C x40+ cycles - melt curve: ramp from 60 °C to 95 °C at 1 °C per second. Run time is ~ 1 hour on the LightCycler480 instrument.

7. Analyze target gene knockdown using the ΔΔCt analysis method (see ABI User Bulletin #2 and/or Current Protocols in Molecular Biology, Unit 15.8: High-Throughput Real-Time Quantitative Reverse Transcription PCR). Use the reference infections with non-targeting constructs as reference samples to define 100% expression. Note that only samples that are quantified on the same plate with the same qPCR assay may be directly compared for relative gene expression. Data quality indicators include the melt curve data (amplicon Tm) and technical replicate consistency.

The RNAi Consortium

Version Notes:

September 2008 cDNA Synthesis – Improvements to the cDNA synthesis step include use of a cocktail of oligo-dT and random 9mer primers and use of Sigma's M-MLV reverse transcriptase. We have found that, for most target genes, oligo-dT is sufficient for cDNA priming, but for some transcripts adding random 9mer primers can improve qPCR detection. We have also compared panels of different reverse transcriptase enzymes and vendors across a variety of target genes and have found that M-MLV from Sigma often outperforms other reverse transcriptases, including SuperScript II.

SYBR Green – Since the first version of this protocol, we have switched from Taqman assays to SYBR Green assays. This requires slight protocol modifications including a different 2x Master Mix formulation (with SYBR Green dye), 3-temperature cycling conditions for better SYBR Green fluorescence, and addition of a melt curve to measure amplicon Tm. We have tested a panel of different 2x SYBR Green Master Mixed and have found very comparable performance from different vendors. There are a variety of sources for SYBR Green assays, including software packages, pre-designed assay collections, and commercial sources. We select SYBR Green assays from PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html), a collection of pre-designed SYBR Green assays for human and mouse genes. We additionally confirm assay specificity for the target gene by BLAST, and we determine whether the assay amplifies all Entrez transcripts for the target gene and whether the assay crosses an intron, both of which are preferred. qPCR Reaction Volume – We have optimized our robotic liquid handling systems to allow the qPCR reaction volume to decrease to 5 µL total volume. We recommend using this small reaction volume only with robotic qPCR reaction setup and only after careful optimization.

LightCycler480 – We now routinely use a LightCycler480 384w qPCR instrument from Roche for high-throughput qPCR. We have found that the LightCycler480 generates equivalent SYBR Green data as the ABI 7900HT, and offers other advantages for our high-throughput process (faster cycling times, better data management options).

40 Characterization of shRNAs from the CTR01 plate assayed for cell viability or proliferation effects across 20 human and mouse cell types Broad RNAi Platform and the RNAi Consortium last updated May 2009 row col cloneName cloneID % cell types exhibiting viabilty defects number cell lines effect observed / total number of cell lines tested A 4 clonetechGfp_437s1c1 TRCN0000072181 0% A 5 clonetechGfp_693s1c1 TRCN0000072182 0% A 9 clonetechGfp_587s1c1 TRCN0000072186 0% A 10 clonetechGfp_692s1c1 TRCN0000072187 0% A 11 clonetechGfp_226s1c1 TRCN0000072188 0% B 7 clonetechGfp_449s1c1 TRCN0000072196 0% B 8 clonetechGfp_117s1c1 TRCN0000072197 0% B 9 clonetechGfp_645s1c1 TRCN0000072198 0% B 10 clonetechGfp_128s1c1 TRCN0000072199 0% C 7 rfp_269s1c1 TRCN0000072208 0% C 8 rfp_188s1c1 TRCN0000072209 0% C 9 rfp_402s1c1 TRCN0000072210 0% C 11 rfp_401s1c1f 40111 TRCN0000072212 0% D 8 rfp_407s1c1 TRCN0000072221 0% D 10 lacZ_1168s1c1 TRCN0000072223 0% D 11 lacZ_1339s1c1 TRCN0000072224 0% D 12 lacZ_2083s1c1 TRCN0000072225 0% E 7 lacZ_27s1c1 TRCN0000072232 0% E 11 lacZ_305s1c1 TRCN0000072236 0% E 12 lacZ_816s1c1 TRCN0000072237 0% F 3 lacZ_29s1c1 TRCN0000072240 0% F 6 promegaLuc_168s1c1 TRCN0000072243 0% F 8 promegaLuc_225s1c1 TRCN0000072245 0% F 9 promegaLuc_221s1c1 TRCN0000072246 0% F 11 promegaLuc_1510s1c1 TRCN0000072248 0% F 12 promegaLuc_976s1c1 TRCN0000072249 0% G 1 promegaLuc_229s1c1 TRCN0000072250 0% G 2 promegaLuc_163s1c1 TRCN0000072251 0% G 3 promegaLuc_154s1c1 TRCN0000072252 0% G 7 promegaLuc_158s1c1 TRCN0000072256 0% G 11 promegaLuc_228s1c1 TRCN0000072260 0% G 12 promegaLuc_755s1c1 TRCN0000072261 0% H 3 promegaLuc_160s1c1 TRCN0000072264 0% H 5 promegaLuc_743s1c1 TRCN0000072266 0% A 1 clonetechGfp_438s1c1 TRCN0000072178 6% A 7 clonetechGfp_684s1c1 TRCN0000072184 6%

41 A 8 clonetechGfp_436s1c1 TRCN0000072185 6% B 5 clonetechGfp_231s1c1 TRCN0000072194 6% B 11 clonetechGfp_428s1c1 TRCN0000072200 6% C 3 rfp_189s1c1 TRCN0000072204 6% C 4 rfp_59s1c1 TRCN0000072205 6% D 2 rfp_403s1c1 TRCN0000072215 6% D 3 rfp_513s1c1 TRCN0000072216 6% D 5 rfp_66s1c1 TRCN0000072218 6% E 2 lacZ_1397s1c1 TRCN0000072227 6% E 6 lacZ_1650s1c1 TRCN0000072231 6% E 10 lacZ_1935s1c1 TRCN0000072235 6% F 1 lacZ_1932s1c1 TRCN0000072238 6% F 10 promegaLuc_230s1c1 TRCN0000072247 6% G 4 promegaLuc_754s1c1 TRCN0000072253 6% G 5 promegaLuc_745s1c1 TRCN0000072254 6% G 9 promegaLuc_1193s1c1 TRCN0000072258 6% G 10 promegaLuc_159s1c1 TRCN0000072259 6% H 2 promegaLuc_164s1c1 TRCN0000072263 6% C 1 clonetechGfp_506s1c1 TRCN0000072202 12% C 2 rfp_283s1c1 TRCN0000072203 12% E 3 lacZ_ 2082s1c1 TRCN0000072228 12% E 5 lacZ_3003s1c1 TRCN0000072230 12% E 8 lacZ_656s1c1 TRCN0000072233 12% F 4 lacZ_2265s1c1 TRCN0000072241 12% F 5 lacZ_1758s1c1 TRCN0000072242 12% F 7 promegaLuc_224s1c1 TRCN0000072244 12% A 3 clonetechGfp_453s1c1 TRCN0000072180 18% A 12 clonetechGfp_197s1c1 TRCN0000072189 18% B 1 clonetechGfp_229s1c1 TRCN0000072190 18% B 12 clonetechGfp_49s1c1 TRCN0000072201 18% C 12 rfp_620s1c1 TRCN0000072213 18% F 2 lacZ_25s1c1 TRCN0000072239 18% H 1 promegaLuc_153s1c1 TRCN0000072262 18% H 6 promegaLuc_34s1c1 TRCN0000072267 18% E 4 lacZ_1340s1c1 TRCN0000072229 24% E 9 lacZ_14s1c1 TRCN0000072234 24% A 2 clonetechGfp_228s1c1 TRCN0000072179 29% B 4 clonetechGfp_63s1c1 TRCN0000072193 29% B 6 clonetechGfp_62s1c1 TRCN0000072195 29% E 1 lacZ_1341s1c1 TRCN0000072226 29% G 8 promegaLuc_162s1c1 TRCN0000072257 29% A 6 clonetechGfp_696s1c1 TRCN0000072183 35% C 10 rfp_621s1c1 TRCN0000072211 35% D 6 rfp_576s1c1 TRCN0000072219 35%

42 H 4 promegaLuc_1546s1c1 TRCN0000072265 35% B 3 clonetechGfp_477s1c1 TRCN0000072192 41% D 4 rfp_612s1c1 TRCN0000072217 47% G 6 promegaLuc_601s1c1 TRCN0000072255 47% C 5 rfp_276s1c1 TRCN0000072206 59%

43 The RNAi Core Version 3 (10/07/09)

Protocol for shRNA construction‐I: PCR method

Preparation of cloning vector:

1. Incubate 3 μg of shRNA cloning vector with 5 units (NEB) of EcoRI and 10 units of AgeI, (double digestion) in a reaction volume of 100 μl at 370C for overnight (using NEB #4 buffer). 2. Take 5 μl of reaction mixture to check the digested DNA in a regular agarose gel electrophoresis. An example of such restriction analysis is shown in below:

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

9.0kb

3.0kb

2.0kb 1.5kb

1. LKO_TRC001 6. LKO_TRC010 11. LKO_TRC017 2. LKO_TRC005 7. LKO_TRC011 12. LKO_TRC018 3. LKO_TRC007 8. LKO_TRC013 13. LKO_TRC019 4. LKO_TRC008 9. LKO_TRC014 14. LKO_TRC020 5. LKO_TRC009 10.LKO_TRC016 15. LKO_TRC024

Figure legend: 400ng of various shRNA cloning vectors were digested with 2.5 units of EcoRI, 5 units of AgeI in a reaction volume of 30 μl at 370C for 6 hrs (using NEB #4 buffer), and then 15 μl of mixtures mixed individually with loading buffer were subjected to electrophoresis (0.5% agarose gel containing 0.1μg/ml of EtBr, run at 50 volts in 0.5X TBE running buffer containing 0.1μg/ml of EtBr) for 2 hours. As shown in this figure, the 1.9 kb stuffer sequence was completely digested out under this reaction condition, an indication of complete digestion of those vectors.

Please note that EcoRI is easy to trigger star activity, an altered or relaxed specificity of the enzyme (please refer to NEB catalog and technical reference for how to avoid star activity of restriction enzymes).

3. Resolve restriction enzymes digested shRNA cloning vector by 0.7% agarose gel (mix of 0.35% regular agarose plus 0.35% low melting agarose recommended). 4. Purify DNA from gel according to the instructions of Roche or Qiagen DNA elution kit and elute it with 50 μl of autoclaved 0.1X TE buffer.

44 The RNAi Core Version 3 (10/07/09)

Preparation of insert (PCR product):

1. Design and order a long oligonucleotide as a PCR template for amplifying shRNA sequence you desired to clone (see appendix 1 for how to design shRNA oligonucleotide sequence). 2. Set up PCR reaction: shRNA oligonucletide (50μM) 1μl Forward primer (100μM) 2μl Reverse primer (100μM) 2μl KAPAHiFi DNA Polymerase 1μl 5X GC buffer 10μl 2mM dNTPs 5μl d.water final volume to 50μl

3. PCR parameter: Step1→ 950C, 1cycle 5-min Step2→ 950C 15 Sec Step3→ 650C 30 Sec Step4→ 720C 20 Sec (Repeat step 2 to step 4 for another 2 cycles) Step5→ 720C, 1 cycle 5-min Hold at 200C

4. Purify PCR product using MinElute Gel Extraction Kit (Qiagen), and elute it with 80 μl of autoclaved 0.1X TE buffer. 5. Digest eluted PCR product with BsmBI and incubate at 550C in the incubator rather than in water bath for O/N (see appendix 2 for the restriction pattern of BsmBI restriction enzyme). Digestion condition: Eluted PCR product 80μl NEB #3 10X buffer 10 μl BsmBI (10U/μl; NEB) 2 μl d.water final volume to 100μl

6. Purify BsmBI-digested PCR product using MinElute Gel Extraction Kit (Qiagen) and elute it with 20 μl of 0.1X TE buffer. (Recovery rate for 55-60 bp DNA is satisfactory if using this kit.). 7. Set up the ligation reaction (use of 2 μl vector and 4 μl of PCR products, respectively). 8. Transform in E. coli (Stbl III [Invitrogen] recommended; Lentivector is hard to transform into DH5α).

45 The RNAi Core Version 3 (10/07/09)

Protocol for shRNA construction‐II: annealing method

1. Design sense (tail with CCGG [AgeI cohesive end] sequence at the 5’ end) and antisense (tail with AATT [EcoRI cohesive end] sequence at the 5’ end) shRNA oligonucleotide as follows:

If consider cgcatacgacgattctgtgat as the target sequence, then sense (up-strand sequence of following example) and antisense (low-strand sequence of following example) oligonucleotide, respectively, will be as follows:

target sequence/passenger strand siRNA sequence/guide strand ccggcgcatacgacgattctgtgatctcgagatcacagaatcgtcgtatgcgttttt gcgtatgctgctaagacactagagctctagtgtcttagcagcatacgcaaaaattaa ctcgag: loop sequence of shRNA Please note that the design is in concert with TRC shRNA library’s design.

2. Order oligonucleotides with 200 nmole scale and OPC or PAGE purification (oligonucleotide produced by Mission Biotech recommended). 3. Dissolve oligonucleotides into 100 μM with autoclaved distillated water. 4. Prepare 10X annealing buffer: 1M K-acetate 0.3M HEPES-KOH pH7.4 20 mM Mg-acetate 5. Set up annealing mixture: Sense oligo 9 μl Antisense oligo 9 μl 10X annealing buffer 2 μl 6. Anneal mixture by PCR machine using the following parameters: 950C, 780C, 740C, 700C, 670C, 630C, 600C, 560C, 630C, 600C, 560C, 530C, 500C, 480C, 460C, 440C, 420C, 400C, 390C,370C, 360C, 350C, 340C, 330C, 320C, 310C------5 min in each step 300C, 280C, 260C, 240C, 220C, 200C------10 min in each step Hold at 40C 7. Set up ligation reaction mixture and ligation for O/N: RE-restricted shRNA cloning vector 2 μl (Prepare vector followed aforementioned protocol) Annealed oligonucleotides 2 μl 10X ligation buffer 1 μl ligase (1 unit/ μl) 1 μl d.water final volume to 10 μl 8. Take 5-μl ligation mixture and transform it into E. coli competent cells (Stbl III).

46 The RNAi Core Version 3 (10/07/09)

Appendix 1: Design of shRNA oligonucleotide sequence for PCR amplification:

As shown in following example, shRNA sequence plus TTTTT is flanked with common 5’ and 3’ end sequences (as indicated by bold sequences in given example) that include two BsmBI recognition sites (the inclusion of BsmBI in the design is described in Appendix 2). The design of shRNA sequence is described in protocol II: annealing method for shRNA construction.

5’-tctctagatcaacagcgtctctccgg-shRNA-tttttaattagagacgtcaccagtcctcgag-3’

y Primers for PCR amplification of shRNA containing sequence:

shRNA-all/F: 5’-tctctagatcaacagcgtctc-3’ shRNA-all/R: 5’-ctcgaggactggtgacgtctc-3’

Appendix 2: Restriction pattern of BsmBI restriction enzyme

BsmBI-digested DNA will produce two 5’ protruding ends with any sequences by your design (please note that protruding sequences in the following diagram [generated by BsmBI] can be ligated to AgeI and EcoRI -restricted cohesive ends, respectively):

BsmBI 5’-tctctagatcaacagcgtctctccgg-shRNA-tttttaattagagacgtcaccagtcctcgag-3’ 3’-agagatctagttgtcgcagagaggcc-shRNA -aaaaattaatctctgcagtggtcaggagctc-5’ BsmBI

BsmBI digestion

5’-tctctagatcaacagcgtctct ccgg-shRNA-ttttt aattagagacgtcaccagtcctcgag-3’ 3’-agagatctagttgtcgcagagaggcc -shRNA-aaaaattaa tctctgcagtggtcaggagctc-5’

Appendix 3: Sequencing primers

1. LKO_shRNA/F (forward primer): 5’-acaaaatacgtgacgtag-3’ (for sequencing forward strand of shRNA) 2. LKO_shRNA/R (reverse primer): 5’-ctgttgctattatgtctac-3’ (for sequencing reverse strand of shRNA)

Appendix 4: Sequencing method 1. First try regular sequencing kits in the presence of 5% DMSO to determine shRNA sequence. 2. The failure of method 1 could be due to secondary structure of shRNA. If so, then try dGTP BigDye V1.1 kit or equivalent product to determine shRNA sequence.

47 The RNAi Core Version 3 (10/07/09)

Appendix 5: Terrific Broth配方 (Please refer to Molecular cloning for detailed)

Tryptone 12 g/L Yeast extract 24 g/L Glycerol(100%) 4 ml/L

KH2PO4 2.31 g/L

K2HPO4 12.54 g/L Ampicillin or Carbenicillin final concentration：100mg / L

Method of cloning shRNA using selection marker other than puromycin

If two genes or transcripts are to be knockdowned at the same time in one cell, pLKO_AS2 series plasmids provides several selection makers including hygromycin, zeocin, neomycin, and EGFP (for cell sorting) that allows one to insert shRNA sequences with selection markers other than puromycin. Following protocol is one way to modify these vectors to express shRNA with alternative selection marker.

1. Choose one of the pLKO_AS2 series plasmids (pLKO_AS2.EGFP, pLKO_AS2.hyg, pLKO_AS2.neo, pLKO_AS2.zeo) provided by the RNAi Core (please visit Vector Information in the section of Documents/ 檔案下載區 in RNAi Core website). 2. Remove IRES of EMCV by digesting with PmeI and MscI, then self-ligate and transform in E. coli to get IRES-deleted plasmid. 3. Digest resultant plasmid with BamHI and MluI (both sites are just upstream of CMV promoter), and dephosphrylated 5’end phospho group by alkaline phosphatase (AP), if necessary (AP reaction could be performed simultaneously along with RE digestion). 4. Purify RE- and AP-treated vector by 0.8% agarose gel. 5. Design primers to amplify shRNA expression cassette (U6 RNA polI promoter) from pLKO_AS1.

Primer #1: 5’-cgggatccgatcacgagactagcctc-3’ BamHI

Primer #2: 5’-ttactaaccggtacgcgtag-3’ MluI 6. Digest PCR products with BamHI and MluI, and purify RE-digested products with 1% agarose gel. 7. Ligation and transformation. 8. Follow above-mentioned protocols to insert shRNA of interest into resultant plasmid.

2008/5/27 49 Protocol for Cloning Insert into AS2 Series Plasmids (Sticky End PCR method)

Introduction 96/12/27

A PCR cloning strategy called Sticky End PCR Cloning (Zeng, 1998) that allows one to generate sticky end by using standard PCR method is described below. In this method, two pairs of PCR primers are designed and are amplified in two different reactions. Both PCR products are mixed in an equimolar ratio and purified using Roche PCR Cleaning Kit or equivalent products. The purified PCR products are then denatured and re-natured at 950C for 5-min and 650C for 10-min, respectively; approximately 25% of the final product carries desirable protruding ends and is ready for ligation (Option: The kinase reaction could be performed to phosphorylate 5’-ends of the PCR products to enhance ligation efficiency.). A schematic diagram outlining the procedure is shown below (The pLKO_AS2 in the destination cloning sites downstream of EMCV IRES is used here as an example. The protruding sequences were restricted to end with 5’-AACC-3’ (BstXI; 3’end protruding) at one arm and with 5’-CTAG-3’ (XbaI; 5’end protruding) at the other arm, arrows indicate the primers): Primer #1 5’ PCR tube #1

5’ Primer #3 Primer #2 5’- AACC PCR tube #2 GATC- 5’ PCR Primer #4

& 5’- AACC CTAG- 3’ 3’- TTGG GATC- 5’ Purify and mix two PCR products in an equimolar ratio; then de-nature and annealing

3’- TTGG GATC- 5’ (effective annealing PCR product for ligation) Alternatively, annealed PCR products with protruding sequences at one end and with blunt sequences at the other end can also be prepared by this approach. (The pLKO_AS2 in the destination cloning sites downstream of CMV immediate early promoter (CMViep) is used here as an example. The protruding sequences were restricted to end with 5’-CTAG-3’ (NheI) at one arm and with blunt end’ (PmeI) at the other arm, arrows indicate the primers.) Primer #1 5’- CTAGC Separated PCR tube #1 @ Primer #3 5’ 5’- C Separated PCR tube #2 Primer #2 @ 5’ Primer #2 PCR 5’- CTAGC 3’- GATCG & C G Purify and mix two PCR products in an equimolar ratio; then de-nature and annealing 5’- CTAG (effective annealing PCR product for ligation)

@ Both reactions use the same reverse primer for PCR amplification.

50 Procedures

(a) Preparation of insert: 1. Follow standard rules to design two pairs of PCR primers containing desirable protruding sequences at the 5’end according to the requirement as described in aforementioned examples. 2. Perform two sets of PCR reaction by using above two primer pairs. PCR mixture: 5X PCR buffer 10 μl 2 mM dNTPs 5 μl #1 primer (100 μM) 0.5 μl #2 primer (100 μM) 0.5 μl 10-20 ng/ μl DNA template 1 μl EHF PCR polymerase (Roche) 1 μl

d.3H2O to 50 μl (EHF= Roche’s extend high fidelity enzyme)

PCR parameter: 950C 2’ ------1X 950C 15’’

500C 30’’ 20X-25X 720C x’’ (follow the rule: 1kb/1 min) 720C 5’ ------1X 0 Hold at 20 C 3. Take 1 μl PCR products to check the quality and quantity by using agarose gel electrophoresis. 4. Mix PCR products in equimolar ratio from two tubes based on the result of agarose gel electrophoresis. 5. Purify PCR products by using Roche’s PCR Cleaning Kit according to the instructions provided by manufacturer. 6. Elute PCR products with 65 μl autoclaved 0.1X TE buffer. 7. Add 10 μl of 5X EHF PCR buffer, mix well and transfer DNA mixture to PCR tube. 8. Denature and re-nature mixed PCR products using PCR machine under following parameter: 95OC 5-min 65OC 10-min Hold at 4OC

9. Add 9 μl 10X PNK (polynucleotide kinase) buffer, 2 μl of 2 mM ATP, and 10 U PNK. 10. Mix well; and incubate at 370C for 1 hr. 11. Purify PCR products by using 0.8% agarose gel (to get rid off plasmid template). 12. Excise the gel containing desired DNA band with minimum possible amount of agarose. 13. Purify the DNA by using Roche PCR Cleaning Kit or equivalent. 14. Elute the DNA with 60 μl autoclaved 0.1X TE; the eluent is ready for ligation (check the DNA before ligation, if necessary.). 15. Add 25ng-50ng of vector (1-2 μl) and 6 μl of re-natured insert for ligation.

51 16. Take 1-5 μl (dependent on transformation efficiency of competent cells) of ligation mixture to perform transformation.

(b) Pr eparation of vector:

Use corresponding protruding end and dephosphorylated vector DNA to perform ligation (vector DNA should be purified by agarose gel electrophoresis after RE digestion and dephosphorylation).

Sequencing Primer

1. Forward primer for sequencing downstream of CMV promoter: 5’-ccaaaatgtcgtaacaactc-3’ 2. Reverse primer for sequencing upstream of IRES: 5’-attccaagcggcttcggc-3’ 3. Forward primer for sequencing downstream of IRES: 5’-acatgtgtttagtcgagg-3’ 4. Reverse primer for sequencing upstream of 3’-LTR: 5’-gagagacccagtacaagc-3’ 5. Forward primer for sequencing downstream of CAG promoter: 5’-ctggttattg tgctgtctc-3’ 6. Forward primer for sequencing downstream of U6 promoter: 5’-caccattatcgtttcacac-3’

Advantages

1. Avoid RE digestion of the PCR products. 2. This method is of greater advantage in uses if the insert sequences contain the same RE sites as in vector that use for cloning, as there is no need to restrict the inserts. 3. Easy and quick method. 4. Higher efficiency of cloning.

Reference

Zeng G., 1998. Sticky-end PCR: new method for subcloning. Biotechniques 25:206-8.

52 國家型干擾性核醣核酸核心設施 National RNAi Core Facility

Sequencing Primer

1. Forward primer for sequencing downstream of CMV promoter: 5’-ccaaaatgtcgtaacaactc-3’ 2. Reverse primer for sequencing upstream of IRES: 5’-attccaagcggcttcggc-3’ 3. Forward primer for sequencing downstream of IRES: 5’-acatgtgtttagtcgagg-3’ 4. Reverse primer for sequencing upstream of 3’-LTR: 5’-gagagacccagtacaagc-3’ 5. Forward primer for sequencing downstream of CAG promoter: 5’-ctggttattg tgctgtctc-3’ 6. Forward primer for sequencing of shRNA ( U6 promoter region ) : 5’-tacaaaatacgtgacgtag-3’ 7. Reverse primer for sequencing of shRNA ( downstream of shRNA ) : 5’-ctgttgctattatgtctac-3’

53 The RNAi Core Version 2 (12/02/08)

Purification of Plasmid DNA by precipitation with PEG 10000

1. Pour 250 ml of bacterial culture into a centrifuge tube suitable for Kubota AG-2506 rotor or equivalent; centrifuge the bacteria at 8,000rpm for 6 min at 40C in a Kubota 6500 centrifuge or corresponding centrifuge. 2. Drain off the medium, leaving the bacterial pellet as dry as possible. 3. Resuspend the bacterial pellet with 5 ml of Solution I and add 50 μl (100 mg/ml) of DNase-free RNaseA, then transfer the bacterial suspension into 50-ml Nalgene high speed centrifuge tube. (Solution I: 50 mM Tris-C1, pH8.0; 10 mM EDTA, pH8.0) 4. Add 10 ml of freshly prepared Solution II & gently mix, then incubate at RT for 4 min. (Solution II: 0.2N NaOH, 1% SDS) 5. Add 200 μl of Alkaline Protease Solution (Promega, Catalog# A1441) & gently invert the tube up and down for several times to mix protease solution, and then incubate at RT for 4 min. 6. Add 7.5 ml of ice-cold Solution III & gently mix, then incubate on ice for 5 to 10 min. (Solution III: 60 ml 5M K-Acetate, 11.5 ml glacial acetic acid, 28.5 ml water) 7. Centrifuge at 15,000rpm for 20-30 min at 40C in a Kubota AG-508R rotor. 8. Transfer the supernatant to a fresh 50-ml Nalgene high speed centrifuge tube. Add 12.5 ml of isopropanol, mix well. 9. Recover plasmid DNA by centrifugation at 12,000rpm for 5-10 min at 40C in a Kubota AG-508R rotor. Rinse the pellet with 70% EtOH & remove the residual EtOH as much as possible (This step can be skipped). 10. Resuspend the pellet with 0.5 ml of autoclaved 0.1X TE buffer. 11. Remove undissolved material by centrifugation at 12,000rpm for 10 min at 40C in a microfuge. 12. Transfer supernatant to 1.5 ml eppendorf tube and add 2 μl (100 mg/ml) of DNase-free RNaseA and incubate at RT for 5 min. 13. Extract DNA solution once with equal volume of phenol/chloroform, and twice with equal volume of chloroform. (it is extremely important to remove residual phenol.) 14. Add equal volume of 1.6 M NaC1 containing 13% (W/V) polyethylene glycol 10,000 (PEG 10,000) or PEG 8,000 to the aqueous solution purified from step 13. Mix well and incubate on ice for 10-30 min, then recover the plasmid DNA by centrifugation at 12,000rpm for 3 min at RT in a microfuge. 15. Drain off supernatant and remove residual PEG solution as completely as possible. 16. Dissolve the pellet in 500μl of autoclaved 0.1X TE. Extract DNA with phenol/chloroform till interface is clean and finally extract once with chloroform. 17. Add 1/5 volume of 10M ammonia-acetate to the aqueous solution and two volumes of absolute EtOH, mix well and incubate the tube on ice for 5-10 min. 18. Recover the plasmid DNA by centrifugation at 12,000rpm for 3-5 min in a microfuge. Wash the DNA once with 70% EtOH, remove the residual EtOH as much as possible, and dry DNA pellet inside the hood or bio-safety cabinet under blowing condition. 19. Dissolve the DNA with appropriate volume of autoclaved 0.1X TE and determine the DNA concentration by spectrophotometry. 20. Check DNA quality/integrity according to the protocol as follow:

54 Protocol 範例

1. 每個待測 DNA 取 500ng 於最終體積為 10 至 M 1 2 3 4 1 kb M 12 μl 的 1X loading buffer 中。

2. 將上之 DNA 樣本置於 0.5% TBE agarose gel (含 0.1μg/ml 的 EtBr) 孔內 (騰達行 SeaKem

LE agarose; 迷你水平電泳槽)。

3. 以 50 伏特電泳兩小時 (0.5X TBE 緩衝液含 10 k 0.1μg/ml 的 EtBr) 此可觀察 plasmid DNA 6 k 是否有斷裂現象(nick)或受染色體 DNA 污染。 4 k 4. 關閉電源，將同樣且等量的 DNA 樣本 (同 1) 3 k 置於旁邊空孔內。 2 k 5. 再以 50 伏特繼續電泳半小時此可觀察 plasmid DNA 是否有殘留 RNA。

Figure legend: 500ng of TRC shRNA plasmid and pLKO_AS3w.hyg cDNA expression vector (AS series plasmids) with the sizes of 7085 bp (lane 1) and 9634 bp (lane 2) respectively, were subjected to electrophoresis (0.5% agarose gel containing 0.1μg/ml of EtBr, run at 50 volts in 0.5X TBE running buffer containing 0.1μg/ml of EtBr) for 2 hours, and then the equal amounts of these two plasmid DNAs are loaded into lane 3 and 4, and ran for another 30-min. Please note that the sizes of the major band of lane 1 and lane 2 are smaller than 7085 bp and 9634 bp, indicating that those DNAs are supercoiled form DNAs in nature. In addition, there are no other signals detected in lane 3 and lane 4 except major band (DNA), suggesting that there are no RNA contaminations in DNA preparation.

Note: 1. Gently extract plasmid DNA with phenol/chloroform by inverting the tube up and down rather than vigorously vortex. 2. The use of alkaline protease and autoclaved 0.1 X TE ensures the integrity of plasmid DNA throughout the purification procedure.